TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4685-5p
miRNA Sequence: CCCAGGGCUUGGAGUGGGGCAAGGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262090 1716 1590 1571 432 420 --21709 536 --
NM_000024chr5--1384 ----
NM_000029chr12170 46 ------
NM_000037chr872466 1884 1817 1786 1713 599 140 21670 467 ----
NM_000044chrX----196 --
NM_000046chr572564 2330 2124 907 853 789 729 1302 21078 253 --
NM_000052chrX53322 3080 2480 808 176 23373 2350 11254 --
NM_000053chr135678 257 197 157 142 31685 1602 120 --1647
NM_000055chr31317 ------
NM_000068chr1921444 260 ------
NM_000080chr173303 259 151 2929 619 ----
NM_000084chrX86712 5876 4932 4425 1745 1522 1367 354 1163 24910 4485 --
NM_000088chr1731231 1140 384 --1534 --
NM_000092chr274479 3924 3313 3053 3017 2958 151 12827 11840 --
NM_000094chr3179 137 ----
NM_000103chr15--21198 27 ----
NM_000109chrX------12323
NM_000110chr12788 754 ------
NM_000129chr621049 28 --11282 --
NM_000135chr161683 --1671 --
NM_000138chr1542519 1959 1006 925 1991 ----
NM_000176chr542982 1313 929 76 --13054 --
NM_000183chr21153 ------
NM_000188chr103624 494 217 ------
NM_000189chr22569 96 2596 356 ----
NM_000202chrX32639 1496 1221 ------
NM_000206chrX136 ------
NM_000208chr1984571 3741 1586 1327 1035 447 182 54 23024 70 13369 13189
NM_000214chr2041750 1628 288 222 ------
NM_000217chr12114721 4677 4585 4206 3755 3389 2053 1857 794 645 623 23693 1824 14636 --
NM_000232chr421169 413 --22534 2185 --
NM_000238chr73141 89 75 168 1276 --
NM_000240chrX61987 1647 1428 809 312 246 2850 480 ----
NM_000248chr322344 658 21956 359 ----
NM_000259chr15125803 5006 4964 4439 4260 4240 4153 4145 3909 2260 1703 909 ----22408 1318
NM_000262chr2281441 1184 1147 560 478 433 221 162 --21668 60 --
NM_000264chr983173 2248 2057 2050 1122 711 566 110 12891 11005 --
NM_000266chrX4402 258 210 176 1755 --1969
NM_000267chr1732742 368 166 ----12639
NM_000274chr10256 30 ------
NM_000278chr10102145 1880 1736 1544 1531 898 812 754 603 545 --11450 --
NM_000280chr111136 ------
NM_000285chr19141 ------
NM_000288chr61263 1135 ----
NM_000304chr172926 29 ------
NM_000310chr111186 ------
NM_000314chr1033137 2662 2339 1551 ----
NM_000318chr842720 2026 466 340 ----22779 2661
NM_000319chr1231098 407 213 ------
NM_000330chrX31588 560 344 --1487 --
NM_000332chr666578 6373 5201 1271 501 362 --16638 14365
NM_000333chr3--175 11063 --
NM_000337chr576470 4163 2150 1628 1340 605 466 36113 4711 4365 --11603
NM_000340chr31270 11087 ----
NM_000353chr163812 208 58 ------
NM_000362chr22103443 3085 2957 2803 1435 1396 1365 1294 777 178 32715 849 55 42771 2332 2318 1375 --
NM_000373chr33693 554 256 ------
NM_000378chr111188 ----1218
NM_000398chr222216 49 1153 3714 654 123 --
NM_000399chr103865 858 263 1365 ----
NM_000408chr213181 ------
NM_000411chr2172911 2733 2561 2090 2070 2021 820 --1184 12782
NM_000430chr1783570 3309 3055 2556 2495 2404 1299 79 140 22897 1185 --
NM_000434chr61203 --1123 --
NM_000435chr197974 881 870 737 688 135 50 ------
NM_000442chr171106 2250 28 ----
NM_000445chr85989 820 707 197 25 --2850 377 1267
NM_000448chr1122261 49 --12611 --
NM_000449chr121269 191 ------
NM_000450chr141613 1439 567 89 ----11299
NM_000461chr3104380 3278 1635 1208 1098 1073 302 218 202 132 11485 13331 --
NM_000462chr15----11431 --
NM_000474chr7--192 ----
NM_000476chr971271 554 474 445 96 67 50 --2454 308 11067
NM_000484chr211744 ------
NM_000494chr101279 127 ----
NM_000503chr8136 ------
NM_000505chr5130 ------
NM_000530chr13374 287 218 ------
NM_000537chr12137 27 --140 --
NM_000555chrX117826 6587 5804 5242 4817 3139 860 700 616 315 180 46462 5295 475 449 25752 5713 --
NM_000557chr203427 193 25 2344 62 ----
NM_000572chr11961 --173 --
NM_000598chr721529 1312 1479 ----
NM_000599chr253973 3821 3308 2958 2858 13118 1421 --
NM_000609chr10102825 2775 2391 2350 978 942 922 694 305 46 22166 1198 ----
NM_000610chr1172948 2571 2263 1942 1050 431 382 22374 594 --1935
NM_000615chr1132365 2039 1968 --12005 --
NM_000618chr1255382 4181 1371 1243 55 12386 11174 1204
NM_000618chr1255382 4181 1371 1243 55 12386 11174 1204
NM_000633chr1883299 1956 1687 1574 1159 846 789 563 24505 873 43477 1360 1254 506 11017
NM_000635chr1941643 1086 576 55 31588 497 306 1219 --
NM_000678chr202310 126 ------
NM_000682chr281679 1451 571 529 372 140 88 65 21528 269 11740 --
NM_000684chr1011279 ------
NM_000687chr202688 121 ------
NM_000688chr3------1124
NM_000719chr1286035 5868 5675 5333 4921 1216 828 423 24830 2367 46041 5428 2012 517 15754
NM_000720chr3----2504 28 --
NM_000723chr1771615 1511 1385 1308 1049 505 35 1408 11067 --
NM_000725chr124804 250 192 24 ------
NM_000756chr81443 ------
NM_000789chr172245 24 ------
NM_000793chr1494943 4337 4158 4085 3509 3461 3279 1457 1263 --24981 401 --
NM_000794chr5----159 --
NM_000801chr2041026 985 681 136 ------
NM_000806chr511879 ------
NM_000809chr458051 6761 3671 3174 1995 29242 247 --11554
NM_000810chr151149 ------
NM_000813chr525486 2004 ------
NM_000814chr1573731 3597 3126 3020 2650 562 362 ----13828
NM_000815chr14343 324 165 65 --2450 33 --
NM_000816chr51649 ------
NM_000818chr101188 ------
NM_000826chr412016 --1131 --
NM_000827chr552261 861 838 578 24 ------
NM_000829chr1121563 63 ------
NM_000831chr1236074 5913 5791 5784 5772 5602 5547 5388 4808 4726 4178 4157 3932 3880 2050 1823 1307 1009 995 911 573 527 326 45673 4306 1264 1159 25954 2179 34445 4434 3917
NM_000832chr95827 692 684 112 58 --1257 --
NM_000836chr193147 137 31 ----1228
NM_000837chr83481 440 60 1426 ----
NM_000838chr62704 240 ------
NM_000839chr34453 395 37 21 --1182 --
NM_000845chr7--182 1430 --
NM_000868chrX41937 1798 1621 467 1887 ----
NM_000875chr15116670 5968 5224 4924 4802 4667 4574 4420 2180 1526 852 46955 5382 5097 4379 14831 --
NM_000876chr621316 1286 ------
NM_000883chr75537 510 504 257 145 --3560 493 215 --
NM_000883chr75537 510 504 257 145 --3560 493 215 --
NM_000891chr1763402 3059 1133 1125 787 639 --33550 3543 290 --
NM_000899chr122795 415 13229 1704 --
NM_000901chr42909 398 --1641 --
NM_000903chr1611149 ------
NM_000908chr5--1608 ----
NM_000912chr863540 2864 2718 2649 2641 1198 --13229 --
NM_000914chr62155 142 ------
NM_000922chr111150 ------
NM_000924chr1251347 1285 1239 473 358 31097 312 265 1330 --
NM_000926chr1199182 8682 7999 6677 5881 5824 3095 2939 1230 28144 6802 --17577
NM_000933chr201178 ------
NM_000935chr331023 946 187 ------
NM_000941chr75346 245 132 76 55 2354 236 197 --
NM_000942chr15265 45 ------
NM_000944chr4----1123 --
NM_000945chr221778 1525 11710 ----
NM_000951chr19----2209 146 --
NM_000960chr195782 762 111 97 32 1200 3535 255 163 1262
NM_000964chr1761299 1184 870 252 130 88 21341 164 3876 277 258 --
NM_000965chr341289 1211 352 310 ------
NM_000966chr124820 439 215 96 ------
NM_001001132chr2121147 98 ------
NM_001001323chr1222162 565 ----2654 606
NM_001001331chr361080 939 903 741 270 168 22062 916 --12265
NM_001001389chr1172948 2571 2263 1942 1050 431 382 22374 594 --1935
NM_001001390chr1172948 2571 2263 1942 1050 431 382 22374 594 --1935
NM_001001391chr1172948 2571 2263 1942 1050 431 382 22374 594 --1935
NM_001001392chr1172994 2617 2309 1988 1096 477 428 22420 640 --1981
NM_001001396chr153398 3202 1740 1133 536 43506 3449 3267 111 11413 --
NM_001001481chr81330 11241 ----
NM_001001484chr1032361 2124 979 1875 ----
NM_001001502chr51118 ------
NM_001001520chr191122 ------
NM_001001522chr113324 122 46 --1104 1380
NM_001001549chr722481 923 ----1341
NM_001001550chr722481 923 ----1341
NM_001001555chr722481 923 ----1341
NM_001001557chr84695 614 522 55 22183 236 2701 23 --
NM_001001560chr223852 602 546 ----1277
NM_001001586chr1----2193 45 2369 71
NM_001001664chr21271 11100 --11420
NM_001001668chr1934243 3341 401 23331 2845 ----
NM_001001852chr225775 617 357 188 125 --2229 42 --
NM_001001890chr2194176 3996 3240 3208 3180 3142 3065 1441 465 --33112 120 102 --
NM_001001936chr104418 370 158 45 ------
NM_001001971chr101960 ------
NM_001001974chr1022063 539 ----1688
NM_001001994chrX133 1565 ----
NM_001001995chrX265 41 11337 ----
NM_001001996chrX133 1565 ----
NM_001002233chr821827 75 ------
NM_001002762chr10112820 2512 1791 953 862 704 635 620 264 256 67 22912 2388 32069 409 82 --
NM_001002814chr843429 2804 2578 75 --33116 2636 933 23135 2827
NM_001002838chrX21303 676 ------
NM_001002860chr1444243 3959 3795 644 21504 806 --14177
NM_001002906chrY--1534 ----
NM_001002909chr1742101 1828 379 58 ------
NM_001002919chr2------149
NM_001003398chr12133 ------
NM_001003406chr22103082 2812 2047 1127 1081 985 972 611 458 417 22520 1060 31170 786 381 1511
NM_001003407chr10115006 3171 3127 2012 1690 1626 1452 1244 1144 976 563 --1526 --
NM_001003408chr10115006 3171 3127 2012 1690 1626 1452 1244 1144 976 563 --1526 --
NM_001003652chr18198665 8570 8333 8151 7541 6862 5711 5611 5465 5298 3408 3035 2712 2533 2320 2030 1541 1403 1374 48309 7406 7388 5840 18023 --
NM_001003676chr113848 646 217 1367 1931 --
NM_001003681chr2241491 1466 688 90 --1670 --
NM_001003682chr161340 1170 506 448 123 24 --11221 --
NM_001003688chr43174 98 41 125 ----
NM_001003698chr671958 1674 1639 1546 752 584 441 11433 ----
NM_001003699chr671958 1674 1639 1546 752 584 441 11433 ----
NM_001003712chr1222749 1386 ------
NM_001003760chr663161 2653 897 844 160 142 12381 --13519
NM_001003792chr3137 ------
NM_001003793chr3137 ------
NM_001003800chr972617 1404 1316 1242 796 598 304 13351 22445 339 --
NM_001003891chr222841 820 --1133 --
NM_001003940chr15103743 3425 3386 3340 3121 1003 743 601 339 272 33651 1432 1013 23721 3619 23226 1210
NM_001003942chr15103743 3425 3386 3340 3121 1003 743 601 339 272 33651 1432 1013 23721 3619 23226 1210
NM_001003943chr15103747 3429 3390 3344 3125 1007 747 605 343 276 33655 1436 1017 23725 3623 23230 1214
NM_001004065chr923069 340 23156 190 13106 1947
NM_001004105chr5130 ------
NM_001004127chr132910 695 1765 ----
NM_001004303chr1163 ------
NM_001004303chr1163 ------
NM_001004304chr1282924 2686 2423 2084 254 226 174 64 42075 320 247 111 33040 2406 453 --
NM_001004317chr674441 3295 3051 1653 1449 1403 912 21032 607 --13378
NM_001004323chr7129 ------
NM_001004329chr121262 ------
NM_001004354chr9130 2930 876 ----
NM_001004419chr1251811 1409 553 507 492 21019 524 ----
NM_001004722chr22230 163 ------
NM_001005158chr3----297 89 --
NM_001005159chr3----297 89 --
NM_001005209chr24521 513 81 39 --1585 --
NM_001005266chr153695 274 261 ------
NM_001005267chr153695 274 261 ------
NM_001005268chr153695 274 261 ------
NM_001005269chr153695 274 261 ------
NM_001005271chr1761114 1105 398 369 208 103 1834 1818 --
NM_001005273chr1761114 1105 398 369 208 103 1834 1818 --
NM_001005291chr174379 212 108 66 ------
NM_001005336chr92561 47 ------
NM_001005377chr191116 --126 --
NM_001005386chr21699 ------
NM_001005404chr17103670 2873 1735 1190 735 646 610 299 216 110 22883 459 2668 405 --
NM_001005415chr192389 62 --1461 --
NM_001005416chr192389 62 --1461 --
NM_001005463chr1031881 1870 252 ------
NM_001005474chr32435 54 ------
NM_001005476chr21749 ------
NM_001005505chr321666 131 1330 2488 152 --
NM_001005527chr31994 2235 29 ----
NM_001005609chrX83577 1527 1270 1103 779 542 376 39 23480 3086 ----
NM_001005732chr21133 ------
NM_001005733chr21133 ------
NM_001005739chr22708 326 1248 ----
NM_001005782chr21338 1370 ----
NM_001005861chr3--1793 ----
NM_001005910chr31560 ------
NM_001005911chr31560 ------
NM_001005920chr1631005 777 389 1277 ----
NM_001006115chr3132561 2359 2253 2149 2071 1976 1876 1817 1116 774 350 267 223 22641 300 61071 1021 965 783 434 373 --
NM_001006600chr51342 ------
NM_001006617chr941046 1000 111 83 ------
NM_001006619chr941046 1000 111 83 ------
NM_001006620chr941046 1000 111 83 ------
NM_001006621chr941046 1000 111 83 ------
NM_001006623chr212035 ------
NM_001006634chr162563 39 ------
NM_001006684chrX1126 1591 ----
NM_001006938chrX3790 582 111 ------
NM_001006946chr231276 126 29 21637 1463 180 1315
NM_001007023chr1494943 4337 4158 4085 3509 3461 3279 1457 1263 --24981 401 --
NM_001007024chr1743726 3154 1051 47 --21514 733 --
NM_001007025chr1743726 3154 1051 47 --21514 733 --
NM_001007097chr974939 3110 1419 1308 1276 1105 76 14269 ----
NM_001007098chr12357 325 ------
NM_001007156chr1561735 1502 751 471 425 39 1684 ----
NM_001007226chr1721136 1111 ------
NM_001007227chr1721136 1111 ------
NM_001007228chr1721136 1111 ------
NM_001007229chr1721136 1111 ------
NM_001007230chr1721136 1111 ------
NM_001007237chr12919 90 12596 ----
NM_001007246chr21------11719
NM_001007271chr106977 937 744 171 57 40 --3962 759 90 --
NM_001007273chr10272 32 --157 --
NM_001007277chr113279 223 44 ------
NM_001007466chr6104464 4403 4229 4125 3796 3784 3759 1633 1521 970 --168 --
NM_001007553chr141142 1038 949 924 ------
NM_001008220chr5123814 3675 3456 2666 1304 1037 943 896 562 448 370 127 --83734 3714 3206 2863 2509 730 509 503 --
NM_001008222chrX71353 1254 1225 1140 960 503 427 1286 1246 --
NM_001008225chr7133 ------
NM_001008270chr7135 ------
NM_001008391chr111582 1286 ----
NM_001008405chr72590 109 11525 ----
NM_001008407chr751657 1347 695 533 252 2500 292 1231 --
NM_001008408chr7196227 6179 6063 5854 5684 5632 5601 5519 5327 5223 4484 4043 3978 1717 979 955 869 764 115 33946 1349 543 46102 5481 4699 2218 --
NM_001008410chr282157 2055 1947 1713 485 460 131 50 1503 21865 1757 22188 22
NM_001008528chr1741160 531 259 218 ------
NM_001008529chr1741265 257 240 225 1341 ----
NM_001008541chr1052274 2259 1576 1456 577 ------
NM_001008541chr1052274 2259 1576 1456 577 ------
NM_001008564chr13--21564 130 ----
NM_001008701chr19112969 2690 2546 2310 2148 1184 819 772 692 368 52 22806 531 2833 64 --
NM_001008707chr144742 671 555 63 ------
NM_001008738chr532762 2129 2100 ------
NM_001008777chr171225 1213 ----
NM_001008925chr432948 1202 241 1658 ----
NM_001008938chr112399 187 ------
NM_001009184chr83481 440 60 1426 ----
NM_001009185chr52706 648 ------
NM_001009554chr454033 2962 1766 1316 1153 11745 ----
NM_001009554chr454033 2962 1766 1316 1153 11745 ----
NM_001009555chr42690 26 ------
NM_001009566chr151348 1130 939 578 226 ------
NM_001009567chr101587 ------
NM_001009571chr731682 573 267 ------
NM_001009812chr2366 59 24 --131 140
NM_001009881chr11143 ------
NM_001009882chr11143 ------
NM_001009899chr3146373 6269 5251 4717 4703 4695 4609 4506 4257 2404 2064 1832 1360 1012 --13952 --
NM_001009923chr202209 203 1597 ----
NM_001009959chr262396 1970 1019 536 467 276 ------
NM_001009960chr732108 1763 888 ------
NM_001009993chr293834 3771 3666 3147 2960 1655 1494 885 75 1987 33155 1639 586 --
NM_001010000chr1833022 1191 528 ------
NM_001010846chr183366 3175 3143 3049 3028 1329 228 31 14328 33059 554 23 1830
NM_001010852chr61149 ------
NM_001010862chrX43134 3120 2879 2517 22497 2156 1753 --
NM_001010867chr1186619 6494 6410 6331 6118 5951 2670 2103 2013 1717 1435 1420 1269 1198 878 344 318 151 45720 2350 1677 206 56652 6131 4301 887 115 --
NM_001010888chrX43879 3264 661 637 --14311 --
NM_001010891chr536805 5628 2588 26318 5553 --14566
NM_001010895chr9--1616 --1124
NM_001010898chr1123550 3466 2763 1181 1058 701 678 621 497 200 176 130 73448 2875 1331 1159 1022 1007 856 43653 671 639 412 --
NM_001010908chr101505 ------
NM_001010917chr1092054 1925 1903 1616 637 607 438 432 49 21867 1719 32250 1849 710 --
NM_001010926chr1----1128 --
NM_001010935chr12188 23 1172 ----
NM_001010938chr33619 300 160 --3312 306 283 2678 93
NM_001010942chr1231344 1064 24 ------
NM_001010971chr13979 885 801 ------
NM_001010980chr1113217 2262 1342 1333 1052 893 813 742 712 169 75 ----22234 1067
NM_001010983chr3------145
NM_001010984chr141714 748 548 154 1700 ----
NM_001011513chr432867 1225 116 13109 ----
NM_001011515chr41954 ------
NM_001011516chr41954 ------
NM_001011537chr361608 1465 807 404 376 175 2919 567 --1692
NM_001011553chr71171 1347 ----
NM_001011645chrX----196 --
NM_001011666chr775208 5104 5068 4794 4477 4269 957 11007 ----
NM_001011708chr211111 --1426 --
NM_001011722chr1--1334 1453 --
NM_001011722chr1--1334 1453 --
NM_001012267chr941414 611 391 377 1331 --1401
NM_001012329chr182307 2129 1985 1586 1558 939 126 62 2335 26 41938 1854 718 352 21815 1484
NM_001012393chr1153158 2050 1948 1819 1584 13615 ----
NM_001012398chr16146 ------
NM_001012415chr95704 338 282 245 207 2929 664 1361 --
NM_001012420chr1522022 203 11039 2753 658 --
NM_001012423chr1522022 203 11039 2753 658 --
NM_001012426chr683374 1353 1341 1232 1209 598 396 206 23203 2329 32442 518 409 12095
NM_001012427chr683374 1353 1341 1232 1209 598 396 206 23203 2329 32442 518 409 12095
NM_001012614chr43695 187 176 1787 2649 95 --
NM_001012642chr1592137 2025 1991 1798 1754 1491 631 468 405 1323 1619 1856
NM_001012753chr19--1338 ----
NM_001012755chrX54366 3135 1023 298 48 23102 1999 1350 --
NM_001012761chr532479 1915 875 --1128 --
NM_001012968chrX3532 522 198 ------
NM_001012974chr6----3231 185 80 --
NM_001012977chrX31002 420 42 ------
NM_001012979chrX3161 61 51 ------
NM_001012989chrX1169 ------
NM_001013031chr1063359 2487 2222 753 647 505 ------
NM_001013255chr11121 2306 180 198 --
NM_001013398chr721529 1312 1479 ----
NM_001013415chr411257 11065 ----
NM_001013438chr32369 139 ------
NM_001013439chr31215 ------
NM_001013622chr441131 1124 999 986 --6482 420 359 173 112 50 --
NM_001013624chr173115 71 60 ------
NM_001013625chr1137 ------
NM_001013635chr1241185 1087 834 482 1259 1983 --
NM_001013690chr1292476 1900 1812 1568 1549 1013 539 522 454 --42288 2256 2143 1851 1621
NM_001013693chr1112690 2233 2187 1853 917 904 406 389 308 228 31 22738 2496 22144 865 --
NM_001013693chr1112690 2233 2187 1853 917 904 406 389 308 228 31 22738 2496 22144 865 --
NM_001013843chr153792 691 335 ------
NM_001014283chr1352161 1819 1620 1469 71 ------
NM_001014435chr163439 132 92 1142 2543 191 --
NM_001014442chr13255 43 ------
NM_001014445chr175979 870 769 721 324 --1792 --
NM_001014449chr16--1208 132 --
NM_001014451chr16--1208 132 --
NM_001014797chr10118128 6705 5638 2900 2804 2772 2261 1852 1428 937 287 36756 5481 1544 17512 --
NM_001014809chr41647 --1818 --
NM_001015045chr422342 97 2466 361 21682 86 22447 74
NM_001015053chr1761411 1134 220 154 113 23 21546 277 1373 --
NM_001015508chr82519 269 ------
NM_001015877chrX32636 825 318 ------
NM_001015880chr1011071 11372 ----
NM_001015881chrX31282 930 884 1196 1259 --
NM_001015887chr311283 21172 734 1218 --
NM_001017368chr1752819 2513 1004 689 300 21775 1029 --11937
NM_001017395chr382976 2835 1052 706 524 397 241 35 1562 12398 --
NM_001017396chr241496 828 112 98 11985 ----
NM_001017405chr41744 ------
NM_001017415chr11519 ------
NM_001017416chr11519 ------
NM_001017440chr7167495 7452 7439 6556 6373 6335 5956 5220 3179 3053 2844 2773 2712 1931 501 184 56255 6190 3143 1869 1072 32937 2078 573 --
NM_001017523chr1231386 1247 390 ------
NM_001017926chr811315 ------
NM_001017979chr4148 2234 170 ----
NM_001017995chr5101684 1649 1356 1293 1265 678 641 277 178 114 13780 11246 11202
NM_001017999chr13678 639 552 21489 496 1583 --
NM_001017999chr13678 639 552 21489 496 1583 --
NM_001018000chr13678 639 552 21489 496 1583 --
NM_001018000chr13678 639 552 21489 496 1583 --
NM_001018001chr13678 639 552 21489 496 1583 --
NM_001018005chr15166 ------
NM_001018008chr152514 150 ------
NM_001018025chrX2351 92 ------
NM_001018050chr22163472 3238 3026 2902 2777 2618 2355 1365 1290 1189 1174 1004 988 857 769 170 31387 262 255 43377 3177 2437 1040 13067
NM_001018052chr22163472 3238 3026 2902 2777 2618 2355 1365 1290 1189 1174 1004 988 857 769 170 31387 262 255 43377 3177 2437 1040 13067
NM_001018053chr12752 556 21924 1905 ----
NM_001018057chr112392 125 ------
NM_001018064chr931922 426 231 --11522 --
NM_001018072chr1231386 1247 390 ------
NM_001018074chr542982 1313 929 76 --13054 --
NM_001018075chr542982 1313 929 76 --13054 --
NM_001018076chr542982 1313 929 76 --13054 --
NM_001018077chr542982 1313 929 76 --13054 --
NM_001018089chr1563105 2667 2601 2469 814 124 1873 11033 --
NM_001018108chr1531551 182 124 --21461 797 11773
NM_001020658chr141537 1352 1052 229 ------
NM_001020658chr141537 1352 1052 229 ------
NM_001020825chr51457 --1529 --
NM_001023567chr1521722 203 --2756 661 --
NM_001023587chr331050 339 148 1963 ----
NM_001024094chr542982 1313 929 76 --13054 --
NM_001024401chr1692850 2835 1042 810 579 533 482 411 394 22596 622 42761 2710 2253 1834 1373
NM_001024465chr6154 ------
NM_001024649chr522270 977 --12875 --
NM_001024666chrX----1197 --
NM_001024808chr12112367 2292 2109 1876 1868 894 740 458 446 425 223 32132 803 704 ----
NM_001024809chr1761299 1184 870 252 130 88 21341 164 3876 277 258 --
NM_001024845chr13744 326 128 1871 1104 --
NM_001024847chr311907 2693 97 ----
NM_001024858chr1472943 2597 2222 2061 1995 838 241 --72927 1825 606 570 556 171 63 --
NM_001024912chr1991863 1496 1379 1185 727 616 521 486 147 ------
NM_001024937chr17189 ----1735
NM_001024947chr51752 ------
NM_001024948chr142633 1158 616 387 11277 ----
NM_001024959chr34765 706 652 230 ----166
NM_001024960chr34765 706 652 230 ----166
NM_001025076chr1055673 5643 5049 4946 4832 14741 12304 12229
NM_001025077chr1057031 7001 6407 6304 6190 16099 14872 --
NM_001025079chr352647 1178 1118 322 81 12925 1379 --
NM_001025105chr52463 158 11291 ----
NM_001025108chr263129 2949 2808 2750 1259 1230 --132 --
NM_001025205chr31181 ----1319
NM_001025233chr1222510 1016 1460 ----
NM_001025252chr843022 2852 2264 443 ------
NM_001025253chr843022 2852 2264 443 ------
NM_001025266chr374919 3795 3563 3544 1670 1528 424 11430 21547 804 --
NM_001025366chr641498 1480 759 560 --1684 --
NM_001025366chr641498 1480 759 560 --1684 --
NM_001025367chr641498 1480 759 560 --1684 --
NM_001025367chr641498 1480 759 560 --1684 --
NM_001025368chr641498 1480 759 560 --1684 --
NM_001025368chr641498 1480 759 560 --1684 --
NM_001025369chr631514 1496 576 --1700 --
NM_001025369chr631514 1496 576 --1700 --
NM_001025370chr641498 1480 759 560 --1684 --
NM_001025370chr641498 1480 759 560 --1684 --
NM_001025579chr1731132 243 31 ------
NM_001025603chr121269 191 ------
NM_001025780chr921277 1157 1375 ----
NM_001029835chr73403 296 92 1313 ----
NM_001029861chr197690 329 274 261 231 123 42 1179 21031 202 --
NM_001029863chr621011 506 21163 357 ----
NM_001029871chr2041439 710 515 24 1571 21694 527 1729
NM_001029883chr221928 196 22514 1961 1202 22970 118
NM_001029896chrX1229 --158 --
NM_001029998chr431381 1327 1007 1955 ----
NM_001030002chr172350 77 ----1248
NM_001030007chr1693384 2644 2482 1219 1092 575 525 296 51 ----13601
NM_001030055chr1423930 1450 ------
NM_001031623chr62708 35 ------
NM_001031680chr192022 1630 1017 987 949 459 346 239 151 12122 1411 --
NM_001031685chr11345 ------
NM_001031690chr742414 2055 1948 452 1138 32012 1975 731 12611
NM_001031692chr71286 ------
NM_001031695chr2285140 4341 4070 4044 3480 1978 1611 1368 21141 765 14016 --
NM_001031702chr33680 597 119 --1156 --
NM_001031732chr4--13193 ----
NM_001031740chr161498 608 543 386 146 134 1692 --181
NM_001032221chr92341 105 --1115 --
NM_001032280chr631480 638 147 ------
NM_001032282chr811005 11244 ----
NM_001032283chr1211071 ----1237
NM_001032284chr1211071 ----1237
NM_001032288chr2041310 1000 592 519 --11211 --
NM_001032289chrX153 176 --1356
NM_001032296chr1372806 2568 2522 2510 2283 568 394 --22627 414 11183
NM_001032363chr182091 2002 1880 1772 1543 1509 627 590 1184 --2669 75
NM_001032363chr182091 2002 1880 1772 1543 1509 627 590 1184 --2669 75
NM_001033044chr12551 387 ------
NM_001033049chr2161955 1734 688 648 575 96 ------
NM_001033056chr12551 387 ------
NM_001033057chr33667 510 337 12047 ----
NM_001033081chr16752 686 636 419 294 228 --21432 270 21484 1372
NM_001033082chr16752 686 636 419 294 228 --21432 270 21484 1372
NM_001033117chr3144577 4439 4427 4292 3911 3512 3400 3394 3381 1670 1544 1261 1088 93 13903 163 21938 100
NM_001033506chr111159 ------
NM_001033507chr141749 1615 1563 1481 ------
NM_001033581chr11358 ------
NM_001033581chr11358 ------
NM_001033582chr11358 ------
NM_001033602chr1352211 2204 1891 1753 92 --32629 2241 163 --
NM_001033667chr13258 213 79 ------
NM_001033677chr122388 361 ------
NM_001033723chr892559 2468 2198 2067 2006 1999 1781 542 32 52633 2612 1770 747 134 32097 2048 49 22321 2165
NM_001033756chr641432 1414 693 494 --1618 --
NM_001033756chr641432 1414 693 494 --1618 --
NM_001033952chr112250 77 ------
NM_001034845chr41388 ------
NM_001034954chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_001034955chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_001034956chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_001034957chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_001035chr121322 138 1382 ----
NM_001035003chr411337 ------
NM_001035004chr411337 ------
NM_001035235chr51246 --1202 146
NM_001035267chr12------1208
NM_001035511chr11247 21483 29 21426 262 --
NM_001035512chr11354 21590 136 21533 369 --
NM_001035513chr11354 21590 136 21533 369 --
NM_001035521chr21750 291 25 ----
NM_001035534chr981363 1297 1254 1112 1075 448 96 85 1346 21356 71 --
NM_001037131chr22848 110 11042 1306 --
NM_001037132chr7----11954 --
NM_001037133chr7----11954 --
NM_001037164chr72156 43 1102 ----
NM_001037174chr211438 11941 ----
NM_001037331chr183927 797 266 ------
NM_001037334chr1832199 2020 1522 --1707 --
NM_001037494chr12193 ------
NM_001037495chr12193 ------
NM_001037553chr21164873 3425 3397 3340 1872 1310 1238 1219 1103 1081 780 638 588 490 436 32 34883 4300 1157 33652 1575 594 --
NM_001037582chr421125 540 ------
NM_001037637chr5--1141 ----
NM_001037954chr1152499 1385 721 637 46 ------
NM_001038493chr251103 578 552 371 25 ------
NM_001038640chr15----2823 728 --
NM_001038707chr152156 2043 1774 1632 176 21449 193 --1264
NM_001038707chr152156 2043 1774 1632 176 21449 193 --1264
NM_001039091chrX21149 1109 1482 ----
NM_001039140chr205387 357 125 98 50 ------
NM_001039141chr2282229 2151 2141 2055 1703 1096 394 371 162 2734 448 11042
NM_001039199chr20114236 3898 3852 3411 3269 1662 1609 1192 1068 1037 639 11581 2906 705 --
NM_001039350chr751529 1453 1438 1169 678 --11725 --
NM_001039459chr74894 885 332 188 --1148 185
NM_001039465chr14----121 --
NM_001039479chr1462372 1759 1737 1589 323 156 31867 394 40 ----
NM_001039538chr252812 2719 338 248 65 12917 ----
NM_001039570chr22184255 4157 4132 4095 4073 3953 3889 3829 3633 3598 3523 3484 3363 3269 3257 3176 1439 1154 1519 33747 3683 234 --
NM_001039571chr22184255 4157 4132 4095 4073 3953 3889 3829 3633 3598 3523 3484 3363 3269 3257 3176 1439 1154 1519 33747 3683 234 --
NM_001039574chr15993 986 919 895 821 165 2877 785 --
NM_001039577chr1114224 3303 3198 3077 3014 2797 1794 1718 1271 1243 372 --1411 11407
NM_001039582chrX2336 91 156 ----
NM_001039585chr143679 1531 642 83 ------
NM_001039590chrX53228 3209 2584 1480 860 ------
NM_001039591chrX53228 3209 2584 1480 860 ------
NM_001039615chr832121 1843 1663 21599 105 ----
NM_001039618chr1145081 1944 427 324 34110 3679 438 --1566
NM_001039619chr14--1267 --130
NM_001039690chr16112169 2067 2017 1600 1495 577 504 492 404 105 87 142 1700 1536
NM_001039693chr253641 3314 496 443 335 ------
NM_001039762chr1041640 1499 376 128 ------
NM_001039770chr391512 651 620 512 390 197 122 93 30 --12150 --
NM_001039775chr1------129
NM_001039802chr12370 118 1382 ----
NM_001039840chrX74574 4266 4173 4151 499 381 56 25950 5688 ----
NM_001039877chr193617 271 257 --122 --
NM_001039905chr153445 273 266 2152 115 --11266
NM_001039916chr121117 --2103 45 --
NM_001039917chr121117 --2103 45 --
NM_001039918chr121117 --2103 45 --
NM_001039919chr121117 --2103 45 --
NM_001039920chr121117 --2103 45 --
NM_001039937chr1353468 2668 1013 935 606 ------
NM_001040056chr163273 195 28 ------
NM_001040057chr71224 1123 ----
NM_001040059chr171570 ------
NM_001040092chr81314 ------
NM_001040101chr441378 623 572 212 ------
NM_001040102chr1022393 2298 32336 2237 1802 12364 1126
NM_001040103chr1022393 2298 32336 2237 1802 12364 1126
NM_001040107chr122156 80 1631 ----
NM_001040110chr721378 1236 21256 1226 ----
NM_001040144chr16112169 2067 2017 1600 1495 577 504 492 404 105 87 142 1700 1536
NM_001040146chr16112169 2067 2017 1600 1495 577 504 492 404 105 87 142 1700 1536
NM_001040152chr714461 11305 13527 11451
NM_001040153chr132687 260 ------
NM_001040167chr75422 400 187 37 27 --2431 75 --
NM_001040272chr95922 860 792 760 31 11945 ----
NM_001040273chr10102039 1832 1618 1571 1357 771 676 186 161 64 22005 579 2597 346 --
NM_001040280chr62521 508 1268 ----
NM_001040284chr1641554 845 727 73 14525 13945 15871
NM_001040402chr453124 2868 2327 1048 156 ------
NM_001040409chr22207 117 ------
NM_001040429chr1353446 2910 702 489 69 --11161 --
NM_001040439chr1681467 1442 1143 544 442 333 289 248 21112 359 2399 322 --
NM_001040446chr5--2836 60 1735 --
NM_001040450chr15--22510 2350 ----
NM_001040451chr52499 471 ------
NM_001040452chr52499 471 ------
NM_001040453chr15--22510 2350 ----
NM_001040624chr852128 2046 783 476 343 12176 12293 --
NM_001040625chr852128 2046 783 476 343 12176 12293 --
NM_001040626chr852128 2046 783 476 343 12176 12293 --
NM_001040627chr852128 2046 783 476 343 12176 12293 --
NM_001040628chr852128 2046 783 476 343 12176 12293 --
NM_001040629chr852128 2046 783 476 343 12176 12293 --
NM_001040630chr852128 2046 783 476 343 12176 12293 --
NM_001040633chr73971 262 50 ------
NM_001040694chr1151062 893 799 397 258 ------
NM_001040709chr152169 632 552 432 340 22443 648 ----
NM_001040876chr4--21608 105 ----
NM_001042353chr205557 483 434 383 363 160 ----
NM_001042355chr16135320 5029 4819 4222 3706 3603 3585 1613 1562 1546 1529 880 420 34652 2046 678 14832 --
NM_001042368chr92546 282 1221 1671 --
NM_001042388chr182747 356 ------
NM_001042403chr1221034 793 1645 ----
NM_001042406chr6185 1439 ----
NM_001042412chr16135320 5029 4819 4222 3706 3603 3585 1613 1562 1546 1529 880 420 34652 2046 678 14832 --
NM_001042413chr983200 2967 936 834 514 287 203 114 31005 270 213 12694 --
NM_001042425chr631480 638 147 ------
NM_001042428chr16------1186
NM_001042453chrX11712 ------
NM_001042478chr1289 27 --1179 --
NM_001042481chr1431724 1677 475 ----1154
NM_001042486chr2041491 1372 1262 432 --1390 --
NM_001042492chr1732742 368 166 ----12639
NM_001042494chr1563847 2888 2596 2488 1446 1300 --12764 --
NM_001042495chr1563847 2888 2596 2488 1446 1300 --12764 --
NM_001042496chr1563847 2888 2596 2488 1446 1300 --12764 --
NM_001042497chr1563847 2888 2596 2488 1446 1300 --12764 --
NM_001042506chrX41329 1002 420 42 ------
NM_001042537chrX52396 499 474 410 194 12330 ----
NM_001042539chr164905 763 227 174 1423 21013 963 11124
NM_001042576chr201467 --1307 --
NM_001042599chr2116719 5794 5555 5527 5269 4835 2985 2339 1490 666 70 25369 449 ----
NM_001042601chr333063 633 561 12510 ----
NM_001042610chr16121354 1345 1288 1189 1144 934 424 299 248 218 167 133 --2949 378 --
NM_001042632chr2082216 1699 584 536 464 393 367 323 42419 2261 998 434 1315 11006
NM_001042633chr2082216 1699 584 536 464 393 367 323 42419 2261 998 434 1315 11006
NM_001042681chr132345 2027 839 ----1241
NM_001042682chr132345 2027 839 ----1241
NM_001042682chr132345 2027 839 ----1241
NM_001042724chr194658 199 136 83 --1674 --
NM_001042728chr124820 439 215 96 ------
NM_001043318chr14143827 3459 3170 1491 1389 1364 1328 1118 1068 1048 919 774 533 425 1707 2631 487 11304
NM_001044305chr621576 1255 ------
NM_001044385chr242583 2527 1048 897 11490 13284 --
NM_001046chr51327 --12886 --
NM_001065chr123547 84 37 ------
NM_001066chr1122053 2019 1557 1532 1466 1355 1335 554 530 386 380 335 21774 1596 62107 2032 523 398 74 47 --
NM_001077628chr13165 55 23 ----1127
NM_001079874chr12655 282 ------
NM_001083620chr412014 --1131 --
NM_001087chr21338 ----1112
NM_001092chr1771843 658 551 542 523 454 432 --21735 563 --
NM_001095chr1251939 1607 1198 521 393 11378 31922 623 87 --
NM_001099678chr366435 5183 4764 4695 4404 391 --14260 --
NM_001106chr3248011 7994 7928 7802 6900 6613 3832 3797 3646 3619 3416 3263 3142 2866 2806 2665 2206 1135 1126 1081 1054 842 824 589 19079 23435 872 13808
NM_001113490chrX31327 1269 802 1660 12313 1689
NM_001116chr1652770 2319 410 218 32 1201 --1824
NM_001117chr1871985 1007 610 601 560 491 36 1941 ----
NM_001119chr481484 1165 1131 524 428 74 40 24 --3932 487 272 --
NM_001121chr1041859 1507 711 231 ------
NM_001122631chr111493 ------
NM_001127chr227878 455 359 351 178 155 125 --1209 --
NM_001128chr1693384 2644 2482 1219 1092 575 525 296 51 ----13601
NM_001140chr17174 --1448 --
NM_001144chr164971 937 361 37 ----11016
NM_001148chr431799 804 791 11416 ----
NM_001160chr1242441 2370 961 663 --22797 818 12475
NM_001163chr91896 41009 881 865 270 1640 --
NM_001172chr141263 ------
NM_001173chr1423930 1450 ------
NM_001174chrX2419 28 2381 273 ----
NM_001177chr1242400 2288 1992 1775 --11898 --
NM_001189chr46884 784 258 231 177 155 1351 1968 --
NM_001191chr2031139 1021 208 1582 21373 1346 --
NM_001197chr22------154
NM_001199chr81264 150 ----
NM_001200chr2021155 467 ------
NM_001204chr237514 7117 4909 ------
NM_001207chr5--1141 ----
NM_001218chr1521786 618 3627 458 70 32587 1871 160 52598 2393 2085 931 371
NM_001219chr741949 1890 1769 276 ------
NM_001222chr1071664 1642 394 370 341 301 92 11495 11411 166
NM_001241chr211910 ------
NM_001241chr211910 ------
NM_001251chr171570 ------
NM_001256chr1722526 757 12508 --12490
NM_001259chr776375 1540 1097 1049 902 137 46 13848 ----
NM_001262chr12328 254 ------
NM_001264chr61661 2726 719 2786 32 --
NM_001267chr17----3194 140 26 --
NM_001270chr5------1928
NM_001274chr11285 28 ------
NM_001277chr1131011 865 823 ------
NM_001293chr11--171 ----
NM_001300chr102449 162 1134 ----
NM_001304chr1711097 12373 23373 2466 --
NM_001310chr1232373 2061 1088 ----11131
NM_001312chr147480 387 202 192 174 100 71 ------
NM_001313chr41647 --1818 --
NM_001326chr111406 ------
NM_001328chr43695 187 176 1787 2649 95 --
NM_001331chr1162785 1885 1057 749 693 311 1303 --1982
NM_001343chr531479 1249 329 1297 ----
NM_001345chr12273 32 154 ----
NM_001346chr362600 1778 673 511 349 296 --2916 437 --
NM_001351chr311762 11253 ----
NM_001352chr19143 ------
NM_001356chrX3425 348 188 1633 --1956
NM_001357chr11275 ------
NM_001362chr144824 396 378 181 --1692 --
NM_001363chrX1181 ------
NM_001364chr1193885 3735 3676 3643 3571 3488 3079 2963 1637 --23828 3542 --
NM_001365chr174635 81 54 32 ------
NM_001379chr19----1120 --
NM_001380chr103929 346 268 ------
NM_001383chr172679 25 --1228 1767
NM_001386chr83984 612 154 12264 ----
NM_001387chr5102778 2532 2315 2239 2154 2054 1257 1045 746 205 12930 22973 2216 13098
NM_001396chr21----1796 --
NM_001397chr1122328 2179 2092 2003 1993 1721 1696 880 676 587 542 106 12371 32171 2149 1638 --
NM_001399chrX83577 1527 1270 1103 779 542 376 39 23480 3086 ----
NM_001400chr12440 78 1249 ----
NM_001402chr631821 1679 1291 ------
NM_001406chr1771625 1173 668 620 509 249 67 1235 ----
NM_001407chr381714 1645 1483 1335 594 386 351 279 ------
NM_001408chr191463 1088 619 583 447 429 232 148 62 1655 11241 --
NM_001412chrX33127 3070 336 11457 1363 --
NM_001417chr1211490 2763 45 11349 --
NM_001418chr111719 ------
NM_001418chr111719 ------
NM_001419chr19103727 3685 3668 3168 3019 1945 1102 881 535 147 33150 1717 282 1549 13221
NM_001420chr1972889 2675 2358 2157 1230 512 163 22816 1211 11179 --
NM_001423chr1241958 1504 1407 548 --1183 11433
NM_001426chr21536 --1527 --
NM_001429chr222877 311 1113 ----
NM_001430chr241540 1518 1450 1365 11299 21831 1437 --
NM_001432chr452848 1564 1462 556 519 21511 1413 ----
NM_001438chr142613 2382 2304 583 ------
NM_001448chrX1354 --11429 --
NM_001449chrX122 ------
NM_001453chr621579 230 ------
NM_001454chr172914 895 127 ----
NM_001456chrX1258 --195 --
NM_001458chr72626 217 --1130 --
NM_001460chr133317 142 96 --13001 --
NM_001478chr121975 1751 1166 --
NM_001489chr9------163
NM_001493chrX2673 253 ------
NM_001495chr861173 418 355 289 241 226 2305 160 11199 --
NM_001497chr992622 2429 2374 2119 1791 1756 1012 1004 205 --1635 1576
NM_001498chr6--1277 ----
NM_001508chr23597 178 21 ------
NM_001511chr42608 50 1573 ----
NM_001521chr21750 291 25 ----
NM_001541chr11----1157 --
NM_001542chr12919 90 12596 ----
NM_001543chr5124656 4379 3964 1839 1573 1492 1425 983 711 660 268 252 24042 3874 44150 3851 1229 648 34553 3922 3900
NM_001552chr1771028 968 887 881 718 193 96 1305 2396 282 153
NM_001554chr11124 ------
NM_001604chr111136 ------
NM_001611chr193227 58 23 ------
NM_001614chr172212 64 ------
NM_001614chr172212 64 ------
NM_001616chr222721 2234 13467 1155 --
NM_001620chr11--1173 154 --
NM_001626chr19153531 3444 3340 3231 2484 2259 2249 1321 1287 1211 949 797 658 587 552 --22240 874 --
NM_001635chr72352 123 ------
NM_001642chr111925 2852 123 2426 25 --
NM_001654chrX3122 88 55 1312 ----
NM_001659chr12112713 2516 2418 2403 2038 1999 1730 819 287 202 139 22633 916 22347 107 --
NM_001660chr33555 529 204 ------
NM_001663chr141236 2117 26 ----
NM_001664chr32382 351 ------
NM_001665chr112189 63 --156 --
NM_001668chr132165 1484 155 1504 11767 1349
NM_001677chr13718 360 318 --1233 --
NM_001678chr1741566 1363 670 546 21289 45 21244 465 --
NM_001679chr3--197 ----
NM_001681chr121279 ------
NM_001682chr1221876 279 ----2368 320
NM_001683chr361080 939 903 741 270 168 22062 916 --12265
NM_001693chr821092 1058 ------
NM_001694chr163438 376 160 1404 ----
NM_001695chr854224 2965 2901 975 339 ------
NM_001699chr1931816 733 112 --1526 --
NM_001701chr911358 --1623 --
NM_001704chr61542 ------
NM_001709chr1142698 1796 1150 874 ------
NM_001723chr61216 ------
NM_001741chr112250 77 ------
NM_001742chr7147 1390 ----
NM_001743chr21471 1228 ----
NM_001745chr52826 386 ------
NM_001746chr522270 977 --12875 --
NM_001753chr721849 55 ------
NM_001754chr2194176 3996 3240 3208 3180 3142 3065 1441 465 --33112 120 102 --
NM_001755chr1621884 751 ------
NM_001759chr1293861 3847 3834 3461 3219 3212 1824 1598 679 23380 3311 34049 4040 877 --
NM_001760chr63899 712 330 --1685 1860
NM_001773chr171452 1328 1250 1062 988 580 142 21106 568 ----
NM_001777chr352647 1178 1118 322 81 12925 1379 --
NM_001788chr71171 1347 ----
NM_001789chr341744 1392 642 269 1484 11124 --
NM_001791chr12370 118 1382 ----
NM_001796chr16--1241 ----
NM_001798chr1221016 146 --172 --
NM_001806chr1932901 2471 172 11809 ----
NM_001810chr206718 702 596 569 129 67 --1237 --
NM_001823chr142131 29 ------
NM_001826chr11446 ------
NM_001839chr12696 66 ------
NM_001842chr94526 472 255 172 ------
NM_001845chr1331047 1030 440 ------
NM_001852chr1260 36 2682 458 ----
NM_001854chr1145 ------
NM_001859chr933569 1094 397 13938 12572 12614
NM_001892chr52463 158 11291 ----
NM_001903chr51284 --1734 --
NM_001907chr163233 80 49 1284 ----
NM_001908chr821813 1683 --42283 1612 155 30 1899
NM_001914chr181102 ------
NM_001923chr112256 49 1204 ----
NM_001927chr21295 --1231 1716
NM_001935chr21810 1926 ----
NM_001936chr751529 1453 1438 1169 678 --11725 --
NM_001937chr131025 883 149 2908 876 1945 --
NM_001939chrX123439 2596 2492 1521 1498 1474 1420 1343 894 447 323 42 11161 1131 1796
NM_001941chr1833575 1291 1155 13894 ----
NM_001946chr123444 341 234 ------
NM_001949chr662479 1298 1138 249 221 211 --11043 --
NM_001954chr62293 253 1186 1690 --
NM_001955chr63752 75 48 ------
NM_001956chr13508 421 154 195 1107 1388
NM_001957chr412288 ------
NM_001962chr51229 --1222 --
NM_001964chr52792 387 ------
NM_001969chr1422724 322 --1423 --
NM_001970chr172556 192 --2220 82 --
NM_001981chr122076 876 ------
NM_001987chr1263231 1690 1217 656 634 622 1160 ----
NM_001993chr12405 345 1114 ----
NM_001999chr521325 173 11273 ----
NM_002006chr495248 5088 4093 4014 3754 976 666 502 467 25262 1733 ----
NM_002009chr1512233 11117 ----
NM_002013chr142186 55 ------
NM_002015chr1352596 2577 2468 2393 314 --21199 1037 1546
NM_002017chr11174 --11217 --
NM_002024chrX2883 439 ------
NM_002025chrX118843 8762 8662 8512 7084 6954 6174 6070 5800 2853 2375 38050 7105 6590 38390 6960 1763 26206 2441
NM_002037chr6127 ------
NM_002045chr32330 100 ------
NM_002048chr92916 174 ----1343
NM_002049chrX2144 99 ------
NM_002054chr2174 ------
NM_002062chr641263 315 190 24 ------
NM_002063chrX2937 138 ------
NM_002065chr12551 387 ------
NM_002069chr72450 196 ------
NM_002071chr182620 137 ------
NM_002072chr9236 25 ----1116
NM_002076chr1273199 2689 1300 614 281 215 127 ------
NM_002077chr911554 --1221 --
NM_002086chr1712150 11439 11905 --
NM_002088chr191395 1377 --1170
NM_002089chr42613 50 1578 ----
NM_002092chr4114815 4614 4375 4181 3802 1423 1156 938 734 647 408 11728 ----
NM_002103chr1951011 850 246 207 31 --1883 1237
NM_002106chr41343 ------
NM_002126chr17--12785 1415 --
NM_002128chr1332576 2194 180 --1186 --
NM_002130chr51247 ----1613
NM_002131chr691301 1169 469 435 401 353 331 220 118 2970 274 1492 --
NM_002133chr222450 238 1148 1566 --
NM_002135chr122367 162 1490 ----
NM_002136chr121489 ------
NM_002139chrX1581 ------
NM_002140chr92415 84 ------
NM_002145chr17143 ------
NM_002146chr1741339 918 154 118 --160 --
NM_002147chr172121 76 2925 175 153 --
NM_002148chr22598 568 1701 ----
NM_002167chr12375 116 2356 147 ----
NM_002168chr15--2245 98 ----
NM_002181chr2--126 --178
NM_002193chr221286 539 ------
NM_002198chr54687 221 213 146 --1759 --
NM_002199chr41117 ------
NM_002202chr51419 ------
NM_002203chr573473 2990 2904 2873 2850 2684 960 ------
NM_002205chr122951 408 1729 1871 --
NM_002207chr32746 47 ------
NM_002211chr101432 1262 ----
NM_002213chr34502 473 246 62 ------
NM_002223chr1263651 1425 1296 669 652 43 ------
NM_002230chr171960 --2879 156 --
NM_002232chr13910 309 55 ------
NM_002241chr133088 825 30 1724 22862 58 --
NM_002247chr103910 667 528 ------
NM_002249chr13473 169 64 ------
NM_002253chr41902 2168 30 1565 --
NM_002254chr272334 2255 2102 1466 205 59 39 1674 --1711
NM_002264chr364997 4348 3149 1666 971 135 23406 501 11870 --
NM_002265chr171920 ------
NM_002268chr331160 445 386 ----1563
NM_002270chr531101 1013 508 ----14367
NM_002285chr263129 2949 2808 2750 1259 1230 --132 --
NM_002293chr152702 2230 1788 1688 67 ------
NM_002296chr131654 1568 1250 ------
NM_002298chr1331449 623 567 1432 --11437
NM_002309chr22122803 2567 2401 2113 1134 969 923 852 521 345 234 158 --43036 2852 2426 914 --
NM_002313chr10115006 3171 3127 2012 1690 1626 1452 1244 1144 976 563 --1526 --
NM_002333chr1971103 1008 921 825 501 326 240 1458 ----
NM_002339chr11121 2306 180 198 --
NM_002351chrX21262 120 ------
NM_002355chr1241382 1167 987 872 ------
NM_002356chr622829 263 ------
NM_002359chr17214192 3990 3942 3930 3895 3815 3617 3610 3262 3157 2802 2762 1618 1604 1530 1494 1376 662 516 485 66 33682 3327 2837 54174 3629 3402 1536 1430 13534
NM_002360chr772617 2573 2456 2182 2148 477 436 --1772 1929
NM_002361chr191249 --2310 137 --
NM_002373chr1521166 403 --1538 --
NM_002374chr252812 2719 338 248 65 12917 ----
NM_002375chr382192 1727 1609 691 629 327 215 185 31625 1518 544 32015 1686 1615 1927
NM_002382chr1451189 401 384 353 326 --11105 11075
NM_002383chr164728 586 321 50 1246 2836 786 1947
NM_002384chr182269 188 --1689 --
NM_002387chr553391 3180 563 216 156 ----1946
NM_002390chr17152069 1945 1894 1736 1662 1648 1383 767 589 403 242 168 161 127 47 --11929 --
NM_002397chr532236 1477 814 ------
NM_002398chr2--41195 417 234 183 ----
NM_002399chr15--2545 237 11037 --
NM_002402chr71172 --191 --
NM_002403chr1257 35 --2130 26 --
NM_002412chr10----1104 --
NM_002429chr1251154 1137 1076 1039 352 21103 320 --21379 412
NM_002430chr2231015 860 780 1504 32157 1642 956 --
NM_002436chrX163 ------
NM_002438chr101587 ------
NM_002442chr1281551 1405 1158 676 599 296 250 165 21628 662 --1620
NM_002445chr841656 460 172 165 164 ----
NM_002448chr4----2543 49 --
NM_002449chr541153 244 188 96 ------
NM_002451chr973216 2841 2782 2768 2689 2562 1402 23463 2828 12807 --
NM_002467chr82100 42 ------
NM_002469chr122481 59 ------
NM_002479chr12497 96 --1117 --
NM_002480chr12--194 ----
NM_002490chr224609 447 223 140 ------
NM_002499chr1572277 1972 918 842 528 448 179 --22288 2085 --
NM_002501chr19133449 3397 2989 2794 2521 1567 1520 1461 1150 1127 1014 951 677 31252 715 244 33489 782 26 1791
NM_002505chr621322 425 11514 --11175
NM_002508chr13500 406 88 1172 ----
NM_002509chr203773 230 204 1177 ----
NM_002515chr141425 11433 ----
NM_002516chr191100 ------
NM_002522chr1793426 2848 2510 2452 1528 1475 922 821 805 1888 23194 652 --
NM_002524chr1160 176 1255 --
NM_002537chr152954 764 --165 --
NM_002545chr1153158 2050 1948 1819 1584 13615 ----
NM_002547chrX83706 3185 2648 1670 833 459 143 123 --2552 24 --
NM_002553chr71330 ------
NM_002569chr1551371 1064 991 980 41 --31237 1000 475 --
NM_002570chr1541209 1177 424 100 --1276 --
NM_002576chr1131194 1142 97 1145 ----
NM_002577chr363694 3631 2736 2576 1136 1127 1434 ----
NM_002581chr944361 1982 1282 460 11049 1823 --
NM_002586chr661648 1414 1114 1078 444 379 ----1422
NM_002587chr52345 126 2193 186 ----
NM_002588chr541414 1168 710 135 --1656 --
NM_002589chr4182 ------
NM_002590chr131456 ------
NM_002599chr114916 819 275 143 1125 2999 92 --
NM_002601chr23367 332 153 ------
NM_002605chr153821 78 24 ------
NM_002607chr72475 48 --11094 --
NM_002608chr2271463 1389 566 443 434 393 383 176 ----
NM_002609chr5121715 1674 1296 1186 583 516 488 356 324 160 63 24 --1740 11213
NM_002613chr16175209 3647 2141 1981 1872 1788 1691 1522 1388 1322 1312 1003 843 755 480 395 373 22122 1437 31833 1716 603 2879 455
NM_002628chr311086 ------
NM_002632chr142333 224 --1794 1294
NM_002633chr12509 173 ------
NM_002634chr173832 736 705 ------
NM_002636chr63491 183 91 ------
NM_002645chr1132609 2214 641 ------
NM_002648chr641211 1122 1075 1028 1160 ----
NM_002650chr22282 66 ------
NM_002653chr53905 798 766 ------
NM_002655chr835110 1355 212 12019 13288 --
NM_002656chr62849 178 ------
NM_002657chr2073410 3397 2442 743 445 188 36 33469 3421 363 12947 --
NM_002660chr205922 432 399 255 45 1315 --1203
NM_002673chr34531 429 156 136 --1145 154
NM_002687chr1411181 ----1514
NM_002693chr151344 ------
NM_002698chr1962684 2676 2494 1019 328 180 1256 4817 723 340 54 --
NM_002699chr13974 965 589 ------
NM_002705chr16168 --191 --
NM_002706chr21130 ------
NM_002709chr233485 880 829 ----11006
NM_002710chr121386 ------
NM_002713chr11123 --2377 244 --
NM_002714chr64941 342 280 148 1229 ----
NM_002717chr81163 1482 ----
NM_002729chr101113 ------
NM_002736chr711723 --1514 --
NM_002737chr17165918 5896 5853 5817 5664 4621 4139 4076 2431 2399 2194 2142 1951 804 672 95 16212 32377 2266 1646 35765 5522 1078
NM_002738chr1611034 --1761 --
NM_002739chr193672 164 125 --1503 --
NM_002742chr14174 ------
NM_002744chr11358 ------
NM_002745chr22114506 4217 4034 2835 1353 581 534 352 209 201 76 11697 --14373
NM_002746chr162104 26 ------
NM_002748chr151317 ------
NM_002752chr51127 ------
NM_002753chr43549 117 72 ------
NM_002758chr17------1170
NM_002764chrX3684 233 59 ------
NM_002765chrX21149 1109 1482 ----
NM_002768chr16111559 1550 1514 1452 1266 1246 586 364 313 273 242 11629 31496 503 197 11047
NM_002779chr102536 56 --1365 1576
NM_002809chr17154 --1237 --
NM_002815chr17157 ------
NM_002822chr122688 479 11469 --1436
NM_002823chr21226 ------
NM_002824chr123346 106 38 1375 1100 --
NM_002827chr2031758 1620 489 21700 327 --11114
NM_002829chr91475 2309 73 ----
NM_002830chr21391 ------
NM_002833chr1551269 1178 1118 641 455 152 ----
NM_002834chr1231498 1396 990 ------
NM_002835chr7------1655
NM_002843chr1133273 3030 2277 --13213 --
NM_002844chr61989 ------
NM_002856chr191275 ----1310
NM_002857chr14972 863 439 366 ------
NM_002858chr13441 400 303 ------
NM_002859chr1251685 1569 1445 1323 191 --11496 --
NM_002861chr173459 410 37 ----1106
NM_002863chr141113 ------
NM_002867chr13735 505 154 ------
NM_002868chr1292274 1964 1653 918 842 719 672 602 213 12112 2491 110 --
NM_002869chr1131980 768 653 ------
NM_002874chr922368 337 12100 ----
NM_002880chr33754 721 218 --1183 --
NM_002883chr2211937 846 706 612 379 337 316 233 137 101 25 ----190
NM_002884chr12188 23 1172 ----
NM_002886chr33207 190 29 15177 11685 --
NM_002890chr5----1248 --
NM_002895chr202776 62 ------
NM_002896chr112347 100 ------
NM_002897chr21704 ------
NM_002900chr10145 --1123 --
NM_002918chr1931028 418 272 --1407 --
NM_002940chr4--21608 105 ----
NM_002942chr32326 31 ------
NM_002955chr671958 1674 1639 1546 752 584 441 11433 ----
NM_002958chr3--1793 ----
NM_002959chr183680 3095 3081 430 424 254 205 111 12863 ----
NM_002968chr162758 316 ------
NM_002977chr252835 2701 2645 2191 306 --1423 --
NM_002997chr231276 126 29 21637 1463 180 1315
NM_003001chr11354 21590 136 21533 369 --
NM_003010chr1721545 939 1376 12218 --
NM_003011chr961427 681 318 284 117 55 ------
NM_003015chr104181 47 35 21 --1172 --
NM_003016chr1731786 1714 791 ------
NM_003026chr911198 ------
NM_003028chr9163782 3761 3737 3496 3202 3092 2516 2490 2470 2440 1213 902 869 776 344 24 23131 1031 12403 23744 849
NM_003034chr1256281 5970 5287 2608 1833 36780 6478 108 --27173 3117
NM_003043chr3104140 3449 3265 3199 3071 3038 1248 911 520 477 23296 2979 43462 3175 1484 1258 13234
NM_003047chr1111255 1208 1182 1070 1041 526 517 425 366 249 101 11084 ----
NM_003060chr531156 974 931 1139 11298 --
NM_003063chr11162 --121 --
NM_003069chrX------1117
NM_003074chr331734 1691 300 11923 3751 264 228 --
NM_003076chr1271491 1464 585 541 521 243 52 11134 21480 81 --
NM_003077chr173625 335 55 --1608 131
NM_003081chr202405 131 ------
NM_003085chr51118 ------
NM_003088chr741071 960 467 312 1329 41008 906 365 231 --
NM_003090chr15174 ------
NM_003098chr204450 393 85 24 ------
NM_003106chr31980 1244 ----
NM_003107chr622022 468 ------
NM_003108chr2107218 2871 2606 2552 1976 1965 1889 1637 1150 54 --11101 --
NM_003112chr713083 ------
NM_003113chr22616 176 --2586 182 --
NM_003131chr692209 2099 862 824 622 586 572 428 256 21771 605 32124 2039 461 --
NM_003133chr11281 ------
NM_003136chr14----1350 --
NM_003137chr631492 265 222 1488 21418 212 --
NM_003139chr113879 722 705 --1795 --
NM_003140chrY1110 ------
NM_003144chr62620 396 --1881 1771
NM_003145chr13195 143 118 1133 ----
NM_003149chr3138 11290 ----
NM_003150chr1772173 2137 919 850 676 443 373 12048 22275 1660 --
NM_003153chr1241007 248 128 80 ----163
NM_003155chr821777 861 ------
NM_003156chr1171322 1249 870 300 206 158 43 11333 11057 1916
NM_003161chr17------23074 834
NM_003164chr114465 165 107 47 1117 ----
NM_003170chr172159 23 --1229 --
NM_003173chrX51286 1192 1125 958 521 ------
NM_003174chr102737 699 1640 ----
NM_003179chrX3403 259 173 --31245 1020 409 --
NM_003183chr21705 ------
NM_003185chr2011099 --1955 --
NM_003186chr113324 122 46 --1104 1380
NM_003189chr182409 2401 2065 741 730 387 159 94 2928 125 32552 1137 652 --
NM_003199chr1844896 1496 812 554 ------
NM_003200chr19112371 2209 2095 1787 1776 1660 909 595 300 193 42 22140 1875 42045 1476 201 50 --
NM_003202chr541329 719 306 84 ------
NM_003204chr1711207 11485 1463 11602
NM_003211chr1241436 654 618 21 --1598 --
NM_003215chr421526 1255 21504 1135 11479 11446
NM_003216chr22103140 3127 2695 2454 2350 1075 1036 833 668 315 52914 923 510 333 296 ----
NM_003217chr1241627 1361 776 202 11551 ----
NM_003220chr631480 638 147 ------
NM_003221chr683520 3302 3284 2954 1347 1320 828 618 12603 --13957
NM_003239chr142712 177 31032 881 754 1819 --
NM_003242chr311907 2693 97 ----
NM_003250chr171325 ------
NM_003255chr1772490 1946 789 653 497 249 69 184 1298 --
NM_003257chr1511080 --1385 --
NM_003269chr631034 396 174 --1252 --
NM_003272chr11197 ------
NM_003274chr211104 --2569 251 1955
NM_003275chr931057 321 61 1474 ----
NM_003290chr1921172 316 138 ----
NM_003291chr132806 240 ------
NM_003298chr354517 2446 2239 1696 925 21670 380 43991 3773 1943 751 11027
NM_003304chr311298 ------
NM_003309chr651712 1649 634 418 391 ------
NM_003317chr142555 34 ------
NM_003320chr11133735 3537 3496 3074 2795 1673 1296 1288 819 749 268 134 73 31604 1001 796 23742 1198 --
NM_003325chr224251 167 153 128 --2265 175 --
NM_003339chr511201 ------
NM_003344chr741498 1320 660 311 ------
NM_003348chr122277 169 ------
NM_003349chr2041310 1000 592 519 --11211 --
NM_003352chr21338 1370 ----
NM_003355chr113336 281 32 1256 ----
NM_003368chr11519 ------
NM_003370chr192580 247 1694 ----
NM_003371chr981835 1501 1359 1344 1334 597 446 56 1436 2773 288 11488
NM_003376chr641498 1480 759 560 --1684 --
NM_003376chr641498 1480 759 560 --1684 --
NM_003392chr341607 1510 1142 461 13398 ----
NM_003394chr122161 70 1102 ----
NM_003400chr21791 ------
NM_003403chr141210 ------
NM_003405chr221536 ------
NM_003406chr8--1571 1359 --
NM_003410chrX52382 2364 2018 563 39 ------
NM_003411chrY2166 36 ------
NM_003412chr342015 1949 722 327 ------
NM_003413chrX2434 312 ------
NM_003418chr3----1306 --
NM_003427chr63607 167 117 1448 1685 --
NM_003430chr191494 ------
NM_003442chr11--1177 ----
NM_003455chr1131665 489 190 11322 --1464
NM_003456chr16------1186
NM_003458chr3183971 3574 3559 3426 3366 3305 3083 3054 3033 2743 2567 1590 1307 1235 1024 587 568 129 23754 64 22474 512 43129 2781 480 90
NM_003459chr24679 501 451 70 ------
NM_003466chr272458 2362 1973 1615 1533 783 715 22240 178 1537 --
NM_003468chr234140 3535 3163 31251 1136 961 ----
NM_003470chr1691668 1656 1582 1553 1294 377 357 316 302 21607 1273 1716 --
NM_003471chr322361 693 1129 ----
NM_003477chr111254 ------
NM_003481chr122186 93 1512 ----
NM_003482chr1272674 2265 1733 479 465 371 177 32115 1027 134 12205 --
NM_003483chr1222472 1902 ------
NM_003487chr17--1212 ----
NM_003489chr2112196 ------
NM_003498chr1652263 1844 1777 247 21 42493 2132 453 350 22161 169 1758
NM_003502chr162189 41 --1525 --
NM_003507chr221322 424 ------
NM_003508chr7155 1306 ----
NM_003557chr111316 1453 11106 --
NM_003559chr17153700 3604 3462 3438 3223 3185 2871 2844 2711 2580 2508 1443 969 537 313 2826 613 53391 2850 1423 1275 1045 12812
NM_003563chr1721136 1111 ------
NM_003574chr1821774 439 --14994 --
NM_003575chr741424 542 504 379 --21090 280 --
NM_003576chr1372806 2568 2522 2510 2283 568 394 --22627 414 11183
NM_003583chr1232688 2555 441 11102 ----
NM_003590chr221593 460 ------
NM_003593chr176685 604 538 495 444 266 --2504 51 --
NM_003607chr173917 3803 3793 3671 3441 1086 744 1424 1833 --
NM_003624chr1951165 401 357 338 148 --11278 --
NM_003626chr111857 ------
NM_003628chr21749 ------
NM_003629chr192876 2653 2569 2549 1394 1200 1062 401 31 ------
NM_003632chr173236 101 52 ------
NM_003633chr542280 1974 1884 640 ------
NM_003637chr161490 1142 1118 502 251 33 1104 21350 1032 --
NM_003644chr17246591 6388 5929 5795 5730 5717 5220 4721 4192 4097 2536 2312 2254 2037 1951 1765 1219 1049 923 409 261 206 98 29 45598 4819 1280 717 34993 4795 944 34422 1460 336
NM_003655chr172617 277 ------
NM_003663chr331342 996 304 ------
NM_003671chr952914 2691 2445 2247 274 1857 --13110
NM_003673chr172300 54 --138 --
NM_003677chr121288 ----11475
NM_003679chr142948 2491 851 742 --13100 --
NM_003684chr14945 433 139 102 155 --1176
NM_003688chrX172 ------
NM_003692chr91846 ------
NM_003701chr132773 313 134 ----
NM_003704chr41217 ------
NM_003705chr2264 36 --1234 --
NM_003713chr1------1220
NM_003716chr32926 37 ------
NM_003735chr541414 1168 710 135 --1656 --
NM_003736chr541414 1168 710 135 --1656 --
NM_003737chr11--1426 176 --
NM_003741chr32146 118 ------
NM_003743chr211475 ----1213
NM_003746chr12193 ------
NM_003766chr171532 --1208 --
NM_003768chr141849 1473 1464 596 1659 1160 --
NM_003771chr172226 32 2197 67 ----
NM_003791chr162221 170 ------
NM_003822chr152522 2513 1977 521 22 ----23038 1142
NM_003825chr1521362 185 ------
NM_003829chr9171 ------
NM_003842chr862423 2211 2056 1811 479 35 1625 ----
NM_003861chr1442333 2169 861 280 ------
NM_003872chr262719 2617 2490 2479 2380 2329 1951 ----
NM_003873chr105910 839 820 722 564 ------
NM_003884chr311183 ------
NM_003885chr1791764 1044 948 769 577 345 184 160 130 1436 ----
NM_003893chr102144 30 --2451 181 --
NM_003908chr2041224 1056 971 390 ------
NM_003913chr633021 557 433 13414 ----
NM_003927chr181780 ------
NM_003930chr722506 680 ------
NM_003934chr9----1230 --
NM_003938chr195855 426 397 274 59 --1327 --
NM_003939chr1083869 3420 3302 3159 2925 2822 964 570 23561 121 --13684
NM_003947chr331085 1064 104 11235 ----
NM_003949chr1792062 1889 1650 1547 1446 1355 638 516 192 ------
NM_003954chr1791301 1056 988 981 587 574 285 191 69 --11442 --
NM_003955chr1771211 1126 587 542 522 452 103 --2246 112 --
NM_003958chr693903 3620 3417 2712 2541 2439 657 175 93 33394 2642 455 22797 2464 --
NM_003975chr11106 --1223 --
NM_003980chr611021 ------
NM_003983chr1693658 3198 1648 1517 1190 1156 916 476 458 13895 21700 1433 --
NM_003987chr10102145 1880 1736 1544 1531 898 812 754 603 545 --11450 --
NM_003988chr1092222 1957 1813 1621 1608 889 831 680 622 --11527 --
NM_003989chr10102081 1816 1672 1480 1467 834 748 690 539 481 --11386 --
NM_003990chr10102081 1816 1672 1480 1467 834 748 690 539 481 --11386 --
NM_003994chr122795 415 13229 1704 --
NM_004006chrX------12323
NM_004007chrX------12323
NM_004009chrX------12323
NM_004010chrX------12323
NM_004011chrX------12323
NM_004012chrX------12323
NM_004013chrX------12323
NM_004014chrX------12323
NM_004015chrX------12323
NM_004016chrX------12237
NM_004017chrX------12323
NM_004018chrX------12237
NM_004020chrX------12323
NM_004021chrX------12237
NM_004022chrX------12237
NM_004023chrX------12237
NM_004035chr1775070 3287 1795 1319 1249 765 442 --35055 4950 3412 --
NM_004036chr24658 282 167 155 180 1471 --
NM_004050chr14152540 2334 2249 2140 2127 1811 1778 1046 913 798 792 739 674 626 318 175 ----
NM_004055chr1172071 2054 2036 1891 1470 294 24 1749 21483 637 --
NM_004059chr93378 335 24 --1394 --
NM_004061chr51132 ------
NM_004067chr721086 213 1117 ----
NM_004068chr31181 ----1319
NM_004074chr112163 57 ------
NM_004077chr1221311 466 ----1236
NM_004089chrX31282 930 884 1196 1259 --
NM_004090chr17112922 2308 2171 1381 1101 883 706 640 470 219 165 22663 2316 2786 146 1729
NM_004093chr1352708 2689 2051 524 357 1207 1186 --
NM_004094chr1452759 2280 1903 748 51 ------
NM_004096chr1061817 1608 759 654 602 142 --21790 1692 --
NM_004099chr941978 1744 1726 529 11443 ----
NM_004100chr652621 2118 386 309 76 22325 1699 ----
NM_004103chr85679 301 198 158 64 ------
NM_004107chr191137 168 ----
NM_004114chrX21189 26 ------
NM_004116chr23478 155 61 ------
NM_004132chr1041165 1102 205 38 --11031 --
NM_004134chr52617 456 ------
NM_004136chr1512379 1336 ----
NM_004171chr11159476 8648 8596 7359 6789 6250 6213 6015 3704 2286 1968 1373 1291 1260 431 48659 6589 6195 3595 18388 --
NM_004172chr541983 1944 817 570 ------
NM_004176chr174379 212 108 66 ------
NM_004181chr4--1302 ----
NM_004185chr1195 --2173 155 1231
NM_004186chr32887 751 --2953 854 --
NM_004187chrX3959 220 190 1205 2922 380 --
NM_004193chr102213 71 --1380 --
NM_004200chr1193265 2957 2572 2530 2278 1217 796 523 491 --42877 2377 2173 212 1531
NM_004202chrY2472 287 ------
NM_004203chr161135 ------
NM_004206chr3135 ------
NM_004227chr7102566 2483 2447 2405 2068 1942 1196 720 193 100 32710 954 626 32677 1238 178 --
NM_004228chr19163 --170 --
NM_004229chrX1738 ------
NM_004233chr62521 508 1268 ----
NM_004236chr151101 ------
NM_004263chr291675 1639 1566 1257 1190 492 409 400 277 31422 1380 1248 11532 1375
NM_004272chr54640 630 618 71 ------
NM_004274chr143747 189 100 --188 --
NM_004276chr122388 361 ------
NM_004279chr722373 709 ------
NM_004295chr173545 471 426 --2271 177 --
NM_004302chr12122580 2483 2423 2409 2248 2217 969 753 487 462 378 30 42722 1884 1122 767 1120 --
NM_004308chr11151896 1728 1701 1664 1527 1481 1474 1451 1374 672 654 623 471 61 33 2217 87 1156 --
NM_004309chr174928 779 137 124 1374 ----
NM_004311chr1062991 2718 2567 2363 2161 50 22794 1094 12169 --
NM_004320chr163330 140 79 ------
NM_004321chr2133560 3420 3389 3356 3167 2666 2292 1181 910 704 565 422 65 23175 523 63198 2511 856 812 625 221 --
NM_004326chr15966 954 932 776 52 ------
NM_004329chr101502 --1309 --
NM_004337chr831884 420 330 ------
NM_004342chr7169 ------
NM_004349chr811102 ------
NM_004350chr192022 1630 1017 987 949 459 346 239 151 12122 1411 --
NM_004358chr2091101 894 793 718 433 409 325 188 132 21057 205 11125 --
NM_004362chr41570 ------
NM_004364chr1951257 1153 989 837 348 --21250 26 1293
NM_004370chr611336 ----11683
NM_004379chr21619 ------
NM_004380chr1622321 1694 42377 1705 1617 532 ----
NM_004383chr153617 415 258 ------
NM_004392chr1322037 2030 12413 ----
NM_004393chr361971 720 665 358 280 159 11880 1702 --
NM_004395chr53506 277 58 --2498 126 --
NM_004397chr1154208 3290 2701 1389 1339 ------
NM_004398chr112442 36 ------
NM_004405chr23420 390 145 ------
NM_004416chr123410 283 40 1672 175 --
NM_004417chr52132 77 ------
NM_004418chr25568 426 417 98 73 ------
NM_004420chr1182190 2080 2002 1779 1605 1570 614 477 12374 --1970
NM_004421chr16742 733 693 269 50 24 --1141 --
NM_004422chr172363 36 --156 --
NM_004423chr392459 2010 800 693 544 345 268 202 180 11699 ----
NM_004426chr122714 198 1310 ----
NM_004428chr12722 558 --199 --
NM_004429chrX71278 1210 558 303 228 216 157 ------
NM_004430chr831095 706 286 --1104 --
NM_004432chr931804 923 328 ----1705
NM_004433chr151793 1591 1553 1469 61 --2216 160 --
NM_004434chr144742 671 555 63 ------
NM_004436chr13446 176 61 ------
NM_004437chr182684 2427 2280 1390 1280 1154 976 539 ------
NM_004438chr222240 1104 --12608 --
NM_004440chr621634 685 --1101 --
NM_004442chr181453 1321 675 542 447 371 221 70 11567 ----
NM_004443chr33733 540 521 ------
NM_004444chr7182 --1694 --
NM_004447chr12170 1216 ----
NM_004449chr2111272 ------
NM_004451chr114592 519 263 136 1512 1208 --
NM_004454chr341944 1486 745 395 1142 ----
NM_004459chr171693 ----1673
NM_004461chr193219 188 66 ------
NM_004472chr51181 ------
NM_004474chr14974 762 698 109 ------
NM_004475chr1781101 962 806 370 363 344 145 95 1468 2860 410 --
NM_004491chr19173507 3193 2785 2761 1655 1593 1507 1375 1283 946 669 562 527 505 385 184 64 1275 22993 359 --
NM_004494chr151290 1250 1244 1230 371 1246 ----
NM_004497chr193618 583 543 ------
NM_004499chr51476 ------
NM_004500chr141683 21644 1473 ----
NM_004501chr164080 3652 3434 2709 1625 1404 13549 12687 --
NM_004503chr122813 563 --1270 1160
NM_004505chr171707 1359 ----
NM_004514chr1792715 2575 2541 2476 1902 1110 855 624 91 22127 2027 12534 --
NM_004521chr10198 ------
NM_004529chr931338 960 275 ------
NM_004530chr164999 985 459 285 1362 1301 --
NM_004537chr12121 159 ----
NM_004554chr143580 105 50 172 21565 408 31843 1437 194
NM_004555chr163190 145 90 2184 100 ----
NM_004560chr92183 148 --1232 --
NM_004566chr1072230 601 314 246 211 204 55 21676 794 41931 888 291 130 --
NM_004573chr156650 523 506 316 201 51 --1588 1124
NM_004580chr1521876 727 1588 ----
NM_004583chr172644 632 ------
NM_004586chrX73851 3664 3589 3456 1919 726 518 25398 197 ----
NM_004587chr201467 --1307 --
NM_004588chr11103468 3153 2807 1621 1053 954 828 653 261 54 22786 1539 4603 437 223 207 23354 1028
NM_004598chr563309 2787 1294 1016 687 431 ------
NM_004602chr2031252 1219 309 1410 ----
NM_004603chr76931 474 413 380 346 98 --2788 54 --
NM_004606chrX2311 22 ------
NM_004608chr161168 --2458 111 2320 61
NM_004612chr964721 4648 3133 1660 401 49 ------
NM_004615chrX4375 284 218 114 ------
NM_004626chr112706 94 1185 --1250
NM_004630chr1131133 399 216 1949 1824 --
NM_004635chr361146 1043 951 398 292 183 --31007 298 68 --
NM_004637chr331222 469 244 ------
NM_004642chr121136 ------
NM_004643chr143642 310 238 ------
NM_004647chr193272 223 26 ------
NM_004651chrX1350 ------
NM_004656chr341197 826 497 165 11070 4491 484 412 124 --
NM_004660chrY32318 423 346 1629 ----
NM_004663chr1511544 11282 ----
NM_004670chr1011071 11372 ----
NM_004677chrY--1534 ----
NM_004685chr1321179 570 1984 ----
NM_004687chr1771966 1549 1346 477 204 134 79 1279 1700 11954
NM_004689chr142375 135 ------
NM_004690chr61114 ------
NM_004703chr1722492 2425 11685 ----
NM_004707chr5161 ------
NM_004709chrX41496 518 493 169 ------
NM_004714chr191326 --160 --
NM_004719chr1222574 1763 ------
NM_004723chr14911 348 190 62 1139 ----
NM_004730chr511746 ------
NM_004736chr132088 1993 852 ------
NM_004737chr2221077 464 1160 ----
NM_004740chr17177 ------
NM_004742chr31441 ------
NM_004744chr433667 2690 2409 21580 226 ----
NM_004745chr896738 5571 5040 5009 4963 4378 2498 1562 247 2423 315 25788 72 --
NM_004748chr1534147 1063 734 ------
NM_004758chr1741174 892 247 82 --3359 199 97 --
NM_004759chr151837 1345 466 212 63 11986 41714 780 619 505 1605
NM_004760chr74852 843 772 68 11644 ----
NM_004761chr64390 326 171 122 ------
NM_004762chr1731991 1425 272 31512 1399 524 31763 718 499 2114 38
NM_004765chr16121 ------
NM_004768chr11108 ------
NM_004772chr541292 600 587 125 1992 ----
NM_004774chr1722825 2536 ------
NM_004775chr182829 186 ------
NM_004776chr2052097 1025 486 358 347 22749 390 22528 2404 1899
NM_004779chr52247 195 ------
NM_004783chr161503 2585 62 ----
NM_004788chr111198 --12277 --
NM_004796chr142252 132 11818 --1285
NM_004798chr2063472 3325 2565 2479 882 191 12935 ----
NM_004800chr13178 ------
NM_004801chr211544 1393 ----
NM_004805chr22295 204 11416 ----
NM_004807chr272036 1962 1777 635 623 287 128 52423 1902 1649 834 297 ----
NM_004808chr1042514 2486 2306 2164 --12330 --
NM_004815chr134607 4524 747 --24148 3853 --
NM_004821chr51263 --188 --
NM_004822chr17102863 2703 2640 2537 2514 1525 1499 1483 1225 306 13234 41473 352 194 67 23356 245
NM_004834chr222704 2612 --1679 --
NM_004838chr19----1161 184
NM_004842chr62320 104 1290 ----
NM_004856chr15----1401 --
NM_004863chr1485235 5198 4234 1875 971 859 791 310 1484 34913 3442 384 --
NM_004867chrX2525 25 ------
NM_004869chr1821435 1281 ------
NM_004871chr1743726 3154 1051 47 --21514 733 --
NM_004879chr112157 101 1356 ----
NM_004897chr102236 148 ------
NM_004902chr202746 737 ------
NM_004904chr775208 5104 5068 4794 4477 4269 957 11007 ----
NM_004906chr62643 505 ------
NM_004921chr131612 244 49 11675 1529 --
NM_004922chr103309 181 112 ----1990
NM_004924chr1941061 928 403 354 --1317 --
NM_004925chr9----136 1625
NM_004926chr141376 2616 236 ----
NM_004932chr511614 11206 1308 --
NM_004938chr921109 982 ------
NM_004943chr1961233 1200 1183 832 295 202 2952 935 ----
NM_004952chr18918 886 854 760 314 294 287 223 --1232 --
NM_004960chr16141 ------
NM_004965chr212494 253 ------
NM_004972chr92904 401 ------
NM_004973chr651680 1666 1586 706 553 ------
NM_004975chr203683 372 109 195 ----
NM_004976chr11135062 5015 4680 3450 3254 3232 2017 1510 1316 790 536 282 183 34885 4210 4059 54028 2041 1795 1629 1070 --
NM_004978chr191656 1649 1582 1558 1484 432 425 388 60 1268 31540 1448 402 --
NM_004979chrX6832 816 398 316 246 210 ------
NM_004985chr1221161 1008 ------
NM_004991chr3184 ------
NM_004992chrX188257 7615 6691 6471 5879 5388 5321 5209 3171 2666 2532 2477 2229 1512 1433 1415 1025 80 17663 63197 3156 3140 2841 1427 650 --
NM_004992chrX188257 7615 6691 6471 5879 5388 5321 5209 3171 2666 2532 2477 2229 1512 1433 1415 1025 80 17663 63197 3156 3140 2841 1427 650 --
NM_004995chr1471347 1266 1041 570 438 310 138 --1424 --
NM_005010chr7----11954 --
NM_005011chr721378 1236 21256 1226 ----
NM_005017chr31224 ------
NM_005020chr73522 223 154 ------
NM_005025chr31188 ------
NM_005027chr1941155 390 318 36 --31136 297 119 --
NM_005030chr162273 198 ------
NM_005045chr72934 926 ------
NM_005056chr1231333 1221 1213 ------
NM_005063chr1053396 3248 1554 966 682 12594 ----
NM_005065chr1494446 4375 4301 4039 3687 858 800 659 21 182 ----
NM_005076chr1104198 3712 3703 3538 3419 2967 2852 1079 693 345 23741 3202 52959 1199 1035 715 478 23232 1137
NM_005077chr92409 316 ------
NM_005078chr1591745 1370 1298 1250 356 343 177 52 32 --11508 --
NM_005079chr843022 2852 2264 443 ------
NM_005087chr31215 ------
NM_005094chr94722 587 556 235 ----173
NM_005096chrX5423 301 155 107 46 --2322 198 --
NM_005099chr13402 250 159 --3364 178 165 --
NM_005104chr62287 138 1546 1512 --
NM_005105chr122064 1656 ----159
NM_005110chr51190 --1711 --
NM_005112chr41324 123 1732 --
NM_005116chr2063695 3229 850 766 697 470 24610 395 ----
NM_005117chr112654 86 ------
NM_005119chr131108 411 155 ------
NM_005121chr1712473 ------
NM_005124chr6147 ------
NM_005128chr211478 ------
NM_005134chr182747 356 ------
NM_005135chr1563847 2888 2596 2488 1446 1300 --12764 --
NM_005137chr22102224 957 883 803 698 685 627 605 589 65 31690 847 464 32083 1721 854 2777 614
NM_005151chr1832199 2020 1522 --1707 --
NM_005153chr161725 --1146 --
NM_005155chr61630 ----159
NM_005156chr944672 4547 4385 3496 ----11909
NM_005157chr991843 1680 1379 778 474 444 146 122 109 31587 1402 375 1671 --
NM_005159chr1551999 1604 880 836 602 11494 ----
NM_005165chr176369 357 331 323 301 27 ------
NM_005182chr163439 132 92 1142 2543 191 --
NM_005184chr1961424 1382 1234 476 394 292 --11073 --
NM_005187chr1631632 1570 325 --21576 1530 --
NM_005188chr11207461 7409 7007 6746 6723 6571 6457 6052 5933 5761 5694 5539 5516 5221 2866 2835 2662 2322 1840 347 37509 2263 1740 26762 963 --
NM_005197chr1445840 4144 1681 806 24749 4280 24268 1647 --
NM_005202chr172207 1713 780 434 409 291 243 181 5746 606 275 121 27 --
NM_005203chr10----1289 --
NM_005207chr2273548 3401 3148 3130 2830 2425 2290 11111 --11466
NM_005215chr181656 ------
NM_005219chr5111615 1579 1350 1124 586 498 415 345 135 94 51 --1234 --
NM_005221chr71218 ------
NM_005225chr2041008 963 460 73 --2410 146 158
NM_005229chrX71130 1087 498 442 424 131 106 11049 11166 --
NM_005233chr31681 --1978 --
NM_005235chr2116719 5794 5555 5527 5269 4835 2985 2339 1490 666 70 25369 449 ----
NM_005238chr1142984 2905 1125 959 --1270 11002
NM_005245chr41268 1141 ----
NM_005254chr1521335 143 ------
NM_005261chr82883 135 ------
NM_005273chr7140 1255 2232 116 --
NM_005276chr1271618 1318 1307 1265 618 265 227 --21465 652 --
NM_005276chr1271618 1318 1307 1265 618 265 227 --21465 652 --
NM_005277chr4----1541 --
NM_005278chrX133 1565 ----
NM_005310chr172350 77 ----1248
NM_005311chr722481 923 ----1341
NM_005312chr9162365 2216 2096 2087 1927 1911 1876 1681 1050 1011 985 957 863 630 455 441 173 12349 1468
NM_005316chr111983 163 ----
NM_005318chr221796 1863 ----
NM_005324chr17------11725
NM_005327chr42251 21 ----1260
NM_005329chr1672040 2020 1709 1686 898 279 172 --1735 --
NM_005334chrX51633 1558 422 414 266 31614 1283 23 --11139
NM_005339chr432759 628 161 ------
NM_005354chr191640 --198 --
NM_005358chr1321850 417 --11549 --
NM_005359chr18146028 5657 5317 5298 5238 4824 4777 4460 4296 2371 2327 2202 1719 139 15976 26063 5152 --
NM_005370chr1941271 1072 967 328 ------
NM_005374chr1792188 1921 1822 1750 888 800 726 712 117 32430 419 393 1462 --
NM_005375chr611159 ------
NM_005381chr23436 115 48 1128 ----
NM_005386chr201737 1837 121 --
NM_005388chr921436 522 ------
NM_005398chr102484 388 ------
NM_005402chr741752 397 336 239 --1684 --
NM_005407chr1441259 411 276 83 1389 --1508
NM_005415chr21486 ------
NM_005417chr20101917 1667 1433 1339 1274 1252 557 443 272 41 2284 266 41923 1394 1371 1328 --
NM_005418chr115642 628 265 78 33 ------
NM_005424chr12325 28 ------
NM_005426chr11345 ------
NM_005430chr122661 396 1884 ----
NM_005435chr71216 1387 ----
NM_005436chr1083751 3131 2796 2690 2623 326 246 80 ----12582
NM_005437chr1011365 --1992 --
NM_005456chr115711 702 645 451 270 ------
NM_005458chr94747 706 668 471 1536 2386 86 1576
NM_005461chr2081793 1345 1280 541 448 349 190 107 ------
NM_005465chr11635 161 ----
NM_005474chr1761411 1134 220 154 113 23 21546 277 1373 --
NM_005475chr1262827 2615 2334 1247 868 530 12054 --12986
NM_005476chr941217 1115 1063 347 --1484 --
NM_005477chr15122462 2304 2171 2085 2074 1638 963 897 807 597 493 472 --51824 1788 704 446 434 12347
NM_005477chr15122462 2304 2171 2085 2074 1638 963 897 807 597 493 472 --51824 1788 704 446 434 12347
NM_005483chr192371 96 1333 ----
NM_005487chr2241491 1466 688 90 --1670 --
NM_005488chr223644 221 78 ------
NM_005493chr6166 ------
NM_005497chr1776133 4920 4786 3832 2449 1164 458 1144 193 --
NM_005502chr93909 794 566 ------
NM_005503chr1561036 921 899 859 430 410 ------
NM_005504chr1246438 5979 4868 1294 11629 12029 --
NM_005506chr432807 209 42 12816 ----
NM_005512chr1141417 748 472 102 --31878 1843 297 1728
NM_005520chr51693 ------
NM_005522chr741373 1054 136 41 11064 ----
NM_005539chr102461 257 11212 ----
NM_005542chr72573 331 21490 131 --1231
NM_005562chr121442 1417 11460 11291 1326
NM_005573chr5--1560 ----
NM_005575chr5159 ------
NM_005587chr15--21017 279 ----
NM_005595chr11917 ------
NM_005596chr966192 5885 4988 1490 1345 501 32285 1108 936 ----
NM_005598chr191578 1447 1386 675 553 418 200 97 35 11499 2531 119 --
NM_005603chr1821660 143 ------
NM_005604chr6155 1264 ----
NM_005605chr8------1314
NM_005609chr111259 ------
NM_005613chr121810 1373 22118 1835 --149
NM_005614chr71821 1848 ----
NM_005628chr193548 111 27 --190 --
NM_005630chr351857 1844 1515 234 23 41627 1534 714 243 1332 --
NM_005634chrX3555 112 80 ------
NM_005638chrX21722 1360 ------
NM_005639chr1221832 1450 ------
NM_005643chr62552 188 ------
NM_005644chr1--178 ----
NM_005647chrX102604 1337 1297 1223 1179 1137 692 411 312 133 12247 12137 --
NM_005650chr223941 901 125 ------
NM_005652chr161117 --1867 --
NM_005655chr811005 11244 ----
NM_005662chr81320 135 ----
NM_005665chr144168 3880 3863 3846 --13647 11673
NM_005667chr21162 ------
NM_005668chr544346 1738 689 381 14125 1905 --
NM_005676chrX2186 45 ------
NM_005677chr341398 1233 1036 952 --180 --
NM_005682chr163992 414 310 21262 1218 2521 187 1344
NM_005686chr161221 1195 1021 515 340 35 11361 21006 372 11100
NM_005688chr3------1920
NM_005698chr1170 --121 --
NM_005707chr153973 249 151 ------
NM_005717chr12820 83 ------
NM_005718chr34765 706 652 230 ----166
NM_005721chr21263 ------
NM_005722chr21699 ------
NM_005730chr1293066 3001 1460 1283 1245 1183 1137 1111 1099 --1845 --
NM_005735chr25667 266 212 120 111 ------
NM_005736chr1041201 411 281 157 11230 1149 11005
NM_005737chr252514 717 598 491 319 12627 22846 604 --
NM_005738chr72156 43 1102 ----
NM_005740chr224763 706 369 353 --2593 82 --
NM_005748chr1211239 12301 ----
NM_005751chr71339 ------
NM_005768chr122653 258 1678 ----
NM_005776chr141246 ------
NM_005778chr32408 93 ------
NM_005779chr533327 3041 321 ----23453 2638
NM_005781chr33619 300 160 --3312 306 283 2678 93
NM_005786chr181121 1115 ----
NM_005789chr1711678 --41691 781 500 58 --
NM_005797chr11--1154 --11608
NM_005814chr1101220 1142 943 571 493 389 223 205 84 59 1307 41199 1173 1083 371 --
NM_005822chr662086 667 636 376 351 92 22058 650 ----
NM_005828chr17174663 4461 4072 3916 3806 3797 3671 3531 3292 1826 1513 1457 1178 695 688 614 151 --14084 --
NM_005840chrX103026 2992 2842 2408 2395 1619 1508 355 171 157 47624 6565 5898 2518 27357 2656 15529
NM_005850chr12178 83 156 ----
NM_005851chr116362 355 120 110 97 66 ------
NM_005852chr1761114 1105 398 369 208 103 1834 1818 --
NM_005853chr16----2606 53 --
NM_005857chr121424 392 --149 --
NM_005860chr1941652 1645 1253 1083 1156 11094 11182
NM_005862chr31906 ------
NM_005863chr101397 1495 11123 --
NM_005864chr14121 1327 3604 256 60 --
NM_005868chr732521 2273 2114 12135 ----
NM_005871chr101761 ------
NM_005875chr3167 ------
NM_005876chr24777 693 652 616 --1644 --
NM_005877chr2282158 2142 2013 1908 749 454 145 95 21843 216 1758 12115
NM_005880chr1631476 372 277 ------
NM_005882chr41744 ------
NM_005885chr51395 2245 172 11645 --
NM_005898chr111231 1865 ----
NM_005900chr43174 98 41 125 ----
NM_005901chr18198665 8570 8333 8151 7541 6862 5711 5611 5465 5298 3408 3035 2712 2533 2320 2030 1541 1403 1374 48309 7406 7388 5840 18023 --
NM_005902chr1574233 3275 3025 1705 1579 1279 1022 1397 1253 13566
NM_005906chr651251 1233 678 489 64 ------
NM_005907chr6--1252 --11221
NM_005911chr231257 431 62 ------
NM_005916chr7256 23 ------
NM_005920chr1143709 3697 3419 3015 2991 2913 1551 1223 1143 1038 981 896 371 122 33293 2361 741 13716 --
NM_005933chr1182850 2789 2676 2599 2234 2216 1046 227 ------
NM_005934chr1962132 1717 1041 456 236 115 42581 2523 1837 441 82294 2169 1639 911 313 276 193 40 --
NM_005935chr445105 3209 888 686 --21926 29 --
NM_005937chr17133671 3602 3378 3352 3123 3116 1473 1116 948 678 150 105 50 3831 497 97 33741 668 397 --
NM_005941chr832814 2672 152 --11380 --
NM_005943chr6111485 1400 1381 1285 1255 1155 639 534 400 258 63 ------
NM_005955chr1114599 3925 3800 3724 3407 1577 1496 815 761 668 25 21686 1057 33768 1887 1002 --
NM_005962chr1052274 2259 1576 1456 577 ------
NM_005962chr1052274 2259 1576 1456 577 ------
NM_005964chr1751525 1366 624 371 317 ------
NM_005969chr116982 949 777 770 359 335 --21038 310 1326
NM_005984chr222117 50 --2369 333 --
NM_005990chr542591 962 574 131 22754 1957 ----
NM_005996chr1211003 ------
NM_006011chr15104183 3943 3685 3142 3115 1685 910 895 411 343 24030 3971 ----
NM_006015chr12265 132 1892 ----
NM_006020chr1421313 498 11076 --1145
NM_006030chr321666 131 1330 2488 152 --
NM_006032chr142191 49 ------
NM_006034chr11132020 1753 977 788 765 750 268 233 180 154 112 101 24 2478 78 42098 1821 1548 840 --
NM_006037chr264378 4146 3231 1967 1831 276 13106 33354 3141 693 --
NM_006038chr2042068 555 504 342 11393 1848 --
NM_006039chr176997 811 752 440 255 113 1760 3851 817 55 1933
NM_006047chr2043162 1330 1087 557 12377 13494 --
NM_006048chr13923 897 502 1392 ----
NM_006051chr52215 200 1249 134 --
NM_006061chr62989 395 21122 323 ----
NM_006062chr25981 888 852 157 26 21155 1083 1843 1188
NM_006073chr61346 11533 ----
NM_006077chr104633 544 329 181 144 ----
NM_006079chr61211 ------
NM_006085chr11291 ------
NM_006089chrX21485 1347 1169 ----
NM_006091chr1521147 282 --11106 --
NM_006094chr822077 826 ------
NM_006095chr443782 3314 1011 27 ----14209
NM_006096chr841565 1368 360 350 11553 1139 --
NM_006108chr1121473 512 1271 ----
NM_006109chr14--1267 --130
NM_006113chr12655 282 ------
NM_006133chr11102080 1776 1573 1002 897 755 736 681 483 49 --71955 1690 935 928 841 718 444 --
NM_006135chr131051 341 187 ------
NM_006139chr212396 ----165
NM_006141chr1672724 2586 1090 1023 999 935 222 21884 216 12771 --
NM_006148chr1792958 2436 2404 1932 1145 522 444 251 186 1227 156 --
NM_006153chr31207 ------
NM_006154chr152866 292 11907 11854 --
NM_006156chr144260 238 206 69 2269 99 ----
NM_006160chr1741262 152 137 125 1284 ----
NM_006164chr2----1421 --
NM_006166chr1242554 2208 617 253 12596 ----
NM_006176chr113739 546 320 ------
NM_006180chr931922 426 231 --11522 --
NM_006191chr123921 847 182 1697 ----
NM_006194chr141112 1817 ----
NM_006195chr92251 36 11382 ----
NM_006197chr81190 ------
NM_006201chrX51120 1029 919 786 410 11075 11113 --
NM_006203chr525128 2134 --14330 --
NM_006209chr81314 ------
NM_006211chr81100 ------
NM_006212chr1105277 5204 3663 1888 1725 1010 807 674 342 297 42093 1953 1288 510 2792 57 --
NM_006216chr2--1655 ----
NM_006224chr1782068 1760 972 847 726 546 433 406 --12316 --
NM_006237chr1372118 1798 889 876 864 398 187 --12292 --
NM_006241chr321724 663 12180 ----
NM_006243chr13908 350 159 ------
NM_006244chr11197 --2551 445 --
NM_006245chr63732 680 302 1884 3703 57 44 --
NM_006246chr1431236 1100 1031 1474 ----
NM_006251chr521153 1038 ------
NM_006256chr11889 ------
NM_006258chr103292 230 28 ------
NM_006266chr92546 282 1221 1671 --
NM_006268chr1171111 938 374 295 178 167 115 21094 871 1282 --
NM_006275chr2032439 1660 1642 ------
NM_006277chr23240 214 133 ------
NM_006279chr11229 1631 1126 --
NM_006283chr864468 3373 3321 1867 1422 635 34100 4033 605 1742 33061 485 172
NM_006293chr151339 2972 937 4956 242 217 41 --
NM_006301chr122614 520 ------
NM_006302chr2143 --1157 --
NM_006306chrX95034 5010 1257 1114 874 598 298 94 24 34797 741 61 1814 --
NM_006309chr3135 ------
NM_006310chr171280 ------
NM_006313chr1211573 1580 ----
NM_006317chr5------1290
NM_006320chr4------11108
NM_006321chr361919 1899 1824 901 686 80 1240 1488 11978
NM_006322chr132102 75 ------
NM_006323chr41272 ------
NM_006324chr161222 ------
NM_006325chr12153 ------
NM_006336chr981488 1456 1378 1075 1062 1038 614 276 31339 1201 1094 21360 545 2426 34
NM_006338chr1181 --1156 --
NM_006345chr411387 137 ----
NM_006352chr121375 269 197 --11764
NM_006353chr621096 23 11213 2405 224 --
NM_006356chr17----125 --
NM_006359chrX52396 499 474 410 194 12330 ----
NM_006367chr131024 677 117 1349 ----
NM_006369chr12296 159 ----1152
NM_006371chr374856 3815 3635 3301 2060 1546 648 65040 4169 3713 2113 1336 1259 21492 459 --
NM_006373chr1781455 1243 1024 990 893 491 212 103 ------
NM_006375chrX41426 1203 320 264 1124 ----
NM_006377chr931058 877 834 11159 1186 --
NM_006379chr7144 ------
NM_006380chr1723297 684 --12673 --
NM_006384chr15----124 --
NM_006386chr2231945 1754 493 ------
NM_006387chr192448 58 ------
NM_006389chr115964 915 526 384 92 ------
NM_006393chr1034139 3256 163 ------
NM_006405chr142222 49 ------
NM_006411chr65905 821 794 725 71 ------
NM_006421chr811064 195 ----
NM_006434chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_006449chr221409 152 21737 1550 ----
NM_006454chr492852 2800 2096 1044 875 841 785 481 22 21011 382 2642 246 --
NM_006457chr432867 1225 116 13109 ----
NM_006459chr1041914 1538 748 727 --2741 133 11811
NM_006460chr1741745 1349 1263 127 --21440 634 --
NM_006464chr283985 3351 3039 2905 1169 771 400 387 24047 22 14247 --
NM_006465chr1572171 1787 1681 1611 538 173 162 11429 22124 696 21510 234
NM_006472chr151212 1124 989 333 161 159 ----
NM_006477chr221114 1304 ----
NM_006480chr56409 387 191 99 77 68 ------
NM_006482chr1232688 2555 441 11102 ----
NM_006483chr191326 --160 --
NM_006484chr191326 --160 --
NM_006489chr141425 11433 ----
NM_006494chr192783 738 --1232 176
NM_006504chr1042852 2301 2081 1911 ----12309
NM_006516chr131426 1395 343 ------
NM_006517chrX61909 1818 1747 1642 1566 252 2315 139 2484 288 --
NM_006520chrX11697 ----11588
NM_006521chrX111067 934 923 525 500 382 268 183 114 100 22 --2486 447 --
NM_006532chr1971630 722 592 550 465 300 245 --31697 459 150 --
NM_006534chr2052641 786 594 533 328 ------
NM_006538chr224080 80 --13034 --
NM_006539chr162539 428 --141 --
NM_006540chr831405 1090 407 --1139 --
NM_006544chr1445452 5352 4388 1648 14031 11210 --
NM_006546chr17116241 5891 5037 4747 4734 4112 4047 2135 2004 1994 1103 25455 1476 15429 --
NM_006547chr71267 ------
NM_006548chr321600 157 ------
NM_006549chr1242273 1192 126 45 --21927 770 --
NM_006557chr931269 1149 617 ------
NM_006558chr8145 ------
NM_006561chr1055673 5643 5049 4946 4832 14741 12304 12229
NM_006565chr163850 505 35 1975 ----
NM_006572chr1732984 2883 973 ------
NM_006587chr41292 ------
NM_006595chr11--11645 ----
NM_006599chr1658154 8063 1876 673 46 26985 6290 26799 5617 --
NM_006602chr202284 81 175 ----
NM_006608chr12125 29 ------
NM_006618chr141311 1002 530 338 ------
NM_006621chr151875 1780 1275 1264 499 ------
NM_006624chr1022102 553 ------
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006628chr1564558 3524 1869 1331 969 480 14480 ----
NM_006633chr5--1779 ----
NM_006634chr2167 ------
NM_006636chr22207 117 ------
NM_006650chr5123814 3675 3456 2666 1304 1037 943 896 562 448 370 127 --83734 3714 3206 2863 2509 730 509 503 --
NM_006651chr461460 1352 1278 1269 930 128 1568 ----
NM_006690chr2092083 1996 1974 1689 1529 1507 855 694 353 --51812 1580 427 229 77 --
NM_006698chr2031258 919 305 --1247 --
NM_006699chr151005 851 830 657 299 ------
NM_006700chr124714 692 578 305 ------
NM_006703chr62337 71 --1343 --
NM_006711chr162608 107 ------
NM_006717chr931277 1154 1070 13130 ----
NM_006718chr62849 178 ------
NM_006720chr10115006 3171 3127 2012 1690 1626 1452 1244 1144 976 563 --1526 --
NM_006722chr322344 658 21956 359 ----
NM_006729chrX95325 5224 4852 3776 3415 2216 1962 1637 891 25587 1346 ----
NM_006732chr19122129 1879 1711 1547 832 810 755 700 565 356 190 118 --1308 --
NM_006734chr621322 464 ------
NM_006738chr1583740 1745 1536 1041 920 794 124 41 33671 2884 1246 33575 3549 1182 33910 1405 142
NM_006750chr16107586 7344 7162 7083 5712 1135 667 400 181 27 11434 12196 1572
NM_006761chr171135 ------
NM_006762chr171290 1276 1242 1026 859 262 110 ------
NM_006766chr832604 1934 1809 ------
NM_006772chr651548 1232 1192 357 121 11429 ----
NM_006775chr612438 13097 12519 --
NM_006777chrX62422 2341 2128 778 693 622 11795 ----
NM_006788chr1871957 1842 1467 768 548 438 429 ------
NM_006804chr172524 35 ------
NM_006805chr55682 653 276 149 118 ------
NM_006813chr62252 90 151 ----
NM_006814chr2022093 845 146 ----
NM_006815chr1221235 55 ------
NM_006823chr821344 401 --11113 --
NM_006826chr22956 189 ------
NM_006827chr1423270 2574 --1302 --
NM_006828chr6190 ------
NM_006833chr71134 ------
NM_006836chr12----1497 --
NM_006837chr81106 ------
NM_006838chr1231668 1243 378 1401 ----
NM_006841chr33604 183 43 1488 1622 1207
NM_006846chr51239 ------
NM_006852chr1742068 263 205 185 --12109 --
NM_006854chr741981 1873 1824 135 11791 ----
NM_006856chr121331 11107 1785 190
NM_006861chr1291852 1731 1704 1412 688 634 583 416 327 --21715 333 --
NM_006874chr411141 --2857 816 --
NM_006876chr112526 183 ------
NM_006885chr1612982 ------
NM_006887chr22748 576 1741 ----
NM_006888chr1443218 2297 593 188 13256 22530 2452 --
NM_006892chr2041366 447 309 85 ------
NM_006892chr2041366 447 309 85 ------
NM_006893chr1----149 --
NM_006896chr751115 1092 879 835 283 --1289 1225
NM_006897chr123632 596 409 --1542 --
NM_006898chr23589 322 112 ------
NM_006899chr203315 297 135 ------
NM_006901chr153347 155 108 --1207 --
NM_006902chr142240 361 221 61 ------
NM_006906chr115798 681 335 68 27 --181 --
NM_006910chr16181 ------
NM_006914chr91113 ----11522
NM_006922chr222310 2030 12493 ----
NM_006924chr1732968 2911 642 21734 1444 1273 --
NM_006925chr14----121 --
NM_006930chr52757 419 ------
NM_006939chr142891 208 ------
NM_006941chr225893 852 784 157 58 ------
NM_006943chr2083130 2960 2592 2072 990 634 461 399 2883 123 ----
NM_006946chr111581 --1443 --
NM_006948chr2121964 708 --1911 --
NM_006950chrX8913 583 369 290 172 52 46 31 3380 363 319 ----
NM_006951chr101720 ------
NM_006979chr61472 --178 1415
NM_006981chr932875 2795 813 ------
NM_006990chr172535 2480 2420 2203 1900 1638 202 11798 ----
NM_006999chr53820 794 738 --11359 --
NM_007005chr931037 52 37 ------
NM_007011chr1566478 6172 2429 2250 559 166 34597 954 41 44223 2306 935 906 --
NM_007014chr1661187 298 168 110 86 44 21384 368 1513 --
NM_007017chr5--1160 ----
NM_007023chr22781 316 ------
NM_007030chr5155065 4697 4377 4320 4284 4204 1790 1248 1190 1049 999 633 523 485 388 --54718 4669 4448 1380 1332 14455
NM_007032chr2282229 2151 2141 2055 1703 1096 394 371 162 2734 448 11042
NM_007039chr1451940 1494 1474 530 232 ------
NM_007040chr1911053 ------
NM_007045chr62387 111 1402 ----
NM_007047chr682392 2092 1965 1902 743 648 633 253 22371 2083 ----
NM_007050chr20146813 6416 5370 5303 1468 1041 1014 784 632 494 461 155 136 92 25422 2026 47651 6352 5804 5319 22593 280
NM_007052chrX2125 116 ------
NM_007067chr1711163 --2965 140 --
NM_007073chr683798 3757 1431 1163 1131 1056 815 228 23260 657 13767 --
NM_007075chrX1229 --158 --
NM_007078chr1041045 799 694 401 22731 1891 1659 --
NM_007084chr131548 ------
NM_007087chr164791 291 217 171 ------
NM_007112chr1--164 151 --
NM_007118chr53723 676 567 ------
NM_007122chr13229 204 145 2545 405 ----
NM_007125chrY11318 ------
NM_007137chrX85119 4912 4343 3943 3784 2207 982 880 33402 2179 1991 ----
NM_007144chr1771257 1243 1101 1044 503 351 106 --11281 --
NM_007146chr1742141 2117 2086 583 ------
NM_007150chrX2410 358 11737 ----
NM_007158chr141142 1038 949 924 ------
NM_007159chr321385 425 ------
NM_007162chr61113 --1399 --
NM_007170chr1276 27 189 ----
NM_007174chr1271991 1795 956 885 683 622 111 --1213 --
NM_007175chr862769 2409 1423 1406 1232 508 --1975 --
NM_007185chr12200 96 1783 190 --
NM_007192chr1421053 937 --1830 --
NM_007200chr1583740 1745 1536 1041 920 794 124 41 33671 2884 1246 33575 3549 1182 33910 1405 142
NM_007203chr923069 340 23156 190 13106 1947
NM_007210chr1242034 1756 1449 563 21785 90 --12072
NM_007212chr121680 876 --1652 --
NM_007214chr61462 --1165 --
NM_007216chr112388 152 ------
NM_007222chr811315 ------
NM_007236chr1592094 1893 1564 927 798 693 615 467 364 --1742 --
NM_007238chr20164716 4524 4499 4290 4108 3893 3801 3772 3673 3464 3321 1910 1431 1299 1100 305 24635 3930 14273 --
NM_007242chr16--1208 132 --
NM_007243chr65582 496 489 148 26 --173 --
NM_007245chr162717 112 --1294 --
NM_007249chr1387161 2797 2735 2391 2317 1442 1163 617 26013 1294 2741 729 --
NM_007256chr1161339 1116 573 308 282 90 1548 1266 --
NM_007260chr16589 507 248 191 172 134 1233 --1775
NM_007270chr731491 1194 1016 ----11277
NM_007275chr331109 971 353 ------
NM_007282chr32980 797 ------
NM_007286chr582066 1966 1898 1733 1402 576 481 199 2698 439 22096 127 1406
NM_007292chr1775070 3287 1795 1319 1249 765 442 --35055 4950 3412 --
NM_007294chr1721073 497 1200 31036 110 73 --
NM_007295chr1721073 497 1200 31036 110 73 --
NM_007296chr1721073 497 1200 31036 110 73 --
NM_007297chr1721073 497 1200 31036 110 73 --
NM_007298chr1721073 497 1200 31036 110 73 --
NM_007299chr1721073 497 1200 31036 110 73 --
NM_007300chr1721073 497 1200 31036 110 73 --
NM_007302chr1721073 497 1200 31036 110 73 --
NM_007303chr1721073 497 1200 31036 110 73 --
NM_007304chr1721073 497 1200 31036 110 73 --
NM_007305chr1721073 497 1200 31036 110 73 --
NM_007313chr991843 1680 1379 778 474 444 146 122 109 31587 1402 375 1671 --
NM_007322chr192401 148 ------
NM_007326chr222216 49 1153 3714 654 123 --
NM_007327chr971142 1007 999 822 427 373 224 ------
NM_007331chr452602 1718 1701 1092 847 ------
NM_007350chr1244330 4280 3599 1152 ------
NM_007351chr42815 80 11132 ----
NM_007353chr792310 2119 1853 691 670 525 399 362 207 --12292 1116
NM_007358chr131970 1572 543 ------
NM_007359chr1711175 1518 ----
NM_007373chr1031596 529 419 ------
NM_012074chr1451114 827 760 744 22 ------
NM_012081chr521151 607 ------
NM_012082chr81684 ------
NM_012090chr131250 969 198 ------
NM_012095chr1012546 12379 32929 2664 560 --
NM_012097chr211438 11941 ----
NM_012098chr941304 1268 572 51 11195 ----
NM_012102chr132345 2027 839 ----1241
NM_012104chr1171001 992 955 406 383 289 139 33086 1038 36 ----
NM_012104chr1171001 992 955 406 383 289 139 33086 1038 36 ----
NM_012110chr4272 56 ------
NM_012111chr141136 ------
NM_012118chr4179 1402 ----
NM_012120chr642632 2453 2207 1864 ------
NM_012134chr141391 1369 762 90 11673 11547 --
NM_012137chr142224 1912 519 421 1914 ----
NM_012141chr1353468 2668 1013 935 606 ------
NM_012153chr1131760 727 317 166 --11642
NM_012156chr20103323 2999 2599 2553 2462 2381 2332 1372 1284 1095 13165 2772 415 --
NM_012158chr1321627 686 ------
NM_012164chr995924 5794 5498 2766 2296 2098 1525 1364 793 75680 4874 4734 1929 1457 1331 775 22455 719 --
NM_012175chr11--1634 1130 --
NM_012180chr42750 169 ------
NM_012183chr12415 76 1114 ----
NM_012192chr1152313 1904 703 514 67 1138 1258 132
NM_012193chr11125301 5183 5158 4947 4654 4637 4016 3958 3685 3284 2027 294 ----12177
NM_012199chr1144544 4417 4305 4146 4083 3361 1772 1641 1577 1493 1048 366 248 123 34484 3257 1532 ----
NM_012200chr112148 93 1102 ----
NM_012202chr112272 45 ------
NM_012210chr921053 102 ------
NM_012214chr296339 4863 4785 4340 2207 2182 2161 2005 1345 --14196 15806
NM_012215chr1021885 378 --11837 --
NM_012224chr41484 ------
NM_012229chr102915 537 --143 --
NM_012232chr1782116 1921 1682 1431 1359 557 402 306 --42200 1420 626 248 --
NM_012234chr333488 2959 1241 21389 83 ----
NM_012245chr142414 384 ------
NM_012257chr71923 ------
NM_012259chr61331 1265 ----
NM_012262chr144526 4500 4262 206 13908 ----
NM_012282chrX5851 842 301 279 53 ----1156
NM_012286chrX132 ------
NM_012287chr31407 ------
NM_012288chr6175488 5386 5332 5093 4646 3508 2137 2043 1303 1208 1072 747 539 481 426 316 260 24192 1773 ----
NM_012294chr763274 2821 2780 1560 1073 578 23239 2560 ----
NM_012296chr1183525 3366 2919 2422 1228 1021 347 162 1808 12783 --
NM_012297chr422159 873 ------
NM_012300chr522085 1703 22213 555 11697 --
NM_012301chr721534 576 11777 11858 --
NM_012302chr12926 121 ------
NM_012304chr592480 2367 2164 2099 1999 865 761 633 614 --22170 655 --
NM_012308chr1182439 1938 1736 1703 980 412 338 88 ------
NM_012309chr11124854 4204 3883 3544 1365 1343 1053 950 649 452 179 123 14639 34737 3618 1180 --
NM_012316chr1135490 4487 4422 4103 3881 2150 1909 1764 1509 624 518 416 65 45388 5244 174 158 11004 21363 121
NM_012320chr1661352 997 557 439 409 55 11393 2365 292 --
NM_012325chr2051449 1392 1059 1022 600 1504 ----
NM_012326chr22686 628 --1184 --
NM_012328chr71265 21445 1095 ----
NM_012330chr1031786 1262 542 ------
NM_012333chr121445 337 --11391 --
NM_012339chr101497 ----1217
NM_012343chr53852 379 292 ------
NM_012347chr632919 2780 236 ------
NM_012384chr2072194 1813 1757 1701 437 287 24 22223 490 42244 1500 925 851 12111
NM_012392chr16617 555 533 242 155 45 ------
NM_012396chr13729 549 80 2503 223 1172 --
NM_012399chr2241694 1539 1506 718 ----11377
NM_012402chr1191292 1215 493 380 346 280 209 196 102 --1927 --
NM_012405chr153664 2669 2361 843 25 --1741 --
NM_012410chr164447 348 105 89 --1380 1154
NM_012416chr921172 198 ------
NM_012419chr61610 182 ----
NM_012430chr32288 104 1556 127 --
NM_012458chr1971243 1123 1081 476 420 197 150 2870 444 ----
NM_012461chr141667 1494 ----
NM_012465chr1083237 2895 2305 1338 1085 1013 765 732 12339 22449 340 --
NM_012478chr172315 94 2886 854 ----
NM_012479chr741717 534 433 133 --12042 --
NM_012482chr11164 ------
NM_013229chr1242441 2370 961 663 --22797 818 12475
NM_013231chr1473546 3118 2797 2734 1542 703 370 34133 1693 1382 ----
NM_013233chr211340 ------
NM_013235chr52827 665 ------
NM_013242chr162425 104 133 ----
NM_013245chr164685 577 507 163 1235 1191 1699
NM_013246chr115834 211 154 112 65 1124 ----
NM_013247chr23142 136 33 --1387 --
NM_013253chr112392 125 ------
NM_013255chr778677 8636 8078 8039 6042 1566 891 28539 7627 ----
NM_013261chr422401 938 1271 --12786
NM_013269chr1251738 1336 480 434 419 2946 451 ----
NM_013279chr11102011 1818 1689 860 783 662 615 519 338 105 11902 12023 1314
NM_013281chr2011321 ------
NM_013283chr52735 181 --1221 --
NM_013286chr383543 3214 2478 1167 985 809 140 103 53687 3644 2992 1477 936 52579 2400 2360 1525 343 --
NM_013305chr185204 189 147 133 57 --3292 250 97 --
NM_013316chr7----1869 --
NM_013323chr1721125 262 --1935 --
NM_013325chr251404 1352 1084 352 47 --11097 --
NM_013333chr193360 120 54 ------
NM_013335chr22190 147 ------
NM_013336chr3121892 1870 1762 1705 1696 1634 1618 1340 732 615 364 182 11465 ----
NM_013341chr211111 --1426 --
NM_013365chr223852 602 546 ----1277
NM_013372chr1541286 609 345 123 12619 ----
NM_013381chr1222159 366 ------
NM_013382chr14102146 2061 1948 1721 876 805 781 721 508 480 --1138 --
NM_013386chr11263 2639 52 ----
NM_013390chr931452 1089 461 1382 ----
NM_013392chr22143 22 146 1390 --
NM_013400chr781017 700 423 345 302 256 247 154 11031 1439 2925 265
NM_013401chr117690 673 367 303 170 98 30 1683 1806 --
NM_013403chr193617 271 257 --122 --
NM_013433chr19111910 1489 1460 1434 1409 1308 674 663 281 259 184 11580 190 --
NM_013434chr271997 1943 1725 1276 589 444 276 --21846 1840 --
NM_013434chr271997 1943 1725 1276 589 444 276 --21846 1840 --
NM_013436chr21649 --145 --
NM_013437chr821423 1091 ------
NM_013438chr921405 282 ----11145
NM_013443chr941048 378 363 126 --21006 316 --
NM_013444chrX1836 ------
NM_013446chr731321 1290 361 11351 ----
NM_013449chr1262903 2009 1995 1981 813 136 11189 188 1503
NM_013450chr211061 ------
NM_013451chr10------1159
NM_013951chr272458 2362 1973 1615 1533 783 715 22240 178 1537 --
NM_013952chr272535 2439 2050 1692 1610 860 792 22317 255 1614 --
NM_013953chr272535 2439 2050 1692 1610 860 792 22317 255 1614 --
NM_013958chr81167 ------
NM_013959chr81167 ------
NM_013961chr81167 ------
NM_013962chr81167 ------
NM_013989chr1494943 4337 4158 4085 3509 3461 3279 1457 1263 --24981 401 --
NM_013992chr272535 2439 2050 1692 1610 860 792 22317 255 1614 --
NM_013993chr62293 253 1186 1690 --
NM_013994chr62293 253 1186 1690 --
NM_013999chr1741281 1068 403 189 11039 11265 --
NM_014001chr17101621 1293 1260 1152 617 561 554 438 89 49 --31487 130 67 1580
NM_014002chr12171 121 --1660 --
NM_014010chr92464 71 2383 65 ----
NM_014011chr21287 ------
NM_014015chr161701 ----154
NM_014016chr32591 171 ------
NM_014021chr143040 2776 2754 2208 11069 ----
NM_014023chr1072457 2212 2199 1784 1035 365 224 2376 105 ----
NM_014028chr612782 23351 2754 ----
NM_014030chr1741142 789 452 130 11054 1146 --
NM_014079chr32354 201 --2786 762 --
NM_014089chr13--21564 130 ----
NM_014106chr153412 127 33 ------
NM_014109chr81464 11159 ----
NM_014110chr11123 --2377 244 --
NM_014112chr855320 4909 3922 1609 640 ------
NM_014117chr1622019 526 --11955 --
NM_014141chr764237 4086 3850 1044 999 587 11094 14212 --
NM_014145chr202209 203 1597 ----
NM_014154chr321571 592 ------
NM_014155chr1176158 5679 5647 4595 1337 423 147 14871 ----
NM_014157chr16123343 2976 2843 2799 1546 1459 1355 1325 1221 974 871 139 53480 3249 2871 446 184 11426 1839
NM_014159chr34560 542 252 121 ------
NM_014171chr22725 50 ------
NM_014181chr252776 2767 2331 1174 1032 --22792 2484 --
NM_014182chr123626 182 171 1688 ----
NM_014183chr20--1293 ----
NM_014188chr11340 130 ----
NM_014189chr481484 1165 1131 524 428 74 40 24 --3932 487 272 --
NM_014190chr481836 1517 1483 426 392 376 360 255 --21284 624 --
NM_014191chr1221007 758 ------
NM_014203chr19--151 ----
NM_014231chr1251997 1871 1830 1704 1621 1480 1502 --
NM_014232chr1741174 534 392 21 1100 11121 --
NM_014232chr1741174 534 392 21 1100 11121 --
NM_014233chr1751791 1675 622 210 101 11745 21606 515 11669
NM_014238chr1751238 1081 530 515 345 1284 --21435 1213
NM_014240chr363486 3104 2999 1372 311 74 1808 12942 --
NM_014243chr41588 ------
NM_014250chr2241491 1466 688 90 --1670 --
NM_014251chr73913 788 64 1697 ----
NM_014253chrX32486 1813 1699 ------
NM_014268chr1851358 979 964 344 198 11340 ----
NM_014275chr55876 857 618 308 37 1935 ----
NM_014286chr9153568 3357 2876 2772 2544 2440 2320 1277 1222 1176 977 762 447 166 69 43525 3253 3234 1459 23469 2689 --
NM_014289chrX3994 583 261 ------
NM_014292chr2231691 1470 592 21770 188 41403 1301 1213 604 --
NM_014299chr19102053 1997 1479 1433 1410 605 285 275 267 253 3765 558 304 31384 818 132 --
NM_014300chr152369 23 ------
NM_014309chr2285130 4331 4060 4034 3470 1968 1601 1358 21131 755 14006 --
NM_014319chr1211959 ------
NM_014325chr12----11450 --
NM_014333chr111300 --1968 --
NM_014351chr222981 61 198 ----
NM_014368chr941890 1772 1726 759 1403 11559 11779
NM_014372chr11212 1127 ----
NM_014374chr781017 700 423 345 302 256 247 154 11031 1439 2925 265
NM_014392chr441378 623 572 212 ------
NM_014393chr831553 867 307 ------
NM_014399chr71954 ------
NM_014409chr141074 997 733 119 ----1234
NM_014415chr331355 1222 440 ------
NM_014417chr195641 210 202 122 69 ------
NM_014418chr1451729 1328 694 684 205 21893 477 1654 --
NM_014423chr552246 2172 1309 1027 429 24693 4134 ----
NM_014437chr13688 390 125 ------
NM_014445chr351697 1511 481 195 75 1641 ----
NM_014452chr6----2989 983 --
NM_014454chr61886 --1850 --
NM_014458chr1--159 ----
NM_014470chr12145 ------
NM_014480chr193882 683 325 1146 ----
NM_014489chr112807 283 ------
NM_014491chr72956 351 ------
NM_014494chr1662309 1501 868 692 628 504 ------
NM_014507chr2251188 1113 1006 759 122 --31080 896 291 --
NM_014515chr125970 873 784 164 104 ------
NM_014516chr19168 ----175
NM_014517chr321380 640 --1270 1235
NM_014554chr1211451 42209 1828 120 73 1131 1664
NM_014564chr95859 797 731 157 48 ------
NM_014567chr162110 56 --1122 1131
NM_014572chr1331714 1120 713 ------
NM_014577chr221703 ------
NM_014585chr22121 99 11185 ----
NM_014587chr1651476 1418 1058 365 47 11113 ----
NM_014591chr103450 109 30 1159 ----
NM_014603chr1781619 1237 633 557 284 226 194 176 31427 656 483 11334 --
NM_014607chr211878 1645 --1633
NM_014613chr552466 1936 1124 1072 444 1891 2985 634 --
NM_014614chr24518 474 464 369 --11400 --
NM_014615chr1643505 3388 780 680 1593 --12668
NM_014616chr342646 891 428 86 ------
NM_014630chr15113300 2742 2703 1080 569 486 476 202 135 86 60 23910 120 13901 --
NM_014634chr2283477 3452 3405 2291 1234 1205 401 363 --63283 2876 2534 1186 504 164 --
NM_014636chr984126 3829 3794 3468 3107 611 587 263 --176 --
NM_014637chr831175 533 29 ------
NM_014646chr1842655 2089 1106 490 1193 2905 842 --
NM_014653chr1292005 1654 1547 298 276 217 119 70 37 21441 568 153 11333
NM_014655chr1102202 2067 1526 1488 1440 843 702 557 440 107 --1113 --
NM_014661chr10183938 3479 3332 3239 2981 2753 2622 2404 1308 1285 1212 1199 1123 785 607 361 350 57 --33697 3338 3267 --
NM_014663chr13314 307 51 ------
NM_014665chr883349 3299 3229 2293 353 253 75 34 --22332 292 --
NM_014666chr51398 1390 ----
NM_014667chr342342 2184 2150 2111 22403 2219 ----
NM_014670chr241108 627 467 324 --170 --
NM_014671chr731219 1003 979 ------
NM_014674chr363812 3559 3527 3157 2637 196 ------
NM_014676chr141537 1352 1052 229 ------
NM_014677chr83502 372 76 ------
NM_014680chr17141 1570 ----
NM_014686chr1952481 2367 678 345 138 12195 --1207
NM_014690chr742414 2055 1948 452 1138 32012 1975 731 12611
NM_014700chr163428 384 298 149 21488 1285 --
NM_014702chr633248 695 526 ------
NM_014706chr122245 41 11065 ----
NM_014712chr166510 427 417 392 51 44 1161 1442 --
NM_014717chr191711 ------
NM_014718chr126735 587 579 553 217 168 1158 2782 42 --
NM_014726chr175473 425 221 189 157 --21168 179 --
NM_014729chr821568 866 1153 --1323
NM_014730chr12114771 4200 3766 3657 3560 2117 1692 1477 1403 997 630 44829 4812 3449 931 84531 3793 2056 1963 1957 1749 1395 456 --
NM_014730chr12114771 4200 3766 3657 3560 2117 1692 1477 1403 997 630 44829 4812 3449 931 84531 3793 2056 1963 1957 1749 1395 456 --
NM_014731chr2051580 1154 1147 504 36 ------
NM_014735chrX31618 723 441 11711 ----
NM_014739chr654086 3773 2744 864 310 1391 ----
NM_014741chr1181833 1781 1630 1481 775 354 281 96 1164 31613 1447 649 1226
NM_014742chr202136 115 2683 130 ----
NM_014743chr422287 1118 ------
NM_014746chr293194 3098 2884 2710 1551 1093 1003 915 340 14284 ----
NM_014747chr1265096 4851 4321 4211 3952 3786 3693 3659 3627 3523 2098 1785 1523 1368 1195 946 923 911 840 762 639 551 492 433 240 104 --44653 4620 651 389 --
NM_014748chr22299 58 --1276 --
NM_014750chr141221 ------
NM_014751chr831969 1870 829 1782 ----
NM_014752chr1141901 1359 188 125 21589 32 --11329
NM_014755chr253512 1200 874 446 229 23495 3371 ----
NM_014756chr112399 187 ------
NM_014757chr532333 1863 808 1817 31882 760 147 --
NM_014759chr8101636 1549 1426 1027 562 494 362 338 271 139 ------
NM_014761chr163287 237 140 1992 ----
NM_014762chr1122315 2219 2212 922 813 728 658 648 557 495 251 148 21805 738 ----
NM_014765chr152510 1904 1864 851 685 --172 --
NM_014766chr72604 332 23801 1258 22934 586 --
NM_014767chr10243547 3198 2932 2864 2845 2748 2482 2458 2379 2355 1474 1408 1190 1044 956 918 663 461 449 439 427 418 264 48 1934 1515 12834
NM_014770chr1241169 1143 413 362 11301 1252 --
NM_014771chr164916 782 146 40 2760 24 ----
NM_014772chr18103594 3051 2867 2610 2198 1394 1335 1017 361 250 --72902 1322 1316 1003 259 91 46 --
NM_014774chr132891 2607 1079 --1627 --
NM_014776chr1232452 1154 450 12233 12969 12751
NM_014781chr82190 51 ------
NM_014783chr1521145 323 11194 ----
NM_014786chr114874 520 202 128 31082 921 270 1508 1809
NM_014790chr51400 ------
NM_014798chr1741404 587 187 24 11292 61870 1730 1182 752 638 279 11441
NM_014800chr74894 885 332 188 --1148 185
NM_014807chr114675 241 129 103 171 ----
NM_014810chr183441 2786 2555 2299 1409 1362 742 603 --21485 45 --
NM_014811chr91122 --3676 170 28 --
NM_014819chr531772 779 356 --12071 --
NM_014822chr41493 ------
NM_014824chr1121331 561 ------
NM_014826chr173917 3803 3793 3671 3441 1086 744 1424 1833 --
NM_014827chr131316 606 160 ----1152
NM_014828chr1452395 2167 2064 1624 944 11790 ----
NM_014830chr1293409 3153 3095 2863 2721 1417 1393 904 680 12811 31405 1383 103 --
NM_014838chr2252547 1790 819 226 79 11967 ----
NM_014839chr121740 615 ------
NM_014840chr12112758 2732 2609 2494 2108 1313 1122 851 771 219 147 --3752 648 388 --
NM_014849chr131096 524 74 1916 2413 370 --
NM_014850chr3144577 4439 4427 4292 3911 3512 3400 3394 3381 1670 1544 1261 1088 93 13903 163 21938 100
NM_014858chr16897 837 459 413 359 32 171 --11052
NM_014859chr1711341 1398 1509 --
NM_014860chr252472 2246 1759 918 785 --11050 --
NM_014862chr15144230 3865 2823 2608 1592 1347 1274 1263 1044 851 697 626 95 86 --31187 433 205 12865
NM_014864chr111503 --14053 2334 130
NM_014868chr123665 581 366 --2818 117 --
NM_014869chr351315 1242 1226 178 162 --1463 1927
NM_014872chr952035 1874 1836 1719 226 12174 ----
NM_014873chr124227 4009 14157 13963 1873
NM_014876chr2252219 1879 1806 661 186 --1818 --
NM_014877chr1757241 6615 5935 5177 2422 25765 5490 26953 5944 17025
NM_014881chr10--140 ----
NM_014883chr422342 97 2466 361 21682 86 22447 74
NM_014884chr19277 59 ------
NM_014899chr541139 960 706 262 ------
NM_014901chr571992 1629 692 532 401 380 348 --21898 1420 146
NM_014902chr2041491 1372 1262 432 --1390 --
NM_014903chr1221549 109 ------
NM_014909chr14123519 3510 3266 2800 2780 2527 2468 851 747 696 378 367 12977 43272 2806 1071 481 13840
NM_014912chr1062885 2868 2853 2532 1168 1054 ------
NM_014913chr1831155 281 121 ------
NM_014914chr22848 110 11042 1306 --
NM_014921chr19112969 2690 2546 2310 2148 1184 819 772 692 368 52 22806 531 2833 64 --
NM_014924chr1483150 1952 1063 1002 900 682 580 312 --12112 --
NM_014931chr192634 612 1130 1573 --
NM_014932chr3166 ------
NM_014935chr1143271 3214 3139 3058 2897 2837 2790 2722 2711 1202 1159 1069 319 103 42755 2517 1170 447 52449 1121 325 248 90 1220
NM_014944chr151348 1130 939 578 226 ------
NM_014946chr222620 208 ------
NM_014948chr2072489 2363 2278 1623 738 513 418 12350 32369 2322 2121 --
NM_014949chr121015 78 ------
NM_014952chr1581977 1709 1498 1331 595 577 491 248 --11365 11725
NM_014961chr42316 88 --1604 --
NM_014962chr2031150 1121 461 ------
NM_014969chr11324 ------
NM_014974chr1031537 1404 1391 --11527 --
NM_014977chr141450 190 ----
NM_014978chr1021343 491 ------
NM_014982chr1475119 4769 3636 3581 1832 913 888 ----15215
NM_014988chr442401 1107 1067 56 1647 12703 --
NM_014989chr621637 1285 ------
NM_014990chr142930 153 ------
NM_014991chr443002 2378 2078 914 12506 ----
NM_014992chr14178 ------
NM_014994chr1552268 2085 1538 681 391 31786 799 202 1754 11989
NM_014996chr3177 11051 ----
NM_015001chr13845 137 44 1410 ----
NM_015002chr1252178 1657 1564 377 258 ------
NM_015008chr382976 2835 1052 706 524 397 241 35 1562 12398 --
NM_015009chr32589 145 ------
NM_015012chr111357 1351 ----
NM_015017chr12312 49 ------
NM_015018chr6166 ------
NM_015020chr1653634 2618 1015 405 195 ----1486
NM_015023chr191780 1743 1709 1192 670 618 357 213 182 2663 280 61612 689 631 416 289 53 21298 559
NM_015024chr8101381 1236 943 911 594 321 306 272 203 94 ------
NM_015025chr222019 1772 ------
NM_015032chr132644 548 ------
NM_015033chr9103075 2892 2779 2606 1046 751 698 311 162 80 23257 38 1339 --
NM_015035chr20176456 6306 6183 6138 5738 4950 4807 4750 4421 4293 2447 2237 1535 1405 1124 633 449 --46431 5011 4977 2419 24584 2562
NM_015037chr102229 200 ------
NM_015039chr193980 3346 3130 3123 1645 1586 1270 952 911 21168 260 71357 425 411 386 347 333 308 --
NM_015040chr243380 2281 2159 364 ------
NM_015042chr15194084 3904 3895 3765 3721 3683 3409 3268 3245 2849 1056 1026 870 816 687 507 351 335 148 63919 3612 1692 1516 1254 981 33927 3839 3308 --
NM_015044chr16103267 3015 2855 2581 2495 2203 1273 697 402 157 1685 23075 123 --
NM_015045chr1021593 763 ------
NM_015046chr952681 2165 822 540 151 ----12472
NM_015052chr741236 913 53 31 ------
NM_015054chr12------137
NM_015057chr131546 ------
NM_015063chr19101297 1227 448 350 326 271 157 143 110 74 ------
NM_015069chr161215 ------
NM_015071chr586377 4890 4658 4546 1957 1898 1883 1152 11556 24209 150 15647
NM_015074chr143542 3229 1993 172 ------
NM_015075chrX122141 2005 1648 1408 1382 888 879 605 494 317 286 101 --11854 1706
NM_015076chr643610 2768 1486 306 ------
NM_015077chr17194535 4314 4088 3996 3699 3641 3280 3145 3066 3028 1294 934 914 799 531 523 236 85 24 34507 4160 4146 33379 3220 774 13601
NM_015080chr114361 232 101 40 --1267 --
NM_015082chr551995 763 389 211 46 12170 122 --
NM_015086chr1271541 1237 1191 983 580 484 44 11382 ----
NM_015090chr1195798 5583 5518 4475 4439 4322 4280 4089 3983 3927 2426 2416 1781 1396 716 626 600 552 311 42091 1360 776 437 14555 --
NM_015091chr141269 ------
NM_015092chr1623566 1599 12910 ----
NM_015093chr621717 511 ------
NM_015097chr311940 ------
NM_015099chr176497 468 267 183 153 29 --1209 --
NM_015101chr142798 2084 831 44 12625 ----
NM_015106chr31153 ------
NM_015107chrX61746 1565 1504 913 295 116 21525 75 1852 191
NM_015115chr453124 2868 2327 1048 156 ------
NM_015116chr1341220 564 81 32 11184 1323 --
NM_015120chr21204 ----129
NM_015132chr711420 --21775 1729 --
NM_015133chr1681467 1442 1143 544 442 333 289 248 21112 359 2399 322 --
NM_015138chr1532816 1013 358 --2876 404 12094
NM_015141chr332507 2190 845 ------
NM_015143chr431433 541 485 ------
NM_015144chr1673377 3284 1525 1044 898 479 418 11166 ----
NM_015155chr1083014 2471 2304 862 823 634 596 320 --1452 --
NM_015156chr1433473 271 141 2357 100 ----
NM_015157chr1191129 985 791 737 428 241 189 154 80 --198 --
NM_015161chr1611102 11129 ----
NM_015171chr162431 103 --2395 90 --
NM_015176chr121419 376 ------
NM_015185chrX92904 2617 2563 2331 2229 675 665 598 402 --22111 1088 --
NM_015192chr2012485 --1352 --
NM_015193chr891489 1282 1261 1195 1175 1151 1108 997 589 21414 322 1100 11396
NM_015194chr1771536 1334 632 468 240 220 147 --31841 445 48 1686
NM_015197chr14183189 3058 3017 2953 2940 2897 2436 2260 2128 1260 1249 1173 610 456 431 321 269 187 43370 3249 2283 332 12974 12721
NM_015199chr322744 798 --1921 --
NM_015200chr41129 ------
NM_015205chr13174744 4469 4048 3978 3957 3935 3860 1924 1888 1228 1126 837 733 349 300 279 244 13909 44430 3853 1911 1364 14071
NM_015206chr1573369 3027 2811 1317 913 866 849 12446 ----
NM_015209chr13678 639 552 21489 496 1583 --
NM_015213chr11153 1302 ----
NM_015215chr112937 1881 ----
NM_015216chr511079 ------
NM_015221chr1051421 521 214 102 27 --1443 --
NM_015233chr1352211 2204 1891 1753 92 --32629 2241 163 --
NM_015236chr41296 ------
NM_015247chr16135320 5029 4819 4222 3706 3603 3585 1613 1562 1546 1529 880 420 34652 2046 678 14832 --
NM_015250chr93431 256 35 11653 1747 --
NM_015252chr21644 1741 ----
NM_015254chr8162935 2807 2602 2472 2441 2056 1257 851 832 536 511 484 276 153 69 54 32318 562 162 61955 895 591 578 571 450 --
NM_015256chr52706 648 ------
NM_015263chr151986 ------
NM_015265chr2--11941 22053 232 --
NM_015269chr11143 ------
NM_015270chr1252225 1930 1692 1598 407 22188 2051 32137 566 503 --
NM_015271chr432863 728 560 1577 ----
NM_015272chr1631886 1773 84 11685 11612 --
NM_015275chr122720 95 31846 1735 109 ----
NM_015284chr1112147 1877 1867 1812 1788 775 585 526 475 287 254 ------
NM_015288chr5173799 3748 3306 3281 2775 2400 1283 1185 1145 1124 947 653 442 405 284 258 28 13004 2684 34 12497
NM_015296chr1311207 --1832 --
NM_015299chr14173829 3732 3717 3681 3597 3319 3274 3251 2641 1579 1522 1038 988 971 428 377 30 23819 1483 33671 2836 456 21302 390
NM_015305chr1461785 1677 1398 1312 1249 742 21752 698 41447 1388 673 239 11200
NM_015310chr8107635 7248 7108 7093 7086 6741 6665 5845 3347 1844 27447 3209 47821 2887 2790 963 --
NM_015313chr1141178 692 393 70 ------
NM_015315chr5153424 2948 2851 2750 2713 2202 1398 1219 1187 1149 491 436 375 348 175 73143 2158 1247 1068 1038 1000 873 1479 12993
NM_015317chr282474 2178 2141 2088 1117 1090 668 209 --12748 --
NM_015326chr192558 2525 2335 2307 544 525 352 304 166 --22701 2280 --
NM_015327chr141284 1182 247 57 ----1540
NM_015328chr762531 2350 2071 2021 639 198 32297 2030 369 ----
NM_015329chr19102633 2591 2500 2364 1879 984 905 577 397 273 --1124 --
NM_015332chr7113395 3356 2966 2777 2498 2389 1311 1110 891 614 445 22205 1040 53559 3538 3483 1205 494 --
NM_015335chr122120 25 ----12223
NM_015336chr1222309 731 12449 ----
NM_015339chr20193 ------
NM_015343chr17277 58 --1133 --
NM_015344chr821918 251 ------
NM_015345chr64742 648 367 288 21849 863 52278 549 219 122 110 32320 914 249
NM_015346chr1471613 1500 1404 1316 1308 421 102 ----1626
NM_015347chr1272933 2212 2183 1997 903 764 465 ----1820
NM_015349chr682761 2270 2075 1139 1097 350 223 78 12152 1605 --
NM_015353chr17102435 2241 1932 1889 1830 1789 1022 980 836 115 2706 339 12129 1637
NM_015374chr2271253 999 965 435 413 242 87 11098 --11370
NM_015378chr1123008 2720 2658 2440 2433 2388 2331 2137 2085 1160 548 282 --22340 1204 --
NM_015385chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_015393chr462358 1176 713 239 151 108 ----23245 602
NM_015396chr3--1102 ----
NM_015397chr951517 1198 689 301 156 ------
NM_015401chr128812 745 684 355 172 81 62 37 --3898 676 274 --
NM_015404chr94594 540 489 42 ------
NM_015407chr31170 ------
NM_015443chr173481 467 452 --1264 1414
NM_015444chr3130 1203 ----
NM_015455chr5126 11134 ----
NM_015457chr114988 803 435 184 2842 244 --1283
NM_015460chr331794 147 59 ------
NM_015461chr181541 1615 ----
NM_015477chr152631 116 ----1248
NM_015481chr121404 1272 ----
NM_015483chr71281 --11016 1410
NM_015484chr12772 716 ------
NM_015488chr281523 1312 1301 1172 664 507 500 310 --11129 1381
NM_015493chr1952047 1493 663 150 82 ----22002 897
NM_015497chr152925 468 ----1974
NM_015511chr2041005 943 116 83 21138 396 2229 55 --
NM_015520chr311035 42745 556 445 433 ----
NM_015523chr111220 ------
NM_015526chr1921264 66 31284 1138 358 ----
NM_015527chr164636 311 277 254 ------
NM_015534chr13218 199 153 ------
NM_015542chr10132 ------
NM_015545chr74579 291 104 43 ----1720
NM_015553chr685172 4529 4125 4066 3618 3301 1559 805 23732 1988 23538 1952 --
NM_015555chr62708 35 ------
NM_015557chr1123287 3128 1455 1374 1234 1213 1045 980 959 643 457 124 23326 1079 53469 2830 1440 998 447 1768
NM_015559chr181802 --11069 --
NM_015564chr543442 2317 2292 1015 12958 ----
NM_015565chr2121435 557 1123 ----
NM_015567chr13----1115 --
NM_015568chr20143955 3583 3522 3207 2763 1665 1623 1470 1444 1075 673 542 238 111 44276 2908 761 46 24226 71 --
NM_015569chr114470 23793 3586 ----
NM_015575chr283366 3160 2776 2500 2262 1429 713 578 11376 ----
NM_015576chr332335 683 77 12843 ----
NM_015577chr541753 1402 1139 270 11364 ----
NM_015578chr1921743 52 ------
NM_015609chr1132838 2795 2788 2762 2722 2702 2677 2105 957 789 767 692 48 --12164 --
NM_015627chr1131779 1745 1648 1633 1521 1333 1208 514 406 328 206 176 33 1318 21707 334 1553
NM_015634chr102527 203 ------
NM_015638chr207617 591 513 249 166 157 69 ------
NM_015645chr113343 300 137 2317 91 1266 --
NM_015646chr1231344 1064 24 ------
NM_015651chr991747 1474 1438 762 722 340 185 134 28 --12026 --
NM_015652chr101226 ------
NM_015657chr21676 --2975 720 --
NM_015670chr171451 --1457 --
NM_015684chr141209 ------
NM_015686chrX52139 2117 1817 825 322 12069 41677 1585 971 356 1957
NM_015695chr63768 180 32 1785 1315 --
NM_015713chr843128 2695 996 301 ----1793
NM_015716chr17189 ----1735
NM_015726chr141713 1610 1396 530 11831 --1199
NM_015833chr2161955 1734 688 648 575 96 ------
NM_015844chr182269 188 --1689 --
NM_015846chr182269 188 --1689 --
NM_015847chr182269 188 --1689 --
NM_015850chr862359 1691 730 622 414 400 --32296 966 596 --
NM_015855chr111776 ------
NM_015872chr1101395 1371 664 595 473 453 391 370 280 106 --11611 --
NM_015878chr821868 1849 11677 ----
NM_015879chr18128591 7237 7169 6622 6508 5501 2977 1969 1396 976 371 339 38375 2469 2096 27567 2747 15691
NM_015881chr112392 125 ------
NM_015886chr824345 3624 1602 ----
NM_015888chr123010 291 ------
NM_015889chr222841 820 --1133 --
NM_015897chr192141 27 1157 ----
NM_015898chr1982318 2069 1927 741 654 499 338 241 11774 1378 --
NM_015906chr123353 1861 23726 3275 11401 14765
NM_015912chr892229 2206 2030 1964 1830 1800 1740 1707 742 ------
NM_015920chr151636 ------
NM_015955chr2----187 --
NM_015980chr541172 614 198 94 11195 ----
NM_015981chr582919 2878 2558 2485 2461 1970 1934 1280 1694 ----
NM_015989chr12127 1687 ----
NM_015993chr164744 281 90 26 1496 ----
NM_015995chr15255131 5045 5023 5000 4971 4878 4758 4748 4554 4423 4299 3967 3468 2070 2045 1863 1760 1714 1352 1284 911 630 608 521 49 45383 5245 1247 328 85431 3461 2170 1730 1683 1403 1384 742 23528 3510
NM_016019chr7----1301 --
NM_016022chr17791 778 714 447 415 371 286 ------
NM_016025chr1622030 96 154 ----
NM_016026chr141124 11224 ----
NM_016032chrX71353 1254 1225 1140 960 503 427 1286 1246 --
NM_016037chr13804 463 304 ------
NM_016045chr201393 31796 659 266 ----
NM_016057chr1221293 291 ------
NM_016063chr61559 ------
NM_016072chr1211763 1434 ----
NM_016073chr151332 1990 ----
NM_016076chr172647 2618 2519 573 556 262 36 22325 1246 ----
NM_016083chr673182 3050 2816 1109 743 440 80 ----13156
NM_016089chr331783 1549 392 11832 ----
NM_016107chr51364 --11254 --
NM_016131chr252328 747 708 508 479 ------
NM_016147chr1141109 1027 410 37 1830 ----
NM_016152chr341289 1211 352 310 ------
NM_016166chr15175 ------
NM_016169chr10163183 3080 2681 2609 2491 2286 2135 1190 1011 990 978 646 540 456 310 219 32420 430 304 --1698
NM_016172chr92274 44 ----1109
NM_016173chr3264269 4245 4221 3751 3478 3391 3300 3085 2925 2786 1755 1684 1477 1433 1369 1118 1104 1003 762 735 628 523 429 194 123 24 24055 3783 93919 3820 3266 3054 1786 1729 829 499 451 23865 436
NM_016179chr13----155 --
NM_016192chr21102 ------
NM_016201chr35784 458 334 262 51 1913 ----
NM_016203chr73971 262 50 ------
NM_016205chr431342 908 397 --1423 --
NM_016206chr3108074 7419 7084 2974 2388 2346 2072 1946 1749 567 38346 7150 2657 17633 --
NM_016219chr92486 113 --2454 125 --
NM_016221chr5187 1294 ----
NM_016223chr114302 100 84 39 162 1134 --
NM_016231chr1711329 11127 ----
NM_016235chr1631201 325 53 11066 ----
NM_016240chr841317 660 622 523 11104 --11557
NM_016248chr1323499 1355 ------
NM_016250chr143744 737 286 1187 ----
NM_016252chr22886 859 1806 ----
NM_016255chr63809 431 68 ------
NM_016257chr1113444 3295 2856 2805 2503 1310 982 338 111 69 26 23543 578 12534 --
NM_016260chr266698 1556 1412 736 664 164 22683 1322 12103 --
NM_016270chr191312 ------
NM_016272chr2241912 1112 535 162 2626 443 21786 743 --
NM_016275chr31676 --12001 11928
NM_016277chr651598 1127 194 175 141 ------
NM_016287chr131918 1385 805 1227 --1399
NM_016289chr212335 --11832 --
NM_016312chr121145 ------
NM_016319chr125570 563 318 88 23 1690 2659 577 --
NM_016320chr1151147 725 374 93 63 ------
NM_016322chr923253 857 12574 ----
NM_016329chr3----297 89 --
NM_016333chr162197 111 1122 --139
NM_016337chr142178 132 ------
NM_016339chr17121766 1726 1671 1607 1526 1398 1231 1207 1131 666 410 36 2608 145 --21647 1354
NM_016352chr73294 214 104 31295 478 150 41217 1170 393 164 --
NM_016364chr10272 32 --157 --
NM_016374chr141599 1306 1043 545 ------
NM_016374chr141599 1306 1043 545 ------
NM_016376chr1794335 3583 3265 1195 1128 727 507 57 34 --11160 --
NM_016377chr62320 104 1290 ----
NM_016396chr15--12727 11190 --
NM_016403chr112608 222 ------
NM_016422chr1122240 696 ------
NM_016423chr143490 465 376 ------
NM_016424chr1741763 1404 532 177 ------
NM_016433chr1231451 126 95 1234 1363 --
NM_016436chr2052057 528 421 410 37 ------
NM_016441chr242089 478 417 147 11533 ----
NM_016486chr11161 ------
NM_016488chr1221455 1358 11274 11925 --
NM_016490chr22306 33 --1297 --
NM_016496chr192389 62 --1461 --
NM_016507chr17121 22509 200 ----
NM_016516chr22708 326 1248 ----
NM_016522chr1131342 1298 206 ----11589
NM_016525chr95860 161 53 44 23 --1215 --
NM_016529chr132972 269 --1333 --
NM_016531chr453964 1531 758 420 59 14245 --12975
NM_016542chrX11712 ------
NM_016559chr311001 ------
NM_016569chr1211003 ------
NM_016575chr1275312 5103 5003 4772 3355 983 280 2623 580 33373 1499 692 1264
NM_016577chr3114192 3923 3545 3502 3476 3400 3289 1412 1316 721 582 24217 977 13508 --
NM_016578chr111233 ------
NM_016580chr52364 285 122 ----
NM_016588chr62859 622 --1345 --
NM_016596chr128812 745 684 355 172 81 62 37 --3898 676 274 --
NM_016598chr35591 524 410 258 251 --21396 1037 --
NM_016604chr521175 975 ------
NM_016605chr582053 1923 1901 1868 1756 1728 245 21 ----22195 602
NM_016620chr11354 ------
NM_016621chr11134058 4019 3794 3552 3462 3348 3249 3178 3005 1838 1790 1771 600 --34142 3566 3293 --
NM_016626chr1811340 ------
NM_016631chr212841 722 ------
NM_016651chr142819 782 1748 ----
NM_016653chr231091 1075 238 ------
NM_016654chr1521335 143 ------
NM_016824chr1041859 1507 711 231 ------
NM_016829chr36746 701 552 312 256 43 1524 ----
NM_016830chr124359 233 192 66 ------
NM_016836chr21704 ------
NM_016839chr21704 ------
NM_016929chr684323 3258 956 689 667 553 180 91 33732 1655 1570 ----
NM_016938chr111440 1362 2381 100 --
NM_016946chr1133196 3172 2492 1442 1314 1303 1262 1165 952 559 504 271 61 --12339 12567
NM_017410chr1221287 1081 ------
NM_017412chr821009 964 ------
NM_017413chrX62465 2169 2022 369 231 174 2243 76 1568 --
NM_017415chr574347 3881 3704 1166 553 213 72 1294 1202 11316
NM_017420chr1423258 1294 12767 ----
NM_017423chr41279 ------
NM_017432chr194402 363 141 95 --1147 --
NM_017433chr102111 76 ----1564
NM_017443chr911178 128 ----
NM_017447chr2154374 4216 3724 1421 28 ------
NM_017449chr181453 1321 675 542 447 371 221 70 11567 ----
NM_017450chr1771474 1294 1139 1083 545 55 30 --1926 --
NM_017452chr2031252 1219 309 1410 ----
NM_017453chr2031252 1219 309 1410 ----
NM_017454chr2031252 1219 309 1410 ----
NM_017456chr1731991 1425 272 31512 1399 524 31763 718 499 2114 38
NM_017457chr19163 --170 --
NM_017459chr1257 35 --2130 26 --
NM_017491chr41324 123 1732 --
NM_017514chrX7858 793 251 185 173 128 38 ----1100
NM_017519chr611288 ------
NM_017540chr5102635 2502 2419 2346 2079 1272 859 801 716 355 11292 22672 513 --
NM_017544chrX1719 ------
NM_017548chr31535 1594 ----
NM_017551chr10102502 2165 2108 1774 967 751 602 449 414 318 12020 --1582
NM_017553chr1531012 351 49 ------
NM_017558chr162359 161 ------
NM_017563chr3124912 4751 4530 2390 2219 1556 1531 1479 914 356 212 71 1267 ----
NM_017582chr11125 3678 654 112 21744 1313 --
NM_017589chr11--151 ----
NM_017590chr2292262 2245 1819 1659 525 426 397 251 137 --21016 31 --
NM_017592chr1942600 686 651 550 1967 3869 290 70 --
NM_017593chr42468 321 ------
NM_017594chr953044 1340 689 573 238 43155 3104 1092 183 22742 1312 --
NM_017596chr1354509 4472 4395 4386 4372 4205 4174 4062 4005 3940 3774 3693 3601 3504 3491 3471 3391 3246 3096 2863 1800 1753 1651 1458 1143 1102 1080 922 884 846 774 719 314 160 138 33733 3439 1262 33957 3163 672 --
NM_017599chr1231381 829 134 31932 1332 775 ----
NM_017602chrX4938 900 217 144 --1878 --
NM_017610chr154780 370 123 49 ------
NM_017617chr941180 1113 434 63 --11128 --
NM_017622chr174516 452 220 200 --276 28 --
NM_017626chr1031658 1350 629 31750 1226 47 1417 --
NM_017633chr653784 3704 3685 132 21 ------
NM_017634chr811917 1705 ----
NM_017635chr111238 21367 483 ----
NM_017637chr9128489 7839 7828 7785 6961 6670 6037 3769 2701 791 539 132 --16053 27873 3078
NM_017640chr62344 98 ------
NM_017643chr1742816 2453 2198 973 32064 990 643 12129 --
NM_017650chr774060 1496 935 703 560 349 62 14469 ----
NM_017658chr1423773 3709 ------
NM_017662chr951633 1444 1364 103 36 ------
NM_017664chr13142 1681 ----
NM_017666chrX21897 1391 22055 478 --12238
NM_017668chr163680 218 134 1616 --1650
NM_017670chr116831 714 603 201 181 27 ------
NM_017672chr1511160 ------
NM_017679chr173657 613 468 --169 --
NM_017700chr44462 226 163 120 ------
NM_017709chr183551 3532 3423 2950 1234 1192 310 113 ------
NM_017715chr72566 495 ------
NM_017719chr362043 806 617 417 402 371 ----11892
NM_017724chr3135 --1316 --
NM_017730chr3----1215 --
NM_017737chr13794 521 358 ------
NM_017739chr12586 392 ------
NM_017742chr183520 194 186 ------
NM_017744chr172454 1807 1667 1601 927 912 439 3764 178 27 ----
NM_017747chr5128 151 ----
NM_017749chr112891 407 1379 --1325
NM_017753chr91166 ------
NM_017758chr1761513 516 481 142 30 21 31182 466 217 ----
NM_017763chr176905 836 460 450 78 71 ------
NM_017772chr641498 1477 444 424 31122 546 169 ----
NM_017778chr821004 996 ------
NM_017779chr122735 2584 ------
NM_017780chr82810 265 ------
NM_017784chr33920 474 36 ------
NM_017786chr81111 ------
NM_017789chr23567 150 100 ------
NM_017799chr1411395 21544 426 ----
NM_017801chr331692 939 697 --162 --
NM_017811chr962787 2446 2207 2188 675 31 ------
NM_017812chr72692 191 ------
NM_017813chr835022 4330 1800 15394 15629 --
NM_017814chr193193 41 27 ------
NM_017824chr1032661 1055 774 ------
NM_017845chr41680 ------
NM_017847chr11166 ------
NM_017848chrX63808 3673 1819 1694 1683 283 1523 ----
NM_017849chr2103068 2768 2526 2365 2305 1276 970 938 853 677 1325 2553 443 1396
NM_017873chr962837 2488 832 614 489 409 --2572 183 12070
NM_017893chr106541 467 430 413 369 256 ------
NM_017896chr20113399 3270 2604 1140 1029 1018 892 851 287 228 37 --11149 --
NM_017902chr10205607 5221 4831 4743 4661 4608 4200 3972 3891 3793 2159 2151 1606 1535 1512 1414 1209 906 701 251 11579 25328 1664 --
NM_017907chr112463 62 --1204 --
NM_017919chr985524 4919 4678 3682 1843 1047 967 730 23835 267 1200 --
NM_017921chr17102341 2281 2254 2201 2104 2015 1639 912 901 426 1175 32230 2036 132 2526 108
NM_017923chr41683 ------
NM_017929chr2271204 1106 1067 1051 996 392 89 --1981 --
NM_017938chrX1354 ------
NM_017944chr1122084 26 13027 ----
NM_017954chr731682 573 267 ------
NM_017955chr143959 104 96 1875 2911 249 --
NM_017957chr1721563 1316 ----1137
NM_017964chr22379 41 ------
NM_017966chr1121281 405 1207 --1138
NM_017994chr742894 2859 1202 83 2298 242 1210 --
NM_018011chr131145 ------
NM_018017chr10----11086 --
NM_018026chr1171383 1371 1363 1013 375 102 31 1284 ----
NM_018027chr1032772 356 308 129 ----
NM_018028chr192169 37 ------
NM_018030chr182874 76 ------
NM_018032chr163610 290 279 --2661 228 --
NM_018036chr1431585 342 58 --11536 --
NM_018045chr192773 2756 2667 2615 2228 2164 969 444 119 22802 2281 22831 886 1388
NM_018047chr5126 ------
NM_018053chr15735 715 647 624 338 ----1229
NM_018054chr162563 39 ------
NM_018061chr121171 271 ------
NM_018064chr6131 ------
NM_018067chr13481 411 111 ------
NM_018071chr143323 280 155 3571 239 120 186 --
NM_018077chr7157 ----1139
NM_018084chr222859 1308 ------
NM_018085chr1138096 7473 7377 6995 6967 2926 2550 2512 2201 546 122 115 71 --47456 6726 5517 484 1469
NM_018092chr161353 11302 ----
NM_018096chr175979 870 769 721 324 --1792 --
NM_018110chr1641115 896 880 533 ------
NM_018117chr102535 106 1275 ----
NM_018121chr1043072 3063 2083 689 ------
NM_018125chr1--1334 1453 --
NM_018133chr342086 1835 1482 29 ------
NM_018145chr152508 113 --1540 --
NM_018150chr14853 793 762 248 1169 ----
NM_018151chr21787 ------
NM_018154chr193732 332 63 1648 3840 164 147 --
NM_018156chr1123008 2720 2658 2440 2433 2388 2331 2137 2085 1160 548 282 --22340 1204 --
NM_018159chrX----1176 --
NM_018171chr121138 1868 ----
NM_018172chr1131493 1433 1000 5587 535 483 431 379 1985 --
NM_018191chr131349 --136 --
NM_018193chr152166 78 ------
NM_018200chr1562204 1932 618 576 458 436 1498 ----
NM_018201chr982299 1895 1725 456 354 315 257 194 32397 2143 827 52250 1881 1755 872 55 --
NM_018202chr1165 --2906 696 --
NM_018203chr11841 --2674 135 2564 31
NM_018207chr1101640 1505 1432 1424 1284 1190 339 205 56 30 --11525 --
NM_018208chr1121132 1121 935 884 872 793 439 396 366 348 216 155 1171 21138 773 169
NM_018214chr6--21321 373 ----
NM_018223chr122944 212 --1135 --
NM_018227chr412587 1286 ----
NM_018234chr282157 2055 1947 1713 485 460 131 50 1503 21865 1757 22188 22
NM_018240chr14863 622 196 176 --2739 566 --
NM_018245chr101472 --2343 160 --
NM_018265chr1141924 1888 1600 1414 788 662 530 476 395 381 355 337 259 164 --1363 --
NM_018293chr321099 776 ------
NM_018299chr81330 11241 ----
NM_018315chr411257 11065 ----
NM_018320chr1141043 351 130 83 ------
NM_018325chr92628 578 183 ----
NM_018353chr142852 25 ------
NM_018361chr84857 540 245 110 11030 11017 --
NM_018362chr1123195 2760 ------
NM_018364chr151278 786 674 552 348 21315 293 ----
NM_018381chr195900 600 374 136 94 --1637 --
NM_018383chr261447 1268 766 653 193 102 2725 34 ----
NM_018403chr383664 3558 3463 3146 2654 2612 622 469 11555 1681 13952
NM_018409chr422951 109 12855 12025 --
NM_018419chr202148 80 ------
NM_018424chr961844 1803 1741 1727 1579 116 11882 11825 --
NM_018425chr1092478 2418 2174 2078 2036 1955 1658 880 463 22093 636 32001 1738 986 --
NM_018434chr5137 ------
NM_018440chr876549 5729 5596 5556 3344 132 21 47349 7158 2094 649 17000 17399
NM_018446chr3------145
NM_018462chr31152 ------
NM_018471chr21548 ------
NM_018482chr82234 66 ------
NM_018486chrX1163 --1434 --
NM_018489chr131944 71 56 ----1154
NM_018509chr1761629 1463 1320 657 535 392 ----136
NM_018527chr13298 82 ------
NM_018557chr221178 120 --11161 --
NM_018566chr134031 1025 728 --155 --
NM_018584chr11983 --1195 --
NM_018602chr1551550 655 435 105 89 ------
NM_018638chr1211338 --23837 2160 --
NM_018645chr23462 152 21 147 1375 2217 96
NM_018650chr122234 680 ------
NM_018660chr882901 2346 2268 1161 1009 834 123 30 22848 803 ----
NM_018667chr16102339 1910 1809 1021 999 779 511 166 157 55 --32224 1094 771 11996
NM_018679chr6--260 31 122 --
NM_018684chrX41128 1035 860 69 ------
NM_018689chr15122103 1901 1810 1798 1031 556 549 532 355 205 161 129 1949 1453 --
NM_018695chr51342 ------
NM_018698chrX21994 348 ------
NM_018699chr42244 223 ------
NM_018700chr521606 155 ------
NM_018703chr16181 ------
NM_018710chr8--163 ----
NM_018712chr1131135 574 237 132 ----
NM_018713chr13912 201 117 ------
NM_018715chr191991 1875 1785 1541 1524 915 810 635 574 31758 1741 1500 ----
NM_018717chr482641 2396 1118 900 745 663 512 304 --2992 717 --
NM_018718chr722138 568 1670 21740 736 --
NM_018840chr20--3308 120 95 ----
NM_018841chr173517 3408 3370 1309 1260 821 389 13387 13487 33350 1590 1240
NM_018844chr72832 351 11767 ----
NM_018896chr172195 64 ------
NM_018898chr552090 773 732 320 217 ------
NM_018899chr552090 773 732 320 217 ------
NM_018900chr552090 773 732 320 217 ------
NM_018901chr552090 773 732 320 217 ------
NM_018902chr552090 773 732 320 217 ------
NM_018903chr552090 773 732 320 217 ------
NM_018904chr552090 773 732 320 217 ------
NM_018905chr552090 773 732 320 217 ------
NM_018906chr552090 773 732 320 217 ------
NM_018907chr552090 773 732 320 217 ------
NM_018908chr552090 773 732 320 217 ------
NM_018909chr552090 773 732 320 217 ------
NM_018910chr552090 773 732 320 217 ------
NM_018911chr552090 773 732 320 217 ------
NM_018912chr541414 1168 710 135 --1656 --
NM_018913chr541414 1168 710 135 --1656 --
NM_018914chr541414 1168 710 135 --1656 --
NM_018915chr541414 1168 710 135 --1656 --
NM_018916chr541414 1168 710 135 --1656 --
NM_018917chr541414 1168 710 135 --1656 --
NM_018918chr541414 1168 710 135 --1656 --
NM_018919chr541414 1168 710 135 --1656 --
NM_018920chr541414 1168 710 135 --1656 --
NM_018921chr541414 1168 710 135 --1656 --
NM_018922chr541414 1168 710 135 --1656 --
NM_018923chr541414 1168 710 135 --1656 --
NM_018924chr541414 1168 710 135 --1656 --
NM_018925chr541414 1168 710 135 --1656 --
NM_018926chr541414 1168 710 135 --1656 --
NM_018927chr541414 1168 710 135 --1656 --
NM_018928chr541414 1168 710 135 --1656 --
NM_018929chr541414 1168 710 135 --1656 --
NM_018948chr131016 986 395 ------
NM_018951chr76917 502 279 130 100 69 ------
NM_018952chr172266 183 1148 --1568
NM_018953chr124815 703 308 150 ------
NM_018959chr194739 523 486 101 ------
NM_018963chr211286 --1177 --
NM_018970chr742094 542 305 27 ------
NM_018976chr1212117 11944 1961 --
NM_018977chrX3887 352 318 ------
NM_018979chr1242559 1976 766 385 ----1912
NM_018992chr1671484 1471 1242 1027 468 426 250 11674 ----
NM_018993chr202243 52 --11389 --
NM_018994chr11532 ------
NM_018999chr1064743 4545 4531 4328 3619 894 ------
NM_019004chr722169 2049 --11573 --
NM_019009chr11122487 2331 2305 2284 1818 963 811 679 600 566 251 179 ------
NM_019027chr42877 842 ------
NM_019036chr6185 1439 ----
NM_019041chr61513 --1864 --
NM_019042chr731131 866 51 ------
NM_019046chr104826 613 362 233 1734 ----
NM_019053chr10--21092 900 ----
NM_019057chr5244 36 1128 ----
NM_019071chr71203 ----1236
NM_019072chr5--21416 857 ----
NM_019074chr152647 267 178 2832 653 --
NM_019084chr1021006 168 --2767 243 --
NM_019087chr551738 589 382 115 36 ------
NM_019096chr63189 86 71 --11001 --
NM_019102chr71107 ------
NM_019102chr71107 ------
NM_019106chr2253409 3270 2161 1012 531 1236 ----
NM_019114chr932059 1949 104 1596 12411 --
NM_019116chr1653636 3045 2876 2294 638 177 12834 --
NM_019555chr351175 688 541 416 274 ------
NM_019556chrX11433 ------
NM_019557chr11653 139 ----
NM_019593chr2022616 1011 12634 --12083
NM_019595chr23240 214 133 ------
NM_019613chr172117 83 --1927 --
NM_019845chr2----2756 337 --
NM_019850chr25628 578 560 491 317 --174 --
NM_019854chr124732 196 161 124 --1202 --
NM_019885chr2152181 2057 1130 1011 893 715 655 634 612 487 462 398 265 243 138 1980 32307 857 664 --
NM_019903chr1041859 1507 711 231 ------
NM_020039chr1251939 1607 1198 521 393 11378 31922 623 87 --
NM_020116chr431802 470 442 ------
NM_020122chr285726 5588 5114 1946 637 629 616 572 15901 ----
NM_020123chr101398 ------
NM_020132chr21164873 3425 3397 3340 1872 1310 1238 1219 1103 1081 780 638 588 490 436 32 34883 4300 1157 33652 1575 594 --
NM_020137chrX160 ------
NM_020141chr132255 2024 233 11865 ----
NM_020144chr742084 1980 1682 1603 ------
NM_020145chr94453 433 190 60 --1423 1211
NM_020147chr15122 ------
NM_020150chr102636 226 140 --1579
NM_020151chr241593 619 510 41 ------
NM_020153chr111129 ------
NM_020178chr1731127 1116 456 --1863 --
NM_020182chr2043461 3418 2966 2930 12729 1760 --
NM_020184chr2112363 2076 2069 1961 1834 1634 1562 878 735 631 178 22094 1673 --1201
NM_020198chr1731455 192 44 ------
NM_020205chr12883 283 ------
NM_020211chr1561317 1029 991 980 500 89 ----11179
NM_020228chr1141759 885 261 65 ------
NM_020235chr3150 ------
NM_020238chr1151062 893 799 397 258 ------
NM_020239chr152156 2043 1774 1632 176 21449 193 --1264
NM_020246chr75291 258 144 107 100 162 ----
NM_020248chr182307 2129 1985 1586 1558 939 126 62 2335 26 41938 1854 718 352 21815 1484
NM_020309chr1941085 846 98 56 ------
NM_020310chr1792415 2185 1810 1755 1710 1134 911 516 344 --21855 864 21717 731
NM_020314chr164640 68 60 34 ------
NM_020336chr2053464 3049 2597 2426 699 12834 ----
NM_020337chr442898 2355 942 679 ------
NM_020338chr10143293 2922 2624 2459 2395 2368 1454 1441 1387 1305 840 562 415 235 12633 12518 1488
NM_020341chr201772 11374 11516 --
NM_020342chr212472 ------
NM_020344chr92125 53 --160 --
NM_020346chr1111557 ------
NM_020348chr1031771 1082 310 12813 --1761
NM_020383chr10------140
NM_020390chr321708 394 14413 ----
NM_020405chr17164298 4017 3730 3360 2970 2934 1638 1552 1369 1307 958 862 855 794 412 80 34468 3961 540 1100 --
NM_020416chr472585 2426 2407 2004 1017 526 388 22285 2277 1949 --
NM_020429chr752203 2153 2057 428 324 1643 --195
NM_020431chr14112746 2681 2641 2189 2058 1964 1095 762 366 306 164 12606 12122 --
NM_020432chr71270 ------
NM_020433chr2081669 1634 1569 1471 1162 696 625 343 31601 1333 96 31373 264 207 --
NM_020438chr981429 908 512 440 324 256 196 52 ------
NM_020443chr1136332 5932 4984 4815 4639 4605 4506 4263 2708 2618 1493 766 312 1670 --36227 5270 4577
NM_020444chr5163 ----11452
NM_020457chr16186 --1198 --
NM_020466chr644565 4010 3772 3148 11193 ----
NM_020474chr181685 ------
NM_020475chr882403 1821 1754 1723 1650 992 536 77 21607 404 ----
NM_020476chr882403 1821 1754 1723 1650 992 536 77 21607 404 ----
NM_020477chr882403 1821 1754 1723 1650 992 536 77 21607 404 ----
NM_020478chr872466 1884 1817 1786 1713 599 140 21670 467 ----
NM_020480chr882403 1821 1754 1723 1650 992 536 77 21607 404 ----
NM_020526chr121429 203 --11779 21692 1180
NM_020530chr223846 330 45 2928 860 ----
NM_020548chr2156 ------
NM_020630chr10186 --1549 --
NM_020640chr31539 ----12034
NM_020647chr851697 1606 224 195 25 1598 1699 --
NM_020651chr221741 486 --195 --
NM_020655chr1621376 1239 --11245 --
NM_020673chr2087520 5995 5126 1948 1447 623 400 45 ----27412 6304
NM_020676chr31140 2841 306 ----
NM_020689chr2021341 186 11214 --1576
NM_020699chr194306 3815 1874 1811 1566 1217 828 224 169 23830 748 35071 3862 296 --
NM_020702chr951352 1161 486 371 265 --21534 689 --
NM_020704chr732304 683 59 --1176 1205
NM_020708chr2082198 1890 1589 770 736 414 390 223 1835 2325 113 --
NM_020711chr262396 1970 1019 536 467 276 ------
NM_020713chr20143062 2619 2596 2554 2264 2188 1185 957 675 567 459 395 369 352 1805 43104 2439 896 787 12285
NM_020717chrX144936 4769 4519 4223 3770 3735 3519 1566 1518 1434 1101 454 393 179 24009 125 44024 1819 1782 656 --
NM_020724chr462610 2169 1953 1855 939 104 12210 22520 208 --
NM_020728chr762916 2514 2222 2185 1276 313 ------
NM_020732chr611288 ------
NM_020734chr1233211 778 460 12996 ----
NM_020739chr1534147 1063 734 ------
NM_020748chr1741863 1428 1404 296 11950 ----
NM_020750chr651114 1051 1017 924 154 --11300 --
NM_020752chr103702 281 217 ------
NM_020766chrX31162 953 232 --11577 1389
NM_020769chrX4792 753 745 197 164 1378 --
NM_020771chr6--11058 ----
NM_020772chr17136685 6449 6128 5416 2251 1963 1947 1719 1529 1265 619 550 526 ------
NM_020774chr1844763 4613 4245 3929 --11577 --
NM_020777chr4122386 2111 2020 1991 1922 1739 1696 724 643 555 318 215 21887 1563 --2859 339
NM_020792chr341893 745 487 313 ----1359
NM_020794chr131510 1050 217 ------
NM_020795chr1771999 1852 1702 1377 604 489 39 4459 450 350 192 11541 --
NM_020796chr52982 143 ------
NM_020801chr522582 1666 --11786 --
NM_020805chr181116 ------
NM_020807chr1661439 1398 1178 710 185 90 ------
NM_020808chr13760 245 221 --1294 --
NM_020809chr1131606 334 241 ------
NM_020814chr23512 434 403 11232 21251 128 --
NM_020818chr14134 ------
NM_020820chr2051505 1458 1311 631 506 2594 37 2614 201 1578
NM_020825chr1693693 3545 3513 2774 2697 1021 843 661 296 11390 31465 592 363 --
NM_020830chr223213 2653 ------
NM_020831chr224802 794 166 135 --2980 216 --
NM_020832chr11562 ----1191
NM_020834chr143688 451 315 ------
NM_020841chr1222749 1386 ------
NM_020845chr12132499 2424 2334 2202 1938 1826 1699 1013 939 833 291 159 119 --1313 --
NM_020850chr1683093 2172 1186 1098 983 876 829 60 1344 32739 2672 23 --
NM_020851chr1531535 1513 1157 11333 --1360
NM_020856chr1951514 984 545 461 125 ------
NM_020858chr1511558 11914 ----
NM_020870chr422039 222 ------
NM_020871chrX22142 1881 ------
NM_020886chr1151037 902 263 82 35 ------
NM_020888chr152014 1864 1453 305 220 --11685 --
NM_020895chr191247 --1271 --
NM_020896chr114886 273 33 24 ----1361
NM_020898chr122210 143 --1314 --
NM_020899chr1772378 400 330 274 180 87 71 2632 130 ----
NM_020918chr1073474 3177 2955 2755 957 175 108 1128 ----
NM_020920chr144389 335 319 55 163 ----
NM_020922chrX21303 676 ------
NM_020927chr1641876 868 375 285 ------
NM_020940chr1052941 2898 2324 926 378 ------
NM_020946chr991650 1564 1522 1502 1437 1420 651 510 408 11339 21475 176 --
NM_020948chr121379 1341 ------
NM_020949chr31209 ------
NM_020951chr1921661 248 ------
NM_020962chr1561938 1867 953 655 488 364 --22191 555 --
NM_020967chr2031083 804 41 --1478 --
NM_020977chr431799 804 791 11416 ----
NM_020983chr1252225 1930 1692 1598 407 22188 2051 42137 1440 566 503 --
NM_020993chr12112367 2292 2109 1876 1868 894 740 458 446 425 223 32132 803 704 ----
NM_021003chr141693 ------
NM_021005chr151395 ------
NM_021012chr17113092 2814 2529 2291 2185 1143 1046 948 667 610 241 --53040 2105 1247 628 100 --
NM_021013chr172385 72 1336 ----
NM_021020chr8163286 2909 2857 2720 2616 2583 2546 2462 2410 2289 678 482 224 214 190 110 52981 2772 941 731 391 1793 32785 446 410
NM_021033chr1342597 2383 1278 1215 11177 --123
NM_021064chr641379 1186 587 445 ------
NM_021078chr175493 431 215 181 24 --177 --
NM_021079chr17132878 2527 2425 2198 2124 1281 1056 995 950 757 650 206 102 22114 899 --12936
NM_021083chrX43627 3446 845 578 --22282 423 1681
NM_021088chr241496 828 112 98 11985 ----
NM_021096chr22103082 2812 2047 1127 1081 985 972 611 458 417 22520 1060 31170 786 381 1511
NM_021104chr12------1208
NM_021106chr92682 238 1117 2531 255 --
NM_021109chrX1306 ------
NM_021109chrX1306 ------
NM_021116chr7278418 8108 7810 7798 7236 6968 5817 3382 3345 3239 3078 2710 2600 2348 2323 2312 2107 2072 1962 1596 1402 1352 720 530 439 411 22 68290 3167 2822 1529 1260 244 32534 1873 487 --
NM_021120chrX153134 3100 3071 2933 2911 2255 1224 1207 1154 1120 1104 870 451 413 152 1358 12235 --
NM_021132chr10--1147 1167 11268
NM_021133chr13270 134 53 ------
NM_021136chr14--1708 ----
NM_021137chr1791997 1647 906 550 312 263 208 178 127 --32306 729 380 --
NM_021140chrX--1365 ----
NM_021148chr711941 ------
NM_021155chr1983022 2742 2529 2464 1078 304 149 67 22556 181 12869 --
NM_021159chr421642 1212 ------
NM_021161chr142476 162 ------
NM_021163chr71420 --13412 --
NM_021165chr11743 ----1668
NM_021174chr83499 278 266 --1651 --
NM_021183chrX12376 --1109 --
NM_021188chr142442 144 ------
NM_021189chr121008 38 3926 805 352 2865 311 --
NM_021190chr11150 ------
NM_021192chr22362 85 ------
NM_021198chr26933 501 403 346 323 254 --11306 2541 367
NM_021213chr1741283 1094 852 244 3108 70 45 ----
NM_021229chr1211199 ------
NM_021237chr31125 ------
NM_021238chr1211575 1821 ----
NM_021239chr1451210 1160 194 170 157 ------
NM_021240chr91196 ------
NM_021242chrX4299 276 225 84 ------
NM_021245chr102239 40 ------
NM_021248chr204620 574 490 116 --1257 --
NM_021249chr1421597 463 21274 674 ----
NM_021253chr641400 129 105 69 --1905 --
NM_021255chr1433527 489 283 ------
NM_021259chr16131034 960 797 790 733 468 452 402 364 356 307 245 28 --1966 2917 84
NM_021260chr1451359 1342 1289 528 481 ----21319 463
NM_021267chr1981276 1146 1014 386 321 251 124 68 ------
NM_021569chr971142 1007 999 822 427 373 224 ------
NM_021619chr961044 516 503 413 248 38 --1164 --
NM_021622chr1022063 539 ----1688
NM_021627chr321066 159 ------
NM_021631chr8123 ------
NM_021637chrX2943 209 ------
NM_021638chr4155014 4964 4226 4200 4055 3381 3035 1514 1240 879 813 493 455 132 81 --13446 23590 336
NM_021639chr12601 350 ------
NM_021643chr261876 1864 1621 1498 611 362 11818 ----
NM_021647chr454033 2962 1766 1316 1153 11745 ----
NM_021648chr652426 1943 557 428 190 ------
NM_021705chr621322 425 11514 --11175
NM_021728chr142892 387 2985 795 ----
NM_021738chr102737 699 1640 ----
NM_021783chrX52424 2221 602 35 27 154 ----
NM_021784chr20133 ------
NM_021813chr6135144 5124 4842 4668 4394 2319 2223 1903 1755 1492 1457 1310 491 --21843 1761 --
NM_021818chr1421040 79 ------
NM_021872chr2091101 894 793 718 433 409 325 188 132 21057 205 11125 --
NM_021873chr2091101 894 793 718 433 409 325 188 132 21057 205 11125 --
NM_021905chr671697 1569 919 557 123 116 54 2237 229 ----
NM_021911chr525486 2004 ------
NM_021912chr1573731 3597 3126 3020 2650 562 362 ----13828
NM_021913chr1931816 733 112 --1526 --
NM_021914chr143867 715 345 21879 878 1454 --
NM_021940chr621576 1255 ------
NM_021942chr4--1872 ----
NM_021943chr621778 142 --31836 764 491 --
NM_021946chrX51245 1238 1085 591 574 1301 31429 1105 353 1344
NM_021954chr1363301 1370 1310 404 363 305 23667 2973 1429 12989
NM_021959chr64764 307 240 173 --1286 --
NM_021960chr132676 2111 1095 11782 ----
NM_021961chr1175908 5902 5292 2910 2803 2402 324 --22903 120 --
NM_021962chr1771843 658 551 542 523 454 432 --21735 563 --
NM_021963chrX267 21 ------
NM_021964chr346478 4944 2589 1652 11597 ----
NM_021965chr931195 542 407 ------
NM_021967chr551250 997 911 309 277 --21256 1189 --
NM_021973chr4199 ------
NM_021988chr2041310 1000 592 519 --11211 --
NM_021991chr171663 --3582 228 181 --
NM_022003chr1141136 1070 934 217 129 1838 --
NM_022039chr105475 420 161 109 25 1389 ----
NM_022041chr1632620 2095 2077 ------
NM_022048chr1575875 4492 2374 2085 1927 350 207 26347 4845 31219 567 31 --
NM_022049chr141161 524 402 51 ------
NM_022051chr11274 ------
NM_022060chr1451342 957 919 344 204 --21372 913 1497
NM_022062chr1161505 1496 1311 772 608 354 31243 679 210 --11225
NM_022066chr174739 423 389 348 ------
NM_022073chr142606 26 11534 ----
NM_022075chr11667 --187 --
NM_022080chr2032781 1945 999 --12792 --
NM_022114chr144510 3763 3706 311 13083 84082 3489 3325 1834 1110 1052 1041 777 13472
NM_022123chr141428 ------
NM_022130chr511009 1539 ----
NM_022133chr821162 627 ------
NM_022138chr611320 2584 229 ----
NM_022152chr241112 785 154 31 1471 --1136
NM_022157chr1125 ------
NM_022166chr16194746 4575 4299 2368 2353 1872 1715 1542 1430 1395 701 678 623 612 568 510 453 121 90 44526 4123 1377 1286 44887 4158 1855 406 --
NM_022169chr1181365 1299 989 556 386 124 100 30 21118 512 41321 1165 455 172 --
NM_022336chr232014 1877 1727 ----159
NM_022343chr931172 981 134 21019 334 --1870
NM_022346chr421412 1197 ------
NM_022442chr2041310 1000 592 519 --11211 --
NM_022455chr5--1298 ----
NM_022458chr732045 1947 422 32327 2137 1967 32268 2250 2072 --
NM_022459chr1324403 1427 --22081 1660 16158
NM_022462chr19203800 3759 3612 3371 3077 2866 2736 2672 2611 2551 2491 2459 1483 1385 1327 915 618 229 215 189 23681 3231 3973 637 554 --
NM_022465chr1272307 2057 1176 1170 532 510 42 1852 --12464
NM_022473chr1574299 4141 3139 1649 954 614 236 --13829 --
NM_022474chr1442381 2352 1104 272 ------
NM_022476chr16146 ------
NM_022479chr771354 1318 1308 1234 981 916 233 1210 21137 77 --
NM_022491chr1252647 1400 1089 1047 999 11064 --1118
NM_022494chr10191 ------
NM_022497chr3112960 2935 2883 793 774 744 475 380 338 205 87 3393 109 100 11431 1809
NM_022552chr22995 174 ------
NM_022557chr172218 182 ------
NM_022572chr281523 1312 1301 1172 664 507 500 310 --11129 1381
NM_022574chr7122106 2062 2034 1632 869 836 787 759 701 645 467 24 --11456 --
NM_022640chr172216 181 ------
NM_022648chr2194545 3864 3551 3416 3399 3358 2937 1739 1333 1213 1174 1164 1069 874 804 775 384 349 234 44565 3690 3491 1092 41841 1835 1402 885 23840 1039
NM_022650chr5----1248 --
NM_022652chr123444 341 234 ------
NM_022658chr1241328 1321 1123 379 1304 1155 --
NM_022659chr82173 122 ------
NM_022716chr132084 205 65 --11263 --
NM_022719chr22123683 3463 3293 3114 3106 2485 1408 1338 575 486 308 199 53749 3622 3024 1106 517 32904 741 314 12516
NM_022726chr621199 221 ------
NM_022730chr25965 926 840 761 726 ------
NM_022733chr131171 1036 237 --1854 --
NM_022735chr11219 11608 ----
NM_022742chr73292 129 62 ------
NM_022744chr1671149 1118 1027 953 898 529 432 ------
NM_022748chr762777 2256 922 664 336 144 11094 22599 1861 148
NM_022749chr861240 1078 552 427 222 89 1562 1940 --
NM_022750chr72501 36 --2591 508 --
NM_022755chr952237 1912 989 964 906 1176 21613 254 --
NM_022756chr131229 354 41 ------
NM_022758chr673099 2622 2133 2107 742 541 107 32370 2066 79 1912 --
NM_022763chr332845 2742 2711 11201 ----
NM_022780chr22596 383 ------
NM_022781chr932611 1273 262 ------
NM_022784chr151815 1146 ----
NM_022822chr114815 667 578 62 --1556 1167
NM_022824chr52680 485 1787 ----
NM_022831chr12197 65 1303 1584 --
NM_022833chr981363 1297 1254 1112 1075 448 96 85 1346 21356 71 --
NM_022836chr121248 574 ------
NM_022841chr1512629 ------
NM_022842chr373163 2747 2547 2382 2325 2078 455 52707 2672 2200 1227 127 22992 959 1312
NM_022843chr1311131 ------
NM_022845chr1621838 705 ------
NM_022893chr232978 967 662 ----32095 1059 733
NM_022894chr21339 ------
NM_022897chr52812 264 1396 ----
NM_022898chr1464613 4445 3004 1604 837 543 11827 1904 --
NM_022912chr222715 439 1843 ----
NM_022918chr1141687 1470 1428 1395 ------
NM_022978chr551250 997 911 309 277 --21256 1189 --
NM_023010chrX127 ------
NM_023011chr131327 1620 ----
NM_023018chr151394 1103 463 235 54 1261 11111 --
NM_023034chr81222 ------
NM_023035chr192711 199 1136 ----
NM_023067chr341332 1151 245 108 1121 --21057 826
NM_023076chr1682686 2498 2422 2276 2188 770 337 38 --12513 --
NM_023079chr1761743 1428 1401 1243 1234 188 11451 ----
NM_023105chr862359 1691 730 622 414 400 --32296 966 596 --
NM_023106chr862359 1691 730 622 414 400 --32296 966 596 --
NM_023110chr862359 1691 730 622 414 400 --32296 966 596 --
NM_023111chr862359 1691 730 622 414 400 --32296 966 596 --
NM_023929chr812769 ------
NM_024007chr5----12964 --
NM_024016chr172578 269 --193 --
NM_024019chr42282 199 ----1102
NM_024043chr16121354 1345 1288 1189 1144 934 424 299 248 218 167 133 --2949 378 --
NM_024046chr351227 837 438 407 365 --11261 --
NM_024052chr1772864 971 717 696 651 605 474 12034 1368 --
NM_024085chr26862 812 741 241 99 52 --1841 --
NM_024087chrX----1619 --
NM_024090chr421867 702 ----11405
NM_024107chr175865 742 341 298 62 ------
NM_024117chr941046 1000 111 83 ------
NM_024119chr171136 --1127 --
NM_024294chr673099 2622 2133 2107 742 541 107 32370 2066 79 1912 --
NM_024306chr167742 485 221 181 154 123 23 1240 141 --
NM_024312chr1221447 209 ------
NM_024328chr144223 167 57 35 --1516 --
NM_024332chrX11220 11303 --11458
NM_024336chr16175 ------
NM_024345chr975343 5126 4916 4844 2063 1296 113 ------
NM_024348chr91255 ------
NM_024408chr133423 387 342 4717 606 446 98 1251 1406
NM_024423chr1843789 1505 1369 152 14108 ----
NM_024424chr111188 ----1218
NM_024425chr111188 ----1218
NM_024426chr111188 ----1218
NM_024429chr73971 262 50 ------
NM_024490chr152573 555 ------
NM_024494chr1195 --2173 155 1231
NM_024511chr423381 816 --1218 --
NM_024519chr162266 23 ------
NM_024522chr171914 1748 1653 1293 697 451 88 --41434 416 286 36 --
NM_024523chr72455 330 123 2206 63 --
NM_024524chr312729 13053 ----
NM_024529chr111114 1416 ----
NM_024536chr24303 296 154 138 --1310 1162
NM_024541chr1061851 1690 1266 1172 645 379 11458 ----
NM_024546chr1321122 35 ------
NM_024551chr12102348 2074 2043 1627 1592 953 285 273 240 142 1691 --11029
NM_024551chr12102348 2074 2043 1627 1592 953 285 273 240 142 1691 --11029
NM_024554chr141520 1130 545 439 1136 --11095
NM_024556chr111324 ------
NM_024565chr52521 471 ----31373 114 32
NM_024581chr6124 ------
NM_024586chr11213 1609 ----
NM_024590chr461577 1537 1246 480 267 175 ------
NM_024595chr111061 31181 836 801 ----
NM_024607chr8104379 4211 4192 3958 3793 3501 2919 1576 1036 52 --14011 --
NM_024611chr1563105 2667 2601 2469 814 124 1873 11033 --
NM_024612chr1711002 ------
NM_024617chr93868 668 587 1842 ----
NM_024624chr2121 ------
NM_024626chr131501 1080 406 31592 1585 420 1582 --
NM_024628chr331099 804 187 ------
NM_024631chr111676 ------
NM_024645chr821193 1158 1993 ----
NM_024652chr153809 280 181 1190 ----
NM_024665chr364260 3909 3803 1321 744 346 ----14551
NM_024674chr163224 2517 2333 973 636 193 1623 ----
NM_024676chr131230 948 259 --11020 --
NM_024692chr231373 1262 595 ------
NM_024698chr1181297 1032 946 880 516 507 384 304 11330 31160 483 270 1953
NM_024704chr202204 186 ------
NM_024705chr133231 201 78 1912 ----
NM_024721chr822020 649 12334 12099 --
NM_024740chr1153760 3697 2958 387 349 12540 23890 135 1591
NM_024742chr16111706 1292 1211 738 730 710 587 535 145 88 74 11937 21587 1332 1486
NM_024744chr22826 33 1313 ----
NM_024755chr153792 691 335 ------
NM_024757chr931119 448 372 1125 ----
NM_024761chr983993 3877 3312 550 512 79 53 46 25042 452 11678 11904
NM_024766chr21438 ------
NM_024779chr1251420 1297 1106 483 283 21031 397 ----
NM_024785chr241146 586 507 102 21075 193 1259 --
NM_024786chr52242 71 1157 ----
NM_024787chr83366 277 254 1930 ----
NM_024792chr1721018 207 --2285 78 --
NM_024798chr1562405 2026 2016 1790 1182 1171 22911 2055 22156 1996 --
NM_024811chr1141586 1346 444 277 ------
NM_024816chr16130 --2388 75 --
NM_024817chr15165933 5636 5003 4160 3704 2251 2207 1881 1589 1357 1146 1132 449 369 307 96 45251 1191 402 240 ----
NM_024828chr9------11295
NM_024830chr542077 734 418 77 --22122 310 --
NM_024850chr51732 1321 ----
NM_024854chr1211315 ------
NM_024855chr202135 27 --142 --
NM_024874chr151268 422 305 135 112 11237 ----
NM_024884chr1464473 4192 4183 3203 1669 1221 --24065 3582 --
NM_024885chrX1305 133 ----
NM_024887chr151790 1782 1601 529 30 21616 430 1779 --
NM_024896chr92765 626 11670 ----
NM_024899chr181511 1211 ----
NM_024909chr661533 1326 1056 530 214 120 11298 1570 --
NM_024911chr12331 227 ------
NM_024915chr862199 1967 1828 1115 1087 573 21134 269 1516 --
NM_024927chr17157 ------
NM_024933chr23629 590 74 ------
NM_024944chr2121275 1244 ------
NM_024948chr102693 526 ------
NM_024949chr454730 4501 3115 1280 881 14252 ----
NM_024953chr121700 --11920 --
NM_024954chr101203 1428 1575 --
NM_024963chr7295461 5268 4502 4494 4275 3741 3600 2389 2306 2227 2075 1985 1828 1668 1592 1564 1494 1457 1377 783 761 595 381 321 313 272 178 133 74 15739 44679 3908 1708 1516 --
NM_024969chr22734 67 ------
NM_024989chr257857 6801 6781 6306 772 25544 3190 11560 16264
NM_024991chr1082672 2595 2207 1089 962 787 741 634 1439 --1751
NM_025004chr111270 ------
NM_025054chr854024 2920 2830 718 194 ------
NM_025058chr16695 663 609 120 83 39 1192 146 --
NM_025074chr442700 2665 1094 542 ------
NM_025076chr21193 ------
NM_025080chr112774 280 11071 ----
NM_025083chr1551786 1740 1322 1258 361 --11402 --
NM_025099chr174990 383 354 251 --2168 62 --
NM_025106chr1111866 1823 1752 1320 751 722 684 582 405 341 123 190 --11228
NM_025109chr17148 ------
NM_025133chr22871 26 ------
NM_025134chr1612376 ------
NM_025138chr131427 1121 1409 --
NM_025146chr31315 ------
NM_025151chr821827 75 ------
NM_025158chr52499 471 ------
NM_025160chr11531 ----13903
NM_025179chr1194493 4318 4148 4006 3927 3778 1987 1919 1882 1860 1592 1574 1134 1020 983 745 413 126 23 11640 --13117
NM_025181chr23751 635 61 ------
NM_025182chr93960 776 214 --2378 314 --
NM_025187chr1651167 857 386 254 154 21304 263 ----
NM_025191chr111365 21046 315 ----
NM_025208chr1132189 1537 144 ------
NM_025221chr411337 ------
NM_025222chr362581 2043 1197 802 773 253 --1400 --
NM_025224chr20112090 2011 1768 1531 805 796 688 570 552 392 153 1851 51801 1628 771 656 194 --
NM_025230chr145611 603 491 222 131 --2427 286 1151
NM_025237chr1741056 259 147 43 --2479 324 --
NM_025248chr17163272 2984 2821 2167 2133 1303 1221 1212 1197 1147 738 732 713 599 121 107 1470 31265 1138 833 1540
NM_025251chr861113 371 323 210 133 32 --2418 360 2300 106
NM_030576chr1782662 2016 2003 1913 1884 842 275 145 22079 2044 12461 --
NM_030621chr1463464 3291 2974 2689 2606 442 13371 ----
NM_030627chr5----12767 --
NM_030629chr1641750 483 446 95 1764 2103 82 --
NM_030630chr176789 746 688 555 222 125 1600 2739 47 --
NM_030645chr171419 523 511 245 124 81 21 1482 21171 164 --
NM_030647chr744898 4874 4765 2484 --25776 3976 --
NM_030648chr475203 4332 2122 1662 1304 649 196 11954 12162 24980 4728
NM_030650chr222865 2844 ------
NM_030651chr67797 720 687 659 639 156 86 ------
NM_030661chr721388 267 11556 11099 --
NM_030664chr1032361 2124 979 1875 ----
NM_030665chr1711138 1366 2447 348 --
NM_030674chr12105865 5540 4642 4326 2226 792 708 662 593 584 13648 ----
NM_030758chr2211467 1168 1484 --
NM_030761chr1112591 2315 2098 2035 1924 1788 1749 1088 684 513 475 2746 429 --12623
NM_030762chr121500 --11974 --
NM_030763chrX1878 ------
NM_030766chr1221010 425 --1277 --
NM_030795chr8----1392 --
NM_030796chr772088 2023 1605 1554 1511 823 48 32072 1802 860 --1654
NM_030799chr532087 752 480 ------
NM_030802chr171296 --2144 45 --
NM_030806chr1199178 8881 8870 8235 7992 7951 7940 7627 7501 6688 6571 6314 3585 2252 1174 1053 819 530 474 48030 7439 5924 597 38339 7262 5791 --
NM_030808chr1721046 157 ------
NM_030816chr123153 2512 1376 ----
NM_030881chr2231945 1754 493 ------
NM_030884chr382192 1727 1609 691 629 327 215 185 31625 1518 544 32015 1686 1615 1927
NM_030911chr1331531 593 66 11068 ----
NM_030913chr1----2519 485 --
NM_030914chr95621 287 115 69 63 1736 1973 --
NM_030918chr184378 4256 4195 2053 1738 1665 495 88 2988 59 44004 1608 470 256 --
NM_030935chr72171 44 ------
NM_030937chr141188 267 162 41 ------
NM_030945chr51248 11885 11845 --
NM_030949chr641397 1355 1147 1137 --147 --
NM_030952chr13495 205 137 21037 1025 ----
NM_030957chr192524 53 --2587 153 --
NM_030962chr112533 498 ------
NM_030964chr593471 3130 2968 2849 2546 2319 1351 220 28 2907 480 32925 2689 794 --
NM_030981chr1191141 1111 1098 1071 980 900 369 162 90 2857 56 3474 408 123 --
NM_031157chr121489 ------
NM_031205chr122388 361 ------
NM_031212chr103300 246 49 170 ----
NM_031226chr15--21198 27 ----
NM_031231chr202549 511 2105 52 ----
NM_031232chr202549 511 2105 52 ----
NM_031262chr92358 27 ------
NM_031263chr92415 84 ------
NM_031266chr51476 ------
NM_031268chr16175209 3647 2141 1981 1872 1788 1691 1522 1388 1322 1312 1003 843 755 480 395 373 22122 1437 31833 1716 603 2879 455
NM_031272chr17129 --149 --
NM_031283chr21256 1104 ----
NM_031286chr12388 329 ------
NM_031309chr872022 1885 1849 895 764 686 161 1361 ----
NM_031314chr141683 21644 1473 ----
NM_031371chr141599 1306 1043 545 ------
NM_031371chr141599 1306 1043 545 ------
NM_031372chr451422 1255 1153 542 311 1652 ----
NM_031411chr552090 773 732 320 217 ------
NM_031417chr1992793 2694 2499 1756 507 429 271 44 32 22331 490 2622 225 --
NM_031418chr1152594 1034 976 709 147 --1474 --
NM_031419chr32435 54 ------
NM_031424chr205557 483 434 383 363 160 ----
NM_031427chr1435862 5531 1979 12098 21665 1409 --
NM_031439chr8154 ----11511
NM_031442chrX33085 706 599 ------
NM_031443chr73403 296 92 1313 ----
NM_031444chr2282177 1778 1760 1685 1679 675 609 251 1472 3740 625 73 --
NM_031445chr262854 2795 2527 786 412 82 1579 13173 --
NM_031453chr101162 184 11958 --
NM_031461chr832012 763 612 ------
NM_031463chr1632231 1788 38 ------
NM_031468chr7167495 7452 7439 6556 6373 6335 5956 5220 3179 3053 2844 2773 2712 1931 501 184 56255 6190 3143 1869 1072 32937 2078 573 --
NM_031469chr663265 3182 1504 1471 1344 47 ------
NM_031477chr162303 281 ----188
NM_031483chr2042868 950 776 250 21401 550 12257 --
NM_031492chr11------1407
NM_031844chr164080 3652 3434 2709 1625 1404 13549 12687 --
NM_031845chr252812 2719 338 248 65 12917 ----
NM_031847chr252812 2719 338 248 65 12917 ----
NM_031849chr552090 773 732 320 217 ------
NM_031857chr552090 773 732 320 217 ------
NM_031860chr552090 773 732 320 217 ------
NM_031866chr1021054 325 1432 ----
NM_031889chr441863 1365 410 179 ------
NM_031890chr2272935 2800 1162 635 551 400 147 22471 1047 12210 1332
NM_031891chr18--1141 1349 1356
NM_031911chr421756 285 ------
NM_031935chr11143 ------
NM_031936chr12695 139 ----1184
NM_031948chr16137 ------
NM_032012chr9115130 4740 4686 3930 3656 3561 921 602 395 280 129 ----14733
NM_032017chr161958 1904 1416 1330 1308 80 1292 ----
NM_032041chr852128 2046 783 476 343 12176 12293 --
NM_032042chr531044 302 269 22433 981 133 --
NM_032052chr225968 252 245 230 146 ------
NM_032088chr541414 1168 710 135 --1656 --
NM_032092chr541414 1168 710 135 --1656 --
NM_032102chr113767 696 681 185 ----
NM_032108chr19--1958 124 --
NM_032109chr561179 1160 1151 350 309 91 ------
NM_032121chrX32458 866 388 ------
NM_032124chr1831095 1089 179 ------
NM_032128chr41835 ------
NM_032144chr231836 620 505 ------
NM_032147chr1221034 793 1645 ----
NM_032174chr121066 479 --1967 --
NM_032181chr22331 91 ------
NM_032182chr1021434 386 ------
NM_032186chr11354 ------
NM_032189chr13174546 4271 3850 3780 3759 3737 3662 1726 1690 1030 928 639 535 151 102 81 46 13711 44232 3655 1713 1166 13873
NM_032192chr172690 555 ------
NM_032195chr212207 150 ------
NM_032199chr1033637 1257 269 --13426 --
NM_032205chr8133 ------
NM_032208chr241203 1066 514 426 23645 412 121 --
NM_032213chr23845 202 115 21010 313 ----
NM_032221chr2031327 821 619 11355 ----
NM_032233chr144856 847 741 299 --1774 --
NM_032236chr12953 421 ------
NM_032242chr3143030 2947 2713 2284 2277 2193 2121 2088 1085 1061 765 710 664 615 22167 888 53049 2651 2631 981 849 --
NM_032256chr121313 ----1895
NM_032268chr1663234 2251 2095 706 665 77 22718 2279 12312 --
NM_032271chr1661505 1345 1119 414 338 206 11056 21177 123 2992 44
NM_032281chr1972889 2675 2358 2157 1230 512 163 22816 1211 11179 --
NM_032283chr181717 1594 1383 1154 670 479 362 301 21621 251 41773 1751 1337 201 1414
NM_032288chr361608 1465 807 404 376 175 2919 567 --1692
NM_032294chr1771551 1448 1322 1181 614 464 246 21713 711 --11277
NM_032316chr372448 2250 2165 1547 1537 199 184 12080 --12148
NM_032325chr1161795 1644 788 158 79 45 --1359 --
NM_032329chr2154011 3921 3899 3671 3266 3236 3194 3178 3100 3063 2891 1524 1385 1058 737 22770 565 23937 1468 --
NM_032339chr174120 64 48 28 ------
NM_032345chr122134 52 ------
NM_032353chr171124 1177 1427 --
NM_032369chr122156 80 1631 ----
NM_032389chr114949 868 259 80 2806 429 1413 --
NM_032403chr541414 1168 710 135 --1656 --
NM_032413chr15------1140
NM_032420chr54815 745 729 103 2657 564 ----
NM_032430chr192367 123 ------
NM_032431chr116986 930 905 241 118 62 ------
NM_032432chr4156 --2330 95 11018
NM_032433chr19--1329 --11215
NM_032434chr23505 324 282 11177 ----
NM_032435chr132364 585 565 1192 ----
NM_032440chr1012689 ------
NM_032452chr1461431 1366 1250 1232 1204 84 1407 ----
NM_032458chrX32966 1155 648 ------
NM_032466chr831633 1320 1083 11560 ----
NM_032468chr831633 1320 1083 11560 ----
NM_032482chr1992723 2700 2642 2039 1951 1894 815 782 576 198 22217 565 --
NM_032499chr1531640 95 81 ------
NM_032505chr322716 227 ------
NM_032508chrX31335 1313 132 ------
NM_032509chr822236 728 11866 12418 --
NM_032511chr6246 29 ------
NM_032514chr206362 319 170 159 69 53 ------
NM_032523chr22494 425 ------
NM_032536chr91472 --1190 --
NM_032538chr6112404 2164 2055 1962 1861 1737 965 836 758 430 241 32808 668 576 22643 1976 --
NM_032539chrX1770 ------
NM_032550chr104418 370 158 45 ------
NM_032552chr931461 1378 679 --2557 366 21414 86
NM_032557chr41768 ------
NM_032560chr14--1304 ----
NM_032562chr10122 1307 ----
NM_032564chr1131001 196 58 127 1737 --
NM_032575chr16141744 1700 1630 1605 1513 1505 1493 1401 1306 1278 734 626 317 216 1500 31476 827 488 --
NM_032580chr173567 392 181 ------
NM_032581chr751664 489 216 106 74 11579 --1613
NM_032582chr173730 697 120 1370 ----
NM_032595chr1721078 428 1348 31393 615 568 --
NM_032631chr191122 ------
NM_032638chr341301 1071 622 487 1128 1442 1595
NM_032682chr393489 2963 2874 2578 2408 1282 1207 903 342 --11199 11160
NM_032687chr83228 68 34 ------
NM_032701chr195562 444 169 122 88 2130 81 ----
NM_032711chr17214192 3990 3942 3930 3895 3815 3617 3610 3262 3157 2802 2762 1618 1604 1530 1494 1376 662 516 485 66 33682 3327 2837 54174 3629 3402 1536 1430 13534
NM_032727chr1021270 620 --11504 1196
NM_032731chr1731485 950 34 ------
NM_032741chr65905 821 794 725 71 ------
NM_032765chr51386 ------
NM_032777chr841354 1283 1214 167 11344 1606 --
NM_032780chr116959 897 458 422 254 128 21004 38 ----
NM_032781chr115798 681 335 68 27 --181 --
NM_032784chr61110 1757 ----
NM_032786chr122140 24 --1501 --
NM_032788chr221434 643 --11091 --
NM_032800chr172523 2515 2241 978 750 632 531 ------
NM_032804chr1022102 208 12535 1129 --
NM_032808chr155933 885 839 828 767 1746 ----
NM_032829chr1231031 903 334 --11022 11040
NM_032832chr6122 ------
NM_032833chr131994 1684 185 22227 830 ----
NM_032836chr1931068 120 22 2266 43 ----
NM_032837chr1712033 ------
NM_032846chr1431492 1284 1240 134 ----
NM_032859chr13----1625 --
NM_032866chr1552162 1064 674 607 582 23183 2214 ----
NM_032873chr1154468 1668 603 496 289 1204 ----
NM_032875chr172612 22 ------
NM_032876chr1451688 827 386 362 117 1746 --1476
NM_032884chr1155 137 ----
NM_032900chr1093691 2968 2652 2603 1549 1529 1382 859 212 12516 --1962
NM_032927chr42236 53 -----