TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4687-5p
miRNA Sequence: CAGCCCUCCUCCCGCACCCAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5169 ------
NM_000038chr511667 --1127 --
NM_000051chr1132737 1157 1108 ------
NM_000061chrX1400 ------
NM_000080chr171199 1768 1822 --
NM_000084chrX76776 6296 6238 5571 5553 2316 442 36897 1948 1563 15607 --
NM_000138chr1512497 --1665 --
NM_000161chr141174 ------
NM_000192chr1221529 1175 ------
NM_000217chr1264735 3512 2006 1844 1737 1248 ------
NM_000245chr721730 559 11707 1335 --
NM_000248chr312164 12513 22230 1859 --
NM_000262chr2241570 1239 461 429 ------
NM_000314chr1032220 468 167 --22978 2302 --
NM_000330chrX1503 2845 92 11433 --
NM_000332chr686752 5256 2210 422 377 314 270 237 ------
NM_000353chr162912 123 ------
NM_000399chr102300 121 --1274 --
NM_000406chr421929 1051 12051 ----
NM_000428chr1422584 809 --12057 --
NM_000430chr1743381 1047 414 222 ------
NM_000462chr1511863 1325 ----
NM_000489chrX1763 12954 --1564
NM_000555chrX36200 2828 2036 187 27680 354 --
NM_000599chr264023 3589 3540 3523 1799 165 --33662 1605 1589 --
NM_000609chr1072590 2528 1050 541 477 300 117 1551 ----
NM_000610chr112862 652 1364 ----
NM_000633chr1811407 --2534 511 --
NM_000721chr132145 938 625 ----1259
NM_000782chr202327 87 ------
NM_000793chr1434414 4036 3530 --14164 1651
NM_000831chr195381 4984 4777 3830 1933 1690 1349 531 334 35084 4205 1532 34683 1985 35 11860
NM_000868chrX1177 ------
NM_000875chr1555585 5260 2135 2050 1568 --15111 --
NM_000901chr421930 363 ------
NM_000935chr3------11002
NM_000945chr21761 --11935 --
NM_001001323chr121471 ------
NM_001001389chr112862 652 1364 ----
NM_001001390chr112862 652 1364 ----
NM_001001391chr112862 652 1364 ----
NM_001001392chr112908 698 1410 ----
NM_001001438chr211276 ------
NM_001001502chr52210 71 ------
NM_001001668chr1913638 13831 ----
NM_001001701chr452090 2002 939 355 266 11513 ----
NM_001001890chr2131043 257 130 --11147 --
NM_001001995chrX21801 1269 11285 ----
NM_001002269chr91415 ------
NM_001002295chr101996 --1892 --
NM_001002862chr2262238 1682 1508 636 353 263 12066 --11757
NM_001003406chr2283006 2151 1153 849 782 498 424 364 1934 12630 --
NM_001003681chr22--11598 3567 311 304 --
NM_001003794chr322332 320 11069 1945 --
NM_001003800chr973049 3038 2927 1102 930 892 111 ----13088
NM_001003940chr1593450 2918 2729 926 495 482 442 269 206 23664 1452 23480 639 --
NM_001003942chr1593450 2918 2729 926 495 482 442 269 206 23664 1452 23480 639 --
NM_001003943chr1593454 2922 2733 930 499 486 446 273 210 23668 1456 23484 643 --
NM_001004304chr1243267 2625 2146 652 ----12972
NM_001004346chr42278 246 ------
NM_001004360chr21226 ------
NM_001004720chr21885 ------
NM_001004722chr211054 ------
NM_001005209chr23548 469 243 --1116 --
NM_001005366chr121102 --1956 --
NM_001005367chr195406 318 158 143 125 ------
NM_001005463chr1022381 484 --1568 --
NM_001005609chrX32693 1004 220 --33642 589 403 --
NM_001005861chr32220 47 ------
NM_001006115chr382280 1830 1781 890 882 610 519 178 2569 101 2454 430 --
NM_001006665chr12785 149 ------
NM_001007023chr1434414 4036 3530 --14164 1651
NM_001007097chr944207 3322 1180 32 1795 1519 --
NM_001007156chr1531649 1485 189 --11361 --
NM_001007246chr2131924 1778 1284 ------
NM_001007466chr654592 3800 3769 3175 241 ----1833
NM_001007553chr131100 482 64 ------
NM_001007794chr11214 ------
NM_001008220chr593559 3520 2929 2558 1226 774 541 252 136 --12502 --
NM_001008701chr19122613 2533 2430 2260 2041 1946 856 197 184 168 60 23 --22450 356 --
NM_001009554chr454764 4178 1813 583 43 ------
NM_001009554chr454764 4178 1813 583 43 ------
NM_001009571chr711137 11462 ----
NM_001009899chr355029 4880 4458 2311 1319 14166 ----
NM_001009993chr284207 3849 3682 2967 1530 1398 1364 1328 --23840 1652 --
NM_001010888chrX33981 1047 505 ------
NM_001010917chr10122087 1939 1620 1457 1451 1418 706 691 352 243 135 45 --31979 1649 224 --
NM_001010935chr111043 ------
NM_001011551chrX1167 ------
NM_001011666chr746112 4186 2013 1078 1989 ----
NM_001012393chr1154423 1618 519 203 188 1657 ----
NM_001012398chr161155 ------
NM_001012426chr673260 3055 2960 2884 1213 366 24 --42156 1358 703 235 --
NM_001012427chr673260 3055 2960 2884 1213 366 24 --42156 1358 703 235 --
NM_001013399chr6----1413 --
NM_001013629chr1032130 1463 531 181 --190
NM_001013690chr1272386 2341 2087 1959 1822 633 96 --11554 1647
NM_001013693chr1102583 1847 1170 1162 946 821 758 541 132 83 --42705 2671 2230 792 --
NM_001013693chr1102583 1847 1170 1162 946 821 758 541 132 83 --42705 2671 2230 792 --
NM_001014797chr1088195 5693 3161 2923 2870 2493 1133 1033 25332 3239 35194 2745 880 --
NM_001015877chrX32647 1034 90 1768 ----
NM_001015887chr331206 505 63 --1467 --
NM_001017368chr172108 64 ------
NM_001017440chr7107303 6656 6418 6303 6223 5535 2117 1719 467 202 --1485 12386
NM_001017923chr1421622 60 ------
NM_001017969chr9----1233 --
NM_001017970chr142866 406 --1165 --
NM_001017995chr594288 4052 3990 3884 3861 1339 1134 742 25 --23003 1353 --
NM_001018050chr2272681 2119 1147 1072 1000 806 702 ----1487
NM_001018052chr2272681 2119 1147 1072 1000 806 702 ----1487
NM_001018057chr1111138 1218 ----
NM_001018108chr1552193 2012 842 713 240 --21962 1858 12206
NM_001024372chr831963 1820 870 ------
NM_001024666chrX2201 188 ------
NM_001024858chr14102919 2782 2617 2181 1071 835 566 330 269 227 12374 1576 --
NM_001024948chr133196 2230 1358 13023 11299 --
NM_001025076chr1035129 4605 3788 14459 --12459
NM_001025077chr1066487 5963 5146 724 594 471 15817 ----
NM_001025105chr521223 450 ------
NM_001025366chr641291 641 196 33 ------
NM_001025366chr641291 641 196 33 ------
NM_001025367chr641291 641 196 33 ------
NM_001025367chr641291 641 196 33 ------
NM_001025368chr641291 641 196 33 ------
NM_001025368chr641291 641 196 33 ------
NM_001025369chr641307 657 212 49 ------
NM_001025369chr641307 657 212 49 ------
NM_001025370chr641291 641 196 33 ------
NM_001025370chr641291 641 196 33 ------
NM_001025580chrX33680 3088 675 ------
NM_001025595chr41341 --1252 --
NM_001025596chr11133 ------
NM_001025780chr911103 ------
NM_001029859chr1152466 1741 844 654 66 ------
NM_001030001chr142167 149 ------
NM_001030055chr1424712 68 ------
NM_001030287chr12460 137 1794 ----
NM_001031690chr7152799 2619 2560 2473 2318 1092 1080 1026 862 796 645 559 498 320 42 --1934 --
NM_001031695chr2285175 5034 4807 4787 2164 1838 1400 1002 13307 ----
NM_001031717chr31113 --3809 715 171 --
NM_001031732chr413237 ------
NM_001031812chr511986 ------
NM_001032280chr6--11163 ----
NM_001032289chrX1130 ------
NM_001032293chr171507 --1422 --
NM_001032296chr1332579 636 204 12409 ----
NM_001032380chr1021410 744 ----1487
NM_001032394chr6--157 11853 --
NM_001033044chr131229 1150 253 ------
NM_001033049chr213484 321 81 --133 1893
NM_001033056chr131229 1150 253 ------
NM_001033087chr2052977 2687 1129 557 77 ------
NM_001033117chr364585 3878 1699 1586 124 104 ------
NM_001033659chr1731195 454 371 1664 ----
NM_001034954chr1031165 1068 1002 ------
NM_001034955chr1031165 1068 1002 ------
NM_001034956chr1031165 1068 1002 ------
NM_001034957chr1031165 1068 1002 ------
NM_001035511chr121978 198 ----1453
NM_001035512chr122085 305 ----1560
NM_001035513chr122085 305 ----1560
NM_001037131chr2------11228
NM_001037324chr32740 732 ------
NM_001037582chr441578 395 102 95 ------
NM_001039538chr221117 918 ------
NM_001039547chr327773 2803 ------
NM_001039570chr2284606 4230 3230 3168 1801 616 542 334 --12917 --
NM_001039571chr2284606 4230 3230 3168 1801 616 542 334 --12917 --
NM_001039618chr1125251 1462 ------
NM_001039888chr1126 1297 ----
NM_001040057chr721060 491 ------
NM_001040102chr1072103 1696 1650 295 139 59 45 --11744 --
NM_001040103chr1072103 1696 1650 295 139 59 45 --11744 --
NM_001040153chr13----150 --
NM_001040181chr3--1750 ----
NM_001040182chr3--1750 ----
NM_001040183chr3--1750 ----
NM_001040199chr3--1750 ----
NM_001040200chr3--1750 ----
NM_001040202chr42630 330 ------
NM_001040214chr6--12293 ----
NM_001040273chr1072027 1964 1899 1809 1408 629 564 ------
NM_001040409chr211003 ------
NM_001040424chr2172803 2704 1948 927 879 312 223 ------
NM_001040429chr1312602 ------
NM_001040446chr541938 1917 313 245 ----1639
NM_001040633chr71107 ------
NM_001040653chr312542 --21922 1804 --
NM_001040876chr421476 361 ------
NM_001042425chr6--11163 ----
NM_001042498chrX2267 50 ------
NM_001042555chr1211030 14517 ----
NM_001042573chr17112160 2093 1942 1900 1733 1498 1461 1375 492 170 123 ------
NM_001042599chr267321 6691 6491 2522 2430 1700 ------
NM_001043318chr1493615 3080 2803 648 456 245 222 135 54 31229 1158 1127 ----
NM_001043351chr132322 2261 1585 --192 --
NM_001044722chr511986 ------
NM_001044723chr511986 ------
NM_001076chr4----168 --
NM_001076chr4----168 --
NM_001077628chr12664 505 ------
NM_001079874chr12710 632 1867 ----
NM_001087chr21101 ------
NM_001092chr1762137 1663 1645 1610 1540 910 ------
NM_001100108chr1108069 7452 5883 2416 2386 477 372 330 234 213 15066 35455 2689 2528 --
NM_001106chr3178068 7496 6551 6508 6299 6243 3844 3700 3564 3319 2316 2180 2090 1791 1776 922 662 --12730 18505
NM_001113490chrX62740 1438 1408 1279 95 82 ------
NM_001116chr1662072 964 678 568 262 162 --32814 2479 1136 --
NM_001123chr101136 ------
NM_001167chrX46509 5669 4694 1648 ------
NM_001173chr1424712 68 ------
NM_001186chr2122190 550 --1635 --
NM_001191chr2061368 1001 292 284 271 127 ------
NM_001200chr202927 827 ------
NM_001206chr93973 936 330 ------
NM_001295chr351106 928 271 174 156 ------
NM_001356chrX21010 514 ------
NM_001395chrX3887 618 84 --193 --
NM_001396chr213468 392 124 ------
NM_001399chrX32693 1004 220 --33642 589 403 --
NM_001400chr11303 ------
NM_001407chr371604 1578 1414 525 145 79 35 --1573 --
NM_001409chr162163 2150 2036 953 799 123 --2865 134 --
NM_001417chr1231718 1656 547 ------
NM_001420chr19142894 2876 2852 2840 2701 2682 2655 2574 2348 759 744 541 174 125 2938 768 22921 369 --
NM_001427chr721740 274 --1264 --
NM_001429chr221830 ------
NM_001430chr21529 11784 ----
NM_001438chr112695 ------
NM_001497chr932535 2399 1748 --22724 2619 --
NM_001543chr5144690 4683 4669 4461 4329 4029 3917 3857 1757 1669 1351 1182 518 140 11234 44782 4616 4576 890 --
NM_001546chr61946 ------
NM_001564chr4--128 ----
NM_001668chr142085 1797 1731 451 ------
NM_001674chr12460 137 1794 ----
NM_001682chr121185 --11076 --
NM_001706chr311000 --1430 --
NM_001722chr82559 148 ------
NM_001754chr2131043 257 130 --11147 --
NM_001755chr1611960 --1413 --
NM_001759chr1264141 4102 3752 3535 3240 2122 11563 11616 --
NM_001798chr123883 867 828 --1264 1422
NM_001892chr521223 450 ------
NM_001923chr11----1444 1436
NM_001955chr61828 ------
NM_001967chr31550 ------
NM_001981chr132392 1625 436 ------
NM_001987chr1253449 1420 1262 213 195 ------
NM_001995chr411322 1561 ----
NM_002025chrX33517 3038 2801 ------
NM_002032chr111350 ------
NM_002048chr94904 452 423 392 ------
NM_002051chr101996 --1892 --
NM_002065chr131229 1150 253 ------
NM_002077chr91216 ------
NM_002090chr4----1153 --
NM_002092chr42981 690 25073 1450 ----
NM_002112chr151235 ------
NM_002128chr1312039 11803 ----
NM_002136chr121247 ------
NM_002137chr721786 897 ------
NM_002140chr91217 ------
NM_002193chr221353 39 ----1771
NM_002223chr1262742 1418 1406 1084 796 273 12849 ----
NM_002249chr1----1388 --
NM_002267chr131656 ------
NM_002270chr524404 1469 ------
NM_002355chr1221231 415 --1984 --
NM_002374chr221117 918 ------
NM_002382chr1421140 504 ------
NM_002390chr17122073 1690 1619 1480 1377 1323 1270 611 524 422 307 198 --1152 --
NM_002397chr5------1610
NM_002401chr1772321 2178 1706 347 339 257 155 --22470 52 --
NM_002408chr141203 ------
NM_002419chr113471 437 392 ------
NM_002427chr1111111 ------
NM_002430chr2211834 1179 ----
NM_002436chrX2176 82 ------
NM_002445chr821612 1073 --1289 --
NM_002446chr191205 ------
NM_002501chr1983034 1443 1430 1156 1034 892 743 508 --22665 1423 --
NM_002537chr152681 113 --3348 126 81 --
NM_002545chr1154423 1618 519 203 188 1657 ----
NM_002576chr112264 246 ------
NM_002577chr313234 14062 ----
NM_002581chr964385 4342 1639 1346 702 381 --24800 3855 --
NM_002585chr1----165 --
NM_002608chr2211316 133 11575 --
NM_002609chr551610 1316 744 244 164 --11641 --
NM_002646chr111731 --2628 618 --
NM_002655chr831634 1398 433 11073 11887 --
NM_002673chr32525 510 ----1558
NM_002698chr19122898 2890 2507 2078 2068 2012 860 391 361 299 269 27 --12860 1765
NM_002701chr6179 ------
NM_002709chr2--11307 ----
NM_002730chr1951321 1076 993 368 91 1141 171 --
NM_002731chr1----11050 12214
NM_002734chr171295 11455 11715 --
NM_002737chr1716239 1134 14266 --
NM_002742chr141474 ------
NM_002745chr2234105 4058 3488 ------
NM_002753chr42642 306 ------
NM_002758chr172488 164 --1123 --
NM_002811chr16----174 --
NM_002822chr121205 ------
NM_002869chr1111946 ------
NM_002871chr131293 789 314 ----2806 153
NM_002884chr111043 ------
NM_002902chr151534 ------
NM_002928chr11261 1240 1252 --
NM_002940chr421476 361 ------
NM_002945chr171598 ------
NM_002953chr12785 149 ------
NM_002958chr32220 47 ------
NM_002994chr411276 ----1642
NM_003001chr122085 305 ----1560
NM_003011chr91334 ------
NM_003028chr973786 3726 3067 2409 1059 735 723 --1167 --
NM_003045chr1383883 3540 3269 1669 1594 653 647 615 --14634 --
NM_003074chr351858 1567 807 713 659 --1826 --
NM_003076chr121143 ------
NM_003081chr201874 ------
NM_003085chr52210 71 ------
NM_003107chr662438 990 796 651 262 132 11632 ----
NM_003108chr2117242 2795 2694 2513 2487 2469 2403 2325 1988 404 35 --12876 --
NM_003112chr71136 ------
NM_003161chr1733534 1449 1048 23143 356 12598 --
NM_003183chr2------1654
NM_003204chr1721198 54 --11490 --
NM_003211chr122501 186 ------
NM_003216chr22103227 3124 2791 2741 1264 1137 1079 753 602 595 --22296 58 1370
NM_003220chr6--11163 ----
NM_003221chr643961 1414 678 672 --12562 --
NM_003234chr322334 340 186 11865 --
NM_003253chr2151796 1558 1321 520 240 ------
NM_003255chr1761671 1051 394 263 238 51 ------
NM_003257chr151522 ------
NM_003272chr11299 ------
NM_003286chr203960 386 264 ------
NM_003334chrX165 ------
NM_003338chr1011870 ------
NM_003341chr3179 ------
NM_003371chr942061 1315 260 138 1388 21929 1921 11991
NM_003376chr641291 641 196 33 ------
NM_003376chr641291 641 196 33 ------
NM_003390chr111342 1249 ----
NM_003392chr32526 403 ------
NM_003410chrX12664 12121 ----
NM_003457chr171507 --1422 --
NM_003458chr373327 2715 1311 1297 1071 507 488 13503 22551 501 --
NM_003466chr242512 2137 2041 952 --42375 2165 1987 606 --
NM_003482chr1272195 1787 942 634 156 110 104 ----11057
NM_003559chr1743710 2541 1279 94 22695 318 1121 13353
NM_003566chr12--1725 ----
NM_003576chr1332579 636 204 12409 ----
NM_003579chr12191 54 ------
NM_003581chr21885 ------
NM_003583chr1223560 2385 --11088 --
NM_003607chr154077 2735 1261 1135 109 --12779 --
NM_003620chr17--1298 149 --
NM_003629chr1103418 3112 3099 2693 2613 2473 2265 2156 162 70 ------
NM_003644chr1796014 5652 4847 4799 4787 4540 1526 1071 381 --45711 406 165 44 --
NM_003666chr11622 ------
NM_003672chr111311 1268 1734 --
NM_003693chr172548 217 1272 ----
NM_003713chr11682 11313 ----
NM_003758chr1511117 11515 ----
NM_003758chr1511117 11515 ----
NM_003762chr1--11378 ----
NM_003768chr131716 709 75 1223 21390 235 1268
NM_003800chr61522 1810 --124
NM_003822chr112410 --1687 --
NM_003872chr2102904 2826 2781 2169 2156 1117 844 830 233 49 12522 ----
NM_003885chr1731809 1784 610 1914 12331 --
NM_003913chr623365 25 --13313 --
NM_003927chr181960 ------
NM_003947chr341104 195 141 111 ----1549
NM_003948chr412662 --1883 --
NM_003949chr1761761 1502 772 551 355 215 --31946 387 197 --
NM_003955chr1761314 1014 559 466 457 125 ------
NM_003971chr17------1493
NM_003972chr1021048 410 ------
NM_003980chr611175 ------
NM_003983chr1674008 3539 2755 380 331 205 124 --33973 943 196 --
NM_004024chr16973 967 496 378 82 65 11153 ----
NM_004050chr1452186 1086 814 246 38 123 1671 --
NM_004093chr133743 731 521 --32320 344 68 --
NM_004136chr1532996 2502 261 ------
NM_004157chr3----1861 --
NM_004161chr211403 --11101 --
NM_004165chr16143 ------
NM_004171chr1169131 6372 3698 3316 3080 1656 --27693 7680 --
NM_004200chr1192518 2507 2463 2414 682 645 208 33 26 --23013 118 --
NM_004227chr753100 2543 753 706 692 --2807 686 --
NM_004232chr1813506 ------
NM_004272chr5----11393 --
NM_004296chr1463422 3217 1083 962 929 126 --13832 --
NM_004311chr1063013 2875 2413 2405 2165 1957 12674 32399 1105 823 --
NM_004321chr263205 2919 1309 1200 687 250 1570 32902 2748 1011 --
NM_004323chr962566 2000 608 246 100 91 --1374 --
NM_004330chr153942 742 729 ------
NM_004342chr711660 ----159
NM_004370chr61155 ------
NM_004384chr511986 ------
NM_004397chr1173934 3401 3379 3173 3166 1400 1123 1629 14205 --
NM_004422chr171377 ------
NM_004423chr372757 2124 1069 978 911 620 155 --12031 --
NM_004425chr1123 ------
NM_004427chr181179 1089 884 491 332 220 109 102 ------
NM_004432chr922234 223 ----1556
NM_004437chr153467 2258 1222 1024 529 --12727 --
NM_004442chr161524 1334 662 652 309 229 ------
NM_004457chr2----1403 1681
NM_004472chr51258 ------
NM_004491chr19154102 3611 3584 3451 3400 3362 3122 3080 2675 1555 1511 1486 868 552 402 --23419 935 --
NM_004496chr14------1347
NM_004501chr132683 647 248 ------
NM_004588chr11143004 2871 2534 1617 925 797 784 726 657 576 432 332 288 242 --1400 --
NM_004630chr111785 ------
NM_004637chr311122 ------
NM_004690chr61557 ------
NM_004736chr12730 575 ------
NM_004737chr224934 493 392 321 2845 284 1876 --
NM_004739chr11140 ------
NM_004742chr321440 1423 --1418 --
NM_004745chr856074 5409 4705 4393 2464 --1766 --
NM_004762chr1791942 1655 1642 1496 709 665 541 477 32 ------
NM_004774chr1763013 1246 830 659 398 188 12278 1819 --
NM_004776chr2072025 1083 1076 1005 556 544 80 ------
NM_004796chr1421822 891 ------
NM_004801chr2----11343 --
NM_004822chr17123316 3179 2546 2486 1229 797 363 340 334 277 147 125 --31132 701 99 --
NM_004841chr12912 757 1995 ----
NM_004869chr181367 ------
NM_004904chr746112 4186 2013 1078 1989 ----
NM_004926chr142639 426 ------
NM_004947chr351807 1685 646 578 197 21898 782 11929 11884
NM_004958chr12768 722 ------
NM_004960chr16198 ------
NM_004973chr631252 364 250 ------
NM_004976chr11144551 4350 4023 4015 3865 1625 1066 947 928 779 486 460 354 113 23724 3399 44525 4124 841 279 --
NM_004992chrX137758 7582 6457 5715 3327 3054 2599 1925 1871 1670 1150 905 77 13389 27826 6029 --
NM_004992chrX137758 7582 6457 5715 3327 3054 2599 1925 1871 1670 1150 905 77 13389 27826 6029 --
NM_005023chr531087 1074 21 ------
NM_005028chr1032041 1700 692 ----1155
NM_005063chr1063153 3120 2756 1512 1304 809 11519 ----
NM_005076chr164090 1346 1305 884 826 555 --23447 1570 --
NM_005109chr31642 ------
NM_005116chr2084397 3016 2777 1782 1388 369 333 154 ------
NM_005121chr171593 2922 157 ----
NM_005126chr31732 ------
NM_005156chr921348 984 ------
NM_005165chr171342 ------
NM_005180chr1011389 ------
NM_005190chr6----1413 --
NM_005197chr1484286 4261 3768 2197 2190 1778 1654 601 14224 ----
NM_005206chr171989 11157 1325 --
NM_005235chr267321 6691 6491 2522 2430 1700 ------
NM_005238chr1122845 431 ------
NM_005249chr141135 ------
NM_005252chr14----194 --
NM_005329chr1661966 1742 1636 1549 291 210 ------
NM_005339chr414119 ------
NM_005347chr9--31642 1618 1453 ----
NM_005358chr131339 ------
NM_005359chr1866043 6032 5508 4888 4197 118 14692 15375 --
NM_005376chr12900 813 --1138 --
NM_005400chr242325 678 498 298 1780 ----
NM_005406chr18--1119 1166 --
NM_005407chr1441328 1063 393 373 --11473 --
NM_005433chr1822230 2161 ------
NM_005435chr73535 428 56 ------
NM_005450chr17----199 --
NM_005461chr201262 ------
NM_005479chr1041070 423 174 42 --162 11085
NM_005487chr22--11598 3567 311 304 --
NM_005520chr5----179 --
NM_005565chr52536 123 ------
NM_005596chr946018 5575 5227 1010 ------
NM_005599chr151453 381 302 291 22 --1224 --
NM_005634chrX1683 1668 1132 --
NM_005644chr11338 ------
NM_005668chr522974 2893 ----13897
NM_005700chr113327 132 80 ------
NM_005708chr13----1326 --
NM_005780chr132359 48 1411 ----
NM_005785chr1221682 663 ------
NM_005814chr121293 1214 135 2434 383 --
NM_005828chr1764870 4042 3854 3836 215 33 ------
NM_005840chrX97647 7480 7316 4734 3050 2780 1876 1358 323 27025 2736 17429 --
NM_005841chr42777 242 1451 ----
NM_005859chr5------1621
NM_005902chr1544150 3427 3110 26 11212 11830 --
NM_005909chr52658 210 ------
NM_005910chr17114024 3822 3192 3082 2774 1299 903 888 799 710 555 23904 1000 ----
NM_005911chr221302 952 ------
NM_005920chr1103701 2986 2799 2572 1097 936 814 794 732 332 1804 2785 263 --
NM_005935chr445080 4746 4363 451 ------
NM_005937chr17134004 3228 3209 3072 2753 1148 1137 1016 1008 952 724 649 436 --1571 --
NM_005938chrX21254 1180 --1216 --
NM_005941chr833955 3118 120 23042 1495 22795 142 --
NM_005955chr195125 4216 3476 3389 1740 921 789 530 488 15006 14676 --
NM_006007chr9----23837 1021 --
NM_006022chr131342 ------
NM_006034chr1182228 2170 2061 929 350 331 138 90 --12183 --
NM_006037chr273837 3365 3350 3145 1867 869 98 --34546 3075 1943 --
NM_006048chr11987 --1842 --
NM_006090chr11214 ------
NM_006094chr852359 2353 838 611 178 ------
NM_006113chr12710 632 1867 ----
NM_006141chr1622168 299 ------
NM_006145chr193759 97 89 --1109 --
NM_006194chr142983 307 ------
NM_006195chr911040 ------
NM_006202chr1971880 1802 1469 765 545 527 219 --1204 --
NM_006203chr535103 3531 3462 11394 --11752
NM_006212chr195192 5149 4976 4880 1489 1014 921 391 301 11363 --11981
NM_006251chr522114 294 13091 1105 --
NM_006252chr146673 4764 1714 1098 --15941 --
NM_006275chr2022250 341 ------
NM_006279chr13700 352 215 1669 ----
NM_006311chr17----1243 --
NM_006329chr141508 ------
NM_006345chr411397 ------
NM_006386chr2212202 --1413 --
NM_006387chr192387 187 ------
NM_006389chr1141158 1088 1051 1044 --173 --
NM_006390chr1241226 1126 87 65 --1573 --
NM_006400chr123127 120 71 ------
NM_006403chr6----11649 --
NM_006408chr71856 ------
NM_006434chr1031165 1068 1002 ------
NM_006449chr231365 322 71 ------
NM_006451chr51831 ------
NM_006454chr4133011 2991 2980 2520 2378 2176 1871 1030 1005 883 864 581 344 --1933 --
NM_006455chr171913 ------
NM_006458chr11162 ------
NM_006482chr1223560 2385 --11088 --
NM_006496chr121856 1305 1580 ----
NM_006510chr62406 26 --1655 --
NM_006521chrX11356 11061 11132 --
NM_006544chr1426092 4223 ----15010
NM_006549chr1282529 2095 1981 1954 1843 1106 617 517 --151 1443
NM_006560chr11133 ------
NM_006561chr1035129 4605 3788 14459 --12459
NM_006565chr16----1224 --
NM_006575chr1411374 --1529 --
NM_006599chr1655722 5210 3082 2690 1255 18080 ----
NM_006601chr121167 ------
NM_006614chr323447 2655 ------
NM_006621chr121872 206 ------
NM_006624chr102532 210 1547 ----
NM_006636chr211003 ------
NM_006650chr593559 3520 2929 2558 1226 774 541 252 136 --12502 --
NM_006653chr6296 89 ------
NM_006654chr1211030 14517 ----
NM_006675chr1272695 2674 2493 907 758 635 204 1568 23247 396 --
NM_006682chr71953 ------
NM_006721chr101136 ------
NM_006722chr312164 12513 22230 1859 --
NM_006729chrX45419 5092 4776 3650 ------
NM_006734chr611160 11260 11181 --
NM_006750chr1665087 3086 2628 1568 1558 555 27061 871 ----
NM_006766chr832021 1984 985 1430 ----
NM_006807chr1721029 917 ------
NM_006815chr121941 ------
NM_006823chr82371 151 ------
NM_006826chr21869 ------
NM_006839chr2168 ------
NM_006861chr1292002 1814 1775 1753 1672 1666 1635 1612 800 --21857 1627 1813
NM_006876chr112554 539 ------
NM_006897chr121576 --2493 180 --
NM_006912chr122296 729 1464 ----
NM_006913chr6153 ------
NM_006920chr221706 569 ------
NM_006931chr122747 406 ------
NM_006965chr181993 ------
NM_006981chr91403 --1262 --
NM_006990chr192504 2344 2272 2266 2217 2117 2070 326 209 ------
NM_006991chr33965 350 286 ----1978
NM_007005chr9----1990 --
NM_007008chr2169 ------
NM_007011chr15106423 6405 6138 5028 4804 4351 2333 2279 902 123 ------
NM_007030chr594268 3163 1672 1594 1426 719 532 393 128 --41587 1395 1085 121 --
NM_007034chr1----1115 --
NM_007042chr332623 257 110 --22208 763 --
NM_007050chr20137376 6735 6325 6309 6269 5537 2909 2638 2335 955 918 793 589 --1152 --
NM_007158chr131100 482 64 ------
NM_007175chr893376 3200 2747 2338 1352 1190 1068 628 166 ----12946
NM_007197chr122851 187 ------
NM_007214chr611172 ------
NM_007238chr2084713 4052 3908 3717 3502 1478 301 117 11311 34808 3725 362 14382
NM_007249chr1352768 2092 1664 929 66 17788 ----
NM_007271chr61519 ------
NM_007282chr31681 ------
NM_007283chr322332 320 11069 1945 --
NM_007345chr1812300 1741 ----
NM_007363chrX2253 153 1915 ----
NM_012072chr2034513 4071 322 31688 748 315 ----
NM_012081chr513691 --13005 1522
NM_012090chr141042 1032 322 304 --1494 --
NM_012095chr1023457 1025 ------
NM_012124chr11--1122 ----
NM_012153chr112677 356 --1921 --
NM_012156chr2083183 2971 2713 2104 1191 1121 785 218 ------
NM_012164chr975767 5086 2396 1844 1395 158 43 --21249 175 --
NM_012193chr11--14428 ----
NM_012197chr9----1535 --
NM_012199chr123341 422 13534 13224 --
NM_012201chr16164 ------
NM_012214chr215816 --14148 1742
NM_012215chr1011233 --11614 --
NM_012223chr221089 1058 1894 ----
NM_012234chr31814 1509 1356 --
NM_012238chr1011386 ------
NM_012250chr111400 ------
NM_012262chr121832 1334 14772 1404 --
NM_012287chr323445 1704 23852 228 ----
NM_012288chr6105620 5194 4379 2284 1086 1049 468 144 51 39 ------
NM_012296chr1163000 2923 747 344 338 173 1837 ----
NM_012306chr12133436 3284 3261 2956 2835 2458 1257 735 703 696 614 381 279 ----12326
NM_012325chr2031628 541 256 ------
NM_012330chr101648 --1567 --
NM_012333chr121119 1108 --11696 --
NM_012384chr20102362 2216 2210 2081 2007 1880 915 697 86 37 ----1313
NM_012405chr112482 --13248 --
NM_012416chr91863 21177 1052 ----
NM_012421chr11396 ----1347
NM_012479chr731924 1909 301 --12086 --
NM_013231chr1424301 269 11657 --11470
NM_013233chr211078 ------
NM_013235chr51768 --1793 --
NM_013247chr23470 104 70 --1222 187
NM_013252chr741014 989 462 283 --1511 --
NM_013253chr1111138 1218 ----
NM_013260chr1731209 980 351 ------
NM_013277chr12--1259 1141 --
NM_013282chr1931220 1109 1067 --2970 50 --
NM_013302chr1651587 1399 1102 679 230 ------
NM_013323chr1741208 902 850 226 1783 1931 --
NM_013354chr811437 ------
NM_013382chr1482219 1983 855 617 485 476 308 276 ------
NM_013386chr11506 11506 ----
NM_013390chr91635 1598 1330 --
NM_013396chr21173 ------
NM_013434chr2101960 1710 1692 1611 1520 760 531 361 338 203 --21359 1350 --
NM_013434chr2101960 1710 1692 1611 1520 760 531 361 338 203 --21359 1350 --
NM_013438chr911380 ------
NM_013443chr971215 1132 981 944 795 505 30 --1972 --
NM_013951chr242512 2137 2041 952 --42375 2165 1987 606 --
NM_013952chr242589 2214 2118 1029 --42452 2242 2064 683 --
NM_013953chr242589 2214 2118 1029 --42452 2242 2064 683 --
NM_013989chr1434414 4036 3530 --14164 1651
NM_013992chr242589 2214 2118 1029 --42452 2242 2064 683 --
NM_014043chr3----1368 --
NM_014048chr1634577 4236 3598 --11981 --
NM_014112chr824313 359 11251 ----
NM_014155chr1132965 2350 630 27212 6569 ----
NM_014232chr1731476 1446 1439 ------
NM_014232chr1731476 1446 1439 ------
NM_014250chr22--11598 3567 311 304 --
NM_014252chr132298 61 ------
NM_014283chr121403 76 ------
NM_014292chr22101747 1647 1359 1334 1307 648 391 270 143 34 --31659 439 25 --
NM_014293chr2283896 3789 3571 3176 3093 1345 920 709 --13253 --
NM_014309chr2285165 5024 4797 4777 2154 1828 1390 992 13297 ----
NM_014331chr437462 5353 2114 1618 ----
NM_014338chr22154 ------
NM_014393chr81616 ------
NM_014423chr535323 3773 807 1339 25094 4868 --
NM_014447chr41341 --1252 --
NM_014456chr1031431 1168 197 --11407 --
NM_014491chr71317 ------
NM_014502chr112393 59 --2382 99 --
NM_014574chr14150 ------
NM_014575chr3----1532 --
NM_014604chr171564 1114 ----
NM_014644chr11144 ------
NM_014646chr1852967 2104 406 222 28 --12065 --
NM_014661chr10133747 3738 3465 3248 2966 2939 2720 954 677 633 397 384 24 1805 53702 2888 1243 1129 372 --
NM_014663chr13938 847 231 --11008 1857
NM_014671chr731401 381 370 --1414 --
NM_014690chr7152799 2619 2560 2473 2318 1092 1080 1026 862 796 645 559 498 320 42 --1934 --
NM_014693chr32740 732 ------
NM_014701chr1532492 460 42 ------
NM_014720chr101602 ------
NM_014730chr1274568 4526 4359 4274 3725 3296 1009 --11869 14213
NM_014730chr1274568 4526 4359 4274 3725 3296 1009 --11869 14213
NM_014735chrX1808 ------
NM_014742chr20101697 1354 695 608 593 405 371 159 151 140 ------
NM_014743chr421983 780 ------
NM_014747chr1154733 4616 4407 3755 2331 2242 2095 1088 984 937 916 872 757 664 544 --44974 4220 1006 683 --
NM_014755chr243332 2953 2756 1013 --14094 --
NM_014764chr1211064 ------
NM_014765chr132714 1845 391 --11806 --
NM_014766chr753423 2344 1138 543 453 11533 12777 --
NM_014767chr1082952 2289 1395 1379 1346 1107 1097 747 ------
NM_014770chr1261271 1051 941 812 528 138 --21079 439 1457
NM_014774chr133212 1992 797 1944 ----
NM_014786chr1161019 925 816 354 321 312 --1343 --
NM_014803chr101331 1270 12572 --
NM_014810chr13724 279 226 ------
NM_014826chr154077 2735 1261 1135 109 --12779 --
NM_014828chr1422127 411 --11801 11969
NM_014836chr1021410 744 ----1487
NM_014850chr364585 3878 1699 1586 124 104 ------
NM_014872chr942191 2167 2009 901 ------
NM_014873chr154747 4242 4143 1647 1518 --14323 --
NM_014877chr1747588 6258 6249 2159 --16942 --
NM_014893chrY1549 ------
NM_014901chr551988 916 665 620 483 --21826 552 --
NM_014903chr123763 459 385 11769 ----
NM_014912chr1032785 74 60 ------
NM_014914chr2------11228
NM_014920chr632827 1348 92 ----1437
NM_014921chr19122613 2533 2430 2260 2041 1946 856 197 184 168 60 23 --22450 356 --
NM_014924chr14--12609 ----
NM_014947chr122884 2008 12571 ----
NM_014952chr15131445 1348 1342 1335 792 785 411 325 319 137 89 57 44 125 31706 1477 779 --
NM_014961chr4--1198 11968 --
NM_014978chr10--11679 ----
NM_014989chr631753 662 595 ------
NM_015000chr1212852 ------
NM_015020chr1663718 3105 1270 1000 477 42 ------
NM_015023chr171829 1784 1603 1354 1309 697 408 --1285 --
NM_015035chr2096543 6359 6069 5979 4344 2661 2654 1584 1577 24504 2464 15931 14142
NM_015039chr124137 3876 1464 24172 3353 --
NM_015042chr1564157 2941 2737 2704 735 709 14151 13593 13040
NM_015071chr541336 689 391 289 ----1535
NM_015076chr643964 3395 3111 799 --14446 --
NM_015077chr1794286 4217 3659 3375 2979 1666 1475 949 270 24678 843 21520 631 --
NM_015090chr1166140 6094 5447 5069 4471 3975 3924 2346 2079 1995 1778 1760 1681 1022 994 907 24637 4240 --13885
NM_015092chr1634098 3993 1456 13857 33571 3240 112 --
NM_015094chr22134244 3894 3810 3804 3650 3472 3293 3190 2934 1757 1449 683 253 --14001 --
NM_015097chr31772 ------
NM_015130chr41469 ------
NM_015132chr731327 689 68 ----11553
NM_015137chr8171 ------
NM_015155chr1063182 3161 2434 1030 440 76 12061 33236 2468 1245 --
NM_015185chrX52348 2335 2046 2039 507 --12248 --
NM_015191chr1162091 1992 979 768 269 142 12632 ----
NM_015194chr1751797 1786 854 779 105 ------
NM_015200chr412209 ------
NM_015215chr12762 345 1414 22602 503 --
NM_015225chr932784 2197 78 --12219 --
NM_015226chr1663430 2820 2403 2340 2255 2168 --22648 772 13335
NM_015231chr111148 --1338 --
NM_015236chr421168 469 ------
NM_015250chr921351 1340 --1303 11390
NM_015254chr8142635 2580 2437 1121 890 817 646 614 607 566 420 250 198 139 ------
NM_015270chr1292172 2102 1814 1461 915 821 378 236 87 21617 185 11604 --
NM_015271chr413555 1193 ----
NM_015278chr653409 2676 2132 407 342 ------
NM_015288chr583840 3340 3288 2931 1050 807 781 555 --33815 2656 769 --
NM_015299chr1444016 898 331 243 13840 1262 --
NM_015310chr842351 1769 762 47 ------
NM_015313chr1143259 3158 1409 609 --23489 816 --
NM_015336chr12--2839 117 ----
NM_015338chr201681 1466 21615 498 --
NM_015344chr81599 ------
NM_015349chr632312 2079 645 11907 --1857
NM_015355chr171152 ------
NM_015358chr21------1386
NM_015365chrX33680 3088 675 ------
NM_015374chr2271431 1197 603 568 444 362 327 --11067 --
NM_015385chr1031165 1068 1002 ------
NM_015396chr31464 ------
NM_015447chr93747 298 73 ------
NM_015455chr543877 3634 3590 631 ------
NM_015460chr32719 141 1686 ----
NM_015470chr271185 879 792 445 266 158 145 --128 --
NM_015477chr151227 ------
NM_015509chr122271 56 --1651 --
NM_015525chr6----1839 --
NM_015534chr11978 ------
NM_015542chr101982 --1458 1242
NM_015550chr723479 2785 1411 ----
NM_015554chr1532351 2298 2224 ------
NM_015557chr1133521 3464 3419 3340 3015 2534 2312 1203 1049 948 856 840 788 --22771 1097 --
NM_015565chr2121448 745 1616 ----
NM_015576chr32662 53 ----142
NM_015609chr162745 2393 2286 814 689 224 --12871 --
NM_015630chr2----1930 --
NM_015678chr131623 11266 ----
NM_015680chr21641 --131 --
NM_015833chr213484 321 81 --133 1893
NM_015878chr81653 1600 ----
NM_015881chr1111138 1218 ----
NM_015906chr11624 14456 11269 --
NM_015912chr831669 1610 824 ------
NM_015975chrX11752 --11764 --
NM_015995chr1595115 5049 4773 2091 2031 1696 1320 995 646 14005 13764 --
NM_016022chr131056 897 132 ------
NM_016045chr2011147 --1228 --
NM_016076chr132831 2477 2107 --1562 --
NM_016090chr112215 196 ------
NM_016097chr181139 ------
NM_016169chr1073187 2966 2291 2092 1038 918 632 12869 ----
NM_016203chr71107 ------
NM_016206chr3--27985 2134 --13043
NM_016210chr381241 1234 1062 1032 591 241 226 178 --1119 --
NM_016217chr61146 --13648 --
NM_016227chr121403 76 ------
NM_016230chr6161 ------
NM_016293chr12163 ------
NM_016319chr121696 ------
NM_016322chr922140 1249 --12959 --
NM_016376chr171589 ------
NM_016396chr1512166 1150 ----
NM_016422chr11170 --23086 2844 --
NM_016424chr172598 66 ------
NM_016507chr17------11102
NM_016513chr632827 1348 92 ----1437
NM_016530chr1563445 2820 2668 863 498 38 ------
NM_016531chr423385 720 ----13322
NM_016547chr11627 ------
NM_016605chr551943 895 887 569 82 --1113 --
NM_016621chr1184250 4189 3885 3698 3063 2810 1805 607 12794 ----
NM_016626chr182552 386 ------
NM_016651chr141932 --1414 --
NM_016823chr171859 11027 1195 --
NM_016834chr17114024 3822 3192 3082 2774 1299 903 888 799 710 555 23904 1000 ----
NM_016835chr17114024 3822 3192 3082 2774 1299 903 888 799 710 555 23904 1000 ----
NM_016841chr17114024 3822 3192 3082 2774 1299 903 888 799 710 555 23904 1000 ----
NM_017420chr14--11074 ----
NM_017449chr161524 1334 662 652 309 229 ------
NM_017456chr1791942 1655 1642 1496 709 665 541 477 32 ------
NM_017548chr32642 328 ----11679
NM_017551chr1062104 1806 883 815 566 332 1592 1712 --
NM_017580chr1022096 892 --2741 646 --
NM_017590chr22112477 2361 2256 1033 787 452 430 383 342 327 99 --41991 1740 923 897 11937
NM_017594chr932758 2350 147 --1776 --
NM_017596chr194391 3962 3810 2958 1606 1313 683 456 318 --23139 1682 --
NM_017599chr1221466 211 ------
NM_017602chrX1631 ------
NM_017612chr12----1239 --
NM_017628chr424124 790 --11289 --
NM_017629chr11299 ------
NM_017633chr612694 ------
NM_017635chr112642 412 ------
NM_017637chr969382 9239 8787 8366 7712 5886 16172 ----
NM_017643chr172166 21 11962 --181
NM_017644chr333306 3207 517 ------
NM_017658chr1424539 496 1585 13366 --
NM_017667chr71403 1524 ----
NM_017672chr152298 253 ------
NM_017719chr312448 ------
NM_017724chr31779 ------
NM_017737chr121905 67 11732 ----
NM_017739chr15403 397 359 99 26 1106 1153 --
NM_017744chr142089 417 272 90 32357 2125 260 12405 --
NM_017752chrX31426 327 77 1756 ----
NM_017758chr1741118 582 311 162 --21304 71 --
NM_017763chr173305 169 161 ------
NM_017770chr62692 357 22343 1835 12852 --
NM_017772chr651456 1442 1335 1308 253 1569 21654 1229 --
NM_017780chr8----1625 --
NM_017784chr32795 74 ------
NM_017787chr1032648 579 482 --12707 1219
NM_017824chr1031939 1878 610 --11928 --
NM_017873chr983123 2593 733 355 347 292 258 83 13132 ----
NM_017902chr10105697 4898 4848 4320 4243 4166 3888 3809 1431 657 --15123 --
NM_017907chr112400 171 ------
NM_017925chr92748 195 11715 ----
NM_017954chr711137 11462 ----
NM_017998chr91912 ------
NM_018000chr21508 ------
NM_018045chr162787 2380 2146 1070 985 97 22661 529 --12477
NM_018084chr213051 ------
NM_018113chr123516 441 108 ------
NM_018128chr17----11026 --
NM_018171chr122823 57 ------
NM_018178chr121380 148 21571 1421 ----
NM_018184chr322109 2033 ------
NM_018205chr1051968 1641 1576 894 101 --21652 95 12135
NM_018239chr1051968 1641 1576 894 101 --21652 95 12135
NM_018247chr623054 2991 ------
NM_018287chr1011242 ------
NM_018302chr4--1607 ----
NM_018314chr11----1285 --
NM_018327chr2021222 500 ------
NM_018424chr9----1468 --
NM_018444chr81670 ------
NM_018482chr81187 ------
NM_018486chrX2444 402 ------
NM_018489chr11181 1240 ----
NM_018566chr1--14776 ----
NM_018667chr1692510 2136 1895 1849 1840 1084 596 348 100 --1570 --
NM_018685chr71108 ------
NM_018711chr1241176 1003 278 131 --151 --
NM_018840chr201163 ------
NM_018963chr2121277 392 ------
NM_018979chr1232153 2071 33 ----1286
NM_018994chr1----1444 --
NM_019006chr15----2287 254 --
NM_019050chr41557 --11706 --
NM_019084chr1022461 2200 ------
NM_019895chr3--1750 ----
NM_020116chr41346 ------
NM_020148chr1842994 2076 1152 838 --1480 --
NM_020163chr381521 744 707 677 437 418 163 40 --21764 323 --
NM_020182chr2073146 2768 2266 728 441 91 27 11342 11108 --
NM_020184chr261990 917 817 376 211 38 1317 ----
NM_020193chr1111121 ------
NM_020198chr1721178 189 ------
NM_020205chr163319 2855 2800 1385 200 181 --12974 --
NM_020245chr654498 3706 3675 3081 147 ----1739
NM_020336chr2033563 2681 867 --12627 --
NM_020337chr4--11244 11230 --
NM_020341chr201140 ------
NM_020342chr212143 --22116 802 --
NM_020429chr732631 2008 123 --22099 383 --
NM_020432chr71458 ------
NM_020438chr951274 495 216 201 169 --31030 453 313 --
NM_020453chr421319 686 ----1180
NM_020455chr6--157 11853 --
NM_020463chr21332 ------
NM_020474chr181525 ------
NM_020532chr2169 ------
NM_020640chr322232 1502 --2919 122 --
NM_020651chr21330 ------
NM_020697chr81175 ------
NM_020699chr185047 4723 4164 3980 3706 3697 3663 594 --23944 654 14362
NM_020713chr20112715 2645 2205 2128 2086 2007 1938 1123 423 295 206 --1248 12341
NM_020717chrX41152 759 459 416 11931 ----
NM_020728chr731096 1090 645 --11939 --
NM_020752chr1052555 1841 1829 824 158 ------
NM_020766chrX23669 1822 ------
NM_020769chrX1828 ------
NM_020772chr1735360 2752 682 ----18009
NM_020774chr1834695 3814 1129 ------
NM_020795chr1761660 1580 1536 1481 1466 218 --11899 --
NM_020796chr522795 2292 ------
NM_020807chr1681548 1207 619 530 523 432 353 166 ------
NM_020810chr1423418 81 ------
NM_020814chr271380 507 438 373 328 105 42 ------
NM_020818chr142361 149 ------
NM_020850chr1682681 2528 2462 2310 1055 823 665 48 --12321 --
NM_020856chr19--11074 ----
NM_020868chr21226 ------
NM_020873chr31171 ------
NM_020899chr1742066 1593 866 123 --1683 --
NM_020920chr141361 ------
NM_020921chr1433025 1449 514 11082 ----
NM_020948chr123475 61 --13186 --
NM_020956chr19294709 4683 4546 4498 4390 4382 4291 4174 4164 4063 3985 3979 3960 3928 3832 3760 3742 3633 3619 3540 3372 3359 3353 3346 3145 1306 1159 637 523 13886 44573 3550 3124 3058 --
NM_020983chr1292172 2102 1814 1461 915 821 378 236 87 21617 185 11604 --
NM_021012chr17113101 3045 3035 2752 2489 745 491 267 260 246 175 --2834 558 --
NM_021020chr8133298 3094 2341 2191 1306 1088 840 645 625 541 272 141 51 --1817 --
NM_021033chr1333289 3051 727 1997 ----
NM_021072chr51197 ------
NM_021090chr2284875 4837 4820 3911 1195 949 674 279 --23844 764 13948
NM_021096chr2283006 2151 1153 849 782 498 424 364 1934 12630 --
NM_021097chr232915 384 240 12189 ----
NM_021148chr7--11879 ----
NM_021183chrX12373 1297 ----
NM_021222chr121354 958 ------
NM_021242chrX7852 332 233 209 166 150 93 --1122 --
NM_021255chr144808 547 113 103 23068 2882 ----
NM_021260chr14--150 ----
NM_021637chrX21143 1106 11174 ----
NM_021647chr454764 4178 1813 583 43 ------
NM_021649chr521220 686 ------
NM_021784chr201198 --1442 --
NM_021954chr1343093 1256 418 246 --1297 --
NM_021962chr1762137 1663 1645 1610 1540 910 ------
NM_021977chr633286 3113 2915 ----12566
NM_022041chr1611008 ------
NM_022048chr1562401 2390 1962 1943 253 102 ------
NM_022049chr121300 599 ------
NM_022093chr11182 --1919 --
NM_022123chr141203 ------
NM_022166chr1695674 5237 3844 2372 2361 2188 2009 1462 507 14393 14841 --
NM_022340chr323636 67 --12382 --
NM_022361chr61381 ------
NM_022373chr7131 ------
NM_022476chr161155 ------
NM_022477chr2021644 1541 11617 ----
NM_022481chr5126 ------
NM_022497chr373591 3121 3010 2968 561 406 169 ------
NM_022552chr231168 927 185 --21214 166 11057
NM_022648chr2124109 3798 3601 3575 3093 3083 1864 1798 1441 855 709 42 --11141 --
NM_022664chr1123 ------
NM_022719chr2283283 2990 2479 1097 1072 1036 345 142 --31225 1131 621 --
NM_022735chr1132 --11307 --
NM_022755chr942224 1722 1684 293 --11006 --
NM_022758chr673036 3027 2948 2461 2396 2224 2007 ------
NM_022781chr932461 641 472 --13320 --
NM_022823chr21101 ------
NM_022824chr52482 86 ------
NM_022842chr31297 --22659 2430 --
NM_022843chr131357 11471 ----
NM_022845chr1611914 --1367 --
NM_022893chr212025 1627 ----
NM_022898chr1454290 3963 3482 958 819 --2830 177 --
NM_023034chr81583 ----1211
NM_023039chr51355 ------
NM_023079chr1761657 1505 481 272 207 164 --21472 416 --
NM_024017chr1711663 --11642 --
NM_024046chr3363 43 24 11110 3928 854 311 --
NM_024294chr673036 3027 2948 2461 2396 2224 2007 ------
NM_024345chr936068 1756 1480 14880 ----
NM_024429chr71107 ------
NM_024501chr21736 ------
NM_024509chr191122 ------
NM_024524chr322474 2032 ------
NM_024539chrX1406 ------
NM_024545chr21535 --166 --
NM_024554chr121154 1086 --1481 --
NM_024615chr5--1197 ----
NM_024624chr21458 ------
NM_024636chr742263 2011 775 377 ------
NM_024665chr313871 ------
NM_024686chr11422 ------
NM_024812chr831857 1714 764 ------
NM_024830chr562151 2089 1884 1681 274 210 --22163 143 --
NM_024887chr181980 1842 1734 1655 1610 250 200 48 ------
NM_024913chr7------11221
NM_024915chr852309 1964 1764 792 548 22036 782 22809 859 --
NM_024923chr331306 1046 275 ------
NM_024946chr1631775 325 257 --11767 --
NM_024947chr347490 6619 2413 250 17002 22425 757 --
NM_024953chr1211774 ------
NM_024989chr2----11608 --
NM_024991chr1031165 1068 1002 ------
NM_025027chr191484 ------
NM_025083chr1571840 1369 1303 656 511 480 370 --11477 --
NM_025133chr211134 ------
NM_025134chr161864 12269 ----
NM_025146chr311670 12171 ----
NM_025160chr1--22806 656 11637 --
NM_025208chr1121612 55 ------
NM_025222chr362667 739 718 707 294 37 12691 12661 --
NM_025248chr17123240 3140 3003 2203 1134 1014 1003 841 793 761 521 132 --11095 --
NM_030627chr51630 ------
NM_030637chr14--188 ----
NM_030647chr735604 262 213 ------
NM_030648chr423563 428 ----12200
NM_030650chr233590 3541 2937 --13662 --
NM_030674chr1223597 3579 14862 ----
NM_030759chr10--1322 ----
NM_030761chr172603 2537 1912 1718 1015 904 378 ------
NM_030784chr6198 ------
NM_030791chr14134 ------
NM_030806chr1107955 6981 6854 6744 3305 2675 2647 1864 1384 873 --47380 6972 2743 1359 --
NM_030816chr112701 ------
NM_030881chr2212202 --1413 --
NM_030885chr362132 1517 1462 205 136 22 ------
NM_030918chr165157 5111 3956 3850 1534 110 ------
NM_030937chr161347 1177 1081 606 272 248 11237 ----
NM_030939chr621099 393 ------
NM_030959chr6------1290
NM_031157chr121247 ------
NM_031216chr181312 ------
NM_031243chr721786 897 ------
NM_031262chr91160 ------
NM_031263chr91217 ------
NM_031417chr1952653 2277 1746 532 401 12479 22324 462 --
NM_031426chr982608 2544 2538 2511 1795 274 247 170 --52717 2445 2420 722 113 --
NM_031435chr1211354 ------
NM_031445chr242719 543 248 162 1169 ----
NM_031468chr7107303 6656 6418 6303 6223 5535 2117 1719 467 202 --1485 12386
NM_031475chr11517 ------
NM_031478chr167602 592 294 260 237 63 55 --1269 --
NM_031483chr2022275 1325 --12433 --
NM_031844chr132683 647 248 ------
NM_031845chr221117 918 ------
NM_031847chr221117 918 ------
NM_031886chr1972605 2305 1786 1036 660 67 55 --1992 --
NM_032013chr2021644 1541 11617 ----
NM_032051chr22----2618 23 --
NM_032121chrX1831 ------
NM_032139chr19----1291 --
NM_032144chr211802 ------
NM_032182chr10----2565 59 --
NM_032189chr1391819 1598 1523 1423 1400 1188 1130 735 547 ------
NM_032221chr2041834 1339 1331 352 ------
NM_032242chr3122964 2958 2734 2640 2226 1078 900 755 684 462 329 314 ------
NM_032281chr19142894 2876 2852 2840 2701 2682 2655 2574 2348 759 744 541 174 125 2938 768 22921 369 --
NM_032294chr1731297 209 203 --41762 1335 512 97 --
NM_032311chr224399 115 41 31 --31686 765 361 --
NM_032315chr1--1231 ----
NM_032364chr122903 46 ------
NM_032373chr1025402 5342 --13660 1933
NM_032379chr111374 ------
NM_032408chr721029 841 ------
NM_032413chr151116 ------
NM_032432chr411028 ------
NM_032434chr211164 --11537 --
NM_032449chr182079 2026 737 725 699 550 478 131 ----12139
NM_032457chr413644 ----1100
NM_032458chrX32977 1364 420 11098 ----
NM_032468chr81372 ------
NM_032521chr2022644 676 12163 ----
NM_032558chr911266 ------
NM_032588chr1149 ------
NM_032590chr121274 --21128 67 --
NM_032595chr1791498 1427 1141 1072 1033 528 367 361 241 --4393 272 262 162 --
NM_032632chr14180 ------
NM_032664chr811560 ------
NM_032687chr8125 ------
NM_032689chr1921251 622 ------
NM_032812chr101317 ------
NM_032842chr731094 570 406 ------
NM_032875chr171121 1105 ----
NM_032900chr1053767 3747 2823 1114 1043 --22989 981 --
NM_032924chr72725 411 ------
NM_032943chr111374 ------
NM_032983chr742974 2196 1119 298 ------
NM_033016chr2211316 133 11575 --
NM_033020chr11624 14456 11269 --
NM_033027chr34906 854 365 63 --2983 206 --
NM_033044chr141042 1032 322 304 --1494 --
NM_033102chr17931 925 366 273 210 77 29 1326 1173 --
NM_033102chr17931 925 366 273 210 77 29 1326 1173 --
NM_033121chr1221866 509 181 ----
NM_033135chr1121612 55 ------
NM_033138chr711660 ----159
NM_033139chr711660 ----159
NM_033140chr711660 ----159
NM_033143chr421801 128 --13073 --
NM_033157chr711660 ----159
NM_033207chr1072103 1696 1650 295 139 59 45 --11744 --
NM_033221chr921872 968 22782 2315 ----
NM_033224chr747876 4967 4958 1857 --1543 --
NM_033225chr833155 2425 714 12166 ----
NM_033278chr11162 ------
NM_033290chrX53180 2845 957 719 135 1713 ----
NM_033315chr1772122 1965 1850 1838 472 66 47 ------
NM_033358chr2133 --1103 --
NM_033387chr972230 2207 2082 1956 1943 1037 803 12407 2607 344 --
NM_033389chr1754216 1903 921 557 135 13271 1484 --
NM_033397chr1042214 1550 1514 42 11706 ----
NM_033406chr11--140 ----
NM_033407chr11465 ------
NM_033429chr1542203 2107 1168 1132 --1790 1450
NM_033449chr5102064 1965 1888 1416 1399 741 664 522 515 273 --32004 1382 767 --
NM_033503chr1593450 2918 2729 926 495 482 442 269 206 23664 1452 23480 639 --
NM_033549chr5159 --2399 79 --
NM_033656chr2124020 223 1918 15746 --
NM_052827chr123883 867 828 --1264 1422
NM_052840chr153282 263 226 1143 31601 1016 536 --
NM_052876chr19112296 2027 1964 1078 1042 1004 905 748 716 705 414 --41071 855 512 312 --
NM_052879chr1223480 2617 --1318 --
NM_052880chr2251286 1036 906 277 170 1985 ----
NM_052898chr841764 287 155 55 --11271 --
NM_052906chr22244921 4743 4731 4365 3715 3695 3426 3231 3222 1995 1983 1890 1832 1785 1686 1469 1456 1218 830 694 434 339 96 46 1364 61316 1160 1040 791 308 40 11919
NM_052911chr181954 ------
NM_052918chr1021239 334 ------
NM_052965chr1190 --1109 --
NM_052966chr152797 2537 772 586 495 148 13793 --
NM_053016chr947631 6624 6195 4874 36922 5676 5229 16816 --
NM_053023chr1141182 986 912 753 --21192 718 1266
NM_053025chr311560 --1392 --
NM_053026chr311560 --1392 --
NM_053027chr311560 --1392 --
NM_053028chr311560 --1392 --
NM_053031chr311560 --1392 --
NM_053032chr311560 --1392 --
NM_053056chr1163054 2919 2424 2313 1074 43 --2484 272 --
NM_057175chr41442 12400 ----
NM_057178chr172108 64 ------
NM_058172chr411212 ------
NM_058191chr211897 ------
NM_078487chr92825 594 --1160 --
NM_080392chr1----1503 --
NM_080491chr1163000 2923 747 344 338 173 1837 ----
NM_080546chr921561 1519 ------
NM_080599chr101982 --1458 1242
NM_080645chr61155 ------
NM_080669chr17154025 3681 3623 3349 3227 1919 1883 1795 1789 1539 1387 1296 769 499 26 --24072 358 --
NM_080671chr21363 11892 12012 --
NM_080676chr2052977 2687 1129 557 77 ------
NM_080679chr64751 699 606 202 1897 187 --
NM_080680chr64751 699 606 202 1897 187 --
NM_080681chr64751 699 606 202 1897 187 --
NM_080717chr1221529 1175 ------
NM_080743chr622540 1784 ------
NM_080797chr20103454 3234 3060 3028 2465 2374 587 581 130 67 11084 ----
NM_080872chr843413 519 479 277 --1206 --
NM_130436chr213468 392 124 ------
NM_130443chr113327 132 80 ------
NM_130468chr155767 555 231 102 95 1186 ----
NM_130809chr51462 12905 ----
NM_130811chr201874 ------
NM_130830chr383973 3942 3747 2879 2692 2640 2513 22 --21087 275 --
NM_130838chr1511863 1325 ----
NM_130839chr1511863 1325 ----
NM_133170chr20137376 6735 6325 6309 6269 5537 2909 2638 2335 955 918 793 589 --1152 --
NM_133264chr1783935 3808 3485 2510 1491 1432 1070 845 13283 ----
NM_133265chrX62740 1438 1408 1279 95 82 ------
NM_133266chr112238 89 ------
NM_133329chr2--21518 1409 ----
NM_133370chr413237 ------
NM_133433chr52825 803 ------
NM_133477chr433012 1280 64 ------
NM_133642chr224934 493 392 321 2845 284 1876 --
NM_134325chr12701 447 --11527 --
NM_138270chrX1763 12954 --1564
NM_138292chr1132737 1157 1108 ------
NM_138316chr1011198 ------
NM_138333chr911632 ------
NM_138338chr2272681 2119 1147 1072 1000 806 702 ----1487
NM_138357chr1021677 202 --11308 --
NM_138415chr2241226 423 395 275 1612 ----
NM_138457chr673260 3055 2960 2884 1213 366 24 --42156 1358 703 235 --
NM_138473chr1224941 4444 --23287 1064 --
NM_138576chr1454290 3963 3482 958 819 --2830 177 --
NM_138578chr2061368 1001 292 284 271 127 ------
NM_138693chr72408 130 ------
NM_138713chr1655722 5210 3082 2690 1255 18080 ----
NM_138714chr1655722 5210 3082 2690 1255 18080 ----
NM_138727chr142089 417 272 90 32357 2125 260 12405 --
NM_138728chr142089 417 272 90 32357 2125 260 12405 --
NM_138735chr2----11325 --
NM_138806chr31771 ------
NM_138927chr211323 ------
NM_138931chr311000 --1430 --
NM_138967chr1552341 2285 1612 515 88 1438 151 --
NM_138970chr1421822 891 ------
NM_138980chr42511 175 ------
NM_138981chr42642 306 ------
NM_138982chr42511 175 ------
NM_139071chr121143 ------
NM_139072chr21697 ------
NM_139167chr81186 ------
NM_139283chr1252319 1993 1833 898 532 ------
NM_139321chr2053387 1503 1472 1380 1330 ----1594
NM_144568chr143636 216 91 ------
NM_144571chr464665 1797 1752 1732 1165 180 26952 5754 15956 --
NM_144574chr141524 ------
NM_144582chr262571 1751 639 217 205 27 1684 1157 --
NM_144588chr1081417 1402 586 541 463 311 286 235 1983 21294 630 --
NM_144595chr13----150 --
NM_144599chr1535107 4862 3891 ------
NM_144635chr391180 878 867 476 372 357 215 188 177 --1112 --
NM_144642chr321248 75 ------
NM_144664chr111345 ------
NM_144671chr1261422 759 629 559 375 359 11978 ----
NM_144778chr131286 ------
NM_144982chr121567 ------
NM_145074chr23470 104 70 --1222 187
NM_145112chr1421140 504 ------
NM_145113chr1431412 1082 1048 --1201 --
NM_145117chr1152615 2527 2158 1295 1078 --11172 --
NM_145176chr642867 514 405 50 13029 ----
NM_145206chr1043359 3217 2035 989 ----12883
NM_145277chr12212 151 ------
NM_145320chr723479 2785 1411 ----
NM_145321chr723479 2785 1411 ----
NM_145322chr723479 2785 1411 ----
NM_145341chr1031431 1168 197 --11407 --
NM_145349chr1751942 1611 788 769 36 11666 ----
NM_145350chr1751294 433 290 140 121 11018 2599 592 --
NM_145799chrX4854 336 195 127 11200 22558 535 --
NM_145800chrX4961 691 652 115 ------
NM_145802chrX3910 640 64 ------
NM_145912chr22114039 3967 3388 3335 1822 801 748 722 656 539 288 --34573 1674 673 --
NM_148174chr81653 1600 ----
NM_148898chr71317 ------
NM_148899chr71317 ------
NM_148977chr1011198 ------
NM_148978chr1011198 ------
NM_152244chr1741208 902 850 226 1783 1931 --
NM_152253chr2254210 4112 2693 1111 628 --1990 --
NM_152265chr11231 ------
NM_152287chr1671940 1916 781 528 420 98 90 --11672 --
NM_152309chr1032034 504 200 ------
NM_152342chr162529 115 ------
NM_152352chr1812903 --11897 1124
NM_152408chr5--154 ----
NM_152417chr811300 ------
NM_152424chrX61698 1381 1109 1067 750 556 --34351 3609 1561 --
NM_152470chr18103791 3646 3396 3385 3278 3072 2830 1176 906 890 --2961 826 --
NM_152538chr331206 505 63 --1467 --
NM_152590chr121119 ------
NM_152594chr1521811 1431 ------
NM_152653chr3--1468 ----
NM_152667chr2041536 1386 1269 617 ------
NM_152671chr2197 ------
NM_152688chr61391 ------
NM_152692chrX1167 ------
NM_152745chr7157 --1315 --
NM_152758chr8----13059 --
NM_152772chr121411 ------
NM_152789chr721060 491 ------
NM_152835chr12655 111 ------
NM_152896chr9172 --1767 --
NM_152914chr17114223 3933 3034 1726 1230 1202 1126 868 792 451 334 24379 281 ----
NM_152924chr15106423 6405 6138 5028 4804 4351 2333 2279 902 123 ------
NM_153029chr1683207 3189 3022 1602 1372 1231 791 35 1636 ----
NM_153050chr2284875 4837 4820 3911 1195 949 674 279 --23844 764 13948
NM_153051chr2284875 4837 4820 3911 1195 949 674 279 --23844 764 13948
NM_153188chr524404 1469 ------
NM_153207chr122709 648 --13767 --
NM_153228chr17171 ------
NM_153260chr151162 --11316 --
NM_153261chr1611541 ------
NM_153273chr382280 1830 1781 890 882 610 519 178 2569 101 2454 430 --
NM_153280chrX165 ------
NM_153335chr1721010 912 --11383 --
NM_153354chr5168 ----1258
NM_153367chr1062800 2692 990 224 123 78 --33725 3441 135 --
NM_153487chr694542 4053 3982 3925 3191 1669 1094 1013 124 ------
NM_153499chr1282627 2193 2079 2052 1941 1204 715 615 --1149 1541
NM_153500chr1282627 2193 2079 2052 1941 1204 715 615 --1149 1541
NM_153607chr5--11034 ----
NM_153649chr132322 2261 1585 --192 --
NM_153675chr201198 --1442 --
NM_153756chr151927 1877 1862 1412 368 ----11281
NM_153759chr231168 927 185 --21214 166 11057
NM_153828chr2169 ------
NM_153836chr251350 724 486 140 99 ------
NM_170606chr711366 ------
NM_170692chr12912 757 1995 ----
NM_170706chr124137 3876 1464 24172 3353 --
NM_170780chr31771 ------
NM_170782chr1----1388 --
NM_172206chr1731297 209 203 --41762 1335 512 97 --
NM_172216chr1282529 2095 1981 1954 1843 1106 617 517 --151 1443
NM_172226chr1282627 2193 2079 2052 1941 1204 715 615 --1149 1541
NM_172344chr2--21518 1409 ----
NM_173156chr121432 123 ------
NM_173198chr91403 --1262 --
NM_173200chr91403 --1262 --
NM_173214chr1655722 5210 3082 2690 1255 18080 ----
NM_173463chr464155 3414 2901 1355 750 372 --13454 --
NM_173468chr445504 910 437 111 --1118 --
NM_173475chr1641669 1557 358 138 ------
NM_173508chr111046 ------
NM_173532chr13668 586 164 ------
NM_173582chr11--1407 ----
NM_173595chr12165094 5024 4838 4584 4520 4092 4085 3994 3499 2055 1731 1326 1213 796 688 112 14448 34666 3922 1263 --
NM_173642chr178183 6427 6392 6098 6092 3369 1358 --26248 1622 11127
NM_174911chr852635 1000 950 549 223 12775 ----
NM_174921chr421062 244 ------
NM_174934chr11102911 2679 2504 2476 1368 712 643 495 267 181 11233 53256 2958 1332 665 486 --
NM_174963chr13700 352 215 1669 ----
NM_174964chr13700 352 215 1669 ----
NM_174965chr13719 371 234 1688 ----
NM_174966chr13700 352 215 1669 ----
NM_174967chr13719 371 234 1688 ----
NM_174968chr13700 352 215 1669 ----
NM_174969chr13700 352 215 1669 ----
NM_174970chr13719 371 234 1688 ----
NM_174971chr13700 352 215 1669 ----
NM_175058chr1151170 414 318 175 132 ------
NM_175077chr203355 208 37 ------
NM_175610chr151522 ------
NM_175629chr231168 927 185 --21214 166 11057
NM_175709chr2262922 2771 2181 874 509 79 --22565 2010 --
NM_175748chr1441887 758 646 550 1257 11622 --
NM_175854chr1332637 2088 2070 --1417 --
NM_175898chr152599 464 ------
NM_175922chr641399 1366 580 363 1414 ----
NM_177414chr11682 11313 ----
NM_177977chr1761761 1502 772 551 355 215 --31946 387 197 --
NM_177990chr201140 ------
NM_177996chr2083183 2971 2713 2104 1191 1121 785 218 ------
NM_177999chr983686 3156 1296 918 910 855 821 646 13695 ----
NM_178136chr224399 115 41 31 --31686 765 361 --
NM_178140chr512472 --1221 --
NM_178148chr61430 ------
NM_178151chrX36200 2828 2036 187 27680 354 --
NM_178152chrX36200 2828 2036 187 27680 354 --
NM_178153chrX36200 2828 2036 187 27680 354 --
NM_178426chr142185 1897 1831 551 ------
NM_178427chr142085 1797 1731 451 ------
NM_178441chr14--150 ----
NM_178454chr1--1762 ----
NM_178496chr311424 ------
NM_178554chr392978 2747 1318 1206 1072 1033 787 329 206 --160 13411
NM_178565chr811597 ------
NM_178566chr911791 ------
NM_181302chr141524 ------
NM_181308chr141524 ------
NM_181349chr732631 2008 123 --22099 383 --
NM_181457chr211257 ------
NM_181460chr211203 ------
NM_181486chr1221529 1175 ------
NM_181489chr364785 2451 2047 1873 908 498 35831 2546 1223 22221 1131 --
NM_181521chr16146861 6463 5485 5441 2502 2069 1743 1690 1472 677 523 332 206 138 12422 25533 5470 --
NM_181552chr71966 ------
NM_181672chrX----11333 --
NM_181673chrX----11333 --
NM_181839chr82371 151 ------
NM_181842chr62209 57 ------
NM_182485chr41494 ------
NM_182487chr9103971 3632 3525 1526 1290 1232 1205 110 98 47 --23779 1127 --
NM_182527chr2281886 1656 1648 1455 901 480 281 191 --21508 890 --
NM_182565chr176588 501 92 67 49 38 ------
NM_182580chr172168 2143 1888 1779 985 806 741 --21986 898 --
NM_182620chr1731665 1404 895 --1101 --
NM_182643chr852359 2353 838 611 178 ------
NM_182646chr41494 ------
NM_182666chr3179 ------
NM_182758chr1523261 2916 ----12815
NM_182765chr101636 ------
NM_182789chr51831 ------
NM_182898chr746112 4186 2013 1078 1989 ----
NM_182899chr746112 4186 2013 1078 1989 ----
NM_182943chr3------11002
NM_182948chr1----11050 12214
NM_182964chr1152615 2527 2158 1295 1078 --11172 --
NM_182970chr20134159 4069 3926 3293 3252 3050 2877 1667 1648 1626 895 675 99 11543 54236 3233 3203 2603 976 --
NM_183058chr10144 ------
NM_183323chr51831 ------
NM_183381chr31681 ------
NM_183383chr31681 ------
NM_183384chr31681 ------
NM_183397chr2084937 4276 4132 3941 3726 1702 525 341 21535 25 45032 3949 586 82 14606
NM_183422chr131342 ------
NM_194278chr1493615 3080 2803 648 456 245 222 135 54 31229 1158 1127 ----
NM_194286chr12115276 2418 2060 1867 1716 1287 1274 1166 668 146 29 11654 35316 155 98 --
NM_194301chr141230 158 ----
NM_194313chr941554 1284 682 30 ----11203
NM_194314chr144683 2147 1338 78 13711 ----
NM_194328chr932461 641 472 --13320 --
NM_194329chr932461 641 472 --13320 --
NM_194330chr932461 641 472 --13320 --
NM_194332chr932461 641 472 --13320 --
NM_194358chr1221682 663 ------
NM_194359chr1221682 663 ------
NM_194463chrX1406 ------
NM_197955chr151116 ------
NM_198040chr181179 1089 884 491 332 220 109 102 ------
NM_198158chr312164 12513 22230 1859 --
NM_198159chr312164 12513 22230 1859 --
NM_198177chr312164 12513 22230 1859 --
NM_198178chr312164 12513 22230 1859 --
NM_198225chr1021410 744 ----1487
NM_198270chrX32846 1378 1371 ------
NM_198273chr51131 ------
NM_198440chr2262429 1873 1699 827 544 454 12257 --11948
NM_198513chr831274 637 334 ------
NM_198560chr373657 3066 2911 2315 1317 909 204 13282 22969 366 --
NM_198581chr267115 7047 7011 6993 5328 2968 ------
NM_198686chr1482632 1914 1703 865 454 217 110 98 12104 ----
NM_198700chr11133 ------
NM_198794chr1411374 --1529 --
NM_198834chr172618 320 147 --1446
NM_198836chr172618 320 147 --1446
NM_198837chr172618 320 147 --1446
NM_198838chr172618 320 147 --1446
NM_198839chr172618 320 147 --1446
NM_198896chr1111946 ------
NM_199169chr2073146 2768 2266 728 441 91 27 11342 11108 --
NM_199170chr2073146 2768 2266 728 441 91 27 11342 11108 --
NM_199171chr2073146 2768 2266 728 441 91 27 11342 11108 --
NM_199188chr1223480 2617 --1318 --
NM_199190chr1223480 2617 --1318 --
NM_199262chr1751952 731 699 497 39 1178 41946 1767 669 577 --
NM_199320chr422626 1802 ------
NM_199320chr422626 1802 ------
NM_199327chr42777 242 1451 ----
NM_199342chr1146 ------
NM_201266chr2102904 2826 2781 2169 2156 1117 844 830 233 49 12522 ----
NM_201279chr2102904 2826 2781 2169 2156 1117 844 830 233 49 12522 ----
NM_201432chr1796014 5652 4847 4799 4787 4540 1526 1071 381 --45711 406 165 44 --
NM_201433chr1796014 5652 4847 4799 4787 4540 1526 1071 381 --45711 406 165 44 --
NM_201568chr121432 123 ------
NM_201569chr121432 123 ------
NM_202004chr12212 151 ------
NM_203327chr2084397 3016 2777 1782 1388 369 333 154 ------
NM_203342chr153467 2258 1222 1024 529 --12727 --
NM_203343chr153467 2258 1222 1024 529 --12727 --
NM_203349chr1521924 853 --1209 --
NM_203351chr1772321 2178 1706 347 339 257 155 --22470 52 --
NM_203372chr2----1403 1681
NM_203463chr254221 4173 3123 1491 1222 --1296 1702
NM_205860chr112410 --1687 --
NM_205861chr181980 1842 1734 1655 1610 250 200 48 ------
NM_206594chr112695 ------
NM_206595chr112695 ------
NM_206866chr2122190 550 --1635 --
NM_206876chr2--11307 ----
NM_206884chr7155 ------
NM_206885chr7155 ------
NM_206907chr522114 294 13091 1105 --
NM_206909chr842351 1769 762 47 ------
NM_206927chr111374 ------
NM_206928chr111374 ------
NM_206929chr111374 ------
NM_206930chr111374 ------
NM_207012chr1023457 1025 ------
NM_207111chr782530 2319 2268 1969 1792 957 554 498 1153 2457 416 --
NM_207116chr782530 2319 2268 1969 1792 957 554 498 1153 2457 416 --
NM_207119chr1051968 1641 1576 894 101 --21652 95 12135
NM_207304chr1321009 173 ------
NM_207371chr1031302 211 194 ------
NM_207380chr15123475 3207 3140 3124 3118 3078 2655 2639 1338 1155 1149 155 12375 ----
NM_207406chr485980 4977 2207 1405 1353 975 261 156 11297 11221 --
NM_207517chr151567 --11610 --
NM_207518chr1951321 1076 993 368 91 1141 171 --
NM_207520chr2169 ------
NM_207521chr2169 ------
NM_212471chr171295 11455 11715 --
NM_212472chr171295 11455 11715 --
NM_213606chr101511 ------
NM_213651chr11506 11506 ----
NM_213652chr12212 151 ------
NM_213653chr12212 151 ------
NM_213662chr1752134 1960 1733 1656 32 --12127 --