TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4691-3p
miRNA Sequence: CCAGCCACGGACUGAGAGUGCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr1421105 389 ------
NM_000038chr51773 --1464 --
NM_000081chr1--1370 ----
NM_000084chrX26928 4645 ------
NM_000090chr2----1919 --
NM_000092chr254482 4371 3838 133 113 --11234 --
NM_000112chr534515 400 113 ------
NM_000115chr1332499 2487 2093 ------
NM_000125chr641391 1245 1049 432 12654 ----
NM_000161chr1421523 28 11315 ----
NM_000163chr51359 21983 910 ----
NM_000167chrX2202 151 ------
NM_000170chr91182 ------
NM_000176chr563259 2491 890 369 148 21 ------
NM_000202chrX23058 887 12643 ----
NM_000210chr231980 1937 1716 ----1451
NM_000217chr1213542 ------
NM_000222chr421940 1915 1330 11797 --
NM_000248chr342755 2535 2463 1032 ------
NM_000264chr951008 854 610 571 88 11236 ----
NM_000314chr1033134 2884 373 --12890 --
NM_000332chr664562 2694 2184 2076 1314 29 12862 ----
NM_000333chr32947 349 --11161 --
NM_000337chr566316 2215 2003 1541 594 64 ------
NM_000340chr31252 ------
NM_000345chr41239 --1801 --
NM_000362chr2223650 1378 ------
NM_000368chr954043 3152 1219 484 305 ------
NM_000369chr1421204 402 ------
NM_000390chrX21119 769 --13267 --
NM_000421chr171246 172 ----
NM_000430chr1723186 405 ------
NM_000439chr531737 695 434 --178 --
NM_000448chr1132862 2274 375 22745 2569 ----
NM_000449chr12508 159 ------
NM_000451chrX21850 305 1594 1843 --
NM_000459chr91238 ------
NM_000461chr344068 1080 444 233 ------
NM_000478chr11712 ------
NM_000480chr115652 411 339 140 57 ------
NM_000489chrX22734 2374 --1932 --
NM_000533chrX21622 793 ------
NM_000544chr6_cox_hap123185 2337 ------
NM_000555chrX46124 5927 3105 556 --16851 --
NM_000615chr111754 --12268 --
NM_000617chr1232259 1717 125 11416 1795 --
NM_000618chr122400 363 ------
NM_000618chr122400 363 ------
NM_000627chr21379 ------
NM_000633chr1874892 4345 3879 1349 1328 457 334 --23713 1144 25082 1787
NM_000693chr1511762 ------
NM_000698chr101402 ------
NM_000719chr1245614 5220 909 715 --11777 12564
NM_000721chr121958 516 11054 12150 --
NM_000724chr1021871 216 1464 ----
NM_000767chr1921324 604 ------
NM_000813chr53718 237 198 ------
NM_000814chr1523924 3734 --22906 615 --
NM_000826chr4--1615 ----
NM_000829chr1121649 927 1110 ----
NM_000831chr145916 4369 703 457 21044 1003 ----
NM_000839chr34488 458 411 82 ------
NM_000868chrX22556 382 11885 ----
NM_000875chr1576121 5971 5859 5144 4664 4469 670 17001 1413 11704
NM_000891chr171293 ------
NM_000899chr1231701 658 41 ------
NM_000901chr4--197 ----
NM_000921chr122676 441 ------
NM_000922chr111976 1734 ----
NM_000926chr1179391 9385 9331 8691 8606 7330 5821 13321 ----
NM_000935chr3------177
NM_000944chr42958 810 ------
NM_000945chr221883 1744 ------
NM_000956chr141308 ------
NM_000958chr541263 1095 299 244 ------
NM_000959chr123982 3587 --13479 --
NM_000962chr992837 2815 2390 2088 841 671 468 439 227 2421 292 12885 --
NM_000965chr311110 ------
NM_000983chr141629 1471 1406 65 ------
NM_001001323chr121690 --12896 --
NM_001001330chr1011245 11064 ----
NM_001001331chr332565 1885 171 ----1861
NM_001001394chr21611 ------
NM_001001483chr112318 116 ------
NM_001001556chr1511111 1148 11613 --
NM_001001557chr83488 330 72 ------
NM_001001560chr221516 ------
NM_001001668chr1944302 3164 573 466 ------
NM_001001701chr4--11615 ----
NM_001001890chr2141709 1567 540 431 ------
NM_001001924chr811373 --11541 --
NM_001001925chr811373 --11541 --
NM_001001931chr811373 --11541 --
NM_001001933chr11564 ----1551
NM_001001974chr10--22374 422 ----
NM_001002031chr12142 --196 --
NM_001002295chr10--1842 1879 --
NM_001002843chr1521065 294 1459 ----
NM_001002860chr1423808 3124 --14360 14263
NM_001002909chr1732104 1780 1769 ------
NM_001002914chr1711057 ----1865
NM_001003652chr1888407 7686 6139 2836 2715 2545 1655 655 --18324 --
NM_001003674chr1865779 5347 4389 1880 1258 1084 ------
NM_001003675chr1865779 5347 4389 1880 1258 1084 ------
NM_001003681chr2252075 1622 844 545 93 ------
NM_001003698chr6185 --1154 1603
NM_001003699chr6185 --1154 1603
NM_001003760chr62778 60 ------
NM_001003794chr323022 993 --1464 --
NM_001003800chr942620 2304 1448 936 ------
NM_001003810chr42567 77 ------
NM_001003940chr1552719 2622 2465 1090 355 ------
NM_001003942chr1552719 2622 2465 1090 355 ------
NM_001003943chr1552723 2626 2469 1094 359 ------
NM_001004127chr131209 1399 1744 --
NM_001004304chr122853 306 1258 12536 --
NM_001004317chr644049 3571 1017 819 --13906 --
NM_001004360chr221963 1506 1404 ----
NM_001004419chr1252962 1501 1323 897 348 ------
NM_001005271chr1731145 315 250 ------
NM_001005273chr1731145 315 250 ------
NM_001005386chr232384 758 414 ------
NM_001005404chr1733673 1211 1095 1244 ----
NM_001005463chr102884 436 12300 ----
NM_001005743chr141436 ------
NM_001005744chr141436 ------
NM_001005745chr141436 ------
NM_001005861chr31740 ------
NM_001005910chr31454 ------
NM_001005911chr31454 ------
NM_001006115chr342683 1767 779 220 --1340 --
NM_001006600chr51152 ------
NM_001006617chr92424 216 ------
NM_001006619chr92424 216 ------
NM_001006620chr92424 216 ------
NM_001006621chr92424 216 ------
NM_001006641chr93675 621 560 11184 ----
NM_001006642chr93675 621 560 11184 ----
NM_001006643chr93675 621 560 11184 ----
NM_001007024chr1724002 1437 13376 13165 --
NM_001007025chr1724002 1437 13376 13165 --
NM_001007097chr933936 3113 1007 34473 3678 50 ----
NM_001007156chr1531774 1514 786 --11382 --
NM_001007237chr132223 906 185 11094 12523 --
NM_001007278chr1363534 3266 1040 1028 981 244 11661 ----
NM_001007466chr665107 4491 4349 2049 380 271 24468 1426 ----
NM_001007538chr1321197 622 1288 1549 --
NM_001007546chr221509 1235 11261 11602 --
NM_001007559chr181159 --1132 --
NM_001008220chr543896 3461 2783 2596 ------
NM_001008225chr71614 ------
NM_001008239chr1822599 1407 ------
NM_001008388chr41259 177 ----
NM_001008405chr731737 1452 593 --125 --
NM_001008408chr786105 6098 5994 4660 4582 1786 1016 405 --1569 --
NM_001008495chr832255 458 201 --12170 --
NM_001008541chr1011459 11992 ----
NM_001008541chr1011459 11992 ----
NM_001008564chr131522 --11871 --
NM_001008701chr1942882 2571 2092 583 --42408 1986 577 96 --
NM_001008707chr1431662 1258 422 ------
NM_001008938chr111102 ------
NM_001009554chr443867 1568 1166 1059 ------
NM_001009554chr443867 1568 1166 1059 ------
NM_001009555chr411133 ------
NM_001009571chr711110 ------
NM_001009899chr336486 4711 413 15001 14864 --
NM_001009958chr72431 166 ------
NM_001009993chr273631 3573 3239 3067 1736 1620 765 --13703 --
NM_001010888chrX44382 3365 602 209 ------
NM_001010891chr585789 5701 5579 1711 1091 614 421 222 1431 --11161
NM_001010922chr133459 1382 1062 21433 476 ----
NM_001010923chr611622 ------
NM_001010924chr1011032 ----1226
NM_001010927chr62424 140 ------
NM_001010971chr11210 --11001 --
NM_001010989chr161362 ------
NM_001010990chr161362 ------
NM_001011537chr32407 224 --12153 --
NM_001011538chr42774 69 ------
NM_001011551chrX1171 ------
NM_001011553chr71307 ------
NM_001011663chr10----2727 344 --
NM_001011666chr71888 22165 912 ----
NM_001011885chr1521590 711 1485 --11495
NM_001012267chr91218 --1262 --
NM_001012329chr182377 2206 1839 463 432 402 225 57 22259 2121 ----
NM_001012393chr1155172 3837 3453 1388 1302 --23811 3410 1781
NM_001012398chr162357 211 ------
NM_001012420chr1542000 974 474 183 ------
NM_001012423chr1542000 974 474 183 ------
NM_001012642chr1531806 402 81 12097 2705 655 --
NM_001012751chr1011907 ------
NM_001012756chr1912438 ------
NM_001012761chr552637 2531 1925 392 163 1311 ----
NM_001013415chr411393 1436 ----
NM_001013622chr451108 463 340 278 216 ------
NM_001013690chr1232556 1815 870 ------
NM_001013839chr171910 --2698 539 --
NM_001013843chr151314 ------
NM_001014283chr1321779 866 21644 1361 ----
NM_001014380chr1365907 5661 1873 1066 921 104 ----1820
NM_001014794chr11285 47 ------
NM_001014795chr11285 47 ------
NM_001014797chr1098025 7315 6460 6427 6089 6079 5436 2423 1875 --17105 --
NM_001014809chr43922 795 336 ------
NM_001014839chr11794 --1236 --
NM_001014841chr11794 --1236 --
NM_001015877chrX22131 2018 ----12035
NM_001015887chr331549 1277 1260 ------
NM_001017371chr22312 30 ------
NM_001017395chr343396 2878 1055 317 --12679 --
NM_001017424chr121244 520 ------
NM_001017425chr121244 520 ------
NM_001017926chr811437 11825 ----
NM_001017930chrX1983 ------
NM_001017977chr11391 ------
NM_001018008chr152517 174 1137 ----
NM_001018009chr32792 311 ------
NM_001018050chr2233241 750 596 13381 42213 1220 214 208 --
NM_001018052chr2233241 750 596 13381 42213 1220 214 208 --
NM_001018056chr92436 211 ------
NM_001018057chr1121154 261 ------
NM_001018064chr921543 234 ------
NM_001018065chr943843 1452 939 368 15391 --14397
NM_001018066chr943843 1452 939 368 15391 --14397
NM_001018067chr135034 1207 1058 ------
NM_001018068chr135034 1207 1058 ------
NM_001018069chr135034 1207 1058 ------
NM_001018074chr563259 2491 890 369 148 21 ------
NM_001018075chr563259 2491 890 369 148 21 ------
NM_001018076chr563259 2491 890 369 148 21 ------
NM_001018077chr563259 2491 890 369 148 21 ------
NM_001018100chr152322 56 ------
NM_001018108chr1531788 811 717 --12110 --
NM_001018111chr723289 2670 --21040 476 --
NM_001020658chr1----2344 111 --
NM_001020658chr1----2344 111 --
NM_001023567chr1531988 982 858 ------
NM_001024024chr14--1369 ----
NM_001024070chr14--1365 ----
NM_001024094chr563259 2491 890 369 148 21 ------
NM_001024226chr11100 --1382 --
NM_001024227chr11100 --1382 --
NM_001024228chr11100 --1382 --
NM_001024463chr15------1293
NM_001024647chr1266666 6342 5092 2741 2100 1135 24780 52 ----
NM_001024649chr54793 724 504 236 ------
NM_001024660chr32317 146 ------
NM_001024808chr121463 1898 ----
NM_001024847chr322226 495 --12028 --
NM_001024947chr51968 ------
NM_001024948chr153134 2398 2307 1063 423 ------
NM_001024959chr31581 --1344 --
NM_001024960chr31581 --1344 --
NM_001025076chr102810 572 ------
NM_001025077chr1044864 2168 1930 637 ------
NM_001025079chr352772 884 545 414 125 13282 ----
NM_001025105chr52504 418 1285 1103 --
NM_001025107chr142643 2580 2476 2013 ------
NM_001025107chr142643 2580 2476 2013 ------
NM_001025389chr115652 411 339 140 57 ------
NM_001025390chr115652 411 339 140 57 ------
NM_001025579chr1711159 --1904 --
NM_001025595chr41176 --11265 --
NM_001025603chr12508 159 ------
NM_001025616chr4----2512 83 --
NM_001025780chr911529 ------
NM_001029835chr71406 ------
NM_001029858chr663362 2937 2200 1018 769 526 ------
NM_001029861chr192693 126 ------
NM_001029863chr622692 2550 22498 88 ----
NM_001030006chr1721053 280 ------
NM_001030007chr1633312 2869 205 14004 ----
NM_001030055chr1423470 657 23723 392 ----
NM_001030059chr101317 ------
NM_001031679chr1212926 ------
NM_001031684chr231411 1245 1025 11401 ----
NM_001031685chr11928 ------
NM_001031690chr75801 657 512 455 50 --1243 --
NM_001031695chr2264681 4290 4194 1472 1268 521 --1531 --
NM_001031712chr61392 ------
NM_001031717chr32140 72 ------
NM_001031740chr141730 1424 1412 337 ------
NM_001031804chr1612689 --23962 235 --
NM_001031812chr5----1148 --
NM_001032280chr611048 --11399 --
NM_001032288chr20------11007
NM_001032296chr1332663 2630 2194 --32767 2596 1098 --
NM_001032380chr1011991 11961 11947 --
NM_001033047chr442626 2428 2205 2045 11011 ----
NM_001033049chr2121506 400 --11773 --
NM_001033059chr6----11625 --
NM_001033117chr354753 3405 159 68 39 --44668 4138 1188 962 --
NM_001033518chr71192 --11057 --
NM_001033519chr71192 --11057 --
NM_001033520chr71192 --11057 --
NM_001033557chr211285 11170 ----
NM_001033602chr1342594 2251 1888 1038 ------
NM_001034025chr121169 1135 1705 --
NM_001034845chr421331 1053 1182 ----
NM_001034852chr1412037 ------
NM_001034954chr1041012 965 765 746 ------
NM_001034955chr1041012 965 765 746 ------
NM_001034956chr1041012 965 765 746 ------
NM_001034957chr1041012 965 765 746 ------
NM_001035003chr411055 ------
NM_001035004chr411055 ------
NM_001035254chr912055 1339 11023 1381
NM_001035260chr101162 ------
NM_001035511chr131650 691 252 --1105 --
NM_001035512chr141757 1404 798 359 --1212 --
NM_001035513chr141757 1404 798 359 --1212 --
NM_001037132chr712125 11438 ----
NM_001037133chr712125 11438 ----
NM_001037164chr7182 ------
NM_001037174chr21842 ------
NM_001037290chr11----1760 --
NM_001037334chr181710 1812 ----
NM_001037954chr1163138 2673 2427 400 324 49 ------
NM_001038702chr532776 757 745 11030 1730 --
NM_001038707chr122038 1458 11636 ----
NM_001038707chr122038 1458 11636 ----
NM_001039479chr1422033 783 ------
NM_001039538chr213622 ----23184 622
NM_001039547chr397388 6615 6229 6059 5940 5491 5349 2428 2069 1777 12563 --
NM_001039574chr11275 ------
NM_001039585chr124239 3844 --13736 --
NM_001039590chrX23331 2587 31227 1110 547 ----
NM_001039591chrX23331 2587 31227 1110 547 ----
NM_001039618chr1144162 4050 4032 1161 1488 ----
NM_001039690chr1652362 2356 1618 1539 801 ------
NM_001039802chr121272 501 ------
NM_001039844chr1022916 801 --12889 --
NM_001039960chr1221691 1119 21711 1149 ----
NM_001040057chr72502 255 ------
NM_001040092chr8139 ------
NM_001040144chr1652362 2356 1618 1539 801 ------
NM_001040146chr1652362 2356 1618 1539 801 ------
NM_001040152chr735152 3657 2009 2610 369 ----
NM_001040153chr132213 68 ------
NM_001040157chr422515 1991 12655 ----
NM_001040181chr32905 183 ------
NM_001040182chr32905 183 ------
NM_001040183chr32905 183 ------
NM_001040199chr32905 183 ------
NM_001040200chr32905 183 ------
NM_001040272chr912080 ------
NM_001040284chr1634860 4670 1389 ------
NM_001040424chr2122953 2598 1980 ----
NM_001040429chr1312699 13450 ----
NM_001040446chr53998 148 90 ------
NM_001040455chr1121326 501 ------
NM_001040624chr822559 1887 ------
NM_001040625chr822559 1887 ------
NM_001040626chr822559 1887 ------
NM_001040627chr822559 1887 ------
NM_001040628chr822559 1887 ------
NM_001040629chr822559 1887 ------
NM_001040630chr822559 1887 ------
NM_001040708chr8----1993 --
NM_001040715chr162351 310 --1982 --
NM_001042388chr181642 ------
NM_001042404chr11245 ------
NM_001042406chr61957 ----1980
NM_001042413chr942870 1147 742 290 ------
NM_001042425chr611048 --11399 --
NM_001042472chr203448 227 196 ------
NM_001042494chr1543014 1370 818 567 --12970 --
NM_001042495chr1543014 1370 818 567 --12970 --
NM_001042496chr1543014 1370 818 567 --12970 --
NM_001042497chr1543014 1370 818 567 --12970 --
NM_001042506chrX21121 294 ------
NM_001042537chrX32356 815 197 ------
NM_001042539chr161192 ------
NM_001042550chr9----1207 --
NM_001042555chr1224241 330 1276 ----
NM_001042599chr267367 6722 6206 4877 970 927 1387 16767 --
NM_001042601chr342804 1302 880 242 ------
NM_001042603chr1253994 1712 340 248 73 14987 1292 15159
NM_001042604chr324174 1102 --23603 3389 --
NM_001042632chr203842 396 108 1975 ----
NM_001042633chr203842 396 108 1975 ----
NM_001042669chr4----2512 83 --
NM_001042749chrX31943 1259 366 ------
NM_001042750chrX31943 1259 366 ------
NM_001042751chrX31943 1259 366 ------
NM_001043318chr141114 11286 ----
NM_001043351chr111939 ------
NM_001044722chr5----1148 --
NM_001044723chr5----1148 --
NM_001049chr1411754 12080 ----
NM_001071775chr1321439 167 ------
NM_001083620chr4--1614 ----
NM_001099678chr325846 4747 1232 ----
NM_001106chr3107815 7633 6629 6454 3419 2671 2302 1670 1386 1177 17050 26190 2911 --
NM_001107chr14139 ------
NM_001111chr142643 2580 2476 2013 ------
NM_001113490chrX2933 279 12428 ----
NM_001116chr1642958 1231 350 66 ------
NM_001117chr1822270 613 ------
NM_001128chr1633312 2869 205 14004 ----
NM_001146chr832302 1912 213 ------
NM_001148chr4--12231 --11520
NM_001151chr4171 ------
NM_001160chr1211863 1302 1139 --
NM_001167chrX56025 4165 2577 765 485 ------
NM_001172chr143556 311 83 ------
NM_001173chr1423470 657 23723 392 ----
NM_001198chr632291 974 72 ------
NM_001219chr71279 ------
NM_001222chr1031771 355 61 ------
NM_001226chr4163 ------
NM_001227chr101311 --11353 --
NM_001241chr22858 375 --12095 --
NM_001241chr22858 375 --12095 --
NM_001256chr1752375 2063 1012 795 367 11024 ----
NM_001257chr1621562 1262 ------
NM_001259chr721663 51 16070 ----
NM_001271chr15--3771 447 132 ----
NM_001280chr192443 37 ----1666
NM_001282chr1721053 280 ------
NM_001300chr101355 ------
NM_001304chr171339 13377 ----
NM_001310chr1232269 2064 1202 12408 ----
NM_001313chr43922 795 336 ------
NM_001315chr642243 1998 1735 467 ------
NM_001331chr111989 --1141 12363
NM_001332chr511465 ----21550 290
NM_001346chr322632 1781 --1260 --
NM_001356chrX32515 2237 202 1921 ----
NM_001358chr4--1288 ----
NM_001364chr1111334 13389 14135 --
NM_001365chr172615 511 ------
NM_001386chr832059 2050 1814 11892 22464 589 --
NM_001390chr1853248 3206 2967 2473 325 --12936 --
NM_001396chr2132328 1066 694 11046 --11983
NM_001406chr1741591 1411 1324 350 --1715 --
NM_001408chr121622 1399 ------
NM_001418chr111619 ------
NM_001418chr111619 ------
NM_001419chr1954777 3859 2999 1603 1377 1472 ----
NM_001420chr1922499 883 ------
NM_001429chr224762 252 214 147 1396 ----
NM_001430chr22637 611 11441 ----
NM_001438chr122462 1374 ------
NM_001440chr852433 1825 1012 443 310 --11970 --
NM_001451chr1611188 1440 ----
NM_001452chr61545 ------
NM_001453chr611452 ------
NM_001458chr71616 ------
NM_001495chr831191 1029 375 ------
NM_001530chr14142 --11115 --
NM_001542chr132223 906 185 11094 12523 --
NM_001543chr544401 4153 1507 1062 --11223 --
NM_001570chr321287 303 ----1293
NM_001634chr6----11625 --
NM_001650chr1823511 1170 ----14095
NM_001655chr1131842 1676 1576 21756 66 ----
NM_001656chr521334 35 --11817 --
NM_001658chr11100 --1382 --
NM_001659chr1232716 2406 2186 11672 21946 333 --
NM_001660chr31596 ------
NM_001662chr71397 ------
NM_001663chr1432739 2342 2024 ------
NM_001679chr31288 ------
NM_001682chr121404 --12610 --
NM_001683chr332565 1885 171 ----1861
NM_001701chr941591 1429 1361 996 ------
NM_001709chr1152468 2429 1955 243 143 1650 ----
NM_001714chr121195 ------
NM_001717chr153946 936 339 ----11271
NM_001731chr121264 ------
NM_001746chr54793 724 504 236 ------
NM_001753chr7--2272 119 ----
NM_001754chr2141709 1567 540 431 ------
NM_001755chr1621763 897 ------
NM_001759chr1234612 1907 64 21838 1311 ----
NM_001777chr352772 884 545 414 125 13282 ----
NM_001788chr71307 ------
NM_001791chr121272 501 ------
NM_001802chr162232 159 1811 ----
NM_001821chr123796 98 --21527 695 --
NM_001845chr1311104 ------
NM_001851chr62740 22 ------
NM_001858chr624348 1647 --1364 --
NM_001873chr41657 ------
NM_001880chr2----197 --
NM_001892chr52504 418 1285 1103 --
NM_001894chr22----11244 1506
NM_001904chr33192 103 86 ------
NM_001931chr112316 82 ------
NM_001938chr121419 612 ------
NM_001939chrX43535 3479 1524 1501 1807 --11003
NM_001964chr511092 ------
NM_001969chr1463583 3244 1582 1459 1032 952 ------
NM_001995chr43932 595 467 ------
NM_001999chr521328 210 ------
NM_002006chr445516 1929 1175 1057 --11391 15381
NM_002009chr152374 253 ----11760
NM_002014chr122132 122 ----1505
NM_002015chr1323020 1040 ------
NM_002019chr132747 595 ------
NM_002025chrX69190 9102 6927 2987 1389 1058 59236 6192 1848 1825 815 37259 6918 6906 11902
NM_002039chr41877 ------
NM_002040chr2113113 ----12668
NM_002044chr1511111 1148 11613 --
NM_002048chr93109 85 25 ------
NM_002051chr10--1842 1879 --
NM_002052chr821483 1355 ------
NM_002056chr21802 ------
NM_002061chr131658 1359 1239 ------
NM_002063chrX11147 ------
NM_002076chr122823 313 12761 2730 208 --
NM_002086chr172645 144 ------
NM_002092chr423436 1073 24979 1553 --13531
NM_002126chr1722792 1356 ------
NM_002130chr51425 ------
NM_002137chr742400 2294 1709 1506 11562 ----
NM_002138chr42567 77 ------
NM_002140chr91307 ------
NM_002141chr73656 214 177 ------
NM_002148chr21628 ------
NM_002181chr21226 ------
NM_002199chr4----124 --
NM_002203chr51262 1871 11329 --
NM_002206chr122456 448 --130 --
NM_002226chr141371 --1592 --
NM_002235chr1221527 1084 ------
NM_002247chr10----1152 --
NM_002264chr364858 4325 3909 798 514 306 ------
NM_002266chr17191 ------
NM_002267chr1321797 1737 ------
NM_002268chr321596 1497 --1588 --
NM_002270chr534964 4745 4135 ----1897
NM_002293chr152717 2570 2365 2253 1815 22588 659 ----
NM_002309chr2222279 759 --22191 80 --
NM_002334chr1131612 839 671 ------
NM_002336chr1224040 1924 160 14549 --
NM_002356chr622811 2209 ------
NM_002358chr4146 ------
NM_002359chr1763522 3434 3160 706 627 61 --1964 --
NM_002372chr51453 ------
NM_002374chr213622 ----23184 622
NM_002376chr141479 ------
NM_002397chr532208 1401 742 ------
NM_002399chr1511040 ------
NM_002408chr141655 ------
NM_002409chr2273170 2955 2393 2152 1140 983 629 ------
NM_002430chr2222480 1769 ------
NM_002473chr2221084 908 ------
NM_002481chr187886 7528 7429 6741 2060 1915 1451 1229 --15739 --
NM_002486chr962302 2220 2019 1806 1664 483 1406 ----
NM_002487chr152619 222 ------
NM_002499chr1511578 12292 --1468
NM_002500chr211023 --1275 --
NM_002505chr621503 141 ------
NM_002509chr202637 88 ------
NM_002515chr1412009 11445 ----
NM_002518chr21479 ------
NM_002522chr1743506 3490 3439 559 23705 695 1347 --
NM_002536chrX31262 494 252 ------
NM_002538chr51126 ------
NM_002545chr1155172 3837 3453 1388 1302 --23811 3410 1781
NM_002556chr112481 173 22018 1598 ----
NM_002576chr1131156 1112 250 ------
NM_002595chr1221696 382 ------
NM_002605chr1511194 ------
NM_002607chr711208 ----1994
NM_002628chr32927 403 ------
NM_002636chr6--1199 ----
NM_002641chrX11374 ----1675
NM_002655chr835010 4027 351 13292 ----
NM_002670chr31357 ------
NM_002677chr832908 715 26 ------
NM_002709chr22368 351 13545 ----
NM_002710chr121718 ------
NM_002714chr611029 ------
NM_002719chr1422335 351 ------
NM_002725chr164219 3819 2933 1369 695 247 --11067 --
NM_002732chr9151 ------
NM_002736chr731508 632 51 ------
NM_002745chr2264424 4117 3417 3021 315 156 1538 ----
NM_002755chr153636 342 43 ------
NM_002756chr171972 ------
NM_002758chr17--1414 ----
NM_002763chr11191 1371 ----
NM_002791chr141128 ------
NM_002806chr142274 25 ------
NM_002828chr182384 207 ------
NM_002843chr1123393 799 ------
NM_002850chr1921210 1029 --11021 --
NM_002855chr112637 234 ------
NM_002857chr122698 224 ------
NM_002858chr12846 248 ------
NM_002859chr1211759 ------
NM_002868chr1252363 1515 824 716 555 ------
NM_002886chr334552 949 220 34080 1545 257 13574 --
NM_002890chr51743 ------
NM_002892chr1411161 ------
NM_002906chr1131877 1619 320 ------
NM_002955chr6185 --1154 1603
NM_002958chr31740 ------
NM_002959chr141495 1007 982 66 ------
NM_002971chr321189 1132 ------
NM_002973chr121502 ------
NM_002994chr421616 312 ------
NM_003001chr141757 1404 798 359 --1212 --
NM_003016chr1741930 1735 1672 201 1349 ----
NM_003026chr921060 283 1141 ----
NM_003030chr331626 1398 214 ------
NM_003036chr1--11094 1791 --
NM_003051chr11619 1493 ----
NM_003070chr91792 ------
NM_003081chr203985 444 226 1844 ----
NM_003099chr1544455 4006 414 309 12632 15363 --
NM_003100chr51121 ------
NM_003108chr277170 6873 6686 6121 6044 5098 1155 --12172 --
NM_003111chr22312 30 ------
NM_003112chr712052 ------
NM_003128chr222654 421 ----1111
NM_003131chr642195 2120 1795 853 ------
NM_003136chr141406 ------
NM_003139chr112302 132 ------
NM_003150chr1752257 1663 606 269 110 ------
NM_003155chr832543 2290 588 12618 ----
NM_003156chr1141201 1102 863 478 ------
NM_003161chr1742234 1284 687 601 1964 ----
NM_003162chr21268 ------
NM_003178chr33645 304 165 ------
NM_003179chrX21345 943 --11253 --
NM_003182chr71217 ------
NM_003182chr71217 ------
NM_003183chr23811 799 158 ------
NM_003189chr11412 1569 1707 --
NM_003199chr1835565 5127 2023 25616 3584 11139 14390
NM_003200chr1942316 2030 1795 1619 ------
NM_003215chr431473 1119 62 ------
NM_003217chr1221255 128 --11353 --
NM_003220chr611048 --11399 --
NM_003221chr624080 3505 1407 1569 --
NM_003239chr142805 362 1134 ----
NM_003242chr322226 495 --12028 --
NM_003244chr18--1429 ----
NM_003247chr621400 81 ------
NM_003256chr31402 ------
NM_003257chr151893 ------
NM_003262chr311482 161 --11308
NM_003274chr212932 675 11044 ----
NM_003275chr91112 --1153 --
NM_003286chr20144 ------
NM_003298chr346212 5303 1163 637 12477 ----
NM_003339chr521390 989 11546 ----
NM_003342chr1762998 2863 2782 2651 1189 127 --12223 --
NM_003345chr162568 382 ------
NM_003349chr20------11007
NM_003370chr193193 182 157 191 ----
NM_003372chrX2363 23 1762 ----
NM_003383chr92436 211 ------
NM_003387chr22765 239 11159 1759 --
NM_003392chr353283 3033 1388 1111 159 ------
NM_003403chr141582 ------
NM_003404chr20----11935 --
NM_003405chr222631 188 ------
NM_003406chr82288 147 ------
NM_003410chrX1750 --1589 --
NM_003412chr322018 1952 ------
NM_003413chrX11723 ------
NM_003418chr3142 ------
NM_003427chr6------2530 87
NM_003442chr111668 ------
NM_003453chr132691 184 ------
NM_003463chr633206 1179 436 ------
NM_003468chr244171 3568 3472 865 ------
NM_003472chr62603 302 ------
NM_003474chr10--12147 12356 --
NM_003482chr1212353 ----1865
NM_003483chr1212344 11165 ----
NM_003488chr172821 630 ------
NM_003489chr2153093 2312 789 580 214 ------
NM_003557chr121381 1212 ------
NM_003566chr1222312 101 ------
NM_003574chr1874765 4000 3536 2286 1484 893 290 22091 1940 ----
NM_003576chr1332663 2630 2194 --32767 2596 1098 --
NM_003580chr82459 128 ------
NM_003583chr1233645 3299 1124 13728 ----
NM_003586chr161621 ------
NM_003590chr2----12562 --
NM_003597chr211867 2679 567 ----
NM_003598chr191174 ------
NM_003603chr42431 354 ------
NM_003618chr22952 409 ------
NM_003619chr41504 ------
NM_003629chr132698 1253 25 ------
NM_003633chr572461 2321 984 745 643 491 398 1501 1769 --
NM_003634chr223787 781 377 ------
NM_003636chr13492 375 94 ------
NM_003659chr2159 ------
NM_003663chr333228 3063 69 2883 839 ----
NM_003670chr32588 404 ------
NM_003671chr931222 785 292 13450 ----
NM_003680chr11188 --1491 --
NM_003701chr131979 ------
NM_003743chr211711 ------
NM_003744chr141436 ------
NM_003759chr473980 3634 2930 2782 1315 1223 202 --12936 --
NM_003772chr111134 ------
NM_003787chr1811285 ------
NM_003800chr62720 98 ------
NM_003825chr1511022 ----1383
NM_003872chr231870 857 211 12938 ----
NM_003883chr5274 51 ------
NM_003884chr321778 60 ------
NM_003885chr1762635 2599 2244 1847 381 348 ------
NM_003887chr222204 185 ------
NM_003895chr2121734 623 ------
NM_003902chr1------1272
NM_003908chr201990 11285 2127 46 --
NM_003913chr622771 256 ----1315
NM_003916chrX----11381 --
NM_003934chr92489 371 ------
NM_003936chr211015 ------
NM_003939chr1033752 3598 980 ------
NM_003941chr722131 1739 12164 ----
NM_003951chrX3354 295 148 ------
NM_003955chr1721384 416 ------
NM_003957chr112770 364 ------
NM_003972chr10--1868 11201 --
NM_003980chr6--11258 ----
NM_003982chr141250 ------
NM_003994chr1231701 658 41 ------
NM_003998chr41489 1227 ----
NM_004028chr1823511 1170 ----14095
NM_004050chr1411754 --2440 33 --
NM_004079chr142733 2324 852 154 ------
NM_004080chr71117 ------
NM_004087chr322012 371 ------
NM_004093chr132748 328 ------
NM_004094chr1422107 54 ------
NM_004096chr1031803 1583 381 12026 ----
NM_004098chr10----1987 --
NM_004103chr81161 ----1857
NM_004113chr331692 438 126 ------
NM_004124chr1453506 3037 2840 2425 1019 12558 ----
NM_004136chr1523077 2971 ----12890
NM_004145chr192638 305 --1701 --
NM_004157chr31128 ------
NM_004161chr211416 --2534 286 --
NM_004171chr1179211 8599 8258 7867 6488 6478 1031 1681 29158 3783 --
NM_004181chr41309 ------
NM_004209chr161824 --1976 --
NM_004227chr723109 3076 --2261 169 --
NM_004229chrX41851 809 741 721 ------
NM_004232chr181634 ------
NM_004235chr91667 ------
NM_004242chr61414 ------
NM_004268chr111333 ------
NM_004280chr6--1321 ----
NM_004296chr1423966 1222 --2950 675 --
NM_004305chr2162 ------
NM_004311chr1033005 2808 2517 --12507 --
NM_004319chr142700 2099 1984 213 ------
NM_004321chr243584 3402 2478 1216 --22806 1205 --
NM_004323chr942233 1941 1695 533 --1212 1635
NM_004326chr111136 ------
NM_004329chr101229 ------
NM_004337chr8159 ------
NM_004338chr1865779 5347 4389 1880 1258 1084 ------
NM_004342chr72628 509 ------
NM_004346chr421366 21 ------
NM_004349chr821310 1004 ------
NM_004368chr191368 --1711 --
NM_004380chr1612324 1601 ----
NM_004384chr5----1148 --
NM_004392chr132398 190 ------
NM_004393chr32660 274 --22146 876 --
NM_004397chr1143974 3336 2930 2859 ------
NM_004420chr1142171 2061 1861 799 ------
NM_004423chr342676 2641 1713 649 ------
NM_004426chr1241651 582 485 160 --1633 --
NM_004432chr92943 378 ------
NM_004434chr1431662 1258 422 ------
NM_004438chr233046 526 467 --22260 2235 --
NM_004441chr32972 867 ------
NM_004449chr2111056 1544 ----
NM_004454chr34583 173 89 70 --1775 1679
NM_004458chrX147 ------
NM_004459chr17146 ------
NM_004472chr5167 ------
NM_004497chr193704 502 33 ------
NM_004498chr152294 284 ------
NM_004501chr143358 3346 1308 670 ------
NM_004505chr1711749 --12007 --
NM_004514chr1721992 693 --197 --
NM_004516chr191115 1444 ----
NM_004517chr11285 47 ------
NM_004523chr1021589 122 ------
NM_004529chr931212 350 68 ------
NM_004537chr1211431 ------
NM_004566chr1041748 1599 672 584 12584 ----
NM_004573chr15160 2602 527 1117 --
NM_004575chr42562 288 ------
NM_004586chrX35225 1904 1494 23845 3737 11700 --
NM_004588chr1143910 3130 1141 370 --23943 2584 --
NM_004598chr533081 1019 378 ------
NM_004606chrX2393 54 ------
NM_004612chr923010 1304 ------
NM_004622chr232391 971 446 ------
NM_004630chr1111205 ------
NM_004635chr331164 917 421 11047 2894 339 --
NM_004637chr311213 ------
NM_004654chrY11371 1521 ----
NM_004660chrY1929 ------
NM_004685chr1311064 12367 1853 --
NM_004687chr1731806 1583 86 --11909 --
NM_004694chr173343 255 36 ------
NM_004713chr142618 327 ------
NM_004725chr1011240 ------
NM_004730chr51292 ------
NM_004733chr3--1136 ----
NM_004736chr111484 1398 ----
NM_004747chr1021141 347 11126 ----
NM_004774chr1722026 927 ------
NM_004788chr11162 --12496 --
NM_004796chr1431742 1688 299 ------
NM_004799chr1----1165 --
NM_004800chr131225 ------
NM_004801chr221547 596 --1518 --
NM_004805chr21224 --11114 --
NM_004815chr174824 4803 4646 3856 3843 3822 1289 ------
NM_004822chr1753204 2463 989 719 567 ------
NM_004834chr211278 ------
NM_004836chr21243 1656 ----
NM_004844chr32792 311 ------
NM_004849chr611185 21514 375 ----
NM_004850chr211521 1217 11725 --
NM_004857chr142646 597 ------
NM_004859chr1742963 2715 1223 1136 ------
NM_004863chr1485243 4671 4659 4009 3661 1571 1527 924 ------
NM_004866chr544109 3504 884 655 14537 ----
NM_004871chr1724002 1437 13376 13165 --
NM_004896chr10177 ------
NM_004902chr201708 ------
NM_004904chr71888 22165 912 ----
NM_004921chr11247 ------
NM_004924chr191967 ----1979
NM_004929chr82508 135 ------
NM_004947chr341013 583 457 203 ------
NM_004956chr724528 4404 ------
NM_004966chr10------1662
NM_004973chr631700 1493 483 1278 11567 --
NM_004976chr1111002 --13328 --
NM_004979chrX1401 1858 --11154
NM_004985chr1224371 3264 ------
NM_004992chrX67842 5527 2785 562 532 150 --12919 --
NM_004992chrX67842 5527 2785 562 532 150 --12919 --
NM_004993chr141408 --11476 --
NM_005010chr712125 11438 ----
NM_005022chr17----1191 --
NM_005045chr7----1827 1764
NM_005056chr1264238 1956 584 492 317 78 25231 117 2536 66 15403
NM_005057chr1------11840
NM_005063chr1043344 3217 1013 416 --33030 2775 702 --
NM_005065chr1445367 4846 861 241 ----11076
NM_005088chrX1719 ------
NM_005095chr121573 377 ------
NM_005116chr2044105 3750 3191 559 --21393 1100 --
NM_005119chr14967 960 953 56 ------
NM_005121chr1723400 865 ------
NM_005126chr31317 ------
NM_005134chr181642 ------
NM_005135chr1543014 1370 818 567 --12970 --
NM_005140chrX3885 816 212 ------
NM_005151chr181710 1812 ----
NM_005153chr16183 1206 ----
NM_005156chr955083 4695 3991 3424 1198 12156 ----
NM_005157chr921930 1872 ----182
NM_005160chr2235421 5050 2400 12172 ----
NM_005176chr12142 --196 --
NM_005178chr191395 ------
NM_005187chr1631929 1781 436 ------
NM_005188chr11117604 7422 7089 2747 2542 2329 1903 1338 1318 1219 139 --27682 389 --
NM_005197chr1435843 4973 2285 11665 13914 1331
NM_005207chr2243274 2500 1024 399 ------
NM_005222chr7--1727 1654 --
NM_005229chrX1323 ------
NM_005233chr332116 1985 351 --140 --
NM_005235chr267367 6722 6206 4877 970 927 1387 16767 --
NM_005238chr1132704 1368 60 --12918 --
NM_005240chr13644 314 185 ------
NM_005243chr221312 ------
NM_005257chr181367 ----1574
NM_005259chr221218 167 ------
NM_005261chr8198 1862 ----
NM_005313chr1521313 207 ------
NM_005324chr1712026 --1851 --
NM_005328chr8--1663 ----
NM_005336chr231835 326 152 --12038 --
NM_005342chrX1165 ------
NM_005349chr4188 ------
NM_005358chr1321756 1523 --150 11900
NM_005359chr1856502 6467 5941 2622 796 ------
NM_005376chr121154 926 ------
NM_005387chr112675 660 ------
NM_005392chr921798 564 ------
NM_005397chr723289 2670 --21040 476 --
NM_005400chr242496 2481 1923 1061 ------
NM_005402chr71488 ------
NM_005417chr2021993 1241 ------
NM_005426chr11928 ------
NM_005433chr1832087 1835 137 --12109 --
NM_005436chr1042971 1057 783 249 --1647 --
NM_005440chr1742841 2300 559 95 ------
NM_005458chr95928 439 373 113 89 ------
NM_005479chr1031467 1422 1054 ------
NM_005487chr2252075 1622 844 545 93 ------
NM_005493chr61706 ------
NM_005497chr1765480 5468 5138 4236 3764 2317 ------
NM_005502chr91620 --12810 127
NM_005522chr721163 513 ------
NM_005523chr731193 253 179 ------
NM_005524chr31113 ------
NM_005540chr131386 1203 1144 ------
NM_005563chr13794 604 336 ------
NM_005578chr3--1319 ----
NM_005595chr13319 254 198 ------
NM_005596chr935190 1707 1140 ------
NM_005599chr11308 ------
NM_005602chr31180 ------
NM_005603chr182518 219 1790 ----
NM_005604chr622495 900 ------
NM_005607chr8--1136 ----
NM_005611chr1611012 ------
NM_005614chr71435 --1963 --
NM_005630chr321954 498 ----1454
NM_005631chr731041 406 263 ------
NM_005637chr181159 --1132 --
NM_005647chrX21182 561 1322 ----
NM_005657chr151163 ------
NM_005667chr22157 80 ------
NM_005686chr13518 472 375 ------
NM_005688chr341169 1159 868 496 ------
NM_005704chr12965 845 ------
NM_005718chr31581 --1344 --
NM_005722chr232384 758 414 ------
NM_005737chr23687 624 67 --1733 --
NM_005738chr7182 ------
NM_005746chr72772 697 ------
NM_005748chr1222572 503 ----1235
NM_005766chr1341087 958 884 393 --21140 31 --
NM_005782chr172230 60 --174 --
NM_005798chr1363534 3266 1040 1028 981 244 11661 ----
NM_005806chr2111308 ------
NM_005822chr621467 103 ------
NM_005832chr32214 208 ------
NM_005840chrX46557 5000 4671 240 17361 ----
NM_005852chr1731145 315 250 ------
NM_005863chr1021020 129 ------
NM_005871chr101122 ------
NM_005898chr1141960 603 450 322 ------
NM_005899chr1711292 ------
NM_005901chr1888407 7686 6139 2836 2715 2545 1655 655 --18324 --
NM_005904chr181130 ------
NM_005909chr51751 ------
NM_005924chr711025 ------
NM_005927chr521153 321 ------
NM_005930chr14----1332 --
NM_005933chr1132277 539 499 1129 ----
NM_005935chr454248 1786 579 183 171 23273 1258 --24489 1186
NM_005937chr1743158 2809 2695 337 ------
NM_005955chr162194 1890 853 781 333 244 --15130 --
NM_005962chr1011459 11992 ----
NM_005962chr1011459 11992 ----
NM_005964chr1731413 1097 320 ------
NM_005966chr2----11757 --
NM_005990chr532411 1846 511 --122 --
NM_006007chr934030 3980 978 14038 --14297
NM_006011chr1532727 105 28 11703 ----
NM_006015chr11475 ------
NM_006016chr631777 897 426 --1224 11463
NM_006022chr132739 27 1920 ----
NM_006037chr224290 3153 --1709 --
NM_006038chr203809 189 139 11577 ----
NM_006040chr16--1225 --1475
NM_006047chr2022942 1260 1145 13225 --
NM_006063chr2136 ------
NM_006080chr712824 --1431 --
NM_006095chr424344 345 ------
NM_006106chr1153457 2719 1326 1090 765 12862 ----
NM_006108chr1152066 660 562 119 55 ------
NM_006136chr71947 ----1419
NM_006141chr1632721 1722 233 --12134 12423
NM_006145chr192356 180 ------
NM_006156chr141241 ------
NM_006158chr831289 373 206 11794 1451 --
NM_006159chr12--1595 ----
NM_006178chr1731413 1284 649 ------
NM_006180chr921543 234 ------
NM_006183chr121118 ------
NM_006186chr21364 ------
NM_006195chr91498 ------
NM_006201chrX11084 ------
NM_006209chr8139 ------
NM_006224chr1732423 700 535 ------
NM_006237chr1341912 1603 827 762 ------
NM_006246chr1411192 ------
NM_006251chr513300 ------
NM_006252chr177111 7034 6552 5731 4873 2870 331 16889 26947 2277 24588 1036
NM_006256chr121777 175 ------
NM_006267chr221730 547 ------
NM_006279chr11232 --1830 --
NM_006283chr853441 3093 1774 422 40 ------
NM_006293chr152280 245 160 ----
NM_006306chrX44915 3876 3659 3646 --11541 --
NM_006310chr1731234 506 289 ------
NM_006311chr17156 ------
NM_006315chr454029 3886 1165 944 894 ----21318 674
NM_006317chr5----1695 --
NM_006321chr352235 1605 1372 707 246 --22065 40 --
NM_006352chr131709 1446 441 ------
NM_006357chr21406 ------
NM_006359chrX32356 815 197 ------
NM_006362chr11163 ------
NM_006364chr141936 ------
NM_006375chrX2561 240 --11240 --
NM_006379chr7----1283 12101
NM_006380chr1763411 3143 1711 1441 1018 746 13211 ----
NM_006386chr2232287 1959 742 12180 ----
NM_006389chr1141331 1194 316 192 ----1327
NM_006391chr11164 ------
NM_006401chr9144 ------
NM_006403chr61198 11733 ----
NM_006411chr61824 --11007 --
NM_006420chr2012375 1617 ----
NM_006434chr1041012 965 765 746 ------
NM_006439chr41394 ------
NM_006454chr442277 2262 878 542 --11917 --
NM_006459chr1011481 ------
NM_006464chr254661 3278 1641 1574 279 24465 3686 ----
NM_006465chr1532295 1857 1597 ------
NM_006469chr131488 1369 1015 ------
NM_006482chr1233645 3299 1124 13728 ----
NM_006486chr223616 438 275 1214 ----
NM_006489chr1412009 11445 ----
NM_006496chr11353 1713 ----
NM_006509chr191366 ------
NM_006517chrX52005 1713 1569 556 514 --12171 --
NM_006527chr4197 ------
NM_006546chr1745235 4420 4050 2100 14804 12578 1701
NM_006547chr721812 722 ------
NM_006549chr1242488 2211 452 212 --21943 416 --
NM_006561chr102810 572 ------
NM_006565chr161914 ------
NM_006572chr1711342 --13043 1166
NM_006589chr1288 52 ------
NM_006595chr111224 ------
NM_006599chr1697972 7320 6874 6180 3067 3015 2899 1487 59 12696 --13241
NM_006603chrX31943 1259 366 ------
NM_006609chr21252 --11123 --
NM_006612chr172504 412 ------
NM_006614chr323116 2620 ------
NM_006622chr52405 145 --1469 --
NM_006625chr11837 ------
NM_006625chr11837 ------
NM_006625chr11837 ------
NM_006646chr1332813 2642 1134 ------
NM_006650chr543896 3461 2783 2596 ------
NM_006654chr1224241 330 1276 ----
NM_006667chrX21106 908 ------
NM_006698chr2021088 250 --1218 --
NM_006717chr933123 2777 2118 13110 ----
NM_006722chr342755 2535 2463 1032 ------
NM_006729chrX44705 4674 1490 896 25264 603 14838 --
NM_006731chr945733 5021 2129 1707 ------
NM_006732chr1912056 ------
NM_006735chr7156 ------
NM_006750chr1635746 5373 1138 12432 --15175
NM_006751chr2------1961
NM_006766chr811937 ------
NM_006775chr61222 22463 2253 11071 --
NM_006777chrX22806 659 ------
NM_006788chr181296 11744 ----
NM_006805chr52658 29 ------
NM_006807chr1721132 92 1894 ----
NM_006813chr61597 1744 1714 --
NM_006815chr1211363 ------
NM_006823chr82218 105 1206 1165 --
NM_006828chr6134 --1138 --
NM_006833chr72160 131 ------
NM_006838chr1241761 1481 567 464 ------
NM_006884chr331626 1398 214 ------
NM_006885chr1633260 1439 1245 13029 --13016
NM_006888chr141179 --1775 --
NM_006920chr21558 ------
NM_006922chr232622 2375 1662 ------
NM_006930chr511330 ------
NM_006940chr1231568 384 327 ------
NM_006959chr192349 337 ------
NM_006981chr932958 877 587 --12558 --
NM_006999chr521369 637 ------
NM_007008chr21888 ------
NM_007009chr7127 ------
NM_007011chr1565693 5394 2426 1685 507 275 --45916 2530 2199 396 --
NM_007017chr51740 ------
NM_007030chr594989 4400 1811 1731 1365 1294 705 329 294 --1761 --
NM_007040chr191411 ------
NM_007042chr332387 896 279 22671 714 ----
NM_007050chr2028070 2996 ------
NM_007064chr32317 146 ------
NM_007073chr653592 3478 3462 1489 1213 --11533 --
NM_007106chr1312387 --1559 --
NM_007125chrY1506 ------
NM_007129chr1321016 385 ------
NM_007146chr1722646 151 22658 400 12257 --
NM_007156chrX2243 31 ------
NM_007157chrX31016 243 31 --12755 --
NM_007170chr12799 155 --1678 --
NM_007174chr121385 ----1175
NM_007175chr863148 2682 2496 1167 992 641 12773 ----
NM_007189chr731269 1138 1007 ------
NM_007197chr123966 751 62 ------
NM_007212chr121886 340 ------
NM_007219chr204860 844 775 80 ------
NM_007222chr811437 11825 ----
NM_007236chr1532405 922 830 12098 --12491
NM_007249chr1337423 3055 2841 11172 --26540 1658
NM_007260chr11746 ------
NM_007275chr32167 71 --1200 --
NM_007276chr711119 ------
NM_007283chr323022 993 --1464 --
NM_007313chr921930 1872 ----182
NM_007324chr1----1165 --
NM_007345chr1842249 1704 575 268 ------
NM_007350chr1224115 2900 24345 532 11785 --
NM_007358chr141958 1575 1413 1310 ------
NM_007371chr9170 ------
NM_007375chr12919 22 ----1225
NM_012064chr123732 417 194 --3873 272 132 --
NM_012081chr53671 634 98 --13725 --
NM_012082chr81231 1122 ----
NM_012083chr1031166 521 115 ------
NM_012096chr333428 743 325 ------
NM_012097chr21842 ------
NM_012104chr1133516 1208 52 --1748 --
NM_012104chr1133516 1208 52 --1748 --
NM_012156chr2022540 2152 21169 236 ----
NM_012193chr1134956 1896 715 23439 504 ----
NM_012199chr174680 4149 3058 1748 1720 1403 594 ------
NM_012200chr11181 ------
NM_012214chr265928 4033 1709 1675 1625 1271 16233 ----
NM_012215chr1031801 486 173 11291 1330 --
NM_012224chr421075 387 ------
NM_012229chr1021410 276 ------
NM_012232chr173763 560 251 22067 82 ----
NM_012234chr333557 1092 799 ------
NM_012249chr223061 870 ------
NM_012250chr1111063 ------
NM_012259chr611176 ------
NM_012262chr153683 2094 1019 563 162 11489 --15049
NM_012285chr172151 115 ------
NM_012288chr634338 334 296 --34558 1955 713 --
NM_012290chr231284 350 126 ------
NM_012295chr221407 ------
NM_012300chr52975 59 --11917 --
NM_012302chr12351 115 ------
NM_012308chr1122007 1027 ------
NM_012309chr1143446 1957 615 162 13887 24412 1744 --
NM_012316chr174938 4566 2189 1881 1749 1560 262 --1933 --
NM_012333chr131469 1462 297 ------
NM_012382chr544275 3729 3632 102 1535 ----
NM_012383chr9--1342 ----
NM_012384chr2032309 1503 42 --1541 --
NM_012402chr1121141 124 --11277 --
NM_012412chr71867 1772 ----
NM_012417chr171495 ------
NM_012419chr61613 ------
NM_012428chr15--1904 ----
NM_012454chr62424 140 ------
NM_012471chrX51818 1618 1275 577 560 ------
NM_012479chr722045 358 --1760 --
NM_013229chr1211863 1302 1139 --
NM_013230chrY1293 11823 ----
NM_013236chr221211 ------
NM_013243chr152510 146 ------
NM_013253chr1121154 261 ------
NM_013261chr423705 3435 13617 ----
NM_013269chr1252889 1428 1250 824 275 ------
NM_013281chr20--2458 450 ----
NM_013283chr51713 ------
NM_013286chr323231 251 1503 1672 --
NM_013348chr1911017 --1900 --
NM_013354chr8--170 ----
NM_013363chr3--1130 ----
NM_013365chr221516 ------
NM_013371chr12327 125 ------
NM_013374chr321068 321 ------
NM_013376chr19250 21 ------
NM_013382chr141879 --1646 11894
NM_013433chr1921838 1695 194 1798 --
NM_013434chr231964 1860 1292 --11366 1288
NM_013434chr231964 1860 1292 --11366 1288
NM_013436chr21158 1179 ----
NM_013986chr221312 ------
NM_013996chr71217 ------
NM_013996chr71217 ------
NM_013997chr71217 ------
NM_013997chr71217 ------
NM_013998chr71217 ------
NM_013998chr71217 ------
NM_014005chr521026 936 ------
NM_014010chr91474 ------
NM_014011chr232486 891 262 ------
NM_014021chr133222 1366 438 ------
NM_014023chr1062509 2383 2014 1854 960 432 ------
NM_014060chrX194 ------
NM_014089chr131522 --11871 --
NM_014106chr1542964 2867 288 259 ------
NM_014112chr81576 14913 13873 --
NM_014117chr1622726 1997 22690 2634 1133 --
NM_014141chr735033 4699 4397 21840 266 --14406
NM_014155chr1122562 1304 1522 ----
NM_014159chr32547 212 ------
NM_014190chr42659 627 ----1207
NM_014191chr121233 ------
NM_014213chr21223 --1160 --
NM_014217chr121244 520 ------
NM_014240chr363686 3658 3145 2882 2705 520 ----12950
NM_014250chr2252075 1622 844 545 93 ------
NM_014253chrX22472 2394 --1610 --
NM_014284chr11794 --1236 --
NM_014286chr962775 2581 2356 688 569 284 ----12483
NM_014292chr2221473 244 --11455 --
NM_014293chr2231432 416 117 12865 ----
NM_014294chr81556 ------
NM_014309chr2264671 4280 4184 1462 1258 511 --1521 --
NM_014319chr1231356 757 528 --1287 --
NM_014325chr1242020 1802 1646 483 ------
NM_014333chr111971 ------
NM_014338chr22123 --1112 --
NM_014342chr1111191 ------
NM_014363chr1311117 ----1833
NM_014372chr13792 133 47 ------
NM_014382chr321506 660 ------
NM_014399chr72951 637 ------
NM_014405chr1712355 ------
NM_014415chr321547 258 ----11494
NM_014423chr512073 ------
NM_014445chr352300 1627 723 407 296 179 ----
NM_014447chr41176 --11264 --
NM_014452chr631028 782 52 ------
NM_014456chr1021444 415 --1569 --
NM_014460chr2221219 149 2447 93 ----
NM_014494chr1631646 1594 1545 ------
NM_014504chr71294 ------
NM_014515chr123973 92 50 ------
NM_014562chr2--1759 ----
NM_014574chr1411108 ------
NM_014575chr3----154 --
NM_014584chr1411578 ------
NM_014585chr22302 85 ------
NM_014586chr2134812 4516 1822 11650 13941 --
NM_014601chr1921641 32 1469 11258 1485
NM_014602chr31317 1306 ----
NM_014612chr91525 ------
NM_014614chr23415 124 73 ------
NM_014615chr162875 251 ------
NM_014616chr3----23402 1203 --
NM_014620chr121709 ------
NM_014623chr6173 ------
NM_014634chr2242930 2294 1243 346 --21462 170 13053
NM_014636chr913252 ------
NM_014659chr15------1293
NM_014660chr711147 ------
NM_014661chr1063869 3386 2442 1388 1054 860 21439 729 --1833
NM_014665chr833008 276 266 1208 22505 556 --
NM_014670chr221195 153 ------
NM_014671chr731533 518 238 --1449 --
NM_014676chr1----2344 111 --
NM_014683chr1721636 735 ------
NM_014685chr161362 ------
NM_014686chr1952466 2072 2012 1925 549 --1153 --
NM_014690chr75801 657 512 455 50 --1243 --
NM_014705chr712119 1203 ----
NM_014707chr71579 ----11959
NM_014709chr22402 252 ------
NM_014713chr21486 ------
NM_014717chr192348 62 ------
NM_014720chr1021682 714 --11183 --
NM_014721chr646512 6122 6024 144 22154 1875 ----
NM_014729chr811727 11747 ----
NM_014730chr1255151 4978 4301 3368 2101 --1221 --
NM_014730chr1255151 4978 4301 3368 2101 --1221 --
NM_014731chr2021162 620 1550 ----
NM_014743chr463085 2160 1074 957 933 457 --12312 --
NM_014746chr254397 2810 2747 1554 47 ------
NM_014755chr264191 3812 1445 962 520 207 ------
NM_014756chr111102 ------
NM_014765chr122387 1811 ------
NM_014770chr1211188 --11071 --
NM_014772chr1853391 2887 2355 2267 1345 ------
NM_014774chr122917 2851 ------
NM_014776chr1211134 22973 337 ----
NM_014779chr32301 105 ------
NM_014781chr81301 1194 ----
NM_014787chr132116 663 444 ------
NM_014791chr91227 ------
NM_014795chr22985 236 ------
NM_014803chr1032958 2558 915 1340 ----
NM_014810chr133592 3279 1135 ------
NM_014812chr11245 ------
NM_014819chr522437 1641 ------
NM_014824chr1141650 1309 740 415 --11990 --
NM_014830chr1243913 3600 2512 1460 --11216 --
NM_014832chr13------1708
NM_014836chr1011991 11961 11947 --
NM_014839chr13612 568 287 11580 ----
NM_014840chr122444 90 22186 1109 1508 --
NM_014841chr6----11258 --
NM_014847chr11466 ------
NM_014850chr354753 3405 159 68 39 --44668 4138 1188 962 --
NM_014853chr1711450 ------
NM_014873chr134171 1042 450 ------
NM_014901chr532095 1901 541 --1707 --
NM_014904chr1021082 241 --1368 --
NM_014906chr1723357 439 ------
NM_014912chr1013478 ------
NM_014918chr151111 ------
NM_014920chr621267 489 --1703 --
NM_014921chr1942882 2571 2092 583 --42408 1986 577 96 --
NM_014924chr1432632 1116 685 1406 ----
NM_014925chr12--1214 ----
NM_014926chr32858 447 ------
NM_014935chr151520 1030 665 398 328 21275 24 ----
NM_014952chr1541821 1275 241 120 ------
NM_014961chr422223 2003 ------
NM_014962chr2032557 2297 231 --1496 --
NM_014964chr173767 688 582 1734 32393 1982 457 --
NM_014969chr11102 ------
NM_014978chr1041825 1616 1354 201 ------
NM_014982chr1424919 1589 14361 ----
NM_014991chr433138 386 221 ------
NM_015000chr1242832 1004 320 170 ------
NM_015002chr122380 133 ------
NM_015005chr142542 89 --31714 1564 1125 --
NM_015008chr343396 2878 1055 317 --12679 --
NM_015015chr191438 11321 ----
NM_015025chr222066 791 ----1434
NM_015042chr1524130 3883 13725 ----
NM_015045chr101544 --11418 --
NM_015051chr923395 499 12545 ----
NM_015055chr1142039 1824 858 102 --12438 --
NM_015068chr754004 2509 1595 1020 861 ------
NM_015071chr522400 1180 --16488 --
NM_015074chr154630 3853 1086 492 107 --24508 746 --
NM_015076chr613490 14536 --11351
NM_015077chr1764693 4252 2974 1594 1084 314 12944 14399 --
NM_015092chr1644499 1525 1513 503 --13377 --
NM_015100chr131806 1263 679 ------
NM_015120chr2--184 ----
NM_015124chr2242036 1653 936 133 ------
NM_015129chrX11604 --11776 --
NM_015132chr731725 764 147 ------
NM_015137chr82794 474 12148 ----
NM_015138chr1532615 2553 2267 1968 ----
NM_015144chr162837 261 13569 33400 908 232 --
NM_015149chr112215 11909 ----
NM_015155chr1072729 2370 987 969 865 687 317 ------
NM_015156chr1433131 2454 1256 --1756 --
NM_015176chr121301 142 ------
NM_015180chr141599 ------
NM_015185chrX22459 1091 --1238 --
NM_015192chr2042521 891 701 524 ------
NM_015206chr1543852 823 429 143 ------
NM_015208chr1863815 3725 3709 3471 760 655 ------
NM_015215chr132940 1954 1251 ------
NM_015219chr171910 --2698 539 --
NM_015233chr1342594 2251 1888 1038 ------
NM_015235chr1031649 413 24 1866 ----
NM_015250chr93606 574 259 ------
NM_015252chr22649 107 ------
NM_015265chr272683 2343 2222 2110 2036 1682 1039 ------
NM_015271chr422754 1351 ------
NM_015272chr1611902 ------
NM_015277chr1831717 1644 1179 21845 215 21748 25 --
NM_015285chr1832388 2133 279 ------
NM_015288chr553361 2429 2363 973 125 ------
NM_015299chr1473869 3832 3545 3343 3055 813 380 --2698 22 --
NM_015316chr1421005 309 ------
NM_015317chr231120 636 594 ------
NM_015327chr111225 --1396 --
NM_015328chr752838 2812 2399 642 189 11051 ----
NM_015335chr12--1547 --1291
NM_015336chr1212054 ------
NM_015339chr202143 106 ------
NM_015347chr1222925 2316 ------
NM_015358chr21146 ------
NM_015385chr1041012 965 765 746 ------
NM_015387chr21783 11838 ----
NM_015393chr441017 507 154 125 ------
NM_015423chr111487 --11482 --
NM_015435chr82518 382 156 ----
NM_015443chr1741151 1003 470 444 ------
NM_015447chr92559 251 --160 --
NM_015455chr523966 1072 1823 ----
NM_015475chr221066 244 1963 ----
NM_015481chr122950 872 ------
NM_015503chr16----1680 2192 174
NM_015508chr321259 333 11017 11442 --
NM_015511chr201424 21110 244 ----
NM_015520chr321993 1851 --11966 --
NM_015535chr232640 751 111 ----1277
NM_015542chr10149 ------
NM_015549chr14----2580 230 --
NM_015550chr733443 3058 551 ------
NM_015569chr144338 4119 3275 907 ------
NM_015578chr19--11443 ----
NM_015609chr152049 1899 1820 890 547 ------
NM_015610chr71192 --11057 --
NM_015640chr135034 1207 1058 ------
NM_015642chr31274 ------
NM_015652chr101218 ------
NM_015833chr2121506 400 --11773 --
NM_015840chr142643 2580 2476 2013 ------
NM_015841chr142643 2580 2476 2013 ------
NM_015850chr821866 500 --1736 --
NM_015853chr11153 ------
NM_015874chr4188 ------
NM_015879chr1836097 2017 30 16172 ----
NM_015881chr1121154 261 ------
NM_015892chr1022250 407 ------
NM_015905chr71393 ------
NM_015981chr522308 994 12573 13096 --
NM_015982chr171306 ------
NM_015995chr15125125 4909 4873 3985 2073 2048 1837 1733 1452 611 544 402 1746 13991 --
NM_016003chr71192 --11057 --
NM_016009chr134858 3368 3258 ------
NM_016018chr832691 2018 32 --1980 --
NM_016059chr62981 336 ------
NM_016072chr122922 554 ------
NM_016073chr152225 58 ------
NM_016075chr1312731 12970 ----
NM_016107chr52263 53 ------
NM_016121chr121130 901 ------
NM_016129chr42334 261 ------
NM_016131chr231803 623 613 ------
NM_016132chr1522614 427 12755 ----
NM_016141chr31148 ------
NM_016152chr311110 ------
NM_016201chr332116 1745 893 --21991 367 --
NM_016205chr421461 1244 ----151
NM_016206chr348773 8434 5727 1752 16690 ----
NM_016217chr653638 3621 1423 311 187 12533 ----
NM_016231chr17----2506 189 --
NM_016248chr1343911 3782 2470 2439 13131 --1352
NM_016252chr21816 ------
NM_016257chr1172 12464 ----
NM_016258chr12543 262 ------
NM_016260chr257379 5761 4748 2312 404 --15823 --
NM_016271chr1812366 ------
NM_016272chr2241002 602 306 229 ------
NM_016282chr931706 1439 1236 ----1323
NM_016289chr252329 2175 1517 301 264 ------
NM_016304chr152744 266 ------
NM_016308chr121598 802 --1116 --
NM_016315chr211595 11848 ----
NM_016322chr942881 2717 2711 2113 ----12345
NM_016340chr521095 462 ------
NM_016353chr82679 114 ----12511
NM_016374chr14988 627 472 38 ------
NM_016374chr14988 627 472 38 ------
NM_016376chr1733622 3000 419 --1455 --
NM_016396chr1511154 ------
NM_016418chr2273219 2581 2482 2460 960 651 157 --33496 2810 687 --
NM_016422chr1142791 957 712 516 ------
NM_016436chr2052160 862 625 523 168 ------
NM_016441chr22887 433 ------
NM_016447chr7----1173 --
NM_016454chr15170 1350 ----
NM_016467chr23383 128 62 ------
NM_016507chr1742779 2648 1072 411 1531 ----
NM_016513chr621267 489 --1703 --
NM_016530chr1554021 3594 2589 1104 942 --12598 --
NM_016577chr394409 4260 4238 3481 3232 1232 1196 838 221 1553 11206 --
NM_016587chr711119 ------
NM_016603chr542024 1653 127 73 ------
NM_016605chr521962 1708 --22722 2475 12430
NM_016607chrX1590 11639 ----
NM_016621chr1163991 3832 3674 3515 1825 751 --1545 --
NM_016628chr101305 --1859 --
NM_016823chr1721067 366 ------
NM_016931chr11--1367 ----
NM_017409chr121158 --1256 --
NM_017413chrX3554 505 177 --11978 --
NM_017420chr1422897 1439 ----1588
NM_017450chr1731171 1050 137 --11217 --
NM_017455chr15--1904 ----
NM_017544chrX2859 124 ------
NM_017545chr201398 ------
NM_017580chr1032240 2121 1668 --1291 --
NM_017582chr131747 1717 91 ------
NM_017583chr112281 202 ------
NM_017596chr144600 4008 3017 1702 --13904 --
NM_017633chr623715 3334 ------
NM_017634chr811922 ------
NM_017635chr112560 316 ------
NM_017637chr989325 8792 8679 7014 6978 1372 576 137 13499 ----
NM_017641chr121438 ----1255
NM_017643chr17--1721 ----
NM_017644chr315210 14196 24620 219 13326
NM_017651chr61401 ------
NM_017658chr1434006 3210 170 13713 1321 --
NM_017660chr1963393 3031 2166 2145 915 162 ------
NM_017661chr1521065 294 1459 ----
NM_017670chr111196 --178 --
NM_017679chr172645 439 ------
NM_017684chr1531747 1538 1254 11423 ----
NM_017709chr153415 2642 1685 1425 630 2888 622 ----
NM_017714chr20178 ------
NM_017719chr311756 22494 1025 --12036
NM_017736chr1632392 2333 965 ------
NM_017753chr91881 1279 ----
NM_017754chr663789 3147 1042 963 881 700 1608 ----
NM_017769chr1443071 2273 1002 271 ------
NM_017772chr611714 ------
NM_017778chr821243 1115 --11042 --
NM_017779chr11925 12109 ----
NM_017786chr81279 ------
NM_017787chr1032889 813 661 ------
NM_017811chr923090 768 1882 ----
NM_017813chr855645 5632 1051 1036 754 12299 ----
NM_017824chr1012727 ----12577
NM_017848chrX23435 3107 ------
NM_017849chr252844 2792 2179 1016 745 --1628 --
NM_017873chr942770 2299 1989 1956 11242 1693 --
NM_017902chr1065780 5766 4568 4129 819 283 25611 1213 25260 3876 12101
NM_017913chr9--1330 ----
NM_017919chr945115 4386 4200 107 --14228 --
NM_017938chrX4805 744 580 37 --1307 --
NM_017944chr1142875 2794 2584 93 ------
NM_017954chr711110 ------
NM_017957chr1711555 ------
NM_017983chr173422 182 47 --1428 --
NM_017994chr722024 486 --12243 --
NM_017998chr911021 131 ----
NM_018000chr241401 602 590 261 ------
NM_018011chr13171 ------
NM_018027chr1052062 1227 1101 929 361 ------
NM_018028chr1921328 929 ------
NM_018030chr181279 ------
NM_018037chr12115 21 ------
NM_018043chr111249 --11493 1554
NM_018045chr133028 659 178 ------
NM_018061chr12400 300 --11387 --
NM_018064chr61317 ------
NM_018067chr11499 ------
NM_018084chr222572 2432 ------
NM_018092chr1621243 483 --1282 --
NM_018110chr1641336 1061 518 57 ------
NM_018116chr11521 ------
NM_018149chr171215 --162 --
NM_018155chr323394 2621 ------
NM_018157chr1211125 1292 ----
NM_018159chrX51491 1288 462 345 179 ------
NM_018178chr12268 38 ------
NM_018181chr1821955 1897 ------
NM_018182chr1712233 ------
NM_018247chr621084 526 21188 685 1635 --
NM_018270chr203635 285 64 --1297 --
NM_018312chr1141904 1862 506 313 ------
NM_018313chr352437 2283 1849 580 259 ------
NM_018315chr411393 1436 ----
NM_018362chr1122512 72 11559 ----
NM_018364chr133850 2683 546 ------
NM_018369chr5161 ------
NM_018371chr821374 588 --163 --
NM_018375chr1411904 ------
NM_018440chr886149 2535 2488 1993 1362 548 469 121 15854 11435 11586
NM_018442chr11391 ------
NM_018444chr852350 2217 2083 1551 492 ------
NM_018448chr121233 ------
NM_018452chr6_random32769 512 48 --12990 --
NM_018482chr81163 --11627 --
NM_018490chr1121519 1444 --11492 --
NM_018509chr171117 ----11654
NM_018557chr21334 --11427 --
NM_018566chr114034 ------
NM_018569chr411615 ------
NM_018602chr154541 417 306 161 ------
NM_018652chr1521049 399 ------
NM_018660chr832868 2393 2200 1473 11142 --
NM_018682chr71708 ------
NM_018684chrX21207 196 ------
NM_018691chr521133 422 1371 ----
NM_018695chr51152 ------
NM_018698chrX21915 652 ------
NM_018700chr531364 1225 232 ----11593
NM_018704chr121930 347 ------
NM_018717chr432146 2039 36 1131 1471 --
NM_018718chr71885 ------
NM_018844chr731979 1694 835 --1267 --
NM_018847chr91152 11351 1446 --
NM_018898chr52657 418 1451 ----
NM_018899chr52657 418 1451 ----
NM_018900chr52657 418 1451 ----
NM_018901chr52657 418 1451 ----
NM_018902chr52657 418 1451 ----
NM_018903chr52657 418 1451 ----
NM_018904chr52657 418 1451 ----
NM_018905chr52657 418 1451 ----
NM_018906chr52657 418 1451 ----
NM_018907chr52657 418 1451 ----
NM_018908chr52657 418 1451 ----
NM_018909chr52657 418 1451 ----
NM_018910chr52657 418 1451 ----
NM_018911chr52657 418 1451 ----
NM_018948chr11933 --11126 --
NM_018970chr723108 682 12911 ----
NM_018979chr1211019 ------
NM_018992chr1631548 1110 81 ------
NM_018999chr1044464 4053 3703 136 1898 11090 --
NM_019001chr324174 1102 --23603 3389 --
NM_019005chr7--1271 ----
NM_019006chr151450 ----1187
NM_019027chr432517 932 860 11708 ----
NM_019028chr112318 116 ------
NM_019036chr61957 ----1980
NM_019063chr212169 ------
NM_019072chr524119 3175 1434 13628 --
NM_019087chr521515 687 ------
NM_019094chr122322 266 --13308 --
NM_019116chr1683530 2535 2299 1376 1280 881 824 409 --13475 --
NM_019556chrX1459 ------
NM_019610chr122085 1406 --21803 420 --
NM_019613chr172283 245 --2216 138 --
NM_019857chrX11170 11788 ----
NM_019885chr222952 2868 12315 149 --
NM_019895chr32905 183 ------
NM_020116chr41121 ------
NM_020122chr224713 1741 14679 1795 --
NM_020123chr1021543 140 ------
NM_020182chr2033382 2953 953 --22566 1143 12883
NM_020189chr8128 ------
NM_020205chr142449 1176 1091 121 --1970 --
NM_020210chr151949 --1399 --
NM_020239chr122038 1458 11636 ----
NM_020240chr532776 757 745 11030 1730 --
NM_020245chr665013 4397 4255 1955 286 177 24374 1332 ----
NM_020248chr182377 2206 1839 463 432 402 225 57 22259 2121 ----
NM_020307chr31346 ------
NM_020309chr194852 803 321 256 --1744 --
NM_020310chr1742374 2365 1851 774 --22723 552 --
NM_020311chr21182 1560 ----
NM_020336chr2063577 2600 2457 1414 1071 1054 ------
NM_020337chr421056 45 ------
NM_020338chr1033650 1308 843 ------
NM_020341chr2011519 ------
NM_020342chr242452 872 320 100 --1990 --
NM_020346chr111418 --11391 --
NM_020381chr631818 1286 346 ------
NM_020382chr1211563 ------
NM_020403chr131617 ------
NM_020429chr743042 2046 397 175 1679 --1374
NM_020438chr921367 259 --1435 --
NM_020443chr156453 4840 2349 528 502 12477 ----
NM_020444chr52116 34 ------
NM_020449chrX1794 1235 ----
NM_020452chr12635 150 --1561 --
NM_020456chr1321934 1609 ----1657
NM_020473chrX11374 ----1675
NM_020475chr812232 --1300 1888
NM_020476chr812232 --1300 1888
NM_020477chr812232 --1300 1888
NM_020480chr812232 --1300 1888
NM_020532chr21888 ------
NM_020640chr32183 80 ------
NM_020647chr82507 210 ------
NM_020648chr1832851 311 74 ------
NM_020651chr211132 ------
NM_020673chr2057467 5957 5870 1356 354 ------
NM_020689chr201297 11566 ----
NM_020693chr111401 ------
NM_020708chr2012005 --11727 --
NM_020717chrX54695 3210 1920 995 449 13308 ----
NM_020718chr1655601 4639 4110 1974 600 ------
NM_020727chr2123468 202 ------
NM_020728chr712617 --13058 --
NM_020734chr1223249 2276 ------
NM_020749chr811373 --11541 --
NM_020752chr1022830 748 ------
NM_020766chrX64551 4095 3683 3358 99 85 ------
NM_020768chr523163 1210 ------
NM_020772chr1747678 5508 3273 340 --16680 --
NM_020773chr452691 2338 2182 925 270 1404 1833 --
NM_020783chr1821902 498 ----1651
NM_020794chr141381 1122 220 188 ------
NM_020796chr521219 180 --22354 2263 --
NM_020800chr3176 ------
NM_020801chr532522 2096 925 ----11768
NM_020808chr1170 ------
NM_020809chr113745 657 251 ------
NM_020810chr1413350 1507 2894 822 --
NM_020819chr61465 --1187 --
NM_020821chr1531747 1538 1254 11423 ----
NM_020830chr222415 211 --1405 --
NM_020836chr14128 ------
NM_020850chr1643096 2992 234 26 --12859 12304
NM_020854chr1811528 11026 ----
NM_020856chr1941522 1371 1245 638 ------
NM_020861chr611118 ------
NM_020866chr13145 ------
NM_020868chr221963 1506 1404 ----
NM_020871chrX1740 ------
NM_020888chr111705 --31276 413 287 --
NM_020898chr122317 249 ----1228
NM_020899chr1722208 517 ----1712
NM_020917chr1943702 1322 660 606 22851 614 11534 --
NM_020927chr1622327 1758 ------
NM_020948chr122927 889 ------
NM_020956chr1973037 1817 1739 1661 1001 917 409 --21895 878 13336
NM_020962chr1561951 1835 658 466 268 21 1137 ----
NM_020967chr2031237 1157 1020 --1969 --
NM_020975chr1031313 236 161 ------
NM_020977chr4--12231 --11520
NM_020993chr121463 1898 ----
NM_021005chr151461 ------
NM_021032chr331692 438 126 ------
NM_021033chr1342553 2356 1020 1003 ------
NM_021069chr42431 354 ------
NM_021090chr2274746 1572 1550 1154 1130 463 241 --13326 --
NM_021101chr342024 1791 1717 1682 ------
NM_021110chr82613 77 ------
NM_021111chr911049 ------
NM_021120chrX32106 1149 693 ------
NM_021132chr102549 283 ------
NM_021136chr141228 ------
NM_021141chr21233 ------
NM_021145chr731130 382 325 ------
NM_021155chr1943017 2543 535 391 ------
NM_021174chr82706 621 ----1119
NM_021183chrX22213 1958 ------
NM_021190chr12893 361 ------
NM_021198chr221426 1221 ------
NM_021202chr2042810 2603 2159 419 12945 ----
NM_021222chr111137 1568 11094 --
NM_021238chr1221868 640 --1620 --
NM_021239chr1421465 173 ------
NM_021240chr91206 1583 ----
NM_021248chr202713 253 --1529 --
NM_021249chr141319 11469 11200 --
NM_021253chr621433 1409 ------
NM_021622chr10--22374 422 ----
NM_021629chr375073 4019 3201 1727 1715 1153 1003 ------
NM_021637chrX11252 ------
NM_021647chr443867 1568 1166 1059 ------
NM_021648chr62421 353 1768 --1608
NM_021705chr621503 141 ------
NM_021728chr141753 1391 ----
NM_021809chr2042400 2339 699 523 ------
NM_021813chr665642 5630 4759 2349 1723 253 11954 ----
NM_021825chr11--1348 126 --
NM_021911chr53718 237 198 ------
NM_021912chr1523924 3734 --22906 615 --
NM_021943chr61188 --2834 525 1172
NM_021946chrX11432 --1218 --
NM_021956chr6------1275
NM_021961chr1116927 --21834 1039 --
NM_021964chr356405 5944 4118 1836 995 ------
NM_021988chr20------11007
NM_021998chrX11288 1306 11424 --
NM_022041chr1632700 898 128 --1230 --
NM_022048chr1544008 2415 2265 1763 26221 263 11876 --
NM_022060chr1431281 1136 952 ------
NM_022062chr1141529 1467 1351 1314 ------
NM_022114chr132988 928 484 --23343 1104 --
NM_022123chr141458 ------
NM_022133chr811427 --11386 --
NM_022137chr1412037 ------
NM_022143chr711148 ------
NM_022166chr1644942 4132 2456 601 2410 246 12096 --
NM_022170chr71162 ------
NM_022171chr331595 1444 389 ------
NM_022351chr833513 746 561 ------
NM_022373chr7151 ------
NM_022442chr20------11007
NM_022444chr7171 1620 ----
NM_022456chr1266666 6342 5092 2741 2100 1135 24780 52 ----
NM_022465chr121838 13068 ----
NM_022469chr11475 23025 2763 ----
NM_022473chr1553151 2998 2988 1289 112 --1609 --
NM_022474chr1422410 2034 11915 ----
NM_022476chr162357 211 ------
NM_022484chr71561 --11051 --
NM_022497chr342905 1522 1354 975 --1442 2600 417
NM_022650chr51743 ------
NM_022719chr2233196 2893 1515 11456 --12597
NM_022733chr121174 22 --1734 --
NM_022735chr121852 1430 ------
NM_022753chr122372 761 ------
NM_022755chr962592 2322 2230 992 508 90 1777 --1853
NM_022758chr662876 2558 1305 1253 897 680 --13124 --
NM_022763chr311131 12360 ----
NM_022768chr11115 153 ----
NM_022780chr23701 648 474 ------
NM_022781chr932567 2495 84 ------
NM_022810chrX3354 295 148 ------
NM_022817chr232213 672 78 ------
NM_022832chr462054 1889 881 607 292 129 ------
NM_022840chr182496 26 ------
NM_022841chr152881 131 11950 ----
NM_022845chr1621717 851 ------
NM_022893chr222539 1169 ------
NM_022900chr7----1154 --
NM_022917chr921094 899 1121 ----
NM_022918chr1121647 1431 ------
NM_022977chrX147 ------
NM_023000chr1411161 ------
NM_023001chr1411161 ------
NM_023034chr81185 ------
NM_023071chr122708 230 ------
NM_023076chr1662673 2459 1930 1828 970 958 --12586 12570
NM_023079chr1711199 --1447 --
NM_023105chr821866 500 --1736 --
NM_023106chr821866 500 --1736 --
NM_023110chr821866 500 --1736 --
NM_023111chr821866 500 --1736 --
NM_023927chr52976 947 21192 556 ----
NM_023929chr8----1205 --
NM_023943chr32200 163 ------
NM_024007chr512701 ------
NM_024052chr1762943 2589 2452 2099 2086 168 12490 ----
NM_024055chr51641 ------
NM_024061chr72431 166 ------
NM_024077chr92727 304 ------
NM_024092chr1131217 1061 771 ------
NM_024095chr124419 366 347 106 ------
NM_024117chr92424 216 ------
NM_024294chr662876 2558 1305 1253 897 680 --13124 --
NM_024324chr221158 ------
NM_024328chr142456 170 ------
NM_024337chr51289 ------
NM_024345chr935160 1554 468 ------
NM_024415chr5128 ------
NM_024496chr141252 ------
NM_024511chr423308 2564 --1964 --
NM_024524chr322588 1032 --22905 2086 --
NM_024546chr132262 27 11026 ----
NM_024551chr1232388 351 139 ------
NM_024551chr1232388 351 139 ------
NM_024554chr131485 404 103 --11526 --
NM_024565chr521129 222 --1541 --
NM_024582chr4------1196
NM_024586chr11113 ------
NM_024595chr14985 423 171 48 ------
NM_024613chr82377 34 ------
NM_024653chr721553 1355 ------
NM_024665chr323806 810 ------
NM_024702chr171213 ------
NM_024713chr1511244 ------
NM_024721chr811637 1198 ----
NM_024725chr111864 ------
NM_024742chr1651733 1647 1524 1309 420 ------
NM_024751chr422030 576 ------
NM_024755chr151314 ------
NM_024757chr91810 --1467 --
NM_024770chr246493 5924 1203 167 ------
NM_024785chr221372 515 11427 ----
NM_024792chr171235 --11074 --
NM_024814chr71400 ------
NM_024824chr1421161 182 ------
NM_024834chr1031864 790 606 ------
NM_024866chr221566 --13472 --
NM_024881chr1923397 1063 --1400 --
NM_024885chrX1706 ------
NM_024899chr182543 495 ------
NM_024911chr11120 ------
NM_024943chr41597 1173 ----
NM_024947chr346899 3824 725 664 --11231 --
NM_024953chr12--180 ----
NM_024969chr21114 ------
NM_024989chr222873 833 18223 1888 --
NM_024991chr1041012 965 765 746 ------
NM_025054chr831282 252 60 11227 ----
NM_025073chr164183 3584 2911 1867 155 21 ------
NM_025074chr432791 2766 2084 ------
NM_025079chr11501 ----1294
NM_025106chr131871 687 585 11912 1146 --
NM_025134chr1612252 ------
NM_025146chr332007 675 220 ------
NM_025179chr154777 4074 3698 1900 255 23872 749 ----
NM_025187chr162497 452 ------
NM_025191chr131026 500 57 ------
NM_025195chr831405 447 197 --11759 --
NM_025203chr241319 1134 534 237 1601 ----
NM_025211chr9----1207 --
NM_025221chr411055 ------
NM_025222chr323067 2265 --22587 635 --
NM_025224chr2021797 1631 --2484 28 --
NM_025235chr1012009 ------
NM_025237chr1731450 468 80 ------
NM_025250chr763016 2894 2703 2490 2277 2195 ------
NM_030576chr1742373 2341 1858 950 ------
NM_030621chr1433620 2966 595 1132 12682 --
NM_030623chr2160 ------
NM_030625chr101584 ------
NM_030627chr511104 13880 ----
NM_030634chr132399 2354 389 ------
NM_030647chr745183 3944 2382 1699 --15984 --
NM_030648chr442165 1752 354 264 ------
NM_030660chr141408 --11476 --
NM_030661chr73216 204 61 ------
NM_030674chr1265077 4161 3694 581 297 142 --1689 --
NM_030762chr1221441 654 ----1390
NM_030796chr712117 ------
NM_030799chr512025 ------
NM_030806chr139108 2910 515 --11776 26301 2383
NM_030808chr1711073 --1818 --
NM_030816chr123156 1199 ------
NM_030881chr2232287 1959 742 12180 ----
NM_030915chr262039 1851 1839 1600 631 502 ----12176
NM_030920chr13729 505 128 ------
NM_030927chr1011167 --21528 293 --
NM_030939chr611191 ------
NM_030945chr51118 --22014 612 --
NM_030958chr8--136 ----
NM_030962chr111248 ------
NM_030964chr542928 2794 2563 262 12760 ----
NM_030965chr11624 ------
NM_031243chr742400 2294 1709 1506 11562 ----
NM_031262chr91250 ------
NM_031263chr91307 ------
NM_031284chr152675 72 ------
NM_031305chr4----2512 83 --
NM_031309chr811930 --21995 1540 --
NM_031369chr42567 77 ------
NM_031370chr42567 77 ------
NM_031371chr14988 627 472 38 ------
NM_031371chr14988 627 472 38 ------
NM_031411chr52657 418 1451 ----
NM_031418chr112964 477 22662 429 ----
NM_031426chr912571 12031 11880 --
NM_031442chrX53245 915 644 447 145 ------
NM_031443chr71406 ------
NM_031445chr233381 2601 2364 ------
NM_031452chr151170 ------
NM_031469chr623281 152 1461 13374 --
NM_031476chr1642359 2036 1106 824 --11802 --
NM_031844chr143358 3346 1308 670 ------
NM_031845chr213622 ----23184 622
NM_031847chr213622 ----23184 622
NM_031849chr52657 418 1451 ----
NM_031857chr52657 418 1451 ----
NM_031858chr1711292 ------
NM_031860chr52657 418 1451 ----
NM_031862chr1711292 ------
NM_031890chr2242333 2105 990 377 ------
NM_031922chr62466 43 ------
NM_031936chr13530 495 192 ------
NM_031938chr11----1760 --
NM_031992chr71162 ------
NM_032012chr953973 1583 1432 569 219 24083 687 --1782
NM_032017chr13795 632 597 --164 --
NM_032041chr822559 1887 ------
NM_032047chr322311 742 11896 ----
NM_032051chr22194 ------
NM_032102chr1122028 716 ----13076
NM_032109chr511163 --1958 --
NM_032116chr1365907 5661 1873 1066 921 104 ----1820
NM_032121chrX42816 2430 2214 1092 12311 ----
NM_032124chr181381 ------
NM_032145chr621668 1431 ------
NM_032153chr322251 2239 12522 ----
NM_032154chr10----2727 344 --
NM_032160chr1853364 1456 1366 1310 1153 11714 ----
NM_032181chr21281 ------
NM_032182chr101614 ------
NM_032199chr1053558 3482 2880 1468 198 23521 2692 ----
NM_032208chr21124 13323 1779 --
NM_032217chr42882 288 11406 ----
NM_032221chr201624 1551 ----
NM_032229chr1311015 ------
NM_032242chr353076 2436 2072 1239 716 --22407 2038 --
NM_032271chr162440 24 1342 21133 368 --
NM_032281chr1922499 883 ------
NM_032283chr12424 139 --1162 --
NM_032288chr32407 224 --12153 --
NM_032295chr71240 ------
NM_032320chr111646 ------
NM_032373chr1054496 3903 3861 2090 476 11816 15592 --
NM_032376chr171666 ------
NM_032410chr811122 1497 --1828
NM_032424chr1131489 92 75 11189 ----
NM_032430chr193294 286 170 ------
NM_032440chr10--12930 ----
NM_032445chr151426 ------
NM_032452chr143485 87 33 1473 --11221
NM_032457chr423050 428 11074 ----
NM_032458chrX22461 2348 ----12365
NM_032466chr851586 1175 1055 328 68 ------
NM_032468chr851586 1175 1055 328 68 ------
NM_032486chr1642077 1954 744 316 --12439 --
NM_032505chr322066 1701 --1717 --
NM_032521chr2011195 --1323 --
NM_032523chr2187 ------
NM_032557chr42803 738 ------
NM_032558chr911501 ------
NM_032578chr10173 11243 ----
NM_032582chr1711761 ------
NM_032590chr121441 ------
NM_032682chr31994 --12599 --
NM_032711chr1763522 3434 3160 706 627 61 --1964 --
NM_032741chr61824 --11007 --
NM_032777chr831429 478 115 --11085 --
NM_032784chr62736 207 ------
NM_032804chr1042105 1978 451 337 ------
NM_032810chr101333 ------
NM_032818chr982483 2363 2352 2147 1859 893 474 190 ----11848
NM_032846chr1411444 2396 86 ----
NM_032873chr1121211 1112 44472 3091 3068 568 ----
NM_032875chr172607 336 ------
NM_032876chr14------1597
NM_032900chr1062535 1466 1162 986 497 451 ------
NM_032905chr104949 220 161 92 ------
NM_032975chr1853248 3206 2967 2473 325 --12936 --
NM_032980chr1853248 3206 2967 2473 325 --12936 --
NM_032991chr421366 21 ------
NM_032992chr4163 ------
NM_032995chr231723 1509 1237 1100 ----
NM_033012chr131979 ------
NM_033018chrX11084 ------
NM_033023chr711184 ----1970
NM_033025chr192113 52 1152 ----
NM_033027chr35973 413 379 292 97 ------
NM_033029chr3----1303 --
NM_033036chr1131386 518 245 --1632 --
NM_033055chr121053 382 ------
NM_033058chr8--2151 95 ----
NM_033089chr2021457 468 ------
NM_033119chr162821 787 ------
NM_033132chr13------11524
NM_033133chr1773138 1475 1095 1028 839 805 460 --12801 --
NM_033136chr541593 1314 408 271 1242 ----
NM_033137chr541593 1314 408 271 1242 ----
NM_033138chr72628 509 ------
NM_033139chr72628 509 ------
NM_033140chr72628 509 ------
NM_033157chr72628 509 ------
NM_033211chr52639 334 ------
NM_033224chr7107245 6650 6386 6347 5100 2581 2411 1081 1026 889 12510 --11851
NM_033285chr854067 3997 1683 521 22 12909 ----
NM_033290chrX33539 3271 621 ------
NM_033309chr162869 78 ------
NM_033315chr1731985 1804 204 --11831 --
NM_033326chr1122184 90 11702 ----
NM_033331chr931222 785 292 13450 ----
NM_033338chr101311 --11353 --
NM_033339chr101311 --11353 --
NM_033340chr101427 --11469 --
NM_033360chr1224492 3385 ------
NM_033389chr1723890 3726 --24770 1342 --
NM_033425chr1163138 2673 2427 400 324 49 ------
NM_033426chr1452840 885 152 120 34 ------
NM_033427chr71584 ------
NM_033503chr1552719 2622 2465 1090 355 ------
NM_033505chr246399 6332 6019 2042 1217 ----
NM_033512chr842986 2235 947 887 148 ----
NM_033624chr122380 133 ------
NM_033631chr173808 2982 2931 2682 386 141 112 --23098 799 --
NM_033632chr411393 1436 ----
NM_033637chr1033752 3598 980 ------
NM_033644chr52975 59 --11917 --
NM_033645chr52975 59 --11917 --
NM_044472chr12731 519 ------
NM_052811chr1363534 3266 1040 1028 981 244 11661 ----
NM_052818chr1331901 1837 739 21683 1539 ----
NM_052832chr822735 84 ------
NM_052834chr1832388 2133 279 ------
NM_052864chr41496 ------
NM_052879chr1231653 180 58 11325 1510 --
NM_052886chr832104 572 328 11454 ----
NM_052900chr831255 641 205 ------
NM_052901chr93675 621 560 11184 ----
NM_052906chr2244819 4416 3516 1663 --34825 4453 4227 14469
NM_052910chr1311834 ------
NM_052911chr182126 56 ------
NM_052913chr63151 126 81 ------
NM_052927chr51118 ------
NM_052928chr1741386 1332 381 82 ------
NM_052951chr201167 ----162
NM_052953chr3166 ------
NM_053002chr321048 186 ------
NM_053016chr956594 6270 5370 3041 977 12322 27812 6021 --
NM_053023chr1143020 2730 2261 1030 --12806 --
NM_053043chr786105 6098 5994 4660 4582 1786 1016 405 --1569 --
NM_053053chr11969 ------
NM_053056chr1133092 2892 135 1655 12781 --
NM_054016chr11500 1288 ----
NM_054016chr11500 1288 ----
NM_054016chr11500 1288 ----
NM_057169chr1211134 22973 337 ----
NM_057170chr1211134 22973 337 ----
NM_057175chr41233 ------
NM_058170chr131179 324 259 ------
NM_058172chr421805 1684 --11468 --
NM_058237chr1421028 229 --180 --
NM_058241chr22758 275 --11995 --
NM_058241chr22758 275 --11995 --
NM_078485chr62740 22 ------
NM_080591chr992837 2815 2390 2088 841 671 468 439 227 2421 292 12885 --
NM_080597chr181279 ------
NM_080599chr10149 ------
NM_080654chr1121293 124 ------
NM_080671chr24760 446 202 26 ------
NM_080679chr63797 769 629 --1166 --
NM_080680chr63797 769 629 --1166 --
NM_080681chr63797 769 629 --1166 --
NM_080738chr131857 1609 504 11348 ----
NM_080742chr61185 ------
NM_080743chr632494 1797 941 ------
NM_080759chr132398 190 ------
NM_080760chr132398 190 ------
NM_080867chr1423201 1150 ------
NM_080927chr323035 2578 --1112 --
NM_100264chr101305 --1859 --
NM_100486chr101305 --1859 --
NM_130436chr2132328 1066 694 11046 --11983
NM_130438chr2122905 1271 --1344 12560
NM_130439chr1011459 11992 ----
NM_130439chr1011459 11992 ----
NM_130798chr1511022 ----1383
NM_130811chr203985 444 226 1844 ----
NM_133170chr2028070 2996 ------
NM_133177chr12965 845 ------
NM_133178chr12965 845 ------
NM_133265chrX2933 279 12428 ----
NM_133467chr1----1417 --
NM_133468chr752404 1952 1697 910 608 ------
NM_133647chr1543014 1370 818 567 --12970 --
NM_138270chrX22734 2374 --1932 --
NM_138338chr2233241 750 596 13381 42213 1220 214 208 --
NM_138395chr21411 --1323 --
NM_138426chr732472 819 768 1987 ----
NM_138444chr1344233 3318 1650 94 1790 ----
NM_138459chr632456 1472 377 ------
NM_138462chr91156 ----174
NM_138473chr1231390 1343 471 23318 545 ----
NM_138479chr121732 1518 11987 --11669
NM_138492chr521252 328 ------
NM_138713chr1697972 7320 6874 6180 3067 3015 2899 1487 59 12696 --13241
NM_138714chr1697972 7320 6874 6180 3067 3015 2899 1487 59 12696 --13241
NM_138730chr61439 ------
NM_138731chr1423745 3654 13689 ----
NM_138735chr221529 596 --1518 --
NM_138736chr1634196 3252 1226 --1926 11279
NM_138764chr19----176 --
NM_138768chr112715 24 ------
NM_138811chr72974 157 ------
NM_138923chrX2393 54 ------
NM_138927chr212372 77 ------
NM_138966chr181199 ------
NM_138967chr1541644 1596 664 75 ------
NM_138970chr1431742 1688 299 ------
NM_138971chr1133516 1208 52 --1748 --
NM_138971chr1133516 1208 52 --1748 --
NM_138972chr1133516 1208 52 --1748 --
NM_138972chr1133516 1208 52 --1748 --
NM_138973chr1133516 1208 52 --1748 --
NM_138973chr1133516 1208 52 --1748 --
NM_139012chr642243 1998 1735 467 ------
NM_139014chr642323 2078 1815 547 ------
NM_139045chr91792 ------
NM_139048chr321211 332 ------
NM_139057chr1541111 952 470 189 ------
NM_139072chr2----2836 296 --
NM_139131chr112675 660 ------
NM_139135chr11475 ------
NM_139159chr192508 213 --142 --
NM_139168chr521844 1408 ----1246
NM_139177chr17--11495 21516 54 --
NM_139207chr1232105 1418 371 ------
NM_139211chr43241 219 80 1456 ----
NM_139212chr43241 219 80 1456 ----
NM_139244chr63900 756 156 ------
NM_139246chr932212 1710 1611 1679 ----
NM_139276chr1752257 1663 606 269 110 ------
NM_139279chr272990 2643 2200 2172 1035 1007 333 ------
NM_139283chr122677 495 1831 1292 --
NM_139323chr20----11935 --
NM_139343chr2162 ------
NM_139344chr2162 ------
NM_139345chr2162 ------
NM_139346chr2162 ------
NM_139347chr2162 ------
NM_139348chr2162 ------
NM_139349chr2162 ------
NM_139350chr2162 ------
NM_139351chr2162 ------
NM_144499chr32924 772 11052 1860 --
NM_144571chr486612 6280 5717 4479 2534 1309 856 582 --11018 --
NM_144586chr231156 907 485 ------
NM_144595chr132213 68 ------
NM_144599chr1555336 5235 3712 1121 49 ------
NM_144609chr17155 1443 ----
NM_144628chr2043052 2298 2225 1063 ------
NM_144632chr232286 1982 609 12013 ----
NM_144633chr32519 329 ------
NM_144635chr341232 1139 1121 830 ------
NM_144721chr442649 2080 909 718 ------
NM_144723chr51670 ------
NM_144732chr191411 ------
NM_144775chr17104902 4862 4047 3403 3159 1987 1625 436 368 133 --11081 13527
NM_144778chr1312724 ------
NM_144949chr232486 891 262 ------
NM_144979chr41209 ------
NM_145008chr111251 --1816 --
NM_145053chr11------1582
NM_145055chr1822599 1407 ------
NM_145063chr61137 --1196 --
NM_145109chr171972 ------
NM_145159chr141371 --1592 --
NM_145203chr13--1284 1102 --
NM_145259chr234605 2313 832 ------
NM_145279chr111598 --2632 56 --
NM_145313chr102453 95 --1536 --
NM_145320chr733443 3058 551 ------
NM_145321chr733443 3058 551 ------
NM_145322chr733443 3058 551 ------
NM_145341chr1021444 415 --1569 --
NM_145686chr211278 ------
NM_145687chr211278 ------
NM_145690chr82288 147 ------
NM_145735chr1321095 904 --12784 --
NM_145739chr2187 ------
NM_145799chrX52935 1156 422 383 236 --13107 --
NM_145804chr1121273 71 ------
NM_145861chr131857 1609 504 11348 ----
NM_145891chr162232 225 1479 --1251
NM_145892chr162232 225 1479 --1251
NM_145893chr162354 347 1601 --1373
NM_147147chr653592 3478 3462 1489 1213 --11533 --
NM_147181chr411055 ------
NM_147182chr411055 ------
NM_147183chr411055 ------
NM_147189chr851601 1456 818 623 301 1191 ----
NM_147202chr932733 2495 929 --22611 944 --
NM_147233chr211711 ------
NM_148571chr1741850 1477 1408 734 1397 ----
NM_148904chr11113 ------
NM_148905chr11113 ------
NM_148906chr11113 ------
NM_148907chr11113 ------
NM_148908chr11113 ------
NM_148909chr11113 ------
NM_148921chr173767 688 582 1734 32393 1982 457 --
NM_148955chr1544455 4006 414 309 12632 15363 --
NM_152221chr22----11244 1506
NM_152233chr141319 11469 11200 --
NM_152253chr2253769 2998 2683 766 184 --12649 --
NM_152261chr1212088 12459 ----
NM_152264chr111254 1954 197 --
NM_152265chr13616 492 56 ------
NM_152271chr82144 43 ------
NM_152275chr21663 1656 ----
NM_152280chr1--11269 13469 --
NM_152292chr441882 1712 1537 785 --11846 --
NM_152344chr172363 57 11261 ----
NM_152345chr17----1866 --
NM_152385chr2155 ------
NM_152431chr111398 ------
NM_152450chr1541833 1661 1652 770 ------
NM_152451chr152322 56 ------
NM_152538chr331549 1277 1260 ------
NM_152556chr742478 2445 2415 1647 ------
NM_152586chr102407 72 ------
NM_152606chr19----1328 --
NM_152608chr111615 ----11810
NM_152629chr942870 1147 742 290 ------
NM_152636chr1122320 884 11887 22223 2217 --
NM_152638chr1211240 ------
NM_152653chr3------1741
NM_152671chr2--1167 --193
NM_152678chr331831 787 199 ------
NM_152688chr62884 270 ------
NM_152692chrX1171 ------
NM_152694chrX1170 ------
NM_152699chr333259 703 461 11469 2997 631 --
NM_152734chr655147 1797 1404 586 198 25517 472 1962 --
NM_152737chr611808 ------
NM_152749chr731061 972 384 ------
NM_152754chr733843 3747 2348 ------
NM_152756chr522651 1704 13862 ----
NM_152758chr81360 ------
NM_152789chr72502 255 ------
NM_152793chr724943 630 ----1276
NM_152826chr1544455 4006 414 309 12632 15363 --
NM_152835chr111125 ----172
NM_152836chr811427 --11386 --
NM_152837chr811427 --11386 --
NM_152838chr2022942 1260 1145 13225 --
NM_152857chr62744 714 ------
NM_152858chr62744 714 ------
NM_152896chr93742 644 34 ------
NM_152924chr1565693 5394 2426 1685 507 275 --45916 2530 2199 396 --
NM_152989chr1231568 384 327 ------
NM_152996chr121537 190 1770 ----
NM_153020chr611072 ------
NM_153029chr1684024 3618 3162 3004 2943 2513 1528 535 141 33780 3730 2668 --
NM_153035chr142476 2238 231 101 22743 92 12831 12399
NM_153042chr621827 303 1339 ----
NM_153050chr2274746 1572 1550 1154 1130 463 241 --13326 --
NM_153051chr2274746 1572 1550 1154 1130 463 241 --13326 --
NM_153181chr181199 ------
NM_153184chr31307 11751 --11974
NM_153188chr534964 4745 4135 ----1897
NM_153207chr1243222 1452 689 537 11488 ----
NM_153235chr6--2666 215 11679 --
NM_153260chr151600 ----165
NM_153273chr342683 1767 779 220 --1340 --
NM_153367chr1022913 1388 12853 ----
NM_153371chr13184 ------
NM_153464chr19--137 1224 --
NM_153487chr633034 428 136 24037 1526 ----
NM_153607chr512888 ------
NM_153631chr73216 204 61 ------
NM_153632chr73216 204 61 ------
NM_153633chr121709 ------
NM_153634chr121180 1670 ----
NM_153649chr111939 ------
NM_153705chr1121842 116 1151 --12409
NM_153756chr11493 ----1227
NM_153758chr12327 125 ------
NM_153812chr162173 2167 2159 671 604 498 1768 ----
NM_153828chr21888 ------
NM_153831chr8--1136 ----
NM_170665chr1273459 1829 1520 1509 884 371 105 ----12906
NM_170674chr1511040 ------
NM_170675chr151716 ------
NM_170676chr151716 ------
NM_170677chr1511040 ------
NM_170695chr18--1429 ----
NM_170707chr13889 371 173 ------
NM_170708chr13889 371 173 ------
NM_170720chr1911017 --1900 --
NM_170731chr1152468 2429 1955 243 143 1650 ----
NM_170732chr1152468 2429 1955 243 143 1650 ----
NM_170733chr1152468 2429 1955 243 143 1650 ----
NM_170734chr1152468 2429 1955 243 143 1650 ----
NM_170735chr1152468 2429 1955 243 143 1650 ----
NM_171825chr522308 994 12573 13096 --
NM_171998chrX----21941 248 12205
NM_172016chr621433 1409 ------
NM_172020chr741704 1435 690 469 ------
NM_172070chr211858 11976 1709 11703
NM_172071chr155971 5893 2839 1688 876 11405 ----
NM_172130chr13492 375 94 ------
NM_172169chr1031771 355 61 ------
NM_172170chr1031771 355 61 ------
NM_172171chr1031771 355 61 ------
NM_172173chr1031771 355 61 ------
NM_172216chr1242488 2211 452 212 --21943 416 --
NM_172315chr1511040 ------
NM_172316chr1511040 ------
NM_172337chr141753 1391 ----
NM_173054chr7----1827 1764
NM_173075chr42541 377 1529 ----
NM_173083chr121092 944 ------
NM_173171chr21364 ------
NM_173173chr21364 ------
NM_173174chr81161 ----1857
NM_173175chr81161 ----1857
NM_173176chr81161 ----1857
NM_173198chr932958 877 587 --12558 --
NM_173199chr91401 --1188 --
NM_173200chr932958 877 587 --12558 --
NM_173207chr18--1429 ----
NM_173208chr18--1429 ----
NM_173209chr18--1429 ----
NM_173210chr18--1429 ----
NM_173211chr18--1429 ----
NM_173214chr1697972 7320 6874 6180 3067 3015 2899 1487 59 12696 --13241
NM_173454chr1511194 ------
NM_173470chrX72801 2781 2770 2335 2212 499 302 --12084 --
NM_173476chr1652050 2031 1514 578 349 11937 ----
NM_173494chrX1634 ------
NM_173511chr232618 1079 1025 --23439 1175 12854
NM_173531chr1943299 2529 1562 273 13472 ----
NM_173546chr32531 92 ------
NM_173561chr63510 491 89 ------
NM_173582chr1176290 5554 5107 5068 1600 1249 571 11997 15001 --
NM_173595chr1254612 3804 1544 1138 32 ------
NM_173602chr1233752 2384 750 ------
NM_173642chr1148644 8591 7974 7655 7504 7095 6779 6723 6124 5621 2718 2398 2044 170 18977 ----
NM_173662chr4--137 ----
NM_173665chr5----1783 --
NM_173683chr8----11307 --
NM_173694chrX41882 1740 851 58 ------
NM_173698chrX21536 519 --1115 --
NM_173808chr131689 570 53 14220 ----
NM_173822chr231436 718 241 ------
NM_173830chr6165 ------
NM_173854chr122290 1543 1431 ----
NM_174886chr18--1429 ----
NM_174890chr101569 ------
NM_174911chr832898 955 917 ------
NM_174921chr42932 254 ------
NM_174937chr101613 ------
NM_174963chr11232 --1830 --
NM_174964chr11232 --1830 --
NM_174965chr11251 --1849 --
NM_174966chr11232 --1830 --
NM_174967chr11251 --1849 --
NM_174968chr11232 --1830 --
NM_174969chr11232 --1830 --
NM_174970chr11251 --1849 --
NM_174971chr11232 --1830 --
NM_175607chr32663 541 ------
NM_175610chr151893 ------
NM_175612chr32663 541 ------
NM_175623chr1266666 6342 5092 2741 2100 1135 24780 52 ----
NM_175634chr821310 1004 ------
NM_175635chr821310 1004 ------
NM_175636chr821310 1004 ------
NM_175709chr2272797 2353 2276 2061 929 653 375 --1720 --
NM_175733chr1132206 2089 2038 ------
NM_175748chr142845 74 ------
NM_175856chr52144 56 ------
NM_175859chrX11170 11788 ----
NM_175866chr121025 408 ------
NM_175921chr523863 2892 13558 13358 22750 1419
NM_175931chr1631929 1781 436 ------
NM_176801chr42659 627 ----1207
NM_176814chr7--11492 ----
NM_176871chr873336 3305 2907 2577 1121 503 150 --21037 640 11070
NM_177438chr1433620 2966 595 1132 12682 --
NM_177947chrX1590 11639 ----
NM_177948chrX1590 11639 ----
NM_177968chr221780 462 ------
NM_177985chr21842 ------
NM_177990chr2011519 ------
NM_177996chr2022540 2152 21169 236 ----
NM_178010chr1231568 384 327 ------
NM_178123chr2----1701 --
NM_178140chr521953 1072 12587 ----
NM_178151chrX46124 5927 3105 556 --16851 --
NM_178152chrX46124 5927 3105 556 --16851 --
NM_178153chrX46124 5927 3105 556 --16851 --
NM_178175chrX2631 175 ------
NM_178424chr51477 1233 ----
NM_178450chr5122 ------
NM_178496chr3158 ------
NM_178565chr821407 652 11372 ----
NM_178566chr921531 576 ------
NM_178585chr433138 386 221 ------
NM_178586chr1422335 351 ------
NM_178812chr811418 ------
NM_178815chr1032016 1890 70 ------
NM_180989chr1311877 ------
NM_181054chr141188 --11261 --
NM_181349chr743042 2046 397 175 1679 --1374
NM_181351chr111754 --12268 --
NM_181354chr81621 ------
NM_181358chr183989 3802 3771 3187 3077 1650 896 873 ------
NM_181361chr32214 208 ------
NM_181442chr202143 106 ------
NM_181443chr2032557 2297 231 --1496 --
NM_181481chr1865779 5347 4389 1880 1258 1084 ------
NM_181482chr1865779 5347 4389 1880 1258 1084 ------
NM_181483chr1865779 5347 4389 1880 1258 1084 ------
NM_181528chr20170 ------
NM_181671chr171806 ------
NM_181672chrX11729 11893 ----
NM_181673chrX11729 11893 ----
NM_181702chr8198 1862 ----
NM_181828chr2273219 2581 2482 2460 960 651 157 --33496 2810 687 --
NM_181829chr2273219 2581 2482 2460 960 651 157 --33496 2810 687 --
NM_181830chr2273219 2581 2482 2460 960 651 157 --33496 2810 687 --
NM_181836chr532411 2045 1790 ------
NM_181838chr521390 989 11546 ----
NM_181839chr82218 105 1206 1165 --
NM_181861chr1211863 1302 1139 --
NM_181868chr1211863 1302 1139 --
NM_181869chr1211948 1387 1224 --
NM_182314chrX2561 240 --11240 --
NM_182485chr433417 2852 51 ------
NM_182503chr635409 4833 1961 23417 1660 15228 --
NM_182511chr1811238 --1527 --
NM_182526chr1432560 935 412 12651 --1276
NM_182543chr10153 --1105 --
NM_182568chr17------134
NM_182603chr11290 83 ----1938
NM_182641chr17146 ------
NM_182646chr433417 2852 51 ------
NM_182678chr21406 ------
NM_182717chr1031266 979 486 ------
NM_182720chr1031266 979 486 ------
NM_182721chr1031266 979 486 ------
NM_182722chr1031266 979 486 ------
NM_182723chr1031266 979 486 ------
NM_182757chr611121 --2766 525 --
NM_182796chr51713 ------
NM_182830chr144880 526 363 254 1281 ----
NM_182848chr132464 192 1987 ----
NM_182853chr1031266 979 486 ------
NM_182898chr71888 22165 912 ----
NM_182899chr71888 22165 912 ----
NM_182907chr632291 974 72 ------
NM_182910chr141599 ------
NM_182913chr141599 ------
NM_182914chr141599 ------
NM_182918chr2111056 1544 ----
NM_182931chr71708 ------
NM_182943chr3------177
NM_182970chr2033712 3700 623 11074 1253 --
NM_182972chr132201 2137 121 ------
NM_183004chr1463583 3244 1582 1459 1032 952 ------
NM_183011chr1031266 979 486 ------
NM_183012chr1031266 979 486 ------
NM_183013chr1031266 979 486 ------
NM_183050chr622007 1915 12294 ----
NM_183416chr11733 ------
NM_183419chr82518 382 156 ----
NM_183422chr132739 27 1920 ----
NM_184234chr201708 ------
NM_194259chr162568 382 ------
NM_194260chr162568 382 ------
NM_194261chr162568 382 ------
NM_194272chr15130 ------
NM_194278chr141114 11286 ----
NM_194285chr1143166 2715 2134 625 ------
NM_194291chr833040 2584 151 ------
NM_194314chr145541 4030 3732 1718 1931 15296 --
NM_194328chr932567 2495 84 ------
NM_194329chr932567 2495 84 ------
NM_194330chr932567 2495 84 ------
NM_194332chr932567 2495 84 ------
NM_194434chr1874765 4000 3536 2286 1484 893 290 22091 1940 ----
NM_194449chr181896 ------
NM_197939chr1731037 452 194 1345 ----
NM_197968chr132691 184 ------
NM_198086chr14------1597
NM_198123chr831255 641 205 ------
NM_198124chr831255 641 205 ------
NM_198128chr1812366 ------
NM_198158chr342755 2535 2463 1032 ------
NM_198159chr342755 2535 2463 1032 ------
NM_198177chr342755 2535 2463 1032 ------
NM_198178chr342755 2535 2463 1032 ------
NM_198186chr91474 ------
NM_198187chr91474 ------
NM_198225chr1011991 11961 11947 --
NM_198243chr151149 ------
NM_198264chr1288 52 ------
NM_198268chr183989 3802 3771 3187 3077 1650 896 873 ------
NM_198269chr183989 3802 3771 3187 3077 1650 896 873 ------
NM_198270chrX2789 167 ------
NM_198291chr2021993 1241 ------
NM_198318chr191174 ------
NM_198319chr191174 ------
NM_198334chr112849 765 ------
NM_198335chr112849 765 ------
NM_198391chr20--2458 450 ----
NM_198468chr624467 3217 1983 ----
NM_198549chr153064 2588 803 612 203 ------
NM_198560chr333230 2977 378 1485 ----
NM_198581chr237098 1514 347 11831 ----
NM_198715chr155801 2352 1652 994 752 12312 ----
NM_198793chr352768 880 541 410 121 13278 ----
NM_198859chr334309 1913 97 --11919 1651
NM_198889chr42882 288 11406 ----
NM_198925chr151949 --1399 --
NM_198965chr12------1358
NM_198966chr12------1358
NM_199040chr122322 266 --13308 --
NM_199129chr203920 899 25 11126 1333 --
NM_199144chr20------11007
NM_199169chr2033382 2953 953 --22566 1143 12883
NM_199170chr2033382 2953 953 --22566 1143 12883
NM_199171chr2033382 2953 953 --22566 1143 12883
NM_199188chr1231653 180 58 11325 1510 --
NM_199190chr1231653 180 58 11325 1510 --
NM_199203chr20------11007
NM_199205chr82706 621 ----1119
NM_199262chr1732249 305 81 --1389 --
NM_199355chr1621428 1295 ------
NM_199421chr1423201 1150 ------
NM_199454chr132988 928 484 --23343 1104 --
NM_199461chr1042910 2257 623 132 ------
NM_199478chrX21622 793 ------
NM_199482chr21783 11838 ----
NM_201266chr231870 857 211 12938 ----
NM_201279chr231870 857 211 12938 ----
NM_201348chr164219 3819 2933 1369 695 247 --11067 --
NM_201403chr111598 --2632 56 --
NM_201436chr71867 1772 ----
NM_201516chr71923 1828 ----
NM_201517chr71867 1772 ----
NM_201520chr1711290 1690 ----
NM_201570chr1021871 216 1464 ----
NM_201571chr1021871 216 1464 ----
NM_201572chr1021871 216 1464 ----
NM_201590chr1021871 216 1464 ----
NM_201593chr1021871 216 1464 ----
NM_201596chr1021871 216 1464 ----
NM_201597chr1021871 216 1464 ----
NM_201628chr153244 2417 1095 827 668 12789 13296 --
NM_201633chr51345 ------
NM_201995chr112776 248 ------
NM_201998chr112841 313 ------
NM_203283chr4188 ------
NM_203284chr4188 ------
NM_203301chr1421381 29 ------
NM_203305chr912055 1339 11023 1381
NM_203327chr2044105 3750 3191 559 --21393 1100 --
NM_203346chr231835 326 152 --12038 --
NM_203354chr14----1332 --
NM_203355chr14----1332 --
NM_203356chr14----1332 --
NM_203391chrX2202 151 ------
NM_203394chr1222141 1722 --12171 --
NM_203399chr13794 604 336 ------
NM_203401chr13794 604 336 ------
NM_203458chr143657 3597 2644 26 12975 ----
NM_203459chr122436 2330 ------
NM_203487chr131617 ------
NM_203506chr172645 144 ------
NM_205768chr131709 1446 441 ------
NM_205842chr21158 1179 ----
NM_205846chr521252 328 ------
NM_206594chr122462 1374 ------
NM_206595chr122462 1374 ------
NM_206852chr141228 ------
NM_206853chr633740 760 601 12786 ----
NM_206854chr635001 2021 1862 14047 ----
NM_206855chr625966 203 15012 ----
NM_206857chr141228 ------
NM_206876chr22368 351 13545 ----
NM_206907chr513300 ------
NM_206943chr21379 ------
NM_206967chr16122 --2398 72 --
NM_207015chr3--1485 ----
NM_207123chr41877 ------
NM_207171chr131806 1263 679 ------
NM_207299chr91881 1279 ----
NM_207303chr1063970 3523 1513 1142 1121 1054 12544 ----
NM_207304chr1312611 ------
NM_207321chr1011064 --11052 --
NM_207406chr445944 4525 2227 1368 ------
NM_207520chr21888 ------
NM_207521chr21888 ------
NM_207645chr111974 ------
NM_207660chr1421161 182 ------
NM_207661chr1421161 182 ------
NM_207662chr1421161 182 ------
NM_212460chr7182 ------
NM_213589chr244575 1838 1280 1159 2537 471 1673 --
NM_213590chr1363534 3266 1040 1028 981 244 11661 ----
NM_213662chr1752351 1757 700 363 204 11530 ----