TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4691-5p
miRNA Sequence: GUCCUCCAGGCCAUGAGCUGCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000719chr12124807 4682 4189 4147 2479 2457 2415 2201 800 646 489 463 44379 4368 806 172 --22230 1783
NM_001004304chr1231182 1176 1093 22449 779 43126 2969 1170 114 12763
NM_001005473chr512467 81890 1061 1041 1017 1001 976 964 952 26417 6003 --
NM_001017440chr787744 7202 6378 5534 5409 3072 2116 937 25631 2433 21840 1806 26962 1215
NM_001043318chr1451306 433 244 202 51 53566 1497 1074 737 80 33804 1151 71 1953
NM_001106chr3136550 6506 6235 3901 3843 3340 3316 2918 2728 766 720 655 643 29748 3518 13032 16366
NM_001659chr1282301 1964 1952 929 625 525 515 506 --1769 1981
NM_002737chr1775839 5535 5296 4264 2031 469 115 42584 2569 1824 462 1476 16471
NM_003107chr651961 802 716 697 505 2256 243 2989 947 22536 605
NM_003108chr296881 6172 2874 2468 2304 1930 1632 415 34 76999 2682 2380 2363 2297 2222 60 36971 1942 136 1658
NM_003216chr2262430 2369 1263 1136 1078 56 13316 42738 2673 2201 708 43186 2857 2617 2229
NM_004774chr1773012 2603 1245 871 817 276 265 22065 300 32902 2336 563 --
NM_004976chr11124749 4523 4078 4022 4014 1467 936 927 459 353 112 97 44399 4222 3364 1643 34037 3356 3147 13489
NM_005197chr1456022 4259 4166 4088 496 32315 1967 503 --25671 2252
NM_005477chr1532349 1890 1752 41675 242 235 225 12371 --
NM_005477chr1532349 1890 1752 41675 242 235 225 12371 --
NM_005759chr234271 1381 787 1472 --24734 3701
NM_006037chr294751 4464 3836 3666 3144 3073 1941 953 920 11786 33364 627 570 14065
NM_006546chr17126375 6080 5379 5088 4709 4688 4373 4183 2591 2088 1930 1913 25635 1508 46550 5485 5433 985 --
NM_007050chr2066725 5880 5758 961 721 450 --56515 5536 2155 917 399 22916 1555
NM_012234chr332488 363 354 1370 --13603
NM_014233chr17111947 1700 1684 1463 691 476 458 333 327 213 152 12118 2571 167 11556
NM_014891chr73290 179 173 11643 2187 167 --
NM_014952chr15111704 1666 1555 1334 784 410 403 336 324 318 130 42015 1384 757 173 --11648
NM_014994chr1562179 1800 1794 1788 282 153 12108 ----
NM_015035chr2056647 5978 5480 4490 2660 24997 4771 12106 34387 2125 1052
NM_015049chr232282 2268 882 32916 752 129 11197 2172 137
NM_015130chr44213 39 30 21 145 ----
NM_015271chr413410 --1964 23305 2649
NM_015375chr154529 4445 3581 3099 1266 14490 21583 630 23704 3233
NM_015686chrX71900 1614 678 377 291 106 64 31014 284 114 --1123
NM_018313chr362361 1943 960 707 95 72 181 12152 --
NM_020443chr176263 5321 4648 2675 1781 327 111 2145 123 26112 418 16245
NM_020699chr1135161 5102 4463 3942 3680 2064 1764 1194 812 725 652 606 590 34563 1598 1093 13705 --
NM_022648chr2104108 3968 3796 3477 3092 1139 854 114 93 53 44431 3218 736 168 34168 3114 213 23076 371
NM_025248chr1762869 2617 2199 2046 1002 131 12235 42927 2191 792 760 32442 975 474
NM_031468chr787744 7202 6378 5534 5409 3072 2116 937 25631 2433 21840 1806 26962 1215
NM_033315chr1791962 1837 1669 1442 604 312 305 288 46 11618 11347 21572 1357
NM_052906chr22174958 4952 4129 3714 3425 3256 2037 1906 1889 1684 1468 1158 1050 788 380 353 45 54640 3243 3109 520 322 34088 1064 1038 158
NM_080669chr17104455 4044 4024 3435 3213 1794 1686 1621 1036 60 43773 3245 1452 482 53233 3144 1913 1882 1386 21138 517
NM_133170chr2066725 5880 5758 961 721 450 --56515 5536 2155 917 399 22916 1555
NM_152424chrX54430 4424 749 85 77 24497 4440 13017 24490 4177
NM_152733chr6145793 5591 5384 5221 4440 2536 2022 1749 1708 1320 393 363 222 115 34590 4526 305 66112 5901 5440 5235 2464 2032 14497
NM_173595chr12244846 4836 4684 4644 4578 4566 4519 4456 4403 4396 4287 4084 4061 3993 3920 3389 1727 1614 1261 1113 795 537 493 118 23763 1241 24463 109 1978
NM_173642chr176649 6424 6245 6091 2898 2892 971 23573 3491 28122 6221 27857 6418
NM_175624chr1277201 7192 7185 2872 2772 2371 2358 16053 --25738 793
NM_175625chr1277201 7192 7185 2872 2772 2371 2358 16053 --25738 793
NM_178864chr117521 171 161 151 145 108 86 --1280 1558
NM_182970chr20104158 3925 3802 3590 3231 1223 1217 830 663 92 24231 3038 43292 3196 845 780 23335 2774
NM_194278chr1451306 433 244 202 51 53566 1497 1074 737 80 33804 1151 71 1953
NM_194286chr1285971 5733 5314 4950 2417 2226 1866 28 11479 14742 23887 1132
NM_198560chr3153065 3022 2910 2736 2529 2502 2379 2346 2314 1316 914 691 680 297 203 12653 51277 949 923 364 174 --
NM_199462chr154529 4445 3581 3099 1266 14490 21583 630 23704 3233