TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4697-3p
miRNA Sequence: UGUCAGUGACUCCUGCCCCUUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr562017 1674 672 541 371 172 11604 ----
NM_000052chrX42750 2097 658 441 1674 --145
NM_000081chr121591 742 ------
NM_000084chrX55583 5429 1680 656 323 --24923 2110 --
NM_000092chr284142 3998 3800 931 843 328 255 236 14287 ----
NM_000108chr731524 685 477 ------
NM_000109chrX22505 747 11846 --1937
NM_000111chr7------1262
NM_000125chr644157 3302 3290 1355 13238 23348 3316 --
NM_000134chr431617 682 98 1315 11381 --
NM_000141chr103263 56 39 11457 11397 --
NM_000153chr1451471 1101 394 373 310 ------
NM_000163chr52296 49 ------
NM_000165chr631164 1130 164 ------
NM_000167chrX51854 1820 1557 504 258 ------
NM_000176chr543205 2618 1224 729 ------
NM_000192chr1221122 352 ------
NM_000202chrX63953 2889 2644 1455 806 264 ------
NM_000208chr1974389 3048 1567 1513 1058 771 569 23762 3708 ----
NM_000214chr2051804 1397 1178 365 93 ----1143
NM_000217chr1265260 5065 4726 453 260 155 ------
NM_000222chr451838 1771 1657 1402 636 ------
NM_000223chr171145 ------
NM_000232chr453076 2697 2660 1177 547 --1921 --
NM_000240chrX52243 2115 1633 722 30 31690 832 62 ----
NM_000245chr741844 1742 1654 474 ------
NM_000248chr342850 2111 1027 802 1622 ----
NM_000259chr15126121 5839 4688 4664 2548 887 785 620 445 336 104 76 2516 26 11900 --
NM_000282chr131181 ------
NM_000297chr422046 1693 ------
NM_000305chr71304 1388 189 --
NM_000314chr1053284 3158 2057 1274 320 1872 ----
NM_000319chr1211250 ------
NM_000321chr133713 674 472 ----11140
NM_000332chr645009 2614 2120 1784 26767 4402 2904 320 1686
NM_000337chr556189 5660 4598 4097 1186 35292 4497 556 21588 62 24995 370
NM_000338chr1511018 1421 --11066
NM_000340chr321479 1096 --11389 --
NM_000346chr1711462 ----11632
NM_000368chr9114624 4006 3947 3592 1725 1660 1127 924 829 177 144 ------
NM_000380chr91515 ------
NM_000390chrX43158 3086 778 537 12563 2942 194 --
NM_000393chr221696 280 1845 ----
NM_000408chr253226 2805 2649 2217 591 ----1699
NM_000411chr2162650 2567 2411 2380 706 454 23241 2196 ----
NM_000421chr171350 ------
NM_000426chr61205 ------
NM_000430chr1773639 2717 2359 927 844 764 73 13650 --13555
NM_000441chr73389 321 112 11600 2414 63 --
NM_000448chr1162631 2428 2060 937 168 59 ------
NM_000458chr174872 722 359 335 ------
NM_000461chr364092 3458 3383 1597 1204 658 1925 11216 21435 1129
NM_000462chr1541468 1451 1381 1263 ------
NM_000492chr731481 1230 1049 ----1174
NM_000523chr2----1395 --
NM_000530chr1------11132
NM_000533chrX3628 487 102 --2606 353 --
NM_000551chr32152 51 1743 ----
NM_000555chrX87562 6374 5720 1598 1372 1309 877 716 26311 5220 1189 --
NM_000579chr332005 1496 1484 1268 1545 --
NM_000598chr731520 1019 121 --1340 --
NM_000609chr1042501 2433 2005 903 --2991 214 12872
NM_000610chr113661 448 91 ------
NM_000618chr12106379 6335 5870 5260 5224 2336 2112 1520 1112 1014 14331 55976 5919 4274 1734 1097 --
NM_000618chr12106379 6335 5870 5260 5224 2336 2112 1520 1112 1014 14331 55976 5919 4274 1734 1097 --
NM_000621chr1331015 352 38 1945 ----
NM_000633chr1894748 4673 4531 2000 1696 1456 1431 842 657 13244 21994 1040 --
NM_000640chrX132 ------
NM_000663chr1632863 2145 999 1365 --12401
NM_000668chr41279 ------
NM_000693chr1511499 --1630 11115
NM_000719chr1296208 5746 5218 5071 4891 2615 2093 1546 694 11057 14676 14096
NM_000726chr221469 394 ------
NM_000740chr12151 143 ------
NM_000788chr411298 --11133 --
NM_000793chr14124868 4646 4473 4242 3791 3753 3712 3631 3183 1936 288 101 2698 301 --11428
NM_000800chr561570 1553 1485 1454 366 225 11059 --11219
NM_000809chr4139145 8195 7237 6630 6559 6377 5824 5803 5749 3456 3342 1422 305 58094 7880 6579 2090 919 38415 1386 517 --
NM_000810chr151194 1242 ----
NM_000813chr564430 3949 3596 3574 511 474 11218 ----
NM_000814chr1594242 4131 3853 3726 3430 2748 1247 845 41 13157 --1631
NM_000817chr21100 ------
NM_000824chr43698 664 336 ------
NM_000826chr431762 584 159 11602 ----
NM_000827chr522176 305 32393 1738 1661 ----
NM_000829chr1131685 597 574 ------
NM_000840chr71497 ------
NM_000844chr33927 328 301 ----1205
NM_000860chr4--1611 ----
NM_000866chr351878 1708 1633 1459 632 ------
NM_000872chr10------11379
NM_000875chr1566275 5389 4684 4605 1952 628 1231 11998 --
NM_000876chr61392 ------
NM_000880chr83721 255 105 1374 ----
NM_000891chr1722850 2811 ----13577
NM_000899chr1243198 2806 755 692 23074 196 ----
NM_000910chr441601 430 150 84 ------
NM_000912chr832946 2504 756 --13272 --
NM_000921chr122504 38 ------
NM_000922chr1171120 1024 953 324 264 102 91 ------
NM_000933chr2031319 244 143 ------
NM_000945chr2--1556 ----
NM_000950chrX43413 2830 1039 483 1601 21322 89 --
NM_000959chr132435 778 243 33808 2857 1089 ----
NM_000966chr122875 55 ------
NM_000983chr131567 1436 1347 1242 ----
NM_001001132chr211292 ------
NM_001001323chr1253143 3028 2385 2043 798 32002 1955 503 1121 --
NM_001001330chr101179 21203 1031 11036 11006
NM_001001344chrX42020 1747 973 902 1713 --11807
NM_001001389chr113661 448 91 ------
NM_001001390chr113661 448 91 ------
NM_001001391chr113661 448 91 ------
NM_001001392chr113707 494 137 ------
NM_001001394chr22189 147 ----1283
NM_001001395chr1262497 2272 1061 1040 1015 95 181 ----
NM_001001396chr144484 4389 4155 4120 12874 12864 --
NM_001001419chr5104821 4804 4230 4091 3772 1237 1191 699 255 89 ------
NM_001001420chr5104821 4804 4230 4091 3772 1237 1191 699 255 89 ------
NM_001001481chr832420 2141 42 1193 ----
NM_001001483chr11----1278 --
NM_001001484chr103692 599 511 ------
NM_001001485chr32405 325 ----137
NM_001001549chr742837 837 148 45 32319 1826 366 11917 --
NM_001001550chr742837 837 148 45 32319 1826 366 11917 --
NM_001001555chr742837 837 148 45 32319 1826 366 11917 --
NM_001001556chr1541130 365 309 253 1358 ----
NM_001001664chr284119 1534 1264 1047 747 681 190 34 11132 ----
NM_001001684chr1762515 2241 1820 1768 1564 691 1253 169 --
NM_001001702chr5--11819 11639 --
NM_001001711chr112431 207 21031 75 ----
NM_001001852chr221749 ------
NM_001001890chr2133873 1039 900 ------
NM_001001928chr22118302 8232 8139 7258 6950 6268 5890 5427 5410 5236 3247 32678 1183 47 ----
NM_001001933chr1169 ------
NM_001001977chr20--1128 ----
NM_001001995chrX2722 634 1484 --1672
NM_001002026chr352455 2071 673 485 358 --1917 --
NM_001002243chr23714 288 175 --1381 --
NM_001002255chr61271 1239 ----
NM_001002258chr231915 1865 480 --1254 11484
NM_001002259chr122289 84 ------
NM_001002814chr863785 3397 3040 2845 355 333 13108 ----
NM_001002860chr1464426 1855 1470 1439 1215 887 34660 3563 2866 14676 11165
NM_001002909chr1721973 810 --11683 11604
NM_001002926chr742138 852 563 163 1884 ----
NM_001003406chr2263112 2489 2246 2052 1042 304 --12603 --
NM_001003407chr1094784 4707 4652 3685 3668 1914 1358 936 332 138 14589 --
NM_001003408chr1094784 4707 4652 3685 3668 1914 1358 936 332 138 14589 --
NM_001003652chr18128483 8220 7832 7607 7503 7265 3230 3175 3099 1369 809 716 11388 25857 3073 --
NM_001003688chr411160 2750 87 ----
NM_001003712chr1283837 3726 2977 2736 1482 706 166 139 ------
NM_001003760chr653462 3296 3022 2868 254 --1109 --
NM_001003792chr32281 56 ------
NM_001003793chr32281 56 ------
NM_001003940chr1543103 2499 912 709 174 1770 12972
NM_001003942chr1543103 2499 912 709 174 1770 12972
NM_001003943chr1543107 2503 916 713 178 1774 12976
NM_001004304chr1242942 2731 2554 1990 12032 22662 870 --
NM_001004317chr651792 1380 969 428 92 --23790 3106 14125
NM_001004329chr122590 363 ----1405
NM_001004342chr165907 5283 4140 1331 614 377 35207 3761 991 ----
NM_001004419chr1244562 3087 1385 329 23319 123 --1812
NM_001005207chr171213 ------
NM_001005266chr152640 166 ------
NM_001005267chr152640 166 ------
NM_001005268chr152640 166 ------
NM_001005269chr152640 166 ------
NM_001005332chrX1203 ------
NM_001005333chrX1203 ------
NM_001005353chr1--31064 817 133 ----
NM_001005353chr1--31064 817 133 ----
NM_001005375chrY41458 402 244 191 ------
NM_001005386chr231863 1543 983 11837 ----
NM_001005463chr1032414 382 216 ----1675
NM_001005473chr542444 2129 1909 94 15088 ----
NM_001005732chr213618 595 257 ------
NM_001005746chr221469 394 ------
NM_001005747chr221469 394 ------
NM_001005781chr23477 467 105 ------
NM_001005849chr17--1240 ----
NM_001006600chr512252 --2843 733 12289
NM_001006624chr141941 1285 306 290 ------
NM_001006636chr21337 1137 --1798
NM_001006657chr233286 2983 2873 13095 ----
NM_001006938chrX1657 ------
NM_001007023chr14124868 4646 4473 4242 3791 3753 3712 3631 3183 1936 288 101 2698 301 --11428
NM_001007024chr1763959 3080 2997 2676 1766 1355 1128 ----
NM_001007025chr1763959 3080 2997 2676 1766 1355 1128 ----
NM_001007027chr111222 ------
NM_001007097chr994710 4288 3896 3526 1466 507 445 393 365 14475 13393 --
NM_001007189chr5158 ------
NM_001007226chr171385 --165 --
NM_001007227chr171385 --165 --
NM_001007228chr171385 --165 --
NM_001007229chr171385 --165 --
NM_001007230chr171385 --165 --
NM_001007246chr2131616 303 141 ------
NM_001007257chr161423 1357 1336 266 121 34 ------
NM_001007464chr62153 138 ------
NM_001007466chr6105138 4089 3996 3897 3549 3385 1863 1385 862 716 14777 2590 247 --
NM_001007527chr52170 128 ------
NM_001007538chr132189 30 1311 ----
NM_001007553chr121239 834 ------
NM_001007563chr9126 ------
NM_001007565chr3----1405 --
NM_001008239chr1823495 3437 1612 12799 --
NM_001008392chr373061 2955 2758 1270 1175 1025 366 13401 ----
NM_001008401chr193913 466 312 21106 932 11409 --
NM_001008405chr741601 641 481 226 ------
NM_001008408chr7115719 5548 4891 2327 2176 2095 1973 1937 1149 1057 527 34275 1986 177 24614 865 --
NM_001008491chr251428 353 343 331 311 11458 1449 --
NM_001008492chr251428 353 343 331 311 11458 1449 --
NM_001008495chr832143 894 114 ------
NM_001008529chr171461 11200 ----
NM_001008540chr22153 79 ------
NM_001008564chr1352164 1910 1902 1656 161 --1252 --
NM_001008566chr222376 162 ------
NM_001008707chr1481749 1438 1273 1255 616 475 409 221 11677 ----
NM_001008801chr1982123 1841 1390 1329 676 592 323 239 11592 ----
NM_001009899chr356137 5891 4172 481 380 11034 ----
NM_001009993chr274579 4394 3857 3540 1759 345 175 14095 21694 578 --
NM_001010000chr1832150 534 415 ------
NM_001010846chr154399 3911 1805 1586 1124 12901 24104 3362 --
NM_001010862chrX73308 3173 2456 381 345 215 192 2790 633 ----
NM_001010888chrX54296 4134 2831 1312 924 14624 23858 3422 --
NM_001010891chr535565 836 312 16623 16415 11966
NM_001010908chr102302 42 1681 ----
NM_001010942chr1211140 ------
NM_001010984chr152191 2162 2123 530 299 12515 ----
NM_001011537chr31904 21963 1622 ----
NM_001011546chr20194 1774 1632 --
NM_001011553chr71360 ------
NM_001011666chr775716 5151 2352 2291 535 332 119 ------
NM_001012393chr1174617 3953 3926 3819 2010 1903 1633 11577 ----
NM_001012420chr1552909 2879 2193 1841 971 22156 529 2853 192 --
NM_001012423chr1552909 2879 2193 1841 971 22156 529 2853 192 --
NM_001012751chr101216 --1719 --
NM_001012753chr1981077 1027 943 859 505 235 153 69 ------
NM_001012754chr1321823 284 --11452 --
NM_001012755chrX84786 4625 3464 1909 1750 1678 1603 1523 21885 1847 14584 --
NM_001012761chr562506 1904 1705 899 566 422 12167 ----
NM_001013031chr1043119 2585 1375 917 ------
NM_001013398chr731520 1019 121 --1340 --
NM_001013406chr731310 1174 678 ------
NM_001013415chr4--31268 1152 197 --1385
NM_001013693chr132941 2779 1942 --12351 1140
NM_001013693chr132941 2779 1942 --12351 1140
NM_001014797chr10108008 6380 6231 5259 5086 2739 2659 1151 1098 218 ----27573 699
NM_001015508chr82181 152 ----2764 136
NM_001015877chrX42909 2036 407 129 --1576 11114
NM_001015880chr1021700 1172 1436 11200 --
NM_001017368chr1762616 1904 1076 965 915 269 12247 ----
NM_001017371chr21138 2446 113 ----
NM_001017395chr343460 3021 2475 2353 --13064 --
NM_001017415chr11155 ------
NM_001017416chr11155 ------
NM_001017424chr121598 673 11922 ----
NM_001017425chr121598 673 11922 ----
NM_001017926chr821294 88 --1622 --
NM_001017928chr31216 ------
NM_001017961chr1----1218 --
NM_001017970chr142621 250 ----11660
NM_001017979chr41301 ------
NM_001018009chr3--21161 812 ----
NM_001018050chr2223389 311 --2616 230 12805
NM_001018052chr2223389 311 --2616 230 12805
NM_001018053chr131864 190 49 ------
NM_001018067chr175120 3940 3706 1793 1779 1700 710 ------
NM_001018068chr175120 3940 3706 1793 1779 1700 710 ------
NM_001018069chr175120 3940 3706 1793 1779 1700 710 ------
NM_001018074chr543205 2618 1224 729 ------
NM_001018075chr543205 2618 1224 729 ------
NM_001018076chr543205 2618 1224 729 ------
NM_001018077chr543205 2618 1224 729 ------
NM_001018088chr152151 65 ------
NM_001018161chr71304 1388 189 --
NM_001020658chr11218 1524 245 36 154
NM_001020658chr11218 1524 245 36 154
NM_001023560chr62852 422 --144 --
NM_001023567chr1542301 2271 1900 1862 1532 1192 --
NM_001023570chr3--122 ----
NM_001023571chr3--122 ----
NM_001023587chr31112 --1924 --
NM_001024094chr543205 2618 1224 729 ------
NM_001024218chr142825 721 1661 148 --
NM_001024455chrX62005 739 664 478 396 89 --1427 --
NM_001024460chr61910 1385 2927 184 --
NM_001024647chr1256281 5948 5133 827 157 --15019 --
NM_001024649chr532603 1175 1076 12562 ----
NM_001024680chr221337 366 21443 241 11482 1459
NM_001024847chr322303 87 --12108 --
NM_001024956chr1155389 4434 936 832 645 13832 15625 --
NM_001025068chr31711 ----11520
NM_001025069chr31711 ----11520
NM_001025076chr1086251 5948 5536 2329 2082 988 403 173 --16223 --
NM_001025077chr10107609 7306 6894 4894 4791 2346 1761 1531 634 405 --17581 --
NM_001025105chr531440 1193 153 --11177 --
NM_001025107chr152547 1820 1740 280 138 1415 1360 --
NM_001025107chr152547 1820 1740 280 138 1415 1360 --
NM_001025108chr243278 744 127 74 ----11620
NM_001025203chr21151 ------
NM_001025204chr21151 ------
NM_001025580chrX73822 3712 3346 1622 1415 1299 26 ------
NM_001025595chr4------1302
NM_001025780chr921635 543 ------
NM_001029858chr683360 2966 2656 2478 1117 923 607 168 11173 12715 --
NM_001029863chr622861 749 ----11033
NM_001029875chr532726 2694 25 22107 242 12516 --
NM_001029884chr662615 1700 764 728 161 64 ------
NM_001030007chr1641512 1464 673 152 ----11149
NM_001030055chr1434534 3492 496 11068 ----
NM_001030272chr112138 109 ------
NM_001030273chr112138 109 ------
NM_001031679chr1241384 594 528 178 11414 ----
NM_001031684chr221398 611 11437 1572 --
NM_001031690chr742704 1914 697 478 ------
NM_001031695chr2274857 3951 1972 1786 1759 1311 1278 44791 4568 1753 1536 24432 2025 --
NM_001031716chr23921 743 202 ------
NM_001031732chr463665 3480 3328 917 775 263 2218 206 121 --
NM_001031804chr1664019 3130 2868 2707 1273 1215 --23190 1733 --
NM_001031812chr541807 596 521 506 ------
NM_001032221chr931765 1473 468 ------
NM_001032363chr141405 615 459 64 ------
NM_001032363chr141405 615 459 64 ------
NM_001032380chr102781 208 41766 1588 1534 233 1123 --
NM_001032394chr662014 1927 1892 1122 344 42 ------
NM_001033045chr224068 201 13887 --13840
NM_001033047chr442549 1923 465 424 ------
NM_001033059chr632012 1678 515 ------
NM_001033081chr151885 1666 1622 602 257 1309 1529 --
NM_001033082chr151885 1666 1622 602 257 1309 1529 --
NM_001033087chr2012831 --1717 --
NM_001033117chr384446 3361 3201 1798 1788 1718 1629 307 14264 ----
NM_001033503chr51166 ------
NM_001033557chr23898 524 59 1386 ----
NM_001033578chr842160 1745 289 26 ------
NM_001033581chr1138 --1323 --
NM_001033581chr1138 --1323 --
NM_001033582chr1138 --1323 --
NM_001033602chr1322078 323 1425 11948 --
NM_001034850chr521450 380 1169 1655 1175
NM_001034852chr1421306 512 1268 11907 --
NM_001034954chr1033145 2584 374 13095 1627 --
NM_001034955chr1033145 2584 374 13095 1627 --
NM_001034956chr1033145 2584 374 13095 1627 --
NM_001034957chr1033145 2584 374 13095 1627 --
NM_001035003chr431384 201 103 ----11069
NM_001035004chr431384 201 103 ----11069
NM_001037132chr72760 598 21748 240 ----
NM_001037133chr72760 598 21748 240 ----
NM_001037164chr741762 1704 812 262 ----11796
NM_001037165chr788238 7588 6321 3104 3038 1012 924 213 27509 6516 36843 5974 5654 --
NM_001037174chr24864 646 500 102 32080 1569 226 ----
NM_001037339chr141651 1592 1481 1293 --1345 --
NM_001037340chr141651 1592 1481 1293 --1345 --
NM_001037341chr141651 1592 1481 1293 --1345 --
NM_001037341chr141651 1592 1481 1293 --1345 --
NM_001037553chr2174238 4095 3979 3576 3137 963 794 --74382 4346 4321 3828 3771 1963 973 --
NM_001037954chr1143104 2398 950 764 ------
NM_001038702chr521806 172 12640 1957 --
NM_001039091chrX21163 911 1412 --1106
NM_001039348chr23840 748 382 ------
NM_001039349chr23840 748 382 ------
NM_001039479chr1461861 1574 907 830 799 561 --2855 78 --
NM_001039538chr273344 3325 3047 2660 2513 179 21 12954 1211 --
NM_001039547chr377054 6693 6335 3119 1957 927 668 1892 --13174
NM_001039585chr132692 1035 500 34065 3114 1346 ----
NM_001039590chrX33197 2888 492 13992 11596 --
NM_001039591chrX33197 2888 492 13992 11596 --
NM_001039618chr1185694 5057 4380 3787 2146 1814 966 592 --24987 4362 14485
NM_001039840chrX55757 5038 4310 4204 489 --15362 11970
NM_001039937chr1353307 2524 1504 1449 1179 --1268 13823
NM_001040092chr81270 --1334 --
NM_001040101chr451560 600 546 468 294 185 ----
NM_001040142chr272475 2116 2106 1957 1825 969 104 1233 ----
NM_001040143chr272475 2116 2106 1957 1825 969 104 1233 ----
NM_001040152chr785031 4096 4032 1638 1055 904 207 157 34413 4016 1311 ----
NM_001040153chr13--1404 ----
NM_001040157chr43543 470 432 ------
NM_001040159chr411395 ------
NM_001040181chr311049 21095 57 ----
NM_001040182chr311049 21095 57 ----
NM_001040183chr311049 21095 57 ----
NM_001040199chr311049 21095 57 ----
NM_001040200chr311049 21095 57 ----
NM_001040202chr421845 1750 1518 ----
NM_001040284chr1695776 4680 4533 2121 1746 1735 1657 834 699 1164 ----
NM_001040402chr433204 2503 1093 --12958 --
NM_001040409chr22396 95 ------
NM_001040429chr1363636 2498 2378 855 481 391 11417 ----
NM_001040441chr155473 5403 4452 1233 200 --2105 47 --
NM_001040446chr552601 1812 1785 971 564 ----12291
NM_001040876chr421601 325 --2761 442 --
NM_001042355chr1663676 2076 1704 483 344 277 ------
NM_001042371chr162759 399 --21738 1536 --
NM_001042403chr122227 59 --11030 --
NM_001042412chr1663676 2076 1704 483 344 277 ------
NM_001042413chr91126 23458 1577 --13073
NM_001042424chr493176 2428 2421 1245 1174 914 468 157 82 --1193 --
NM_001042440chr531277 695 211 ----11591
NM_001042441chr531277 695 211 ----11591
NM_001042442chr531277 695 211 ----11591
NM_001042443chr531277 695 211 ----11591
NM_001042444chr531277 695 211 ----11591
NM_001042445chr531277 695 211 ----11591
NM_001042446chr531277 695 211 ----11591
NM_001042453chrX2528 118 ------
NM_001042486chr201131 ------
NM_001042493chr631878 1477 694 ------
NM_001042494chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_001042495chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_001042496chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_001042497chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_001042510chr842150 2027 1842 473 22144 669 ----
NM_001042511chr842150 2027 1842 473 22144 669 ----
NM_001042537chrX22458 1851 11938 1613 --
NM_001042555chr1234227 3316 616 1105 14703 --
NM_001042585chr12632 113 --1575 --
NM_001042599chr267785 6981 2941 1040 1021 425 56947 6381 5499 4965 987 35616 5204 2279 15490
NM_001042601chr343106 2688 1060 328 ------
NM_001042603chr1274075 2125 1173 1006 860 562 47 ------
NM_001042604chr374833 4491 3806 3007 1771 448 398 23689 1956 ----
NM_001042632chr2062439 2355 2293 1602 388 296 ------
NM_001042633chr2062439 2355 2293 1602 388 296 ------
NM_001042681chr132273 1742 1650 21924 638 --1368
NM_001042682chr132273 1742 1650 21924 638 --1368
NM_001042682chr132273 1742 1650 21924 638 --1368
NM_001042683chr621391 597 ------
NM_001042728chr122875 55 ------
NM_001042749chrX1147 ------
NM_001042750chrX1147 ------
NM_001042751chrX1147 ------
NM_001043351chr121956 77 --1825 11825
NM_001044305chr641226 449 153 135 11174 11298 --
NM_001044385chr283915 2897 2543 903 460 421 306 120 33826 3627 1091 22771 2501 --
NM_001044722chr541807 596 521 506 ------
NM_001044723chr541807 596 521 506 ------
NM_001046chr552759 2643 2098 1021 156 --1472 --
NM_001049chr1411926 --11731 22152 150
NM_001068chr31111 ------
NM_001083620chr431760 583 159 11601 ----
NM_001083621chr141858 1826 1677 1443 14582 33681 3399 1460 11296
NM_001100108chr1127907 7815 7050 6483 5859 3325 2466 1685 1661 1654 957 248 1950 12629 --
NM_001106chr359671 9278 6976 6079 681 ----16139
NM_001111chr152547 1820 1740 280 138 1415 1360 --
NM_001113490chrX23292 3108 --1931 13665
NM_001117chr1822421 66 ------
NM_001119chr43957 286 159 --21241 1200 --
NM_001121chr1021480 405 ----1498
NM_001123chr101798 --1316 --
NM_001128chr1641512 1464 673 152 ----11149
NM_001146chr81796 --1236 --
NM_001148chr451959 619 474 425 253 --155 --
NM_001149chr1021391 1186 ----11351
NM_001167chrX66572 5399 5034 2570 289 67 1620 ----
NM_001173chr1434534 3492 496 11068 ----
NM_001177chr121117 1831 1557 --
NM_001178chr112138 109 ------
NM_001186chr2143165 3088 3062 2603 ----1830
NM_001187chr211450 --1251 --
NM_001198chr642337 2324 1872 162 22058 1918 ----
NM_001201chr453995 3207 2789 1542 300 --13423 --
NM_001204chr2107047 6517 6357 5879 2945 2812 2718 2250 2220 1589 17615 16588 --
NM_001206chr953006 2905 2556 2093 397 ------
NM_001219chr72654 81 ------
NM_001222chr1011749 ------
NM_001233chr71452 21720 149 --1446
NM_001241chr21823 1550 --21646 759
NM_001241chr21823 1550 --21646 759
NM_001248chr34803 734 333 141 ------
NM_001256chr1792905 2866 2785 2006 804 423 198 73 47 ------
NM_001257chr1621126 1067 ------
NM_001263chr4--127 --156
NM_001270chr531097 818 334 --11129 --
NM_001271chr15103279 2923 2462 2368 2020 970 772 294 271 167 --2800 129 --
NM_001304chr1732701 941 452 ----1156
NM_001329chr104575 189 124 103 ----11323
NM_001331chr1152611 2604 918 421 62 ------
NM_001333chr92108 68 ------
NM_001343chr521182 274 ------
NM_001346chr322007 1146 --12301 --
NM_001356chrX3922 401 125 --12127 11894
NM_001364chr1154181 4116 4018 3716 3414 21151 551 --1611
NM_001380chr10------11061
NM_001385chr81415 ------
NM_001387chr512801 23157 2830 11946 12456
NM_001389chr211139 ------
NM_001390chr1832840 2582 2215 --23156 2340 --
NM_001396chr2161984 1803 761 659 171 108 ----12800
NM_001400chr141374 1083 267 198 ------
NM_001408chr131680 1547 346 --11377 --
NM_001412chrX43690 2728 518 121 32738 704 159 --13187
NM_001419chr1964274 3680 3398 3027 1763 587 23555 3450 1265 --
NM_001422chr1141268 1180 957 300 11204 --21161 890
NM_001430chr252011 1873 1788 1483 552 11957 ----
NM_001432chr463924 3772 2825 2537 1504 256 --13952 --
NM_001438chr11712 ----21227 121
NM_001440chr852344 2157 2014 245 179 --32268 538 229 --
NM_001449chrX2351 258 1471 ----
NM_001460chr132823 450 73 11390 ----
NM_001491chr642533 1814 1069 156 1932 ----
NM_001493chrX1105 --1114 --
NM_001498chr651018 488 249 40 32 1914 ----
NM_001560chrX32566 2241 214 12249 ----
NM_001616chr233067 2680 974 1319 --11401
NM_001620chr113593 333 146 --1274 --
NM_001634chr632012 1678 515 ------
NM_001635chr72780 107 ------
NM_001650chr1842968 2746 1503 1291 12608 ----
NM_001656chr521546 436 ------
NM_001660chr3----1523 --
NM_001681chr122198 95 ------
NM_001682chr1242857 2742 2099 512 1217 ----
NM_001684chr144201 4106 3872 3837 12591 12581 --
NM_001689chr231915 1865 480 --1254 11484
NM_001695chr853561 2606 1445 1427 417 ------
NM_001701chr911231 --11427 1288
NM_001704chr6------148
NM_001714chr121412 ------
NM_001717chr1541224 969 486 181 ----1230
NM_001718chr621159 1054 ------
NM_001730chr1331111 483 413 ------
NM_001730chr1331111 483 413 ------
NM_001742chr761532 1344 472 331 295 32 11263 ----
NM_001746chr532603 1175 1076 12562 ----
NM_001750chr531277 695 211 ----11591
NM_001754chr2133873 1039 900 ------
NM_001755chr1611571 11495 ----
NM_001781chr12125 ------
NM_001788chr71360 ------
NM_001792chr1841023 301 230 191 151 ----
NM_001795chr1631167 1093 485 --21318 640 --
NM_001806chr1952040 1883 891 635 142 1345 ----
NM_001830chrX83612 3295 1472 1409 1207 792 462 317 23541 685 23851 36 --
NM_001845chr13----2274 163 --
NM_001858chr6114497 4323 4029 3997 1759 1476 1316 1275 651 326 48 --11301 21508 706
NM_001873chr43572 481 99 ------
NM_001880chr21200 ------
NM_001884chr51152 ------
NM_001891chr4143 ------
NM_001892chr531440 1193 153 --11177 --
NM_001895chr2011104 --1971 --
NM_001924chr12111 39 --190 --
NM_001931chr111153 --140 --
NM_001933chr1451379 1309 1209 1162 913 --1552 --
NM_001941chr1853637 2523 1144 1017 222 ----13425
NM_001951chr8----1112 --
NM_001963chr41553 ------
NM_001964chr521155 1040 ------
NM_001969chr1473547 2474 1546 1199 821 786 347 1565 12608 --
NM_001980chr1232002 867 117 --21776 255 --
NM_002006chr495576 5473 4940 4796 4646 4526 4506 1839 631 ------
NM_002009chr1532013 134 125 11077 ----
NM_002015chr1342494 1146 535 494 12743 ----
NM_002017chr1121113 485 11356 11091 --
NM_002024chrX2763 272 ------
NM_002025chrX99290 7832 3660 3599 1591 1386 521 87 69 1963 37487 2147 60 --
NM_002026chr221041 850 ------
NM_002031chr61169 ------
NM_002039chr42733 653 --1851 --
NM_002040chr2122685 76 1592 ----
NM_002044chr1541130 365 309 253 1358 ----
NM_002061chr131664 463 97 ------
NM_002063chrX21018 394 ------
NM_002074chr11183 ------
NM_002076chr1273146 3081 2245 2098 760 652 154 22913 234 12325 --
NM_002077chr921803 163 --11905 163
NM_002081chr251669 1352 1192 398 38 11091 1693 --
NM_002094chr16291 44 ------
NM_002114chr61533 ------
NM_002126chr1783700 3404 3120 2790 2571 1316 964 121 23020 1481 13290 23787 1642
NM_002130chr51690 31663 189 132 21485 607 --
NM_002140chr91251 ------
NM_002158chr242399 1167 951 391 ------
NM_002188chr53772 757 578 --1790 --
NM_002193chr2--1207 11467 --
NM_002199chr41132 ------
NM_002202chr51263 ------
NM_002205chr12297 61 --21021 910 --
NM_002210chr243145 2668 1256 1019 12417 11129 --
NM_002211chr1031140 374 30 1189 ----
NM_002214chr795573 5445 4291 4039 4010 3932 3896 401 179 35612 2263 141 1297 --
NM_002222chr311203 ------
NM_002232chr12880 162 ------
NM_002239chr22941 792 ------
NM_002252chr22364 319 1340 ----
NM_002253chr421450 1187 1349 ----
NM_002254chr21777 12088 21733 417 --
NM_002264chr322018 547 34720 1033 376 ----
NM_002265chr173436 146 40 --2809 214 --
NM_002267chr13--32085 531 279 --21577 341
NM_002268chr32687 37 --1334 --
NM_002270chr574293 3875 3652 3613 2034 1953 775 15355 ----
NM_002271chr1351612 654 482 231 195 22383 1926 ----
NM_002285chr243278 744 127 74 ----11620
NM_002293chr142306 2027 687 602 12561 ----
NM_002310chr595379 4883 4128 2620 2411 2174 1180 140 72 --1663 --
NM_002313chr1094784 4707 4652 3685 3668 1914 1358 936 332 138 14589 --
NM_002336chr1224284 1610 --34877 806 342 --
NM_002356chr642344 2102 2001 1914 ------
NM_002359chr1774237 3948 3483 3179 2919 1423 606 ------
NM_002374chr273344 3325 3047 2660 2513 179 21 12954 1211 --
NM_002376chr141410 --156 --
NM_002380chr81124 1920 1364 --
NM_002387chr5104964 4368 4193 1654 1544 1377 986 975 166 57 --44584 4217 3765 1897 11285
NM_002397chr521633 381 ----11988
NM_002398chr221433 358 ------
NM_002428chr1641434 1033 970 521 ----11315
NM_002444chrX2481 240 11411 ----
NM_002445chr831441 622 85 --1326 --
NM_002481chr187240 5875 5512 2989 2832 1322 570 535 25940 3106 27427 7068 --
NM_002487chr153330 294 282 ------
NM_002499chr1552387 1944 1619 746 127 ------
NM_002501chr1924134 3955 ------
NM_002505chr631156 1107 83 --1445 1240
NM_002515chr1451710 1652 1496 751 739 ------
NM_002519chr111115 2504 78 ----
NM_002522chr1763615 3364 3332 2742 2569 1063 --21284 705 21577 1298
NM_002524chr11762 1971 --154
NM_002545chr1174617 3953 3926 3819 2010 1903 1633 11577 ----
NM_002570chr1531086 481 311 ------
NM_002572chr112319 273 ----159
NM_002576chr1121072 165 --11177 --
NM_002577chr353618 3380 3063 742 303 --1765 14012
NM_002581chr955187 4030 3945 1088 870 --11936 --
NM_002583chr122404 43 ------
NM_002590chr132226 61 ------
NM_002595chr12--21591 587 ----
NM_002600chr141651 1592 1481 1293 --1345 --
NM_002605chr151455 11032 ----
NM_002612chr732032 1798 767 21526 352 1134 --
NM_002613chr1654437 4151 3779 3734 910 ----12153
NM_002641chrX41996 1863 1486 257 ----11382
NM_002645chr1132694 2580 2526 12491 1601 12722
NM_002655chr853966 3459 1808 1471 969 ------
NM_002662chr321779 156 ----2728 638
NM_002677chr812228 22455 372 --167
NM_002706chr21181 ------
NM_002709chr2--21015 702 1707 --
NM_002715chr5--11137 ----
NM_002716chr1142296 1306 1058 227 23707 884 --12502
NM_002717chr82696 669 ------
NM_002718chr341871 762 612 456 ------
NM_002736chr721999 61 2356 218 ----
NM_002744chr1138 --1323 --
NM_002747chr1811488 1375 11698 11443
NM_002748chr1521092 287 1187 ----
NM_002750chr101185 ------
NM_002752chr5132 ------
NM_002757chr151250 --1335 1226
NM_002760chrY96000 5733 4716 4496 4441 3834 2358 1883 1334 1362 15086 --
NM_002765chrX21163 911 1412 --1106
NM_002786chr11161 ------
NM_002822chr121645 11371 ----
NM_002834chr1252998 2811 1640 1594 1534 1818 --1586
NM_002836chr20------2455 173
NM_002841chr31169 ----1116
NM_002843chr1143018 3010 2874 579 --22125 1130 --
NM_002848chr1211198 ------
NM_002851chr71559 ------
NM_002858chr131293 1286 904 --11269 --
NM_002869chr1122177 688 --166 1579
NM_002886chr323261 616 14294 1711 --
NM_002890chr5--2405 384 ----
NM_002892chr1421546 1406 11295 ----
NM_002894chr18181 ------
NM_002897chr2--1100 ----
NM_002906chr1141756 1507 841 791 --1694 --
NM_002938chr431397 546 489 --1408 --
NM_002940chr421601 325 --2761 442 --
NM_002941chr341613 1341 645 332 11278 ----
NM_002945chr171659 --2670 315 --
NM_002956chr121420 ----150
NM_002959chr133988 3700 754 ------
NM_002968chr161265 ------
NM_002971chr331195 757 36 --1399 --
NM_002977chr242571 2531 2474 1156 33445 891 828 1184 --
NM_002998chr841522 1373 354 37 22242 730 ----
NM_002999chr2041934 1575 309 99 11523 121 --
NM_003016chr1761397 1288 555 459 341 150 ------
NM_003030chr321526 703 --1125 --
NM_003032chr342347 2281 1758 747 --12256 --
NM_003034chr12127971 7553 7209 6881 6187 5352 3245 2271 1852 1298 431 392 11558 ----
NM_003043chr373405 3187 1499 1354 1309 675 267 --1807 --
NM_003045chr1394692 4231 3907 3456 3400 3210 1421 856 810 34956 3713 1807 14973 --
NM_003051chr141507 465 137 66 21466 521 ----
NM_003063chr11128 ------
NM_003071chr331935 1340 563 1142 ----
NM_003096chr21211 ------
NM_003108chr286637 5179 4592 2927 2480 2023 762 668 26442 1588 ----
NM_003111chr21138 2446 113 ----
NM_003112chr742581 2165 442 189 ------
NM_003128chr242652 2507 2250 969 1645 ----
NM_003130chr731196 882 867 ----11166
NM_003137chr632212 1644 688 --2360 38 --
NM_003139chr111847 --1212 --
NM_003161chr1733066 2738 892 1292 ----
NM_003165chr941864 1572 567 61 ------
NM_003178chr372183 1856 1635 796 571 120 91 ------
NM_003189chr132961 2592 153 12865 --12700
NM_003199chr1885192 4873 3585 1820 1798 1636 877 734 14694 ----
NM_003217chr1241586 1404 810 163 ------
NM_003221chr623935 3793 1281 ----
NM_003234chr331819 870 746 22163 1740 ----
NM_003242chr322303 87 --12108 --
NM_003246chr1561874 1677 765 649 580 28 ------
NM_003257chr151204 1136 ----
NM_003262chr3114985 4769 4621 3902 3498 3331 1849 1665 1557 940 113 --1606 --
NM_003269chr641280 1208 971 228 1140 ----
NM_003270chrX31059 490 306 2109 93 ----
NM_003274chr2151076 977 969 740 627 ------
NM_003275chr9101519 1420 1344 1302 1085 975 943 567 447 265 ------
NM_003291chr131115 --1154 --
NM_003317chr14------1736
NM_003320chr1134461 175 155 --13563 --
NM_003325chr224734 607 591 55 ----1111
NM_003338chr102623 213 21213 775 ----
NM_003339chr51285 --11283 --
NM_003340chr421340 493 11082 ----
NM_003342chr1752640 2505 1172 816 616 1169 1125 --
NM_003344chr731586 286 128 ------
NM_003347chr221687 192 --12010
NM_003348chr1211386 11052 11169 --
NM_003360chr43226 205 43 ------
NM_003367chr192543 340 1500 ----
NM_003368chr11155 ------
NM_003375chr101346 --1334 --
NM_003390chr1131121 1024 114 ----165
NM_003392chr353556 3328 1675 1097 1031 13572 ----
NM_003404chr2051293 780 691 643 385 --11706 1238
NM_003410chrX32170 2088 774 22741 217 ----
NM_003411chrY61250 729 532 514 251 93 ------
NM_003412chr382723 2590 2393 2071 2063 544 71 45 ------
NM_003413chrX2614 366 --1784 --
NM_003432chr52152 51 ------
NM_003435chr19--1687 --165
NM_003439chr753007 951 922 690 527 --11213 --
NM_003441chr421145 981 ------
NM_003442chr111609 ------
NM_003463chr652540 1286 554 463 252 ------
NM_003467chr22153 79 ------
NM_003468chr233862 2978 2911 14049 ----
NM_003473chr10----1164 148
NM_003478chr1133235 959 400 ------
NM_003489chr2122724 199 12595 ----
NM_003498chr16102772 2614 2352 2138 1882 1784 974 858 564 214 1101 1146 --
NM_003506chr84853 819 502 46 ------
NM_003558chr91458 ------
NM_003559chr1733751 2470 951 --12824 --
NM_003563chr171385 --165 --
NM_003566chr1221168 98 23388 2191 --12403
NM_003574chr18105370 5313 5012 4834 4349 3578 1104 788 702 243 25503 4697 ----
NM_003583chr1243708 3472 3076 2985 --21271 289 --
NM_003590chr233570 1363 129 13366 --12834
NM_003595chr222376 162 ------
NM_003603chr422031 1742 ------
NM_003607chr153986 1744 1724 1368 561 14147 --13933
NM_003615chr374009 3234 2821 2631 2528 1404 523 13894 13638 --
NM_003620chr1721054 880 ------
NM_003622chr1251950 1760 681 658 190 12576 ----
NM_003629chr112447 12675 12825 1211
NM_003631chr103682 419 81 ------
NM_003635chr101445 ------
NM_003644chr17105925 5266 4407 2318 1620 1552 1117 1107 671 106 14060 34264 1991 1490 --
NM_003659chr23943 416 348 1174 ----
NM_003663chr312181 22272 885 13204 --
NM_003668chr121104 ------
NM_003671chr963367 3098 2457 701 446 148 --1975 --
NM_003672chr161454 1280 1230 773 612 197 ------
NM_003677chr122815 413 ------
NM_003679chr123327 2357 12342 1357 --
NM_003692chr9----127 --
NM_003701chr132875 829 1844 ----
NM_003713chr141546 1247 391 113 145 ----
NM_003714chr542580 2416 2306 1166 22831 2164 ----
NM_003716chr3----1180 --
NM_003718chr7----1417 --
NM_003722chr342262 962 435 382 1688 1293 --
NM_003743chr222177 1652 ------
NM_003759chr483705 3429 3422 3190 1728 1378 800 531 1168 12754 --
NM_003760chr12772 610 ------
NM_003766chr172515 389 ------
NM_003772chr1131219 1082 207 1430 ----
NM_003774chr1242582 1276 159 126 131 1690 --
NM_003783chr1168 ------
NM_003787chr1831199 362 25 ------
NM_003822chr152649 1199 1066 1016 344 ------
NM_003829chr9166 1170 11006 --
NM_003831chr1831689 1425 174 1547 ----
NM_003850chr13----1581 --
NM_003873chr1032479 679 113 2693 264 2851 729 12144
NM_003884chr311464 --11270 --
NM_003885chr1722029 258 12060 22703 228 --
NM_003895chr2111421 1341 --1108
NM_003899chr1352603 941 279 202 179 1657 ----
NM_003913chr634329 644 529 1592 ----
NM_003916chrX21465 1261 1449 ----
NM_003921chr131794 1507 275 --1447 --
NM_003934chr921141 1111 11274 ----
NM_003941chr742528 1975 1020 688 1299 ----
NM_003948chr432372 834 408 ------
NM_003951chrX2269 256 ------
NM_003966chr577841 7285 7198 6993 6730 6238 2132 11007 11354 27602 3011
NM_003968chr3----1668 --
NM_003971chr17--1439 ----
NM_003994chr1243198 2806 755 692 23074 196 ----
NM_004006chrX22505 747 11846 --1937
NM_004007chrX22505 747 11846 --1937
NM_004009chrX22505 747 11846 --1937
NM_004010chrX22505 747 11846 --1937
NM_004011chrX22505 747 11846 --1937
NM_004012chrX22505 747 11846 --1937
NM_004013chrX22505 747 11846 --1937
NM_004014chrX22505 747 11846 --1937
NM_004015chrX22505 747 11846 --1937
NM_004016chrX22419 661 11760 --1851
NM_004017chrX22505 747 11846 --1937
NM_004018chrX22419 661 11760 --1851
NM_004020chrX22505 747 11846 --1937
NM_004021chrX22419 661 11760 --1851
NM_004022chrX22419 661 11760 --1851
NM_004023chrX22419 661 11760 --1851
NM_004028chr1842968 2746 1503 1291 12608 ----
NM_004035chr17115198 5031 4253 4110 3499 1824 1498 1394 312 195 109 --1352 --
NM_004081chrY41458 402 244 191 ------
NM_004085chrX1815 1223 ----
NM_004086chr143726 599 73 ------
NM_004087chr321833 90 ------
NM_004100chr641863 643 531 48 12643 ----
NM_004105chr23840 748 382 ------
NM_004109chr112572 144 1843 --12123
NM_004113chr31389 1479 ----
NM_004124chr1452577 2529 1245 502 420 23486 3065 13379 --
NM_004133chr832472 2440 886 --1780 --
NM_004136chr1563269 3045 2610 1078 904 653 12682 ----
NM_004161chr21152 ----11329
NM_004171chr11129556 8843 8695 8306 7707 7675 6266 6239 5989 1804 1520 59 27959 766 15905 18027
NM_004177chr1161755 1397 719 570 38 27 1543 ----
NM_004225chr851398 1320 1061 523 407 --11530 --
NM_004227chr762928 2703 2054 975 649 237 --12001 --
NM_004232chr1843794 3759 3130 485 1541 ----
NM_004236chr15--1236 ----
NM_004241chr101572 1142 178 --
NM_004253chr9--169 --1906
NM_004255chr15--136 ----
NM_004272chr521424 814 --11450 --
NM_004274chr143878 538 39 22596 2519 1137 --
NM_004277chr631639 1544 122 11461 ----
NM_004290chr54551 451 172 158 ------
NM_004311chr1042594 1020 406 174 ------
NM_004331chr832410 2063 1913 --11861 --
NM_004342chr752164 2022 1592 612 259 1602 11867 12228
NM_004379chr22605 45 21478 468 ----
NM_004380chr1651730 1058 546 426 53 ------
NM_004384chr541807 596 521 506 ------
NM_004392chr133679 655 175 ------
NM_004397chr1164333 4106 1454 1310 378 217 13869 ----
NM_004404chr251428 353 343 331 311 11458 1449 --
NM_004409chr192680 611 ----1633
NM_004411chr72757 642 --2738 180 --
NM_004432chr942225 2008 1783 951 ------
NM_004434chr1481749 1438 1273 1255 616 475 409 221 11677 ----
NM_004438chr273090 2987 2977 2489 1074 420 327 --1963 --
NM_004440chr641855 1644 514 54 ------
NM_004442chr121073 567 ----11144
NM_004449chr212238 169 ------
NM_004464chr443697 1298 1226 449 13153 ----
NM_004469chrX2432 172 ------
NM_004480chr14--1153 1582 --
NM_004482chr21865 ------
NM_004498chr151321 ------
NM_004501chr173063 2754 2518 1446 1367 1325 1306 21212 24 ----
NM_004504chr233080 2239 2021 11079 187 --
NM_004505chr1721914 81 1452 11855 --
NM_004520chr52632 494 ------
NM_004525chr251478 1424 363 288 218 ------
NM_004540chr211600 1237 181 --
NM_004549chr11------134
NM_004560chr92833 273 ------
NM_004571chr2133242 2563 717 13363 ----
NM_004575chr411585 --1631 --
NM_004576chr5136 --192 --
NM_004580chr151602 ------
NM_004586chrX94750 3846 3748 1280 1193 688 553 295 245 ------
NM_004588chr1123360 3172 44057 3084 1605 414 21519 562 --
NM_004595chrX1407 ------
NM_004598chr542895 2647 891 373 11187 23117 2210 --
NM_004600chr121356 136 ------
NM_004602chr2041517 1212 56 47 ------
NM_004612chr964716 4158 4142 3360 1762 86 ------
NM_004642chr121239 ------
NM_004655chr171196 1370 ----
NM_004660chrY12245 ----22053 1825
NM_004664chr12----1215 196
NM_004670chr1021700 1172 1436 11200 --
NM_004681chrY3518 171 120 ------
NM_004684chr4----1276 --
NM_004685chr1352732 2657 2291 836 274 12369 ----
NM_004687chr1731715 710 563 ------
NM_004703chr1752535 2056 1769 575 510 12219 ----
NM_004705chr113706 125 109 1700 ----
NM_004713chr142764 638 ------
NM_004714chr19----1132 --
NM_004717chr731081 1023 189 ------
NM_004719chr1252849 2333 2075 591 346 --12601 --
NM_004723chr13849 47 34 ------
NM_004726chrX65613 5473 4542 1274 528 194 14182 --14529
NM_004730chr521473 659 1620 11397 --
NM_004734chr1373297 2660 2346 2132 1178 818 272 12966 --11232
NM_004736chr132211 2180 358 11828 1482 --
NM_004737chr2231241 1189 919 ------
NM_004741chr1021587 293 21528 1181 1967 --
NM_004742chr341496 1343 1222 1189 ------
NM_004745chr876772 6699 6465 5531 1691 940 98 25847 2219 15391 --
NM_004748chr1573787 3499 3279 3051 2777 670 86 --13630 --
NM_004763chr26810 758 702 422 366 310 ----1873
NM_004768chr11915 --1397 --
NM_004772chr511540 --1550 11013
NM_004774chr1732073 1085 878 --12241 --
NM_004776chr2063229 3144 2931 2516 2446 174 11243 23133 229 --
NM_004779chr54483 146 122 56 --11352 --
NM_004792chr21146 ------
NM_004798chr2063520 3336 3139 2988 2701 2667 ------
NM_004801chr211386 11316 --11468
NM_004815chr134702 202 160 23790 3299 --24318 3305
NM_004824chr641283 1162 1093 575 ------
NM_004834chr242965 2663 986 27 1494 ----
NM_004842chr651731 1659 1626 1385 71 1197 11426 --
NM_004844chr3--21161 812 ----
NM_004845chrX33495 705 520 --23784 297 --
NM_004849chr61248 --21595 1368 --
NM_004850chr21411 21245 117 ----
NM_004857chr1444822 4792 751 176 ------
NM_004859chr1752295 994 811 514 40 --22634 2019 1452
NM_004866chr524952 286 11623 11288 --
NM_004869chr1821675 1424 1281 ----
NM_004871chr1763959 3080 2997 2676 1766 1355 1128 ----
NM_004898chr431818 1777 678 ------
NM_004904chr775716 5151 2352 2291 535 332 119 ------
NM_004906chr62671 495 ------
NM_004912chr731310 1174 678 ------
NM_004930chr1----1127 --
NM_004932chr531643 1160 35 ------
NM_004937chr1731965 1653 366 ------
NM_004956chr723451 1036 23068 2837 --21415 1283
NM_004967chr4------1370
NM_004975chr202923 858 ----1362
NM_004976chr1175023 3858 1757 1183 924 329 174 --13380 --
NM_004985chr1283897 3673 2936 2788 1502 1348 439 431 11167 14378 --
NM_004992chrX98508 8000 6585 5896 3361 2722 1038 697 293 26645 601 --28406 5269
NM_004992chrX98508 8000 6585 5896 3361 2722 1038 697 293 26645 601 --28406 5269
NM_004999chr631574 1340 891 33620 1170 1045 --13398
NM_005000chr72707 37 184 ----
NM_005010chr72760 598 21748 240 ----
NM_005023chr521236 367 ------
NM_005028chr1031487 650 145 ----1630
NM_005036chr22118302 8232 8139 7258 6950 6268 5890 5427 5410 5236 3247 32678 1183 47 ----
NM_005044chrX94289 4282 3578 3235 3015 2960 1784 1611 723 1179 13605 --
NM_005045chr7--1268 ----
NM_005056chr1264319 1417 1250 1104 806 291 ------
NM_005057chr141633 1468 1187 81 ------
NM_005063chr1043460 3022 1319 74 12922 13379 --
NM_005065chr1474709 3560 2041 1412 728 398 127 13749 ----
NM_005066chr12271 119 ------
NM_005068chr641394 1209 526 308 ------
NM_005076chr134193 3642 1573 1792 34106 987 243 13687
NM_005095chr111925 ------
NM_005097chr101115 ------
NM_005104chr62198 170 ------
NM_005105chr151680 1650 1555 857 540 ------
NM_005109chr342161 1672 955 427 --1995 --
NM_005116chr2064333 3448 1168 920 514 486 14212 1727 --
NM_005121chr1743753 2751 990 210 --1180 --
NM_005124chr62346 212 --1256 --
NM_005126chr33262 246 29 1763 ----
NM_005135chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_005137chr2251789 1742 1613 538 391 --1124 12147
NM_005156chr995324 4685 4632 4445 4092 2084 1537 1469 545 23681 1321 ----
NM_005160chr2295918 5527 4602 1776 1068 1020 666 468 191 --25439 5063 11174
NM_005184chr191116 1628 ----
NM_005188chr1157161 5190 848 814 687 17034 ----
NM_005197chr1486216 5296 4228 3908 881 744 574 467 1233 35114 2070 1093 --
NM_005207chr2263395 2751 2433 1338 324 245 1128 12925 --
NM_005233chr331049 304 292 --12317 --
NM_005235chr267785 6981 2941 1040 1021 425 56947 6381 5499 4965 987 35616 5204 2279 15490
NM_005238chr1152714 1028 747 480 389 ----12206
NM_005241chr331031 355 221 1537 ----
NM_005243chr22----129 --
NM_005254chr151401 --1910 11169
NM_005259chr221358 1328 1537 ----
NM_005276chr1231641 500 124 11197 11460 1187
NM_005276chr1231641 500 124 11197 11460 1187
NM_005277chr4----11394 --
NM_005295chr7--167 ----
NM_005296chrX2434 88 1396 ----
NM_005297chr223637 591 346 ------
NM_005302chr71139 ------
NM_005311chr742837 837 148 45 32319 1826 366 11917 --
NM_005314chrX1630 ----1692
NM_005316chr111387 ------
NM_005327chr41700 ------
NM_005329chr1632247 635 430 --1193 --
NM_005339chr464263 4181 3476 3400 2746 2662 53674 3506 1040 935 99 ----
NM_005359chr1846137 2180 1760 1241 ----12068
NM_005369chrX184 ------
NM_005375chr621125 749 ------
NM_005386chr201784 --1722 --
NM_005388chr941646 1635 1452 605 ------
NM_005402chr731759 80 67 21781 655 31649 1353 1255 --
NM_005406chr1831361 1031 161 --11421 --
NM_005410chr52172 129 ------
NM_005433chr1852788 2756 2670 759 239 22731 2144 ----
NM_005436chr1083359 3278 2932 2501 1173 1051 398 109 1597 ----
NM_005437chr1031463 1024 1004 ------
NM_005443chr41447 --1186 --
NM_005461chr2021375 1356 --1530 11628
NM_005465chr161979 1972 1601 1501 1250 47 11684 1385 --
NM_005475chr1242142 1180 835 762 12446 12561 1351
NM_005497chr1754614 2229 359 75 58 ----11232
NM_005499chr192457 418 195 ----
NM_005502chr943119 2861 2711 587 1129 12775 --
NM_005504chr1255742 5384 4147 2388 1036 26218 706 15183 --
NM_005509chr51499 --1148 --
NM_005522chr721320 987 ------
NM_005544chr2----1188 --
NM_005570chr1831214 255 129 ------
NM_005573chr52463 155 1213 ----
NM_005578chr355100 4215 1229 186 28 --13844 --
NM_005587chr151794 ------
NM_005591chr112536 151 --12424 --
NM_005595chr11374 1759 1281 --
NM_005596chr955580 5480 2018 1966 415 25597 1369 25016 323 --
NM_005602chr331284 1049 339 --11243 --
NM_005604chr662212 2086 2046 997 326 178 ------
NM_005613chr122005 1463 ----1805
NM_005639chr122648 396 1499 ----
NM_005643chr62615 30 ------
NM_005665chr194771 4702 3938 3706 1350 1236 1075 868 262 13742 1194 24584 1537
NM_005668chr544484 4053 1671 1561 ------
NM_005717chr11358 1442 11208 --
NM_005722chr231863 1543 983 11837 ----
NM_005723chr4272 31 ----1172
NM_005737chr242432 1076 427 276 --12184 --
NM_005738chr741762 1704 812 262 ----11796
NM_005739chr1562309 2294 2020 1567 586 386 --2241 90 --
NM_005746chr742210 2048 1091 301 12388 ----
NM_005748chr1273224 3085 2582 2495 746 739 697 ------
NM_005751chr72484 362 ------
NM_005752chr1611151 ------
NM_005765chrX5628 336 284 247 177 ------
NM_005779chr563591 3317 3183 2442 902 535 --22308 1287 --
NM_005796chr162345 141 1283 ----
NM_005802chr92714 22 1318 ----
NM_005807chr1159 189 ----
NM_005808chr373061 2955 2758 1270 1175 1025 366 13401 ----
NM_005813chr22570 534 2823 48 12620 --
NM_005819chr143025 2772 948 327 32676 690 150 22193 122 13446
NM_005822chr651838 1725 1518 763 662 ------
NM_005828chr1785103 4924 4857 4684 3939 3303 1869 1160 --2707 324 1824
NM_005839chr12651 218 1207 --1200
NM_005840chrX87302 6819 1707 1334 1258 795 612 286 32112 946 295 25326 1857 --
NM_005841chr41773 ------
NM_005857chr11182 ----21287 1198
NM_005859chr521304 1213 21517 175 ----
NM_005862chr331066 356 211 ------
NM_005868chr742425 807 767 115 ----12145
NM_005880chr1631495 1043 497 11462 ----
NM_005898chr1141157 903 500 341 1401 143 --
NM_005900chr411160 2750 87 ----
NM_005901chr18128483 8220 7832 7607 7503 7265 3230 3175 3099 1369 809 716 11388 25857 3073 --
NM_005903chr5104821 4804 4230 4091 3772 1237 1191 699 255 89 ------
NM_005909chr564263 4043 3062 738 288 104 ----1715
NM_005910chr1753324 3293 2862 1295 835 --44117 3918 3726 2602 23539 1071
NM_005920chr163402 3260 3120 2554 1074 626 --22484 254 --
NM_005922chr61462 --1392 --
NM_005923chr63609 545 161 ------
NM_005924chr73441 377 288 1990 ----
NM_005933chr1152573 1991 789 613 61 --12591 --
NM_005935chr454490 4469 4298 3857 1393 --44900 4182 3783 676 --
NM_005937chr1753811 3424 1652 1424 1257 --13245 11099
NM_005941chr864045 3814 2925 2902 1335 123 21668 1296 --11536
NM_005955chr1105321 4692 4640 4123 3937 3460 2149 1844 1414 368 1448 12210 --
NM_005966chr252257 1836 1698 830 582 ------
NM_005968chr191173 ------
NM_005986chr1322306 1914 ----1205
NM_005996chr1231558 511 240 1988 ----
NM_006007chr954324 3475 1604 1448 683 1419 11137 --
NM_006009chr12160 ------
NM_006011chr1554109 3656 1252 878 170 23281 2657 23357 2932 13785
NM_006016chr642306 1862 636 52 ------
NM_006036chr251839 751 683 184 36 ------
NM_006037chr264853 4384 3599 3325 3211 1402 --34657 4142 3151 --
NM_006038chr202700 81 --1673 --
NM_006047chr2033096 591 356 23403 2564 ----
NM_006070chr3----1405 --
NM_006080chr72599 508 --21881 589 --
NM_006091chr151426 --11757 --
NM_006095chr441086 464 328 128 --1794 --
NM_006107chr174539 499 195 67 ------
NM_006135chr131355 426 348 ------
NM_006136chr721371 1057 ------
NM_006141chr1642798 2012 1762 674 11973 11062 --
NM_006153chr3--1125 ----
NM_006154chr1552082 2047 766 373 98 ------
NM_006155chr251428 353 343 331 311 11458 1449 --
NM_006162chr1871714 1497 1482 1381 446 159 88 ------
NM_006166chr1222442 1778 11930 ----
NM_006190chr2--1829 ----
NM_006191chr124979 829 368 177 ------
NM_006194chr141240 1199 ----
NM_006195chr931299 1124 421 ------
NM_006197chr81600 --12237 --
NM_006203chr574672 4406 2011 777 719 662 128 24719 253 1546 11741
NM_006209chr81270 --1334 --
NM_006224chr1732161 1575 665 11857 11566 --
NM_006226chr221420 994 ------
NM_006237chr1321948 1694 ------
NM_006238chr652066 774 713 581 47 --3813 704 78 1747
NM_006251chr543066 2931 2858 2076 23127 2818 ----
NM_006252chr177237 6385 5473 5319 2194 1642 148 16736 27230 306 --
NM_006265chr851164 960 615 348 184 1586 --1460
NM_006267chr251690 1494 1168 200 166 --11807 --
NM_006268chr11------11054
NM_006277chr22493 470 ------
NM_006281chr841070 1000 854 327 1167 ----
NM_006281chr841070 1000 854 327 1167 ----
NM_006283chr863998 3918 3499 1939 1877 1237 ------
NM_006287chr252440 2400 2362 1930 210 --11960 --
NM_006298chr673430 3049 2614 2298 669 661 56 12763 1653 --
NM_006301chr121138 1554 --1179
NM_006306chrX75459 4492 4278 3657 2169 1119 976 15118 11142 --
NM_006317chr51876 ------
NM_006322chr131865 --169 --
NM_006350chr5127 ------
NM_006352chr131639 599 590 21970 1382 ----
NM_006359chrX22458 1851 11938 1613 --
NM_006364chr1431063 439 339 ------
NM_006371chr394862 4792 4560 4067 3434 1830 1521 1293 872 --24200 1083 --
NM_006372chr61178 135 ----
NM_006379chr71102 21914 1651 1612 11788
NM_006380chr1774400 2917 1724 1571 121 108 100 ------
NM_006382chr17----1239 1198
NM_006390chr1231864 1644 1514 11535 1608 --
NM_006403chr631734 714 550 11230 ----
NM_006405chr14183 ------
NM_006434chr1033145 2584 374 13095 1627 --
NM_006458chr11197 ----1366
NM_006459chr103506 430 282 --21736 146 --
NM_006469chr121517 1420 --1462 11546
NM_006474chr141941 1285 306 290 ------
NM_006482chr1243708 3472 3076 2985 --21271 289 --
NM_006483chr19----1132 --
NM_006484chr19----1132 --
NM_006489chr1451710 1652 1496 751 739 ------
NM_006504chr1011176 22726 2017 --11187
NM_006510chr61887 --1840 --
NM_006513chr12200 192 ------
NM_006521chrX21363 1193 ------
NM_006526chr2051699 1586 615 294 105 ------
NM_006534chr2033415 3272 294 ------
NM_006538chr264018 3655 3212 1403 640 604 --24102 4003 --
NM_006540chr851319 1196 385 98 32 11001 ----
NM_006544chr1466027 5994 5093 1713 1447 220 1879 ----
NM_006546chr1785975 5763 5495 1431 1222 938 857 549 26063 1437 ----
NM_006557chr9183 21758 1257 ----
NM_006561chr1086251 5948 5536 2329 2082 988 403 173 --16223 --
NM_006565chr1611084 --1292 --
NM_006572chr1732874 1356 266 --22658 1253 --
NM_006575chr1421226 49 ------
NM_006595chr1141874 1686 426 55 ------
NM_006599chr16168294 8041 7787 7755 6688 6617 6366 6275 5765 2951 2889 2877 2328 2007 1807 915 36414 793 123 28031 1266 18128
NM_006603chrX1147 ------
NM_006609chr223004 245 ----1352
NM_006614chr373142 3013 2544 2316 831 496 397 --12693 --
NM_006620chr674672 4423 3911 3479 3138 1312 299 1193 ----
NM_006621chr1----11499 --
NM_006624chr1021648 683 21791 1498 ----
NM_006628chr1564535 4168 4048 3255 1488 187 1106 14318 --
NM_006629chr1842344 2310 607 60 11982 ----
NM_006636chr22396 95 ------
NM_006644chr133637 263 76 ------
NM_006654chr1234227 3316 616 1105 14703 --
NM_006675chr1223030 2561 --2956 297 1330
NM_006698chr2031074 529 408 --1170 156
NM_006699chr132006 1718 627 22631 597 ----
NM_006702chr191127 --1160 --
NM_006720chr1094784 4707 4652 3685 3668 1914 1358 936 332 138 14589 --
NM_006721chr101798 --1316 --
NM_006722chr342850 2111 1027 802 1622 ----
NM_006724chr61462 --1392 --
NM_006729chrX33897 3627 1321 11999 ----
NM_006731chr933935 1826 166 12092 22127 739 --
NM_006738chr1544581 3000 263 90 --24102 893 --
NM_006751chr21293 --1261 --
NM_006754chr72946 910 ------
NM_006758chr21151 ------
NM_006766chr821751 689 21011 63 ----
NM_006775chr63905 714 238 12658 1282 --
NM_006777chrX1403 1967 22796 2729 --
NM_006788chr1832164 823 744 12019 11989 --
NM_006802chr11450 --11086 --
NM_006807chr1721057 1010 --1891 11041
NM_006813chr63800 741 347 ------
NM_006815chr1231335 918 859 11100 ----
NM_006818chr13879 849 328 ------
NM_006826chr2----1935 --
NM_006827chr141127 13155 ----
NM_006828chr62596 148 1131 ----
NM_006832chr142927 280 --1273 --
NM_006851chr1242819 2647 2557 588 11906 12468 --
NM_006852chr1732330 760 172 11793 32686 2674 1944 --
NM_006868chr1842626 1242 1233 436 --33199 2514 117 --
NM_006870chr20194 1774 1632 --
NM_006873chr263558 3311 1407 1315 342 319 12522 ----
NM_006884chr321526 703 --1125 --
NM_006885chr1643809 3146 816 365 23248 963 --13421
NM_006886chr20--1128 ----
NM_006888chr1463363 2868 2161 1108 534 447 12640 ----
NM_006895chr231525 612 406 21557 1544 --11357
NM_006908chr751458 1345 1243 494 365 11427 11373 --
NM_006910chr16123 ------
NM_006912chr122359 72 32018 508 103 1955 --
NM_006918chr1155389 4434 936 832 645 13832 15625 --
NM_006924chr1763509 3400 1429 1313 740 530 22902 882 ----
NM_006937chr17--1240 ----
NM_006939chr143409 307 125 ----125
NM_006940chr1261621 1424 1339 732 279 143 --198 --
NM_006947chr411506 11569 1496 --
NM_006948chr21--11933 12362 --
NM_006951chr101714 ----1554
NM_006956chr742354 2149 1593 723 12057 ----
NM_006986chrX1203 ------
NM_006999chr541817 1776 1609 124 12045 ----
NM_007005chr941525 460 352 324 --11379 --
NM_007011chr1576786 6701 6151 4204 2581 1066 667 24342 1948 ----
NM_007013chr82709 200 ------
NM_007030chr5124943 4651 4622 4478 4271 3982 1802 1582 1200 695 355 284 --24519 219 11450
NM_007034chr1268 40 1656 ----
NM_007038chr21126021 5744 5351 4278 4267 3946 3835 2361 1845 1709 1147 1001 --2254 51 --
NM_007039chr1471510 927 695 573 313 150 114 ------
NM_007078chr1041945 1164 628 24 11955 --11210
NM_007080chr4------1124
NM_007106chr1332298 830 450 ----1567
NM_007111chr133843 582 556 ------
NM_007114chr332445 1148 410 ----1562
NM_007124chr63686 139 124 --1156 --
NM_007146chr1742575 2497 913 191 2779 229 ----
NM_007150chrX32037 2009 676 ------
NM_007158chr121239 834 ------
NM_007173chr1131826 257 165 1596 ----
NM_007187chr132364 340 ------
NM_007195chr1833204 800 589 13499 ----
NM_007197chr123858 794 163 ------
NM_007200chr1544581 3000 263 90 --24102 893 --
NM_007207chr12644 185 1208 1664 --
NM_007212chr111668 171 --1701
NM_007214chr631230 1164 94 ------
NM_007222chr821294 88 --1622 --
NM_007236chr1512327 --11854 --
NM_007245chr161317 ------
NM_007249chr1389414 8060 6782 6319 6066 1135 1045 634 45808 2644 2487 753 --25850 909
NM_007270chr711481 ------
NM_007271chr61627 ------
NM_007275chr3179 ------
NM_007276chr72960 175 --1829 --
NM_007292chr17115198 5031 4253 4110 3499 1824 1498 1394 312 195 109 --1352 --
NM_007315chr231071 1050 203 2977 470 --11200
NM_007327chr9----1365 1265
NM_007345chr1841991 1504 360 220 1559 ----
NM_007350chr1294122 3422 3366 3224 1104 1029 845 731 143 ------
NM_007358chr12471 315 ------
NM_007375chr142144 2067 580 354 12534 ----
NM_012080chrX1967 --2866 468 --
NM_012081chr553098 2899 1253 851 580 13516 ----
NM_012096chr321027 174 33703 983 807 --13551
NM_012097chr24864 646 500 102 32080 1569 226 ----
NM_012102chr132273 1742 1650 21924 638 --1368
NM_012104chr1162840 2559 2355 2330 922 558 1363 ----
NM_012104chr1162840 2559 2355 2330 922 558 1363 ----
NM_012137chr11897 --12894 --
NM_012141chr1353307 2524 1504 1449 1179 --1268 13823
NM_012154chr81117 1728 ----
NM_012156chr2073243 2609 1124 1070 1064 636 608 21003 238 2123 95 --
NM_012164chr9106545 6375 6348 6318 4627 2545 2079 1801 1479 871 27367 188 47562 4952 223 23 --
NM_012193chr11114319 4280 3875 3710 3643 1604 1548 1301 1081 900 456 13503 ----
NM_012199chr194296 4132 3194 1339 948 933 278 258 25 --23738 3511 1994
NM_012207chr10----1225 --
NM_012214chr245597 4771 4666 1596 23921 1112 11673 11821
NM_012219chr363244 2165 2147 1248 1158 74 ----11024
NM_012233chr221128 909 ----1298
NM_012234chr321210 570 33668 3508 785 ----
NM_012238chr101442 11668 --1515
NM_012242chr102766 315 1333 ----
NM_012249chr263590 3160 2652 2435 1267 906 12716 ----
NM_012250chr111471 2997 513 ----
NM_012252chr775002 4941 4712 4395 4353 4069 3704 41684 1486 1043 133 ----
NM_012257chr71127 1120 146 --
NM_012262chr1115183 5162 4908 4553 4089 2019 1658 1103 425 399 160 24666 87 24930 4534 --
NM_012281chr731868 457 260 12138 ----
NM_012294chr752499 1578 1512 745 674 1637 ----
NM_012297chr422633 288 ----1507
NM_012300chr542537 2279 1721 50 ------
NM_012301chr71195 ----11925
NM_012307chr182136 95 ----1162
NM_012308chr1162026 1714 1612 1033 530 332 --1827 --
NM_012309chr1164627 4339 3603 3560 1934 141 ------
NM_012316chr195547 5413 4531 4433 3842 2034 1586 1548 835 --14564 --
NM_012325chr2041335 282 247 97 --1623 --
NM_012329chr1731395 521 254 --1107 --
NM_012398chr1962901 2715 2405 2198 2024 78 22470 815 12211 --
NM_012399chr2241681 1556 419 287 11500 ----
NM_012402chr112982 891 ------
NM_012412chr73773 721 641 ------
NM_012416chr911140 ------
NM_012428chr1531040 892 639 --1739 --
NM_013230chrY11792 2639 133 11550 --
NM_013231chr1464214 3004 1387 1076 1051 943 13045 22906 1760 --
NM_013235chr53899 362 108 2572 348 ----
NM_013236chr2251215 1163 978 969 851 ----1491
NM_013238chr133733 207 108 11367 1464 --
NM_013255chr7116901 6843 6198 6013 3346 2967 2242 1465 1292 661 571 76599 6394 2945 2852 2350 1843 1074 173 --
NM_013257chr842160 1745 289 26 ------
NM_013269chr1244489 3014 1312 256 23246 50 --1739
NM_013277chr1221039 368 --133 --
NM_013281chr2041203 447 306 90 ------
NM_013354chr81273 11168 1343 --
NM_013357chr83779 741 58 ------
NM_013372chr1552419 2297 2133 1361 884 23173 2848 12459 --
NM_013396chr2121478 212 ------
NM_013397chr6----1766 1680
NM_013410chr1--31064 817 133 ----
NM_013411chr182723 2705 2349 2042 1788 962 857 449 --11799 12428
NM_013444chrX21057 907 ------
NM_013448chr14196 ------
NM_013958chr82320 92 ------
NM_013959chr82320 92 ------
NM_013961chr82320 92 ------
NM_013962chr82320 92 ------
NM_013986chr22----129 --
NM_013989chr14124868 4646 4473 4242 3791 3753 3712 3631 3183 1936 288 101 2698 301 --11428
NM_013995chrX1239 11800 12226 --
NM_014001chr1741473 1010 341 332 2532 324 ----
NM_014007chr941194 1163 870 442 ------
NM_014011chr232183 1599 321 11727 ----
NM_014018chr8124 ------
NM_014021chr143178 1015 621 318 11329 ----
NM_014023chr1072514 2120 2104 2004 1071 990 789 --1701 --
NM_014028chr61695 124 1540 --
NM_014031chr51351 ------
NM_014048chr1674494 3404 1896 1648 1326 923 721 43860 3227 1488 714 23645 2110 11667
NM_014089chr1352164 1910 1902 1656 161 --1252 --
NM_014109chr811130 1191 ----
NM_014141chr794853 4514 4317 3917 3766 3583 1326 718 161 44866 4461 4184 609 13874 --
NM_014153chr162600 577 --141 1196
NM_014155chr11107435 7319 6665 5388 2808 2770 1567 854 611 431 35443 2505 913 16976 26786 2345
NM_014159chr32622 105 ------
NM_014189chr43957 286 159 --21241 1200 --
NM_014190chr451309 638 511 165 153 --21593 1552 --
NM_014212chr121641 ------
NM_014217chr121598 673 11922 ----
NM_014243chr442133 2115 1817 314 1659 1186 --
NM_014253chrX12278 --1876 --
NM_014271chrX1274 ------
NM_014280chr14936 699 301 170 ------
NM_014294chr821455 1443 11434 ----
NM_014309chr2274847 3941 1962 1776 1749 1301 1268 44781 4558 1743 1526 24422 2015 --
NM_014314chr961285 439 390 367 298 180 ------
NM_014322chr12964 398 ----1944
NM_014329chr162321 39 ------
NM_014331chr487719 7325 6704 6680 6577 5767 5406 1169 36502 2040 1260 17474 1488
NM_014363chr1331115 383 258 11017 ----
NM_014368chr942172 1640 1482 59 1431 --11741
NM_014382chr331480 1443 1429 --1111 --
NM_014392chr451560 600 546 468 294 185 ----
NM_014393chr852258 1910 882 657 606 ------
NM_014410chr181382 ------
NM_014415chr331495 307 45 11521 ----
NM_014421chr422086 290 1717 ----
NM_014423chr545672 4884 1912 229 25168 1050 14521 15120
NM_014437chr14945 812 626 106 ------
NM_014447chr4------1302
NM_014456chr1041388 529 357 300 ------
NM_014480chr194833 229 169 124 ------
NM_014487chr41257 1166 ----
NM_014488chr111474 ------
NM_014491chr71242 --144 --
NM_014494chr1652296 2215 2040 562 400 ------
NM_014498chr32295 74 ------
NM_014504chr761915 1662 1641 1369 825 67 1202 ----
NM_014515chr12186 ----1305
NM_014552chr221521 553 ------
NM_014571chr153018 2132 568 421 99 --1677 --
NM_014572chr1331279 731 409 11805 ----
NM_014575chr31109 ------
NM_014607chr251465 844 679 498 378 --1705 --
NM_014608chr151148 ------
NM_014612chr921485 990 --1952 --
NM_014613chr543038 2417 2273 2247 1560 ----
NM_014614chr231462 1070 214 ------
NM_014615chr1642962 2817 2647 83 22859 2607 11056 --
NM_014616chr32495 380 12982 ----
NM_014620chr12162 ------
NM_014636chr944317 4216 3164 1473 12791 ----
NM_014646chr1861175 854 589 514 376 76 --1977 --
NM_014647chr1631876 357 157 --1115 --
NM_014660chr741056 901 424 413 ------
NM_014661chr1053403 3158 844 773 621 21441 835 13371 13492
NM_014666chr51257 ------
NM_014667chr352267 2087 2055 1617 1595 --12193 --
NM_014671chr721241 1211 11515 ----
NM_014676chr11218 1524 245 36 154
NM_014682chr812149 --1553 --
NM_014683chr1731529 867 350 21596 1338 ----
NM_014686chr1952380 2150 547 520 393 189 --1903
NM_014690chr742704 1914 697 478 ------
NM_014701chr1542900 2803 2788 2137 12563 1542 --
NM_014702chr62639 515 22619 1226 --13285
NM_014703chr331210 287 156 ------
NM_014705chr731620 800 361 ------
NM_014707chr741411 182 171 142 ------
NM_014709chr22624 587 1579 ----
NM_014721chr676715 5130 4616 687 378 81 34 12769 26808 305 --
NM_014723chr2042019 1183 947 546 --2514 43 12953
NM_014729chr83654 486 28 1571 ----
NM_014730chr1265133 4580 2099 1142 980 405 ----25109 4738
NM_014730chr1265133 4580 2099 1142 980 405 ----25109 4738
NM_014733chr51850 1497 ----
NM_014735chrX31901 562 337 2855 652 --1300
NM_014739chr673931 3615 1080 825 649 478 189 13031 13797 --
NM_014741chr1142025 1684 1588 1355 ----11504
NM_014743chr483063 2853 2348 2266 2223 1102 1082 114 ------
NM_014746chr2102986 2835 2787 1583 1341 1258 959 728 173 113 ------
NM_014751chr822077 1578 2209 176 ----
NM_014762chr172403 2005 1915 1680 709 357 348 ------
NM_014764chr12----11197 --
NM_014765chr162385 2367 1915 946 759 111 12413 ----
NM_014766chr753727 3561 1327 1249 1034 ------
NM_014767chr1022522 1003 1365 --1235
NM_014782chrX--2405 292 ----
NM_014810chr153703 3340 694 196 26 ------
NM_014820chr332027 295 22 11343 --11885
NM_014822chr43444 243 21 ------
NM_014826chr153986 1744 1724 1368 561 14147 --13933
NM_014829chr521787 620 --12312 12251
NM_014830chr1233773 3114 965 1331 13127 --
NM_014836chr102781 208 41766 1588 1534 233 1123 --
NM_014839chr132229 2023 1861 32466 2342 953 ----
NM_014840chr1263391 3013 1156 701 563 280 13057 ----
NM_014848chr1562478 2113 1874 528 182 50 1516 ----
NM_014850chr384446 3361 3201 1798 1788 1718 1629 307 14264 ----
NM_014870chr141858 1826 1677 1443 14582 33681 3399 1460 11296
NM_014873chr143869 3175 1955 586 1555 ----
NM_014877chr1767345 7143 6783 6649 5483 5391 11557 ----
NM_014893chrY42188 1851 1517 527 --1110 11508
NM_014897chr1743210 2865 213 132 11044 ----
NM_014900chr21961 ------
NM_014901chr522175 303 ------
NM_014902chr201131 ------
NM_014903chr1221703 651 12492 --1745
NM_014904chr1074053 2950 1505 1382 1245 271 78 11306 ----
NM_014906chr1743191 2998 2491 1086 43809 1557 1104 540 ----
NM_014912chr1073145 3067 2649 2466 1018 219 170 22177 1283 ----
NM_014926chr32840 280 ------
NM_014937chr1021239 458 1529 11032 --
NM_014939chr18121 ----11065
NM_014945chr591949 1518 1511 1477 1453 715 375 253 61 ------
NM_014947chr182659 2417 2340 1986 649 480 381 302 23120 2739 12363 --
NM_014953chr1384037 3602 1601 1232 1155 1135 860 304 --14286 --
NM_014962chr2032688 1925 1762 ------
NM_014969chr12359 54 1811 --1143
NM_014974chr1051301 1291 1151 197 63 ------
NM_014982chr1485422 5088 4277 3678 1937 1904 1463 1222 15406 --1800
NM_014989chr631975 1885 1345 --1233 --
NM_014991chr443072 2967 146 77 ------
NM_014992chr141270 ------
NM_014997chr722398 22 ------
NM_015000chr1262174 2066 707 564 114 83 22997 2043 ----
NM_015008chr343460 3021 2475 2353 --13064 --
NM_015020chr1653275 3082 2884 2568 1547 11282 1889 --
NM_015024chr821497 371 ------
NM_015026chr1271813 1640 1281 944 877 810 225 1490 --11804
NM_015032chr1322039 779 1332 1193 --
NM_015033chr953305 3291 2031 728 274 --1576 --
NM_015035chr2096065 6055 5609 5126 5073 1602 1209 832 29 1688 22248 1024 --
NM_015039chr133468 1282 116 23710 3163 ----
NM_015040chr223050 356 13355 ----
NM_015045chr1062037 1829 1697 1577 1483 413 ----11919
NM_015049chr252351 581 466 326 60 ------
NM_015051chr921114 492 33341 3171 1222 ----
NM_015052chr71363 1142 ----
NM_015060chr71213 ------
NM_015068chr753883 2948 2884 1037 490 33265 2868 163 11558 --
NM_015071chr5116300 6293 5408 4761 2571 2512 1167 1007 412 108 89 24387 4379 11130 --
NM_015072chr142601 182 ----1563
NM_015076chr694553 1688 1227 1190 843 427 173 138 65 23245 157 ----
NM_015079chr1543207 3120 2326 818 22897 2867 22796 2381 --
NM_015082chr572561 2447 2384 2039 759 417 128 12537 --12196
NM_015090chr176232 6168 4971 2181 1348 1175 968 --1802 1839
NM_015092chr1644064 3592 3067 1403 13171 ----
NM_015093chr621325 337 ------
NM_015094chr22144633 4539 4512 4222 4191 3970 3748 3694 3296 3038 1553 1421 1131 598 21430 1199 24365 514 --
NM_015097chr332240 1448 748 21605 637 ----
NM_015100chr132074 1904 596 11750 ----
NM_015101chr13815 443 293 --11919 --
NM_015110chr941790 928 696 615 ------
NM_015115chr433204 2503 1093 --12958 --
NM_015129chrX11156 168 1190 1185
NM_015132chr721407 230 --12000 --
NM_015138chr1522341 416 --22521 2016 --
NM_015143chr4------11247
NM_015144chr1674010 3707 3450 3309 2876 2538 1382 12832 22619 307 --
NM_015153chr61559 ------
NM_015155chr1022462 1038 --22994 2124 1761
NM_015156chr1454045 3934 2662 1419 948 ------
NM_015161chr1661496 1249 1228 1013 966 553 --11290 --
NM_015163chr1441942 770 580 560 21403 365 ----
NM_015172chr11585 ----1157
NM_015173chr41529 11175 11782 --
NM_015176chr14713 571 544 178 1596 ----
NM_015185chrX82945 2395 2056 1197 1128 837 533 452 ----12406
NM_015191chr1152646 2444 618 514 420 1739 --1279
NM_015192chr2042591 2372 751 519 21086 577 ----
NM_015199chr33770 728 223 ------
NM_015200chr431970 1641 464 ----1397
NM_015208chr1823331 1532 ------
NM_015214chr82136 37 1617 2641 210 --
NM_015215chr173077 2698 2465 2421 2338 2237 488 ------
NM_015233chr1322078 323 1425 11948 --
NM_015234chr631109 975 566 ------
NM_015236chr421521 611 ------
NM_015238chr5193 --251 33 --
NM_015247chr1663676 2076 1704 483 344 277 ------
NM_015252chr21941 ------
NM_015263chr1521225 1015 1189 1376 --
NM_015267chr1241748 1417 520 441 ------
NM_015271chr464097 2836 1643 969 801 212 14105 13257 --
NM_015278chr641239 952 463 280 ------
NM_015284chr141601 115 79 21 --3765 592 208 --
NM_015285chr1832284 990 423 --11587 12344
NM_015286chr1572377 2357 1927 1678 1562 871 695 ------
NM_015288chr573247 3121 1300 908 540 422 337 --12811 --
NM_015291chr173494 2891 2800 2729 1229 251 236 ------
NM_015294chr173982 804 22 ------
NM_015296chr1321257 199 ----2481 326
NM_015310chr897303 7186 6096 5841 3341 2911 2196 1950 1401 27390 5115 36733 5492 2573 --
NM_015313chr1184591 3758 3478 3267 1453 1336 1305 1066 13108 11161 --
NM_015317chr242446 937 375 125 12505 ----
NM_015326chr162759 2672 2040 746 410 47 ------
NM_015335chr1232196 1674 267 ------
NM_015336chr1242704 2429 452 336 21020 321 ----
NM_015338chr202513 87 --11899 --
NM_015344chr831771 801 213 ----12137
NM_015346chr1431745 1652 299 11782 21772 1330 --
NM_015355chr1731456 1362 34 ------
NM_015365chrX73822 3712 3346 1622 1415 1299 26 ------
NM_015385chr1033145 2584 374 13095 1627 --
NM_015393chr443022 2737 879 89 ------
NM_015396chr31498 ------
NM_015419chrX1386 2448 36 ----
NM_015429chr32206 51 ------
NM_015441chr11312 ------
NM_015443chr1741319 598 301 292 ------
NM_015446chr11676 --11319 --
NM_015453chr331530 1383 35 11870 ----
NM_015455chr564025 3807 3489 3207 1094 82 13622 ----
NM_015458chr885198 4767 4566 1448 1424 1370 908 725 14252 ----
NM_015496chr8167 ------
NM_015541chr341432 1391 1271 1186 ------
NM_015542chr102785 295 ------
NM_015550chr733522 1214 952 ------
NM_015553chr674773 4666 3515 1997 1881 1150 199 1864 ----
NM_015564chr563592 3504 3241 2782 1249 324 12450 11114 --
NM_015571chr632653 2167 1722 ------
NM_015576chr342786 2189 1913 1112 ------
NM_015578chr193310 119 60 11819 11787 --
NM_015601chr102788 346 ----1675
NM_015626chr173407 388 68 134 ----
NM_015640chr175120 3940 3706 1793 1779 1700 710 ------
NM_015646chr1211140 ------
NM_015660chr71297 ------
NM_015678chr1331448 1164 1081 ------
NM_015686chrX11738 ----137
NM_015691chrX22802 382 ----12277
NM_015693chr41272 ------
NM_015695chr641416 1333 592 238 1573 1398 --
NM_015713chr862917 2280 1450 1203 460 209 12258 ----
NM_015840chr152547 1820 1740 280 138 1415 1360 --
NM_015841chr152547 1820 1740 280 138 1415 1360 --
NM_015852chr733329 2329 794 ----12316
NM_015866chr161423 1357 1336 266 121 34 ------
NM_015879chr18218611 8340 7623 7394 7067 7043 6628 6525 6420 6369 5985 5685 3451 3197 2987 2523 1982 1407 1226 1206 187 21999 1992 27862 2760 17911
NM_015885chr11----1665 --
NM_015886chr834962 1439 1267 --24336 3891 --
NM_015888chr142478 926 608 521 1726 ----
NM_015898chr1922078 661 --11884 --
NM_015904chr22334 174 --1101 --
NM_015906chr13866 675 519 ------
NM_015907chr41282 ------
NM_015912chr871754 1731 829 798 688 326 319 ------
NM_015938chr31821 ------
NM_015948chr62418 179 175 ----
NM_015952chr62153 138 ------
NM_015962chr1421375 105 --21159 1142 --
NM_015975chrX162 ----1287
NM_015981chr52561 483 32575 2291 1066 42306 1958 1113 271 --
NM_016009chr154093 3472 920 604 131 13090 --14678
NM_016018chr842698 2434 2057 690 32660 1856 565 1116 --
NM_016023chr821461 88 ------
NM_016025chr1621960 679 1371 --1424
NM_016061chr251602 1492 1463 1027 44 ------
NM_016073chr151202 --1783 1113
NM_016075chr1373121 2460 2122 976 960 864 65 1598 1393 --
NM_016076chr133217 3207 530 1766 11079 --
NM_016083chr663533 3397 1310 1243 829 640 12501 13337 --
NM_016090chr1121092 759 ------
NM_016096chr842150 2027 1842 473 22144 669 ----
NM_016103chr51166 ------
NM_016104chr62153 138 ------
NM_016107chr5182 21351 1116 ----
NM_016125chr171540 161 1422 --
NM_016131chr242066 1800 1663 166 12089 1874 --
NM_016132chr1572632 2593 2137 1288 1020 961 687 1618 ----
NM_016144chr52175 57 ------
NM_016151chr16138 --1263 --
NM_016200chr73498 93 49 1620 ----
NM_016201chr331862 1791 752 1302 1130 --
NM_016206chr388461 7843 6790 6058 665 432 181 52 12128 28213 7262 23537 521
NM_016218chr53390 298 158 ------
NM_016224chr61504 ----1297
NM_016230chr61511 1199 ----
NM_016231chr1751630 1497 1072 48 24 ------
NM_016252chr23852 773 307 --1219 --
NM_016258chr11622 --1102 --
NM_016260chr277271 7226 5775 5350 3061 3048 1718 21742 719 --1344
NM_016269chr421072 175 ----1139
NM_016271chr1832015 1487 698 ------
NM_016272chr2222587 750 ------
NM_016275chr33951 903 85 166 --12053
NM_016277chr641367 1026 494 446 ------
NM_016289chr241585 866 539 440 11482 --1321
NM_016302chr32547 285 ------
NM_016308chr141888 1747 1363 522 ------
NM_016351chr71214 ------
NM_016376chr1764373 4190 2754 1415 654 382 33823 3533 3410 ----
NM_016377chr651731 1659 1626 1385 71 1197 11426 --
NM_016396chr1532654 1839 25 ------
NM_016403chr11------1512
NM_016422chr1132900 2515 2257 ----22952 82
NM_016424chr1772044 2004 1749 1700 1572 618 291 --11398 --
NM_016436chr2052091 1892 1762 374 111 1776 1300 --
NM_016441chr261705 1634 1496 769 430 199 12043 11484 --
NM_016442chr562326 2267 2161 1977 1939 76 ------
NM_016453chr31588 ----185
NM_016467chr231291 1087 38 11126 ----
NM_016507chr1741955 602 319 279 12004 13089 --
NM_016530chr1542503 1338 543 116 24059 3844 ----
NM_016531chr423575 938 ------
NM_016532chr17----1854 --
NM_016542chrX2528 118 ------
NM_016548chr961390 1186 1167 1028 455 76 --1529 --
NM_016569chr1231558 511 240 1988 ----
NM_016587chr72960 175 --1829 --
NM_016591chr54814 796 371 218 ------
NM_016598chr331306 1282 1150 ------
NM_016603chr52398 369 ------
NM_016607chrX21433 312 ------
NM_016620chr121342 1134 --1445 --
NM_016626chr1821107 576 ----11712
NM_016628chr101820 ------
NM_016640chr5296 47 1231 ----
NM_016644chr51407 ------
NM_016654chr151401 --1910 11169
NM_016824chr1021480 405 ----1498
NM_016834chr1753324 3293 2862 1295 835 --44117 3918 3726 2602 23539 1071
NM_016835chr1753324 3293 2862 1295 835 --44117 3918 3726 2602 23539 1071
NM_016836chr2--1100 ----
NM_016839chr2--1100 ----
NM_016841chr1753324 3293 2862 1295 835 --44117 3918 3726 2602 23539 1071
NM_016937chrX1699 --1967 --
NM_016950chr411395 ------
NM_016953chr2116032 5932 5003 4535 4527 3774 1189 1180 574 336 119 15486 24077 845 --
NM_017420chr142872 423 --23180 1046 --
NM_017423chr431673 1404 144 2779 36 --1857
NM_017447chr2154201 3775 3072 1511 1018 13374 ----
NM_017449chr121073 567 ----11144
NM_017452chr2041517 1212 56 47 ------
NM_017453chr2041517 1212 56 47 ------
NM_017454chr2041517 1212 56 47 ------
NM_017455chr1531040 892 639 --1739 --
NM_017510chr53636 168 62 ------
NM_017519chr63403 346 57 ------
NM_017544chrX3627 384 347 ------
NM_017548chr331946 617 313 11569 ----
NM_017563chr3106290 5473 5274 5027 4352 4299 939 650 621 350 16353 --16255
NM_017575chr1711612 11162 --11168
NM_017594chr932557 2380 2286 --12227 --
NM_017599chr122251 148 ------
NM_017610chr1532089 1908 104 11616 ----
NM_017626chr1041818 1619 1272 70 1663 ----
NM_017628chr454383 3379 1674 1330 821 24284 420 11889 --
NM_017629chr151828 1537 386 229 134 1614 ----
NM_017633chr611095 13866 ----
NM_017634chr831382 635 169 ------
NM_017637chr967926 7781 7493 6161 1747 551 48664 6770 5981 3087 ----
NM_017643chr1772948 2448 2089 1990 1258 753 51 ------
NM_017644chr354745 3736 3392 3333 574 13376 134 --
NM_017650chr776097 5236 4940 4351 3703 2096 659 25649 2319 --1839
NM_017651chr641516 1300 652 476 ----11465
NM_017657chr23714 288 175 --1381 --
NM_017658chr1434040 3088 961 23715 2925 ----
NM_017666chrX22170 617 1509 ----
NM_017686chr11138 ------
NM_017703chr19144 ------
NM_017719chr322466 541 ----12520
NM_017736chr1632499 1050 288 1527 --12897
NM_017737chr121443 786 21764 1666 ----
NM_017742chr1841256 357 315 288 ------
NM_017744chr122167 1717 1608 2981 618 --
NM_017746chr9168 ------
NM_017753chr91254 ------
NM_017754chr674833 4744 4655 3875 3731 1319 773 ------
NM_017778chr8----21258 265 --
NM_017779chr122759 851 --12566 --
NM_017787chr1032361 1812 520 ------
NM_017799chr1431914 637 281 --11812 --
NM_017811chr942878 2848 2412 134 11094 12255 --
NM_017813chr844880 1452 520 421 24090 1857 ----
NM_017824chr1022725 887 ----1422
NM_017848chrX23399 3104 24351 1522 13122 11627
NM_017849chr252714 1054 449 192 96 ----12066
NM_017866chr8188 --1766 --
NM_017873chr972666 2639 2026 1919 884 804 750 11055 ----
NM_017875chr32808 689 ------
NM_017902chr1035455 1142 61 12079 21699 976 --
NM_017910chr22353 24 --1347 --
NM_017915chr1221201 414 1228 ----
NM_017938chrX52082 1922 1672 1363 690 ------
NM_017944chr1151943 1135 840 686 65 --2428 120 1449
NM_017948chr94472 124 57 26 2453 80 ----
NM_017952chr264396 4353 3876 3792 316 154 --22763 876 --
NM_017953chr131166 176 61 ------
NM_017955chr141771 --156 143
NM_017964chr2134 --177 --
NM_017988chr121192 ------
NM_018000chr261626 1465 390 332 188 122 ------
NM_018011chr13------1601
NM_018027chr1053130 2449 2176 940 858 12661 ----
NM_018036chr1464390 4325 4287 4221 3183 2707 ------
NM_018061chr151641 1631 1611 386 29 ------
NM_018078chr411025 ------
NM_018080chr152151 65 ------
NM_018084chr272180 2136 2120 1258 1182 874 278 ------
NM_018085chr156887 6630 5078 3109 2315 35867 5489 1066 37778 141 67 --
NM_018086chr211688 ----11868
NM_018094chrX185 146 ----
NM_018097chr152158 101 ------
NM_018098chr321114 64 ------
NM_018103chr11297 1343 ----
NM_018105chr821066 1045 ------
NM_018107chr145894 361 351 242 182 ------
NM_018115chr4------1317
NM_018120chr851497 1095 467 413 165 ------
NM_018121chr1072904 2814 2573 2514 2343 1019 213 ------
NM_018126chr411177 --192 --
NM_018133chr32441 248 1492 1884 --
NM_018137chr1------11175
NM_018155chr323437 1064 1591 23203 708 --
NM_018157chr1253030 2698 2246 567 130 11034 ----
NM_018159chrX31534 355 43 --1165 --
NM_018171chr122654 145 1107 187 --
NM_018178chr141842 1487 472 64 ------
NM_018181chr18--11970 ----
NM_018184chr331934 1806 619 1412 1417 --
NM_018191chr1321634 444 ----11491
NM_018246chr832472 1766 749 1171 11037 12118
NM_018247chr642733 2294 2200 1987 1348 ----
NM_018254chr161688 1584 660 378 103 67 11642 1726 --
NM_018257chr2041009 523 303 158 21713 509 ----
NM_018260chr1931328 810 236 1857 ----
NM_018266chr311051 ------
NM_018293chr382921 2654 2626 2552 982 875 833 627 ------
NM_018299chr832420 2141 42 1193 ----
NM_018312chr1132135 1825 24 --11950 1196
NM_018313chr362410 2217 1940 1634 922 912 ------
NM_018314chr11294 75 ------
NM_018315chr4--31268 1152 197 --1385
NM_018330chr102594 177 --128 --
NM_018339chr921392 85 ------
NM_018348chr16----1497 --
NM_018362chr11103916 3699 3443 2565 1546 1371 1188 709 665 637 13939 ----
NM_018364chr13958 829 70 13942 ----
NM_018371chr84321 295 111 54 ------
NM_018374chr764941 3369 3259 1218 393 323 ------
NM_018375chr1461928 1856 1678 607 572 419 11384 ----
NM_018387chr9----2414 353 --
NM_018416chr1211700 ------
NM_018440chr895324 3420 2722 2709 2697 2504 1895 934 425 --38167 2066 1252 11749
NM_018445chr152411 230 ------
NM_018448chr12149 156 ----
NM_018452chr6_random53250 2691 131 115 85 ----1732
NM_018453chr14196 ------
NM_018460chr2--1177 ----
NM_018465chr9143 ------
NM_018471chr2154 ------
NM_018475chr41156 --1112 --
NM_018482chr831831 397 357 21809 957 31956 934 579 --
NM_018489chr11271 --11462 --
NM_018553chr1711430 --1574 --
NM_018555chr1931705 1430 464 --1835 --
NM_018557chr231735 1371 176 ------
NM_018566chr175087 1809 719 598 483 376 141 33806 1590 265 21829 270 24233 648
NM_018590chr1021313 488 2510 221 ----
NM_018638chr1285625 5253 4912 4853 4406 4204 2045 1134 11050 1499 --
NM_018640chr1262497 2272 1061 1040 1015 95 181 ----
NM_018650chr131949 1715 1705 12001 ----
NM_018660chr832879 937 238 --12275 151
NM_018684chrX162 11173 ----
NM_018685chr73453 172 77 ------
NM_018695chr512252 --2843 733 12289
NM_018696chr183784 134 49 --11002 128
NM_018703chr16123 ------
NM_018710chr831265 1089 1015 ------
NM_018717chr4102910 2752 2604 2494 2454 2244 1904 1054 549 505 1133 ----
NM_018718chr72641 605 12286 ----
NM_018834chr52977 247 184 ----
NM_018841chr133733 374 185 1734 ----
NM_018844chr731843 723 468 11306 ----
NM_018890chr751458 1345 1243 494 365 11427 11373 --
NM_018898chr522172 406 11771 --1625
NM_018899chr522172 406 11771 --1625
NM_018900chr522172 406 11771 --1625
NM_018901chr522172 406 11771 --1625
NM_018902chr522172 406 11771 --1625
NM_018903chr522172 406 11771 --1625
NM_018904chr522172 406 11771 --1625
NM_018905chr522172 406 11771 --1625
NM_018906chr522172 406 11771 --1625
NM_018907chr522172 406 11771 --1625
NM_018908chr522172 406 11771 --1625
NM_018909chr522172 406 11771 --1625
NM_018910chr522172 406 11771 --1625
NM_018911chr522172 406 11771 --1625
NM_018945chr643212 814 624 331 --12773 --
NM_018947chr784961 4626 3910 3829 1170 1059 906 154 23243 112 ----
NM_018959chr194664 592 547 217 --1725 --
NM_018970chr7103145 3077 3028 2746 2100 1142 987 860 666 189 ------
NM_018976chr1211957 22558 954 --1421
NM_018979chr1232374 1765 151 ------
NM_018981chr22487 147 11173 --1929
NM_018999chr1064845 4343 4282 3463 1030 826 ------
NM_019000chr521450 380 1169 1655 1175
NM_019001chr374833 4491 3806 3007 1771 448 398 23689 1956 ----
NM_019004chr742006 1820 945 630 1226 12200 1114
NM_019006chr15150 ------
NM_019008chr2263405 3303 3138 2625 1517 471 ------
NM_019027chr472405 2095 1876 686 652 629 43 1832 ----
NM_019028chr11----1278 --
NM_019044chr293772 3294 3202 2875 1477 804 384 370 30 ------
NM_019049chr12240 162 ------
NM_019050chr442296 1432 157 109 ------
NM_019058chr103514 165 91 1298 ----
NM_019072chr554310 2945 1205 456 258 11270 1955 --
NM_019074chr152753 256 --1970 1371
NM_019087chr52498 205 11406 ----
NM_019094chr1263455 3149 2807 2656 1071 83 ------
NM_019095chr201155 ------
NM_019114chr942481 2278 1589 633 --12035 1453
NM_019116chr1662478 2371 1373 849 521 32 ------
NM_019556chrX31073 932 366 ------
NM_019557chr12625 323 1118 1675 --
NM_019595chr22493 470 ------
NM_019605chr11222 ------
NM_019860chr10------11458
NM_019895chr311049 21095 57 ----
NM_019903chr1021480 405 ----1498
NM_020122chr235976 5875 858 15415 15916 --
NM_020130chr821186 487 1921 ----
NM_020132chr2174238 4095 3979 3576 3137 963 794 --74382 4346 4321 3828 3771 1963 973 --
NM_020148chr1852987 2687 525 214 60 21060 512 ----
NM_020150chr1042007 1658 1619 45 ------
NM_020177chr532653 994 761 ----12494
NM_020178chr172941 55 ------
NM_020184chr292100 1969 1939 1666 1461 820 801 615 251 ------
NM_020198chr171417 21623 637 ----
NM_020205chr163286 2876 2594 1237 1162 1005 ------
NM_020228chr1182454 2447 2286 1841 1605 289 181 145 1961 --12215
NM_020240chr521806 172 12640 1957 --
NM_020243chr221105 ------
NM_020245chr6105044 3995 3902 3803 3455 3291 1769 1291 768 622 14683 2496 153 --
NM_020336chr2073696 3209 2842 2610 2395 2350 826 11025 --1526
NM_020337chr442933 2738 929 567 --1920 --
NM_020338chr1023717 311 13762 --1500
NM_020341chr2031979 1613 608 ----1192
NM_020357chr341082 1047 462 453 ------
NM_020374chr1241815 1438 1431 437 --11751 --
NM_020384chrX51690 1496 503 126 91 --1366 --
NM_020390chr383784 3677 3661 3594 1775 1682 639 428 ------
NM_020403chr131402 ------
NM_020416chr431801 824 438 --2849 104 --
NM_020420chrY41458 402 244 191 ------
NM_020425chr631878 1477 694 ------
NM_020432chr76924 675 500 403 214 50 32163 841 249 178 --
NM_020440chr172542 2326 2261 1124 716 677 288 1474 23205 2298 13002
NM_020443chr176931 5056 4399 2736 2538 1538 237 --24270 93 --
NM_020455chr662014 1927 1892 1122 344 42 ------
NM_020466chr6114897 4422 4365 4024 3902 3248 1525 1350 1294 1085 160 11176 ----
NM_020473chrX41996 1863 1486 257 ----11382
NM_020474chr183625 280 39 --1228 --
NM_020640chr312249 ------
NM_020645chr111475 ------
NM_020651chr221413 671 ------
NM_020672chr1------1575
NM_020673chr2087126 5949 5423 2633 1419 973 557 513 27577 5368 25799 5626 15654
NM_020686chr1632863 2145 999 1365 --12401
NM_020689chr2061701 1128 678 568 306 295 11250 31477 1143 326 --
NM_020699chr163739 2167 1909 1857 1592 685 13747 ----
NM_020717chrX54472 4093 1169 797 532 13310 --13753
NM_020718chr1686237 6169 5550 5160 5111 1972 395 199 15221 36452 4722 1838 26197 231
NM_020732chr63403 346 57 ------
NM_020734chr1232955 2165 1245 --23075 901 --
NM_020739chr1573787 3499 3279 3051 2777 670 86 --13630 --
NM_020755chr621161 172 ------
NM_020760chr221772 1304 21613 372 11399 --
NM_020766chrX74067 3966 3957 3470 3200 3173 464 34088 3589 3485 34093 3072 38 --
NM_020768chr573219 3130 3033 2646 2133 512 129 23140 2474 13181 --
NM_020772chr17118076 7675 7627 7621 6039 5943 2650 2071 687 386 258 37934 7345 1905 ----
NM_020773chr431731 439 126 174 22365 545 --
NM_020774chr1865311 4959 4418 1928 1788 757 44403 4044 2451 683 ----
NM_020779chr233286 2983 2873 13095 ----
NM_020794chr141551 1490 1253 1205 --1142 --
NM_020796chr552842 1089 857 783 518 22569 2207 12589 --
NM_020801chr542261 2155 814 568 21902 229 --1497
NM_020806chr142825 721 1661 148 --
NM_020810chr1463545 3322 2418 1383 1343 835 --1887 11093
NM_020841chr1283837 3726 2977 2736 1482 706 166 139 ------
NM_020844chr8127684 7130 6401 5911 5205 3026 2881 2711 1400 1148 330 182 22145 1609 22060 1233 --
NM_020845chr1282207 1000 885 865 572 550 461 261 --3473 361 89 --
NM_020856chr1921146 575 21443 1436 ----
NM_020860chr42229 218 ------
NM_020866chr133978 730 129 1671 ----
NM_020871chrX2160 139 1281 --11676
NM_020909chr254160 4144 3146 1360 610 --13282 --
NM_020917chr1953788 2408 857 583 302 --22619 622 --
NM_020918chr1053189 3030 1417 1085 775 3933 555 297 --11462
NM_020921chr143781 628 40 --12549 1540
NM_020924chr91438 137 ----
NM_020933chr1911964 ----11671
NM_020940chr102881 518 32762 1154 918 ----
NM_020948chr123509 1093 23404 2856 ----
NM_020960chr934927 4442 428 ------
NM_020975chr1031943 1792 785 ----11392
NM_020977chr451959 619 474 425 253 --155 --
NM_020987chr1021391 1186 ----11351
NM_021005chr151961 ------
NM_021007chr272475 2116 2106 1957 1825 969 104 1233 ----
NM_021032chr31389 1479 ----
NM_021033chr1393394 3184 2805 2349 1223 788 501 436 293 12991 ----
NM_021069chr422031 1742 ------
NM_021072chr531641 629 371 ----11708
NM_021079chr1793194 2609 2225 1206 792 731 645 571 35 ------
NM_021096chr2263112 2489 2246 2052 1042 304 --12603 --
NM_021097chr232476 2300 1184 22966 81 ----
NM_021116chr7139055 8850 8783 8545 7323 6301 5940 5924 2030 2014 1207 1093 379 ----17244
NM_021132chr1031199 1146 83 ------
NM_021143chr19----1484 --
NM_021144chr92131 48 ------
NM_021153chr181176 ------
NM_021159chr451551 1353 1148 641 494 ------
NM_021161chr142118 70 ------
NM_021183chrX52469 1699 1687 764 686 1918 12142 --
NM_021229chr122971 233 ----1212
NM_021238chr1231415 776 75 ------
NM_021249chr1431657 499 90 11423 ----
NM_021255chr1433719 862 209 23161 1487 ----
NM_021569chr9----1365 1265
NM_021627chr321033 115 11147 ----
NM_021629chr334481 3615 29 11360 --2660 527
NM_021633chr121353 225 ------
NM_021637chrX31064 1053 410 ----1182
NM_021644chr10----1225 --
NM_021648chr621040 396 22395 486 ----
NM_021649chr511161 11385 ----
NM_021705chr631156 1107 83 --1445 1240
NM_021722chr71173 ------
NM_021723chr71214 ------
NM_021728chr142770 730 ------
NM_021809chr2082439 2295 2155 1979 1835 1750 619 191 11654 ----
NM_021813chr664870 4609 3844 1859 864 381 11524 24888 1386 --
NM_021814chr6------11377
NM_021870chr42248 26 1167 ----
NM_021871chr4177 ------
NM_021905chr641623 502 365 328 --131 --
NM_021911chr564430 3949 3596 3574 511 474 11218 ----
NM_021912chr1594242 4131 3853 3726 3430 2748 1247 845 41 13157 --1631
NM_021914chr1481990 1935 1833 945 677 663 362 110 32157 2148 1964 ----
NM_021940chr641226 449 153 135 11174 11298 --
NM_021947chr1731238 288 46 4923 294 233 225 ----
NM_021949chrX22315 2042 11008 1112 12102
NM_021954chr1373160 2621 2539 2402 1472 886 292 22909 727 12266 --
NM_021961chr11116317 6227 5185 4812 2588 2472 2375 1564 958 857 88 16492 ----
NM_021963chrX1719 ------
NM_021964chr3136193 5756 5447 5209 4581 4295 4102 4039 2415 1967 1640 1490 568 31020 312 31 15942 16531
NM_021998chrX21498 453 ------
NM_022048chr1535881 4233 740 ----12109
NM_022051chr11527 ------
NM_022062chr1131954 360 30 --124 11865
NM_022079chr102788 346 ----1675
NM_022114chr164520 4316 3642 3583 3438 458 --23919 3280 --
NM_022137chr1421306 512 1268 11907 --
NM_022143chr7----21553 1341 --
NM_022154chr4--21331 1205 ----
NM_022166chr1656044 5976 5693 5152 387 23872 418 11836 --
NM_022334chr26810 758 702 422 366 310 ----1873
NM_022351chr823325 2999 ------
NM_022456chr1256281 5948 5133 827 157 --15019 --
NM_022458chr752596 2146 1119 589 405 ------
NM_022459chr13106184 5951 5892 4914 2347 2299 2004 1990 574 49 14953 22527 1159 --
NM_022465chr1253065 2550 245 110 56 ------
NM_022469chr143249 2954 332 141 1500 23263 1052 --
NM_022477chr2041599 587 116 83 ------
NM_022484chr721257 945 --11097 --
NM_022497chr353699 3344 3245 831 634 1602 1866 --
NM_022550chr51418 ----1195
NM_022648chr244369 3432 1482 610 31694 1636 1597 14587 --
NM_022650chr5--2405 384 ----
NM_022716chr132522 2261 623 --1417 --
NM_022719chr22113693 3388 3207 2815 2690 1483 1262 1061 934 413 131 1162 ----
NM_022763chr332104 2069 2031 12482 1306 --
NM_022771chr1231048 879 125 ------
NM_022776chr321584 80 11632 ----
NM_022781chr942430 661 597 67 --1631 --
NM_022802chr104575 189 124 103 ----11323
NM_022810chrX2269 256 ------
NM_022817chr2188 --11974 --
NM_022824chr571866 1836 1800 1568 1475 396 26 ------
NM_022826chr21824 --21228 104 --
NM_022832chr472329 1913 1619 1015 631 620 22 --11024 --
NM_022836chr14669 164 63 30 --1532 --
NM_022841chr1552258 2140 1697 980 251 --12516 --
NM_022843chr1331440 1165 41 ------
NM_022845chr1621525 882 11449 ----
NM_022893chr22936 585 31235 1137 670 ----
NM_022894chr231581 1478 479 --1191 1329
NM_022898chr1454464 3989 1613 1239 64 24491 1529 11182 --
NM_022900chr71259 ------
NM_022912chr232643 2562 1968 12478 ----
NM_022913chr5----1234 --
NM_022918chr1121630 1540 22149 238 --11788
NM_022970chr103263 56 39 11457 11397 --
NM_023000chr1421546 1406 11295 ----
NM_023001chr1421546 1406 11295 ----
NM_023016chr242397 2200 645 506 ------
NM_023925chr122289 84 ------
NM_023929chr832541 654 380 12522 ----
NM_024007chr51165 1252 ----
NM_024046chr321298 1078 ----189
NM_024052chr1742307 2041 878 296 ------
NM_024103chr1991171 737 708 663 446 361 205 61 53 ------
NM_024295chr86831 665 475 321 243 107 ------
NM_024312chr1261096 657 614 216 185 41 2632 549 1159 1277
NM_024324chr221209 ------
NM_024328chr141244 ------
NM_024345chr974589 4552 2418 2161 1329 1188 247 ------
NM_024415chr51150 1196 ----
NM_024420chr12111 96 --1383 --
NM_024524chr321206 474 11198 ----
NM_024539chrX2795 109 --11203 --
NM_024551chr1262545 2285 1642 294 261 75 2868 682 12159 --
NM_024551chr1262545 2285 1642 294 261 75 2868 682 12159 --
NM_024557chr1131690 1061 572 --1623 --
NM_024561chr134998 893 527 462 --11073 --
NM_024565chr541111 399 151 59 --1331 --
NM_024582chr42815 69 1995 ----
NM_024612chr173365 329 308 ------
NM_024617chr9--1619 ----
NM_024626chr121632 498 1601 ----
NM_024635chr91230 ------
NM_024659chr21337 1137 --1798
NM_024665chr364527 4383 3216 2947 1812 1741 --34006 3091 3074 --
NM_024670chr1031632 489 174 1190 ----
NM_024692chr221723 620 ------
NM_024700chr131107 144 58 --2846 174 --
NM_024713chr1541424 528 221 180 11378 ----
NM_024721chr82186 120 ------
NM_024722chr171558 ------
NM_024740chr1143362 2524 1611 1340 11366 12837 --
NM_024744chr251681 962 908 686 86 1138 ----
NM_024749chr162110 1868 1500 747 627 214 --1707 --
NM_024751chr442006 1957 1677 851 ------
NM_024757chr92747 727 ----1276
NM_024770chr236687 6367 2319 2961 602 14510 --
NM_024786chr52639 597 ------
NM_024814chr71257 ------
NM_024817chr1544374 1943 694 224 45535 1661 663 455 1348 14644
NM_024824chr1431543 480 54 1309 21253 1112 --
NM_024834chr1031501 488 183 ------
NM_024837chr152339 283 1411 ----
NM_024852chr1135 149 ----
NM_024881chr1983700 3407 2852 2559 2337 1356 995 458 23239 417 --13810
NM_024887chr14853 736 596 585 ------
NM_024900chr44804 639 346 167 --1480 --
NM_024900chr44804 639 346 167 --1480 --
NM_024946chr1631463 1344 475 ----1244
NM_024947chr3137872 7652 6940 6754 6396 3756 3725 3285 2643 1702 1416 558 231 68804 8191 7986 7268 1877 142 23552 1150 --
NM_024948chr10191 2608 65 1101 --
NM_024953chr1262441 1997 1877 757 395 167 12368 125 --
NM_024989chr296675 5976 5790 3134 3091 2716 1684 454 257 27639 3153 ----
NM_024991chr1033145 2584 374 13095 1627 --
NM_024993chr241551 1464 1217 164 ------
NM_024996chr34936 262 231 25 ------
NM_025027chr19145 ------
NM_025054chr823140 1202 23062 2821 12976 --
NM_025073chr144711 3533 3348 1072 ------
NM_025076chr21461 ------
NM_025077chr12177 82 --1196 --
NM_025106chr12296 51 ------
NM_025126chr121252 1550 ----
NM_025133chr22310 179 ------
NM_025134chr165895 576 341 99 33 ------
NM_025146chr341032 792 327 61 ------
NM_025152chr1421944 1517 21360 37 ----
NM_025154chr741384 1199 1050 59 --21241 365 --
NM_025160chr194316 3937 3361 2886 2796 1254 786 553 277 ------
NM_025179chr194972 4734 3937 3092 1924 1680 1422 750 54 ------
NM_025191chr153526 2776 280 178 135 --12178 --
NM_025221chr431384 201 103 ----11069
NM_025235chr1051536 772 378 296 30 ------
NM_030576chr1721965 892 12085 12288 1644
NM_030583chr81124 1920 1364 --
NM_030594chr1541228 1077 412 177 1351 180 --
NM_030621chr1433814 3400 840 34090 3237 306 23662 953 --
NM_030625chr1021748 903 --11811 --
NM_030627chr51783 11487 ----
NM_030647chr746133 5818 2509 1976 11050 25505 2470 --
NM_030648chr441294 978 699 213 13797 11065 11673
NM_030664chr103692 599 511 ------
NM_030667chr1211198 ------
NM_030668chr1211198 ------
NM_030669chr1211198 ------
NM_030674chr12105019 4368 4313 4231 3654 1787 1749 1630 1232 383 ----15353
NM_030763chrX1113 ----1679
NM_030766chr122724 50 1253 ----
NM_030771chr11--1107 ----
NM_030784chr61324 148 ----
NM_030791chr1441448 725 537 202 148 ----
NM_030795chr82167 96 --1544 --
NM_030806chr1149139 8085 7958 7934 6546 6442 3710 3597 3256 2299 1964 1698 1613 1602 26424 6303 15759 49201 857 851 487
NM_030816chr173342 2936 2822 2693 2378 1351 114 ------
NM_030885chr31927 11826 ----
NM_030893chr12632 113 --1575 --
NM_030915chr222237 454 12108 ----
NM_030920chr131845 1671 1562 1632 1209 --
NM_030934chr14703 540 363 247 ------
NM_030939chr62985 288 ------
NM_030958chr81155 ------
NM_030959chr62570 37 ------
NM_030962chr1111226 189 --11074
NM_030964chr583730 2709 2662 1339 1129 761 597 103 --12290 --
NM_030978chr9--171 ----
NM_031203chr191173 ------
NM_031216chr1852237 2147 2070 2001 1824 21722 199 11814 --
NM_031262chr91194 ------
NM_031263chr91251 ------
NM_031267chr7----1417 --
NM_031268chr1654437 4151 3779 3734 910 ----12153
NM_031283chr2140 ------
NM_031284chr151748 --1846 --
NM_031372chr431649 1162 63 ------
NM_031411chr522172 406 11771 --1625
NM_031426chr972430 2028 1986 997 858 800 108 1251 2970 378 --
NM_031431chr1341597 1266 430 136 ------
NM_031438chr53784 450 363 11578 ----
NM_031439chr811807 --1288 --
NM_031442chrX32830 2317 1031 12154 --1387
NM_031445chr243418 2348 721 705 --1151 --
NM_031461chr821547 345 12096 1847 --
NM_031483chr2063418 3055 2836 2693 1377 1142 13076 ----
NM_031844chr173063 2754 2518 1446 1367 1325 1306 21212 24 ----
NM_031845chr273344 3325 3047 2660 2513 179 21 12954 1211 --
NM_031847chr273344 3325 3047 2660 2513 179 21 12954 1211 --
NM_031849chr522172 406 11771 --1625
NM_031857chr522172 406 11771 --1625
NM_031860chr522172 406 11771 --1625
NM_031866chr102227 193 --1841 --
NM_031890chr2221225 408 --52159 1863 877 818 430 --
NM_031922chr61531 ------
NM_031964chr171327 --123 --
NM_032013chr2041599 587 116 83 ------
NM_032021chr1121059 290 ------
NM_032042chr551793 840 833 670 196 32634 2339 261 ----
NM_032047chr322120 36 ------
NM_032102chr1143021 2532 2397 808 --12795 --
NM_032121chrX42474 711 612 28 ----12536
NM_032142chr181230 ------
NM_032147chr122227 59 --11030 --
NM_032156chr122289 84 ------
NM_032160chr1864297 2684 1593 846 622 524 22959 906 ----
NM_032177chr5167 ----190
NM_032182chr1031634 1319 52 ------
NM_032186chr121342 1134 --1445 --
NM_032189chr1384992 4317 3964 1895 1612 1313 837 272 24879 1226 14308 --
NM_032199chr1083095 2872 2676 1232 806 709 528 192 21374 391 11179 11061
NM_032208chr242938 2313 1300 653 --199 --
NM_032211chr1021154 908 21189 479 ----
NM_032217chr42146 95 ------
NM_032221chr2041753 1676 656 362 ------
NM_032228chr1143212 3133 3037 2408 --1297 --
NM_032229chr134967 799 265 163 ------
NM_032246chr1511160 ------
NM_032268chr1663046 844 635 617 485 21 --1131 --
NM_032288chr31904 21963 1622 ----
NM_032293chr91240 ------
NM_032299chr111175 ------
NM_032312chr21644 ------
NM_032315chr1168 ------
NM_032321chr242932 2539 1278 682 ----12398
NM_032325chr1141890 720 130 39 ------
NM_032333chr102663 254 2760 189 ----
NM_032352chr143513 151 100 ------
NM_032373chr1065251 5115 5046 2356 200 24 12192 ----
NM_032408chr71384 ----11077
NM_032433chr1921336 430 11619 ----
NM_032434chr231420 422 354 ------
NM_032439chr1031492 376 94 ------
NM_032440chr10----1126 1564
NM_032445chr1542065 971 94 37 1583 ----
NM_032446chr563651 2712 1522 1465 440 28 1153 1767 --
NM_032456chr42494 176 1535 ----
NM_032457chr443317 3248 2985 1357 --23721 228 --
NM_032458chrX43239 2366 737 459 --1906 153
NM_032466chr831515 413 95 ----2538 158
NM_032468chr831515 413 95 ----2538 158
NM_032505chr332491 2013 512 176 --131
NM_032538chr662217 2196 2129 1769 1023 68 --22476 1045 --
NM_032547chr41100 ------
NM_032557chr431024 327 26 ------
NM_032558chr911375 11334 ----
NM_032560chr141309 2857 108 ----
NM_032576chrY2375 24 ------
NM_032582chr1721574 81 2463 61 11867 --
NM_032601chr2276 31 ------
NM_032632chr1422034 601 2342 285 ----
NM_032682chr353368 1310 1112 359 307 11147 ----
NM_032711chr1774237 3948 3483 3179 2919 1423 606 ------
NM_032802chr15267 32 180 ----
NM_032804chr1042443 2358 432 226 ------
NM_032810chr1021331 477 1428 ----
NM_032813chr1331148 195 111 --1388 --
NM_032837chr1741831 852 477 312 ----1807
NM_032842chr731650 271 42 --179 --
NM_032846chr1441131 515 424 160 11143 ----
NM_032859chr1353244 2963 613 517 506 13980 ----
NM_032869chr821968 499 11429 ----
NM_032870chr6144 ------
NM_032873chr1133656 1182 393 --11457 --
NM_032906chr42624 141 1582 ----
NM_032949chr132226 61 ------
NM_032961chr41294 --1890 --
NM_032968chrX73694 3492 2834 1694 1401 1112 320 ------
NM_032969chrX73694 3492 2834 1694 1401 1112 320 ------
NM_032973chrY63686 3488 2829 1401 1112 320 ------
NM_032975chr1832840 2582 2215 --23156 2340 --
NM_032980chr1832840 2582 2215 --23156 2340 --
NM_033012chr132875 829 1844 ----
NM_033020chr13866 675 519 ------
NM_033030chr2134 --21538 1167 --
NM_033081chr2011192 ----1340
NM_033103chr1931263 1165 47 11285 ----
NM_033132chr131655 ------
NM_033133chr1773478 3470 2311 1322 837 247 151 11226 1397 --
NM_033136chr561751 1734 1666 1635 547 406 11240 --11400
NM_033137chr561751 1734 1666 1635 547 406 11240 --11400
NM_033138chr752164 2022 1592 612 259 1602 11867 12228
NM_033139chr752164 2022 1592 612 259 1602 11867 12228
NM_033140chr752164 2022 1592 612 259 1602 11867 12228
NM_033143chr444028 1629 1557 780 13484 ----
NM_033157chr752164 2022 1592 612 259 1602 11867 12228
NM_033181chr663533 3397 1310 1243 829 640 12501 13337 --
NM_033211chr551901 1652 1286 525 342 21773 549 ----
NM_033222chr9----11036 --
NM_033224chr7107500 7279 6943 5630 5582 1421 1372 1023 467 374 37970 6519 210 12988 16088
NM_033225chr852262 2107 1185 904 25 1132 ----
NM_033227chr5176 ------
NM_033260chr62828 509 ------
NM_033278chr11197 ----1366
NM_033285chr874322 3170 3145 1487 1286 1226 420 11534 ----
NM_033290chrX73474 2987 2913 2900 2690 2429 1073 12980 --13628
NM_033331chr963367 3098 2457 701 446 148 --1975 --
NM_033360chr1284018 3794 3057 2909 1623 1469 560 552 11288 14499 --
NM_033364chr3--1671 11900 11371
NM_033394chr231078 447 132 ------
NM_033407chr11113 1441 ----
NM_033425chr1143104 2398 950 764 ------
NM_033426chr1442925 2451 1821 204 ------
NM_033427chr71864 1781 ----
NM_033429chr1531989 880 762 12679 ----
NM_033430chr442846 306 246 208 --43274 1157 889 743 --
NM_033437chr442846 306 246 208 --43274 1157 889 743 --
NM_033495chrX2817 140 ------
NM_033503chr1543103 2499 912 709 174 1770 12972
NM_033505chr286623 4722 2565 2232 1262 1061 80 69 32135 1891 1118 --1353
NM_033516chr9--1279 ----
NM_033540chr311156 ------
NM_033632chr4--31268 1152 197 --1385
NM_033644chr542537 2279 1721 50 ------
NM_033645chr542537 2279 1721 50 ------
NM_033656chr2155610 5379 4939 4474 572 2454 43 12122 --
NM_033666chr103894 161 148 ------
NM_052818chr1352109 1978 1442 654 505 22150 1541 ----
NM_052832chr832413 763 249 11036 --12264
NM_052834chr1832284 990 423 --11587 12344
NM_052874chr16------1542
NM_052879chr1273359 3329 1588 1272 1124 1072 1009 13750 --12953
NM_052885chr1253650 3175 1424 624 117 13323 ----
NM_052898chr831777 628 348 11899 ----
NM_052900chr821712 1339 11574 1410 --
NM_052918chr1033318 2784 1116 ------
NM_052923chr6156 ------
NM_052937chr812088 131 12146 --
NM_052958chr81735 ------
NM_053002chr33747 424 42 ------
NM_053016chr955642 5473 2071 659 345 12101 ----
NM_053024chr321336 1026 ------
NM_053043chr7115719 5548 4891 2327 2176 2095 1973 1937 1149 1057 527 34275 1986 177 24614 865 --
NM_053053chr13131 48 41 1868 ----
NM_053064chr143450 348 46 ------
NM_053279chr882424 1965 1016 989 783 325 203 120 ----1507
NM_054110chr33693 288 240 --1181 --
NM_057175chr471834 1701 1633 910 458 421 408 ------
NM_057178chr1762616 1904 1076 965 915 269 12247 ----
NM_058170chr131350 651 24 ------
NM_058172chr42598 242 --31803 1232 262 --
NM_058191chr213782 735 256 ------
NM_058241chr21723 1450 --21546 659
NM_058241chr21723 1450 --21546 659
NM_058243chr191860 --147 --
NM_080415chr173946 828 672 ----1116
NM_080422chr18148 ------
NM_080423chr18148 ------
NM_080546chr92905 442 ----132
NM_080599chr102785 295 ------
NM_080604chr63661 512 182 ------
NM_080616chr20----1539 --
NM_080654chr111546 ------
NM_080676chr2012831 --1717 --
NM_080717chr1221122 352 ------
NM_080737chrX41346 1328 1231 1221 ------
NM_080738chr131393 1349 119 1789 11664 --
NM_080759chr133679 655 175 ------
NM_080760chr133679 655 175 ------
NM_080840chr20------2455 173
NM_080841chr20------2455 173
NM_080867chr1484871 4728 4523 1881 1422 982 536 475 ----11402
NM_080872chr8--23274 426 13854 --
NM_080927chr353142 2751 2731 2474 104 1364 12571 --
NM_100264chr101820 ------
NM_100486chr101820 ------
NM_130386chr182121 107 1134 ----
NM_130435chr1011176 22726 2017 --11187
NM_130436chr2161984 1803 761 659 171 108 ----12800
NM_130438chr2182561 2380 2139 1338 1236 748 685 586 22069 425 --13377
NM_130766chr17----1854 --
NM_130808chr31364 ------
NM_130838chr1541468 1451 1381 1263 ------
NM_130839chr1541468 1451 1381 1263 ------
NM_133264chr1773726 3639 3380 3165 2506 1101 960 23345 202 ----
NM_133265chrX23292 3108 --1931 13665
NM_133330chr493176 2428 2421 1245 1174 914 468 157 82 --1193 --
NM_133331chr493176 2428 2421 1245 1174 914 468 157 82 --1193 --
NM_133335chr493176 2428 2421 1245 1174 914 468 157 82 --1193 --
NM_133370chr463665 3480 3328 917 775 263 2218 206 121 --
NM_133446chr101313 ------
NM_133462chr31359 ------
NM_133468chr751893 1856 1023 250 49 ------
NM_133474chr431563 1516 303 ------
NM_133631chr341613 1341 645 332 11278 ----
NM_133634chr2151703 1552 721 353 338 --162 --
NM_133638chr531120 366 345 ------
NM_133642chr2231241 1189 919 ------
NM_133647chr15103338 3193 2712 2705 2357 1095 1015 989 804 123 --11148 --
NM_134265chr173407 388 68 134 ----
NM_134442chr22605 45 21478 468 ----
NM_138288chr1411982 --12001 --
NM_138316chr1031177 1135 352 ------
NM_138317chr142118 70 ------
NM_138318chr142118 70 ------
NM_138319chr1531086 481 311 ------
NM_138333chr942638 546 374 67 12537 11856 12587
NM_138335chr42231 207 ------
NM_138338chr2223389 311 --2616 230 12805
NM_138357chr101531 1612 11322 1690
NM_138395chr231150 819 187 ------
NM_138410chr31577 ------
NM_138423chr151114 ------
NM_138426chr722420 1664 --1140 --
NM_138444chr1344937 3853 786 443 23374 810 ----
NM_138448chr22153 27 ------
NM_138459chr641223 768 462 455 --12805 --
NM_138473chr1284706 4699 3742 3253 1573 1530 893 380 13160 --14850
NM_138479chr161889 1718 811 432 335 97 --11984 --
NM_138576chr1454464 3989 1613 1239 64 24491 1529 11182 --
NM_138619chr1741473 1010 341 332 2532 324 ----
NM_138621chr264018 3655 3212 1403 640 604 --24102 4003 --
NM_138633chr651731 1659 1626 1385 71 1197 11426 --
NM_138638chr1481990 1935 1833 945 677 663 362 110 32157 2148 1964 ----
NM_138689chr112223 197 ------
NM_138694chr653387 2943 2414 350 307 11326 ----
NM_138713chr16168294 8041 7787 7755 6688 6617 6366 6275 5765 2951 2889 2877 2328 2007 1807 915 36414 793 123 28031 1266 18128
NM_138714chr16168294 8041 7787 7755 6688 6617 6366 6275 5765 2951 2889 2877 2328 2007 1807 915 36414 793 123 28031 1266 18128
NM_138727chr122167 1717 1608 2981 618 --
NM_138728chr122167 1717 1608 2981 618 --
NM_138731chr1463931 3467 1494 467 298 179 ------
NM_138735chr211368 11298 --11450
NM_138771chr721116 318 ------
NM_138782chr53177 162 124 ------
NM_138799chr231946 1815 311 ------
NM_138927chr211788 ------
NM_138959chr1106229 6174 5578 4167 2602 2256 1411 200 127 106 1117 11326 --
NM_138966chr18------1177
NM_138971chr1162840 2559 2355 2330 922 558 1363 ----
NM_138971chr1162840 2559 2355 2330 922 558 1363 ----
NM_138972chr1162840 2559 2355 2330 922 558 1363 ----
NM_138972chr1162840 2559 2355 2330 922 558 1363 ----
NM_138973chr1162840 2559 2355 2330 922 558 1363 ----
NM_138973chr1162840 2559 2355 2330 922 558 1363 ----
NM_139046chr101185 ------
NM_139068chr52163 61 ------
NM_139069chr52163 61 ------
NM_139070chr5132 ------
NM_139078chr121104 ------
NM_139167chr8--1196 ----
NM_139207chr1211731 1135 ----
NM_139242chr1511139 ----11010
NM_139244chr62695 103 ------
NM_139273chr112236 91 ------
NM_139279chr2103580 3498 2857 2353 2300 1283 1242 959 485 139 ------
NM_139283chr1222306 2281 12028 197 --
NM_139286chr91214 ------
NM_139316chr72780 107 ------
NM_139319chr1221413 314 1223 ----
NM_139323chr2051293 780 691 643 385 --11706 1238
NM_144571chr496625 6359 5789 5733 5500 5109 4987 4273 464 --26810 5412 --
NM_144578chr1454535 3547 2095 2027 1266 22000 1000 14522 24624 3981
NM_144595chr13--1404 ----
NM_144599chr15105045 5024 4778 3765 2165 1180 1141 979 507 107 15088 13967 1625
NM_144600chr1621411 506 11579 --11087
NM_144665chr113264 219 61 ------
NM_144710chr2--21291 133 1264 --
NM_144718chr331992 693 190 ------
NM_144721chr462427 2204 2078 1040 530 397 22311 855 ----
NM_144726chr5--21220 113 --1827
NM_144728chr12644 185 1208 1664 --
NM_144729chr12644 185 1208 1664 --
NM_144767chr1544581 3000 263 90 --24102 893 --
NM_144778chr1352620 2018 1973 486 39 ------
NM_144949chr232183 1599 321 11727 ----
NM_144963chr822133 1026 12696 1703 1632
NM_145012chr101682 ------
NM_145029chr62180 30 ------
NM_145049chr52248 93 --1818 --
NM_145052chrX31068 248 70 1713 ----
NM_145055chr1823495 3437 1612 12799 --
NM_145056chr19----2557 64 --
NM_145115chr772127 1852 1596 1467 812 421 89 11916 11791 --
NM_145117chr112917 275 --12459 --
NM_145160chr151250 --1335 1226
NM_145175chr221383 1134 1229 ----
NM_145176chr662942 2539 2387 2265 440 256 ------
NM_145206chr1032877 677 571 13196 --191
NM_145235chr10----1125 --
NM_145239chr1641177 1031 208 85 --1804 1951
NM_145251chr1411007 --1190 --
NM_145259chr286398 6060 4629 4426 1803 1783 1421 681 32038 1832 721 ----
NM_145307chr1053958 3902 3457 3205 1218 14522 1497 14126
NM_145320chr733522 1214 952 ------
NM_145321chr733522 1214 952 ------
NM_145322chr733522 1214 952 ------
NM_145332chr62819 712 ------
NM_145333chr62819 712 ------
NM_145341chr1041388 529 357 300 ------
NM_145649chr642533 1814 1069 156 1932 ----
NM_145655chr642533 1814 1069 156 1932 ----
NM_145686chr242965 2663 986 27 1494 ----
NM_145687chr242965 2663 986 27 1494 ----
NM_145728chr1572377 2357 1927 1678 1562 871 695 ------
NM_145735chr1352123 1759 1070 350 185 --21980 446 --
NM_145756chr1831578 530 271 ------
NM_145808chr772732 2426 2247 1012 915 775 672 ------
NM_145861chr131393 1349 119 1789 11664 --
NM_145891chr1621092 505 ------
NM_145892chr1621092 505 ------
NM_145893chr1631214 627 23 ------
NM_147171chr72484 362 ------
NM_147175chrX42047 1401 521 45 11920 12164 --
NM_147181chr431384 201 103 ----11069
NM_147182chr431384 201 103 ----11069
NM_147183chr431384 201 103 ----11069
NM_147185chr72484 362 ------
NM_147188chr1541226 509 439 235 1568 1194 --
NM_147189chr861628 788 637 468 357 153 ------
NM_147223chr262360 1835 1553 175 103 42 ------
NM_147233chr222177 1652 ------
NM_148898chr71242 --144 --
NM_148899chr71242 --144 --
NM_148976chr11161 ------
NM_148977chr1031177 1135 352 ------
NM_148978chr1031177 1135 352 ------
NM_152233chr1431657 499 90 11423 ----
NM_152261chr1242520 594 136 51 ------
NM_152271chr82210 49 ------
NM_152275chr222379 846 1749 --1377
NM_152280chr143285 3009 2836 2647 23048 1017 11309 --
NM_152284chr8--1679 ----
NM_152332chr1432478 1877 1002 12912 ----
NM_152334chr151748 2518 153 1100 --
NM_152349chr171561 ------
NM_152388chr283915 2897 2543 903 460 421 306 120 33826 3627 1091 22771 2501 --
NM_152407chr553250 3081 2270 1266 1069 11213 22990 2853 --
NM_152409chr553487 3011 2955 2767 399 1164 ----
NM_152424chrX13722 --1512 14667
NM_152437chr1242164 1764 1616 973 1413 178 --
NM_152447chr14------146
NM_152455chr1532289 2280 939 ----11774
NM_152523chr22531 501 ------
NM_152529chr224068 201 13887 --13840
NM_152556chr751747 1724 539 348 86 12203 ----
NM_152557chr741379 370 138 129 11537 1422 --
NM_152588chr1221775 124 ------
NM_152594chr1521764 109 11721 ----
NM_152608chr141979 1843 922 464 ------
NM_152610chr1189 ------
NM_152622chr543420 3202 866 81 --13447 --
NM_152629chr91126 23458 1577 --13073
NM_152638chr123218 77 38 11249 ----
NM_152641chr1262459 2345 2082 810 663 63 12061 ----
NM_152653chr32561 482 ------
NM_152678chr332509 2121 214 22533 55 1399 --
NM_152685chr51394 ------
NM_152688chr6------1184
NM_152694chrX3807 583 157 ------
NM_152699chr363286 2647 2436 1479 970 586 11133 13493 --
NM_152707chr103824 210 119 1362 ----
NM_152729chr661554 1464 1272 642 604 104 --1483 --
NM_152736chr62852 422 --144 --
NM_152754chr773295 2932 2665 641 606 598 570 --12589 --
NM_152756chr584203 4127 4116 3597 1344 275 159 84 12749 ----
NM_152774chr752431 2154 2046 394 152 12728 12062 --
NM_152787chrX22924 719 ----12476
NM_152793chr774427 4248 3818 3791 597 383 277 14666 1318 --
NM_152835chr141816 1798 1052 982 --11076 --
NM_152838chr2033096 591 356 23403 2564 ----
NM_152890chr131197 1036 357 ------
NM_152902chr132063 1634 415 1738 ----
NM_152913chr7245 38 --180 1219
NM_152924chr1576786 6701 6151 4204 2581 1066 667 24342 1948 ----
NM_152989chr1261621 1424 1339 732 279 143 --198 --
NM_152996chr11393 --1458 --
NM_153020chr611605 --2463 87 --
NM_153035chr162945 2586 1989 1299 872 616 --1229 12494
NM_153040chr151103 ------
NM_153042chr631466 695 357 11472 1170 --
NM_153181chr18------1177
NM_153188chr574293 3875 3652 3613 2034 1953 775 15355 ----
NM_153207chr1211325 23862 2734 --161
NM_153223chr551383 1308 1012 1005 184 ------
NM_153226chr1031222 1201 335 ------
NM_153251chr13----1190 --
NM_153260chr1521034 37 ------
NM_153262chr162733 2065 2006 849 512 415 43220 2961 2646 162 ----
NM_153267chr92775 156 ------
NM_153341chr12320 246 ------
NM_153365chr432026 811 21 12701 12750 12402
NM_153367chr1033270 2630 372 1181 --1589
NM_153371chr1332107 1812 817 21952 99 11734 --
NM_153456chr13126305 5657 5437 5008 4782 4414 2108 1890 1514 1342 881 599 25897 3968 151 --
NM_153487chr63623 176 73 21202 752 14034 --
NM_153619chr1552886 2601 1221 1033 586 13089 ----
NM_153620chr731711 1378 391 ------
NM_153633chr12162 ------
NM_153634chr1231583 1088 449 ------
NM_153649chr121956 77 --1825 11825
NM_153686chr442315 2132 2098 1820 ------
NM_153687chr1221484 59 ----11627
NM_153689chr231908 1450 335 ------
NM_153810chr1075012 4196 3868 3485 1719 1657 46 --25033 4323 --
NM_153836chr242085 556 445 76 --11940 --
NM_170606chr72536 520 21521 183 ----
NM_170665chr1274033 3930 3621 3457 3350 478 103 ----1205
NM_170672chr251376 1273 1188 565 171 11480 ----
NM_170706chr133468 1282 116 23710 3163 ----
NM_170709chr842160 1745 289 26 ------
NM_170711chr195840 768 723 627 588 --1901 --
NM_170750chrX2706 67 ------
NM_170751chr641283 1162 1093 575 ------
NM_170752chr641283 1162 1093 575 ------
NM_171825chr52561 483 32575 2291 1066 42306 1958 1113 271 --
NM_171998chrX32003 1872 81 1201 ----
NM_172037chr821505 1132 2422 80 ----
NM_172069chr232227 1849 644 ------
NM_172070chr231666 811 323 11724 ----
NM_172071chr1157328 5964 5488 5445 5383 4809 4690 2397 1886 1860 1660 1372 1040 834 641 1918 ----
NM_172103chr641863 643 531 48 12643 ----
NM_172105chr641863 643 531 48 12643 ----
NM_172115chr4----1115 --
NM_172127chr422100 538 ------
NM_172128chr422056 494 ------
NM_172169chr1011749 ------
NM_172170chr1011749 ------
NM_172171chr1011749 ------
NM_172173chr1011749 ------
NM_172337chr142770 730 ------
NM_172373chr133553 470 66 ------
NM_172387chr1871667 1450 1435 1334 399 112 41 ------
NM_172388chr1871714 1497 1482 1381 446 159 88 ------
NM_172389chr1871714 1497 1482 1381 446 159 88 ------
NM_173054chr7--1268 ----
NM_173060chr531277 695 211 ----11591
NM_173061chr531277 695 211 ----11591
NM_173063chr531277 695 211 ----11591
NM_173065chr151333 1137 1094 168 30 --1552 --
NM_173075chr43733 463 42 1569 11611 --
NM_173082chr631128 594 334 ------
NM_173083chr12518 170 --1302 --
NM_173172chr2--1279 ----
NM_173214chr16168294 8041 7787 7755 6688 6617 6366 6275 5765 2951 2889 2877 2328 2007 1807 915 36414 793 123 28031 1266 18128
NM_173216chr342347 2281 1758 747 --12256 --
NM_173217chr342347 2281 1758 747 --12256 --
NM_173354chr2171801 1479 1438 868 795 415 166 --132 --
NM_173359chr331803 1215 346 ----1582
NM_173362chr51563 ------
NM_173454chr151455 11032 ----
NM_173468chr485944 5901 5171 5045 4868 2317 2186 696 --14998 --
NM_173470chrX42597 2003 847 817 12327 ----
NM_173485chr204254 102 93 56 ------
NM_173494chrX1646 ------
NM_173495chrX22313 523 1582 1383 --
NM_173500chr152898 434 ------
NM_173510chr223825 718 166 ------
NM_173511chr243450 639 388 57 11153 1220 --
NM_173519chr872075 2029 1605 659 645 494 77 11773 134 --
NM_173533chr11107 1309 ----
NM_173552chr321855 1812 --145 1127
NM_173582chr11136088 5716 5472 4957 4382 4011 2176 1938 1697 1151 646 150 69 24424 2356 15066 24865 4151
NM_173595chr1244933 4023 1352 553 1192 --11272
NM_173602chr1233776 2801 1190 --1492 --
NM_173609chr152640 166 ------
NM_173632chr19103135 2365 860 723 487 301 291 228 144 62 13196 --12227
NM_173644chr2091863 1711 1656 1610 1599 1444 573 198 53 1425 ----
NM_173653chr341264 978 573 49 ------
NM_173683chr821469 1260 ------
NM_173808chr123376 568 ----1779
NM_173822chr211630 1847 ----
NM_173827chr463027 2828 2678 2267 900 601 ------
NM_173851chr863182 1252 1124 901 200 170 ----1699
NM_173854chr12608 158 22402 2383 ----
NM_174909chr52107 57 ------
NM_174916chr1532064 1734 1688 1388 22295 1868 1402
NM_174934chr112706 56 --13540 12589
NM_175056chr342072 1772 1682 473 1231 140 --
NM_175061chr731790 735 356 ------
NM_175605chr13------1233
NM_175610chr151204 1136 ----
NM_175623chr1256281 5948 5133 827 157 --15019 --
NM_175624chr1256376 6043 5228 922 252 --15114 --
NM_175625chr1256376 6043 5228 922 252 --15114 --
NM_175748chr1452007 1974 1881 591 168 ------
NM_175767chr531888 1621 1572 2339 91 ----
NM_175852chr112762 1728 12307 13000
NM_175856chr52619 216 --1198 --
NM_175861chr1275922 5359 4752 3812 2392 1308 944 24374 4071 15142 12301
NM_175863chr63403 346 57 ------
NM_175866chr15543 505 443 205 175 --11498 --
NM_175907chr1822873 2176 --21126 1118 --
NM_175921chr553437 2889 1039 743 90 22752 997 ----
NM_176801chr451309 638 511 165 153 --21593 1552 --
NM_176812chr202605 278 1719 1297 --
NM_176814chr7--1374 ----
NM_176875chr113483 429 377 186 150 --
NM_177414chr141546 1247 391 113 145 ----
NM_177422chr1135 149 ----
NM_177438chr1433814 3400 840 34090 3237 306 23662 953 --
NM_177559chr2011104 --1971 --
NM_177560chr2011104 --1971 --
NM_177925chr1221116 253 22669 1156 ----
NM_177937chr961390 1186 1167 1028 455 76 --1529 --
NM_177947chrX21433 312 ------
NM_177948chrX21433 312 ------
NM_177949chrX--2405 292 ----
NM_177951chr14----1861 1271
NM_177966chr331853 1497 1266 11237 ----
NM_177969chr21181 ------
NM_177972chr1134461 175 155 --13563 --
NM_177974chr151114 ------
NM_177985chr24864 646 500 102 32080 1569 226 ----
NM_177990chr2031979 1613 608 ----1192
NM_177996chr2073243 2609 1124 1070 1064 636 608 21003 238 2123 95 --
NM_177999chr973229 3202 2589 2482 1447 1367 1313 ------
NM_178010chr1261621 1424 1339 732 279 143 --198 --
NM_178012chr61329 ------
NM_178013chr1463073 1096 818 752 730 50 --22248 319 1592
NM_178123chr21238 1292 ----
NM_178151chrX87562 6374 5720 1598 1372 1309 877 716 26311 5220 1189 --
NM_178152chrX87562 6374 5720 1598 1372 1309 877 716 26311 5220 1189 --
NM_178153chrX87562 6374 5720 1598 1372 1309 877 716 26311 5220 1189 --
NM_178154chr14--1153 1582 --
NM_178155chr14--1153 1582 --
NM_178156chr14--1153 1582 --
NM_178157chr14--1153 1582 --
NM_178313chr221623 161 11696 1716 --
NM_178496chr331564 952 599 21113 444 ----
NM_178505chr1022484 2224 11370 ----
NM_178539chr1231990 1688 41 1662 11505 --
NM_178554chr373567 2888 2397 1306 631 620 94 ------
NM_178566chr921702 630 1317 ----
NM_178584chr2--21291 133 1264 --
NM_178585chr443072 2967 146 77 ------
NM_178812chr841618 1488 1379 596 11173 ----
NM_180989chr133983 786 426 12244 ----
NM_181077chr1542294 2264 1898 1860 1532 1192 --
NM_181354chr82521 396 ------
NM_181358chr134044 1201 135 43745 3119 1441 937 ----
NM_181443chr2032688 1925 1762 ------
NM_181486chr1221122 352 ------
NM_181504chr543515 3427 2608 1559 ------
NM_181521chr1656992 5602 5515 2129 1693 25189 1421 22809 2778 14771
NM_181523chr543515 3427 2608 1559 ------
NM_181524chr543515 3427 2608 1559 ------
NM_181528chr202489 51 ------
NM_181659chr2033415 3272 294 ------
NM_181659chr2033415 3272 294 ------
NM_181672chrX41758 1742 1459 832 21514 506 ----
NM_181673chrX41758 1742 1459 832 21514 506 ----
NM_181674chr5136 --192 --
NM_181675chr5136 --192 --
NM_181676chr5136 --192 --
NM_181677chr5136 --192 --
NM_181678chr5136 --192 --
NM_181689chr201784 --1722 --
NM_181705chr585008 4986 1271 1213 1162 494 229 163 24655 97 --1979
NM_181723chr872094 2037 1789 1653 1589 1450 516 ------
NM_181782chr632282 1987 189 12014 ----
NM_181809chr193737 1510 1121 998 977 844 538 333 249 11253 22642 409 12663
NM_181838chr51285 --11283 --
NM_181847chr1221341 666 --11719 1536
NM_181872chr9--1259 ----
NM_181876chr431801 824 438 --2849 104 --
NM_181886chr421340 493 11082 ----
NM_181887chr421340 493 11082 ----
NM_181888chr421340 493 11082 ----
NM_181889chr421340 493 11082 ----
NM_181890chr421340 493 11082 ----
NM_181891chr421340 493 11082 ----
NM_181892chr421387 540 11129 ----
NM_181893chr421340 493 11082 ----
NM_181897chr341871 762 612 456 ------
NM_182481chr212474 366 1879 ----
NM_182482chr212474 366 1879 ----
NM_182485chr433747 3114 2913 174 ----
NM_182488chr131647 2894 156 174 --
NM_182503chr684163 2103 1713 1473 968 863 460 315 1405 34787 4238 3617 --
NM_182511chr18--1182 --11190
NM_182527chr2242056 2007 1668 1614 --12133 --
NM_182646chr433747 3114 2913 174 ----
NM_182648chr14196 ------
NM_182697chr731586 286 128 ------
NM_182715chr72946 910 ------
NM_182757chr652425 2390 2319 985 287 22893 2880 --11330
NM_182762chr796282 6054 5877 5161 4601 4489 4445 3893 1650 31211 795 236 --11053
NM_182767chr1221535 1336 ----1492
NM_182797chr2031339 264 163 ------
NM_182830chr1441642 155 113 75 --1107 144
NM_182898chr775716 5151 2352 2291 535 332 119 ------
NM_182899chr775716 5151 2352 2291 535 332 119 ------
NM_182907chr642337 2324 1872 162 22058 1918 ----
NM_182918chr212238 169 ------
NM_182964chr112917 275 --12459 --
NM_183004chr1473547 2474 1546 1199 821 786 347 1565 12608 --
NM_183006chr201131 ------
NM_183075chr462133 1858 1155 931 820 146 12029 11988 --
NM_183227chr641367 1026 494 446 ------
NM_183234chr151602 ------
NM_183235chr151602 ------
NM_183236chr151602 ------
NM_183238chr1293161 2687 1352 969 948 938 797 418 237 1818 13729 --
NM_183393chr3----1180 --
NM_183394chr3----1180 --
NM_183397chr2054555 4412 4095 1398 458 14178 44253 3735 1419 367 --
NM_183398chr54551 451 172 158 ------
NM_183399chr54551 451 172 158 ------
NM_183400chr54551 451 172 158 ------
NM_183401chr54551 451 172 158 ------
NM_183425chr20191 ------
NM_184231chr31588 ----185
NM_194071chr754232 925 774 461 90 15242 22019 436 1558
NM_194247chr264053 3703 3585 3350 1147 546 ----1608
NM_194271chr121252 1550 ----
NM_194282chr41135 13087 ----
NM_194283chr553985 992 795 457 212 --11385 --
NM_194286chr1275378 4993 4564 4113 3960 3820 1407 24626 753 14518 --
NM_194291chr842699 2108 301 287 --12820 --
NM_194314chr174302 3965 3899 2107 1868 1564 158 11913 --1425
NM_194328chr942430 661 597 67 --1631 --
NM_194329chr942430 661 597 67 --1631 --
NM_194330chr942430 661 597 67 --1631 --
NM_194332chr942430 661 597 67 --1631 --
NM_194434chr18105370 5313 5012 4834 4349 3578 1104 788 702 243 25503 4697 ----
NM_194454chr731310 1174 678 ------
NM_194455chr731310 1174 678 ------
NM_194456chr731310 1174 678 ------
NM_194463chrX2795 109 --11203 --
NM_197941chr572687 2351 2043 1017 989 361 128 1144 ----
NM_197970chr2134 --21538 1167 --
NM_198123chr821712 1339 11574 1410 --
NM_198124chr821712 1339 11574 1410 --
NM_198128chr1832015 1487 698 ------
NM_198158chr342850 2111 1027 802 1622 ----
NM_198159chr342850 2111 1027 802 1622 ----
NM_198177chr342850 2111 1027 802 1622 ----
NM_198178chr342850 2111 1027 802 1622 ----
NM_198182chr221521 553 ------
NM_198195chr3----1668 --
NM_198212chr71414 21682 111 --1408
NM_198225chr102781 208 41766 1588 1534 233 1123 --
NM_198240chr121420 ----150
NM_198268chr134044 1201 135 43745 3119 1441 937 ----
NM_198269chr134044 1201 135 43745 3119 1441 937 ----
NM_198270chrX22566 700 12525 12940 --
NM_198381chr1141268 1180 957 300 11204 --21161 890
NM_198391chr2041203 447 306 90 ------
NM_198399chr31711 ----11520
NM_198400chr1552082 2047 766 373 98 ------
NM_198404chr132780 193 ------
NM_198450chrX11753 192 11939 --
NM_198467chr71449 1529 ----
NM_198485chr321740 837 22404 166 ----
NM_198549chr132379 571 175 21288 973 ----
NM_198581chr246167 1579 433 208 27403 1758 ----
NM_198793chr313471 ------
NM_198794chr1421226 49 ------
NM_198829chr751458 1345 1243 494 365 11427 11373 --
NM_198834chr1742162 881 516 106 --21763 1433 --
NM_198836chr1742162 881 516 106 --21763 1433 --
NM_198837chr1742162 881 516 106 --21763 1433 --
NM_198838chr1742162 881 516 106 --21763 1433 --
NM_198839chr1742162 881 516 106 --21763 1433 --
NM_198859chr365136 4675 3826 3665 3627 2030 14506 24694 1882 --
NM_198889chr42146 95 ------
NM_198896chr1122177 688 --166 1579
NM_198901chr731196 882 867 ----11166
NM_198935chr2042693 2189 2005 447 32776 2077 1292 1175 --
NM_198992chr1221326 53 ------
NM_199000chr72668 346 --12096 --
NM_199003chr821350 1329 ------
NM_199040chr1263455 3149 2807 2656 1071 83 ------
NM_199129chr2021245 449 --1171 11165
NM_199132chr1982123 1841 1390 1329 676 592 323 239 11592 ----
NM_199160chr932113 1581 1423 1372 --11682
NM_199167chr181382 ------
NM_199168chr102488 137 11358 ----
NM_199188chr1273359 3329 1588 1272 1124 1072 1009 13750 --12953
NM_199189chr52977 247 184 ----
NM_199190chr1273359 3329 1588 1272 1124 1072 1009 13750 --12953
NM_199320chr421782 1119 --1803 --
NM_199320chr421782 1119 --1803 --
NM_199324chr453482 2946 2582 2289 761 12756 --1880
NM_199327chr41773 ------
NM_199355chr1621147 289 2632 537 ----
NM_199421chr1484871 4728 4523 1881 1422 982 536 475 ----11402
NM_199437chr1182454 2447 2286 1841 1605 289 181 145 1961 --12215
NM_199438chr1182454 2447 2286 1841 1605 289 181 145 1961 --12215
NM_199439chr1182454 2447 2286 1841 1605 289 181 145 1961 --12215
NM_199454chr164520 4316 3642 3583 3438 458 --23919 3280 --
NM_199461chr1053631 1318 717 435 193 12580 ----
NM_199464chr132565 51 157 ----
NM_199478chrX3628 487 102 --2606 353 --
NM_201269chr121342 1134 --1445 --
NM_201280chr61291 21576 149 ----
NM_201432chr17105925 5266 4407 2318 1620 1552 1117 1107 671 106 14060 34264 1991 1490 --
NM_201433chr17105925 5266 4407 2318 1620 1552 1117 1107 671 106 14060 34264 1991 1490 --
NM_201435chr12184 1645 ----
NM_201436chr73773 721 641 ------
NM_201516chr73829 777 697 ------
NM_201517chr73773 721 641 ------
NM_201591chr4----11394 --
NM_201592chr4----11394 --
NM_201613chr122233 99 ----1248
NM_203291chr18181 ------
NM_203292chr18174 ------
NM_203301chr1431701 634 289 ----11586
NM_203327chr2064333 3448 1168 920 514 486 14212 1727 --
NM_203349chr1541445 555 493 272 ----127
NM_203364chr1141135 875 822 297 1970 ----
NM_203390chr851685 1617 1581 1480 406 --11323 --
NM_203391chrX51854 1820 1557 504 258 ------
NM_203394chr1232684 1770 234 --12381 --
NM_203406chr572755 2416 1989 995 789 471 66 --12102 --
NM_203437chr23714 288 175 --1381 --
NM_203446chr2162231 1996 793 643 285 57 11151 --1918
NM_203458chr153655 2976 2911 845 173 153 --1357
NM_203459chr142259 2249 319 286 ------
NM_203463chr264902 1286 1166 878 793 319 1213 34200 4133 4121 --
NM_203464chr1--31064 817 133 ----
NM_203487chr131402 ------
NM_203504chr422633 288 ----1507
NM_203505chr422633 288 ----1507
NM_205768chr131639 599 590 21970 1382 ----
NM_205836chr51637 ------
NM_205848chr121966 1783 ----11845
NM_205860chr152649 1199 1066 1016 344 ------
NM_205861chr14853 736 596 585 ------
NM_206594chr11712 ----21227 121
NM_206595chr11712 ----21227 121
NM_206853chr653434 3266 2873 285 219 ----1968
NM_206854chr674695 4527 4134 1546 1480 1200 1010 ------
NM_206855chr6115660 5492 5099 4152 2511 2445 2165 1975 905 809 256 13924 1966 --
NM_206866chr2143165 3088 3062 2603 ----1830
NM_206876chr2--21015 702 1707 --
NM_206907chr543066 2931 2858 2076 23127 2818 ----
NM_206909chr897303 7186 6096 5841 3341 2911 2196 1950 1401 27390 5115 36733 5492 2573 --
NM_206914chr1222240 97 --1717 --
NM_206933chr132710 832 367 1851 12392 --
NM_207015chr352066 1556 813 563 80 ------
NM_207043chr151730 1453 692 512 37 21672 190 ----
NM_207044chr151730 1453 692 512 37 21672 190 ----
NM_207047chr151730 1453 692 512 37 21672 190 ----
NM_207113chr731648 1295 150 11606 ----
NM_207123chr42733 653 --1851 --
NM_207171chr132074 1904 596 11750 ----
NM_207291chr192543 340 1500 ----
NM_207299chr91254 ------
NM_207304chr1352507 1905 1860 1018 373 ------
NM_207334chr1----21015 827 --
NM_207387chr1741854 1751 1376 46 --11128 --
NM_207406chr4126192 4840 4777 4643 2608 2124 1553 1396 884 878 866 841 24700 2414 14166 --
NM_207422chrX31150 226 144 1195 ----
NM_207445chr1531810 1724 425 1792 --1133
NM_207481chr2----1919 --
NM_207491chr421302 312 ------
NM_207517chr152724 73 11917 1554 11579
NM_207647chr952347 2206 2032 562 214 ----1847
NM_207660chr1431543 480 54 1309 21253 1112 --
NM_207661chr1431543 480 54 1309 21253 1112 --
NM_207662chr1431543 480 54 1309 21253 1112 --
NM_212460chr741762 1704 812 262 ----11796
NM_212474chr221041 850 ------
NM_212475chr221041 850 ------
NM_212476chr221041 850 ------
NM_212478chr221041 850 ------
NM_212482chr221041 850 ------
NM_212551chr111124 --1946 --
NM_212558chr963227 2973 1662 376 208 105 1894 ----
NM_213589chr245425 3741 1267 1131 31342 765 559 ----