TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4699-3p
miRNA Sequence: AAUUUACUCUGCAAUCUUCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr5125384 5237 4929 4791 4765 4623 4349 4168 3606 1747 1549 1226 14915 14025 24805 937
NM_000217chr12115049 4499 4131 3955 3929 3923 1677 1509 424 296 113 25010 99 --11030
NM_000232chr453249 2649 2468 1298 488 1338 12604 21974 834
NM_000259chr1595833 5757 5720 5317 5241 5145 2353 1591 664 --36345 5393 1983 --
NM_000318chr842212 834 620 186 12180 11075 22468 955
NM_000390chrX73073 1298 1179 1110 1094 792 622 --33415 2264 2230 --
NM_000430chr17133791 3709 3671 3161 1218 1130 1100 826 650 190 170 125 109 22602 1111 ----
NM_000461chr384161 4053 3088 2917 1842 1648 1578 212 34626 3786 1686 11565 23564 1444
NM_000555chrX117198 7066 6681 6552 5960 5102 3075 2872 2236 1476 760 27031 5416 26899 694 --
NM_000618chr12136231 5884 5708 2065 1765 1698 1645 1502 1467 839 214 151 22 --14058 --
NM_000618chr12136231 5884 5708 2065 1765 1698 1645 1502 1467 839 214 151 22 --14058 --
NM_000793chr1475072 4986 4565 3878 1295 680 216 31914 1654 594 --1190
NM_000809chr4259169 8626 8320 8126 8041 7453 7353 6953 6182 3637 3253 2988 2613 1888 1762 1352 1210 1115 1051 1027 862 803 529 174 166 23241 1981 59024 8233 6946 6483 1568 28716 3427
NM_000813chr5135504 4893 4791 4509 4087 2193 2164 2096 1246 1225 866 751 726 55586 4908 4069 3962 1825 11681 --
NM_000826chr462389 2281 1971 1750 720 705 12080 --1653
NM_000899chr1294214 3912 3650 3334 3311 3305 3129 3081 2786 33290 3240 1303 31627 1237 430 --
NM_000926chr11159439 9308 8884 7887 7542 6358 6330 5954 5876 3256 2424 1318 855 262 130 38817 3739 2945 1648 18979
NM_000950chrX52625 1243 862 437 261 23521 2553 13386 1832
NM_001001419chr5114908 4727 4654 4527 4452 4101 3371 3285 1880 562 372 --1380 1225
NM_001001420chr5114908 4727 4654 4527 4452 4101 3371 3285 1880 562 372 --1380 1225
NM_001001668chr19133940 3928 3436 2901 2765 1454 1411 1253 1234 1133 903 345 307 12869 1358 --
NM_001003652chr18158135 8092 7961 7046 6724 6690 6067 5302 3330 2734 1799 1715 1519 1151 845 27902 6426 36322 6302 2391 --
NM_001003712chr1283175 2549 1490 1429 942 659 442 26 53884 3611 1472 1244 670 23926 3339 1936
NM_001004419chr12114621 4268 3912 3842 2953 2914 2865 1750 1123 1039 231 23144 2832 13828 --
NM_001005473chr596637 6578 5257 5238 4929 4256 2411 2207 689 14504 36247 2213 790 15602
NM_001007023chr1475072 4986 4565 3878 1295 680 216 31914 1654 594 --1190
NM_001007214chr171567 1365 1278 1267 392 124 60 ----11179
NM_001008495chr892247 2210 2062 1557 1532 380 188 182 176 ------
NM_001009554chr423568 181 --1158 24418 4143
NM_001009554chr423568 181 --1158 24418 4143
NM_001009899chr3116262 6075 4915 4369 4343 2156 1845 1510 1133 787 371 46420 6360 1191 712 1233 12338
NM_001010861chr172637 2446 2237 2042 2000 554 90 32424 2336 1114 1786 --
NM_001010891chr5106771 6756 6628 5522 5262 4766 4394 2235 890 502 26818 4721 56365 4940 2418 1989 792 --
NM_001011513chr484157 3804 3143 1486 1072 903 292 177 --1368 1461
NM_001011666chr785973 5295 4344 2563 2140 1782 902 388 26398 700 26238 5375 --
NM_001013659chr1995248 4847 4592 1881 1312 1160 956 587 223 24863 981 15131 14708
NM_001014380chr13115714 4603 4516 4302 3847 3827 3625 3576 2161 1600 1534 15472 21302 1139 --
NM_001014797chr1096858 6682 6195 6141 5791 3256 2539 1347 262 32697 1925 654 35685 5157 622 --
NM_001018067chr1105087 4570 4506 4370 4346 3599 3353 1391 1212 837 11277 25378 3441 --
NM_001018068chr1105087 4570 4506 4370 4346 3599 3353 1391 1212 837 11277 25378 3441 --
NM_001018069chr1105087 4570 4506 4370 4346 3599 3353 1391 1212 837 11277 25378 3441 --
NM_001024647chr1286582 5402 2993 2563 1758 1405 1067 711 17183 22950 222 17054
NM_001024948chr183462 3390 2986 2527 1119 1101 492 378 32595 635 153 2586 366 --
NM_001024956chr11175553 4901 4531 4510 4479 4445 4300 4215 4060 3769 3595 1994 1516 775 764 551 27 14630 24852 108 --
NM_001025076chr10135992 5784 5766 5616 4993 4650 4451 2055 1849 1763 1074 798 616 ----25803 4085
NM_001025077chr10167350 7142 7124 6974 6351 6008 5809 5042 4598 2432 2156 1974 1279 835 745 50 ----27161 5443
NM_001030055chr14114632 3791 3256 3231 3136 1702 1330 1301 1243 1228 585 2454 311 24392 3122 11406
NM_001032394chr662796 2287 1905 1865 604 211 --22060 1914 11880
NM_001032395chr662663 2154 1772 1732 471 78 --21927 1781 11747
NM_001037132chr772175 2049 1861 1834 1730 1562 1508 21546 1526 11649 --
NM_001037133chr772175 2049 1861 1834 1730 1562 1508 21546 1526 11649 --
NM_001037317chr172637 2446 2237 2042 2000 554 90 32424 2336 1114 1786 --
NM_001039569chr233226 2708 964 21042 51 13333 23197 2879
NM_001039585chr153941 3763 2668 673 616 54059 3159 3087 2818 1653 43130 2569 544 275 --
NM_001039618chr11135968 5868 5741 5721 5704 5539 4562 3725 2326 1605 1530 1066 628 --35341 5188 2180 --
NM_001039693chr284071 3440 2565 1572 1438 651 241 40 21452 110 --11382
NM_001039937chr1353656 3590 2693 1260 454 --34018 3094 2895 156
NM_001040020chr731513 631 608 3178 162 80 --1618
NM_001040157chr472833 2773 2735 2613 2511 1089 259 11159 --22244 1822
NM_001040284chr16125093 4832 4607 3855 3595 2341 2291 1999 1723 1486 1381 1026 --12181 --
NM_001040441chr1125333 5109 4992 4572 4106 3539 3470 2073 2028 2008 1499 653 24970 3478 ----
NM_001040665chr7104641 4618 4542 3867 3761 1903 1813 1536 1378 425 13073 13966 13650
NM_001042355chr1684249 4024 3889 1673 1586 1567 1432 1390 1355 25162 789 11049
NM_001042412chr1684249 4024 3889 1673 1586 1567 1432 1390 1355 25162 789 11049
NM_001042533chr373180 3050 2982 966 939 849 838 --12953 13329
NM_001042599chr2136614 6009 5967 5686 2479 2451 1850 1694 1414 1360 940 779 564 77255 7208 6590 6321 5948 2124 1507 55902 5403 5297 2796 1929 --
NM_001042601chr383276 2793 2528 2312 1091 1020 163 68 --12889 11098
NM_001042604chr384771 4016 3845 3727 1898 1094 744 113 --21603 1227 1697
NM_001083620chr462387 2279 1969 1749 719 704 12078 --1652
NM_001099678chr3116329 6177 5880 4598 2012 1905 1726 1439 944 581 211 65852 5548 2223 2155 1954 802 24043 1374 15741
NM_001100108chr197938 7446 7356 5277 3296 2797 1861 633 201 18290 31767 1471 1173 17739
NM_001106chr399695 9205 8701 8517 8268 3087 2085 1540 1413 21645 975 26020 1270 11525
NM_001160chr1252213 2180 1795 752 272 1247 11857 22081 1950
NM_001167chrX146733 6475 6001 5660 4655 2223 2035 1727 1694 1296 1290 1187 1032 309 36756 6643 6600 1313 11480
NM_001173chr14114632 3791 3256 3231 3136 1702 1330 1301 1243 1228 585 2454 311 24392 3122 11406
NM_001201chr473881 3638 3514 2493 1546 1316 972 13087 22563 2506 1222
NM_001204chr286996 6754 6688 6382 2861 2755 2460 25 37654 6957 1005 37657 1639 641 --
NM_001241chr272416 2187 2172 1544 472 266 224 52274 2207 1685 642 616 ----
NM_001241chr272416 2187 2172 1544 472 266 224 52274 2207 1685 642 616 ----
NM_001438chr193546 3459 3417 2965 2797 2656 2472 2455 620 ----12900
NM_001663chr1482752 2618 1976 1845 612 485 432 326 2951 777 32672 2636 720 --
NM_001709chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_001821chr184165 3954 3856 3138 2967 1607 447 429 --14671 14201
NM_001858chr664560 4531 1856 814 321 122 34831 4769 3526 1270 14729
NM_001938chr191777 1560 1510 651 431 424 391 322 64 ----11457
NM_002006chr4145659 5344 5173 4766 4592 1138 1019 950 684 431 229 162 138 74 --34657 3819 1601 24748 3927
NM_002025chrX149005 8013 7827 6039 3617 2809 2603 2464 2160 1499 1225 947 759 160 11450 28977 2206 18699
NM_002033chr1163929 3871 2703 1369 1058 607 24023 790 21506 98 13465
NM_002092chr4124914 4851 4481 4331 3745 3154 1966 1910 1445 595 432 397 34488 3305 3125 14090 --
NM_002203chr5113672 3385 3239 3231 3195 1400 1252 1187 578 112 65 43762 3030 2548 436 31368 1207 891 13119
NM_002210chr273535 3235 2788 2539 943 618 85 --12702 23450 925
NM_002270chr5125672 5248 4422 4154 2058 1695 1555 1289 581 486 442 112 44670 3791 3461 1633 14609 --
NM_002336chr12164776 4729 4709 4316 4188 4002 3531 3409 1996 1900 1354 1164 1034 762 485 297 147 13106 1581
NM_002451chr9113316 2971 2723 998 899 708 636 606 423 390 217 1765 23605 883 --
NM_002460chr6123771 3461 3392 3303 2896 1414 842 693 613 605 502 246 33824 3727 231 ----
NM_002645chr1142415 1186 940 420 21997 611 12502 23062 934
NM_002655chr8145296 4737 4045 3925 3772 1880 1865 1409 1332 1223 1097 821 401 281 1422 ----
NM_002709chr283404 3362 2805 1332 1230 1130 463 135 --23215 2563 22479 678
NM_002837chr1274629 4095 3224 1771 1501 1094 324 1206 41780 1735 1119 1052 11506
NM_003034chr12258132 8090 7897 7283 6536 6299 5700 5244 3082 2926 2688 2066 1858 1742 1705 1543 1471 1460 975 884 840 502 363 259 234 28146 7198 22470 825 --
NM_003112chr7113253 3200 3192 2827 2725 2656 2125 1232 892 633 553 1920 11238 --
NM_003199chr18125260 4116 4094 3849 3522 1888 1657 1620 1365 1259 910 374 44650 2181 969 769 11804 --
NM_003392chr374111 3979 3582 1008 900 454 336 --1888 13705
NM_003412chr363141 3014 2215 704 585 156 33120 408 365 22823 567 --
NM_003423chr1962311 892 776 717 326 100 21651 757 --1966
NM_003574chr1845166 1417 466 328 35712 4627 1814 24463 1320 15031
NM_003583chr12123872 3486 3389 3232 2890 2773 2414 1556 1518 1366 1324 1133 ----13887
NM_003615chr3103943 3872 3299 3192 2813 2807 2706 1007 655 499 21125 906 33382 2619 1111 --
NM_003913chr673251 2971 1343 1335 1199 1120 979 11709 13182 23701 35
NM_003966chr5117293 7128 6029 5547 2099 1791 1321 937 604 350 30 27809 5264 13140 17567
NM_003994chr1294214 3912 3650 3334 3311 3305 3129 3081 2786 33290 3240 1303 31627 1237 430 --
NM_004133chr862323 2250 1906 1712 1673 525 21865 325 22638 385 12558
NM_004171chr11259620 9109 8433 8399 8294 8278 8232 8173 8105 7782 7603 7583 6746 3160 3073 2352 1921 1877 1500 1186 857 774 574 493 346 48349 7752 2542 760 11867 --
NM_004397chr11104292 4114 4056 3905 3784 3087 1714 1571 1208 753 2999 723 13646 1777
NM_004612chr984865 4415 4306 3640 3373 3198 1254 683 24739 4259 33710 882 648 --
NM_004726chrX115481 5442 5083 4624 4440 3789 2176 2010 1173 847 743 14958 11725 --
NM_004744chr4113847 3482 3285 2951 2872 1244 1197 1133 907 751 391 2813 42 2919 593 11379
NM_004857chr1464681 3538 1661 1423 1352 479 21342 458 33029 1245 1157 13158
NM_004866chr593795 3706 3318 3125 1398 1318 795 492 387 24643 1691 1264 1519
NM_004904chr785973 5295 4344 2563 2140 1782 902 388 26398 700 26238 5375 --
NM_004999chr684175 2917 2865 1679 1398 1218 144 113 --41646 1581 1024 901 13571
NM_005010chr772175 2049 1861 1834 1730 1562 1508 21546 1526 11649 --
NM_005065chr14105351 5223 4993 4969 4571 4485 4452 4313 3898 3652 11773 13372 --
NM_005126chr331884 1576 633 2829 626 11749 11469
NM_005188chr11117502 5824 5333 5030 3296 3216 2935 2758 2017 1117 103 38157 3046 749 26960 1150 22005 1454
NM_005197chr1474925 4826 1113 1016 920 718 472 26146 1345 --11880
NM_005235chr2136614 6009 5967 5686 2479 2451 1850 1694 1414 1360 940 779 564 77255 7208 6590 6321 5948 2124 1507 55902 5403 5297 2796 1929 --
NM_005339chr451628 1388 657 438 192 1167 23447 889 1830
NM_005359chr18106253 5764 5018 4083 4042 2260 1988 1880 1221 578 --35881 5281 522 --
NM_005504chr1286418 6318 6296 5862 4360 2297 1853 749 24859 535 35676 4546 727 15582
NM_005570chr1861165 1083 977 841 262 195 1272 1215 11023
NM_005578chr3125010 4874 4406 4283 4275 4233 3674 3610 1309 1096 567 70 ------
NM_005596chr9116322 6226 5128 4860 4247 4092 3902 2256 1229 828 330 35724 5196 1907 15826 --
NM_005665chr184532 4504 3900 3383 1761 1686 677 215 33920 3680 1148 13811 11961
NM_005748chr1283058 2944 2665 2659 2173 1308 683 265 --22145 291 12829
NM_005901chr18158135 8092 7961 7046 6724 6690 6067 5302 3330 2734 1799 1715 1519 1151 845 27902 6426 36322 6302 2391 --
NM_005903chr5114908 4727 4654 4527 4452 4101 3371 3285 1880 562 372 --1380 1225
NM_006047chr20123288 3125 2971 2862 2670 1266 1069 603 445 347 199 29 ------
NM_006080chr782978 2612 2602 678 498 489 221 34 22706 2341 1851 --
NM_006095chr494460 4039 3825 3760 3611 3421 2934 2818 110 12780 43867 1342 880 547 14128
NM_006154chr1542112 1022 726 481 --2938 311 12864
NM_006158chr861846 1800 1713 1572 272 99 --2663 312 21125 415
NM_006252chr1136697 6406 6204 5762 5688 4596 2467 2438 2266 1327 470 455 370 11295 12939 --
NM_006457chr484157 3804 3143 1486 1072 903 292 177 --1368 1461
NM_006482chr12123872 3486 3389 3232 2890 2773 2414 1556 1518 1366 1324 1133 ----13887
NM_006529chr461663 1290 394 316 262 252 11161 21640 1082 --
NM_006544chr14125693 5157 4958 4947 4148 2372 1963 1656 1161 833 733 676 56099 5590 2433 710 494 14014 24186 1968
NM_006561chr10135992 5784 5766 5616 4993 4650 4451 2055 1849 1763 1074 798 616 ----25803 4085
NM_006599chr16177796 7740 7316 7118 6918 6863 6441 6248 5429 5350 5213 2756 2091 553 497 432 117 17093 ----
NM_006620chr684695 4152 3950 3881 1253 1206 544 38 24360 3185 54274 3996 3992 1239 1028 34568 920 707
NM_006628chr15123826 3615 3155 2903 1651 1637 1598 1526 835 670 544 219 1725 14552 1788
NM_006729chrX115555 5449 4523 4389 3862 1522 1276 1158 575 353 37 31813 1466 1111 13811 --
NM_006777chrX72722 2133 1944 1878 915 793 179 22491 1825 --1450
NM_006918chr11175553 4901 4531 4510 4479 4445 4300 4215 4060 3769 3595 1994 1516 775 764 551 27 14630 24852 108 --
NM_006924chr1793581 3430 3376 3166 3088 1760 1685 1107 258 21194 954 24275 1754 14067
NM_007007chr12114180 4151 4034 3609 3269 3242 2913 1886 1027 1017 823 44485 3709 1903 998 2597 319 13978
NM_007038chr2175973 5667 5279 4484 1389 1312 1073 35570 4018 392 --1662
NM_007039chr1482217 1966 1956 1908 1589 904 824 123 11918 --12324
NM_007050chr20138041 7993 7549 7349 7278 6891 6536 5666 5380 5181 5108 1719 66 17941 27106 5689 24902 3172
NM_007114chr3113096 2958 2772 2720 2501 2492 2266 2048 549 491 362 23312 332 33183 2964 586 --
NM_007137chrX95141 3689 3373 1930 1668 1650 434 344 223 13387 33927 1875 594 14982
NM_007146chr173295 82 30 21142 664 --2478 38
NM_007249chr13199046 7851 7783 7715 6739 6587 6567 6268 6079 5859 3103 2958 2635 2376 2368 1563 949 497 450 19086 12724 --
NM_007347chr15112949 2805 2725 2683 2583 2544 2409 2169 1012 950 71 --1680 13142
NM_012095chr1082614 2603 2343 862 845 768 722 290 --12430 23491 678
NM_012096chr3113527 3373 3099 2792 2719 2317 1364 1172 1125 931 813 11102 13531 12548
NM_012141chr1353656 3590 2693 1260 454 --34018 3094 2895 156
NM_012164chr9187266 7163 6844 6443 5874 5653 5614 5589 5533 4592 2387 2184 1969 1635 1619 1299 572 309 27079 2699 15906 26497 4849
NM_012214chr285586 5111 4681 4546 4493 2120 808 35 1116 45964 4803 492 148 --
NM_012249chr2103549 2934 2675 2354 1186 1076 726 416 313 183 ----12735
NM_012262chr163592 1809 1398 1119 1044 624 1963 25109 758 21765 155
NM_012281chr7102301 2261 2025 1983 1836 1830 1742 1502 234 125 1157 1673 --
NM_012297chr4112548 2369 2359 2227 1819 1766 1040 843 557 308 266 11635 ----
NM_012382chr593929 3814 3687 3595 3534 951 656 266 222 21653 1572 21817 448 2717 317
NM_013229chr1252213 2180 1795 752 272 1247 11857 22081 1950
NM_013255chr7128763 7854 7595 5514 2937 2513 1942 1911 1111 474 215 83 18787 --67077 2658 1712 1360 837 722
NM_013269chr12114548 4195 3839 3769 2880 2841 2792 1677 1050 966 158 23071 2759 13755 --
NM_013989chr1475072 4986 4565 3878 1295 680 216 31914 1654 594 --1190
NM_014021chr193477 3377 2734 2362 2323 576 475 395 328 1228 --22944 2920
NM_014112chr854140 3993 3598 3591 218 15028 --33933 1677 1497
NM_014155chr11126834 6049 5947 5274 5189 4567 2789 2517 1915 1901 1129 965 47230 1941 777 468 26350 2146 1679
NM_014331chr4117277 6026 5373 5119 3136 2874 2735 2309 1954 1820 657 27601 1154 47626 7604 5437 2080 33035 2152 202
NM_014721chr6107216 6693 5813 2666 2524 2454 2369 2095 1609 1582 36789 1600 1404 22783 620 --
NM_014739chr6123926 2946 2915 2772 1286 1226 1186 978 520 365 200 166 23518 1169 11243 12909
NM_014810chr152716 1463 1457 1182 1059 43696 3649 3600 3517 --13184
NM_014864chr1103925 3816 3764 3747 3164 3070 2656 1712 155 22 23380 1701 23724 754 --
NM_014877chr17137720 7542 6085 5145 5102 1542 1251 964 882 851 843 814 55 27173 366 27489 4862 --
NM_014888chr731513 631 608 3178 162 80 --1618
NM_014906chr17113962 3656 3543 3456 2799 2647 1320 1029 557 509 60 1134 --13978
NM_014936chr652331 2163 747 432 197 32881 2582 538 22506 210 --
NM_014982chr14105168 5074 5068 3459 1705 1676 1477 1195 1055 487 25330 1454 14480 32155 1731 764
NM_015040chr253247 2992 2979 938 159 23407 2839 2810 799 1288
NM_015076chr683834 3821 3674 3267 2917 1615 1032 444 --34093 3733 3435 11317
NM_015092chr1654221 4058 3869 1249 601 --53693 1357 1196 697 157 23311 519
NM_015208chr18163598 3592 2848 2647 1631 1562 1488 1380 1180 988 930 850 546 466 137 109 21037 1027 12793 --
NM_015247chr1684249 4024 3889 1673 1586 1567 1432 1390 1355 25162 789 11049
NM_015271chr493687 3544 3516 3244 2727 2675 1103 532 347 ----13315
NM_015310chr8148398 8366 8246 7542 7348 6699 6177 5850 5402 3146 1854 1725 1386 496 25535 77 48171 6339 1611 409 --
NM_015317chr262636 2432 1041 307 146 63 12831 32616 946 630 1576
NM_015323chr681622 1546 1537 1231 187 177 160 31 11648 --11478
NM_015554chr152726 602 2571 317 32895 2152 1057 1444
NM_015569chr1104655 4009 3820 3700 3577 1863 1778 1635 1537 1079 23281 3149 33753 1416 76 23135 669
NM_015640chr1105087 4570 4506 4370 4346 3599 3353 1391 1212 837 11277 25378 3441 --
NM_015886chr875086 4617 2231 1775 1050 418 335 14217 --1317
NM_015906chr194368 4252 3887 3181 3154 1780 1638 1344 240 34743 1297 982 33876 3331 1300 1353
NM_016217chr6103528 3096 3012 2749 2423 2387 848 650 431 290 13585 21210 425 --
NM_016248chr1383092 2997 1614 1580 1392 915 847 104 12933 22688 473 2125 90
NM_016260chr2117599 7030 6793 6720 5839 5319 5009 2114 1450 1125 36 35194 2230 1714 15283 --
NM_016308chr161867 1671 1632 470 178 132 --3407 186 143 12061
NM_016467chr241286 1167 966 68 ----2933 279
NM_016626chr1861651 698 671 286 141 76 11428 11385 11235
NM_016953chr2136019 5382 4973 4237 2453 2060 1980 1945 1729 1357 751 550 344 --24709 1062 --
NM_017420chr14103154 2975 2861 2691 2683 1503 1270 1018 778 174 23137 640 2680 269 11390
NM_017444chr851285 1255 551 367 68 11861 11541 11653
NM_017447chr21114285 3916 3584 3547 3207 3113 1323 1244 1162 970 943 31747 687 510 34018 3238 856 --
NM_017637chr9139395 8380 8006 7165 6843 6836 6554 6426 5767 3519 3009 2395 1288 36872 3666 529 38389 2878 898 27649 3170
NM_017644chr3144761 4286 4042 3861 3845 2010 1917 1396 1267 1125 1058 317 276 111 35105 3195 254 23286 1979 14575
NM_017645chr973161 2585 2465 2080 1023 672 622 13103 33037 1193 292 --
NM_017650chr7145737 5536 5173 5061 5028 4773 4715 4476 3839 2204 2121 2045 2012 373 36036 4979 4798 ----
NM_017658chr14104311 4252 3847 3657 3443 3206 2935 1773 456 229 34128 814 531 21450 190 13278
NM_017813chr895404 4433 3582 1863 1638 1542 1446 388 267 25758 4557 24768 3934 --
NM_017848chrX124693 4527 4359 4289 4083 3608 1009 876 588 571 295 225 --24071 677 --
NM_017944chr11112944 2219 2150 2042 2036 1020 863 545 341 299 219 1744 21918 463 --
NM_018085chr1137256 6418 5873 5428 5111 3010 2953 2899 2017 1816 1395 1270 890 23254 973 48019 7856 1906 1140 --
NM_018364chr193809 3779 3546 3045 2773 2599 744 439 316 24002 991 1493 13319
NM_018409chr4103269 2071 997 988 882 824 744 525 424 357 --1346 --
NM_018440chr8147723 7123 6782 6695 6033 5950 2662 2372 2266 1986 1602 1440 1398 1067 38654 7806 3012 37713 6455 5501 13480
NM_018638chr12185514 5472 5230 4786 4746 4639 4632 4456 4350 4091 3804 3583 1613 1174 1077 414 287 46 35673 510 462 22125 1769 11586
NM_018685chr751180 799 771 301 196 ----1204
NM_018999chr1094747 3953 3678 3524 1477 1282 934 273 178 11130 13424 14950
NM_019001chr384771 4016 3845 3727 1898 1094 744 113 --21603 1227 1697
NM_019022chr1872821 2487 2410 2154 1983 1970 685 11224 12369 12159
NM_019050chr461630 1441 809 687 408 103 42192 1952 1714 1486 11415 --
NM_020337chr483179 3069 2427 1273 995 894 662 162 12915 --22784 2257
NM_020455chr662796 2287 1905 1865 604 211 --22060 1914 11880
NM_020673chr20127344 6147 5917 5638 5217 4804 2974 2522 1753 1425 1201 795 1935 1587 17645
NM_020718chr16115938 5295 4925 4205 2530 2523 2152 1608 1574 1404 867 12283 1613 11450
NM_020748chr1772127 1360 592 486 439 316 94 32048 2035 1881 12059 11565
NM_020772chr17138648 8259 7920 7821 7081 6747 6702 2111 1686 1516 1003 302 113 15522 47172 6217 5801 3183 --
NM_020774chr18126161 5902 5443 4629 4371 4294 4271 1672 887 462 317 137 25923 5382 25967 576 11324
NM_020782chr12124540 4129 4116 4033 3588 3546 3262 1095 339 306 285 93 1138 1575 13157
NM_020805chr1871935 1909 1877 1835 1489 786 276 ----21886 1310
NM_020841chr1283175 2549 1490 1429 942 659 442 26 53884 3611 1472 1244 670 23926 3339 1936
NM_020844chr8126722 6302 6099 5049 4928 4808 2987 2360 1872 1225 885 444 37091 6996 2699 --17403
NM_020890chr34436 429 423 128 --1513 --
NM_021097chr282227 2221 1136 880 439 426 409 152 --123 12639
NM_021148chr741800 1567 1011 683 1671 12096 2763 530
NM_021163chr7123764 2687 2470 2374 1509 1279 1243 853 778 672 323 232 ------
NM_021629chr3135091 4955 4425 4300 3978 3731 1658 1538 1392 1181 857 248 140 14704 ----
NM_021647chr423568 181 --1158 24418 4143
NM_021814chr661264 1135 1070 378 372 353 11416 ----
NM_021815chr272734 2297 1201 1009 877 257 119 --33067 1154 322 11891
NM_021911chr5135504 4893 4791 4509 4087 2193 2164 2096 1246 1225 866 751 726 55586 4908 4069 3962 1825 11681 --
NM_021961chr11137002 6804 6694 6574 6308 5733 4978 1618 1252 1069 473 447 162 15949 27188 1371 2945 849
NM_021964chr3115542 5185 5083 4636 4206 1574 962 823 808 433 74 26035 22 --24402 1945
NM_022091chr6102765 2339 2140 1925 1883 1751 1722 797 555 173 --22343 1026 12488
NM_022130chr531084 558 40 21273 426 1995 1516
NM_022456chr1286582 5402 2993 2563 1758 1405 1067 711 17183 22950 222 17054
NM_022459chr13166192 6116 5945 5934 5906 5309 5238 4068 4059 1938 1648 1642 1152 1036 939 150 12087 26362 1228 15192
NM_022491chr1243424 3223 3143 1251 11286 42301 2177 637 140 23549 824
NM_022900chr771137 987 978 966 925 331 281 199 --11191
NM_023929chr8102681 2497 2304 2190 1979 1822 1024 959 428 249 21911 1903 12227 --
NM_024345chr985821 5648 5259 5109 4340 3958 1764 970 25883 2148 44050 2196 1916 1525 12445
NM_024665chr3114533 3692 3578 3483 1864 1734 951 728 604 513 198 24100 3182 24284 522 --
NM_024770chr2116518 5993 5818 4267 2451 1605 1148 369 338 163 61 --16693 15277
NM_024947chr3199611 9600 9378 8232 7930 7866 7820 7790 7481 6996 6248 6196 5993 3311 3180 2129 1608 201 63 --59384 8778 7034 6002 2707 36870 6357 6337
NM_024989chr2148068 7522 6986 6359 6270 6091 5754 5521 5292 5162 2358 1355 1300 1004 11387 23020 329 --
NM_025191chr173273 3094 2990 858 753 694 45 13555 12217 13207
NM_030621chr1494065 3842 2795 1655 1529 673 609 568 402 24036 3871 24245 4013 --
NM_030627chr5104065 3761 3558 2666 1431 1243 1196 772 705 165 --13258 --
NM_030755chr1462844 2334 2010 1195 742 77 12133 22734 2721 12648
NM_030816chr183445 3060 2872 927 571 390 144 93 22810 2455 22587 2506 12801
NM_031216chr1872093 1850 1421 858 600 570 503 --1579 --
NM_031427chr1485923 5289 4864 4767 4758 1363 1206 930 15370 35305 4401 2121 12106
NM_031435chr12113356 3304 3271 2643 2618 2173 1043 931 661 528 52 --1694 --
NM_031442chrX122976 2838 2731 2718 2489 2185 2003 1270 1262 909 515 21 --12326 --
NM_032116chr13115714 4603 4516 4302 3847 3827 3625 3576 2161 1600 1534 15472 21302 1139 --
NM_032228chr1183182 3176 2636 2394 947 718 525 180 1430 2360 127 13097
NM_032229chr1341011 870 231 115 2815 65 --1932
NM_032373chr10125629 5095 4659 4391 4351 3759 3575 1500 1479 1016 342 252 25707 764 13820 --
NM_032457chr463753 2978 2955 2927 2692 2479 23897 2459 33568 3101 2648 --
NM_032458chrX103172 3128 2988 2917 2515 2431 2272 1221 620 84 --13033 --
NM_032778chr373180 3050 2982 966 939 849 838 --12953 13329
NM_032826chr785343 4317 3827 3605 3590 2024 1303 500 45481 5409 4409 4199 --13999
NM_032859chr13103816 3387 3186 3079 3038 1279 870 836 630 584 1499 --1376
NM_032968chrX114158 4118 4000 3980 3647 3218 1639 1025 942 701 243 41052 553 109 97 --13862
NM_032969chrX114158 4118 4000 3980 3647 3218 1639 1025 942 701 243 41052 553 109 97 --13862
NM_032973chrY104150 4110 3992 3972 3639 3213 1025 942 701 243 41052 553 109 97 --13854
NM_033020chr194368 4252 3887 3181 3154 1780 1638 1344 240 34743 1297 982 33876 3331 1300 1353
NM_033224chr7127670 7293 6775 5729 4887 2737 2243 2005 1511 1357 1343 752 57899 7576 7438 3047 1365 38112 7010 993 --
NM_033430chr4103698 3625 3508 3027 2565 1646 1376 1144 801 463 13793 12825 11300
NM_033437chr4103698 3625 3508 3027 2565 1646 1376 1144 801 463 13793 12825 11300
NM_033505chr276758 5710 5578 4251 2179 2106 1952 35003 50 36 25665 4914 --
NM_033656chr21135106 4643 4588 4551 4407 4109 4001 1634 1360 1262 1191 676 539 36004 4293 3982 15385 11791
NM_052879chr1273212 1646 1614 1576 1525 1307 1153 --53691 1640 1548 612 579 11356
NM_052937chr842691 2638 2323 629 21068 915 42330 2056 876 674 22385 164
NM_053016chr9136306 5623 5539 5331 4920 2832 2577 2550 2385 2286 1735 1379 848 17796 37731 1594 249 16949
NM_058241chr282316 2087 2072 1444 940 372 166 124 52174 2107 1585 542 516 ----
NM_058241chr282316 2087 2072 1444 940 372 166 124 52174 2107 1585 542 516 ----
NM_080867chr14105059 5003 4632 4306 4243 3952 3356 1875 1293 495 11355 --14072
NM_130438chr2173404 3280 2646 2640 2129 1190 929 --12064 12788
NM_133170chr20138041 7993 7549 7349 7278 6891 6536 5666 5380 5181 5108 1719 66 17941 27106 5689 24902 3172
NM_133445chr993703 3351 3105 2892 2393 2341 1300 632 234 32999 1284 258 22494 2325 --
NM_133493chr674335 3791 3658 3537 3379 880 548 13177 33962 3678 1469 23981 503
NM_133496chr1104566 4434 4272 3816 2844 1804 1755 856 369 124 13840 24038 1579 --
NM_138444chr13104564 4443 4074 3935 3769 3120 1715 1621 663 638 11537 23261 1131 --
NM_138468chr2104826 4578 4439 4383 4351 2039 1787 529 417 148 24094 113 --14606
NM_138713chr16177796 7740 7316 7118 6918 6863 6441 6248 5429 5350 5213 2756 2091 553 497 432 117 17093 ----
NM_138714chr16177796 7740 7316 7118 6918 6863 6441 6248 5429 5350 5213 2756 2091 553 497 432 117 17093 ----
NM_138731chr1473980 3595 3136 2641 1184 1150 945 11679 --1385
NM_139321chr2053905 3258 1658 833 378 14036 14261 24225 4047
NM_144571chr4105012 4813 4668 4391 4262 2069 1501 1277 77 58 11903 55575 4339 2543 1890 1695 1758
NM_144578chr14154998 4554 4186 4135 4097 3754 3584 1727 1489 1421 1287 1088 994 704 599 11214 1206 --
NM_144599chr15124412 4394 4044 3523 1973 1914 1838 1797 1778 1087 1046 76 25473 4430 21784 428 1578
NM_144664chr1192489 2394 2135 824 663 630 537 85 39 12439 --11660
NM_144973chr1295045 5032 4992 4225 4219 1843 1313 805 364 34428 374 225 24571 1288 13614
NM_145207chr484451 3614 1627 1089 877 465 173 122 1166 --13578
NM_145259chr296707 5436 4314 1558 1530 1506 1343 543 66 27001 2374 11512 --
NM_145307chr1074639 3967 1630 1481 917 700 195 43015 2914 865 94 24187 3428 1290
NM_145756chr1831279 1083 455 21421 1323 21545 1077 21644 1134
NM_147128chr72546 168 --11341 31463 1418 1154
NM_152581chrX2250 221 1324 --1228
NM_152624chr5187179 6406 5858 5784 5767 5523 5111 5088 4716 2844 2594 1783 1767 692 544 174 148 22 27326 847 56896 6759 6742 6600 5028 --
NM_152641chr1221867 1068 72694 2656 2389 792 740 629 619 22207 165 --
NM_152737chr61167 --11878 21782 1640
NM_152754chr753550 2840 2413 1069 254 1295 13510 11209
NM_152756chr593906 3566 3463 3395 3312 2895 2836 1282 1016 23736 393 22682 1620 12743
NM_152774chr762502 721 614 523 494 179 4954 789 743 630 21914 1875 --
NM_152793chr7175104 5053 5038 4403 4014 3935 3243 1895 1856 1830 1673 1641 1552 1519 897 640 448 --34817 4587 3162 --
NM_152835chr192743 2614 2536 2318 2086 1883 673 438 212 1431 22657 2188 --
NM_152838chr20123288 3125 2971 2862 2670 1266 1069 603 445 347 199 29 ------
NM_152999chr7104641 4618 4542 3867 3761 1903 1813 1536 1378 425 13073 13966 13650
NM_153042chr651642 1314 542 266 107 --11572 21782 1287
NM_153182chr373180 3050 2982 966 939 849 838 --12953 13329
NM_153188chr5125672 5248 4422 4154 2058 1695 1555 1289 581 486 442 112 44670 3791 3461 1633 14609 --
NM_153207chr1273160 1464 1141 604 279 180 172 11092 13563 13188
NM_153262chr183070 3046 2641 2155 2142 1998 1207 192 --13194 1908
NM_153607chr5153162 3148 3136 2774 2762 2308 2211 1224 1056 956 577 307 299 148 61 1769 22516 246 11150
NM_170710chr44953 678 647 496 11199 21188 140 2549 384
NM_170731chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_170732chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_170733chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_170734chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_170735chr11112714 2253 1980 1847 1080 1068 953 811 612 318 74 22835 2682 12685 2715 419
NM_172070chr251940 1879 1695 526 508 1632 11955 21737 660
NM_172071chr1137405 6908 6652 6565 5397 5305 4632 4534 2529 2154 1410 1187 263 37436 6965 5885 26271 5194 --
NM_173214chr16177796 7740 7316 7118 6918 6863 6441 6248 5429 5350 5213 2756 2091 553 497 432 117 17093 ----
NM_173468chr4154701 2361 2308 2289 2194 2094 2032 1993 1797 1746 1647 1603 850 760 215 35987 4984 2120 21366 1167 --
NM_173642chr1148918 8378 7988 7668 6784 6371 5797 3638 2805 2643 2630 2165 567 311 --43406 2611 1178 985 164
NM_173698chrX82062 1496 1303 660 628 235 101 52 1420 --1213
NM_173808chr1104007 3851 3630 3234 2844 1765 1433 1314 690 598 34240 3688 153 --2855 360
NM_173829chr5155559 4953 4773 3805 2389 2026 2006 1976 1913 1521 1434 1421 1075 595 485 16015 32204 1294 726 25548 1212
NM_175056chr371738 1537 755 619 336 240 154 21943 1796 11763 1223
NM_175623chr1286582 5402 2993 2563 1758 1405 1067 711 17183 22950 222 17054
NM_175624chr1286677 5497 3088 2658 1853 1500 1162 806 17278 23045 317 17149
NM_175625chr1286677 5497 3088 2658 1853 1500 1162 806 17278 23045 317 17149
NM_177438chr1494065 3842 2795 1655 1529 673 609 568 402 24036 3871 24245 4013 --
NM_177538chr2108479 7476 6566 6282 5970 3456 3001 2956 1781 133 12574 18872 28859 1185
NM_178151chrX117198 7066 6681 6552 5960 5102 3075 2872 2236 1476 760 27031 5416 26899 694 --
NM_178152chrX117198 7066 6681 6552 5960 5102 3075 2872 2236 1476 760 27031 5416 26899 694 --
NM_178153chrX117198 7066 6681 6552 5960 5102 3075 2872 2236 1476 760 27031 5416 26899 694 --
NM_178498chr1193679 3045 2819 1300 1145 1129 1121 1101 846 1484 24083 3093 190
NM_178509chr17104090 3052 2788 2617 1516 1265 1199 980 440 93 13126 --12781
NM_178566chr981754 1465 1234 1176 636 534 449 344 21879 1554 21719 1587 --
NM_181265chr44953 678 647 496 11199 21188 140 2549 384
NM_181521chr16116675 6114 5006 4833 4729 2284 2038 1185 1165 778 117 12435 14537 --
NM_181705chr585685 5372 4603 4356 4253 2108 1659 704 11779 25303 257 25051 954
NM_181861chr1252213 2180 1795 752 272 1247 11857 22081 1950
NM_181868chr1252213 2180 1795 752 272 1247 11857 22081 1950
NM_181869chr1252298 2265 1880 837 357 1332 11942 22166 2035
NM_182485chr4103573 3227 3121 2479 2430 1285 1274 1095 624 417 ------
NM_182515chr19115767 5398 5210 4998 4442 2383 2103 2066 1354 1101 1071 11395 21384 1276 11597
NM_182646chr4103573 3227 3121 2479 2430 1285 1274 1095 624 417 ------
NM_182757chr6103439 3365 2447 2242 2140 1126 1113 1077 726 664 1916 ----
NM_182898chr785973 5295 4344 2563 2140 1782 902 388 26398 700 26238 5375 --
NM_182899chr785973 5295 4344 2563 2140 1782 902 388 26398 700 26238 5375 --
NM_182975chr191136 1108 929 910 792 779 397 252 232 11046 11025 --
NM_194247chr2114075 4008 3875 3419 3079 3015 2999 2765 691 477 336 14520 --24545 4270
NM_194314chr195388 5069 4215 2244 1621 1513 1378 1309 789 14099 25349 4537 14560
NM_194434chr1845166 1417 466 328 35712 4627 1814 24463 1320 15031
NM_198270chrX53422 3061 1157 643 155 43295 584 483 455 --11135
NM_198400chr1542112 1022 726 481 --2938 311 12864
NM_198465chrX142674 2649 2617 2280 2233 2078 2065 2012 1960 1952 1157 319 255 103 ------
NM_198569chr662663 2154 1772 1732 471 78 --21927 1781 11747
NM_198581chr296747 6591 1592 1521 1397 660 565 478 235 1254 57337 5805 2901 2407 1842 16091
NM_198859chr3124737 4380 4281 3168 1503 899 824 737 427 416 297 223 --22006 132 1362
NM_199188chr1273212 1646 1614 1576 1525 1307 1153 --53691 1640 1548 612 579 11356
NM_199190chr1273212 1646 1614 1576 1525 1307 1153 --53691 1640 1548 612 579 11356
NM_199421chr14105059 5003 4632 4306 4243 3952 3356 1875 1293 495 11355 --14072
NM_203390chr851891 1459 310 153 53 2140 125 11288 21858 1692
NM_203504chr4112548 2369 2359 2227 1819 1766 1040 843 557 308 266 11635 ----
NM_203505chr4112548 2369 2359 2227 1819 1766 1040 843 557 308 266 11635 ----
NM_206594chr193546 3459 3417 2965 2797 2656 2472 2455 620 ----12900
NM_206595chr193546 3459 3417 2965 2797 2656 2472 2455 620 ----12900
NM_206853chr693517 3345 2815 1507 1229 711 517 457 140 24132 1554 1652 1444
NM_206854chr6134778 4606 4076 3388 3335 1972 1778 1718 1401 997 878 795 285 25393 927 11913 11705
NM_206855chr6135743 5571 5041 4353 4300 3982 2366 1962 1843 1760 1250 390 209 26358 1892 ----
NM_206876chr283404 3362 2805 1332 1230 1130 463 135 --23215 2563 22479 678
NM_206909chr8148398 8366 8246 7542 7348 6699 6177 5850 5402 3146 1854 1725 1386 496 25535 77 48171 6339 1611 409 --
NM_207012chr1082614 2603 2343 862 845 768 722 290 --12430 23491 678
NM_207361chr13115796 5434 5382 5356 4857 2521 1440 1243 373 78 34 11630 26024 5254 --
NM_212558chr9103932 3797 3386 3350 2921 2889 1121 1057 1048 633 32643 1703 156 ----
NM_213589chr2125547 5503 5255 4961 4734 4497 3669 2086 1782 1664 1429 71 25148 1686 24606 1985 1690