TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4699-5p
miRNA Sequence: AGAAGAUUGCAGAGUAAGUUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521248 1145 ------
NM_000021chr144918 826 765 76 --1141 --
NM_000024chr51367 ------
NM_000038chr562028 2005 1639 1322 723 97 1168 11579 --
NM_000046chr563175 3096 2832 2529 2397 2026 --12931 --
NM_000051chr1173506 3414 2722 2331 1077 726 691 22952 1052 --12445
NM_000052chrX143246 3202 3113 3095 2663 2538 2526 1373 1029 757 707 622 609 158 ----21172 923
NM_000055chr32364 33 2339 144 ----
NM_000081chr151638 713 643 479 280 ------
NM_000084chrX106702 5872 5198 5113 4790 4777 1424 591 497 85 26962 1965 32044 746 174 --
NM_000088chr1721049 179 ------
NM_000089chr72612 218 1698 1659 --
NM_000092chr2104399 3112 1776 1735 1610 1468 1337 1297 1267 1219 33328 1186 461 13629 --
NM_000093chr942263 2123 1896 939 --1891 --
NM_000097chr331219 464 437 1402 1108 --
NM_000104chr2103118 2775 2143 2033 1241 1181 1098 709 43 25 11152 22916 2709 --
NM_000108chr731708 1320 340 21857 268 ----
NM_000109chrX42280 2018 1790 316 12600 12292 12059
NM_000112chr5185257 5188 4757 4713 4627 3834 3502 3431 1942 1933 1770 1624 1279 884 671 516 101 85 ------
NM_000115chr13102311 2035 1970 1939 1885 1874 868 442 237 30 11903 1889 --
NM_000125chr693767 3637 3281 3146 2647 897 759 180 173 --24270 219 --
NM_000129chr651433 575 534 505 49 ------
NM_000138chr1562288 2259 2244 2139 1896 64 --21623 101 1434
NM_000139chr1142640 2491 2207 632 22444 2393 ----
NM_000141chr1051447 1400 1223 1105 317 11156 1181 1554
NM_000142chr4--11171 ----
NM_000151chr1791911 1847 1556 1539 1438 1208 485 341 330 --1586 --
NM_000161chr1431938 1866 1829 21688 89 ----
NM_000163chr592395 2083 1990 1671 1567 904 795 407 280 ------
NM_000165chr661352 1271 1184 1091 618 83 ------
NM_000167chrX51774 1757 1404 692 657 1500 2467 336 --
NM_000173chr173458 409 387 1141 ----
NM_000176chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_000189chr292405 2396 2186 2055 2043 1898 913 804 751 1781 12270 --
NM_000192chr1241379 1285 342 185 --1453 --
NM_000196chr161536 ------
NM_000202chrX173969 3912 3881 3836 3295 3202 3113 2989 2839 2520 2437 1434 1374 1239 641 572 183 23170 3072 32611 1250 1154 --
NM_000208chr1964509 3772 3129 1852 1023 42 --24117 891 --
NM_000212chr1732466 2383 1735 ----22340 1659
NM_000214chr2061508 1484 1457 1381 1132 336 ------
NM_000217chr12135381 5314 4364 4319 4183 4105 3889 2119 1919 1177 432 250 214 45204 4776 4292 3713 11263 --
NM_000222chr431884 1416 69 ------
NM_000223chr171122 ------
NM_000232chr483091 2977 2964 2931 2453 2307 2272 684 1672 23101 153 22609 202
NM_000245chr751542 1421 806 665 275 11621 ----
NM_000248chr352453 677 525 159 110 --193 --
NM_000251chr21247 ------
NM_000252chrX71368 1350 1272 1104 1039 377 123 --1614 --
NM_000259chr15166190 6067 6056 5760 5695 5671 5438 5284 4564 2482 2153 1760 1643 1552 1488 651 3992 302 202 22472 904 --
NM_000264chr9102989 2669 2562 2430 2310 2274 1262 744 524 332 ------
NM_000266chrX4981 935 698 250 1235 ----
NM_000267chr1763454 3025 2747 795 788 781 13434 21120 486 32470 1297 966
NM_000268chr2273736 3450 2935 2327 783 252 229 13658 11081 --
NM_000278chr1012314 ------
NM_000280chr112686 640 1771 --1219
NM_000282chr13------1177
NM_000284chrX31710 554 482 ------
NM_000291chrX2215 55 1168 ----
NM_000293chr162732 641 --1322 --
NM_000297chr452008 1962 1871 643 109 11622 31360 289 130 1241
NM_000304chr1721080 751 ------
NM_000314chr1072858 2578 1261 1215 536 339 141 ----11101
NM_000317chr113390 333 299 ------
NM_000321chr13101817 1767 1650 1456 1106 721 613 550 453 212 1111 ----
NM_000328chrX5391 354 332 316 94 ------
NM_000329chr13808 127 81 ------
NM_000330chrX31939 1463 137 --31520 279 247 --
NM_000332chr6137038 6985 6831 5799 5583 5099 5052 5021 2866 2687 2052 107 99 56333 5545 2011 1872 1114 46126 2427 1770 983 16616
NM_000337chr5136619 6498 6464 6164 6108 6088 4678 4399 2645 2520 668 408 271 14155 --36421 2289 379
NM_000343chr221101 ------
NM_000345chr421000 699 --1125 --
NM_000362chr2253564 2834 2575 2503 1044 ------
NM_000367chr652351 2206 848 536 89 32261 2112 123 ----
NM_000368chr944771 1521 1481 1418 --23081 347 --
NM_000369chr1421212 760 11436 11930 --
NM_000378chr1151203 500 373 276 109 1810 ----
NM_000379chr271269 1192 1184 1065 523 480 246 --125 --
NM_000390chrX102807 2701 1373 1081 412 406 388 347 328 145 1368 23301 934 12765
NM_000393chr271932 1446 737 712 683 618 577 ------
NM_000399chr101985 --1749 --
NM_000405chr531574 1294 501 --11778 1344
NM_000406chr483092 2062 1148 1040 871 852 677 202 ----2180 151
NM_000408chr263376 2369 1124 1000 962 525 1237 ----
NM_000411chr2162963 2319 2299 1288 331 108 12332 180 --
NM_000414chr51254 2240 121 ----
NM_000426chr61162 ------
NM_000430chr1783773 3657 3430 3000 1429 1269 756 552 --2509 468 --
NM_000436chr5--31560 1533 267 ----
NM_000439chr5112342 2295 2282 2211 2073 1638 865 598 511 445 219 --22044 630 11753
NM_000441chr742156 1963 937 876 21576 677 1695 --
NM_000444chrX--1116 ----
NM_000451chrX62001 1829 1767 1431 439 312 ------
NM_000452chr1371962 1650 1565 1343 728 471 431 21393 318 ----
NM_000461chr363952 3766 3750 3670 3496 913 --1987 33855 720 480
NM_000462chr1551580 599 537 91 66 1730 11300 --
NM_000474chr72664 132 ------
NM_000484chr211924 21069 754 2954 783 --
NM_000489chrX73063 1313 776 628 569 303 47 33417 2661 722 3791 205 122 --
NM_000492chr741212 1113 1098 273 ------
NM_000493chr66817 801 218 111 104 26 ------
NM_000495chrX21051 724 ------
NM_000503chr891868 1854 1747 1501 1317 1242 729 643 134 1326 21556 416 --
NM_000508chr45967 668 164 118 34 2899 201 ----
NM_000510chr1171447 1388 1367 1319 1209 277 237 1421 31053 379 287 --
NM_000533chrX71929 1497 1378 1226 747 581 143 ----1299
NM_000538chr1341782 332 213 115 --1176 11696
NM_000544chr6_cox_hap1113363 3302 3122 2933 2743 2704 2472 2115 1289 1233 277 23345 1257 --1942
NM_000550chr96998 985 921 885 259 81 --21017 176 1196
NM_000555chrX177884 6659 6190 6061 5346 5263 5231 4970 2614 2599 2546 2404 2354 1870 1395 324 162 56753 5886 5854 5827 5641 21325 339 12385
NM_000573chr1101782 1423 896 819 718 567 485 474 98 41 12172 12303 11740
NM_000582chr41397 --2418 357 --
NM_000597chr22278 99 ------
NM_000598chr721505 197 1555 1236 --
NM_000599chr264595 4531 3891 3187 1694 1319 ----14364
NM_000602chr7178 11505 ----
NM_000609chr1032638 2042 1238 1145 23137 2207 --
NM_000610chr1152604 2515 1849 619 506 42415 2148 694 484 32535 128 111 22295 797
NM_000614chr1141111 871 811 115 1168 ----
NM_000615chr1162993 2589 2547 2086 1957 977 12781 12577 --
NM_000618chr12186595 6222 6111 5661 5623 5458 5211 4979 4613 4435 4023 2207 2171 1905 1163 473 358 227 34712 2320 1595 14676 --
NM_000618chr12186595 6222 6111 5661 5623 5458 5211 4979 4613 4435 4023 2207 2171 1905 1163 473 358 227 34712 2320 1595 14676 --
NM_000619chr12130 ------
NM_000627chr24951 902 889 749 1609 --1368
NM_000633chr1874456 4398 4037 3964 3841 3434 1659 35028 3943 1638 --1178
NM_000635chr19------1386
NM_000651chr1101782 1423 896 819 718 567 485 474 98 41 12172 12303 11740
NM_000663chr1672992 2857 2811 2139 1172 320 188 ------
NM_000683chr41509 --1448 --
NM_000685chr34881 682 277 31 ------
NM_000685chr34881 682 277 31 ------
NM_000686chrX51588 1560 1293 996 380 11503 2116 105 --
NM_000688chr3197 ------
NM_000693chr1521641 1128 ----11506
NM_000702chr121991 1868 12184 --12150
NM_000706chr122782 725 3909 316 149 ----
NM_000719chr1256485 5544 5029 1916 1380 1113 12161 11992
NM_000724chr1071372 1264 651 530 490 76 43 --11298 --
NM_000761chr1521343 1200 11355 11061 --
NM_000767chr1941311 1095 533 386 --21395 1197 --
NM_000773chr101118 ------
NM_000787chr91573 ------
NM_000788chr471136 1002 924 524 329 148 59 11036 ----
NM_000801chr205806 764 427 413 293 ------
NM_000806chr531769 753 446 1124 ----
NM_000809chr4339321 9157 8853 8573 8405 8112 7826 7800 7664 7550 7419 7123 7029 6922 6756 6571 6440 6259 6139 5608 3222 2964 2775 2719 2585 2258 1526 1466 1222 625 577 439 112 26846 6147 27410 467 --
NM_000813chr5155545 5400 4934 4750 4134 2053 2030 1629 1366 1256 1097 1082 691 467 368 15451 24309 1693 --
NM_000814chr1574140 3800 3767 3067 1470 1093 953 13516 23008 466 --
NM_000817chr221070 814 ------
NM_000824chr42822 151 1758 --192
NM_000826chr492524 2442 1847 1024 996 879 741 413 337 22108 571 ----
NM_000827chr532444 927 375 --11708 --
NM_000829chr1142091 1801 1739 732 1371 ----
NM_000831chr166298 6230 2282 1461 971 203 --1552 --
NM_000833chr1631557 1121 185 --2378 170 --
NM_000838chr642794 2768 1967 1765 21873 592 --22057 1736
NM_000840chr71453 ------
NM_000842chr113650 252 200 --1188 --
NM_000844chr331001 848 733 --1376 --
NM_000857chr42486 101 ------
NM_000859chr521333 1327 ------
NM_000860chr481682 1588 1543 1488 474 456 218 145 31348 254 65 11209 --
NM_000864chr1101160 1103 1090 804 399 263 231 115 80 30 1982 ----
NM_000868chrX52511 2349 945 549 68 --156 --
NM_000872chr1021625 1297 ------
NM_000875chr15116774 6747 6362 5955 5684 5535 1295 1127 587 509 496 35941 4916 116 ----
NM_000876chr62888 93 ------
NM_000877chr2103086 3020 3001 2880 2761 2639 2407 834 789 210 12033 12183 23100 1944
NM_000879chr5------197
NM_000880chr81842 1872 ----
NM_000891chr17103598 3528 3007 2745 2438 912 691 470 451 379 22492 1111 23630 2366 --
NM_000899chr1284415 3785 3663 3321 3109 2682 1318 460 1122 34048 3504 1450 --
NM_000901chr492425 1848 1731 886 867 759 694 684 563 32512 2071 298 11794 1792
NM_000902chr363192 2985 2418 2342 1274 748 --23079 673 --
NM_000908chr52736 108 ------
NM_000910chr421479 276 ------
NM_000912chr873344 3129 2391 2192 1282 777 702 --13430 --
NM_000919chr5--1607 1542 --
NM_000922chr1131034 739 714 1983 ----
NM_000926chr11248760 8227 8138 7875 7036 6291 6186 5972 5726 3225 2719 2396 1997 1971 1886 1293 905 863 606 451 350 215 164 33 69409 9262 5916 2596 1411 503 98923 6902 2531 2321 1427 1136 1125 1053 1025 18854
NM_000933chr2041738 1087 478 468 21552 1114 11804 --
NM_000935chr351272 1230 1019 916 340 ------
NM_000937chr171429 ------
NM_000941chr71333 ------
NM_000944chr4112313 1770 1710 1602 805 760 722 695 623 545 261 22045 1917 ----
NM_000945chr271810 1630 1383 1307 522 290 127 12059 ----
NM_000949chr55959 952 775 623 585 ------
NM_000950chrX43270 2416 963 139 22959 1178 11033 22531 931
NM_000953chr1461754 1504 1492 698 262 234 3206 140 47 ----
NM_000958chr55945 902 892 477 437 1844 ----
NM_000959chr193906 3865 3706 3217 3040 3001 745 718 253 --33205 1352 1164 23695 691
NM_000962chr952757 2081 495 379 93 ------
NM_000964chr171528 1327 --1559
NM_000965chr341163 811 253 201 ------
NM_000983chr131616 401 23 ------
NM_000990chr11103944 3937 3758 1357 1327 865 739 595 438 274 33669 2712 605 13457 --
NM_001001132chr21--11398 11001 --
NM_001001323chr1282821 2733 2315 2285 1257 1106 1097 885 1838 32845 2122 2103 12970
NM_001001330chr103971 479 58 1891 1828 --
NM_001001342chr1061296 1094 534 352 321 28 --1558 --
NM_001001389chr1152604 2515 1849 619 506 42415 2148 694 484 32535 128 111 22295 797
NM_001001390chr1152604 2515 1849 619 506 42415 2148 694 484 32535 128 111 22295 797
NM_001001391chr1152604 2515 1849 619 506 42415 2148 694 484 32535 128 111 22295 797
NM_001001392chr1152650 2561 1895 665 552 42461 2194 740 530 32581 174 157 22341 843
NM_001001395chr1242163 2149 863 52 22405 637 11128 11873
NM_001001396chr184079 3410 3301 2784 1534 859 763 330 12733 33108 3068 289 --
NM_001001419chr5164993 4787 4640 4472 4394 4301 3758 3213 2006 1892 685 654 402 299 259 50 --24772 841 11700
NM_001001420chr5164993 4787 4640 4472 4394 4301 3758 3213 2006 1892 685 654 402 299 259 50 --24772 841 11700
NM_001001433chr2083233 2824 1976 724 710 495 481 394 11993 1407 --
NM_001001481chr873464 3357 3163 3078 2904 983 71 1649 11063 --
NM_001001483chr113447 354 165 1302 ----
NM_001001484chr1062298 2099 1512 617 565 484 --32417 1952 1641 --
NM_001001549chr792567 2388 2148 2138 1812 1788 1144 1059 349 --11745 --
NM_001001550chr792567 2388 2148 2138 1812 1788 1144 1059 349 --11745 --
NM_001001555chr792567 2388 2148 2138 1812 1788 1144 1059 349 --11745 --
NM_001001556chr1541594 1514 554 235 21455 135 182 --
NM_001001557chr842059 2037 1596 1447 1214 ----
NM_001001567chr211174 ------
NM_001001568chr211174 ------
NM_001001571chr211174 ------
NM_001001572chr211174 ------
NM_001001573chr211174 ------
NM_001001574chr211174 ------
NM_001001575chr211174 ------
NM_001001576chr211174 ------
NM_001001577chr211174 ------
NM_001001579chr211174 ------
NM_001001580chr211174 ------
NM_001001581chr211174 ------
NM_001001582chr211174 ------
NM_001001584chr211174 ------
NM_001001585chr211174 ------
NM_001001660chr122246 187 ------
NM_001001664chr2143885 3839 3785 3705 3345 3325 2787 1342 1057 947 730 390 359 255 23992 221 --13127
NM_001001668chr1954259 3899 3179 1306 200 --13491 --
NM_001001787chr12481 173 ----1358
NM_001001870chr172766 678 --1828 1797
NM_001001890chr21113725 3578 3421 2837 1602 1465 1174 858 806 494 426 14048 11073 --
NM_001001924chr861922 1848 1678 839 806 691 ------
NM_001001925chr861922 1848 1678 839 806 691 ------
NM_001001928chr22128376 8205 8197 8184 8120 3180 1652 1507 1234 573 361 160 55851 5525 2615 1740 1329 11388 --
NM_001001931chr861922 1848 1678 839 806 691 ------
NM_001001933chr12618 90 ------
NM_001001971chr1041364 1126 1091 56 11057 ----
NM_001001974chr1092297 1986 1940 1634 1537 1510 750 733 545 12357 ----
NM_001001994chrX2481 91 ------
NM_001001995chrX61784 1756 1740 1686 1650 692 --1175 1733
NM_001001996chrX2481 91 ------
NM_001002009chr71203 1133 ----
NM_001002010chr71203 1133 ----
NM_001002026chr362420 627 558 443 428 132 31969 586 232 ----
NM_001002233chr841852 1766 1584 511 --1181 --
NM_001002257chr283444 2849 1358 1091 1032 691 170 145 11249 11216 13427
NM_001002258chr252022 1953 1901 776 277 --1609 --
NM_001002269chr93488 159 102 ------
NM_001002295chr103835 819 780 ------
NM_001002838chrX71783 1425 1370 752 647 481 99 2493 49 ----
NM_001002843chr1521221 843 ----1370
NM_001002860chr1474414 3858 1344 549 446 314 291 33599 1327 377 34047 3317 3187 --
NM_001002906chrY--1425 ----
NM_001002909chr1792131 2060 1751 1414 746 508 498 368 357 --11487 --
NM_001002926chr772820 2202 1818 950 632 595 452 ----1535
NM_001003652chr18228588 7553 6841 6673 6552 6366 6276 6107 5698 5676 5331 3163 2878 2538 2363 1791 1731 1679 1289 695 545 526 46985 1633 979 504 35638 5367 2939 11562
NM_001003674chr18136839 6746 6084 6032 5972 5290 5191 5086 4684 2747 2645 2173 1555 26244 5958 ----
NM_001003675chr18136839 6746 6084 6032 5972 5290 5191 5086 4684 2747 2645 2173 1555 26244 5958 ----
NM_001003679chr152099 2069 1612 1588 1515 ----1232
NM_001003681chr2262117 1721 365 225 190 108 --11527 1752
NM_001003688chr441117 1091 1007 760 --21132 436 21207 997
NM_001003690chr63413 343 45 ------
NM_001003712chr12174079 4022 3753 3685 3643 3076 2934 2503 2456 1268 1193 1103 537 408 385 318 152 1160 13297 --
NM_001003790chr82270 181 --1287 1679
NM_001003791chr82270 181 --1287 1679
NM_001003800chr943133 2567 295 88 23677 2855 22523 1219 --
NM_001003810chr44617 278 113 49 ------
NM_001003937chr241570 1529 1489 1419 11650 ----
NM_001004019chr31113 ------
NM_001004065chr963980 3777 3752 3029 2952 484 1773 ----
NM_001004127chr131777 ------
NM_001004196chr321092 764 11189 --11059
NM_001004303chr13686 203 98 ------
NM_001004303chr13686 203 98 ------
NM_001004317chr673971 3669 3307 2918 1265 618 129 --33800 1347 926 13363
NM_001004342chr1126080 5959 4760 4675 4284 4050 1430 960 938 526 503 150 14062 15788 14132
NM_001004356chr411478 ------
NM_001004358chr411478 ------
NM_001004360chr261814 1700 1430 1409 394 349 2694 621 ----
NM_001004419chr1274251 3805 3462 3422 3310 637 543 24298 713 11463 23634 103
NM_001004720chr23949 877 781 ------
NM_001004722chr231118 1046 950 1122 ----
NM_001005207chr171238 ------
NM_001005266chr151482 2732 463 ----
NM_001005267chr151482 2732 463 ----
NM_001005268chr151482 2732 463 ----
NM_001005269chr151482 2732 463 ----
NM_001005366chr121628 --1384 --
NM_001005375chrY91733 1508 1201 1174 701 622 565 447 176 ----11483
NM_001005386chr292344 2261 2078 1894 1740 1725 604 326 163 1293 162 --
NM_001005404chr1794286 4030 3426 3217 3160 1151 1073 750 146 24424 3096 ----
NM_001005463chr1021941 953 41029 592 237 99 ----
NM_001005473chr5156670 6581 6279 5423 4658 4222 2580 2509 2471 2325 2299 2151 530 275 81 76291 5930 5608 4776 1633 1281 1124 44920 4872 4088 4080 --
NM_001005474chr361470 1235 1182 1002 642 506 ------
NM_001005476chr21706 ------
NM_001005502chr12114979 4782 4556 4292 3239 3196 381 265 254 194 116 --12028 --
NM_001005527chr341311 1148 902 887 ----1286
NM_001005732chr212612 172 1164 ----
NM_001005733chr212569 172 1164 ----
NM_001005739chr21546 ------
NM_001005753chr242303 2024 345 335 ------
NM_001005781chr22420 138 ----1170
NM_001005782chr21869 1274 ----
NM_001005845chr871778 1754 1550 1534 1499 626 32 31390 418 78 1755 21804 1244
NM_001005849chr172464 424 ------
NM_001005861chr35942 246 232 184 111 2955 700 ----
NM_001006118chrY------1253
NM_001006120chrY------1253
NM_001006600chr5132486 2443 2319 2178 2033 1832 1798 1572 921 821 787 769 567 32216 2080 1854 ----
NM_001006605chr121043 56 2962 828 ----
NM_001006605chr121043 56 2962 828 ----
NM_001006612chrX1401 ------
NM_001006613chrX1401 ------
NM_001006614chrX1401 ------
NM_001006635chr24325 221 82 26 ------
NM_001006636chr231035 814 715 ------
NM_001006641chr91281 11148 --11664
NM_001006642chr91281 11148 --11664
NM_001006643chr91281 11148 --11664
NM_001006657chr2123237 2737 2647 2599 2070 1194 497 404 344 302 162 131 2512 201 12455 --
NM_001006684chrX5393 166 106 69 57 ------
NM_001006946chr221537 1242 ------
NM_001007024chr1774378 4353 4332 4017 3435 3265 3135 --23911 3836 --
NM_001007025chr1774378 4353 4332 4017 3435 3265 3135 --23911 3836 --
NM_001007033chr123690 339 46 --3861 701 173 --
NM_001007067chr82921 145 1401 ----
NM_001007068chr82921 145 1401 ----
NM_001007069chr82921 145 1401 ----
NM_001007070chr82921 145 1401 ----
NM_001007072chr152232 89 ------
NM_001007088chrX154 ------
NM_001007097chr985030 4998 4987 1954 1905 1890 1603 487 34566 4552 3258 ----
NM_001007098chr11819 --160 1636
NM_001007099chr11795 --1758 --
NM_001007100chr11795 --1758 --
NM_001007102chr641678 486 244 213 1668 1254 --
NM_001007156chr1551973 1881 1866 625 305 1260 ----
NM_001007189chr51109 ------
NM_001007226chr1731058 915 488 ------
NM_001007227chr1731058 915 488 ------
NM_001007228chr1731058 915 488 ------
NM_001007229chr1731058 915 488 ------
NM_001007230chr1731058 915 488 ------
NM_001007245chr72437 26 ------
NM_001007246chr2161680 1485 1392 477 402 146 11589 21887 273 11511
NM_001007267chr2--2667 229 1769 --
NM_001007277chr1141085 769 374 270 1803 ----
NM_001007464chr6--1105 ----
NM_001007466chr6135215 5123 4782 4627 4602 4557 4528 4509 4028 1596 1323 1104 147 34248 3263 1737 11303 11316
NM_001007526chrY------1253
NM_001007553chr151163 1112 885 498 248 ------
NM_001007559chr1821784 1643 11373 12028 --
NM_001008225chr71210 ------
NM_001008239chr1883796 3421 3405 1170 540 353 282 244 33078 2741 1444 1557 --
NM_001008388chr45929 312 208 103 44 1302 11137 --
NM_001008392chr373016 2878 1343 796 471 464 436 --42735 989 945 514 --
NM_001008393chr4102417 2367 2298 2204 2189 2182 2142 1891 999 128 22162 859 12214 --
NM_001008401chr1951497 1457 1375 1180 1071 --11330 1437
NM_001008408chr765168 5067 4542 2560 1501 466 55779 5727 5191 4859 417 1438 25354 4764
NM_001008491chr242036 496 242 149 1633 ----
NM_001008492chr242036 496 242 149 1633 ----
NM_001008495chr892098 2092 1483 1444 790 435 358 163 137 1656 12075 1542
NM_001008539chr8125409 5265 5098 4550 3874 3576 3530 3468 3450 1768 1533 602 24337 763 11978 --
NM_001008541chr1042311 944 460 242 11534 1274 --
NM_001008541chr1042311 944 460 242 11534 1274 --
NM_001008564chr1331892 1671 169 21729 1717 --11627
NM_001008660chr1131047 565 437 41399 1339 1187 1106 --11513
NM_001008712chr8278 21 ------
NM_001008738chr572689 2622 2595 2518 1967 398 238 21085 648 ----
NM_001008744chr1481408 1377 1365 1354 572 461 328 95 1591 1118 1532
NM_001008801chr1982137 2055 1683 1626 1486 1454 853 520 --12010 --
NM_001008860chr15--2771 248 1112 --
NM_001008892chr15--2771 248 1112 --
NM_001008894chr15--2771 248 1112 --
NM_001008895chr1361305 1166 1133 907 182 145 ----11316
NM_001008925chr483393 3123 3022 2902 2433 677 567 216 23248 483 2798 641 22548 556
NM_001009185chr53525 257 157 --1564 --
NM_001009554chr484283 4260 4158 3170 3085 1609 1500 445 54323 4091 3617 3140 1435 31869 1778 1581 --
NM_001009554chr484283 4260 4158 3170 3085 1609 1500 445 54323 4091 3617 3140 1435 31869 1778 1581 --
NM_001009555chr421663 1649 11700 1134 31723 589 173
NM_001009566chr121222 905 --11045 --
NM_001009567chr102532 62 1179 ----
NM_001009571chr751595 1531 1447 1245 1126 ----1527
NM_001009881chr11155 --1645 --
NM_001009882chr11155 --1645 --
NM_001009894chr12121567 1416 1376 1220 618 469 462 424 332 182 158 39 --21261 131 2576 301
NM_001009899chr3246457 6390 6182 5946 5633 5404 5197 4814 4585 4404 4390 4374 4356 4147 2502 2141 2038 1494 1165 686 614 224 190 130 46065 5727 4786 1024 15543 15863
NM_001009909chr11113843 3193 2898 2546 2444 1544 1537 958 571 441 112 31424 145 45 13695 23086 1274
NM_001009955chr12390 166 ------
NM_001009955chr12390 166 ------
NM_001009958chr71615 ------
NM_001009959chr262235 866 834 780 390 221 1979 41758 1704 896 597 --
NM_001009960chr772117 826 756 551 528 267 240 1287 1706 --
NM_001009993chr274474 4361 1600 1437 881 435 228 --11806 1806
NM_001010000chr18123398 3369 3091 2876 2490 2429 2357 2307 1402 1105 813 784 23108 2949 ----
NM_001010845chr161983 ------
NM_001010846chr1154024 3093 2874 1768 1721 1654 1239 1203 1196 1079 929 446 345 304 202 11410 1114 --
NM_001010853chr6123061 3037 2990 2909 2805 2524 2256 1085 986 674 177 90 13201 ----
NM_001010861chr152662 2467 659 124 115 --12641 1402
NM_001010862chrX133294 2782 2702 2682 2535 2449 2260 2134 2092 2036 523 91 60 13145 --12350
NM_001010867chr1156661 6307 6180 6095 5724 5447 5438 5389 5304 5056 4197 2146 2086 2007 73 45470 4691 4292 1900 16272 --
NM_001010876chr6160 ------
NM_001010888chrX74440 3468 3426 3407 3166 2942 578 23837 1699 11297 24151 2838
NM_001010891chr5236932 6763 6689 6526 6260 6236 6022 5917 5247 5106 4445 4246 2664 2185 2048 1913 1896 1889 1479 1410 1262 1126 1078 34327 1576 756 25772 574 11472
NM_001010895chr9131934 1863 1687 1594 1548 1530 718 666 627 580 251 180 129 ----1536
NM_001010908chr104663 616 604 279 --2636 571 --
NM_001010922chr174176 1706 787 650 484 441 239 34018 1611 811 ----
NM_001010927chr62565 126 ------
NM_001010971chr18852 725 688 675 356 295 242 21 --1326 --
NM_001010984chr192445 2313 2295 2277 2260 1920 1752 799 691 2646 493 22058 987 42173 731 593 88
NM_001010986chrX62512 2475 2320 2153 842 420 ----12182
NM_001011513chr4144065 4031 4016 3485 3132 2711 2601 1611 1091 977 482 400 304 70 33737 2653 449 23160 2973 13680
NM_001011537chr362036 1992 1885 1604 841 625 21589 382 12135 --
NM_001011553chr73723 685 232 2356 257 ----
NM_001011663chr106773 434 388 295 243 227 ------
NM_001011666chr796428 5830 4055 2573 2533 2526 2273 977 337 24174 1654 45041 2243 2094 420 --
NM_001011708chr251951 923 740 576 508 12517 2792 113 --
NM_001011713chr1451287 632 564 372 334 21122 603 21197 472 --
NM_001011720chr891469 1422 1034 1026 470 301 204 186 26 1397 ----
NM_001011722chr11159 ------
NM_001011722chr11159 ------
NM_001011885chr1541525 1413 392 385 --1362 11440
NM_001012267chr951950 1342 541 82 56 21509 429 ----
NM_001012337chr3121 --188 --
NM_001012393chr11115114 5029 4081 3936 3909 2041 1069 886 682 596 459 24265 1058 34775 4106 3656 23826 1643
NM_001012398chr1621110 1052 1803 1956 --
NM_001012418chr6114293 4103 3723 3325 3292 2787 1334 307 299 116 63 --13773 --
NM_001012420chr1572832 2312 2290 2040 580 437 36 --1221 --
NM_001012423chr1572832 2312 2290 2040 580 437 36 --1221 --
NM_001012478chr191413 ------
NM_001012514chr211092 --11140 --
NM_001012516chr211092 --11140 --
NM_001012614chr41540 ------
NM_001012732chr431284 1111 44 11197 1145 --
NM_001012751chr1061781 1682 1650 1638 1536 775 1106 1159 --
NM_001012754chr1352123 1969 1669 1319 147 ------
NM_001012755chrX104384 4210 4166 3843 3565 3361 2004 1349 1140 874 1462 45073 4400 1637 43 --
NM_001012756chr19102986 2929 2636 2502 2400 2235 2083 2006 975 764 --23022 2273 --
NM_001012761chr562612 2357 1787 570 208 49 11094 ----
NM_001012968chrX102499 2183 1820 1111 1099 507 395 161 138 120 32435 2392 405 --12031
NM_001012977chrX31325 244 173 21303 314 ----
NM_001012979chrX--1182 ----
NM_001013398chr721505 197 1555 1236 --
NM_001013406chr731638 1375 511 11493 ----
NM_001013415chr471584 1578 1497 1417 1208 1029 307 ------
NM_001013659chr19135160 4183 3398 3332 2079 1986 1388 1380 1243 572 369 203 36 --34579 3869 3856 --
NM_001013691chr193723 492 262 ------
NM_001013699chr121120 1551 ----
NM_001013703chr152481 409 ------
NM_001013843chr151150 2623 379 ----
NM_001014380chr13165455 5310 5284 4901 4772 4764 4648 4378 4199 2272 2194 1822 824 538 88 66 ----11090
NM_001014797chr10168036 7545 7152 6924 6360 5714 5518 3059 2550 2432 2290 1576 1496 585 435 270 1734 38044 3148 1520 --
NM_001014972chr21209 --186 --
NM_001015045chr452294 2024 1559 985 674 1634 12578 --
NM_001015048chr1441981 612 582 390 13184 ----
NM_001015049chr1441981 612 582 390 13184 ----
NM_001015877chrX62706 2661 2435 2245 1135 899 23048 1106 22508 382 --
NM_001015880chr1081441 1264 660 596 450 349 261 203 --1108 11412
NM_001015881chrX11246 1381 ----
NM_001015882chr95701 689 322 264 196 2410 50 ----
NM_001015887chr331878 1157 338 ----11537
NM_001017365chr1----149 --
NM_001017366chr1----149 --
NM_001017367chr1----149 --
NM_001017368chr17102831 2759 1116 898 861 584 469 305 248 161 --22480 2312 --
NM_001017371chr291153 1070 1020 853 428 402 235 103 82 11185 1411 --
NM_001017395chr3123578 3074 3051 2486 1232 994 690 491 471 253 236 209 33185 3174 1360 11352 --
NM_001017415chr17777 617 575 293 185 171 90 ----180
NM_001017416chr17777 617 575 293 185 171 90 ----180
NM_001017420chr861400 1363 998 946 939 470 --1223 --
NM_001017423chr104709 278 256 159 141 128 --
NM_001017424chr171813 1723 1550 1423 1361 563 414 11511 1467 11689
NM_001017425chr171813 1723 1550 1423 1361 563 414 11511 1467 11689
NM_001017434chr16594 534 517 152 126 119 ------
NM_001017440chr7157985 7957 7609 7556 7164 6249 5841 5211 5027 3174 2858 2647 2129 1612 1167 62293 1201 1156 582 309 209 26107 1091 18062
NM_001017523chr1241918 715 531 473 ------
NM_001017922chr131708 1165 566 ------
NM_001017923chr1451654 570 549 344 188 1128 ----
NM_001017926chr851619 1237 439 296 249 --177 --
NM_001017928chr31244 --1266 --
NM_001017969chr92600 154 ----165
NM_001017977chr12259 90 ----1309
NM_001017979chr41311 ------
NM_001017992chr551403 1177 1103 443 32 1968 --21473 1381
NM_001018004chr151739 ------
NM_001018006chr151739 ------
NM_001018007chr151739 ------
NM_001018020chr151739 ------
NM_001018037chr941101 535 314 295 ------
NM_001018054chr111329 ------
NM_001018056chr92525 504 ------
NM_001018064chr931816 282 67 21869 1835 1259 --
NM_001018065chr9116006 5366 5165 5052 4774 3936 3764 1420 619 571 535 24813 4658 1841 --
NM_001018066chr9116006 5366 5165 5052 4774 3936 3764 1420 619 571 535 24813 4658 1841 --
NM_001018067chr1145381 5325 5149 4623 4310 4129 3506 1722 1674 1410 1399 1089 497 140 53278 2148 1493 721 550 23561 569 2614 246
NM_001018068chr1145381 5325 5149 4623 4310 4129 3506 1722 1674 1410 1399 1089 497 140 53278 2148 1493 721 550 23561 569 2614 246
NM_001018069chr1145381 5325 5149 4623 4310 4129 3506 1722 1674 1410 1399 1089 497 140 53278 2148 1493 721 550 23561 569 2614 246
NM_001018072chr1241918 715 531 473 ------
NM_001018074chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_001018075chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_001018076chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_001018077chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_001018080chr1171447 1388 1367 1319 1209 277 237 1421 31053 379 287 --
NM_001018090chr15102602 2332 2280 2237 2224 1775 1090 557 223 103 12263 11870 --
NM_001018091chr1592712 2442 2390 2347 2334 1885 667 333 213 12373 11980 153
NM_001018100chr151716 ------
NM_001018102chr15102602 2332 2280 2237 2224 1775 1090 557 223 103 12263 11870 --
NM_001018111chr793983 3587 3212 2897 2518 910 709 584 145 11084 13343 --
NM_001020658chr121139 183 11676 11484 --
NM_001020658chr121139 183 11676 11484 --
NM_001023560chr61864 1938 ----
NM_001023567chr1542374 2224 583 36 22466 2085 ----
NM_001023587chr3--11160 1198 --
NM_001024094chr563664 3487 3136 2544 2384 578 33399 2531 1162 21194 381 --
NM_001024218chr145811 724 224 185 155 1329 ----
NM_001024372chr852305 922 890 568 453 ------
NM_001024380chr862366 2025 675 517 106 48 2548 322 1297 2440 403
NM_001024381chr862366 2025 675 517 106 48 2548 322 1297 2440 403
NM_001024463chr15----1152 --
NM_001024649chr5102725 2616 2456 2355 2203 929 512 328 319 283 1847 ----
NM_001024660chr361710 652 551 376 303 291 --1666 --
NM_001024666chrX3575 140 77 --2179 56 --
NM_001024680chr241465 1164 609 176 180 11227 --
NM_001024808chr1262798 2762 2743 1829 1761 307 --1809 --
NM_001024809chr171528 1327 --1559
NM_001024847chr31906 21858 781 ----
NM_001024855chr341737 1693 1682 1491 11921 ----
NM_001024924chr42562 103 ----1513
NM_001024934chr62493 197 ------
NM_001024935chr62493 197 ------
NM_001024936chr62493 197 ------
NM_001024937chr171488 ------
NM_001024947chr51856 ------
NM_001024948chr1103424 3378 3145 2808 1135 998 890 884 755 146 32342 1248 510 23522 1154 33408 2741 689
NM_001024956chr11185563 5506 5265 5155 5144 4955 4670 4517 3914 1929 1680 1330 954 892 590 291 248 203 14405 ----
NM_001025068chr331686 1598 1167 --179 --
NM_001025069chr331686 1598 1167 --179 --
NM_001025072chr382344 2207 1956 1948 1124 918 631 310 21933 885 ----
NM_001025073chr382344 2207 1956 1948 1124 918 631 310 21933 885 ----
NM_001025076chr1056182 5066 3941 1386 824 55962 4931 4675 1833 53 12210 --
NM_001025077chr10107540 6424 5299 5019 4857 2744 2182 876 838 291 47320 6289 6033 1411 ----
NM_001025079chr354129 3560 2524 1355 1308 13372 13900 --
NM_001025105chr531450 326 75 --11388 1399
NM_001025108chr273879 3212 2884 1409 978 945 138 ------
NM_001025201chr21630 ------
NM_001025233chr1282754 2721 2455 1934 1896 750 325 134 12199 ----
NM_001025248chr1551273 905 442 390 286 ------
NM_001025249chr1551273 905 442 390 286 ------
NM_001025252chr851048 980 750 468 356 33010 912 167 ----
NM_001025253chr851048 980 750 468 356 33010 912 167 ----
NM_001025266chr394526 4254 3879 1746 1644 1583 1436 311 92 ------
NM_001025356chr1242569 686 425 253 2525 335 32718 925 825 1578
NM_001025579chr172843 286 --1465 --
NM_001025580chrX31539 279 243 53363 3294 3004 2905 591 11386 --
NM_001025595chr441661 1085 589 134 31309 439 424 1219 --
NM_001025616chr461744 1721 1256 1227 1189 290 21610 1500 21383 1290 --
NM_001025780chr951079 604 598 367 231 --1549 --
NM_001029839chr31562 1517 ----
NM_001029840chr31562 1517 ----
NM_001029858chr682336 2291 2116 2056 1358 1062 869 261 --1831 12816
NM_001029860chr8----184 1237
NM_001029863chr683115 3095 2558 2330 1109 754 581 349 21095 246 1887 12096
NM_001029875chr5112804 2613 2379 2118 1988 1146 1113 866 638 414 232 22818 1943 1551 --
NM_001029884chr682627 2212 1988 1886 620 252 213 100 1231 ----
NM_001029989chr151702 ------
NM_001029991chr142140 31 ------
NM_001030007chr1683921 3804 3155 2920 2621 1604 904 135 33784 817 465 11183 --
NM_001030055chr14234659 4611 4365 4125 3836 3586 3442 3356 3299 3245 3191 3091 3048 1683 1614 1515 1172 828 798 736 318 206 122 53853 3559 1417 885 573 23797 3639 33978 3327 1281
NM_001030287chr13865 207 87 --11140 --
NM_001030288chr1674441 4339 4246 3691 3678 1231 918 --14589 11962
NM_001031623chr681324 1214 1197 631 538 480 348 149 ------
NM_001031677chr51403 ------
NM_001031679chr1283475 3423 2863 2824 2492 1375 654 552 1335 --13519
NM_001031684chr251391 1134 402 362 162 ----1921
NM_001031689chr92158 114 ------
NM_001031695chr2284621 4529 3641 2086 1420 1256 618 459 15315 34893 1480 487 11214
NM_001031709chr101153 146 154 --
NM_001031710chr7--1354 1995 --
NM_001031723chr42458 131 ------
NM_001031725chr1296 87 ------
NM_001031732chr4153623 3591 3385 2888 2817 2752 2451 1252 1242 867 794 785 593 341 44 189 21076 601 1552
NM_001031746chr1051349 1036 354 348 278 21425 90 ----
NM_001031804chr1694187 3579 3563 3262 2784 1718 1158 522 475 ------
NM_001031812chr552261 2176 1689 644 297 193 1408 --
NM_001032279chr111108 ------
NM_001032280chr611704 21251 584 11173 --
NM_001032282chr851181 871 504 486 470 ------
NM_001032283chr122923 663 142 1225 --
NM_001032284chr122923 663 142 1225 --
NM_001032288chr202533 171 --21501 81 159
NM_001032296chr1352702 1002 962 926 258 --1705 2831 160
NM_001032363chr141848 1706 730 176 1737 ----
NM_001032363chr141848 1706 730 176 1737 ----
NM_001032380chr1061858 1827 1723 1613 151 126 11706 1557 1727
NM_001032393chrX3638 279 160 --2775 713 --
NM_001032394chr672746 2562 2524 2005 533 524 287 1627 11019 12234
NM_001032395chr672613 2429 2391 1872 400 391 154 1494 1886 12101
NM_001032999chr2075270 1711 1528 1426 1252 956 668 24180 1274 ----
NM_001033002chr171227 ------
NM_001033045chr284133 3892 3798 3693 3429 1702 1115 862 42843 2826 1656 721 ----
NM_001033047chr442512 2347 837 63 12159 1372 11819
NM_001033057chr351409 833 362 270 149 --21918 326 --
NM_001033059chr631907 1486 441 ------
NM_001033085chr2285 77 1122 138 --
NM_001033087chr2082962 2499 2003 1322 611 548 430 236 32233 938 752 43056 2817 2729 2193 --
NM_001033117chr374240 4050 3652 3017 2994 1842 1076 21399 1062 23042 1913 13130
NM_001033503chr52386 352 ------
NM_001033504chr171606 2593 403 ----
NM_001033506chr112372 114 172 ----
NM_001033518chr752883 1999 622 537 215 21014 181 12479 --
NM_001033519chr752883 1999 622 537 215 21014 181 12479 --
NM_001033520chr752883 1999 622 537 215 21014 181 12479 --
NM_001033557chr251187 1149 1021 403 64 ------
NM_001033559chr154366 349 87 24 ------
NM_001033566chr172888 684 ------
NM_001033568chr172888 684 ------
NM_001033578chr822377 143 --12166 --
NM_001033581chr11296 ------
NM_001033581chr11296 ------
NM_001033582chr11296 ------
NM_001033659chr1721171 27 --21678 1411 --
NM_001033678chr11127 ------
NM_001033723chr862301 1855 1752 944 550 482 1381 2741 471 --
NM_001033910chr122007 1730 51771 740 631 556 433 ----
NM_001033925chr1082005 1917 1828 1732 1334 537 270 163 11325 ----
NM_001034837chr51780 ------
NM_001034838chr51780 ------
NM_001034841chr1685277 4710 4436 4363 4183 3905 1987 1181 23628 189 --1482
NM_001034845chr451277 1196 908 877 51 ------
NM_001034853chrX3969 960 182 --1206 --
NM_001034915chr891289 599 548 521 499 454 352 173 60 1134 ----
NM_001034954chr1052779 2658 2424 2286 64 12504 ----
NM_001034955chr1052779 2658 2424 2286 64 12504 ----
NM_001034956chr1052779 2658 2424 2286 64 12504 ----
NM_001034957chr1052779 2658 2424 2286 64 12504 ----
NM_001035chr121302 288 1521 1310 --
NM_001035005chr183628 441 61 ------
NM_001035260chr1041542 1322 1120 419 11561 1211 1392
NM_001035511chr172123 1847 1828 1765 1641 652 586 11785 --21792 1357
NM_001035512chr192230 1954 1935 1872 1748 759 693 55 27 21892 124 --21899 1464
NM_001035513chr192230 1954 1935 1872 1748 759 693 55 27 21892 124 --21899 1464
NM_001037132chr742253 1501 513 105 --1649 11772
NM_001037133chr742253 1501 513 105 --1649 11772
NM_001037163chr73838 740 34 1305 ----
NM_001037164chr741650 686 508 348 --1218 --
NM_001037172chr351419 982 940 372 363 21238 1156 ----
NM_001037174chr262310 2107 1740 1429 352 305 12268 ----
NM_001037277chr121081 329 11205 31554 482 49 --
NM_001037278chr121081 329 11205 31554 482 49 --
NM_001037317chr152662 2467 659 124 115 --12641 1402
NM_001037331chr18--1336 ----
NM_001037334chr18122251 2126 2041 1948 1909 1874 1576 897 791 783 684 188 ------
NM_001037339chr111571 21794 422 2539 369 --
NM_001037340chr111571 21794 422 2539 369 --
NM_001037341chr111571 21794 422 2539 369 --
NM_001037341chr111571 21794 422 2539 369 --
NM_001037494chr121210 ----187
NM_001037495chr121210 ----187
NM_001037582chr451658 1651 1442 1373 369 11620 11352 --
NM_001037631chr231123 447 432 ------
NM_001037637chr5183 ------
NM_001037872chr21101 ----1520
NM_001037954chr1163337 3041 2786 1025 997 848 23230 3160 1537 12651
NM_001038493chr231413 1039 1000 ------
NM_001038633chr11899 ------
NM_001038640chr152651 84 ------
NM_001038702chr572161 1903 1827 1756 1105 217 206 2812 571 12308 1179
NM_001038707chr152205 2169 1969 1549 818 1532 1613 --
NM_001038707chr152205 2169 1969 1549 818 1532 1613 --
NM_001039029chr1222025 1898 11946 21856 230 --
NM_001039199chr20135015 4982 4186 3905 3395 3342 3327 1562 1246 1158 1113 938 90 126 23147 1089 --
NM_001039372chr73623 474 436 ------
NM_001039468chr111288 ------
NM_001039469chr111328 ------
NM_001039535chr1871549 1466 1399 653 292 132 79 --296 65 --
NM_001039538chr243303 2558 963 888 13430 22678 144 --
NM_001039547chr3287138 7030 6974 6584 6473 6296 6110 5871 5168 5157 5127 5055 3132 2999 2922 1828 1770 1633 1497 1395 833 809 739 680 619 480 224 106 36575 6303 5313 36646 5980 1514 26767 3196
NM_001039577chr151570 1072 1001 525 231 2430 56 ----
NM_001039580chr494750 3762 3249 2044 1436 796 663 573 288 44622 4084 3203 1142 14740 1513
NM_001039585chr1114163 4122 3963 3474 3297 3258 2572 1002 975 510 73 --33462 1609 1421 23952 948
NM_001039590chrX83480 2723 2556 1336 1132 1115 900 502 1812 32940 1017 335 12851
NM_001039591chrX83480 2723 2556 1336 1132 1115 900 502 1812 32940 1017 335 12851
NM_001039618chr11155636 5329 5035 4996 4567 3800 2221 2057 2001 1509 1196 1146 1101 1014 128 31903 993 84 ----
NM_001039709chr2075270 1711 1528 1426 1252 956 668 24180 1274 ----
NM_001039762chr1042386 1555 680 512 1369 2795 279 1481
NM_001039802chr151286 886 474 264 198 --11308 --
NM_001039840chrX136051 5578 4822 4371 3925 3862 3845 2334 2237 2006 643 209 168 44664 1964 1938 1018 13753 1330
NM_001039884chr1961265 1094 504 438 198 95 1248 ----
NM_001039888chr12691 549 ------
NM_001039916chr122933 52 ----1982
NM_001039917chr122933 52 ----1982
NM_001039918chr122933 52 ----1982
NM_001039919chr122933 52 ----1982
NM_001039920chr122933 52 ----1982
NM_001039937chr13144025 3977 3333 3121 2908 2887 2715 1191 596 379 302 86 74 37 33582 2786 1555 --13031
NM_001039960chr1241515 1472 679 308 11610 11399 --
NM_001040001chr661832 699 680 344 332 169 11361 142 --
NM_001040020chr741082 513 429 388 --11422 --
NM_001040057chr751396 1158 948 444 381 21342 339 1100 --
NM_001040058chr41397 --2418 357 --
NM_001040060chr41397 --2418 357 --
NM_001040097chr71161 ------
NM_001040098chr71161 ------
NM_001040099chr71161 ------
NM_001040100chr371286 1149 489 483 390 304 81 1976 --1402
NM_001040101chr431340 1086 346 1239 11058 --
NM_001040110chr72185 47 ------
NM_001040134chr1911481 ------
NM_001040142chr272354 2347 2252 1951 1921 1898 308 21619 220 ----
NM_001040143chr272354 2347 2252 1951 1921 1898 308 21619 220 ----
NM_001040152chr774665 3871 3858 1347 1231 830 93 64483 3484 3175 1889 1736 1248 --14960
NM_001040153chr131364 1800 1884 --
NM_001040157chr4122415 2395 2078 1858 1797 1142 1076 851 749 687 136 78 --12307 12620
NM_001040158chr51465 1106 ----
NM_001040159chr441528 1487 389 75 11350 2348 300 --
NM_001040181chr341008 205 88 62 ------
NM_001040182chr341008 205 88 62 ------
NM_001040183chr341008 205 88 62 ------
NM_001040199chr341008 205 88 62 ------
NM_001040200chr341008 205 88 62 ------
NM_001040202chr472476 2350 2196 1859 1611 999 658 22495 377 ----
NM_001040214chr642099 1464 836 417 1815 ----
NM_001040260chr411097 1276 ----
NM_001040261chr411097 1276 ----
NM_001040284chr16205978 5877 5675 5390 5321 5263 5143 4394 4025 3620 2351 2277 1983 1910 1880 1384 1186 942 740 26 25608 1225 --23830 1761
NM_001040402chr452795 2445 2287 344 273 11976 1964 22317 937
NM_001040441chr195372 4914 4382 4156 3530 1159 684 600 492 44203 1581 1430 1397 ----
NM_001040450chr15112304 2196 1835 1782 905 745 737 727 418 334 282 ------
NM_001040453chr15112304 2196 1835 1782 905 745 737 727 418 334 282 ------
NM_001040619chr151315 657 537 127 92 --11590 --
NM_001040624chr852320 1824 995 824 69 --11859 --
NM_001040625chr852320 1824 995 824 69 --11859 --
NM_001040626chr852320 1824 995 824 69 --11859 --
NM_001040627chr852320 1824 995 824 69 --11859 --
NM_001040628chr852320 1824 995 824 69 --11859 --
NM_001040629chr852320 1824 995 824 69 --11859 --
NM_001040630chr852320 1824 995 824 69 --11859 --
NM_001040633chr71905 ------
NM_001040665chr7154854 4814 4801 4774 4320 4271 3969 3470 1957 1906 1884 1594 1423 348 193 1703 11450 24034 164
NM_001040666chr75556 516 503 476 22 ------
NM_001040708chr87955 938 808 347 225 164 123 --2919 414 --
NM_001040712chr993519 3189 2854 2640 2363 2346 1054 768 597 22795 2754 12408 --
NM_001040876chr451728 1238 495 351 57 21690 290 1592 11707
NM_001042355chr16145346 5336 5184 5082 5072 5066 4064 4010 3292 3267 673 521 366 308 22019 1419 --24873 1296
NM_001042357chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042358chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042360chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042361chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042363chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042364chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042365chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042387chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042389chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042390chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042392chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042393chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042395chr1081490 1484 1270 1091 1009 233 199 132 1572 11534 --
NM_001042396chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042397chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_001042403chr125877 401 345 332 133 --1287 --
NM_001042404chr161320 1228 298 131 123 108 1257 1551 --
NM_001042406chr651187 986 899 876 229 ----1818
NM_001042410chr21181 ------
NM_001042412chr16145346 5336 5184 5082 5072 5066 4064 4010 3292 3267 673 521 366 308 22019 1419 --24873 1296
NM_001042413chr943144 2708 2569 1318 23231 2726 13625 21517 1271
NM_001042424chr462851 2833 2241 2204 762 394 ------
NM_001042425chr611704 21251 584 11173 --
NM_001042453chrX51572 1505 680 501 107 1314 --11090
NM_001042459chr31264 1250 ----
NM_001042473chr1052022 1525 1381 320 84 11862 2551 400 --
NM_001042479chrX3505 329 232 11703 1212 11835
NM_001042480chrX3505 329 232 11703 1212 11835
NM_001042481chr1462203 2176 978 669 389 93 1955 ----
NM_001042492chr1763454 3025 2747 795 788 781 13434 21120 486 32470 1297 966
NM_001042493chr6101944 1883 1672 1663 1284 1270 766 586 456 152 ----21470 50
NM_001042494chr15163884 3663 3638 3447 3289 2672 2570 2505 2388 2381 1267 1164 1024 963 537 234 12681 32989 1331 1181 --
NM_001042495chr15163884 3663 3638 3447 3289 2672 2570 2505 2388 2381 1267 1164 1024 963 537 234 12681 32989 1331 1181 --
NM_001042496chr15163884 3663 3638 3447 3289 2672 2570 2505 2388 2381 1267 1164 1024 963 537 234 12681 32989 1331 1181 --
NM_001042497chr15163884 3663 3638 3447 3289 2672 2570 2505 2388 2381 1267 1164 1024 963 537 234 12681 32989 1331 1181 --
NM_001042506chrX2244 173 21314 314 ----
NM_001042510chr861846 1582 1405 868 808 239 12004 ----
NM_001042511chr861846 1582 1405 868 808 239 12004 ----
NM_001042533chr363067 2628 1143 638 480 389 --22613 724 22026 806
NM_001042537chrX62220 1000 895 539 362 300 ----12308
NM_001042543chr4101523 1200 1187 1175 1074 1011 549 540 432 393 ------
NM_001042552chr161395 1333 1307 941 538 436 ------
NM_001042555chr12124432 4422 4403 4048 3928 3861 3514 1564 1380 1313 641 112 43738 846 139 72 34130 2953 1836 --
NM_001042573chr1732051 1534 375 ------
NM_001042599chr2197278 7030 6787 6578 6463 5992 5970 5805 5625 5118 5014 4926 4776 3074 2079 1523 1100 492 78 47295 7078 1292 857 11560 35856 3096 809
NM_001042601chr3113264 3252 3144 2903 2074 1173 752 592 571 542 353 12183 33293 913 33 21148 581
NM_001042603chr12104266 4015 3571 1896 1823 1622 1392 750 646 204 15191 15038 --
NM_001042604chr3164670 4605 4593 4414 4133 3558 3398 3294 2952 1869 1581 1514 1339 704 615 122 54688 4451 3436 1525 1296 1789 11266
NM_001042646chr321991 1754 ------
NM_001042669chr461744 1721 1256 1227 1189 290 21610 1500 21383 1290 --
NM_001042681chr162639 2395 548 449 277 103 --1466 1494
NM_001042682chr162639 2395 548 449 277 103 --1466 1494
NM_001042682chr162639 2395 548 449 277 103 --1466 1494
NM_001042683chr661774 1493 1297 731 527 212 21520 420 ----
NM_001042749chrX51982 1596 578 58 38 11438 ----
NM_001042750chrX51982 1596 578 58 38 11438 ----
NM_001042751chrX51982 1596 578 58 38 11438 ----
NM_001042762chr751070 1027 336 286 245 1909 142 --
NM_001043318chr1474084 3472 2917 2669 2595 1585 789 14147 12772 --
NM_001044305chr61609 --11082 11345
NM_001044385chr283789 3705 3355 2973 2661 1604 578 263 13481 11330 --
NM_001044387chr1994100 3411 2788 2648 1497 980 156 118 35 --14201 --
NM_001044388chr1994100 3411 2788 2648 1497 980 156 118 35 --14201 --
NM_001044722chr552261 2176 1689 644 297 193 1408 --
NM_001044723chr552261 2176 1689 644 297 193 1408 --
NM_001046chr572624 2102 1977 1217 1079 462 204 12006 --22521 68
NM_001048183chr1123805 3524 3409 3375 3179 3098 2999 2757 2616 1032 167 118 23546 1112 13770 --
NM_001071775chr1381507 1353 1247 1214 530 499 416 114 11542 1295 --
NM_001077628chr11654 ------
NM_001078chr11706 ------
NM_001079874chr161969 1724 1618 1405 355 147 1717 21889 431 --
NM_001083620chr492522 2440 1845 1023 995 878 740 412 336 22106 570 ----
NM_001083621chr124726 1170 21061 797 ----
NM_001094chr171817 ------
NM_001099678chr3196378 6290 5698 5070 5048 4729 4478 4178 2452 2397 2361 2209 2164 2038 1846 1307 1061 950 88 35057 1987 95 56275 2408 2127 2112 1757 34392 3961 915
NM_001100108chr1138327 7761 7544 6829 3107 3068 2855 2424 1263 833 679 602 466 38214 3132 1340 --37263 7240 7021
NM_001106chr3189778 9603 9578 9250 8978 8611 8241 7919 7162 6712 3300 2410 2060 1701 1600 1403 1332 906 37590 6786 2542 23447 1470 --
NM_001113490chrX73656 3373 2875 2688 982 565 53 1615 1322 --
NM_001115chr8178 ------
NM_001116chr1653024 2930 2700 2597 400 1170 ----
NM_001117chr1832523 2394 2152 --22310 2003 11649
NM_001119chr4------11405
NM_001121chr1081201 733 617 543 507 388 344 203 11212 21301 1193 --
NM_001122631chr111140 1480 ----
NM_001122679chr521248 1145 ------
NM_001123chr104678 628 266 124 1279 --1168
NM_001126chr15999 914 817 792 135 ----1703
NM_001128chr1683921 3804 3155 2920 2621 1604 904 135 33784 817 465 11183 --
NM_001144chr1631301 929 220 --11333 --
NM_001146chr842281 1824 1530 493 1603 11573 --
NM_001148chr421676 1382 ----12102
NM_001149chr101954 ------
NM_001153chr24852 343 325 47 ------
NM_001159chr22804 613 1205 ----
NM_001160chr12132830 2720 2665 2248 2191 1811 1037 737 600 548 452 190 39 ------
NM_001167chrX156650 5770 5694 5642 5572 2663 2352 2018 1879 1435 1246 1171 898 863 512 25994 4624 21861 159 --
NM_001173chr14234659 4611 4365 4125 3836 3586 3442 3356 3299 3245 3191 3091 3048 1683 1614 1515 1172 828 798 736 318 206 122 53853 3559 1417 885 573 23797 3639 33978 3327 1281
NM_001186chr2173103 2809 2770 2750 2539 1203 544 12305 43118 2047 1088 35 --
NM_001187chr212618 227 ----1388
NM_001189chr42462 297 ------
NM_001200chr20----1400 --
NM_001201chr493938 3669 3506 3371 3178 2971 2483 1009 663 13280 --23766 1248
NM_001204chr2297414 7197 7106 6836 6713 6173 5657 5580 5566 5547 5420 5236 2511 2253 2130 2087 2043 1867 1745 1570 1374 1345 1322 1132 1059 991 644 486 191 56285 6006 2102 2023 1338 22029 1804 26128 5300
NM_001206chr982671 2642 2196 2015 1014 803 381 145 13012 11040 12252
NM_001207chr5183 ------
NM_001219chr772116 1741 1671 668 629 486 392 ------
NM_001222chr1011894 ------
NM_001233chr752305 2273 2260 887 786 --12410 --
NM_001237chr451026 410 204 168 82 ------
NM_001237chr451026 410 204 168 82 ------
NM_001241chr292285 2134 1947 1753 1614 1525 829 274 121 12182 21883 1549 12297
NM_001241chr292285 2134 1947 1753 1614 1525 829 274 121 12182 21883 1549 12297
NM_001249chr141128 --1329 --
NM_001253chr61280 181 ----
NM_001254chr1741090 1009 170 129 1911 --161
NM_001256chr17132944 2888 2880 2806 2630 2623 2601 1995 1958 1807 1127 658 78 ----12781
NM_001257chr1641229 259 185 138 --2221 212 --
NM_001259chr7195840 5643 5515 5323 4975 4725 4680 4632 4548 4264 2541 2419 2399 1710 1501 1355 508 465 124 34499 1803 1432 21057 576 1734
NM_001261chr91453 ------
NM_001262chr12248 142 --1118 --
NM_001265chr132938 771 1764 ----
NM_001269chr1----2947 181 --
NM_001283chr71521 ------
NM_001288chr6136 ------
NM_001289chrX61680 1444 1316 1284 657 140 1184 31138 260 202 --
NM_001290chr44973 427 279 143 1763 --165
NM_001304chr17103725 3686 3534 3231 3175 2785 2731 1459 1159 778 23359 1267 ----
NM_001305chr71827 ------
NM_001310chr1272956 2780 2485 2155 766 483 169 12118 12669 --
NM_001315chr661980 1749 1507 1494 1448 573 11588 ----
NM_001326chr113468 367 171 ------
NM_001328chr41540 ------
NM_001330chr163979 316 304 ------
NM_001331chr1142720 2201 470 73 ----22846 352
NM_001332chr5--11216 ----
NM_001333chr92280 54 ----1240
NM_001343chr531685 1638 479 11243 11527 1385
NM_001346chr362576 2116 2022 1828 755 656 12190 1308 --
NM_001349chr22626 464 1396 ----
NM_001351chr391706 1482 1170 1143 681 605 467 348 88 1306 1525 11457
NM_001356chrX62243 1636 1595 658 276 131 22523 2320 ----
NM_001357chr11271 1112 ----
NM_001358chr42453 123 --1402 --
NM_001363chrX1685 ------
NM_001364chr1153654 3337 1918 446 428 12986 ----
NM_001365chr171642 ------
NM_001380chr104937 858 794 284 ------
NM_001385chr84322 308 278 149 1423 ----
NM_001386chr872044 1962 890 809 470 419 348 --12012 1657
NM_001396chr2131996 1810 344 2566 206 12710 --
NM_001401chr951125 1109 1090 1064 534 --1615 11216
NM_001402chr622051 266 --1608 --
NM_001407chr321202 1108 ------
NM_001412chrX73413 3375 2941 2595 905 866 30 22833 837 11409 13641
NM_001415chrX51780 1411 1309 807 454 21712 77 ----
NM_001419chr1984546 3932 3612 1756 1300 1214 984 200 24612 4359 11134 196
NM_001420chr1933198 2430 634 ------
NM_001422chr1141166 264 235 86 ------
NM_001429chr224783 413 74 40 --2107 85 --
NM_001430chr22568 235 ------
NM_001438chr1103339 3090 3084 2854 2675 2242 952 513 316 204 --22999 851 --
NM_001448chrX41776 1580 1153 548 ----21631 1520
NM_001451chr1631061 452 381 ------
NM_001452chr62715 459 ------
NM_001453chr641192 640 280 192 --11342 --
NM_001460chr1123509 3026 2580 2539 2222 1411 1358 1228 1004 606 388 375 152 22560 1314 --
NM_001480chr1851176 797 481 416 202 ------
NM_001482chr155928 819 366 360 240 --3713 611 323 --
NM_001483chr751063 938 704 432 64 ------
NM_001490chr9143140 2963 2913 2558 2373 2277 2252 1369 1118 778 755 712 383 128 21304 633 1793 12661
NM_001491chr651728 712 298 224 218 --22562 402 --
NM_001498chr64509 426 407 364 11168 1440 --
NM_001527chr6114784 4579 4414 4219 4117 3915 3762 512 379 349 308 2322 123 24522 1733 --
NM_001530chr1491162 1090 1016 394 343 209 130 85 72 ------
NM_001546chr61381 21399 1328 ----
NM_001550chr72437 26 ------
NM_001554chr11602 ------
NM_001557chr221335 1203 ------
NM_001564chr41101 ------
NM_001570chr341201 977 484 402 --11414 --
NM_001584chr1121011 306 --21061 493 1421
NM_001604chr112686 640 1771 --1219
NM_001608chr23801 333 254 --1172 1312
NM_001609chr10124407 4144 3030 2881 1797 1570 850 723 683 677 482 48 13313 12917 --
NM_001614chr172637 241 ------
NM_001614chr172637 241 ------
NM_001616chr2103344 2869 2365 2265 2222 2172 995 952 284 83 ------
NM_001621chr782941 2827 2508 2271 1969 629 151 145 22352 674 ----
NM_001621chr782941 2827 2508 2271 1969 629 151 145 22352 674 ----
NM_001634chr631907 1486 441 ------
NM_001642chr1121196 1092 1350 ----
NM_001650chr18114100 3677 3563 2997 2913 2871 2791 1520 734 308 279 --23090 1234 11108
NM_001655chr1151550 1497 1355 740 518 --1231 135
NM_001656chr541667 1262 170 133 --21909 1858 --
NM_001659chr1262529 2389 2180 2168 731 654 21013 900 ----
NM_001660chr33801 644 229 1756 ----
NM_001663chr1462655 2564 2294 2206 2064 379 --22458 372 12446
NM_001664chr331029 59 38 ------
NM_001668chr121948 693 11900 2682 68 --
NM_001674chr13865 207 87 --11140 --
NM_001677chr151119 926 902 811 75 1887 --1996
NM_001681chr121537 1528 ----
NM_001682chr1282535 2447 2029 1999 971 820 811 599 1552 32559 1836 1817 22684 1051
NM_001684chr173796 3127 3018 1251 576 480 47 --22825 2785 --
NM_001689chr252022 1953 1901 776 277 --1609 --
NM_001690chr352374 1807 786 684 62 ----21739 502
NM_001695chr883709 3049 3040 2678 885 868 760 159 32620 1699 449 43407 3374 3344 1121 --
NM_001701chr951442 1304 1033 258 115 ----166
NM_001704chr6--1514 --1246
NM_001709chr1182893 2595 2284 2197 2179 1834 424 101 12916 ----
NM_001713chr52216 163 --1185 --
NM_001714chr121359 1495 ----
NM_001718chr631243 1000 989 ------
NM_001721chrX--2248 55 ----
NM_001730chr1361622 1584 1432 1278 1070 550 11303 --11349
NM_001730chr1361622 1584 1432 1278 1070 550 11303 --11349
NM_001731chr126913 816 771 293 200 153 --1337 --
NM_001742chr721863 441 ------
NM_001743chr21487 ------
NM_001746chr5102725 2616 2456 2355 2203 929 512 328 319 283 1847 ----
NM_001748chr131150 937 918 ------
NM_001752chr112407 156 ------
NM_001753chr771832 1803 679 616 600 221 202 21669 452 31517 555 51 --
NM_001754chr21113725 3578 3421 2837 1602 1465 1174 858 806 494 426 14048 11073 --
NM_001755chr1672207 1938 1909 1729 1440 921 240 181 ----
NM_001759chr1294190 3564 1659 1408 1375 1239 905 840 139 --14114 --
NM_001762chr75337 323 93 71 28 1698 1106 --
NM_001769chr122336 113 ------
NM_001777chr354129 3560 2524 1355 1308 13372 13900 --
NM_001781chr122831 116 --3678 136 89 1809
NM_001788chr73723 685 232 2356 257 ----
NM_001791chr151286 886 474 264 198 --11308 --
NM_001792chr1871179 918 902 893 886 812 212 ------
NM_001795chr1621503 1161 ----11605
NM_001797chr162666 531 --2798 557 --
NM_001798chr124783 725 281 130 ------
NM_001806chr1972948 1128 1010 836 797 436 127 --1980 --
NM_001812chr42322 113 ------
NM_001821chr194674 4529 3331 3242 1895 460 343 235 162 1331 21140 55 --
NM_001822chr21630 ------
NM_001829chr4----1914 --
NM_001830chrX83739 3579 3129 2772 1354 1215 1185 1098 33846 923 23 ----
NM_001839chr15582 509 314 87 75 ------
NM_001842chr91575 ----1452
NM_001845chr132517 255 31072 933 353 1376 --
NM_001854chr151541 1290 1120 1013 464 ------
NM_001855chr94884 743 582 36 --1814 --
NM_001858chr6133875 3570 3531 3307 3222 2056 1721 1248 905 515 404 384 273 23977 3581 11941 --
NM_001859chr943512 3280 1137 358 22773 1184 1883 --
NM_001872chr131114 ----1396
NM_001873chr43500 256 210 ------
NM_001874chr12114979 4782 4556 4292 3239 3196 381 265 254 194 116 --12028 --
NM_001875chr221066 338 ------
NM_001880chr22239 105 ------
NM_001881chr108477 465 435 198 178 152 136 110 ------
NM_001882chr53440 406 166 --1538 --
NM_001884chr51388 1134 ----
NM_001891chr4----122 --
NM_001892chr531450 326 75 --11388 1399
NM_001894chr2231193 829 50 140 ----
NM_001895chr2031058 267 175 --1838 --
NM_001901chr61367 ------
NM_001903chr51876 --1146 --
NM_001904chr31740 ------
NM_001916chr8----1181 --
NM_001918chr1148889 8470 7067 6909 6240 6234 3128 2875 2177 1455 1223 973 715 675 59129 8368 6616 1103 81 ----
NM_001920chr125624 578 205 180 41 1194 ----
NM_001921chr431284 1111 44 11197 1145 --
NM_001924chr11515 ------
NM_001931chr112506 158 --2802 492 --
NM_001935chr22871 843 2179 93 1325 --
NM_001938chr181793 1572 1436 394 248 227 220 86 --11378 --
NM_001939chrX43586 3077 2403 738 1607 22675 2570 1233
NM_001942chr1881962 1904 1875 1597 1394 1362 1343 746 --22009 240 --
NM_001948chr1551273 905 442 390 286 ------
NM_001949chr693244 3210 2765 2702 2292 2234 817 703 159 12687 22394 398 --
NM_001955chr63930 889 423 2733 183 ----
NM_001961chr191320 ------
NM_001967chr32429 96 --1244 --
NM_001968chr42667 647 1831 ----
NM_001969chr14103673 3612 3262 3062 2965 2913 2834 2485 1447 1078 11374 2961 46 11540
NM_001977chr4127 1346 1373 1441
NM_001981chr1132157 1938 1901 1731 1682 1651 960 905 841 687 656 612 136 --12202 11829
NM_001987chr1264339 4300 3490 3379 2709 711 --14070 --
NM_001994chr12179 66 ------
NM_001998chr31113 ------
NM_001999chr5180 ----11093
NM_002006chr4175634 5415 5237 5144 4283 4187 3822 3595 3551 2290 2229 1441 1289 1005 542 251 123 34966 900 612 35482 2208 618 24757 3653
NM_002009chr1562321 1910 1018 825 692 283 --21750 79 22056 795
NM_002015chr1393374 3341 2952 2591 2322 2284 991 929 857 1306 23240 1176 1897
NM_002017chr1151309 1259 986 855 446 11170 ----
NM_002024chrX92247 2200 1838 1783 1499 803 306 261 140 2837 519 1879 31414 412 176
NM_002025chrX189318 8091 7875 7608 7425 6167 6140 6084 6000 5721 3488 3402 2745 2543 1771 1096 667 254 28068 7336 38868 6582 1975 43332 3254 504 490
NM_002026chr23825 427 349 ----1982
NM_002031chr63641 609 331 ------
NM_002035chr18123839 3792 3570 3556 3489 1454 1441 932 711 385 223 72 --33117 999 424 23993 3441
NM_002037chr62433 397 1362 ----
NM_002040chr21123152 3133 3121 2436 2142 2084 1992 1945 665 655 162 31 22940 2674 33014 1025 88 12160
NM_002044chr1541594 1514 554 235 21455 135 182 --
NM_002051chr103835 819 780 ------
NM_002054chr2--127 1133 1476
NM_002056chr24827 680 259 182 ------
NM_002063chrX21243 1089 11110 --1245
NM_002069chr791910 1901 1712 1610 1472 705 591 458 76 131 11367 --
NM_002072chr92909 232 ------
NM_002074chr141681 367 274 138 --1597 --
NM_002076chr1253151 2774 2572 2404 1132 --22276 1052 185
NM_002092chr4194858 4761 4553 4316 4064 3977 3958 3423 3410 1975 1795 1612 1290 1265 701 556 524 226 59 --11456 --
NM_002094chr163329 313 81 ------
NM_002106chr41102 ------
NM_002107chr12479 201 1185 ----
NM_002111chr453846 3364 2639 2368 593 12999 ----
NM_002114chr63495 436 363 --1110 --
NM_002126chr1774178 3988 3981 3132 2966 1616 788 23268 580 --13612
NM_002128chr1372375 2059 953 676 519 495 454 2321 197 12538 --
NM_002129chr42358 314 ----1419
NM_002130chr561284 1206 386 368 119 93 ------
NM_002135chr121485 ------
NM_002137chr752322 2274 948 827 714 11573 11810 11954
NM_002138chr44617 278 113 49 ------
NM_002139chrX3446 183 143 ------
NM_002140chr92257 91 --2792 173 --
NM_002145chr171293 1381 ----
NM_002146chr1741463 1092 421 398 11055 1179 --
NM_002154chr52201 122 1158 ----
NM_002158chr2193838 3477 1537 1374 1333 1187 1116 1066 1046 911 627 501 471 407 363 353 252 220 149 22701 2351 33709 2517 874 --
NM_002182chr392681 2464 2296 1796 998 915 667 596 318 12801 --167
NM_002187chr541017 384 208 141 ------
NM_002193chr221606 1571 11799 11862 --
NM_002196chr2031059 713 442 11141 ----
NM_002196chr2031059 713 442 11141 ----
NM_002199chr461033 990 942 874 852 352 1643 ----
NM_002201chr151110 ------
NM_002202chr51252 21076 327 1369 --
NM_002203chr594161 3899 3875 3712 3452 3327 1531 737 560 23571 1167 --1253
NM_002210chr263455 2799 2330 975 684 533 --13151 11049
NM_002211chr1031000 881 135 --2859 712 --
NM_002214chr7195132 5090 5068 5050 4853 4437 4191 3996 3684 3666 2061 2026 1893 1747 1569 1328 1040 549 68 13657 23963 3462 23735 1623
NM_002223chr1252935 2896 1594 1433 1360 23548 698 ----
NM_002226chr141142 --1339 --
NM_002228chr111118 --11195 --
NM_002232chr121238 361 ------
NM_002235chr1281710 1645 1558 1448 1413 1364 1248 491 --1326 --
NM_002239chr251068 1048 762 248 99 ------
NM_002240chr212551 116 --147 1141
NM_002242chr241620 1579 730 535 1362 ----
NM_002247chr1032388 1939 925 ------
NM_002254chr221830 405 1848 --11588
NM_002264chr3105049 4568 3767 3676 3447 3074 2031 1198 1158 411 --34229 1099 900 1400
NM_002267chr1372423 1926 1870 1771 950 710 23 2516 465 12021 --
NM_002270chr5205633 5562 5543 5345 5007 4705 4642 4631 4622 4565 4034 4001 3726 1749 1724 1680 1432 1111 768 48 14390 33883 3467 1197 --
NM_002271chr1362272 912 834 792 416 294 12349 ----
NM_002285chr273879 3212 2884 1409 978 945 138 ------
NM_002293chr192626 2446 1890 1109 980 891 843 781 715 ------
NM_002296chr151754 1486 344 281 156 1718 --2437 251
NM_002310chr5206622 6585 6445 6047 5638 5492 5401 5236 5026 4294 4182 4021 1814 1557 1533 1423 1358 1060 1020 539 24770 4358 --25299 4249
NM_002312chr1361014 921 767 658 296 147 ------
NM_002332chr121732 ------
NM_002335chr111194 ------
NM_002336chr12134808 4656 4266 4158 3936 3691 3364 3221 1763 1336 1229 713 185 --24836 820 --
NM_002345chr12199 ------
NM_002349chr2111674 1579 1349 1151 1103 1038 519 382 317 266 129 --11488 --
NM_002350chr831152 966 237 --11028 --
NM_002351chrX71729 1617 1571 614 375 57 31 1225 ----
NM_002355chr1271346 1275 1146 1108 1055 182 144 1346 1945 --
NM_002356chr6102640 2606 2295 2134 1977 920 829 643 568 155 1326 --21930 1042
NM_002358chr42100 35 --1417 --
NM_002360chr7----22658 1914 --
NM_002372chr5--2700 658 ----
NM_002374chr243303 2558 963 888 13430 22678 144 --
NM_002381chr251032 932 398 312 156 ------
NM_002382chr142246 135 --1932 --
NM_002384chr182991 793 ------
NM_002387chr5105015 4495 4070 3884 1980 1758 1415 665 398 359 21448 1221 43909 3299 3129 800 1699
NM_002395chr641216 1153 180 57 --174 --
NM_002397chr521934 1646 2703 377 --11857
NM_002398chr241438 1268 1225 610 ------
NM_002401chr1712073 1385 ----
NM_002402chr711209 ------
NM_002408chr142268 116 --3293 147 29 --
NM_002430chr2241804 928 463 322 2868 671 22560 2439 --
NM_002438chr102532 62 1179 ----
NM_002442chr12--11763 21529 1427 --
NM_002445chr851166 1158 1105 554 336 11460 --1641
NM_002448chr42781 736 ------
NM_002449chr521061 412 --2923 207 --
NM_002451chr973930 3912 2886 2496 1238 843 836 32539 1023 865 22937 854 --
NM_002472chr17185 ------
NM_002480chr1241397 461 143 107 31368 1041 1006 2527 165 --
NM_002481chr1167840 6975 6567 6545 6444 6424 6099 5985 5080 2979 1816 1614 933 914 420 159 --15479 25502 4958
NM_002499chr15102253 2242 2232 1793 1633 900 506 382 263 45 ------
NM_002500chr261242 921 520 462 346 202 ------
NM_002514chr82891 119 ------
NM_002518chr231220 973 935 1948 ----
NM_002520chr5----134 --
NM_002526chr651663 344 277 265 254 1103 ----
NM_002537chr151423 ------
NM_002545chr11115114 5029 4081 3936 3909 2041 1069 886 682 596 459 24265 1058 34775 4106 3656 23826 1643
NM_002546chr85626 498 235 118 96 ------
NM_002547chrX64218 4171 3426 3372 3133 60 1209 ----
NM_002553chr71439 ------
NM_002556chr1112169 22110 682 12060 --
NM_002568chr81319 ----1279
NM_002570chr1521147 1040 11082 1228 1318
NM_002577chr3114047 3956 3865 3710 3503 3282 2946 946 791 404 38 23950 3085 13367 11042
NM_002579chr1911481 ------
NM_002581chr985451 4574 4250 4218 3764 3727 816 139 --45396 1313 1228 426 --
NM_002585chr11259 1330 ----
NM_002586chr661316 1287 1188 1161 1137 229 ------
NM_002590chr134450 418 211 184 ------
NM_002594chr2052441 2073 1618 758 115 22143 154 2796 174 --
NM_002595chr1291463 1457 1331 1233 1199 269 214 189 134 ------
NM_002600chr111571 21794 422 2539 369 --
NM_002605chr151933 21108 402 11072 --
NM_002606chr211174 ------
NM_002610chr2113120 3075 2630 2361 2160 677 640 578 419 390 357 42971 2695 452 203 21229 287 --
NM_002612chr762112 1391 1357 742 547 407 ------
NM_002613chr1625397 3708 24406 3325 45377 5274 4668 3333 --
NM_002618chr21431 --1475 --
NM_002623chr201683 1142 2265 64 2308 113
NM_002628chr361117 943 876 495 106 91 135 1384 --
NM_002629chr101796 1147 ----
NM_002631chr1191 ------
NM_002639chr1851326 1246 861 187 82 --1310 --
NM_002641chrX61813 1661 1505 1441 245 141 21491 801 --11821
NM_002645chr1183018 2783 2686 2541 2452 1121 204 98 ----22396 2030
NM_002646chr162194 1737 1557 832 796 356 --11962 11782
NM_002648chr631287 825 814 ------
NM_002649chr751400 1392 529 391 381 21221 360 ----
NM_002651chr12693 679 ------
NM_002655chr8104953 4404 3993 3912 2052 1231 1207 833 760 319 53527 887 801 596 302 21516 442 2329 124
NM_002656chr611120 --1840 1404
NM_002657chr2053853 3092 1143 1080 850 13895 33739 2550 1270 --
NM_002658chr101894 ------
NM_002667chr641153 925 877 181 2435 208 1289 1816
NM_002670chr351397 1249 1189 619 381 21093 1049 ----
NM_002687chr143891 263 175 1444 1119 1320
NM_002697chr11215 ------
NM_002699chr121412 1344 11472 ----
NM_002709chr2143497 3422 2856 2783 2620 2603 730 580 539 505 437 268 149 142 23026 254 ----
NM_002710chr123353 310 239 --1865 --
NM_002714chr62189 89 ------
NM_002716chr1162513 2349 967 600 503 192 --13624 --
NM_002718chr342567 1808 752 663 22287 532 --12434
NM_002719chr1442378 1991 566 336 22271 308 12075 --
NM_002720chr163271 222 65 ------
NM_002721chr91137 --2197 55 --
NM_002726chr62157 151 1356 ----
NM_002729chr104590 324 305 181 ----168
NM_002731chr152725 1228 896 587 502 11245 32958 1947 904 --
NM_002734chr1752052 1809 1680 481 72 21423 157 ----
NM_002736chr741464 781 461 92 11865 11891 --
NM_002737chr17186351 6122 5828 5590 4996 4845 4668 4409 4395 4347 4131 2340 2024 1580 1335 1248 1058 80 ------
NM_002738chr162254 107 ------
NM_002740chr3112828 2618 2522 2290 1773 523 493 402 365 273 124 --12437 12303
NM_002742chr14193 ------
NM_002744chr11296 ------
NM_002748chr1531214 963 24 1400 ----
NM_002755chr153774 357 283 1656 ----
NM_002758chr172548 92 --1139 --
NM_002763chr11162 ------
NM_002767chr172469 191 ------
NM_002788chr14199 ----190
NM_002812chr191426 ------
NM_002822chr1281852 1644 677 617 539 409 278 224 11498 ----
NM_002827chr204474 448 413 155 11467 ----
NM_002830chr21267 ------
NM_002834chr1284113 3569 3457 3396 2914 1537 735 389 --23713 3408 --
NM_002835chr72552 485 182 ----
NM_002836chr201148 ------
NM_002837chr12103584 3421 3384 3209 3072 2982 1701 1601 1383 142 41202 1089 1019 903 23991 1739 32817 1328 1101
NM_002839chr993519 3189 2854 2640 2363 2346 1054 768 597 22795 2754 12408 --
NM_002843chr1143172 2776 1364 131 1787 13323 --
NM_002844chr631040 511 395 ------
NM_002845chr181688 ------
NM_002849chr1221051 922 ----1984
NM_002850chr19------1828
NM_002851chr72688 221 ------
NM_002852chr3------1135
NM_002858chr151357 1320 1024 431 353 ----1420
NM_002860chr104709 278 256 159 141 128 --
NM_002868chr1232291 835 306 --22071 804 1817
NM_002869chr1152221 2066 594 517 264 31697 663 190 11375 21533 1433
NM_002874chr972476 2434 2314 1919 696 452 380 12528 12349 --
NM_002886chr3115191 4666 3914 3420 3238 1595 1408 1370 1321 869 415 55159 4639 4479 4027 1208 11152 34748 4193 1284
NM_002890chr51903 1323 --1230
NM_002892chr1431607 1155 229 --1605 --
NM_002893chrX1280 ------
NM_002897chr21759 ------
NM_002906chr1162378 2340 2186 1475 529 425 21696 679 22042 1517 --
NM_002907chr121334 1126 2414 21 --
NM_002912chr63815 787 725 ------
NM_002930chr18138 ------
NM_002938chr4177 11353 21565 316 --
NM_002940chr451728 1238 495 351 57 21690 290 1592 11707
NM_002941chr321640 1604 --1439 --
NM_002942chr341099 918 445 432 1165 ----
NM_002956chr1271332 1269 1211 1178 1089 933 219 41165 869 455 144 1924 --
NM_002957chr953751 3690 3514 1565 323 1439 22559 820 12553
NM_002958chr35942 246 232 184 111 2955 700 ----
NM_002959chr143488 1758 1163 1095 --24413 953 --
NM_002968chr1631085 350 238 ------
NM_002971chr351039 1018 919 402 72 --11157 1117
NM_002977chr273273 3237 2953 2785 2520 336 314 --42926 2167 1224 922 --
NM_002979chr11795 --1758 --
NM_002994chr461952 1851 1711 682 665 655 1458 1321 142
NM_002997chr221537 1242 ------
NM_002998chr841740 698 559 79 1522 ----
NM_003001chr192230 1954 1935 1872 1748 759 693 55 27 21892 124 --21899 1464
NM_003002chr114814 780 731 505 1143 1156 --
NM_003010chr1732078 1815 780 22147 631 --164
NM_003013chr42661 226 ------
NM_003016chr1732024 1965 274 ------
NM_003017chr631410 889 424 11219 11042 --
NM_003027chr151173 ------
NM_003030chr32503 370 ------
NM_003032chr352723 2573 944 863 78 11738 12266 --
NM_003034chr12197749 7329 6895 6522 5797 5550 5495 5151 3162 2915 2829 2713 2437 2429 1790 1733 1340 752 612 53140 2850 2653 1623 857 --17489
NM_003036chr11925 11217 1175 --
NM_003043chr374275 4156 2868 2774 764 380 301 1406 1473 11721
NM_003045chr1384683 4522 4388 3172 3058 1928 915 421 14184 ----
NM_003046chr8125409 5265 5098 4550 3874 3576 3530 3468 3450 1768 1533 602 24337 763 11978 --
NM_003048chr292377 2126 2104 1931 1794 982 958 357 302 12255 ----
NM_003051chr171739 1562 1283 532 423 297 245 41685 1594 1588 461 11911 --
NM_003054chr101237 ------
NM_003068chr83727 310 82 11061 --11005
NM_003069chrX1187 1202 ----
NM_003070chr91617 --1765 --
NM_003071chr372042 806 506 462 363 293 99 21482 284 11434 --
NM_003074chr361880 1544 1530 1519 406 398 ------
NM_003075chr121336 ------
NM_003081chr204945 917 781 264 ------
NM_003082chr143554 195 29 ----21435 1396
NM_003087chr101234 ------
NM_003095chr121376 ------
NM_003096chr21248 188 1197 --
NM_003099chr15166527 6105 5687 5468 5293 4704 2558 2100 1895 1828 1765 1694 1511 822 802 186 46602 6069 5254 1631 15003 --
NM_003100chr51310 ------
NM_003106chr351103 950 886 750 405 11056 --137
NM_003107chr652327 2251 2095 1729 1652 ------
NM_003108chr2177027 6784 6601 6423 5846 5276 5191 4953 2151 2120 1566 1122 941 674 623 332 209 35598 4416 964 17337 15078
NM_003110chr1721092 748 ----11132
NM_003111chr291153 1070 1020 853 428 402 235 103 82 11185 1411 --
NM_003112chr7113256 3029 2730 2319 2246 2100 2040 698 686 354 165 1590 21150 274 11227
NM_003114chr83289 194 139 ------
NM_003123chr1674441 4339 4246 3691 3678 1231 918 --14589 11962
NM_003126chr15553 497 434 171 32 ----1488
NM_003128chr252630 2068 675 495 279 12479 --1941
NM_003133chr151061 837 754 352 49 --1136 --
NM_003136chr141290 ------
NM_003137chr692083 2077 1856 1710 746 641 483 115 66 --1378 1651
NM_003144chr672234 2189 1394 836 425 339 292 1577 ----
NM_003155chr83716 616 114 2689 652 1551 --
NM_003157chr34933 912 354 293 2949 803 ----
NM_003161chr1742666 2581 1260 248 52264 1104 952 725 270 1510 --
NM_003164chr11----1416 --
NM_003178chr32295 36 2541 473 ----
NM_003184chr821089 1041 1698 1991 --
NM_003185chr2031251 462 215 11042 ----
NM_003188chr62182 155 ------
NM_003189chr192977 2796 2759 2519 2485 1309 1280 1036 247 22804 487 --11067
NM_003199chr18105590 4999 4673 4264 3736 2127 2071 1891 929 612 23476 1053 1304 11625
NM_003201chr105979 760 739 653 124 ----1662
NM_003203chr292263 2229 1805 1545 968 688 601 365 30 --2340 274 11989
NM_003204chr1721733 118 ----1534
NM_003211chr1241611 1297 300 270 ------
NM_003213chr12--1193 ----
NM_003217chr1242003 1432 198 146 11925 ----
NM_003220chr611704 21251 584 11173 --
NM_003221chr6114121 3816 3423 1267 886 720 625 433 247 136 68 13338 1546 --
NM_003222chr201951 --1314 --
NM_003234chr362430 1560 839 821 673 245 22137 1502 11482 22125 77
NM_003238chr11263 ------
NM_003242chr31906 21858 781 ----
NM_003244chr182463 340 1143 1392 --
NM_003246chr1541758 1552 1329 219 31397 541 366 ----
NM_003253chr2171610 1598 1572 1406 1248 743 222 1169 ----
NM_003257chr152927 264 ------
NM_003259chr191128 ------
NM_003262chr3215197 5058 5034 5002 4624 4574 4214 3355 2059 1886 1803 1775 1577 1382 1331 1194 943 878 303 224 49 24340 3815 --11006
NM_003274chr2162745 2359 2046 1884 870 817 12902 12582 --
NM_003275chr93479 260 167 11244 1533 --
NM_003286chr2081119 1105 1019 835 783 244 126 109 1257 1856 --
NM_003290chr192464 94 ------
NM_003291chr132818 25 1623 --2697 592
NM_003292chr142291 1840 733 504 ------
NM_003297chr12194 ------
NM_003298chr3136080 5894 5476 5426 4681 4428 4249 4235 3880 2023 2004 1954 1401 16100 34944 4915 237 14853
NM_003299chr122230 166 ------
NM_003304chr341396 1145 522 470 ----133
NM_003305chr43348 280 93 ----1447
NM_003309chr661748 1676 1455 1366 768 628 --11644 --
NM_003319chr22884 796 --3347 155 70 --
NM_003336chrX3969 885 127 1825 1775 --
NM_003337chr531662 1455 76 --124 1551
NM_003338chr1031951 790 747 41890 1393 600 262 ----
NM_003339chr541370 1311 1051 109 11582 11403 --
NM_003340chr451159 252 117 108 74 1297 1867 --
NM_003342chr1763133 3072 2759 2250 1113 539 22978 1053 ----
NM_003344chr771759 1682 1600 1484 537 161 88 --11709 --
NM_003347chr2231517 1496 281 11739 --1295
NM_003348chr1241372 651 391 85 21664 122 21563 1208 --
NM_003349chr202533 171 --21501 81 159
NM_003352chr21869 1274 ----
NM_003359chr451290 1113 1021 499 266 11167 1948 --
NM_003367chr19----1482 --
NM_003368chr17777 617 575 293 185 171 90 ----180
NM_003369chr1122718 580 ------
NM_003371chr931849 815 33 --1113 --
NM_003373chr1011940 11604 ----
NM_003375chr101388 ------
NM_003379chr62920 437 ------
NM_003381chr64851 643 227 83 ------
NM_003383chr92525 504 ------
NM_003385chr241033 819 794 194 ----1736
NM_003387chr292938 2795 2413 2383 2157 1973 926 635 557 12462 1487 1675
NM_003392chr3113996 3929 3922 3620 3414 1702 1587 1415 865 349 234 1550 ----
NM_003400chr23758 337 244 1199 1152 --
NM_003403chr144577 529 103 42 ------
NM_003406chr861979 1557 1437 1307 1291 240 ------
NM_003409chr1821420 552 11320 11038 --
NM_003410chrX133023 2778 2480 2430 2423 2341 2074 1999 1115 1101 824 649 283 1517 ----
NM_003411chrY81555 1356 734 664 612 492 457 68 21636 473 --1258
NM_003412chr393125 3078 3005 2903 2838 2796 2342 2224 1073 --11221 --
NM_003413chrX52007 1975 1424 772 415 21962 1318 --21681 231
NM_003418chr32842 52 2716 626 ----
NM_003420chr32512 329 ------
NM_003427chr61672 ------
NM_003430chr1951461 1434 1421 1118 454 21030 243 1230 --
NM_003431chr12452 177 1656 194 --
NM_003436chr19------1728
NM_003440chr12140 --1763 --
NM_003442chr117901 886 699 314 304 46 38 ----1244
NM_003453chr133645 568 300 164 ----
NM_003454chr1631384 1352 510 21101 1076 11362 11493
NM_003463chr693266 2398 2171 2064 2050 1204 913 579 315 1687 ----
NM_003468chr284349 4221 3037 2991 2948 932 819 171 --12930 --
NM_003471chr392334 1905 1879 1857 1687 557 529 204 80 31727 579 517 21642 1485 1780
NM_003472chr641335 1270 1223 209 11391 ----
NM_003473chr103989 952 711 ------
NM_003474chr1072108 1916 1600 1465 633 458 50 ------
NM_003478chr11153351 3316 3257 2962 2744 2716 2656 2542 2477 2314 2083 2074 1276 417 38 2618 384 22737 2257 --
NM_003482chr1232348 2304 833 11821 12486 --
NM_003483chr1262796 2644 2608 2375 555 44 21978 780 ----
NM_003489chr2163407 3201 3143 1170 165 29 22522 782 23429 1050 --
NM_003498chr1632761 2638 966 22110 808 --22783 2653
NM_003505chr711299 --11604 --
NM_003506chr871348 1327 1173 1156 1119 390 376 --2531 263 --
NM_003507chr282056 1881 1867 1795 1660 1542 755 642 21458 1265 ----
NM_003557chr131070 298 149 31148 584 264 188 --
NM_003563chr1731058 915 488 ------
NM_003566chr12153238 3018 2711 2689 2457 2295 2268 2124 1228 1149 1031 881 789 730 196 2994 932 1642 --
NM_003567chr13442 55 31 ------
NM_003573chr191266 --1245 --
NM_003574chr18165581 5117 5041 3850 2050 1842 1734 1558 1323 1266 1002 775 506 469 355 322 43665 2322 1743 1179 25572 1123 --
NM_003576chr1352702 1002 962 926 258 --1705 2831 160
NM_003581chr23949 877 781 ------
NM_003583chr12123937 3900 3422 3158 2522 2419 1437 1335 848 542 135 120 22977 1359 1680 --
NM_003589chr1361305 1166 1133 907 182 145 ----11316
NM_003590chr2153842 3603 3471 3374 3016 2984 2944 1615 1560 1255 744 667 572 493 483 42916 1240 352 219 21524 1002 23392 1068
NM_003597chr292180 1657 1419 800 673 600 546 363 189 ------
NM_003603chr462091 1518 1489 1429 1422 656 22135 441 ----
NM_003615chr3153848 3818 3758 3718 3049 2825 2779 1596 1496 1329 1186 977 613 602 362 --43019 2888 1317 244 23447 384
NM_003617chr1164928 4815 3861 3830 3807 3634 3435 3342 3105 1992 1624 1469 1292 1281 1161 82 54921 3600 997 798 239 23098 1110 11304
NM_003618chr23972 501 150 21264 103 1221 --
NM_003622chr12102598 2405 2265 1993 965 869 831 764 646 38 --12091 --
NM_003626chr1151397 1020 407 315 309 1551 11291 194
NM_003628chr21706 ------
NM_003630chr62757 715 ----1130
NM_003631chr101224 ----1930
NM_003632chr171864 ------
NM_003633chr522610 805 1719 12047 --
NM_003642chr2285 77 1122 138 --
NM_003651chr122586 210 ------
NM_003659chr231101 244 35 ----11024
NM_003663chr3143335 3164 3043 2739 2546 2382 1362 1272 919 872 683 565 431 181 2490 254 1651 22799 1383
NM_003668chr12166 ------
NM_003670chr321345 361 1345 ----
NM_003672chr141922 1868 1516 420 ------
NM_003677chr1251665 1498 810 599 397 1296 ----
NM_003679chr163004 2533 2421 2256 1395 529 ------
NM_003701chr1331062 1002 220 ------
NM_003702chr84838 720 531 90 1808 ----
NM_003714chr562539 2272 1895 1219 264 47 --127 --
NM_003722chr342663 1966 1917 1682 11861 --173
NM_003728chr4----1247 --
NM_003743chr21689 --1748 --
NM_003746chr121210 ----187
NM_003750chr103889 666 204 --1824 --
NM_003758chr1541274 1027 179 115 129 --11264
NM_003758chr1541274 1027 179 115 129 --11264
NM_003759chr4124089 4056 3728 3560 3369 3070 2825 1631 1266 912 873 654 13974 13327 --
NM_003760chr12249 68 --2539 262 1710
NM_003762chr14990 941 933 166 ------
NM_003763chr2083233 2824 1976 724 710 495 481 394 11993 1407 --
NM_003766chr17144 ------
NM_003768chr11366 1335 ----
NM_003769chr122111 102 ------
NM_003772chr1151307 1184 1174 813 379 --3345 293 69 --
NM_003774chr12133249 3188 3165 2323 2172 2162 2094 1310 1219 770 736 498 473 12733 22621 2414 11293
NM_003778chr33138 122 55 ------
NM_003779chr12484 418 ------
NM_003783chr13458 423 327 --1278 --
NM_003787chr1841631 1584 490 101 --11698 11053
NM_003794chr33984 891 362 2961 851 ----
NM_003795chr61485 ----1536
NM_003798chr93133 122 78 ------
NM_003800chr652234 2009 1999 1747 123 21911 659 22036 419 --
NM_003816chr871392 1368 1164 1148 1113 507 240 31004 547 32 1369 11418
NM_003822chr193209 3161 2484 2194 2008 913 894 601 376 --11168 --
NM_003825chr1541571 1164 1095 204 ------
NM_003829chr93908 502 79 1104 --21246 829
NM_003831chr1861717 1616 573 304 266 160 ----11728
NM_003838chr161603 1031 580 515 319 310 1423 1289 11415
NM_003848chr36972 960 931 823 346 134 ------
NM_003861chr1462717 2140 1976 1049 657 124 --2590 295 --
NM_003867chr81553 ------
NM_003870chr1571796 1623 1387 1344 539 295 235 ------
NM_003873chr1052392 2242 1831 871 75 12571 ----
NM_003877chr12----1925 --
NM_003884chr351811 1736 1638 1246 712 1356 1244 --
NM_003887chr21151 12248 11629 --
NM_003895chr2132098 653 383 1114 31577 696 302 --
NM_003902chr15778 631 531 97 91 1581 ----
NM_003908chr2031338 1031 905 ------
NM_003913chr6124164 4049 4021 3571 3254 3125 3108 2963 1568 1277 934 647 23949 1323 13923 12844
NM_003916chrX2984 148 31490 1141 1126 --11428
NM_003921chr191555 1370 1350 1281 1243 1226 378 260 22 2654 631 --31410 405 362
NM_003930chr752566 2539 2448 707 120 1541 ----
NM_003931chr62493 197 ------
NM_003934chr961332 988 916 415 381 145 ------
NM_003939chr1063425 3270 1231 987 245 238 13634 ----
NM_003941chr792473 2050 1967 1861 1624 907 752 742 541 32458 1911 350 1379 --
NM_003943chr421120 1053 21130 411 ----
NM_003947chr331156 999 855 11033 ----
NM_003948chr482593 1735 1052 701 635 575 131 54 --12235 --
NM_003968chr31166 2567 192 ----
NM_003971chr172544 56 ------
NM_003972chr1041096 484 445 219 1311 ----
NM_003987chr1012314 ------
NM_003988chr1012391 ------
NM_003989chr1012250 ------
NM_003990chr1012250 ------
NM_003994chr1284415 3785 3663 3321 3109 2682 1318 460 1122 34048 3504 1450 --
NM_003998chr42578 179 ------
NM_004006chrX42280 2018 1790 316 12600 12292 12059
NM_004007chrX42280 2018 1790 316 12600 12292 12059
NM_004009chrX42280 2018 1790 316 12600 12292 12059
NM_004010chrX42280 2018 1790 316 12600 12292 12059
NM_004011chrX42280 2018 1790 316 12600 12292 12059
NM_004012chrX42280 2018 1790 316 12600 12292 12059
NM_004013chrX42280 2018 1790 316 12600 12292 12059
NM_004014chrX42280 2018 1790 316 12600 12292 12059
NM_004015chrX42280 2018 1790 316 12600 12292 12059
NM_004016chrX42194 1932 1704 230 12514 12206 11973
NM_004017chrX42280 2018 1790 316 12600 12292 12059
NM_004018chrX42194 1932 1704 230 12514 12206 11973
NM_004019chrX1328 ------
NM_004020chrX42280 2018 1790 316 12600 12292 12059
NM_004021chrX42194 1932 1704 230 12514 12206 11973
NM_004022chrX42194 1932 1704 230 12514 12206 11973
NM_004023chrX42194 1932 1704 230 12514 12206 11973
NM_004024chr151224 566 446 127 92 --11499 --
NM_004028chr18114100 3677 3563 2997 2913 2871 2791 1520 734 308 279 --23090 1234 11108
NM_004035chr17124865 4369 4130 4015 3877 3825 3675 3516 3365 3201 1159 59 34170 4059 329 34633 666 70 13591
NM_004040chr231014 516 510 1323 11163 --
NM_004050chr1422377 2238 --1963 --
NM_004052chr103824 687 291 ----1252
NM_004060chr551263 942 887 846 426 --1375 1273
NM_004063chr83300 160 95 1790 ----
NM_004071chr24212 65 57 34 ------
NM_004073chr11306 ------
NM_004075chr121389 --1403 --
NM_004077chr1251230 1094 932 875 535 1925 ----
NM_004079chr172958 2535 2026 1966 1811 815 61 ------
NM_004080chr731373 1057 194 11209 172 --
NM_004081chrY91733 1508 1201 1174 701 622 565 447 176 ----11483
NM_004085chrX4310 207 152 102 ------
NM_004086chr141648 ------
NM_004087chr351755 1720 1462 77 43 ----11448
NM_004089chrX11246 1381 ----
NM_004090chr1753356 3325 2802 1312 747 23126 1369 23162 696 --
NM_004094chr1482912 2027 1862 1122 1048 834 788 501 21074 491 1369 1247
NM_004096chr1082108 1502 1442 1413 693 667 340 136 ------
NM_004097chr21319 ------
NM_004100chr672257 2059 1967 1914 552 376 53 12193 ----
NM_004101chr592093 1811 1592 1543 1451 663 553 432 363 ------
NM_004109chr1162182 1615 598 174 149 34 125 11791 --
NM_004113chr31657 --21945 149 11267
NM_004117chr632113 2080 764 ------
NM_004124chr14153551 3445 3436 3139 2670 2347 2321 2237 1432 1356 1162 1003 648 537 518 32958 2747 169 23172 899 --
NM_004133chr882611 2367 2253 2106 489 276 136 53 12490 11088 --
NM_004136chr15103060 2387 2360 2261 2197 2162 1299 1182 1049 830 12549 1165 --
NM_004157chr32779 261 ------
NM_004161chr221505 1247 1197 31596 1315 347 --
NM_004162chr321114 162 21188 880 132 --
NM_004170chr951652 1324 495 387 136 1692 ----
NM_004171chr11229438 9194 7813 7641 7309 7217 7095 7082 7068 6873 6759 3309 3283 2830 2315 2107 1962 1474 1428 1314 1110 555 37978 3378 2508 31178 1165 215 19429
NM_004172chr551560 271 227 205 103 12038 2383 59 2642 187
NM_004180chr23606 505 130 ------
NM_004200chr1173192 3122 2841 2038 1196 346 223 ------
NM_004205chr112517 56 ------
NM_004209chr1611091 11143 ----
NM_004215chr82592 399 1559 ----
NM_004225chr821025 61 1457 --11157
NM_004229chrX82169 2018 1836 1808 787 692 667 176 21498 599 21731 1628 1139
NM_004232chr18163622 3338 3310 3206 2620 2456 1358 1310 1283 1174 930 674 650 581 548 205 23300 425 189 21447 961
NM_004241chr102797 205 1592 ----
NM_004242chr62307 91 ------
NM_004252chr172525 500 ------
NM_004261chr131000 669 102 1959 ----
NM_004264chr1211235 2906 155 1147 --
NM_004272chr592044 1855 1751 1561 1233 775 654 170 135 1549 1292 --
NM_004274chr1432458 2221 1190 33139 2975 689 32533 1170 157 --
NM_004277chr631683 1658 245 --11130 --
NM_004279chr761882 889 848 743 234 171 1262 ----
NM_004280chr63371 184 124 ------
NM_004281chr102405 53 ------
NM_004289chr72494 472 2402 101 --1453
NM_004290chr541360 1100 1030 296 1144 148 --
NM_004291chr51107 ------
NM_004293chr9103516 3306 3144 2931 2827 2368 1531 1149 1100 1093 32600 2480 1538 1878 32982 1303 1063
NM_004295chr1711067 ------
NM_004301chr32133 84 ------
NM_004319chr152690 2473 2435 2420 723 23126 903 ----
NM_004323chr942710 2184 2122 2085 --32548 265 122 2668 360
NM_004327chr2212044 ------
NM_004330chr1571099 1090 806 775 458 437 305 ------
NM_004331chr851733 1723 852 363 295 21650 700 21687 745 --
NM_004337chr832275 1911 1838 --184 --
NM_004338chr18136839 6746 6084 6032 5972 5290 5191 5086 4684 2747 2645 2173 1555 26244 5958 ----
NM_004342chr762201 2067 1699 1617 1446 112 12142 22089 1731 --
NM_004343chr192569 213 ------
NM_004346chr441538 1519 1180 344 ----1304
NM_004349chr841224 1031 991 226 1300 ----
NM_004354chr42825 543 2248 157 ----
NM_004360chr16102032 2019 1949 1707 1636 628 407 340 328 269 ------
NM_004365chr52350 310 ------
NM_004370chr631826 1724 819 11741 --1620
NM_004371chr151296 976 959 188 136 ------
NM_004379chr241316 1105 594 85 11173 1323 1214
NM_004380chr1622217 1892 1371 ----
NM_004384chr552261 2176 1689 644 297 193 1408 --
NM_004386chr1942310 2131 1944 1894 11822 31971 1828 1469 --
NM_004392chr13132573 2513 2251 2140 1908 1704 1642 992 883 567 514 344 112 22433 181 12646 --
NM_004397chr11134297 3776 3595 3351 3343 3221 3074 2851 569 492 329 136 94 13570 11543 --
NM_004398chr11--1417 ----
NM_004404chr242036 496 242 149 1633 ----
NM_004411chr71689 1210 --1658
NM_004414chr2121225 582 --152 --
NM_004415chr62314 177 --1592 --
NM_004432chr971941 1887 1711 1691 1669 840 191 ----11742
NM_004438chr253167 2731 2545 704 91 12941 ----
NM_004440chr661926 1586 736 706 383 357 11703 11971 --
NM_004441chr331300 811 383 ------
NM_004442chr11584 ------
NM_004444chr72544 44 ------
NM_004447chr123982 730 205 ----11092
NM_004456chr71205 ------
NM_004458chrX112667 2528 2434 2422 2043 1640 1069 937 842 378 65 --12080 --
NM_004459chr1751739 1638 1427 794 163 ------
NM_004464chr4124296 4249 3872 3860 3704 3669 3620 3446 3302 3017 459 276 33846 3392 62 23082 558 12986
NM_004472chr52617 124 ----1692
NM_004480chr144755 736 723 646 ------
NM_004482chr24857 797 720 606 1141 2656 268 --
NM_004496chr1431254 945 234 ------
NM_004498chr152333 56 ------
NM_004499chr52414 369 ------
NM_004500chr1491585 1454 1259 557 241 228 215 70 25 2179 99 11281 --
NM_004501chr164007 3499 3174 943 899 717 11339 11548 --
NM_004504chr272712 1201 923 872 494 114 90 ------
NM_004505chr1721760 1266 11612 ----
NM_004506chr62282 264 1230 ----
NM_004514chr1753101 2987 2463 953 667 --1865 --
NM_004516chr192412 234 ------
NM_004520chr56755 742 610 275 143 92 ------
NM_004523chr1041245 1228 432 23 --11354 --
NM_004526chr31639 ------
NM_004529chr911412 21454 1060 11145 --
NM_004535chr2071412 1381 1322 1298 1193 1114 611 ------
NM_004537chr12101575 1409 1352 965 605 586 392 342 191 163 21219 96 11446 --
NM_004540chr212895 205 1593 ----
NM_004571chr2142110 844 828 321 --23369 3330 --
NM_004575chr471597 1481 1443 1125 634 520 499 --11197 --
NM_004578chr12916 86 1114 1223 --
NM_004582chr11122 ------
NM_004583chr175284 240 212 205 143 ------
NM_004586chrX85134 4881 4475 3688 1201 882 668 192 24726 2105 24329 1872 15445
NM_004593chr31252 1888 ----
NM_004598chr533343 2939 2812 22491 2341 ----
NM_004602chr2041359 1295 1092 598 ------
NM_004607chr51205 ------
NM_004612chr9104575 4447 3630 3496 1846 1829 1627 1520 1021 487 1329 ----
NM_004617chr33519 361 168 1178 1225 --
NM_004619chr122007 1730 51771 740 631 556 433 ----
NM_004622chr262194 1910 476 371 197 116 1753 11563 --
NM_004627chr213584 176 158 ------
NM_004631chr111329 ------
NM_004637chr31985 --1905 --
NM_004642chr123687 523 33 1726 ----
NM_004643chr141833 ------
NM_004650chrX31611 1459 348 21406 509 --11690
NM_004654chrY21281 438 --1891 --
NM_004655chr1721400 1266 1174 ----
NM_004660chrY41638 1580 1537 274 12119 11952 --
NM_004663chr154563 550 135 118 --31383 1010 489 --
NM_004667chr153691 445 221 ------
NM_004670chr1081441 1264 660 596 450 349 261 203 --1108 11412
NM_004673chr161560 1221 1113 569 289 126 ------
NM_004677chrY--1425 ----
NM_004681chrY1505 1129 ----
NM_004685chr1352435 2382 2091 1074 101 12738 ----
NM_004686chr841606 601 538 307 ------
NM_004689chr142494 337 ----1464
NM_004690chr63748 607 133 --1652 --
NM_004696chr15763 648 537 293 125 ------
NM_004703chr1732484 863 308 31710 744 52 1360 --
NM_004705chr114901 864 623 90 ------
NM_004709chrX41693 636 299 253 11328 11437 --
NM_004713chr144749 550 259 40 ------
NM_004718chr24678 653 545 77 1535 ----
NM_004719chr1292893 2630 2563 2483 2383 2136 2064 1108 720 32264 409 253 ----
NM_004723chr121041 922 --11027 --
NM_004725chr1071385 1201 1187 582 496 152 105 ------
NM_004726chrX74813 4001 1995 1818 1767 746 49 15330 22222 293 25385 997
NM_004727chr1551745 1681 833 628 454 11819 ----
NM_004731chr124273 192 149 133 11433 1282 --
NM_004734chr13103014 3001 2796 2711 2557 2277 477 451 354 251 12991 12583 --
NM_004736chr171812 1761 447 423 195 118 28 21864 210 1202 11633
NM_004741chr1021566 376 2349 253 ----
NM_004744chr4113976 3938 3725 3660 3324 3088 1496 1425 1166 1021 932 --33879 448 187 --
NM_004745chr896809 5548 5449 4903 2409 1990 1478 858 756 11366 ----
NM_004748chr15173992 3906 3807 3706 3487 3462 3237 2984 2854 1663 1284 755 538 467 357 298 194 54083 1153 557 551 412 2630 309 21094 589
NM_004755chr1441097 1084 463 67 1837 ----
NM_004760chr782485 2382 1753 802 658 618 534 455 22010 943 1480 --
NM_004764chr123585 203 91 ------
NM_004768chr121019 731 --1850 --
NM_004772chr531249 1125 279 11536 ----
NM_004774chr1762975 2681 2444 2057 894 334 12160 23033 213 --
NM_004775chr1892197 2177 2113 2020 1618 1532 1521 763 275 42394 1900 1610 960 ----
NM_004781chr12641 104 1339 1458 --
NM_004781chr12641 104 1339 1458 --
NM_004788chr1171848 1693 908 649 636 606 578 21980 1063 --1258
NM_004789chr9--2293 51 ----
NM_004795chr1361891 1843 1686 1546 1231 337 31678 1399 1242 --11722
NM_004796chr1452415 2278 2174 2043 1519 --163 --
NM_004797chr383686 3602 3438 3344 2752 2602 1390 921 21372 1280 23138 1340 --
NM_004798chr2073524 1439 1323 817 561 428 202 12909 ----
NM_004801chr211392 21201 633 11157 142
NM_004804chr242349 496 458 261 1776 ----
NM_004808chr1053371 2981 1290 451 262 22854 640 1358 1256
NM_004815chr1134834 4366 3655 3449 3103 3056 1850 1400 1118 554 486 473 440 23975 213 24585 3988 --
NM_004817chr92614 586 ------
NM_004824chr62941 293 ------
NM_004831chr191436 ------
NM_004834chr243246 2864 1042 866 ----141
NM_004835chr34881 682 277 31 ------
NM_004835chr34881 682 277 31 ------
NM_004836chr23757 214 109 ------
NM_004837chr121081 329 11205 31554 482 49 --
NM_004840chrX1282 42448 2116 1995 338 22405 516 --
NM_004841chr141118 1063 1041 470 31131 858 852 1740 --
NM_004842chr61662 21776 512 ----
NM_004845chrX53857 3714 3265 3129 2794 13726 ----
NM_004849chr661678 1046 556 505 471 256 11363 --1415
NM_004850chr241444 1128 333 103 21108 421 ----
NM_004857chr1483732 3705 3322 1645 1543 1471 607 541 11789 33661 3232 1915 --
NM_004859chr1752401 2310 744 204 33 ----12143
NM_004866chr5134651 4518 3814 3620 3361 3174 3128 1765 1616 1343 1279 1005 539 14723 14582 34401 1989 357
NM_004867chrX3694 504 174 ----1558
NM_004869chr1831092 338 300 21378 382 --1456
NM_004871chr1774378 4353 4332 4017 3435 3265 3135 --23911 3836 --
NM_004873chr1441981 612 582 390 13184 ----
NM_004879chr114963 647 252 148 1681 ----
NM_004883chr5--2149 45 ----
NM_004890chr17----1257 --
NM_004893chr51465 1106 ----
NM_004895chr14598 482 454 400 ------
NM_004896chr1061457 1237 1035 620 602 334 11476 1126 1307
NM_004898chr422622 1101 1854 22586 1127 --
NM_004902chr202535 67 --2834 720 --
NM_004904chr796428 5830 4055 2573 2533 2526 2273 977 337 24174 1654 45041 2243 2094 420 --
NM_004906chr61558 ------
NM_004912chr731638 1375 511 11493 ----
NM_004921chr162556 2210 1963 1945 939 633 3904 108 59 ----
NM_004926chr1441298 1290 1216 707 11280 ----
NM_004929chr831367 241 82 ------
NM_004932chr571749 1703 1659 1536 1287 191 21 21674 1273 11690 --
NM_004941chr172459 119 ------
NM_004947chr332547 2431 2093 22214 984 ----
NM_004949chr1881513 1477 1376 423 397 389 279 152 32101 2001 1669 11595 --
NM_004953chr31311 ------
NM_004954chr111288 ------
NM_004956chr7134513 4023 3854 3713 3484 3460 2873 2785 1808 1636 1017 676 439 24351 3811 175 24380 826
NM_004958chr12943 916 ------
NM_004965chr212655 482 ------
NM_004966chr101291 2205 38 2898 166 --
NM_004967chr42133 56 ------
NM_004969chr103512 227 175 --2555 49 --
NM_004972chr971127 1045 1007 833 796 463 335 11168 11197 --
NM_004973chr63491 140 116 ------
NM_004976chr1153557 3263 1762 1351 634 1667 ----
NM_004985chr12103593 3230 3107 1735 1701 1283 908 787 99 50 11724 1891 --
NM_004987chr21271 ------
NM_004992chrX97144 7124 6266 5476 3296 2301 2133 1986 1190 12029 --1994
NM_004992chrX97144 7124 6266 5476 3296 2301 2133 1986 1190 12029 --1994
NM_004993chr1451059 964 591 305 178 ------
NM_004999chr694432 4237 3440 1755 1492 1050 921 872 175 32820 1371 484 --13793
NM_005006chr231103 1027 793 1297 ----
NM_005010chr742253 1501 513 105 --1649 11772
NM_005011chr72185 47 ------
NM_005016chr122327 255 ----1114
NM_005023chr551379 1286 484 288 104 11039 21538 185 3376 343 162
NM_005028chr1051862 1751 1504 1474 180 1129 12352 --
NM_005032chrX4933 719 391 318 ------
NM_005036chr22128376 8205 8197 8184 8120 3180 1652 1507 1234 573 361 160 55851 5525 2615 1740 1329 11388 --
NM_005054chr241235 643 377 359 11121 11309 --
NM_005056chr12114510 4259 3815 2140 2067 1866 1636 994 890 448 229 15435 15282 --
NM_005058chrY------1253
NM_005063chr1063806 2948 1338 918 869 301 32822 975 469 23241 442 --
NM_005065chr14125338 5235 4599 4388 4284 4266 4182 4116 2112 1192 1124 309 44839 3456 368 166 ----
NM_005066chr14693 293 189 94 --160 1616
NM_005076chr143394 3274 2676 197 22726 322 23606 1367 --
NM_005079chr851048 980 750 468 356 33010 912 167 ----
NM_005086chr1261639 1511 493 405 394 72 2512 279 1333 --
NM_005093chr2075270 1711 1528 1426 1252 956 668 24180 1274 ----
NM_005095chr182097 1919 1832 1805 1442 1436 648 263 4884 543 229 25 ----
NM_005097chr101349 --135 --
NM_005099chr131083 938 528 ------
NM_005103chr111319 ------
NM_005105chr182225 2171 2060 1955 1909 602 430 293 ------
NM_005110chr52841 636 ------
NM_005113chr14--1405 2469 161 --
NM_005114chr42457 72 ------
NM_005116chr2054313 3060 1569 1370 1319 13586 --44462 4255 3412 3075
NM_005119chr12884 390 1866 1907 --
NM_005121chr17123423 3408 3349 3027 2870 2853 2615 1483 1035 1007 236 80 53512 3066 3004 1094 820 21363 507 --
NM_005124chr65762 728 675 120 28 --1129 1826
NM_005125chr111156 ------
NM_005126chr372190 2071 2018 1917 1907 1696 402 12056 --11889
NM_005133chr111108 ------
NM_005135chr15163884 3663 3638 3447 3289 2672 2570 2505 2388 2381 1267 1164 1024 963 537 234 12681 32989 1331 1181 --
NM_005141chr41169 --170 1273
NM_005151chr18122251 2126 2041 1948 1909 1874 1576 897 791 783 684 188 ------
NM_005153chr161535 ------
NM_005154chr154674 634 564 30 ----1603
NM_005156chr9235301 5243 4728 4582 4085 4018 3970 3953 2018 1643 1375 1228 1190 1175 956 888 820 810 748 507 273 259 86 34869 4465 640 14306 --
NM_005159chr1582182 2141 2133 1658 1588 804 796 85 11511 31411 595 63 12239
NM_005160chr22165779 5285 5088 4940 4744 4718 2426 2418 1745 1570 1245 1231 766 503 396 278 15340 11380 --
NM_005168chr24631 577 383 141 ------
NM_005171chr1241180 967 522 325 11050 1262 --
NM_005180chr1031172 1096 29 157 --11326
NM_005188chr11228269 8058 7918 7858 7150 7123 6896 6023 5928 5436 3334 2649 2586 2459 2231 2161 1916 1823 1769 1682 999 108 48196 2842 1210 1177 56016 5471 2257 583 477 --
NM_005194chr201146 --1544 --
NM_005197chr14146194 5919 5905 5890 5160 3956 2235 1419 1187 982 903 722 193 91 34483 1639 1377 12175 --
NM_005201chr3134 ------
NM_005203chr10--1417 ----
NM_005204chr104901 694 304 101 --2855 787 --
NM_005207chr2243663 738 289 74 13566 ----
NM_005214chr231086 410 395 ------
NM_005215chr18--1240 2758 32 --
NM_005224chr193569 539 467 ------
NM_005229chrX----1928 1982
NM_005230chr121217 ------
NM_005233chr382017 1998 1854 1787 1594 644 620 169 1950 ----
NM_005235chr2197278 7030 6787 6578 6463 5992 5970 5805 5625 5118 5014 4926 4776 3074 2079 1523 1100 492 78 47295 7078 1292 857 11560 35856 3096 809
NM_005238chr1193290 2804 2345 1180 1161 932 586 99 73 23305 2596 --1229
NM_005241chr32449 295 ------
NM_005252chr142493 83 ------
NM_005254chr1531367 522 54 --1465 --
NM_005256chr113975 794 226 1814 ----
NM_005257chr1841155 1079 901 362 ------
NM_005259chr2160 ------
NM_005261chr85994 987 821 794 341 ------
NM_005264chr101847 ------
NM_005271chr101488 1776 ----
NM_005273chr71321 1334 ----
NM_005277chr461499 1328 1222 619 504 200 11824 11465 --
NM_005278chrX2481 91 ------
NM_005284chr6--1398 ----
NM_005295chr7------1122
NM_005296chrX21042 47 1803 ----
NM_005302chr7--143 ----
NM_005308chr101415 ------
NM_005311chr792567 2388 2148 2138 1812 1788 1144 1059 349 --11745 --
NM_005313chr1561249 1158 980 335 278 271 --21120 145 --
NM_005316chr113905 878 758 1912 ----
NM_005318chr2231271 1254 46 1399 160 --
NM_005327chr41230 ------
NM_005328chr83544 531 518 1148 ----
NM_005329chr1631469 850 532 12177 --12334
NM_005333chrX2354 63 ------
NM_005339chr4124303 3712 3601 3188 3088 1527 1481 1333 919 805 771 218 ------
NM_005342chrX42823 2401 1861 326 ------
NM_005358chr1351512 1483 1310 580 159 21687 631 21210 671 --
NM_005359chr18185751 5478 5354 5233 4612 4361 4262 4181 4096 2105 1949 1794 1615 1518 1148 485 174 106 16006 34048 1892 543 --
NM_005369chrX2646 496 1581 --1537
NM_005378chr21640 ------
NM_005384chr9------182
NM_005385chr352379 1081 764 443 239 22326 873 ----
NM_005387chr111638 ----1482
NM_005388chr981610 1470 1432 1425 556 399 326 79 1317 1675 11727
NM_005389chr6--1169 ----
NM_005392chr911747 ----11334
NM_005397chr793983 3587 3212 2897 2518 910 709 584 145 11084 13343 --
NM_005398chr1041321 1243 972 74 11141 ----
NM_005399chr184123 3992 3825 3478 3303 2764 1079 70 1947 ----
NM_005400chr283108 2986 2920 2795 2647 2139 2106 1001 32586 2171 713 ----
NM_005402chr761690 1587 586 387 360 276 11196 ----
NM_005406chr181605 21516 998 11094 --
NM_005407chr1441282 1273 455 195 1989 ----
NM_005410chr53589 528 153 ------
NM_005424chr11110 ------
NM_005429chr4131 ------
NM_005433chr1872491 2257 2165 1781 742 513 62 32510 1953 822 189 --
NM_005436chr10144144 4102 4024 3534 3482 3242 3049 2665 1561 1388 1210 536 360 298 1583 --1228
NM_005437chr1071471 1117 556 547 464 271 129 --180 --
NM_005443chr43572 203 122 ------
NM_005455chr12739 703 ------
NM_005461chr2021429 694 ------
NM_005465chr151630 792 617 344 337 31654 1405 35 1280 --
NM_005475chr1263319 3269 3214 2928 2833 80 12241 12873 --
NM_005487chr2262117 1721 365 225 190 108 --11527 1752
NM_005493chr62191 163 1199 1769 --
NM_005494chr71420 ------
NM_005497chr17146071 4860 3731 1988 1936 1791 1619 1272 1259 980 661 603 566 241 46099 1287 678 102 1624 11982
NM_005499chr191568 ------
NM_005502chr983211 2833 2566 2451 2421 2411 1154 1058 33184 2377 2110 ----
NM_005506chr462754 2437 2145 1045 298 265 1552 1584 --
NM_005507chr111167 ------
NM_005509chr531518 1445 746 1483 ----
NM_005513chr371478 1387 1287 519 416 240 61 --1559 --
NM_005517chr12934 91 2545 525 ----
NM_005521chr101279 ------
NM_005522chr75943 555 353 226 82 41238 878 544 492 1345 --
NM_005530chr1561445 1433 1217 1184 970 384 11244 1482 11227
NM_005536chr83320 286 200 --1976 --
NM_005537chr133940 866 377 ------
NM_005542chr781705 1571 1514 1479 1429 691 664 80 --1193 21671 723
NM_005544chr241048 776 770 117 2360 275 1913 --
NM_005546chr572022 2009 1901 1586 821 790 471 --11787 --
NM_005562chr121708 1465 21610 560 ----
NM_005573chr55516 498 468 260 112 ----146
NM_005575chr55713 682 640 254 164 ------
NM_005578chr385028 4819 2061 1959 1676 1620 532 201 44544 4179 1182 871 35133 4964 1444 25053 1285
NM_005585chr151288 ------
NM_005593chr125607 581 526 504 411 ------
NM_005595chr12828 785 ------
NM_005596chr9166092 5743 5516 5426 5176 5155 4491 4007 3945 1799 1423 992 976 846 703 148 35836 4552 1753 --11596
NM_005599chr151443 1271 429 359 240 ------
NM_005600chr11215 ------
NM_005603chr1852048 1939 1704 1555 738 --12033 1128
NM_005604chr662449 1901 1840 1765 1721 573 22326 933 ----
NM_005610chr1----2225 212 --
NM_005611chr1621305 1147 11101 ----
NM_005613chr141881 1857 1817 758 1284 21594 217 --
NM_005614chr74873 269 254 196 2213 190 ----
NM_005618chr62657 504 ------
NM_005625chr82921 145 1401 ----
NM_005637chr1821784 1643 11373 12028 --
NM_005638chrX61457 1224 679 323 161 136 --11517 --
NM_005647chrX103064 2859 2527 2225 1278 1047 1039 886 587 533 --21199 543 22479 165
NM_005648chr8--1201 ----
NM_005650chr2231273 1240 1195 1537 ----
NM_005651chr42383 55 2301 67 1407 --
NM_005655chr851181 871 504 486 470 ------
NM_005665chr1124879 4691 4468 4193 3727 3288 1298 906 661 559 174 156 11427 43416 1268 600 349 1186
NM_005668chr5104266 3437 3227 1651 1571 1313 1005 823 533 502 44099 3364 1271 851 11121 11252
NM_005697chr151178 ------
NM_005700chr111371 ------
NM_005708chr13--1414 1373 --
NM_005715chr652590 1781 1002 628 177 --12763 --
NM_005719chr12147 --2192 69 --
NM_005721chr231028 856 219 1996 21071 51 --
NM_005722chr292344 2261 2078 1894 1740 1725 604 326 163 1293 162 --
NM_005725chr121628 812 12253 22467 667 12340
NM_005737chr272807 2261 2251 2017 1056 786 142 --1558 --
NM_005738chr741650 686 508 348 --1218 --
NM_005742chr2130 ------
NM_005746chr772550 2033 1892 1061 748 423 259 22381 1763 22334 1866 --
NM_005748chr1273431 2319 2219 977 846 753 346 31044 274 81 --12275
NM_005749chr173633 567 77 ------
NM_005751chr71460 1509 ----
NM_005752chr1671109 987 863 368 271 150 85 --2924 259 --
NM_005754chr571234 826 814 389 206 192 126 --21168 60 --
NM_005756chrX61363 463 435 326 215 55 11556 11490 --
NM_005759chr2144751 4107 3845 3724 3615 3571 3557 3347 3269 2912 906 323 184 45 34464 3386 992 23953 3245 14128
NM_005760chr2147 ------
NM_005765chrX2121 65 ------
NM_005776chr14--1807 ----
NM_005779chr5103643 3109 3002 2985 2777 2742 2540 702 40 24 13618 ----
NM_005780chr131899 1726 ----
NM_005786chr1831054 247 87 1218 ----
NM_005795chr283005 2713 2409 2299 987 897 887 809 12898 22742 2560 23025 2219
NM_005796chr16----1397 --
NM_005797chr1121489 235 11268 --21323 1252
NM_005802chr94754 676 628 284 ------
NM_005807chr16604 596 473 285 163 51 ------
NM_005808chr373016 2878 1343 796 471 464 436 --42735 989 945 514 --
NM_005810chr1231099 829 233 1897 11085 --
NM_005813chr252233 1996 1976 1843 302 1894 12668 11965
NM_005822chr632067 268 237 1499 ----
NM_005828chr1775058 4884 3372 523 506 471 231 14847 21677 1099 15011
NM_005832chr371477 1334 1269 1225 1101 225 25 ------
NM_005836chr8146 ----186
NM_005839chr13985 356 29 ------
NM_005840chrX157391 6499 5996 5873 5706 5342 4799 2611 2346 2328 1574 1166 761 210 70 25699 5232 37074 6636 2096 --
NM_005842chr135685 592 585 119 88 ------
NM_005843chr231854 1769 1547 --21830 206 --
NM_005853chr162412 232 ------
NM_005857chr161358 1273 995 555 227 191 11304 ----
NM_005862chr371048 990 937 786 388 297 290 ------
NM_005863chr1041283 417 355 211 21003 116 21243 1202 --
NM_005868chr762299 1925 959 532 130 109 21631 211 2521 433 --
NM_005871chr1051043 1019 916 422 277 1441 --1343
NM_005875chr31290 --1353 --
NM_005880chr1631361 1315 32 1191 ----
NM_005885chr531558 1477 176 21417 274 --11438
NM_005886chr161280 ------
NM_005896chr25807 225 213 132 101 --1725 --
NM_005898chr1193083 3035 2918 2379 2291 2246 1265 1216 1029 13156 ----
NM_005899chr17--149 1546 2373 190
NM_005900chr441117 1091 1007 760 --21132 436 21207 997
NM_005901chr18228588 7553 6841 6673 6552 6366 6276 6107 5698 5676 5331 3163 2878 2538 2363 1791 1731 1679 1289 695 545 526 46985 1633 979 504 35638 5367 2939 11562
NM_005902chr1534063 1272 1008 33736 3723 2856 21817 110 --
NM_005903chr5164993 4787 4640 4472 4394 4301 3758 3213 2006 1892 685 654 402 299 259 50 --24772 841 11700
NM_005904chr18170 ------
NM_005907chr661560 1113 1074 538 488 134 11648 --11426
NM_005908chr4--122 ----
NM_005909chr5123728 3525 3509 3370 3349 3290 2949 1462 1366 1248 599 522 33228 1718 672 21320 606 12680
NM_005911chr22560 148 1972 191 --
NM_005927chr52870 198 1890 --2445 153
NM_005930chr146740 659 653 185 163 31 2822 48 1266 --
NM_005933chr1131862 1110 1079 2922 743 --22870 1846
NM_005935chr4135208 5182 4837 4700 4689 3996 3801 3718 3359 2088 1585 420 226 25267 3351 14875 --
NM_005941chr873684 1280 1228 1160 1045 648 350 54186 3655 3500 1606 778 44136 4085 1311 858 --
NM_005944chr321092 764 11189 --11059
NM_005955chr1105166 4878 3981 2009 1910 1793 1571 1162 901 136 64718 4435 4372 3603 3439 1585 1810 --
NM_005962chr1042311 944 460 242 11534 1274 --
NM_005962chr1042311 944 460 242 11534 1274 --
NM_005964chr1751446 1389 1381 997 246 ------
NM_005966chr252422 2068 1956 602 398 32253 2025 1942 21975 950 --
NM_005968chr191194 ------
NM_005977chr132663 264 --1319 --
NM_005982chr142226 152 ------
NM_005986chr1372604 2195 1945 1034 803 670 664 ------
NM_005989chr73526 246 229 11049 ----
NM_005996chr1231574 1320 173 11205 1409 --
NM_005999chr151167 1105 344 262 234 --11574 --
NM_006002chr13178 188 ----
NM_006007chr974009 1715 1584 1361 872 858 831 12904 23569 363 --
NM_006011chr1563823 3665 1338 1330 357 276 ------
NM_006015chr121343 498 ----11299
NM_006016chr662105 1965 1930 493 362 70 21482 110 ----
NM_006024chr77783 772 610 597 206 190 171 1246 ----
NM_006033chr1852349 1959 1830 1698 1603 11842 ----
NM_006036chr282515 2455 2411 2289 1829 141 113 52 1699 --1219
NM_006037chr294474 4069 3804 1586 1545 1444 1200 1117 974 24803 1769 21641 1615 --
NM_006047chr20113535 3362 3264 3086 2736 2720 2673 2572 1020 942 469 22655 34 33320 2527 1402 11147
NM_006055chr2113224 2883 2872 2723 2689 2225 1160 962 296 199 142 --32446 836 447 --
NM_006063chr21198 ----1219
NM_006067chr1631019 431 354 ------
NM_006078chr221191 ------
NM_006080chr752802 2533 1868 954 606 32907 2037 790 ----
NM_006083chr51108 ------
NM_006084chr142356 319 ------
NM_006086chr161255 ------
NM_006088chr9--1146 ----
NM_006089chrX81817 1709 1407 756 673 572 484 440 ----1291
NM_006095chr4104485 3763 3619 3342 3079 3066 2821 1701 1176 226 54264 4173 1596 1294 1279 13907 --
NM_006100chr3159 ------
NM_006106chr11102893 2787 2585 2502 2098 1258 1241 1013 687 551 12831 --22797 867
NM_006108chr1142055 869 421 133 11596 1878 --
NM_006113chr161969 1724 1618 1405 355 147 1717 21889 431 --
NM_006134chr21124 11237 ----
NM_006135chr131440 1250 963 --3540 225 195 --
NM_006136chr741209 999 515 357 11041 1861 --
NM_006139chr272819 2793 2265 2228 2147 214 130 --1430 --
NM_006141chr1662326 1939 1926 1919 878 836 2799 622 ----
NM_006145chr1951013 833 781 744 381 --1152 --
NM_006153chr33667 630 554 1577 1446 --
NM_006154chr1572933 2695 2223 2204 314 113 56 22620 1808 32850 104 70 --
NM_006155chr242036 496 242 149 1633 ----
NM_006160chr1731567 555 313 ------
NM_006164chr21438 ------
NM_006166chr1292655 2549 2403 2337 1893 1848 1751 1639 100 41056 884 825 324 31722 1660 173 --
NM_006180chr931816 282 67 21869 1835 1259 --
NM_006183chr121562 ----1186
NM_006186chr241276 1130 1077 818 ------
NM_006187chr1272948 2628 2356 1144 924 511 372 13136 ----
NM_006190chr22895 331 ------
NM_006191chr121385 2648 277 1633 --
NM_006194chr1431301 839 331 ------
NM_006196chr21245 ------
NM_006197chr852109 2094 1763 785 318 21635 236 1455 --
NM_006198chr211244 1224 ----
NM_006203chr595234 4753 4553 4124 3975 3488 1093 874 743 44440 367 285 210 65381 4610 3812 1959 503 488 --
NM_006206chr43892 552 404 22941 638 12470 --
NM_006207chr81267 ------
NM_006224chr174977 451 442 88 1336 12521 --
NM_006226chr251341 1154 1029 886 467 21170 132 ----
NM_006237chr135926 693 545 510 162 ------
NM_006241chr362389 2173 1996 1524 529 322 2475 345 1853 --
NM_006243chr13970 251 112 11043 ----
NM_006246chr143517 500 371 1269 --1356
NM_006251chr5163213 3193 3166 2960 2830 2686 2604 2403 2231 2094 1176 1101 926 920 659 452 --12673 12597
NM_006252chr1227459 7268 6726 6362 6226 6107 5884 5606 5223 4813 4648 4627 2743 2199 2002 1787 1630 1340 1162 900 494 60 67013 5289 1573 908 777 233 22960 1057 1610
NM_006256chr182587 2142 2097 2017 1751 1018 821 674 ------
NM_006258chr1021447 982 11061 ----
NM_006259chr46967 692 649 252 99 75 1786 ----
NM_006267chr2101838 1753 1419 1175 746 631 431 405 321 264 ----1531
NM_006273chr17------1416
NM_006275chr2051743 1680 970 818 664 --12134 1427
NM_006277chr2--2703 270 1640 --
NM_006281chr8--1275 ----
NM_006281chr8--1275 ----
NM_006283chr8124872 3410 1915 1564 1432 1342 1146 1017 941 691 407 359 2315 293 33239 1952 400 44511 1616 1450 933
NM_006287chr2122527 2517 2502 2208 2111 2091 1850 1030 468 232 170 67 22165 252 21658 114 --
NM_006298chr653215 2841 1281 967 503 12691 ----
NM_006306chrX85913 5182 4808 4802 4518 3738 1721 498 25866 2032 ----
NM_006311chr17163 ------
NM_006313chr1231660 303 213 1513 ----
NM_006315chr453870 3698 1723 1347 369 --13904 --
NM_006321chr332176 2113 660 12156 ----
NM_006325chr123842 733 288 ------
NM_006329chr143758 741 682 2547 296 --1267
NM_006330chr861504 1360 1098 1025 614 172 21407 1112 --21141 79
NM_006334chr91111 ------
NM_006345chr43870 443 325 ----1425
NM_006350chr52329 83 ------
NM_006352chr182065 2004 1890 1831 773 432 299 87 11776 ----
NM_006353chr671430 1376 1310 1074 1012 216 92 11363 11450 --
NM_006359chrX62220 1000 895 539 362 300 ----12308
NM_006364chr143841 379 245 --1345 1459
NM_006369chr12453 95 ------
NM_006371chr3104277 4260 4123 3754 3613 592 571 531 377 210 2836 179 1643 --
NM_006375chrX51785 1712 1625 614 507 --1132 --
NM_006377chr931228 817 245 ------
NM_006379chr762062 1825 1705 933 159 63 31973 250 50 12175 --
NM_006380chr17113610 3439 3375 3116 3086 2883 2764 1600 1507 1111 443 21422 231 1261 34173 2899 459
NM_006386chr2241636 956 502 123 21594 963 21649 826 --
NM_006390chr1271696 1617 1569 1416 1361 412 393 11256 --1539
NM_006391chr111231 ------
NM_006393chr1063218 2969 1364 1258 1160 922 23381 185 44106 4094 210 54 --
NM_006415chr941154 908 495 106 11146 1503 --
NM_006420chr20113486 3364 3193 3182 2978 2860 2766 2688 2650 2577 2474 22671 916 12185 --
NM_006434chr1052779 2658 2424 2286 64 12504 ----
NM_006449chr262160 2104 2057 571 522 375 1233 11756 --
NM_006451chr53774 283 139 --2910 342 --
NM_006452chr471495 1484 522 498 297 88 21 ------
NM_006457chr4144065 4031 4016 3485 3132 2711 2601 1611 1091 977 482 400 304 70 33737 2653 449 23160 2973 13680
NM_006459chr1061966 1851 1630 1582 527 200 --21440 1244 11684
NM_006460chr1741362 1276 716 533 1601 --2520 505
NM_006469chr131625 1404 1199 --1515 1618
NM_006471chr18160 ------
NM_006472chr13905 819 269 11093 ----
NM_006479chr123921 407 208 ----2937 743
NM_006482chr12123937 3900 3422 3158 2522 2419 1437 1335 848 542 135 120 22977 1359 1680 --
NM_006496chr181959 1607 1323 1238 445 401 256 124 11948 21772 1582 1428
NM_006497chr171813 ------
NM_006502chr62346 110 476 62 56 46 --1231
NM_006504chr1082846 2820 2777 548 310 252 157 92 1524 22355 996 --
NM_006520chrX91729 1670 1517 1356 1066 596 579 498 269 --1508 --
NM_006526chr2081931 1868 1762 1495 1447 818 314 67 --11708 --
NM_006529chr4101611 1514 1191 1178 1166 1065 540 531 423 384 ------
NM_006530chr121344 ----1168
NM_006534chr2072567 2528 2477 2374 2329 2084 1270 12091 12669 --
NM_006537chr152235 166 ------
NM_006538chr294189 4109 3206 2874 2728 2535 1518 498 391 43523 3229 1669 795 14177 11567
NM_006540chr831443 1291 462 11359 ----
NM_006544chr14246117 6064 5860 5262 5100 4525 4354 3873 2377 2305 2140 2132 2115 2072 1923 1847 1693 1665 1465 1147 965 499 373 225 45704 5138 4196 1898 21456 1270 35324 3961 3920
NM_006546chr17136233 6055 5826 5750 5728 4833 2641 2511 1785 1704 1669 1214 486 2724 496 1417 15372
NM_006547chr732136 2109 620 ------
NM_006548chr351606 1488 585 531 513 ------
NM_006549chr1262860 2660 2578 1899 652 579 1318 ----
NM_006554chr24325 221 82 26 ------
NM_006557chr981766 1630 1538 1529 1444 259 148 105 --1430 --
NM_006558chr84461 362 191 66 ------
NM_006559chr12974 230 --1853 1882
NM_006561chr1056182 5066 3941 1386 824 55962 4931 4675 1833 53 12210 --
NM_006565chr1641079 841 357 66 1981 1883 --
NM_006572chr17122938 2853 2537 2370 1368 1221 963 631 405 132 103 31 23220 2653 --22843 2547
NM_006575chr146989 580 570 548 265 154 --11441 --
NM_006577chr261139 1014 473 227 187 21 1909 ----
NM_006593chr21509 --1683 --
NM_006595chr1162074 1794 686 485 431 275 11453 21350 323 --
NM_006599chr16268011 8000 7882 7335 6580 6148 5631 5379 5312 4990 3222 3061 2558 2490 2375 2189 1889 1699 1433 1105 1076 937 828 387 277 53 38141 5264 198 57179 6470 2962 2771 506 11070
NM_006601chr123920 380 195 --11135 --
NM_006602chr201273 --1548 --
NM_006603chrX51982 1596 578 58 38 11438 ----
NM_006609chr2102830 2310 2291 2239 2052 1986 964 574 232 177 --21927 192 --
NM_006614chr3103078 2787 2419 1345 1290 1276 641 544 529 478 23651 818 ----
NM_006618chr151474 1378 463 326 187 21081 1061 11151 --
NM_006620chr663662 3553 3266 3147 1413 732 24295 2985 --14458
NM_006621chr161695 1614 734 667 292 77 ----11486
NM_006624chr1081459 739 717 693 642 262 229 136 2314 253 41989 1434 677 156 --
NM_006626chr9152632 2323 2097 2032 1995 1978 1831 1691 1663 1032 861 695 568 457 54 --22491 99 12475
NM_006628chr15123989 3975 3600 3498 2969 1857 1816 1520 1002 903 549 301 --34218 4141 3772 --
NM_006629chr1861074 1057 940 851 673 645 ------
NM_006633chr51727 ------
NM_006642chr1--1286 ----
NM_006644chr133161 117 92 ------
NM_006646chr13103012 2915 2526 2360 2221 2183 1958 1013 740 401 32763 2423 2211 --12411
NM_006654chr12124432 4422 4403 4048 3928 3861 3514 1564 1380 1313 641 112 43738 846 139 72 34130 2953 1836 --
NM_006656chr113842 321 150 21105 989 1974 --
NM_006681chr4----121 --
NM_006691chr1131052 1042 1020 ------
NM_006693chr71844 --1601 --
NM_006699chr1102708 2578 2287 1865 1762 1746 1704 1667 902 689 --1652 1569
NM_006703chr61371 --158 --
NM_006704chr135450 305 143 95 78 ----1292
NM_006705chr91454 ------
NM_006706chr54806 579 237 229 1708 --158
NM_006716chr751371 1220 1214 354 55 --1146 --
NM_006717chr9123355 3270 3264 3239 3200 2832 2618 2284 746 495 303 293 --1526 --
NM_006718chr611120 --1840 1404
NM_006721chr104678 628 266 124 1279 --1168
NM_006722chr352453 677 525 159 110 --193 --
NM_006726chr421240 150 2359 254 ----
NM_006727chr53377 109 89 ------
NM_006729chrX225258 5136 5078 4822 4786 4449 4139 4111 3945 3927 3831 3822 3610 3600 2040 1921 1847 1356 1092 740 563 341 14885 23523 1864 14463
NM_006731chr9155841 5610 3996 2151 2052 2000 1772 1477 1426 971 952 924 894 798 548 65793 5742 4507 2330 996 734 54984 4277 2026 1646 275 34660 4305 176
NM_006734chr621536 36 --11354 --
NM_006735chr72136 93 1291 ----
NM_006738chr15124601 4565 4006 3460 3206 3143 2900 1830 1764 1557 1412 1312 12980 ----
NM_006750chr16127948 7888 7863 6581 6113 6087 2648 2640 2347 2113 1358 765 22797 2575 57518 5399 5012 2912 1957 27008 2257
NM_006751chr23908 887 186 ------
NM_006754chr721266 256 1316 11135 --
NM_006755chr111138 ------
NM_006756chr871089 1003 991 509 442 197 100 ------
NM_006763chr151923 1760 1650 811 512 --11809 11575
NM_006766chr882359 2351 1794 1678 727 211 160 123 32344 1914 350 32263 696 277 --
NM_006772chr611389 ------
NM_006773chr251623 1558 1530 265 49 --11284 --
NM_006775chr662877 2832 2608 2472 1165 289 --1403 1721
NM_006777chrX72588 2177 1975 1051 1015 867 146 22262 896 32870 393 161 1861
NM_006785chr1871792 1721 878 835 816 384 31 1274 11958 1777
NM_006788chr1821613 110 --2811 256 --
NM_006791chr151650 1641 1617 --
NM_006807chr1711170 1328 ----
NM_006813chr65781 649 609 295 36 ------
NM_006814chr2031908 1712 785 12391 ----
NM_006823chr81912 11040 ----
NM_006827chr1482841 2650 2510 2259 902 888 840 513 32789 2660 1216 13392 --
NM_006832chr141739 ------
NM_006838chr1261844 1777 1619 1568 411 35 1432 ----
NM_006851chr1252504 2488 2440 959 657 1178 1460 --
NM_006852chr17102517 2403 2375 2012 1955 1160 1121 1036 570 125 ------
NM_006854chr781619 1599 1494 1437 1273 360 321 194 ------
NM_006868chr1872763 2216 2003 1957 689 626 313 13220 ----
NM_006873chr273240 2954 2315 1256 1160 814 791 32612 620 355 1441 --
NM_006874chr431126 923 384 1882 ----
NM_006884chr32503 370 ------
NM_006885chr1654047 3569 3507 2857 2756 ------
NM_006888chr1463423 2825 2267 855 712 680 11104 21308 54 --
NM_006892chr2041389 1314 971 426 ------
NM_006892chr2041389 1314 971 426 ------
NM_006902chr193038 2989 2968 2732 2150 2114 1259 712 657 22086 1345 ----
NM_006908chr751462 1416 584 179 143 1923 11018 --
NM_006910chr162296 53 ----1284
NM_006912chr122522 964 ------
NM_006914chr951544 1091 1024 298 258 1982 ----
NM_006915chrX62429 2213 1876 1618 1595 562 ------
NM_006918chr11185563 5506 5265 5155 5144 4955 4670 4517 3914 1929 1680 1330 954 892 590 291 248 203 14405 ----
NM_006920chr281867 1715 1646 1628 1410 745 685 414 11495 ----
NM_006922chr2122334 2135 1852 1738 1647 1594 864 718 597 580 524 22 ------
NM_006924chr17104450 4253 3963 3934 3812 3345 3248 3047 2788 574 --167 --
NM_006931chr1252132 1526 610 504 186 1169 11405 --
NM_006937chr172464 424 ------
NM_006939chr1451209 1203 942 434 334 ------
NM_006940chr1261852 708 668 419 285 120 ------
NM_006941chr2211042 ------
NM_006947chr451513 1420 1357 286 149 2700 115 2566 430 --
NM_006948chr2152198 2121 1796 276 138 22087 900 ----
NM_006951chr101267 ------
NM_006962chrX154 ------
NM_006963chr1021209 120 1290 172 --
NM_006965chr1841041 916 436 203 --1236 1140
NM_006977chr14278 21 ------
NM_006981chr962639 2263 1093 1068 639 614 --11112 --
NM_006990chr11109 1195 ----
NM_006999chr52609 570 3538 343 167 ----
NM_007005chr931143 961 555 --11224 2261 205
NM_007007chr12174702 4527 4519 4402 3913 3701 3101 3083 3074 1417 1407 1061 1044 963 915 584 485 --21928 1770 144
NM_007008chr23770 307 240 2128 35 ----
NM_007011chr15126881 6735 6670 5857 4775 2760 2645 1395 1219 781 739 698 15995 25296 2413 16228
NM_007013chr83981 907 226 11003 1104 --
NM_007017chr52685 267 1171 ----
NM_007018chr92380 317 ------
NM_007023chr261078 1006 840 777 407 262 11102 148 1876
NM_007026chr17------1237
NM_007034chr121043 694 --2838 822 --
NM_007036chr54821 283 104 36 ------
NM_007038chr21175904 5845 4921 4900 4857 4652 3979 3967 2074 1868 1771 1622 1554 1443 650 639 584 46017 1341 895 352 25802 4287 11836
NM_007039chr1472298 2026 1911 1853 508 375 290 ------
NM_007040chr191224 1691 ----
NM_007054chr5113264 2806 2666 2642 1000 933 900 853 784 587 548 --23996 3628 163
NM_007064chr361710 652 551 376 303 291 --1666 --
NM_007074chr161107 ------
NM_007078chr1052443 2211 1972 615 137 ------
NM_007106chr1381793 971 838 667 384 283 146 34 42742 2037 1877 598 1870 1319
NM_007107chr352395 2173 2149 1936 845 --1522 --
NM_007112chr1134 ------
NM_007114chr383163 2987 2327 988 609 532 521 126 23172 2698 23192 425 --
NM_007115chr22360 341 1480 150 --
NM_007118chr53692 625 302 ----163
NM_007124chr642030 1800 1765 1264 11619 ----
NM_007125chrY1519 --1344 --
NM_007126chr9--1205 ----
NM_007137chrX85323 5254 4852 4350 4269 3893 3583 651 14809 14093 23932 1778
NM_007145chr1921369 306 1241 ----
NM_007147chr1911069 11055 2249 68 --
NM_007150chrX52084 2019 1376 707 564 --1763 --
NM_007156chrX153 ------
NM_007157chrX132984 2667 2490 2439 2375 2331 2114 1169 1096 782 754 155 53 11993 1477 --
NM_007158chr151163 1112 885 498 248 ------
NM_007159chr361531 1274 702 238 226 81 ------
NM_007166chr1131047 565 437 41399 1339 1187 1106 --11513
NM_007170chr11641 3927 874 623 ----
NM_007172chr2252699 2140 2057 1251 233 42598 1307 1045 622 --12397
NM_007173chr1172428 2317 2263 2063 1557 701 562 2469 37 21712 133 1299
NM_007175chr8103549 3530 3034 2959 2886 2660 2613 701 270 102 144 ----
NM_007191chr123465 202 114 1286 --1262
NM_007192chr142463 56 11138 ----
NM_007195chr18133619 3529 3194 3156 2756 2436 2387 1475 1331 1059 817 204 48 --11156 --
NM_007200chr15124601 4565 4006 3460 3206 3143 2900 1830 1764 1557 1412 1312 12980 ----
NM_007203chr963980 3777 3752 3029 2952 484 1773 ----
NM_007204chr14610 513 238 127 1187 ----
NM_007207chr12933 235 1970 ----
NM_007212chr1102119 1772 1489 915 672 635 538 427 303 92 1466 2149 112 21452 751
NM_007214chr6146 ------
NM_007217chr3166 ------
NM_007218chr81915 ------
NM_007222chr851619 1237 439 296 249 --177 --
NM_007231chrX62056 1784 1645 401 381 342 12261 22121 721 --
NM_007235chr12----3368 358 157 --
NM_007236chr1592464 2391 1976 1790 1640 1538 474 443 252 --1766 --
NM_007246chr47920 912 820 790 776 367 259 21016 374 1414 1222
NM_007249chr13258776 8602 8579 7978 7878 7727 7405 7230 7185 6694 6625 6463 6121 5879 3215 3113 2670 2594 1972 1899 1883 1706 1414 432 301 45735 2869 2120 2005 46331 2502 1145 640 38899 7028 1067
NM_007257chr852790 2292 2012 1823 55 22478 2052 1651 --
NM_007266chr23644 145 44 --1108 --
NM_007269chr13570 560 241 ------
NM_007279chr191413 ------
NM_007281chr41183 ------
NM_007282chr3------1666
NM_007285chr16--165 ----
NM_007287chr363192 2985 2418 2342 1274 748 --23079 673 --
NM_007288chr363192 2985 2418 2342 1274 748 --23079 673 --
NM_007289chr363192 2985 2418 2342 1274 748 --23079 673 --
NM_007292chr17124865 4369 4130 4015 3877 3825 3675 3516 3365 3201 1159 59 34170 4059 329 34633 666 70 13591
NM_007294chr1741275 1195 233 180 1963 1989 --
NM_007295chr1741275 1195 233 180 1963 1989 --
NM_007296chr1741275 1195 233 180 1963 1989 --
NM_007297chr1741275 1195 233 180 1963 1989 --
NM_007298chr1741275 1195 233 180 1963 1989 --
NM_007299chr1741275 1195 233 180 1963 1989 --
NM_007300chr1741275 1195 233 180 1963 1989 --
NM_007302chr1741275 1195 233 180 1963 1989 --
NM_007303chr1741275 1195 233 180 1963 1989 --
NM_007304chr1741275 1195 233 180 1963 1989 --
NM_007305chr1741275 1195 233 180 1963 1989 --
NM_007308chr42699 491 --1125 --
NM_007331chr452769 2374 1769 672 243 --11968 --
NM_007345chr1872201 2071 1859 1819 1785 1449 379 12235 12213 --
NM_007347chr1583118 2652 2392 1168 1091 870 472 313 1964 ----
NM_007349chr72182 165 ------
NM_007350chr12154552 4093 3976 3954 3841 3677 3414 2819 1505 1490 1261 996 426 374 289 54628 3463 1239 396 74 1263 --
NM_007351chr43979 404 62 11167 ----
NM_007358chr1111947 1868 1817 1653 1296 298 226 217 190 88 40 11500 1496 --
NM_007359chr1761226 1128 435 343 307 27 1218 1497 --
NM_007361chr143637 558 237 --1646 1178
NM_007363chrX6902 815 793 750 371 300 2781 765 ----
NM_007373chr1091810 1216 718 674 468 432 378 352 160 11114 ----
NM_007375chr192824 2801 2446 2392 2376 2196 1828 183 49 ----1101
NM_009585chr34881 682 277 31 ------
NM_009585chr34881 682 277 31 ------
NM_012064chr1211043 11099 1170 --
NM_012069chrX82715 2643 2584 2459 2444 2337 2315 128 1754 12733 --
NM_012074chr142273 106 ----1361
NM_012081chr563132 3122 2382 1434 429 238 ------
NM_012082chr84793 694 665 640 1188 ----
NM_012084chrX2522 477 ------
NM_012089chr161547 1526 441 293 246 171 41554 1426 566 232 ----
NM_012090chr131213 366 341 1163 ----
NM_012092chr221440 115 --1615 --
NM_012093chr141177 1131 854 461 ------
NM_012095chr1062540 2135 992 691 407 214 1878 23368 1003 13546
NM_012096chr3133083 2981 2943 2810 2583 2398 1430 1396 1267 1137 845 280 178 21000 652 1966 --
NM_012097chr262310 2107 1740 1429 352 305 12268 ----
NM_012102chr162639 2395 548 449 277 103 --1466 1494
NM_012104chr1173781 3450 2987 2671 2613 1422 997 22533 1191 11031 --
NM_012104chr1173781 3450 2987 2671 2613 1422 997 22533 1191 11031 --
NM_012108chr41360 2531 48 ----
NM_012110chr4--1254 ----
NM_012124chr114702 580 176 42 --181 --
NM_012125chr15--2511 87 ----
NM_012129chr7102025 1890 1858 1750 754 651 221 197 188 88 --11909 1342
NM_012134chr151465 1331 1227 651 211 ------
NM_012137chr192920 2794 2715 2589 2011 1814 883 861 345 12022 1987 --
NM_012141chr13144025 3977 3333 3121 2908 2887 2715 1191 596 379 302 86 74 37 33582 2786 1555 --13031
NM_012155chr19145 ------
NM_012156chr2063280 3169 2580 706 628 558 23139 2874 ----
NM_012158chr1341500 1489 1434 220 2393 116 ----
NM_012160chr63517 363 52 ------
NM_012164chr9197472 7206 7192 6123 5729 5607 5522 5198 4635 2760 2739 2372 2270 2038 1570 1219 1210 548 281 36334 5931 1407 27035 5689 --
NM_012175chr113956 841 581 1618 1212 1652
NM_012176chr52253 244 ------
NM_012177chr61617 188 ----
NM_012180chr45489 205 195 185 149 ------
NM_012183chr11622 ----1510
NM_012193chr11135432 5025 4897 4441 3990 3571 1959 1590 1141 1021 772 681 522 --1589 --
NM_012199chr184227 4037 3236 1635 1597 1518 748 651 ------
NM_012207chr1051000 372 333 207 27 1820 ----
NM_012214chr2166210 5894 5311 5271 5062 4902 4737 4563 4044 2065 1984 1940 1861 1081 1026 68 56300 6225 5503 1224 682 22387 900 34629 4506 798
NM_012215chr106797 722 406 373 313 237 170 --1289
NM_012219chr3103227 3142 2630 2511 2336 1260 1241 1141 1081 736 ------
NM_012223chr231334 955 148 21245 229 ----
NM_012234chr383708 3408 3394 2669 2544 953 633 224 --42912 1377 302 91 --
NM_012238chr1061704 1650 1260 520 313 156 31195 423 237 ----
NM_012243chr16917 723 649 356 336 61 ----1838
NM_012245chr141397 ------
NM_012247chr1041057 867 811 203 1361 --1267
NM_012249chr253497 2863 2724 845 785 22610 2596 22293 1284 11235
NM_012250chr1151074 880 418 348 48 1430 ----
NM_012252chr7245363 5283 5179 5096 5033 5007 4876 4499 4427 4183 4023 3609 3568 3538 3372 2157 2118 2009 1857 1846 1139 897 727 395 21611 1081 75331 5124 3922 1817 1754 573 419 24486 2131
NM_012257chr721038 132 --1867 1813
NM_012262chr1124843 4544 4513 3942 3304 1548 1502 1248 1130 1032 862 571 44914 1423 734 51 24182 3297 --
NM_012281chr782362 2186 1888 1809 1735 1509 375 144 22087 528 11907 --
NM_012284chr121317 ------
NM_012287chr384489 4014 3941 3887 3580 1193 98 71 1384 11680 --
NM_012288chr675761 4679 3667 1855 1743 766 380 23986 363 1215 --
NM_012290chr23294 220 29 --1554 --
NM_012294chr793690 3396 2897 2692 1413 1397 1204 800 771 34052 1541 1264 22674 1195 1735
NM_012296chr1123716 394 --12594 13760
NM_012297chr4122253 2097 1874 1854 1690 935 923 545 406 130 67 23 32513 1910 1029 1320 --
NM_012300chr531000 418 39 1462 1549 --
NM_012301chr782187 1883 1766 1660 822 793 772 457 2707 84 12244 11590
NM_012302chr121270 161 1791 1501 --
NM_012307chr181172 1901 --1263
NM_012309chr11124791 4669 4661 4585 4146 3838 3221 3207 3126 1915 1908 325 24815 170 11674 --
NM_012316chr195470 2085 2038 1639 1197 940 562 534 389 35225 4922 3935 12230 --
NM_012322chr7163 ------
NM_012325chr2021604 356 --11187 --
NM_012327chr1821590 1579 ------
NM_012328chr751275 1260 1243 235 53 11387 170 --
NM_012329chr1771388 1055 646 560 502 286 118 --1165 --
NM_012330chr1021757 1379 11597 ----
NM_012333chr141320 1243 600 568 11063 2465 74 --
NM_012334chr573418 3287 3157 2881 958 770 572 --24701 3296 11108
NM_012338chr751262 1143 965 789 55 ------
NM_012343chr521101 183 1942 ----
NM_012347chr652835 2661 2387 2278 366 ------
NM_012388chr1572871 2341 2242 316 239 218 208 ------
NM_012399chr2241775 1287 577 526 2356 329 ----
NM_012405chr183826 3004 2810 2663 2650 1070 515 90 --13115 --
NM_012406chr123977 356 23 1108 1892 --
NM_012412chr72849 83 ------
NM_012413chr21466 --1452 --
NM_012414chr12820 85 ------
NM_012416chr941078 816 397 182 --1960 --
NM_012417chr172546 436 136 2229 68 --
NM_012419chr62534 478 1640 ----
NM_012420chr1061556 1498 766 606 508 170 11648 11567 --
NM_012421chr11467 ------
NM_012426chr161332 ------
NM_012428chr152794 695 --162 --
NM_012430chr35773 765 750 547 274 ------
NM_012443chr102908 131 1803 ----
NM_012448chr1732357 2157 1008 237 22 1444 --
NM_012454chr62565 126 ------
NM_012463chr1251496 659 519 400 296 21531 100 --11401
NM_012464chr492902 2889 2732 2378 2013 1917 613 380 139 22715 2469 1495 --
NM_012465chr10103381 3310 3163 2795 1308 1179 470 393 162 36 12189 ----
NM_012479chr742507 2364 2334 48 32695 1942 902 --12328
NM_012484chr51103 ------
NM_013229chr12132830 2720 2665 2248 2191 1811 1037 737 600 548 452 190 39 ------
NM_013230chrY51591 1526 1218 42 25 21621 100 11470 --
NM_013231chr14134412 3974 3380 3208 1705 1479 1415 1349 1240 1142 1117 233 180 33460 1165 754 11632 11297
NM_013233chr231042 545 171 --21211 375 --
NM_013243chr153466 86 25 ------
NM_013249chr113370 333 81 3351 342 166 ----
NM_013254chr125725 468 195 189 165 ------
NM_013255chr7278877 8686 8183 7415 7147 6847 6506 6327 6244 5898 5861 5799 5717 5481 2883 2165 2142 2117 2084 2047 1988 1205 1176 856 273 126 46 42898 2709 2674 939 58654 7111 6919 6804 1811 28745 6617
NM_013257chr822377 143 --12166 --
NM_013261chr4133262 3169 2969 2760 2746 2623 2613 2599 2340 2300 1455 1193 914 23547 2519 11515 --
NM_013264chr11173 ------
NM_013269chr1274178 3732 3389 3349 3237 564 470 24225 640 11390 23561 30
NM_013277chr1241010 926 344 241 ------
NM_013280chr112602 181 ------
NM_013281chr2051552 1365 1309 478 260 --21149 341 --
NM_013282chr1991277 1128 1119 1020 1008 983 936 429 133 1175 ----
NM_013283chr54872 743 195 116 1342 ----
NM_013293chr72677 266 ------
NM_013302chr16184709 4580 4310 3996 3599 3330 1874 1853 1325 1302 1002 977 694 673 455 353 315 127 23419 604 ----
NM_013316chr751062 685 666 196 125 --1814 --
NM_013322chr741431 1292 1091 254 31254 1168 694 ----
NM_013336chr33215 168 154 ------
NM_013341chr251951 923 740 576 508 12517 2792 113 --
NM_013352chr63910 808 747 1829 ----
NM_013367chr41107 ------
NM_013372chr1572918 2897 2870 2568 2406 2238 765 12655 12213 23358 2941
NM_013373chr2211032 ------
NM_013374chr3102770 2670 2595 2352 2215 1012 661 529 460 452 ----22751 2462
NM_013377chr123197 151 123 --1603 --
NM_013380chr192775 63 --127 --
NM_013381chr12132441 2109 1759 1725 1683 1526 1499 967 929 868 621 521 128 32373 748 104 ----
NM_013386chr171737 1713 1602 1372 1344 1191 234 ----2657 338
NM_013390chr931599 487 102 11674 1686 --
NM_013396chr213586 497 299 --1542 --
NM_013423chrX41167 1058 836 322 ----11245
NM_013427chrX41167 1058 836 322 ----11245
NM_013433chr1911820 --11632 --
NM_013436chr25762 696 625 227 132 --1297 --
NM_013437chr831332 1289 551 ------
NM_013438chr94627 616 462 237 ------
NM_013442chr9148 ------
NM_013444chrX3767 756 746 --1927 162
NM_013449chr1272715 2296 1831 708 695 586 263 22269 69 22003 653 --
NM_013450chr25944 872 797 503 423 --1460 1256
NM_013937chr671070 1021 824 776 413 293 155 ------
NM_013943chr183264 3254 3199 2735 2582 1012 450 35 53325 2756 2127 732 28 21232 1102 --
NM_013958chr82413 333 ------
NM_013959chr82413 333 ------
NM_013961chr82413 333 ------
NM_013962chr82413 333 ------
NM_013981chr5--2149 45 ----
NM_013982chr5--2149 45 ----
NM_013983chr5--2149 45 ----
NM_013995chrX52069 1926 919 670 334 12582 2714 684 --
NM_014000chr1011940 11604 ----
NM_014011chr272465 2452 1852 739 681 656 605 --1503 --
NM_014021chr1143344 3243 2977 2742 2530 1047 993 982 914 783 581 338 156 136 32865 1216 1091 --12409
NM_014028chr6102907 2832 2707 2500 2402 1306 858 594 562 318 --1146 --
NM_014031chr54346 327 235 136 ------
NM_014033chr1292283 2263 2241 1967 1890 930 905 801 603 ------
NM_014034chr641065 343 254 190 21176 951 31142 1052 526 --
NM_014043chr31333 1634 2312 159 --
NM_014048chr16105292 5234 4538 4071 4023 2026 1604 1569 987 658 14934 24252 1283 14759
NM_014057chr92531 150 --11046 --
NM_014059chr131253 ------
NM_014071chr203410 105 60 --1383 --
NM_014089chr1331892 1671 169 21729 1717 --11627
NM_014106chr15122809 2273 2095 2016 1046 1030 954 735 489 455 192 40 32789 1156 568 --12985
NM_014109chr881263 1216 813 790 430 418 349 324 2481 98 ----
NM_014112chr865377 4325 2092 1849 1550 1008 23666 2193 1527 15466
NM_014117chr1642080 2061 1990 92 ------
NM_014141chr7115118 4934 4554 3988 3844 2047 1872 1487 1292 1178 755 --23632 1388 --
NM_014153chr162609 463 ------
NM_014154chr3----2467 422 --
NM_014155chr11196866 6649 6514 6500 6486 6218 5969 5903 5317 4716 2891 2489 2424 2111 2024 846 350 256 53 22804 1696 27388 5628 27428 5823
NM_014157chr1683866 3702 3316 1432 1341 1237 1011 741 13886 1863 --
NM_014171chr24634 211 197 176 ----158
NM_014175chr8--1141 ----
NM_014181chr252799 2649 2629 948 279 22843 1893 12946 --
NM_014184chr11108 ------
NM_014189chr4------11405
NM_014190chr4------11757
NM_014191chr121213 ------
NM_014212chr124969 656 84 72 ------
NM_014216chr141124 ------
NM_014217chr171813 1723 1550 1423 1361 563 414 11511 1467 11689
NM_014223chr12295 41 ------
NM_014240chr384124 4083 4003 3563 3428 1126 220 191 --23250 1156 14042
NM_014250chr2262117 1721 365 225 190 108 --11527 1752
NM_014253chrX1741 32294 1853 499 ----
NM_014263chr10--11146 ----
NM_014264chr45645 632 603 540 118 ----193
NM_014265chr82778 126 ----1167
NM_014267chr114753 659 604 98 ------
NM_014268chr1851281 1261 1121 561 165 --11138 --
NM_014271chrX1355 ------
NM_014280chr11682 ------
NM_014283chr13594 552 164 ----11499
NM_014289chrX149 --11149 188
NM_014294chr881479 1416 966 479 469 400 346 58 11017 ----
NM_014309chr2284611 4519 3631 2076 1410 1246 608 449 15305 34883 1470 477 11204
NM_014313chr161531 1200 615 245 234 89 --11451 --
NM_014317chr10156 ------
NM_014319chr1281769 1565 1351 1255 611 386 136 68 1274 11640 --
NM_014322chr14990 403 310 257 21023 277 ----
NM_014323chr221902 1187 ----
NM_014325chr1242143 2061 788 310 12269 1707 --
NM_014331chr4207729 7686 6989 6180 6070 5839 5140 5108 4977 4936 4905 3040 2921 2740 2003 1861 1790 1040 1022 70 36831 6605 2474 46731 5713 5038 2271 26339 2655
NM_014332chrX171 ------
NM_014333chr1162818 2259 2050 1762 916 227 11750 ----
NM_014335chr154433 304 281 61 1522 ----
NM_014342chr1141410 366 269 112 ----11493
NM_014344chr112817 724 1795 ----
NM_014345chr62271 253 ------
NM_014351chr22--11473 11090 --
NM_014352chr1171224 1117 1081 962 554 312 140 1243 11367 1539
NM_014363chr136801 507 469 421 339 30 --1849 --
NM_014368chr91521 --11791 --
NM_014372chr182081 1976 1957 1939 1807 828 248 55 ------
NM_014382chr331637 1362 632 ------
NM_014386chr51100 ----166
NM_014388chr1165924 5794 5425 4867 4264 3738 2226 2080 1978 1914 1482 659 558 450 206 143 44710 2408 706 691 14117 --
NM_014392chr431340 1086 346 1239 11058 --
NM_014393chr891672 1620 1598 436 429 312 268 226 171 21990 1684 ----
NM_014397chr931171 442 60 ----1317
NM_014411chr71518 11491 ----
NM_014415chr341712 1565 1505 671 --11179 --
NM_014417chr191923 --1902 --
NM_014423chr5195655 5567 4996 4440 4383 4161 3496 1993 1980 1510 1429 1151 971 557 545 452 316 301 31 25250 4451 45203 4670 3802 1548 --
NM_014432chr61349 2612 322 --11467
NM_014445chr332223 401 41 --11692 --
NM_014447chr441660 1084 589 134 31308 439 424 1219 --
NM_014452chr62453 295 1322 163 --
NM_014454chr651095 735 681 399 389 ------
NM_014456chr1071818 760 716 513 481 154 22 11882 ----
NM_014458chr161449 1202 1139 878 500 96 11075 11231 1174
NM_014461chr31171 --121 --
NM_014469chr111339 2779 563 2307 255 --
NM_014489chr114881 846 821 705 ------
NM_014491chr74962 748 246 85 --21042 414 --
NM_014494chr1662415 1908 1876 1868 1466 119 ------
NM_014495chr13513 244 224 ------
NM_014497chr21209 --186 --
NM_014498chr31260 ------
NM_014504chr751512 503 397 263 233 1624 31791 1727 245 --
NM_014505chr122542 371 ------
NM_014515chr1261026 1018 700 657 379 239 1897 ----
NM_014516chr19--1237 ----
NM_014517chr351909 1441 1358 1318 79 11558 ----
NM_014521chr231817 622 304 --1675 --
NM_014522chrX1200 2598 23 ----
NM_014547chr155737 627 247 212 109 --3325 77 21 --
NM_014547chr155737 627 247 212 109 --3325 77 21 --
NM_014552chr261553 1383 1304 1135 609 53 11328 1560 --
NM_014554chr1221468 345 ----1488
NM_014572chr1341825 1306 1211 341 ----11476
NM_014573chr1721283 282 31722 1346 93 11150 11856
NM_014575chr31168 ------
NM_014577chr221301 --1739 --
NM_014583chr31465 ------
NM_014584chr1481383 1263 1197 1036 589 423 230 88 ------
NM_014585chr251286 1208 502 465 286 --11249 --
NM_014588chr203519 104 58 --2734 501 --
NM_014592chr51780 ------
NM_014602chr3124 ----197
NM_014606chr471523 1471 1390 1313 1094 1074 971 ------
NM_014607chr291962 1935 1548 1409 566 532 489 474 94 11766 1693 22141 2101
NM_014612chr971412 1154 978 959 371 342 333 ----11557
NM_014613chr523063 1883 11180 ----
NM_014615chr1643090 2944 2735 750 --23653 538 --
NM_014616chr373477 3381 3162 1109 827 503 342 23216 1116 33057 2735 107 --
NM_014620chr121766 ------
NM_014628chr63413 343 45 ------
NM_014629chr831253 846 505 --1238 --
NM_014630chr1583131 2925 1557 1289 1215 540 398 49 11232 31298 1198 897 --
NM_014633chr112439 100 --1116 --
NM_014635chr251656 1406 607 341 323 --11277 --
NM_014636chr9104363 4280 3752 2834 2727 1699 1350 1311 1143 1106 ----13972
NM_014637chr841448 570 435 114 ----11065
NM_014647chr1651616 848 643 271 180 1538 11454 --
NM_014659chr15----1152 --
NM_014660chr751048 951 840 715 245 2984 934 11129 --
NM_014666chr531277 348 36 ------
NM_014667chr372436 1950 1891 1748 1580 893 746 ------
NM_014670chr26520 267 251 238 131 83 11209 ----
NM_014673chr8----1109 --
NM_014674chr3164017 3930 3337 2941 2653 1613 1594 1530 1313 1234 938 824 638 381 285 96 --43779 3367 3045 2921 1718
NM_014676chr121139 183 11676 11484 --
NM_014677chr851319 1007 997 972 105 ------
NM_014678chr221104 --179 --
NM_014679chr11123 --1232 1354
NM_014682chr871702 439 398 342 217 139 133 1228 21854 1512 --
NM_014683chr1761715 1384 1326 805 533 521 1474 2586 576 1543
NM_014686chr1932553 2283 1914 21981 994 ----
NM_014689chr22175 140 ----1520
NM_014699chr163339 103 72 --1413 --
NM_014700chr1611369 ------
NM_014701chr15113336 3236 3188 3181 3134 3038 2367 1352 1343 854 265 13010 12711 12128
NM_014702chr683114 2457 2222 2164 899 190 160 111 23393 2967 23333 1005 1130
NM_014705chr772162 2007 1750 1631 1471 756 300 ------
NM_014707chr762150 2089 1922 1887 1876 444 --11422 1410
NM_014711chr1681701 1667 1587 1417 783 664 156 34 12085 21509 706 --
NM_014720chr1041567 726 665 62 31796 1335 696 2612 427 --
NM_014721chr6167385 6246 6164 6058 4559 2201 2170 1844 1826 1562 1344 878 716 661 331 41 24694 2049 32342 1530 871 12969
NM_014725chrX1989 ----11095
NM_014729chr821574 328 1585 21967 905 --
NM_014730chr12104842 4555 4154 3784 3512 1655 1559 1434 1290 891 --13898 --
NM_014730chr12104842 4555 4154 3784 3512 1655 1559 1434 1290 891 --13898 --
NM_014733chr572293 1939 1845 1839 1640 572 146 ----1746
NM_014735chrX42059 1342 512 381 11554 ----
NM_014739chr6104033 3891 3505 2760 1536 1370 1193 1174 131 102 13001 14044 1145
NM_014743chr41137 12992 32708 928 315 12741
NM_014746chr2124098 4001 3622 3436 3414 3278 3105 1636 1407 1175 374 91 23288 1032 --1927
NM_014747chr155672 5656 3731 3604 1822 --34415 2027 79 15203
NM_014750chr14272 26 1192 ----
NM_014751chr881730 1504 354 305 294 235 189 183 --1215 1491
NM_014752chr1181940 749 666 657 348 159 132 36 ------
NM_014755chr2124263 3772 3311 3210 1616 1330 1271 1158 1140 1121 1102 117 12732 ----
NM_014757chr552126 2044 1570 700 462 ----12356
NM_014758chr1162419 2321 2300 962 806 561 1826 11949 --
NM_014772chr1813126 ------
NM_014774chr193185 2287 2134 2078 1011 837 761 309 228 ------
NM_014776chr122370 355 11002 --1167
NM_014779chr3--1462 21057 1019 --
NM_014781chr83868 272 91 11080 ----
NM_014787chr152836 2007 1987 820 773 12562 --1700
NM_014795chr2121255 1236 1169 1104 1006 956 936 895 871 551 538 204 --11343 11380
NM_014802chr1261146 759 236 166 139 72 --1159 --
NM_014803chr1092842 2148 2002 1972 658 598 281 241 84 32822 2591 1935 1296 12197
NM_014810chr1143567 3304 3154 3015 2959 2838 2685 2665 2541 2370 1116 885 630 537 33540 3271 214 12597 --
NM_014812chr161320 1228 298 131 123 108 1257 1551 --
NM_014813chr12563 47 ------
NM_014819chr5102471 2256 2239 2018 1549 906 857 565 501 216 12055 11525 --
NM_014820chr372050 1890 1632 1404 785 650 188 11328 11675 --
NM_014822chr44691 628 567 233 1108 2422 67 --
NM_014824chr1171848 1731 1482 1407 403 198 62 --21807 1527 11692
NM_014827chr191727 1604 1515 1365 1135 651 588 442 224 11443 ----
NM_014829chr552258 1845 1500 521 488 12096 2868 713 --
NM_014830chr1263363 3182 2885 1320 1298 96 --23397 591 --
NM_014832chr1351984 1651 748 404 293 22066 1424 32002 1450 369 11299
NM_014836chr1061858 1827 1723 1613 151 126 11706 1557 1727
NM_014838chr2241860 1835 1081 880 21060 999 12092 --
NM_014839chr142378 1589 901 815 1701 21978 840 --
NM_014841chr621046 415 1895 ----
NM_014847chr12203 32 ------
NM_014848chr1552704 2177 1744 500 36 22279 996 21929 242 --
NM_014850chr374240 4050 3652 3017 2994 1842 1076 21399 1062 23042 1913 13130
NM_014859chr1711115 11413 ----
NM_014860chr252656 2629 1932 1634 634 21641 722 12602 --
NM_014867chr843327 1351 1026 755 1704 2843 575 1764
NM_014868chr125289 265 178 161 85 ------
NM_014870chr124726 1170 21061 797 ----
NM_014872chr942246 860 327 316 --12293 --
NM_014873chr184847 4736 4627 4574 2961 1753 1367 716 23688 1898 23820 1837 --
NM_014876chr2241760 1724 736 295 11658 ----
NM_014877chr17237619 7597 7472 7350 6925 6069 5734 5051 4928 3031 2948 2828 2687 2578 1906 1327 1245 970 791 499 473 235 158 27031 6824 47366 2199 2048 1438 24908 2222
NM_014883chr452294 2024 1559 985 674 1634 12578 --
NM_014885chr4136 1168 ----
NM_014888chr741082 513 429 388 --11422 --
NM_014890chr31264 1250 ----
NM_014891chr731683 1076 205 1583 ----
NM_014892chr62629 405 ------
NM_014893chrY42294 805 504 173 31608 1502 821 ----
NM_014897chr1792886 2526 2488 2123 1282 689 646 284 240 23123 2279 22077 521 --
NM_014899chr543083 2982 2777 2315 ------
NM_014900chr23757 192 184 1256 ----
NM_014903chr1242375 2316 951 411 167 12109 --
NM_014904chr1074031 3911 3640 3299 1631 1286 798 1306 43785 3052 1455 1336 --
NM_014905chr231967 1266 277 21539 412 21998 653 1307
NM_014906chr1794110 3747 3687 3559 3430 3201 1537 1000 734 13242 ----
NM_014912chr1093344 3235 2230 2202 2184 901 654 600 264 33384 3037 403 --23157 3020
NM_014916chr7--2747 530 ----
NM_014918chr1551359 1311 643 187 58 1499 ----
NM_014920chr6103574 3120 3058 2502 1478 936 680 358 333 242 13049 23596 1408 --
NM_014923chr1361996 1984 1467 936 226 201 1136 --12319
NM_014924chr1472307 2237 2028 807 717 642 73 --23220 2772 --
NM_014932chr351889 1769 1542 1277 252 ----1396
NM_014934chr1393120 3111 2580 2508 2491 693 442 329 317 ----23454 1253
NM_014936chr6102397 2323 2267 1779 1756 1159 1139 1091 666 435 1338 --1418
NM_014937chr1031328 1307 160 ----154
NM_014939chr1821253 562 --1440 1499
NM_014942chr632179 2002 700 52308 1938 1649 710 566 11701 12513
NM_014944chr121222 905 --11045 --
NM_014946chr2153038 3015 2764 2431 1973 1052 999 963 873 836 487 387 275 190 115 21193 60 --1751
NM_014947chr12938 459 12219 1539 --
NM_014950chr1461682 1605 1556 632 109 100 1322 --257 43
NM_014951chr1092432 2319 2156 1052 688 292 247 185 169 22055 2001 12458 21679 329
NM_014953chr13104117 3540 2728 2644 1201 1116 427 395 370 320 2911 471 14051 122
NM_014961chr462185 2122 1885 1838 1399 747 --11816 --
NM_014962chr20112873 2565 2436 2350 2250 1115 1109 942 725 443 321 22385 1945 --12120
NM_014969chr111036 21019 1013 1185 --
NM_014977chr141512 ------
NM_014978chr1041551 1416 1250 232 11466 ----
NM_014982chr14165435 4505 4337 4190 3749 2162 1796 1781 1623 1486 1438 1162 1119 1060 751 564 14565 44029 2107 1372 945 --
NM_014988chr432319 2230 441 --22373 814 1884
NM_014989chr641995 1457 732 697 11265 ----
NM_014991chr433284 2625 2513 22011 1026 ----
NM_014992chr143676 285 100 ------
NM_014996chr33867 675 204 2963 94 1752 --
NM_014999chr1241628 1267 399 198 ----31060 652 625
NM_015000chr12102989 2480 1890 1176 1100 1073 1035 780 459 427 --32393 2249 1136 12692
NM_015001chr12776 310 1783 133 --
NM_015004chr31127 ------
NM_015008chr3123578 3074 3051 2486 1232 994 690 491 471 253 236 209 33185 3174 1360 11352 --
NM_015009chr34863 741 585 295 2648 108 ----
NM_015017chr151126 388 248 230 217 140 ----
NM_015020chr1653852 3803 2509 1083 132 13465 33554 2544 931 --
NM_015024chr831364 965 408 --1972 --
NM_015025chr242679 2609 2521 824 1865 ----
NM_015026chr12204528 4508 4426 4069 3959 3872 3800 3524 3305 3110 3086 2975 1751 1713 1457 1070 1023 1014 550 423 --165 11356
NM_015027chr1642013 1779 1547 1437 11798 11237 --
NM_015032chr13122764 2581 2284 2239 1014 750 720 476 434 389 263 204 12689 2694 48 22921 564
NM_015039chr184327 3427 2796 2790 810 562 181 42 11290 22860 1513 --
NM_015040chr2103417 3222 2808 2780 2612 2514 713 635 629 585 --1234 12246
NM_015042chr1554187 3678 1501 1431 1079 1591 33651 3563 3430 --
NM_015045chr1062257 2177 1433 872 537 528 ------
NM_015046chr962706 2619 2567 2394 628 168 21118 160 2745 257 --
NM_015049chr2103286 2996 2969 2788 2739 2596 2199 2038 606 573 --23335 2653 --
NM_015051chr972182 2065 1262 874 848 136 122 2398 77 12848 --
NM_015052chr73555 414 27 1123 ----
NM_015054chr12--196 1187 --
NM_015055chr1132902 2891 487 --11016 --
NM_015057chr132615 203 ------
NM_015061chr95915 685 642 236 210 ------
NM_015064chr1233360 3262 1442 --23108 2836 11006
NM_015068chr773517 2723 2710 1584 1193 199 83 63335 1413 1096 741 588 100 --23812 1000
NM_015069chr161500 ------
NM_015071chr5146185 5271 5104 4962 4233 4146 2215 2175 1933 1658 1475 1390 1276 979 --1619 --
NM_015074chr174792 4532 3610 3025 689 552 480 34807 4801 4380 11737 --
NM_015076chr6134304 4110 3809 3515 2902 2800 1176 886 763 683 634 505 348 --11214 --
NM_015080chr112960 379 --1370 --
NM_015087chr13102725 2636 2482 2364 2239 2088 1078 152 139 52 ----1480
NM_015090chr186206 5964 5904 5603 4111 1625 1151 383 ------
NM_015091chr143777 697 247 1827 ----
NM_015092chr16144607 4543 3941 3765 3723 3540 2969 2927 1838 1501 1322 1271 1148 708 13633 54467 3527 3474 1047 988 --
NM_015093chr651843 690 522 342 21 --1738 --
NM_015097chr3112148 1931 1737 1540 906 795 659 329 291 251 147 1669 ----
NM_015100chr152019 1923 1890 352 116 --11317 --
NM_015110chr9102415 2350 2296 2065 1795 585 539 431 205 31 11566 1196 12312
NM_015115chr452795 2445 2287 344 273 11976 1964 22317 937
NM_015116chr1351374 1270 1161 387 154 21393 108 ----
NM_015122chr191231 ------
NM_015124chr2232502 2328 818 --133 --
NM_015132chr74717 664 101 60 31872 1662 800 ----
NM_015137chr852484 2136 1742 560 399 1124 ----
NM_015143chr421273 1009 --1353 --
NM_015144chr16114023 3761 3675 3242 2926 2804 2563 1395 852 816 697 23516 3317 31327 1074 97 21367 1309
NM_015153chr63661 291 105 3614 608 98 ----
NM_015155chr1032231 1294 1146 22954 884 12522 --
NM_015156chr1483813 3784 2783 2751 2567 2461 1617 769 1417 12622 24036 3724
NM_015158chr91200 2846 609 ----
NM_015161chr1651583 1459 1427 622 349 1174 --11192
NM_015163chr1441222 323 300 141 --21710 1342 --
NM_015170chr841843 1636 1607 614 11645 12115 12135
NM_015172chr141565 1450 1330 1212 1243 11260 --
NM_015176chr161774 1307 1199 446 337 325 --1191 --
NM_015180chr141570 --1754 --
NM_015185chrX52830 877 473 466 25 --11936 --
NM_015186chr91106 1134 1374 --
NM_015187chr42643 123 --2707 40 --
NM_015192chr2043000 2969 311 91 2497 472 11981 12627
NM_015196chr41126 ------
NM_015199chr382974 2287 2170 2085 1887 699 358 192 --11997 1936
NM_015200chr492508 2500 2424 2255 2162 904 825 622 473 ----1974
NM_015206chr15113808 3663 3062 2997 2976 1520 1218 1070 839 235 65 2994 592 12720 --
NM_015208chr18103430 3314 2884 2796 2678 1289 1052 549 504 177 13388 ----
NM_015213chr112721 534 ------
NM_015215chr153028 2840 2739 806 728 12436 2479 255 1524
NM_015216chr52571 480 1357 ----
NM_015225chr953132 2917 2336 1088 659 --13018 1956
NM_015230chr421636 1532 --11591 155
NM_015231chr112943 867 --1385 --
NM_015234chr631245 1052 573 21157 311 ----
NM_015235chr1072159 1889 1874 1787 796 127 38 ------
NM_015236chr411417 1999 11330 1102
NM_015239chr92351 190 ------
NM_015245chr621750 737 32740 1928 1909 22542 291 1349
NM_015247chr16145346 5336 5184 5082 5072 5066 4064 4010 3292 3267 673 521 366 308 22019 1419 --24873 1296
NM_015250chr911435 11979 1825 --
NM_015252chr25879 732 708 334 42 ----1959
NM_015256chr53525 257 157 --1564 --
NM_015265chr2132676 2642 2616 2389 2302 2255 2151 1961 1763 953 792 691 46 ------
NM_015267chr1232175 2031 1861 11827 ----
NM_015268chr32715 222 ------
NM_015269chr11155 --1645 --
NM_015271chr464080 2695 1635 1331 1321 286 14038 43359 1573 1197 446 --
NM_015272chr1651638 854 568 362 302 2689 294 1513 11665
NM_015275chr1262194 2090 1962 1530 840 345 11501 ----
NM_015277chr1841145 742 629 560 1392 ----
NM_015278chr622753 1320 73111 2851 2583 2371 663 561 250 --12506
NM_015282chr282677 1088 1078 821 576 529 424 160 3999 830 488 --22164 206
NM_015285chr1821926 642 --11820 --
NM_015291chr162878 2814 2380 2373 1085 867 43239 1176 805 67 2208 141 --
NM_015294chr17149 2789 417 ----
NM_015296chr1351184 1154 1128 996 112 154 ----
NM_015299chr1463905 3778 2591 1567 1076 166 23983 3607 --13975
NM_015305chr1421888 710 11662 11366 --
NM_015310chr8198024 7994 7676 7424 6987 6966 6640 5557 5120 5075 3149 2945 2865 2617 982 742 449 124 59 32464 2394 1256 11148 17014
NM_015313chr11144637 4074 3654 3423 3360 3113 1859 1613 1569 1152 1125 853 847 382 23723 1781 14049 --
NM_015314chr7102487 2319 2250 1812 1019 685 546 217 161 142 1125 21919 982 12423
NM_015315chr553148 2332 878 581 545 23291 2514 11031 --
NM_015316chr1421148 221 ------
NM_015317chr292630 2601 2567 2415 1905 1063 310 149 50 --32516 2369 1941 194
NM_015323chr671721 1583 270 247 180 163 38 31338 261 225 21323 329 --
NM_015326chr172808 2296 2011 1890 953 905 889 --22583 63 1440
NM_015328chr762427 2316 1911 1204 482 26 ----23072 390
NM_015335chr1242271 2117 1872 967 --11821 --
NM_015336chr1292676 2557 2091 1970 1925 1915 224 137 129 32115 853 536 ----
NM_015339chr204992 833 652 76 21002 920 1787 --
NM_015344chr831933 398 190 1158 12118 --
NM_015345chr632470 2256 676 12154 ----
NM_015347chr1232974 2366 2086 72854 2665 2492 2300 2124 680 231 21873 1815 --
NM_015349chr682724 2685 2624 2378 1070 560 359 124 ------
NM_015355chr1751255 719 570 375 324 21337 429 --1649
NM_015358chr2181297 1171 1037 982 838 423 344 73 ----1118
NM_015365chrX31539 279 243 53363 3294 3004 2905 591 11386 --
NM_015367chr2251563 1198 1050 554 228 11262 11341 --
NM_015375chr154838 4148 3672 1337 1131 14709 --14946
NM_015378chr152153 748 409 270 215 ------
NM_015381chr2242036 1567 1445 452 ------
NM_015385chr1052779 2658 2424 2286 64 12504 ----
NM_015387chr2122103 2015 1989 1787 1672 1591 1580 1517 1424 1359 681 575 1735 ----
NM_015393chr483555 3475 3451 2639 1208 1186 1151 100 33087 2989 1091 ----
NM_015394chr1251768 1692 252 194 105 11909 11633 11573
NM_015396chr34577 457 284 266 --11276 --
NM_015397chr991900 1735 1718 1655 736 467 443 222 213 --1665 11830
NM_015412chr382344 2207 1956 1948 1124 918 631 310 21933 885 ----
NM_015423chr1161247 345 310 235 88 45 ------
NM_015435chr851434 1099 1023 166 130 --11325 --
NM_015436chr483212 2942 2841 2721 2252 496 386 35 23067 302 31250 617 460 22367 375
NM_015442chr31212 ------
NM_015443chr1741465 1377 305 164 ----21171 99
NM_015446chr17643 551 534 369 341 181 110 1131 ----
NM_015455chr5154100 4049 4008 3992 3730 3455 2555 1654 1251 1138 1043 745 541 491 254 21344 284 23865 1309 22575 855
NM_015457chr112318 216 ------
NM_015460chr372056 1999 1660 1480 470 328 289 11970 21603 1532 --
NM_015461chr181603 ------
NM_015464chr73874 755 716 ----1418
NM_015472chr31553 1205 ----
NM_015472chr31553 1205 ----
NM_015474chr203252 178 103 ------
NM_015483chr74172 118 108 49 1810 ----
NM_015484chr1180 1783 1301 --
NM_015485chr1192 --2327 315 --
NM_015497chr1551107 464 406 347 125 --168 --
NM_015508chr31516 --11494 --
NM_015509chr1261528 1396 1248 501 335 242 --21537 121 --
NM_015520chr352107 1918 1060 968 847 161 22616 1024 --
NM_015530chr22785 289 1890 ----
NM_015532chr15102602 2332 2280 2237 2224 1775 1090 557 223 103 12263 11870 --
NM_015535chr273820 2965 2583 1486 1278 1042 904 12762 14205 1177
NM_015541chr361374 1278 1251 344 305 248 ----1271
NM_015542chr1011104 --2502 248 11223
NM_015544chr171606 2593 403 ----
NM_015548chr64786 725 361 165 ------
NM_015550chr7113296 3004 2982 2969 2492 2272 1189 1034 1002 462 148 33409 3282 534 33508 2370 304 13336
NM_015553chr6104976 4805 4184 4060 3958 1414 1236 1228 1194 344 1901 11487 --
NM_015554chr1532364 1094 797 32667 1836 1155 22291 2033 --
NM_015555chr681324 1214 1197 631 538 480 348 149 ------
NM_015556chr141213 ------
NM_015564chr5113388 3320 3157 2819 2696 2637 2567 2340 1183 156 77 11060 1106 1481
NM_015565chr2162023 1947 1519 1478 1427 903 ------
NM_015567chr1331311 1108 932 1855 --1894
NM_015569chr1144769 4714 4666 4660 4616 4387 3649 3093 2989 1887 1329 1256 1025 946 23598 149 24090 3426 11877
NM_015570chr751448 1297 1261 694 194 ----11804
NM_015571chr672548 1943 1683 584 250 194 108 1488 32035 1991 1018 --
NM_015575chr253665 3494 3453 2806 777 33577 3279 1097 --1896
NM_015576chr382523 2193 2157 2126 1012 805 709 333 11090 ----
NM_015577chr511337 --1695 --
NM_015578chr1941470 678 538 70 11458 11971 --
NM_015601chr104859 332 272 218 ------
NM_015605chr1081521 1515 1301 1122 1040 264 230 163 1603 11565 --
NM_015610chr752883 1999 622 537 215 21014 181 12479 --
NM_015626chr174935 371 348 206 ------
NM_015630chr23955 765 449 ------
NM_015635chr961811 1669 1568 1448 1377 216 1138 ----
NM_015640chr1145381 5325 5149 4623 4310 4129 3506 1722 1674 1410 1399 1089 497 140 53278 2148 1493 721 550 23561 569 2614 246
NM_015660chr71269 1228 ----
NM_015668chr81156 ------
NM_015676chr142409 325 1146 ----
NM_015678chr1341149 1115 648 510 1659 11294 --
NM_015687chr62527 393 ------
NM_015695chr662149 2114 1790 1383 523 503 ------
NM_015713chr8103423 3224 2720 2248 1442 824 550 317 78 58 23551 343 33055 2393 161 --
NM_015716chr171488 ------
NM_015723chr7----1523 --
NM_015844chr182991 793 ------
NM_015846chr182991 793 ------
NM_015847chr182991 793 ------
NM_015850chr832217 1778 221 1863 --12348
NM_015852chr793484 3430 3393 3106 2879 2857 2766 2477 1387 33597 3345 846 --2762 174
NM_015853chr112169 24 177 ----
NM_015878chr852251 805 552 368 89 --1899 --
NM_015879chr18178455 7968 7308 7022 6983 6746 6232 6176 5880 5622 2306 2232 1464 1350 1091 778 456 45264 2127 1738 270 16787 --
NM_015885chr11169 ------
NM_015886chr8155448 5359 4867 4557 4239 3816 3727 2141 2070 1511 1481 455 201 108 77 11427 14253 14142
NM_015888chr193257 2884 2098 1105 916 622 432 368 152 22711 1048 21318 397 1342
NM_015895chr62194 31 ------
NM_015902chr83860 278 45 ------
NM_015906chr1104631 4424 4297 3774 3637 3259 3114 3063 1888 607 34181 4094 3590 3953 881 383 11168
NM_015912chr832500 2094 777 12484 --12006
NM_015914chr16296 67 ------
NM_015938chr35772 739 247 233 76 1287 1798 1354
NM_015939chr202663 26 ------
NM_015952chr6--1105 ----
NM_015960chr101301 --1112 --
NM_015975chrX6674 634 567 418 336 82 ------
NM_015980chr511573 --11639 --
NM_015984chr14581 459 421 357 2544 47 ----
NM_015986chr1721232 199 ----1533
NM_015995chr1575530 5377 4199 4158 4040 887 114 12194 14282 --
NM_015999chr12583 472 ------
NM_016002chr11725 2644 260 --1707
NM_016003chr752883 1999 622 537 215 21014 181 12479 --
NM_016009chr154909 4041 3861 1498 83 23747 575 53854 3809 1934 1731 475 --
NM_016018chr8122521 2511 2338 2298 2069 2029 1849 1742 1042 778 463 291 22382 2354 ----
NM_016021chr682157 1945 1190 870 591 550 320 272 12305 1710 11015
NM_016022chr121046 725 ------
NM_016023chr8102095 1824 1575 1413 1368 1344 805 408 192 179 1265 11797 1313
NM_016026chr1441106 564 554 277 1594 11306 21280 391
NM_016028chr1121168 24 2280 38 ----
NM_016037chr14945 318 222 202 --1389 --
NM_016040chr1122664 2557 2390 2081 1952 876 755 612 277 259 129 84 1649 12053 32248 464 150
NM_016057chr1221242 813 --11100 164
NM_016061chr25564 228 178 170 24 ------
NM_016072chr1282288 1946 1555 1505 912 884 566 500 ------
NM_016073chr152998 907 ------
NM_016075chr1362827 2641 2410 2229 2005 524 1485 --12695
NM_016076chr163015 2902 2606 2226 1283 306 23039 352 1373 33160 3076 344
NM_016079chr242303 2024 345 335 ------
NM_016081chr442066 1803 1734 1625 ------
NM_016083chr673740 1226 906 865 771 632 37 23522 751 13472 11015
NM_016087chr751688 1662 1598 1292 160 --1589 11642
NM_016090chr116961 953 945 929 315 127 1843 ----
NM_016093chr52152 139 ------
NM_016096chr861846 1582 1405 868 808 239 12004 ----
NM_016097chr1811090 1690 ----
NM_016100chr201359 159 ----
NM_016101chr1661415 1180 565 347 206 90 ------
NM_016103chr52386 352 ------
NM_016104chr6--1105 ----
NM_016106chr141134 ------
NM_016107chr521046 257 1927 --1327
NM_016118chr71821 --21162 28 --
NM_016120chrX1281 1340 1347 --
NM_016121chr15967 882 199 190 125 1993 --21106 362
NM_016125chr172518 409 2460 82 ----
NM_016131chr292198 1786 1760 1671 945 692 502 473 361 11475 31887 385 181 1632
NM_016132chr1593200 2899 1063 1039 1015 535 381 257 163 12202 --1943
NM_016133chr2101547 1499 1408 1256 1201 1148 1039 458 295 283 --1644 11622
NM_016138chr1641831 1314 600 109 11279 1265 1648
NM_016139chr71272 ------
NM_016152chr341163 811 253 201 ------
NM_016162chr122858 840 ------
NM_016166chr15--1176 ----
NM_016169chr1083293 3218 3145 3011 2804 2027 1150 878 ------
NM_016179chr13142 ------
NM_016195chr104891 343 139 31 ------
NM_016200chr72751 696 --135 1739
NM_016201chr351948 1677 1486 561 534 ------
NM_016203chr71905 ------
NM_016206chr3188594 8465 7807 7413 7170 7116 7110 6659 6650 6261 6115 5995 3325 3063 2875 2284 2232 1744 77895 7702 7218 6875 6359 2323 1654 38656 6857 1967 11735
NM_016216chr32534 196 ------
NM_016217chr693228 3147 3088 2762 2582 2487 1024 390 60 13107 2853 253 --
NM_016218chr561283 1190 361 192 172 26 ------
NM_016221chr552104 1691 1511 688 665 22333 564 --1808
NM_016224chr63830 764 343 --1372 1266
NM_016227chr13594 552 164 ----11499
NM_016230chr61394 ------
NM_016231chr1731527 177 98 11395 ----
NM_016248chr13113992 3807 3304 3271 3024 1149 945 888 875 853 383 33453 2951 513 ----
NM_016252chr22630 153 1931 ----
NM_016255chr642332 1026 414 208 22396 311 11088 --
NM_016257chr183017 2440 1410 1367 1340 677 212 159 32595 2480 2194 --1906
NM_016258chr11550 ------
NM_016260chr2237332 7235 6672 6265 6054 5738 5732 5599 5517 5100 2934 2922 2873 2864 2651 2551 2479 2307 2250 2235 1874 671 468 26441 512 56764 6525 6476 2348 1142 --
NM_016261chr17166 155 --1575
NM_016269chr41147 ----1938
NM_016271chr18122326 2022 1688 1526 690 619 579 480 378 293 270 25 147 --1754
NM_016272chr2252487 2326 2150 106 100 1296 ----
NM_016275chr382727 2115 2019 1056 1042 1011 818 581 21859 893 ----
NM_016277chr661540 1308 1097 465 288 211 1652 ----
NM_016281chr1231048 964 870 1836 ----
NM_016287chr192111 1851 1287 745 485 329 103 49 43 --32061 2045 1424 --
NM_016289chr292359 2285 2199 1905 688 642 626 354 212 ------
NM_016298chr342379 2276 2033 664 ------
NM_016301chr123423 415 151 --1191 --
NM_016302chr33559 525 305 ------
NM_016303chrX1401 ------
NM_016304chr151122 --1593 1190
NM_016306chr31117 194 ----
NM_016308chr172076 1785 1449 1326 1260 761 146 11279 190 --
NM_016312chr122416 107 ------
NM_016315chr251745 1533 1524 327 171 11370 21345 130 --
NM_016316chr21101 ----1520
NM_016322chr9102658 2637 2513 2123 1120 965 939 608 577 81 ------
NM_016338chr531119 304 206 --21251 969 --
NM_016351chr72641 166 ------
NM_016352chr741432 506 488 207 --1473 --
NM_016353chr872333 2277 1922 1705 1543 365 268 1733 12078 --
NM_016356chr662725 1888 1795 411 376 353 3862 785 766 ----
NM_016357chr1271226 1052 1045 949 826 507 473 ------
NM_016374chr111430 21397 425 ----
NM_016374chr111430 21397 425 ----
NM_016376chr1784080 3952 3834 3562 2736 947 514 103 --33063 577 368 --
NM_016377chr61662 21776 512 ----
NM_016396chr15133040 2515 2362 2259 1968 1852 1070 569 361 245 216 125 90 21954 1935 31917 897 733 11182
NM_016410chr92413 67 ------
NM_016418chr2273796 3510 2995 2387 843 312 289 13718 11141 --
NM_016422chr11133186 3010 2888 2384 2334 2153 897 823 540 470 216 172 105 --42974 2264 705 349 --
NM_016424chr1731849 1529 790 1768 12025 --
NM_016436chr2061919 1882 754 518 451 265 ------
NM_016441chr252196 2102 2066 1998 688 ------
NM_016442chr5102334 2311 2252 2202 2153 1674 946 771 721 339 2921 744 11883 --
NM_016447chr71207 --1231 --
NM_016448chr141380 1171 470 293 1605 2490 144 1272
NM_016451chr113311 278 69 ------
NM_016467chr241427 979 943 27 ------
NM_016472chr1431222 493 93 21415 238 ----
NM_016475chr1441275 1062 962 63 1499 ----
NM_016485chr672102 1661 1533 1525 1408 526 338 166 --12155
NM_016489chr71203 1133 ----
NM_016499chr112565 177 ------
NM_016507chr1743165 2545 2429 428 ----169
NM_016513chr6103574 3120 3058 2502 1478 936 680 358 333 242 13049 23596 1408 --
NM_016516chr21546 ------
NM_016519chr41547 ------
NM_016522chr1141516 1283 1197 1139 --11528 --
NM_016530chr15114027 3804 3549 3392 3355 2854 2625 1172 832 331 279 13677 11651 23314 2869
NM_016531chr433490 553 538 13302 33593 3398 986 --
NM_016542chrX51572 1505 680 501 107 1314 --11090
NM_016557chr33713 680 284 21028 918 ----
NM_016559chr33591 518 424 --21395 1246 --
NM_016569chr1231574 1320 173 11205 1409 --
NM_016577chr374154 3052 2882 1585 1190 1175 298 11732 ----
NM_016578chr115637 259 209 145 82 ------
NM_016586chr141440 1124 --2477 155
NM_016588chr63726 310 295 1251 ----
NM_016591chr541180 1103 1032 235 1339 11142 --
NM_016599chr461451 1332 506 223 180 122 1212 --11558
NM_016603chr551812 1426 595 568 297 ----1392
NM_016604chr521274 851 21058 954 ----
NM_016605chr542762 1716 700 521 --22646 139 12381
NM_016607chrX31334 1283 52 21310 308 ----
NM_016613chr472674 2218 2107 1704 832 626 577 12008 32731 1717 1055 --
NM_016618chr25523 487 449 412 183 ------
NM_016620chr131213 1050 972 ------
NM_016621chr1194495 3961 1639 1577 1428 1291 1170 988 917 --24151 1228 --
NM_016626chr1831587 1245 1167 ------
NM_016631chr2151043 971 882 777 56 1958 ----
NM_016639chr16------1549
NM_016644chr52495 399 --135 --
NM_016649chr204181 136 93 36 1549 1115 --
NM_016651chr144952 773 363 333 1152 --1392
NM_016654chr1531367 522 54 --1465 --
NM_016824chr1081201 733 617 543 507 388 344 203 11212 21301 1193 --
NM_016831chr162379 2308 651 380 238 173 21494 280 21525 145 1857
NM_016836chr21759 ------
NM_016839chr21759 ------
NM_016929chr6134584 4447 3926 3824 3480 3308 3302 2848 2822 1331 1062 995 156 24625 424 11284 --
NM_016931chr11--1278 ----
NM_016946chr1113272 3133 3018 2787 2761 2650 2258 1057 525 364 103 12671 --1642
NM_016950chr441528 1487 389 75 11350 2348 300 --
NM_016952chr1183984 3680 3573 3380 3303 2884 501 465 22950 1121 ----
NM_016953chr2136131 5817 5773 5737 5549 4652 4491 4427 4197 4045 4028 1714 938 45900 5510 4825 54 34146 4134 1306 --
NM_016954chrX4658 598 574 47 ------
NM_017412chr841167 943 900 26 11056 1411 11191
NM_017415chr574576 3918 3238 3006 2824 1539 1209 14232 11728 1736
NM_017420chr1463665 1376 905 683 523 77 12332 146 --
NM_017423chr492160 2009 1889 1812 1645 452 444 312 233 --1830 --
NM_017437chr1462157 1489 718 603 380 188 --12316 --
NM_017440chr123561 73 45 1274 ----
NM_017444chr871626 1288 745 707 618 461 312 197 --11815
NM_017447chr21124415 4335 4011 3899 3226 2722 1597 1225 414 348 236 140 23695 895 1174 --
NM_017449chr11584 ------
NM_017452chr2041359 1295 1092 598 ------
NM_017453chr2041359 1295 1092 598 ------
NM_017454chr2041359 1295 1092 598 ------
NM_017455chr152794 695 --162 --
NM_017489chr821059 529 11203 ----
NM_017490chr111288 ------
NM_017516chr112869 761 11083 1217 --
NM_017519chr631363 910 295 --1108 11324
NM_017520chr132580 440 --1596 --
NM_017522chr111329 ------
NM_017544chrX3928 367 277 ----1621
NM_017548chr351926 1900 1637 772 746 --1296 1193
NM_017551chr1072595 2250 2227 2126 763 613 247 12390 22493 198 --
NM_017569chr134378 310 42 35 ------
NM_017578chr3121 --190 --
NM_017580chr1082392 2139 1770 1562 935 896 352 226 1334 21608 565 --
NM_017582chr131792 425 355 1479 --11486
NM_017588chr961972 1824 1701 516 345 278 ----11965
NM_017594chr973058 2909 2217 1191 1146 793 416 32476 1220 652 11226 --
NM_017599chr12142033 2013 1914 1874 1829 1748 1728 1710 1603 1415 602 460 258 183 21896 623 21941 1425 11657
NM_017610chr1571864 1354 844 740 718 385 334 --1626 --
NM_017617chr931587 1292 140 ------
NM_017628chr4175123 5106 4927 4050 3786 3738 3660 3492 3329 3281 3265 1978 1967 1908 1553 1261 518 55150 3236 1191 1091 385 43884 3505 1050 775 21795 392
NM_017629chr171667 1250 529 349 239 216 106 ------
NM_017632chr42303 91 ------
NM_017633chr663905 2821 2656 1543 546 162 13568 13537 --
NM_017634chr841973 1555 1299 1212 31671 1615 1422 11224 --
NM_017635chr1151321 1298 1057 444 180 ------
NM_017637chr9179460 9403 9332 9302 8509 7212 7066 6707 5927 3413 3178 2456 2260 598 368 240 199 15738 37594 6530 5804 29010 499
NM_017638chr12898 242 ------
NM_017641chr1261080 991 843 799 764 260 ------
NM_017643chr1782927 2635 1972 1244 793 251 240 208 22763 1905 42920 2826 1921 1028 23051 186
NM_017644chr3125221 5153 4926 4831 3828 1909 1804 1783 1772 1399 1270 506 64202 3955 2045 1312 1259 327 34373 1854 152 25048 3265
NM_017650chr7145764 4336 4147 3965 2401 2249 2068 2048 1517 1225 1158 997 179 154 31850 957 920 --1378
NM_017654chr771743 1721 1701 1489 1097 486 51 11683 21626 512 --
NM_017655chr161165 594 369 289 154 145 1414 ----
NM_017658chr14174412 4234 3674 3650 3336 3018 1595 1532 1463 1364 1161 1012 893 877 856 602 378 44209 4025 3799 3752 14113 --
NM_017660chr1943209 967 931 463 --23312 2328 --
NM_017661chr1521221 843 ----1370
NM_017666chrX101636 1474 1467 1365 711 589 357 315 183 79 --1810 --
NM_017672chr1541176 1170 1125 211 --1440 11354
NM_017680chr92240 166 ----11058
NM_017693chr1341474 1335 527 109 11457 ----
NM_017697chr87548 521 499 454 352 173 60 1134 ----
NM_017705chr15113695 3423 3383 3151 3110 2728 2597 2299 1285 355 261 ------
NM_017709chr1114071 3848 3623 2943 1570 1184 964 893 517 468 252 23169 1713 ----
NM_017714chr203957 854 88 1314 ----
NM_017719chr372380 2368 2288 1727 724 232 217 22232 982 ----
NM_017737chr152133 2087 1854 1517 345 1751 12231 22117 1450
NM_017738chr941239 1036 863 262 ------
NM_017742chr1841363 1235 557 394 ----1322
NM_017752chrX42070 1981 538 238 11454 2602 563 11474
NM_017753chr97901 678 664 400 392 217 41 --2311 235 --
NM_017754chr6114993 4664 4625 4601 4581 4470 4389 1710 1644 1601 1566 --2716 295 14771
NM_017761chr161556 1384 1363 1160 1089 454 ------
NM_017762chr1542498 783 613 189 --11795 --
NM_017769chr1482744 2629 2614 2304 2247 834 450 221 11047 1751 22363 393
NM_017772chr62577 411 ------
NM_017778chr841397 941 567 131 1466 ----
NM_017779chr192686 2473 2115 2069 1981 1015 963 286 271 22227 2169 12606 --
NM_017780chr81381 ------
NM_017785chr54542 530 504 350 1128 ----
NM_017791chr1421259 1184 --1563 21131 354
NM_017794chr94325 287 259 226 ------
NM_017798chr202894 114 ------
NM_017799chr144673 502 415 261 1313 1247 --
NM_017801chr372619 2572 2483 2407 2382 948 194 ------
NM_017811chr942743 2492 2018 359 --12704 12960
NM_017812chr71760 1728 ----
NM_017822chr122266 150 ----1755
NM_017824chr1072750 2680 2450 1759 681 639 274 12463 22218 2057 --
NM_017831chr1884150 3892 1827 1083 884 507 481 166 14534 23294 369 --
NM_017848chrX83945 3797 2965 1785 1645 1321 611 142 23261 1877 --14076
NM_017849chr283227 2991 2924 2888 2441 2205 304 115 12637 ----
NM_017856chrX3505 329 232 11703 1212 11835
NM_017866chr82371 351 11070 1954 1899
NM_017890chr861706 1694 1374 1298 1175 662 11508 --11813
NM_017896chr2063488 3025 2443 2398 609 137 13255 12687 --
NM_017906chr63279 251 66 ------
NM_017910chr21133 ------
NM_017913chr92148 65 ------
NM_017915chr122330 66 ----21197 183
NM_017919chr9105622 5085 5018 4144 4043 3737 722 704 533 259 25109 905 34866 1029 596 12311
NM_017925chr931819 1698 1405 1216 11242 11799
NM_017933chr221104 648 ------
NM_017938chrX61764 1712 1383 798 409 315 1652 21372 872 --
NM_017943chr1441049 776 747 141 ------
NM_017944chr1173060 2966 2385 1232 1034 954 21 --21004 412 --
NM_017945chr34856 438 273 72 251 43 1397 --
NM_017948chr95398 357 299 150 109 ------
NM_017953chr131184 932 108 ----11069
NM_017954chr751595 1531 1447 1245 1126 ----1527
NM_017964chr291012 967 934 921 871 753 373 256 118 ------
NM_017974chr221244 918 1965 ----
NM_017975chr1511069 --2753 402 --
NM_017987chr1092222 1813 1538 1500 1366 687 660 447 125 3593 439 195 1710 11776
NM_017994chr732387 989 720 21034 1015 12977 --
NM_018000chr241989 1772 1472 145 --22241 1952 11507
NM_018003chr1572117 1876 698 209 193 187 165 32070 588 486 ----
NM_018014chr22910 444 ------
NM_018015chrX51088 980 410 387 212 ------
NM_018017chr10102874 2721 2691 2319 2243 2031 1880 1810 1123 663 12837 1511 --
NM_018018chr1261844 1838 1685 1241 449 439 21638 1619 ----
NM_018025chr192252 243 ------
NM_018027chr1031234 1164 924 23321 2500 ----
NM_018030chr186977 199 180 91 66 45 ------
NM_018036chr1474350 3618 3543 1630 1436 357 90 33216 811 447 22856 1359 --
NM_018040chr13525 468 212 --1551 --
NM_018046chr551954 1656 1613 1575 562 ------
NM_018051chr71354 ------
NM_018061chr131297 1202 443 1122 --11346
NM_018063chr10----1153 --
NM_018070chr12390 166 ------
NM_018078chr451006 958 834 259 237 1906 1122 --
NM_018079chr23481 126 35 ------
NM_018084chr293021 2883 2827 2559 1272 1158 1139 1121 230 12390 1678 21233 130
NM_018085chr146091 5880 3238 690 25459 2637 13229 1900
NM_018086chr231799 1512 1357 1139 ----
NM_018087chr11249 ----1240
NM_018089chr21181 ------
NM_018092chr1641470 1361 645 463 ------
NM_018094chrX2310 302 ------
NM_018098chr34974 778 750 317 1179 1873 --
NM_018103chr13348 253 107 ------
NM_018105chr851171 1110 906 505 164 ------
NM_018110chr1631037 994 318 ------
NM_018112chr9101059 944 740 676 663 403 325 276 69 35 11033 2875 845 1775
NM_018115chr41143 1789 ----
NM_018117chr104684 639 564 291 ------
NM_018120chr831445 617 346 --11253 --
NM_018121chr10112875 2854 2607 2396 890 776 768 563 462 328 234 12095 1446 --
NM_018125chr11159 ------
NM_018126chr461531 585 575 437 192 150 11215 ----
NM_018133chr372007 1963 1746 1492 829 774 383 --1602 --
NM_018139chr143332 142 122 ------
NM_018142chr81207 ------
NM_018155chr383461 3113 2251 2243 768 730 331 256 1451 1308 1868
NM_018156chr152153 748 409 270 215 ------
NM_018157chr1243271 1991 519 45 12304 170 --
NM_018159chrX41518 1221 1188 667 --11715 11261
NM_018177chr44813 711 348 219 ------
NM_018179chr12263 22 --1183 --
NM_018184chr352047 1956 1890 871 805 ------
NM_018195chr1131906 1479 146 --21923 1625 --
NM_018196chrX21044 267 --11361 --
NM_018197chr205767 614 528 262 52 ------
NM_018199chr1461164 1142 1102 1044 846 476 ------
NM_018200chr1572575 1937 1780 1712 1033 928 487 32143 302 255 1560 --
NM_018202chr13846 730 193 --1681 --
NM_018206chr163557 518 204 ------
NM_018211chr142221 1938 1847 196 11390 ----
NM_018214chr661160 465 457 315 115 34 11089 ----
NM_018227chr4103004 2749 2672 2200 940 903 415 401 376 121 22559 2289 12706 --
NM_018237chr101220 ------
NM_018243chr4133761 3705 3365 3165 3142 3042 3034 3001 2973 1612 1450 1027 412 1554 31181 837 781 --
NM_018246chr832023 1127 1045 21903 138 12446 1394
NM_018247chr683028 2562 2493 1946 974 816 514 134 22894 485 --22218 321
NM_018254chr182260 1605 1598 767 587 458 443 160 --12357 12372
NM_018257chr2092487 1737 1632 1027 727 635 619 595 481 11656 2670 444 1254
NM_018261chr42562 103 ----1513
NM_018263chr242515 1924 868 576 21996 114 1561 --
NM_018269chr23694 203 117 --2869 721 1852
NM_018279chr1272936 2911 2627 676 617 239 144 22356 744 ----
NM_018293chr382963 2493 1936 1908 1880 1115 146 102 11989 12404 --
NM_018294chr10175 1883 ----
NM_018299chr873464 3357 3163 3078 2904 983 71 1649 11063 --
NM_018300chr191423 ------
NM_018307chr172888 684 ------
NM_018313chr362639 2620 1933 896 286 102 12197 --11737
NM_018314chr113739 701 211 1496 ----
NM_018315chr471584 1578 1497 1417 1208 1029 307 ------
NM_018318chr122918 174 --1794 --
NM_018319chr1481408 1377 1365 1354 572 461 328 95 1591 1118 1532
NM_018323chr461641 1458 1352 1174 265 114 21508 1365 ----
NM_018325chr981690 1667 1647 1557 1136 1085 387 260 ------
NM_018327chr2031886 357 104 11205 1635 --
NM_018328chr22414 159 ------
NM_018330chr1031626 1514 1308 1428 ----
NM_018339chr971861 1774 1540 1531 1361 1334 667 11662 --1319
NM_018340chr1663921 3784 3435 1388 1041 380 23545 3449 34469 3723 1071 --
NM_018342chr431700 1192 650 191 ----
NM_018351chr12174684 4603 4494 4432 4417 4403 4210 4136 3705 3313 1885 660 508 373 357 201 157 1998 33921 1626 745 --
NM_018353chr145845 656 333 257 82 162 ----
NM_018360chrX1118 --190 --
NM_018361chr873932 3610 3221 3167 2676 1620 444 24036 366 ----
NM_018362chr1193334 3189 3147 2888 2882 2695 1627 1272 808 --23756 333 13889
NM_018364chr1183981 3661 3418 3410 3185 2626 2570 2511 1470 1417 1029 899 864 814 337 151 98 42 13358 32817 1440 1107 13784
NM_018367chr112911 762 1774 11026 --
NM_018368chr61250 --1292 --
NM_018369chr52669 507 2788 640 ----
NM_018370chr122449 421 12104 1222 12165
NM_018371chr831024 581 547 ------
NM_018373chr14116168 5582 5442 5278 4996 4878 2350 1893 886 614 395 --56388 6084 5310 1827 297 16492
NM_018374chr7164757 4681 4486 4040 3800 3660 3462 2001 1868 1810 1546 1003 660 631 335 199 54184 1724 1570 1247 702 54494 3211 1619 690 607 23200 1536
NM_018375chr1441790 1473 1450 227 11294 ----
NM_018383chr241381 1262 636 255 1151 1694 22004 1931
NM_018388chrX21141 298 1991 21272 30 --
NM_018394chr321369 419 --1194 --
NM_018399chr62189 169 ------
NM_018403chr384093 3539 3205 1586 1458 1228 1200 824 --13260 1757
NM_018409chr4142702 2681 2580 2565 2538 2448 2433 2265 857 734 705 492 448 427 --23263 721 23291 477
NM_018416chr1272242 2120 1939 1041 1024 948 565 --21013 903 --
NM_018424chr961682 1265 1197 731 567 447 11522 11442 --
NM_018425chr1052367 996 959 918 755 12497 1891 --
NM_018429chr562834 2660 2629 2522 1143 1044 --22872 1838 --
NM_018433chr23559 533 93 1518 ----
NM_018439chr1882653 2173 2097 1958 1866 671 458 249 1811 11910 12263
NM_018440chr8188473 8021 7768 7546 7088 6726 5839 5405 3283 3155 3049 2997 2987 2436 1817 1642 1224 808 65343 5320 2564 2169 1683 1356 32808 1556 797 37102 883 488
NM_018442chr12259 90 ----1309
NM_018444chr862155 1470 943 637 438 310 11798 ----
NM_018448chr1261203 1059 999 856 396 341 --2843 374 --
NM_018462chr31325 1555 ----
NM_018469chr1721016 536 ------
NM_018482chr862269 2240 2234 2213 1026 705 ------
NM_018489chr142313 1957 1876 1631 --22290 213 --
NM_018490chr11111651 1548 1398 1247 1199 693 564 419 389 255 73 1160 21839 1585 --
NM_018509chr1741238 1216 685 602 --21514 1448 --
NM_018553chr1741243 1210 1142 187 21402 170 ----
NM_018555chr1951657 1591 1560 525 119 1709 11711 --
NM_018557chr251577 1114 632 569 113 21306 1227 ----
NM_018566chr195043 4630 3359 1941 1551 1368 1005 668 517 --21161 967 --
NM_018569chr451576 1548 1169 320 307 ------
NM_018584chr12462 237 --11104 --
NM_018593chr62159 44 1297 ----
NM_018638chr12165647 4062 3968 3818 2209 2178 1992 1901 1842 1637 1297 1247 1138 887 792 698 65526 5389 3570 1865 778 524 44368 3604 1488 50 14213
NM_018640chr1242163 2149 863 52 22405 637 11128 11873
NM_018650chr1112167 2093 2071 2016 1721 1527 1413 565 494 411 248 --11927 11691
NM_018652chr152651 84 ------
NM_018657chr33693 603 252 1682 ----
NM_018658chr1792249 2201 1926 1829 640 246 202 185 46 1274 21727 1461 --
NM_018660chr833050 3020 2780 --1155 --
NM_018662chr164373 4228 3879 1752 762 271 --24221 624 --
NM_018667chr1642778 2577 2186 250 22675 2537 ----
NM_018672chr178859 835 824 715 346 249 119 53 1330 ----
NM_018685chr74319 250 230 150 ----1784
NM_018689chr1552667 2445 2073 1876 1738 1411 12463 1470
NM_018695chr5132486 2443 2319 2178 2033 1832 1798 1572 921 821 787 769 567 32216 2080 1854 ----
NM_018698chrX71988 1717 1450 1242 557 253 118 11213 2385 304 11353
NM_018703chr162296 53 ----1284
NM_018704chr13860 669 195 21972 1790 --11644
NM_018710chr841171 1124 901 136 171 11075 --
NM_018712chr1121524 1476 ------
NM_018713chr131154 248 171 --21111 858 --
NM_018718chr761960 1752 1627 1545 451 261 21822 700 11608 --
NM_018834chr54811 705 696 680 2799 650 ----
NM_018841chr1113289 3131 3021 1573 1564 1303 688 499 213 207 150 12688 12559 12972
NM_018846chr71642 1354 1995 --
NM_018847chr931369 317 67 ----11699
NM_018890chr751462 1416 584 179 143 1923 11018 --
NM_018898chr551919 1803 1755 1668 571 ----1940
NM_018899chr551919 1803 1755 1668 571 ----1940
NM_018900chr551919 1803 1755 1668 571 ----1940
NM_018901chr551919 1803 1755 1668 571 ----1940
NM_018902chr551919 1803 1755 1668 571 ----1940
NM_018903chr551919 1803 1755 1668 571 ----1940
NM_018904chr551919 1803 1755 1668 571 ----1940
NM_018905chr551919 1803 1755 1668 571 ----1940
NM_018906chr551919 1803 1755 1668 571 ----1940
NM_018907chr551919 1803 1755 1668 571 ----1940
NM_018908chr551919 1803 1755 1668 571 ----1940
NM_018909chr551919 1803 1755 1668 571 ----1940
NM_018910chr551919 1803 1755 1668 571 ----1940
NM_018911chr551919 1803 1755 1668 571 ----1940
NM_018931chr55832 303 137 117 69 2740 320 --1747
NM_018932chr54804 747 729 249 ----2768 695
NM_018934chr5127 --170 1148
NM_018939chr55513 226 211 110 25 ------
NM_018940chr581130 997 960 942 916 727 371 248 ----1766
NM_018945chr673112 1095 987 980 792 662 133 13441 23483 520 --
NM_018948chr121096 202 21172 125 2540 56 --
NM_018963chr2131150 368 106 --1118 1387
NM_018968chr2140 ------
NM_018970chr763089 2269 1154 1002 405 137 ----12682
NM_018976chr1272636 2623 2280 2170 882 638 249 22687 824 --12234
NM_018977chrX31055 929 918 ------
NM_018979chr1262420 2272 2263 1824 1780 296 21735 1642 ----
NM_018981chr221232 895 --1920 --
NM_018992chr161641 ------
NM_018993chr2041511 1460 1019 493 ------
NM_018994chr1----149 1384
NM_018999chr10134711 4581 3727 3632 3274 3076 1929 1761 1663 1481 841 704 490 13885 13281 --
NM_019001chr3164670 4605 4593 4414 4133 3558 3398 3294 2952 1869 1581 1514 1339 704 615 122 54688 4451 3436 1525 1296 1789 11266
NM_019002chr2165 ------
NM_019004chr742255 1993 1977 924 --1369 1560
NM_019006chr153727 279 236 ------
NM_019010chr173406 62 56 1259 ----
NM_019022chr1892462 2414 2188 2164 2008 1138 644 438 234 22924 86 23117 849 22718 612
NM_019026chr13467 295 21 ------
NM_019027chr452565 948 528 334 247 3965 317 180 11680 --
NM_019028chr113447 354 165 1302 ----
NM_019030chr5----1169 --
NM_019035chr461850 1291 776 502 241 149 ------
NM_019036chr651187 986 899 876 229 ----1818
NM_019040chr112220 192 ------
NM_019045chrX2613 95 1665 1735 --
NM_019049chr12561 102 ------
NM_019050chr4132283 1896 1691 1659 1561 1555 1544 872 728 714 303 257 38 22248 736 ----
NM_019053chr104972 925 421 54 1443 11006 --
NM_019063chr272298 1785 1709 1482 1410 503 141 1148 ----
NM_019072chr5134234 4180 4147 3677 3235 1658 1491 1354 1328 1068 919 705 582 53858 3385 2726 551 276 22676 1038 13939
NM_019080chr1381535 1528 1366 1324 1067 1029 1008 470 11156 2952 342 --
NM_019083chr161049 484 349 335 47 31 11204 11419 --
NM_019084chr10112604 2376 1919 693 659 633 549 490 464 435 406 --12191 11962
NM_019087chr5111752 1634 1522 1388 1233 1143 477 377 242 109 68 1439 ----
NM_019091chr24812 357 229 197 1171 ----
NM_019094chr12103833 3657 2715 2598 2375 1401 1018 901 485 211 33617 3269 290 32742 1100 158 1598
NM_019095chr201232 ------
NM_019098chr851835 1654 709 358 239 1485 11783 --
NM_019106chr2243345 2619 1212 741 1222 ----
NM_019114chr981805 817 776 760 477 467 327 51 --11833 11798
NM_019117chrX53053 1253 985 893 614 1377 13195 13303
NM_019555chr341545 1494 562 510 ----1696
NM_019556chrX51142 1134 1076 583 287 11062 11271 --
NM_019590chr1041464 976 516 336 ------
NM_019593chr2062930 2623 2530 2300 1262 1191 32366 1998 531 2619 471 21019 368
NM_019595chr2--2703 270 1640 --
NM_019596chr2192387 2330 2270 2261 2088 995 801 330 307 11126 ----
NM_019597chrX3638 279 160 --2775 713 --
NM_019600chr152724 272 --1759 --
NM_019610chr162060 1669 733 340 187 147 ------
NM_019842chr6--1390 ----
NM_019860chr1021704 1376 ------
NM_019884chr191392 ------
NM_019891chr141323 1222 1180 226 1948 --11204
NM_019895chr341008 205 88 62 ------
NM_019903chr1081201 733 617 543 507 388 344 203 11212 21301 1193 --
NM_020066chr13971 662 160 --2858 125 --
NM_020116chr441545 1500 1191 1169 1581 11698 --
NM_020119chr783971 3771 2447 1496 1231 418 138 94 --1647 --
NM_020122chr255741 2334 1045 806 178 21827 1723 15282 --
NM_020123chr1031322 1199 1151 --2394 257 --
NM_020130chr831148 1065 492 ------
NM_020133chr6156460 6319 6062 5666 5641 5596 5468 5402 5366 5295 4411 4324 2452 792 757 24301 2149 46451 2226 2112 184 --
NM_020135chr61328 ------
NM_020141chr162382 1550 1468 807 523 344 --22265 709 1414
NM_020144chr7122000 1794 1558 1373 1325 1313 696 660 636 379 159 123 1286 11693 --
NM_020147chr1561072 1056 980 963 930 872 140 183 148
NM_020148chr1862940 2831 2779 2708 2185 1006 1695 13084 --
NM_020150chr1051910 1428 1392 1376 782 ------
NM_020156chr71398 ------
NM_020159chr441566 1441 1301 702 11621 11154 11500
NM_020168chr1521339 1327 ------
NM_020177chr5123201 3056 2717 2457 2329 2145 667 638 572 526 363 346 --23070 868 --
NM_020178chr171357 ------
NM_020180chr1821007 871 ------
NM_020182chr2073643 3319 3216 2807 522 320 279 ------
NM_020193chr1151335 1031 478 470 258 ------
NM_020198chr1761569 1513 1503 1157 205 105 ------
NM_020199chr541277 832 162 33 ------
NM_020200chr102913 841 2929 96 ----
NM_020205chr172762 2325 2215 2128 805 743 358 23314 2740 ----
NM_020225chr4277 22 1305 --1165
NM_020226chr43786 670 648 ------
NM_020227chr51301 ------
NM_020228chr1162533 2360 1942 874 570 220 1171 11717 --
NM_020232chr182196 181 ------
NM_020239chr152205 2169 1969 1549 818 1532 1613 --
NM_020240chr572161 1903 1827 1756 1105 217 206 2812 571 12308 1179
NM_020245chr6135121 5029 4688 4533 4508 4463 4434 4415 3934 1502 1229 1010 53 34154 3169 1643 11209 11222
NM_020336chr20103873 3766 3675 3548 2991 2827 2787 501 421 266 ------
NM_020337chr4113052 3041 2707 2489 2089 1043 959 762 654 548 497 22247 470 12014 12483
NM_020338chr1063744 3553 3387 2831 735 384 ------
NM_020341chr2081934 1914 1542 1264 806 449 332 160 11624 21946 1848 --
NM_020342chr262422 2317 2175 2077 888 757 --12106 11728
NM_020345chr32758 737 ------
NM_020346chr1141401 1243 114 67 ----11165
NM_020348chr1032785 2706 160 12587 --1737
NM_020353chr321519 35 --11890 1460
NM_020357chr351586 1545 1533 208 86 31229 1109 653 --1663
NM_020368chr43319 96 49 ------
NM_020376chr111323 ------
NM_020379chr1--1603 ----
NM_020381chr61697 --11975 --
NM_020384chrX21782 1471 ------
NM_020390chr3144820 4605 4464 3952 3471 3055 1738 1569 1538 1313 1303 200 189 162 14422 13353 --
NM_020401chr12175 --1214 129
NM_020403chr132244 192 ------
NM_020420chrY91733 1508 1201 1174 701 622 565 447 176 ----11483
NM_020425chr6101944 1883 1672 1663 1284 1270 766 586 456 152 ----21470 50
NM_020432chr741917 1457 430 190 22146 751 1881 --
NM_020438chr91144 ------
NM_020439chr1------136
NM_020443chr195900 5601 4425 2644 2495 1831 1038 441 399 16077 36504 6158 4773 12077
NM_020449chrX3728 616 65 1224 ----
NM_020453chr452077 1295 595 389 342 2300 274 --21806 1799
NM_020455chr672746 2562 2524 2005 533 524 287 1627 11019 12234
NM_020456chr1352298 1796 1694 905 408 --12075 --
NM_020457chr162622 512 ------
NM_020463chr261351 1345 1068 611 459 364 ----11252
NM_020465chr1671968 1731 1701 1546 1538 1402 137 ------
NM_020466chr643210 1307 655 87 34045 3489 27 11630 11894
NM_020473chrX61813 1661 1505 1441 245 141 21491 801 --11821
NM_020474chr1861758 1483 1307 788 680 251 11845 ----
NM_020482chr61864 1734 1820 --
NM_020532chr23770 307 240 2128 35 ----
NM_020546chr572887 2728 2154 696 688 681 326 138 ----
NM_020640chr361823 1758 610 526 288 196 1350 ----
NM_020644chr1161017 805 750 725 641 220 ----1345
NM_020647chr831939 790 565 21514 836 --11469
NM_020651chr231795 1355 121 1421 31481 1306 207 --
NM_020652chr171214 ------
NM_020653chr17147 ------
NM_020654chr351599 1486 1153 1025 232 11359 ----
NM_020657chr1991960 1795 1786 1740 1459 1397 661 524 433 2532 380 ----
NM_020665chrX3543 506 123 ------
NM_020673chr20167512 7177 6341 5784 5737 5202 3075 2666 2218 2174 1721 1711 1318 990 822 99 44960 2543 2410 1550 1107 11082
NM_020686chr1672992 2857 2811 2139 1172 320 188 ------
NM_020693chr112363 182 ------
NM_020697chr831138 980 293 ------
NM_020699chr195366 5229 4695 4407 4148 2137 1698 1354 229 1266 34439 4424 427 --
NM_020708chr2032534 2396 229 12125 1653 12352
NM_020711chr262235 866 834 780 390 221 1979 41758 1704 896 597 --
NM_020715chr1472264 2044 1551 1417 855 624 483 --1356 --
NM_020717chrX114421 4279 3935 3264 3155 2002 1763 1391 967 715 227 13956 161 --
NM_020718chr16145647 4876 4816 4592 4576 4301 2317 1762 1367 943 854 814 681 535 36344 4603 4353 --12271
NM_020724chr492672 2466 2331 1976 896 853 806 383 159 ------
NM_020726chr53544 434 134 ------
NM_020727chr21123656 3503 3493 2835 2558 1563 1519 1482 1108 921 401 261 ----13689
NM_020728chr742443 2025 1202 423 32718 604 465 21969 181 32405 895 371
NM_020731chr553376 3305 2578 1026 178 ----1267
NM_020732chr631363 910 295 --1108 11324
NM_020734chr1293339 3191 2882 2745 2546 2381 759 517 443 22647 849 12962 12678
NM_020739chr15173992 3906 3807 3706 3487 3462 3237 2984 2854 1663 1284 755 538 467 357 298 194 54083 1153 557 551 412 2630 309 21094 589
NM_020744chr2129 ------
NM_020748chr1761732 1581 740 703 649 192 ----11786
NM_020749chr861922 1848 1678 839 806 691 ------
NM_020752chr1062583 2374 1905 568 503 478 22816 1861 32132 1974 236 --
NM_020755chr651651 1066 584 470 156 ----