TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4701-3p
miRNA Sequence: AUGGGUGAUGGGUGUGGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr53997 529 183 --1457 --
NM_000038chr531804 1784 1362 --1507 --
NM_000053chr1361681 1530 580 289 135 44 ------
NM_000068chr1961276 1270 1254 974 278 238 --2569 308 --
NM_000084chrX96411 5890 4394 4345 2504 2013 1767 1083 391 174 35188 1884 913 15127
NM_000091chr242331 1007 834 36 22169 272 ----
NM_000092chr2104380 4031 3402 3030 2821 1548 1482 1159 1021 984 12804 1950 --
NM_000109chrX----1814 12167
NM_000125chr623272 50 23819 109 --13089
NM_000138chr1532007 920 843 11853 ----
NM_000161chr1421346 1338 11610 ----
NM_000168chr763251 3103 3051 2619 1258 844 1234 --1119
NM_000176chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_000189chr232314 352 70 ------
NM_000208chr19104477 3998 3906 3730 3171 1358 1172 746 441 293 12900 21828 521 --
NM_000210chr24900 538 532 493 1220 ----
NM_000212chr1742032 1894 820 702 11548 22150 990 --
NM_000217chr1254238 3551 2151 1670 1253 11394 15208 --
NM_000248chr322960 1054 --11131 --
NM_000252chrX11432 ----1485
NM_000259chr1565359 4554 4037 2437 765 214 --36263 6097 1338 --
NM_000264chr933268 3247 861 1784 --13228
NM_000267chr1733447 3047 395 ----22758 747
NM_000297chr421894 266 --2764 164 11319
NM_000314chr1033206 160 150 ------
NM_000330chrX42180 1976 1955 199 21515 693 22248 2143 --
NM_000332chr686392 5668 5109 2320 2114 911 854 453 --26697 6155 --
NM_000333chr341035 977 446 65 ------
NM_000334chr1771828 1790 1753 883 833 287 156 1486 1539 --
NM_000335chr382107 1707 1586 1467 1396 699 565 263 ------
NM_000337chr576242 2166 1976 1927 1424 1337 1307 21781 460 25489 4306 1683
NM_000346chr1721770 1340 1179 21570 221 --
NM_000361chr2041320 604 595 53 1834 ----
NM_000362chr2263002 2814 2794 2763 1022 699 13190 22413 986 --
NM_000368chr983895 3807 3689 3581 1608 1229 841 205 --13221 --
NM_000376chr1282703 2494 2040 1160 683 358 140 95 11170 11030 11941
NM_000390chrX12403 22147 27 12460 --
NM_000428chr1482127 1627 1070 999 829 777 517 382 --42671 1656 607 300 --
NM_000430chr1753497 3195 3109 1083 67 12757 ----
NM_000439chr552122 1851 1756 532 49 --11596 12407
NM_000451chrX21789 466 176 12137 --
NM_000461chr343211 2931 1403 295 23882 384 ----
NM_000486chr12112931 2257 2241 1164 1145 1090 1053 1028 419 331 138 13252 11156 --
NM_000489chrX32934 1118 856 --12364 11212
NM_000503chr841541 1445 1335 453 --1539 --
NM_000530chr16725 709 412 370 301 250 ------
NM_000555chrX127416 6705 6004 5597 5408 4998 4991 4796 2203 2168 513 506 12623 14945 26338 2605
NM_000599chr294065 3644 3215 3175 2872 1455 1249 88 29 --13107 --
NM_000610chr1172815 2347 2048 833 823 697 267 1531 --11973
NM_000612chr11113724 3691 3459 3172 2544 2413 1532 1459 859 819 697 ------
NM_000615chr11102874 2333 1165 1076 932 833 814 561 387 228 12703 ----
NM_000618chr12125984 5971 5437 2343 2244 2218 1729 1368 1259 1026 488 87 --14230 --
NM_000618chr12125984 5971 5437 2343 2244 2218 1729 1368 1259 1026 488 87 --14230 --
NM_000620chr1271945 1903 1786 1336 838 622 144 1804 ----
NM_000633chr1843756 3583 1156 653 14766 34461 929 774 --
NM_000635chr1921639 52 1370 ----
NM_000682chr251737 1482 754 424 51 --2650 506 --
NM_000719chr12156567 6353 5974 5957 5949 5009 4490 4299 2519 2363 2103 1995 1234 842 553 22269 669 35378 4063 2607 --
NM_000726chr221443 910 11154 ----
NM_000734chr14410 389 89 46 124 ----
NM_000761chr1551382 1361 1024 974 358 --1403 --
NM_000800chr541153 1076 175 55 ------
NM_000801chr2031013 861 732 --1158 --
NM_000814chr1583379 3355 3247 2919 1670 1533 1185 392 11231 23091 2913 11293
NM_000827chr561763 1688 1610 566 456 202 ------
NM_000829chr1162301 2099 2069 1419 937 435 --1879 --
NM_000831chr196012 5290 4190 3995 1017 521 487 280 191 16048 35610 5123 4083 --
NM_000833chr1631152 1132 576 1177 ----
NM_000868chrX12353 22262 401 ----
NM_000870chr53525 100 85 21640 1177 2319 296 --
NM_000875chr15156578 5864 5337 5003 2796 2739 2673 2629 1716 1694 1556 1351 514 448 300 1432 35565 5501 2719 1556
NM_000878chr2261859 597 166 143 128 97 ------
NM_000891chr1743429 3380 1238 1156 ------
NM_000899chr1263397 3143 3087 1010 372 139 --1630 --
NM_000901chr432008 394 56 ------
NM_000944chr421964 1551 12126 --11994
NM_000950chrX53154 2596 2373 836 358 12770 ----
NM_000984chr174443 405 348 167 ------
NM_001001323chr1252332 1941 283 247 210 1554 ----
NM_001001331chr392649 2523 2089 596 303 280 152 67 52 184 --193
NM_001001344chrX102303 2187 2170 1902 1873 1843 1830 860 452 205 --12032 --
NM_001001389chr1172815 2347 2048 833 823 697 267 1531 --11973
NM_001001390chr1172815 2347 2048 833 823 697 267 1531 --11973
NM_001001391chr1172815 2347 2048 833 823 697 267 1531 --11973
NM_001001392chr1182861 2393 2094 879 869 743 313 52 1577 --12019
NM_001001396chr183739 3035 2969 1674 587 307 188 48 24264 788 13492 --
NM_001001419chr523703 1599 1899 11603 13869
NM_001001420chr523703 1599 1899 11603 13869
NM_001001433chr2031021 977 137 1764 12635 --
NM_001001484chr1021737 579 --12349 --
NM_001001664chr233315 1209 42 ----12659
NM_001001668chr1943615 3381 474 30 ----23774 3281
NM_001001684chr1742171 866 674 288 1240 1680 --
NM_001001890chr2173918 2904 1212 1048 463 278 184 13172 --11455
NM_001001924chr821829 1300 --1773 1304
NM_001001925chr821829 1300 --1773 1304
NM_001001931chr821829 1300 --1773 1304
NM_001002233chr841615 1365 532 49 ------
NM_001002258chr221441 468 --11991 11311
NM_001002814chr853345 3223 1365 532 49 ----13816
NM_001002909chr175898 643 587 552 266 --11655 --
NM_001003652chr1888500 7724 5944 5608 5499 2675 2372 1763 ----16990
NM_001003665chr193451 3379 3308 3179 2591 2251 1024 315 265 --13201 1784
NM_001003674chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_001003675chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_001003698chr62720 448 --21461 1263 --
NM_001003699chr62720 448 --21461 1263 --
NM_001003712chr1223052 523 --12537 --
NM_001003760chr693445 3216 2838 1255 1160 861 855 625 326 --12705 13186
NM_001003789chr2261144 871 435 426 383 120 ------
NM_001003792chr3------1149
NM_001003793chr3------1149
NM_001003800chr9102839 1401 1377 1185 1127 949 312 210 185 44 1360 ----
NM_001004065chr943500 3484 2964 196 --13392 13801
NM_001004317chr684387 4129 3238 1446 932 562 148 32 ------
NM_001004342chr1135853 5840 5610 5585 3819 2378 2018 1683 1440 1020 242 230 57 24767 4037 54136 2315 1574 1339 898 --
NM_001004720chr261057 378 350 190 174 161 --1430 --
NM_001004722chr271226 820 805 359 343 330 116 ------
NM_001005242chr1231163 67 52 --21210 394 --
NM_001005404chr1764427 2976 1598 1330 1025 97 21344 812 1727 --
NM_001005473chr566061 4972 4849 2457 1356 784 --1505 14098
NM_001005474chr341568 1145 210 34 ------
NM_001005746chr221443 910 11154 ----
NM_001005747chr221443 910 11154 ----
NM_001005782chr23365 252 212 ------
NM_001005861chr32863 400 ------
NM_001005920chr1651080 971 716 322 113 --1734 --
NM_001006623chr242141 1636 1602 235 161 21984 1932 --
NM_001006636chr231025 902 310 ------
NM_001006657chr232766 2361 239 ----12385
NM_001006932chr682813 2124 1277 1028 575 382 252 83 1980 --1890
NM_001007024chr1754160 1685 1580 1540 895 23941 375 1652 --
NM_001007025chr1754160 1685 1580 1540 895 23941 375 1652 --
NM_001007075chr421017 335 ----1782
NM_001007156chr1591888 1853 1691 1672 1624 641 469 175 36 21321 508 ----
NM_001007237chr142783 743 497 370 2516 83 ----
NM_001007279chr225895 580 316 232 111 ----1637
NM_001007466chr665014 4208 3545 3155 1831 780 ------
NM_001008215chr2------1327
NM_001008220chr583666 3508 3203 2733 1002 710 571 173 11070 ----
NM_001008239chr1841308 730 473 50 ------
NM_001008410chr241940 851 747 660 12303 ----
NM_001008495chr842277 1542 749 593 12205 22115 906 --
NM_001008726chr1421611 66 1443 --11440
NM_001008738chr521958 1832 1561 11842 --
NM_001009554chr472959 1717 1230 884 855 846 105 11427 13293 11216
NM_001009554chr472959 1717 1230 884 855 846 105 11427 13293 11216
NM_001009555chr4153 ----21534 1199
NM_001009899chr344874 2261 2218 650 --45287 5283 2011 1906 16168
NM_001010861chr132244 54 40 168 ----
NM_001010862chrX63116 2693 2677 341 310 243 --1548 --
NM_001010888chrX63922 3333 1267 704 655 442 1258 14592 21472 892
NM_001010891chr595731 5716 5333 5238 4853 2742 2527 2339 2277 15433 15120 --
NM_001010895chr951629 1516 1484 1290 470 ------
NM_001011666chr765992 5049 1628 1615 1328 569 16605 21362 783 --
NM_001011885chr1541297 1149 1120 455 143 ----
NM_001012264chr146660 387 304 233 216 205 1265 1741 --
NM_001012329chr152065 2053 1925 698 671 1116 ----
NM_001012393chr1153540 1460 981 877 489 44153 1167 866 433 31838 1218 832 --
NM_001012755chrX104762 4352 3440 3159 1477 1428 1328 1117 936 204 --14517 --
NM_001012761chr561715 992 789 497 340 136 --11940 --
NM_001012968chrX51910 968 541 390 321 --12795 --
NM_001013031chr1032652 661 90 12961 2776 745 --
NM_001013438chr31335 1124 ----
NM_001013690chr12102376 2241 1952 1857 918 659 650 497 369 288 1945 ----
NM_001013693chr162490 2320 2314 1981 838 776 2895 243 32768 2002 1922 --
NM_001013693chr162490 2320 2314 1981 838 776 2895 243 32768 2002 1922 --
NM_001014797chr10137892 7203 7081 7005 5891 5780 5399 2815 2406 2209 2147 787 51 28143 6502 16611 --
NM_001017395chr332433 626 413 --11224 1537
NM_001017424chr151850 684 569 553 126 ------
NM_001017425chr151850 684 569 553 126 ------
NM_001017440chr7177285 6917 6521 5895 5193 3250 3014 2677 2184 2062 1688 978 972 894 518 381 333 32175 1658 866 36670 6006 5519 --
NM_001017535chr1282703 2494 2040 1160 683 358 140 95 11170 11030 11941
NM_001017926chr81656 2135 114 11414 --
NM_001017995chr5104442 3907 3638 3497 3138 1885 1157 508 472 296 13821 151 --
NM_001018050chr2283303 3222 2476 2376 2245 1230 974 530 23274 725 22408 296 --
NM_001018052chr2283303 3222 2476 2376 2245 1230 974 530 23274 725 22408 296 --
NM_001018064chr951594 1487 1466 303 107 --21403 172 --
NM_001018065chr995160 3884 3725 3653 1907 1219 1064 351 129 24626 4034 35271 4817 4700 11987
NM_001018066chr995160 3884 3725 3653 1907 1219 1064 351 129 24626 4034 35271 4817 4700 11987
NM_001018067chr145180 3956 1748 999 34281 4153 128 34747 4005 1949 --
NM_001018068chr145180 3956 1748 999 34281 4153 128 34747 4005 1949 --
NM_001018069chr145180 3956 1748 999 34281 4153 128 34747 4005 1949 --
NM_001018074chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_001018075chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_001018076chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_001018077chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_001018089chr1552466 927 898 864 187 12718 ----
NM_001024071chr142368 360 1632 ----
NM_001024094chr563417 3266 2534 1258 1156 852 1306 --23123 1116
NM_001024372chr822054 1684 2849 61 --1601
NM_001024380chr822246 1841 --12253 21623 1599
NM_001024381chr822246 1841 --12253 21623 1599
NM_001024455chrX72346 1945 548 366 347 309 24 1810 --1415
NM_001024660chr341151 469 178 95 ------
NM_001024688chr832162 1774 300 --22166 599 --
NM_001024808chr1262606 2418 2401 2081 1151 1020 1201 ----
NM_001025068chr331743 1383 375 ------
NM_001025069chr331743 1383 375 ------
NM_001025076chr10125570 5026 4960 4771 4725 4348 4195 4145 2448 1447 674 639 24665 1774 ----
NM_001025077chr10166928 6384 6318 6129 6083 5706 5553 5503 2805 2032 1997 1187 1176 437 170 157 16023 ----
NM_001025079chr333951 3344 1102 14146 2389 132 --
NM_001025107chr162197 2070 1993 1987 1750 1017 1262 1779 --
NM_001025107chr162197 2070 1993 1987 1750 1017 1262 1779 --
NM_001025108chr242875 1084 698 330 ------
NM_001025366chr631474 522 342 ------
NM_001025366chr631474 522 342 ------
NM_001025367chr631474 522 342 ------
NM_001025367chr631474 522 342 ------
NM_001025368chr631474 522 342 ------
NM_001025368chr631474 522 342 ------
NM_001025369chr631490 538 358 ------
NM_001025369chr631490 538 358 ------
NM_001025370chr631474 522 342 ------
NM_001025370chr631474 522 342 ------
NM_001025580chrX43793 3264 2707 594 ----14317
NM_001025616chr451531 635 348 146 90 --21795 1751 --
NM_001029858chr653210 2376 1349 1222 1151 --11231 --
NM_001029863chr622648 157 ----12066
NM_001029864chr2082245 2182 2135 2065 1557 754 719 340 12092 21684 200 --
NM_001029875chr552915 2749 2273 2188 535 --42799 2600 1947 517 --
NM_001030006chr1752479 2233 861 210 110 ----12527
NM_001030007chr162852 361 34048 2561 36 ----
NM_001030055chr1423902 298 --34565 3104 352 --
NM_001030287chr12942 405 2809 58 11039 --
NM_001031685chr13843 704 250 ------
NM_001031690chr7113052 2113 2095 2065 1992 1062 1021 952 875 471 424 --22842 2161 --
NM_001031695chr2235067 4425 1318 25120 3974 --11648
NM_001031717chr35912 872 336 265 223 ------
NM_001031740chr171429 1213 677 433 237 205 36 ------
NM_001031804chr1644394 3103 575 405 ------
NM_001032380chr1031691 1639 432 ------
NM_001032394chr632344 519 23 1497 11829 --
NM_001033044chr13739 197 45 --11705 --
NM_001033047chr422252 471 --1762 11746
NM_001033056chr13739 197 45 --11705 --
NM_001033059chr61448 11732 --1350
NM_001033087chr2023012 313 --11090 1943
NM_001033117chr394108 4076 3575 3049 3032 1707 1564 1227 818 --11337 --
NM_001033507chr151746 1667 1501 618 432 ------
NM_001033566chr174778 756 601 351 ------
NM_001033568chr174778 756 601 351 ------
NM_001033602chr1332284 1043 1021 1524 1782 --
NM_001033756chr631408 456 276 ------
NM_001033756chr631408 456 276 ------
NM_001033925chr1021649 418 11968 ----
NM_001034954chr10----12865 1545
NM_001034955chr10----12865 1545
NM_001034956chr10----12865 1545
NM_001034957chr10----12865 1545
NM_001035chr121172 354 --2983 358 --
NM_001035254chr96726 698 617 410 173 91 --21843 110 11630
NM_001037132chr7------1784
NM_001037133chr7------1784
NM_001037174chr21168 ----11830
NM_001037317chr132244 54 40 168 ----
NM_001037334chr1862385 2286 875 420 365 109 --12389 21746 333
NM_001037582chr461420 653 448 360 289 233 11278 21710 242 --
NM_001037954chr112841 41 13174 21194 58 --
NM_001038702chr532624 1775 848 ------
NM_001039348chr23996 967 116 11006 1120 --
NM_001039349chr23996 967 116 11006 1120 --
NM_001039459chr74755 138 76 44 1939 ----
NM_001039538chr273713 3367 3099 2963 2597 646 116 ----11361
NM_001039577chr144122 3855 3769 940 34476 3907 1322 ----
NM_001039590chrX4764 449 347 41 13951 ----
NM_001039591chrX4764 449 347 41 13951 ----
NM_001039618chr1165932 5477 5053 4849 957 34 24725 4101 ----
NM_001039690chr1622044 125 11551 --12211
NM_001039840chrX32257 1709 1702 12319 15002 15860
NM_001039905chr154441 148 104 23 11552 21242 517 11332
NM_001039916chr122343 332 --2919 229 --
NM_001039917chr122343 332 --2919 229 --
NM_001039918chr122343 332 --2919 229 --
NM_001039919chr122343 332 --2919 229 --
NM_001039920chr122343 332 --2919 229 --
NM_001039937chr132329 205 --11208 --
NM_001039938chr1341503 1349 307 143 ------
NM_001039960chr1251652 1358 1105 645 176 ------
NM_001040108chr1463182 3097 2735 2320 2130 226 23107 3054 12255 --
NM_001040144chr1622044 125 11551 --12211
NM_001040146chr1622044 125 11551 --12211
NM_001040151chr11164127 4001 3808 3653 3645 3530 3214 3016 3003 1744 1241 1028 265 175 154 122 14531 44098 4043 1037 146 14197
NM_001040152chr795084 5003 4757 3424 3163 2056 989 968 593 21917 754 24369 3330 13805
NM_001040159chr4--21440 1052 ----
NM_001040172chr53525 100 85 21640 1177 2319 296 --
NM_001040173chr53525 100 85 21640 1177 2319 296 --
NM_001040214chr641996 1730 571 244 ----1389
NM_001040272chr921625 1533 --31827 1501 542 --
NM_001040284chr1632163 1296 647 --23677 998 --
NM_001040402chr442691 2370 1298 863 13163 2306 52 --
NM_001040450chr1542807 2707 2081 29 ----12380
NM_001040453chr1542807 2707 2081 29 ----12380
NM_001040619chr121392 178 21259 508 11489 --
NM_001040709chr172429 2226 2190 2071 1565 757 518 ------
NM_001040712chr941173 1124 801 424 23050 1156 12451 --
NM_001042371chr1662035 1979 1760 1517 713 643 ----159
NM_001042413chr9103537 3384 2996 1130 1074 947 712 428 263 29 --22988 921 1419
NM_001042424chr492755 2676 2633 2619 1267 1170 1083 750 239 12608 ----
NM_001042453chrX31511 684 222 ------
NM_001042481chr1451794 1673 638 483 100 1707 ----
NM_001042492chr1733447 3047 395 ----22758 747
NM_001042494chr1533436 2663 524 190 ----
NM_001042495chr1533436 2663 524 190 ----
NM_001042496chr1533436 2663 524 190 ----
NM_001042497chr1533436 2663 524 190 ----
NM_001042533chr322128 523 ----22674 1152
NM_001042555chr1213932 11660 --1735
NM_001042599chr2117791 2459 2024 2005 1936 1739 1601 1302 866 860 395 27525 1949 37605 6061 2722 15262
NM_001042601chr372648 2506 2048 516 412 405 235 1451 --13005
NM_001042603chr1275330 5321 4651 4383 4377 1478 639 ------
NM_001042669chr451531 635 348 146 90 --21795 1751 --
NM_001042681chr172592 2475 2167 2069 1674 762 257 ------
NM_001042682chr172592 2475 2167 2069 1674 762 257 ------
NM_001042682chr172592 2475 2167 2069 1674 762 257 ------
NM_001042683chr61519 --1319 11486
NM_001043318chr1483289 2856 2762 1428 1180 412 285 235 23364 1409 33500 2644 865 --
NM_001043351chr131688 854 401 ------
NM_001044387chr1963580 1178 966 641 107 85 --3951 650 251 --
NM_001044388chr1963580 1178 966 641 107 85 --3951 650 251 --
NM_001048183chr163438 3285 2965 2833 1227 787 1582 12974 --
NM_001049chr1441626 858 689 683 21791 760 12146 --
NM_001095chr1251621 1524 1356 1217 660 11533 ----
NM_001099678chr365647 4796 3999 1703 865 155 14088 24504 1039 1253
NM_001100108chr197039 6869 6779 6406 5917 2553 2109 1178 361 11237 ----
NM_001106chr3159503 9358 9226 9037 8830 8643 7231 7222 7073 3851 3481 2988 2552 1444 1359 19481 16519 28236 3404
NM_001111chr162197 2070 1993 1987 1750 1017 1262 1779 --
NM_001113490chrX53386 3035 1335 1089 470 12530 12266 --
NM_001116chr1682779 2196 1128 895 786 771 606 225 --52806 2791 2253 684 174 --
NM_001122679chr53997 529 183 --1457 --
NM_001128chr162852 361 34048 2561 36 ----
NM_001135chr155811 673 158 69 23 1750 ----
NM_001140chr172178 147 ----140
NM_001148chr422036 491 ----1212
NM_001167chrX66074 5001 4080 2239 1196 41 --32638 1891 965 --
NM_001173chr1423902 298 --34565 3104 352 --
NM_001177chr1261771 1539 1515 730 188 42 12479 ----
NM_001186chr2132868 1247 983 12000 --13234
NM_001198chr642235 1981 892 129 11850 --1681
NM_001204chr2107175 6936 6344 5281 5126 5025 4906 4811 1137 1076 --25249 1752 --
NM_001222chr1041856 1255 751 485 --3759 755 361 --
NM_001237chr4--1993 --143
NM_001237chr4--1993 --143
NM_001282chr1752479 2233 861 210 110 ----12527
NM_001289chrX31429 638 351 --21303 1271 --
NM_001310chr1252966 2944 2698 2385 236 11897 ----
NM_001346chr382841 2610 2103 1736 1008 164 83 60 ------
NM_001356chrX2624 23 --1469 --
NM_001364chr1143732 1690 1251 299 14156 23452 400 --
NM_001386chr871920 1597 981 896 769 635 243 2271 234 2571 202 --
NM_001387chr592960 2743 2683 2527 2141 1053 920 913 872 --12852 --
NM_001391chr1851098 931 395 375 357 ------
NM_001397chr172428 1903 1799 1693 614 98 62 --12029 --
NM_001406chr1741720 1619 472 122 --1312 --
NM_001412chrX33224 2917 677 ------
NM_001419chr1931814 1003 376 13329 43631 3457 3416 522 11446
NM_001420chr1992947 2192 1236 1176 1159 1073 985 418 251 ------
NM_001421chrX41664 1594 1188 1148 11275 ----
NM_001424chr164708 644 621 599 1247 --1496
NM_001430chr241850 1755 1378 56 ------
NM_001438chr131248 377 265 ----12271
NM_001455chr694713 3922 3348 1852 913 672 294 201 183 11668 ----
NM_001460chr163265 3064 2749 2406 2209 1142 183 22313 56 1679
NM_001542chr142783 743 497 370 2516 83 ----
NM_001609chr1053587 3236 3229 603 382 13869 34045 502 305 --
NM_001616chr232981 2589 1095 --11114 --
NM_001618chr1275 27 ----2725 52
NM_001634chr61448 11732 --1350
NM_001642chr1121263 900 --21288 938 --
NM_001649chrX62465 2447 2335 2243 1924 728 --32451 632 435 --
NM_001650chr1852667 1202 1039 700 64 1577 13772 --
NM_001656chr511454 ----1662
NM_001659chr1292664 2287 2280 853 667 282 175 57 33 11777 11847 --
NM_001663chr1422599 74 11011 ----
NM_001664chr34978 880 767 645 ------
NM_001668chr161996 870 751 588 335 112 ------
NM_001674chr12942 405 2809 58 11039 --
NM_001678chr1771758 1683 1631 1132 665 353 183 --180 --
NM_001683chr392649 2523 2089 596 303 280 152 67 52 184 --193
NM_001684chr173456 2752 2686 1652 1391 304 24 23981 505 13209 --
NM_001689chr221441 468 --11991 11311
NM_001695chr853977 2953 1637 1176 504 12745 23831 2908 --
NM_001709chr1122447 1905 ----12479
NM_001716chr1131509 1190 1060 11291 21148 256 1311
NM_001754chr2173918 2904 1212 1048 463 278 184 13172 --11455
NM_001759chr1255335 4902 4459 3830 120 --11717 --
NM_001777chr333951 3344 1102 14146 2389 132 --
NM_001789chr331381 648 54 11096 --11324
NM_001830chrX43072 2945 1387 1120 1958 12949 1785
NM_001843chr12------1183
NM_001851chr62616 584 173 ----
NM_001903chr51864 ----166
NM_001918chr1149060 8628 7722 6935 6927 6685 6655 5681 2857 2523 1947 1675 992 356 13682 ----
NM_001939chrX53813 1108 436 410 396 23357 946 11429 176
NM_001946chr1241052 967 257 240 ------
NM_001949chr642203 1188 851 294 ------
NM_001981chr142283 816 342 220 1304 --1806
NM_001987chr12103905 3810 3789 3146 1384 1162 804 286 280 181 1730 ----
NM_002006chr465361 4842 1408 938 641 564 --21724 224 --
NM_002009chr1532712 1854 303 12440 --12250
NM_002023chr131114 654 205 --1495 --
NM_002025chrX127810 7579 5971 5883 3559 2228 1951 1319 767 431 83 39 32031 1944 310 26523 6473 22901 1365
NM_002035chr1862556 1434 1256 1185 610 168 --1883 12626
NM_002060chr13481 345 329 ----124
NM_002061chr161761 1226 757 730 723 525 ------
NM_002065chr13739 197 45 --11705 --
NM_002072chr94880 864 812 287 ------
NM_002076chr1223052 1086 11201 22638 1249 2608 509
NM_002077chr93550 532 230 1681 ----
NM_002080chr164720 627 188 133 --1956 --
NM_002092chr475021 4681 4442 3994 3280 3255 2039 13938 34769 4563 4188 --
NM_002126chr1783761 3581 3382 2955 2947 2804 1010 333 12521 ----
NM_002128chr13168 1670 1655 --
NM_002136chr12------1550
NM_002158chr232846 2317 844 ----1646
NM_002199chr4187 ----1241
NM_002205chr123964 948 743 1678 ----
NM_002210chr253304 2893 2879 1078 769 22959 559 23466 519 --
NM_002254chr252183 1983 1771 1546 381 21848 28 ----
NM_002264chr384842 4814 3310 1546 1005 620 609 45 ------
NM_002270chr584841 4590 3838 2171 1930 687 91 76 11386 14649 --
NM_002285chr242875 1084 698 330 ------
NM_002293chr152335 2150 1743 758 566 --1239 --
NM_002349chr231363 1337 184 ------
NM_002359chr1773351 3115 2955 1520 586 430 240 ------
NM_002374chr273713 3367 3099 2963 2597 646 116 ----11361
NM_002387chr553965 3362 1904 1819 286 11338 14508 --
NM_002397chr531611 541 486 ------
NM_002409chr2273185 2969 2096 1265 919 902 791 11284 ----
NM_002430chr2241722 1661 446 75 ------
NM_002445chr861600 386 321 252 236 59 ------
NM_002485chr832162 1774 300 --22166 599 --
NM_002499chr153608 345 56 1430 ----
NM_002501chr19103666 3458 3417 3244 3011 1487 936 663 449 173 ------
NM_002504chr9--1135 --1428
NM_002514chr84322 100 53 24 ------
NM_002515chr1441357 1345 1257 44 11336 ----
NM_002522chr1792547 2530 2521 942 883 732 713 114 37 ------
NM_002545chr1153540 1460 981 877 489 44153 1167 866 433 31838 1218 832 --
NM_002547chrX54019 3887 3292 1371 212 --14095 --
NM_002578chrX------1404
NM_002581chr974578 3966 1922 1169 1045 689 360 31833 1820 120 1144 --
NM_002588chr571429 1278 535 342 242 166 71 1226 ----
NM_002594chr2052063 782 655 215 80 1821 2135 96 --
NM_002609chr551330 1272 759 457 52 --41922 1782 1486 535 --
NM_002613chr1664210 3935 1782 1452 526 307 24105 168 11966 --
NM_002641chrX3630 373 232 --1495 --
NM_002644chr13603 41 29 --21559 1101 --
NM_002645chr1142572 1262 901 318 --1700 12670
NM_002655chr844236 3305 1708 741 25170 852 --13947
NM_002657chr20123464 2736 2600 2538 1551 1541 1028 974 612 593 359 56 13071 1519 --
NM_002662chr3--11922 --1539
NM_002698chr1992802 2611 1211 1120 872 640 211 205 196 12753 --1949
NM_002709chr243324 2689 894 82 ----1797
NM_002716chr1183480 2800 2764 2624 1483 1399 1129 888 ----1109
NM_002719chr1432274 2035 1579 197 ----
NM_002721chr9266 47 1347 ----
NM_002725chr1124439 4369 4274 4160 3468 3120 2859 1060 530 315 215 200 1227 ----
NM_002730chr1971238 1159 866 393 210 201 120 1411 11094 --
NM_002731chr152823 1164 163 142 33 --22806 765 --
NM_002737chr17136511 6150 5893 5751 5305 4968 4835 4707 4094 2679 1636 876 823 25314 411 14421 --
NM_002738chr164736 459 338 95 1350 ----
NM_002745chr22114381 4176 4165 4133 2940 1774 835 717 705 485 259 23551 3054 23433 222 --
NM_002768chr1631586 539 131 1492 1287 --
NM_002776chr1982041 1933 1790 1332 810 646 182 168 21924 724 31990 1775 271 21712 302
NM_002819chr1971347 973 528 367 239 171 162 ------
NM_002827chr2091537 1304 430 312 306 291 182 175 30 ------
NM_002837chr12104245 3431 3286 2990 2828 1844 1831 860 854 770 11589 --11151
NM_002839chr941173 1124 801 424 23050 1156 12451 --
NM_002869chr1151795 1710 423 407 396 ------
NM_002886chr344302 4116 3205 314 --14164 --
NM_002903chr175322 116 50 39 32 ------
NM_002955chr62720 448 --21461 1263 --
NM_002956chr121211 1997 ----
NM_002958chr32863 400 ------
NM_002971chr32966 899 ------
NM_002977chr232485 1266 954 12546 12652 --
NM_003010chr1731906 223 67 --31505 157 96 --
NM_003026chr93967 517 349 --1117 --
NM_003028chr9123824 3638 3540 3033 2726 1557 1441 1375 1307 1222 1042 751 --1589 --
NM_003030chr341444 1431 83 43 ------
NM_003032chr342201 1000 787 560 12068 --12706
NM_003042chr331512 1435 35 11887 --11395
NM_003043chr384304 3416 3172 3022 2848 1595 1264 490 23518 3491 13389 13922
NM_003045chr13124447 4187 3571 3375 3287 1715 1237 1150 690 442 332 198 1669 1910 --
NM_003051chr131770 1261 790 ------
NM_003060chr541248 971 155 149 ------
NM_003071chr321795 667 1743 ----
NM_003076chr1231197 615 177 --11618 --
NM_003079chr172267 169 1879 ----
NM_003081chr202806 760 ------
NM_003106chr331036 194 188 --1147 --
NM_003110chr174856 757 693 315 ------
NM_003128chr222470 425 1169 ----
NM_003131chr671930 1895 1752 1513 1486 183 149 --21911 1907 1308
NM_003137chr631733 754 623 ------
NM_003162chr22720 21 1967 ----
NM_003189chr162807 2619 2430 636 511 372 22730 457 32852 2359 491 --
NM_003200chr1991860 1804 1710 1671 1552 258 212 93 30 --22179 87 1437
NM_003214chr671274 1203 1112 1091 341 252 140 ------
NM_003217chr1241850 663 375 216 --1344 --
NM_003236chr242820 1409 1276 126 --22824 272 --
NM_003243chr151174 917 340 177 169 11021 2366 157 --
NM_003255chr1772380 1942 750 724 515 202 106 1561 ----
NM_003274chr2142786 370 297 208 ----22106 2038
NM_003319chr2130 1825 ----
NM_003336chrX31064 392 62 1892 ----
NM_003338chr10--11825 1122 --
NM_003339chr52519 365 --1369 --
NM_003340chr431198 426 300 ------
NM_003342chr1763025 1082 775 708 309 83 --22030 1022 --
NM_003350chr82848 159 --1367 --
NM_003352chr23365 252 212 ------
NM_003369chr1182287 1913 874 799 573 302 272 239 ------
NM_003370chr195754 688 173 54 43 ------
NM_003371chr951525 650 581 242 48 ----11704
NM_003374chr52694 155 1733 ----
NM_003376chr631474 522 342 ------
NM_003376chr631474 522 342 ------
NM_003387chr232506 2314 172 3603 430 25 12260 --
NM_003392chr343394 1721 1302 327 ------
NM_003404chr2052021 1929 1621 1507 36 --11511 --
NM_003406chr831627 1571 647 11786 162 --
NM_003411chrY31639 1230 79 11784 ----
NM_003453chr131122 ----1706
NM_003458chr3113271 3002 2984 2971 2750 2671 2652 2646 2563 1469 963 13771 13458 12734
NM_003466chr24902 500 489 297 12385 1813 11743
NM_003478chr1132537 1260 283 --11045 --
NM_003480chr121134 ----1157
NM_003482chr1272497 676 670 619 494 310 40 ------
NM_003483chr121193 ----1932
NM_003559chr17113382 2728 2721 2575 1486 1391 722 535 409 260 232 ----1801
NM_003574chr1864701 4210 1746 912 548 410 11070 ----
NM_003581chr261057 378 350 190 174 161 --1430 --
NM_003593chr178667 648 561 486 283 169 76 62 --2287 222 --
NM_003598chr195631 457 258 68 26 ------
NM_003607chr164188 2800 999 775 402 271 23695 901 --11579
NM_003615chr323948 685 12962 --23533 2986
NM_003617chr154506 3873 446 110 27 33981 895 204 ----
NM_003630chr6----167 1683
NM_003633chr542217 404 47 39 ------
NM_003636chr181755 1383 1351 668 285 271 261 168 2250 103 ----
NM_003658chr112587 201 --1669 --
NM_003663chr353254 3103 3073 554 315 ------
NM_003671chr993331 3272 2964 2938 2305 2235 1194 400 280 4965 541 265 117 33211 3166 3140 --
NM_003680chr13178 156 69 --284 76 --
NM_003714chr541997 1024 960 384 ----12172
NM_003735chr571429 1278 535 342 242 166 71 1226 ----
NM_003736chr571429 1278 535 342 242 166 71 1226 ----
NM_003743chr232042 1907 1741 --11456 --
NM_003758chr1521608 435 ------
NM_003758chr1521608 435 ------
NM_003759chr421095 25 --23889 2749 1399
NM_003763chr2031021 977 137 1764 12635 --
NM_003768chr141784 738 646 98 1459 ----
NM_003774chr1242351 621 172 104 --23079 818 --
NM_003861chr1432050 837 421 12563 22881 2012 --
NM_003872chr242401 2230 2104 192 ------
NM_003887chr232190 501 469 ------
NM_003895chr2121744 750 31381 713 328 ----
NM_003913chr653554 3494 2927 1673 1183 ------
NM_003930chr731567 859 617 --21972 263 11589
NM_003947chr34994 336 318 187 1902 183 --
NM_003953chr182582 2316 1102 950 524 463 239 180 12751 ----
NM_003958chr663122 3016 2952 2930 1189 1056 1219 --13858
NM_003983chr1694002 3776 2914 2741 2711 1623 1514 972 142 21417 600 14056 --
NM_003994chr1263397 3143 3087 1010 372 139 --1630 --
NM_004006chrX----1814 12167
NM_004007chrX----1814 12167
NM_004009chrX----1814 12167
NM_004010chrX----1814 12167
NM_004011chrX----1814 12167
NM_004012chrX----1814 12167
NM_004013chrX----1814 12167
NM_004014chrX----1814 12167
NM_004015chrX----1814 12167
NM_004016chrX----1728 12081
NM_004017chrX----1814 12167
NM_004018chrX----1728 12081
NM_004020chrX----1814 12167
NM_004021chrX----1728 12081
NM_004022chrX----1728 12081
NM_004023chrX----1728 12081
NM_004028chr1852667 1202 1039 700 64 1577 13772 --
NM_004035chr1775016 4547 3958 3594 3229 1768 439 --45048 4344 3792 3236 --
NM_004067chr73608 496 210 141 1439 --
NM_004090chr1783024 2872 2763 2717 2550 2372 2197 1378 ------
NM_004093chr1362815 2366 578 537 503 235 143 42866 567 516 295 12716
NM_004096chr1071756 1682 1669 1337 613 469 441 ------
NM_004100chr632358 444 306 1921 ----
NM_004102chr13393 234 192 ------
NM_004105chr23996 967 116 11006 1120 --
NM_004112chr1741706 1329 267 84 21718 1464 11691 --
NM_004113chr332025 1673 33 31496 142 87 163 --
NM_004114chrX--11239 2270 164 181
NM_004117chr641867 1481 1424 323 12039 11752 --
NM_004136chr1542003 1025 858 793 --22602 117 --
NM_004171chr1188490 6560 6529 6297 6259 2182 846 654 ------
NM_004172chr551999 1565 724 589 190 ------
NM_004183chr113732 576 43 ----1712
NM_004227chr762480 1987 1175 426 191 98 22047 676 ----
NM_004229chrX21492 548 --22132 171 11569
NM_004264chr122864 158 ----1925
NM_004272chr52615 117 --21759 1532 --
NM_004277chr62278 106 21723 223 ----
NM_004293chr953021 2985 2441 1411 905 1959 ----
NM_004296chr14113916 3692 2827 2461 1383 1327 523 501 447 432 362 13291 11141 --
NM_004311chr1062890 2559 2532 1173 679 608 ------
NM_004319chr152375 1990 1130 1036 475 --1374 --
NM_004321chr2143292 3128 2680 2189 1411 1405 1315 1282 891 838 133 79 71 53 13515 23259 3097 --
NM_004327chr2262469 1564 1542 967 431 178 --12207 --
NM_004338chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_004370chr63809 766 641 --21474 682 --
NM_004380chr1692406 2302 2225 2120 1828 1802 687 573 528 ------
NM_004392chr1332050 904 184 --1403 --
NM_004397chr1143860 711 610 414 12908 ----
NM_004420chr1182253 2178 2068 1814 1630 1584 1503 434 --11562 --
NM_004423chr3102559 2280 939 797 747 580 469 417 359 167 --21103 991 --
NM_004437chr163630 2690 1168 991 738 238 144 13345 --
NM_004438chr263014 2868 2694 2440 976 95 --21310 49 --
NM_004440chr631521 1230 140 1256 11949 --
NM_004485chr1123845 3784 3440 3060 2857 1586 1333 844 795 710 494 96 --34213 3957 592 --
NM_004494chr131227 517 194 --21086 859 --
NM_004499chr53360 349 147 ------
NM_004500chr1461705 1529 1381 1330 1265 219 ------
NM_004501chr153920 3783 3763 3530 2957 13594 1927 --
NM_004505chr1741816 1378 1311 804 ------
NM_004514chr1752862 2773 2327 476 107 ------
NM_004559chr1129 ----144
NM_004560chr941034 337 254 67 1198 1884 --
NM_004561chr1151290 640 340 297 46 --1164 199
NM_004580chr152616 338 --11389 --
NM_004586chrX63630 1543 894 801 580 116 35018 443 284 ----
NM_004593chr3------1926
NM_004598chr563009 2995 2946 2934 1328 699 23057 1239 1367 --
NM_004615chrX3274 161 133 ----1836
NM_004637chr351168 509 433 262 114 ------
NM_004660chrY32070 620 24 --1468 --
NM_004711chr22103589 3008 2505 1204 895 843 668 494 471 56 --22261 594 --
NM_004726chrX75276 5251 3555 2116 2072 1974 869 --11868 --
NM_004729chrX51663 121 105 71 30 --12072 --
NM_004730chr551489 1387 587 65 36 21769 48 ----
NM_004736chr11466 ----11438
NM_004745chr8146781 6690 6277 6244 6097 6039 6008 5989 5519 4824 2825 2718 850 683 25796 439 15807 --
NM_004747chr1031041 315 260 ------
NM_004748chr1564041 3713 1426 1327 406 281 --13997 --
NM_004759chr172051 2013 1875 1648 1548 1385 384 1563 ----
NM_004760chr73726 664 205 ------
NM_004763chr25796 740 404 348 292 ------
NM_004772chr511548 11562 1336 --
NM_004774chr1742291 2231 2163 1155 --11970 --
NM_004776chr2033125 935 906 11265 129 --
NM_004779chr51270 ----11198
NM_004796chr1421624 719 1866 1947 --
NM_004798chr2053407 3045 870 410 181 ------
NM_004807chr242018 1987 846 684 21877 74 1535 --
NM_004808chr1072848 2481 2103 687 468 294 188 ------
NM_004815chr154914 4476 1969 1361 742 14895 14264 1972
NM_004820chr8141 ----1340
NM_004822chr1773653 3196 2800 2472 1543 724 481 1497 13774 --
NM_004831chr194913 807 391 305 ------
NM_004845chrX83677 3443 3292 3120 1395 998 247 166 ------
NM_004850chr221570 127 --1618 --
NM_004859chr1712918 1951 3157 57 28 --
NM_004863chr1484676 1683 1671 1421 778 527 454 205 --140 --
NM_004869chr1821254 667 --1256 --
NM_004871chr1754160 1685 1580 1540 895 23941 375 1652 --
NM_004884chr1571187 1151 513 454 398 261 185 ------
NM_004904chr765992 5049 1628 1615 1328 569 16605 21362 783 --
NM_004921chr132202 1842 1825 --1515 --
NM_004932chr52568 209 21400 626 --11802
NM_004936chr942246 430 207 22 22346 68 --2625 46
NM_004947chr361798 1739 947 557 113 54 ------
NM_004956chr731803 1558 1032 --14210 --
NM_004960chr163252 56 47 ----193
NM_004976chr11104817 4718 4419 3187 1486 1411 1106 607 493 88 14321 --14101
NM_004985chr1241148 578 507 353 --11070 --
NM_004992chrX168271 7927 7438 6715 6541 6003 5753 3409 3381 3153 2822 2152 1563 1299 1253 554 37594 7339 333 46675 2881 1698 870 17850
NM_004992chrX168271 7927 7438 6715 6541 6003 5753 3409 3381 3153 2822 2152 1563 1299 1253 554 37594 7339 333 46675 2881 1698 870 17850
NM_005010chr7------1784
NM_005056chr1275574 5565 4895 4627 4621 1722 883 ------
NM_005057chr131700 338 116 ----11359
NM_005067chr33741 664 113 --1745 --
NM_005095chr132170 1941 61 11935 ----
NM_005116chr2094131 4004 3777 3367 2908 2885 1766 995 328 1812 13484 --
NM_005121chr1731501 1459 303 --13187 --
NM_005135chr1533436 2663 524 190 ----
NM_005140chrX3782 416 95 21043 157 ----
NM_005151chr1862385 2286 875 420 365 109 --12389 21746 333
NM_005156chr964662 4596 3707 3381 1899 1476 --22077 1383 14196
NM_005168chr211459 ----11103
NM_005188chr11148320 8127 7863 5730 5176 5091 3263 2621 2388 2149 1389 820 636 67 25479 514 11908 --
NM_005197chr1486074 5636 5466 4243 2274 2093 382 237 12243 ----
NM_005206chr1741055 926 479 433 ------
NM_005215chr182464 124 --3625 111 61 --
NM_005233chr332223 793 60 1121 12426 --
NM_005235chr2117791 2459 2024 2005 1936 1739 1601 1302 866 860 395 27525 1949 37605 6061 2722 15262
NM_005238chr1121100 508 --22444 320 --
NM_005241chr32406 305 --1114 --
NM_005277chr421273 133 269 61 ----
NM_005334chrX81644 1623 1610 1078 260 124 104 58 --11318 1476
NM_005339chr443725 1716 899 611 ----13701
NM_005342chrX42847 2696 546 272 ------
NM_005359chr1842321 1692 882 254 11887 24059 412 1550
NM_005374chr17102325 2195 2146 1835 1809 1767 438 406 289 28 12385 1665 --
NM_005398chr1021429 1402 1190 ----
NM_005399chr143085 1554 959 804 21741 1198 13507 --
NM_005417chr202763 478 --21782 666 11742
NM_005426chr13843 704 250 ------
NM_005433chr1832679 1741 1113 ------
NM_005436chr1063748 3091 1631 1180 601 411 --22561 1070 141
NM_005458chr941620 778 699 142 1840 22214 1914 1648
NM_005475chr1272392 2256 2171 1236 808 754 655 ------
NM_005477chr1552528 2023 690 682 621 --12536 --
NM_005477chr1552528 2023 690 682 621 --12536 --
NM_005497chr1756037 4007 2422 1423 1249 1489 36060 1824 1650 --
NM_005504chr1256346 4114 1251 1233 1074 14452 1302 --
NM_005522chr721396 472 --1202 160
NM_005575chr51817 --1159 1220
NM_005603chr1851419 532 373 361 268 ------
NM_005604chr622312 1832 ------
NM_005613chr121561 359 1775 ----
NM_005639chr122724 641 11511 ----
NM_005647chrX83409 3375 3233 2775 2743 2351 2220 300 12336 ----
NM_005650chr2221285 1073 1192 ----
NM_005665chr144767 4020 788 739 21556 1069 1534 --
NM_005668chr553940 899 755 280 96 ------
NM_005730chr1293156 2997 2571 2319 1130 692 575 355 187 ------
NM_005736chr1051531 1373 642 392 22 ------
NM_005785chr1251808 571 262 80 53 --11414 --
NM_005789chr1792033 1963 1755 1739 1581 1477 821 767 654 1225 11590 --
NM_005813chr251884 1847 1709 685 386 ------
NM_005819chr143333 3070 2536 2409 ------
NM_005822chr631822 541 186 --21524 444 --
NM_005828chr17115014 4777 4602 4458 4393 1614 1297 786 169 161 119 1944 14138 --
NM_005838chr11272 29 --2459 446 --
NM_005840chrX105492 5235 2673 2073 1514 1499 1320 850 544 365 --17407 16195
NM_005853chr162566 421 ------
NM_005896chr2--179 --1700
NM_005898chr1131190 256 130 ----1886
NM_005899chr1721139 493 11580 ----
NM_005901chr1888500 7724 5944 5608 5499 2675 2372 1763 ----16990
NM_005903chr523703 1599 1899 11603 13869
NM_005909chr573801 3603 3151 1019 830 454 68 1875 11685 --
NM_005911chr221145 128 ----1311
NM_005920chr143244 3079 2465 221 12653 23688 2627 --
NM_005933chr1182711 2608 2412 2402 2050 1997 717 465 150 ----
NM_005935chr434561 4443 1225 ------
NM_005938chrX51369 532 351 288 69 ------
NM_005941chr843506 2917 705 174 ------
NM_005943chr651673 1564 1504 667 545 ------
NM_005955chr164083 3403 1619 161 121 21 ------
NM_005957chr1154888 4360 4259 3559 3408 3228 3141 1936 1770 1496 1159 915 862 586 496 12983 ----
NM_005986chr1342791 2115 1959 167 1761 1272 --
NM_006022chr132989 162 1808 190 --
NM_006036chr242335 1018 484 380 ------
NM_006037chr264836 4675 561 159 123 113 --1432 14564
NM_006047chr20157 --23503 167 --
NM_006054chr1131457 1377 1062 11617 11127 --
NM_006060chr784238 3477 1556 1431 1216 823 278 223 1495 ----
NM_006080chr732785 2139 559 1203 1566 --
NM_006091chr1541708 1676 1580 53 11600 --1524
NM_006094chr842056 1930 720 601 12425 ----
NM_006108chr1162337 2264 2175 1787 605 201 --22327 125 --
NM_006139chr242628 2393 693 518 11851 22837 327 --
NM_006148chr1762777 2380 788 605 351 299 --12195 --
NM_006160chr1741548 1540 518 426 21611 1499 11552 --
NM_006180chr951594 1487 1466 303 107 --21403 172 --
NM_006187chr1273142 2996 2514 2502 1058 856 312 1817 ----
NM_006195chr921238 384 ----1391
NM_006203chr574136 3547 1825 1072 903 190 179 ------
NM_006206chr422234 438 1430 --11053
NM_006224chr1762170 2001 1636 894 812 754 1602 12148 --
NM_006226chr221159 881 --128 --
NM_006237chr1352059 1795 719 707 149 ------
NM_006238chr6101833 1800 1549 1446 751 699 143 125 95 60 1521 ----
NM_006252chr146399 5446 1423 983 --25543 994 14924
NM_006256chr13886 862 844 ----11730
NM_006265chr81516 21241 1065 ----
NM_006279chr14708 598 180 63 ----1884
NM_006293chr152762 640 ----1161
NM_006298chr663441 3297 1092 1063 1043 645 22801 1361 ----
NM_006306chrX75132 4658 4321 4093 2327 2281 2035 --34504 531 280 11443
NM_006315chr494292 4223 4118 3744 3569 969 682 666 294 33591 3355 152 1650 11714
NM_006321chr341842 712 455 413 ------
NM_006380chr1763709 3403 2846 2759 2739 1208 ------
NM_006390chr1251736 738 558 522 174 ------
NM_006411chr65934 780 709 192 53 --1385 --
NM_006420chr2041212 919 341 201 22387 431 31358 1347 1307 --
NM_006421chr81491 ----1317
NM_006434chr10----12865 1545
NM_006469chr121245 1171 11054 ----
NM_006489chr1441357 1345 1257 44 11336 ----
NM_006516chr161627 1482 1469 1318 462 305 2547 539 21060 368 --
NM_006517chrX91981 1675 1615 1472 1443 750 710 427 48 --32066 1533 335 --
NM_006521chrX61252 1228 306 285 207 36 11313 ----
NM_006539chr166517 444 418 387 157 29 ------
NM_006540chr84560 304 246 213 ------
NM_006546chr1785986 5903 5813 5519 5136 2349 1023 596 26498 192 ----
NM_006548chr35689 670 627 274 262 --1642 --
NM_006561chr10125570 5026 4960 4771 4725 4348 4195 4145 2448 1447 674 639 24665 1774 ----
NM_006566chr1821031 375 183 ----
NM_006599chr1686406 6225 3157 1375 1188 873 329 155 17447 22605 2298 --
NM_006601chr12------1308
NM_006609chr23796 286 53 ------
NM_006614chr353159 2896 2551 667 35 --1115 --
NM_006621chr131807 1550 214 ----11624
NM_006624chr1031541 1407 24 --11450 --
NM_006628chr1564285 4057 3999 3466 1342 1102 --13407 --
NM_006646chr1341228 1113 1092 1059 42462 770 137 66 ----
NM_006650chr583666 3508 3203 2733 1002 710 571 173 11070 ----
NM_006654chr1213932 11660 --1735
NM_006667chrX21078 967 --11209 --
NM_006675chr12123372 3026 2842 2501 2487 2396 2342 702 406 133 105 72 --22594 479 --
NM_006690chr2082228 1883 1788 1651 1548 832 399 208 ------
NM_006699chr1129 --12193 1943
NM_006704chr131388 ----142
NM_006713chr52530 217 --1713 --
NM_006717chr91313 ----1554
NM_006722chr322960 1054 --11131 --
NM_006729chrX115598 5583 4966 4690 4576 4190 3975 2012 358 322 78 24633 4350 34975 3984 3882 15460
NM_006751chr2--1322 --1662
NM_006766chr841904 942 763 756 ------
NM_006772chr681587 1339 1244 1226 596 508 348 284 ------
NM_006775chr621976 270 22272 733 11248 135
NM_006788chr1841810 781 765 449 ------
NM_006802chr131170 413 327 ------
NM_006807chr171188 11200 --1882
NM_006827chr1472776 2569 2523 1337 796 475 162 32436 938 169 21124 250 --
NM_006838chr123607 368 356 ------
NM_006854chr731954 1850 1648 11857 11900 --
NM_006884chr341444 1431 83 43 ------
NM_006892chr202560 321 ----1400
NM_006892chr202560 321 ----1400
NM_006895chr211814 --289 56 --
NM_006922chr222278 327 11632 ----
NM_006924chr1723076 985 ----13443
NM_006930chr562003 1981 1952 1510 1320 31 ------
NM_006940chr1261863 1838 1574 1448 289 58 1272 1360 --
NM_006941chr229987 921 462 432 321 245 178 169 31 ------
NM_006948chr21--1682 --12353
NM_006951chr102548 328 1593 ----
NM_006965chr1831182 449 32 --1144 --
NM_006990chr182366 2187 2146 1670 974 872 609 505 ------
NM_007011chr15145442 5399 4427 2440 1956 1863 1780 1208 986 950 557 433 128 59 ----12007
NM_007030chr5135034 4298 3283 3254 1979 1917 1748 1467 1215 1130 1101 898 58 --13307 52074 2043 2012 1950 1888
NM_007036chr54994 841 829 174 --1746 --
NM_007038chr2145793 5456 4744 3729 35060 4883 1433 2356 311 11945
NM_007039chr1411664 11775 11759 --
NM_007043chr12--1759 11537 1542
NM_007054chr552864 2797 2461 814 479 --12679 --
NM_007064chr341151 469 178 95 ------
NM_007081chr2261144 871 435 426 383 120 ------
NM_007087chr164694 637 613 304 ----1809
NM_007106chr134901 642 460 185 --22542 787 --
NM_007118chr54814 656 645 35 ------
NM_007124chr632013 1707 1257 11696 11623 --
NM_007159chr321582 55 21143 387 ----
NM_007175chr842766 1229 765 390 --22787 708 --
NM_007203chr943500 3484 2964 196 --13392 13801
NM_007218chr82309 77 ----155
NM_007222chr81656 2135 114 11414 --
NM_007236chr1541504 789 406 282 --11513 --
NM_007249chr13158426 8285 7991 7031 6200 5710 3251 2602 2335 1866 1475 591 548 402 202 2467 54 2834 345 26915 6054
NM_007276chr73981 454 166 --1700 --
NM_007292chr1775016 4547 3958 3594 3229 1768 439 --45048 4344 3792 3236 --
NM_007308chr42469 165 1276 ----
NM_007331chr442669 2409 2218 1018 ------
NM_007347chr1542383 2255 1124 685 --11216 --
NM_007372chr173348 301 142 ------
NM_007373chr1021425 582 11603 ----
NM_007375chr142700 2318 992 375 ------
NM_012072chr2064428 3862 2939 2892 933 81 13201 --1800
NM_012081chr553278 3178 2592 1473 1148 13651 ----
NM_012095chr1032791 2773 2305 11283 23395 345 1904
NM_012097chr21168 ----11830
NM_012102chr172592 2475 2167 2069 1674 762 257 ------
NM_012104chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_012104chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_012120chr632734 1870 1839 --1630 --
NM_012134chr161612 1598 1189 661 357 53 ----11623
NM_012137chr162034 1128 960 770 629 281 ------
NM_012141chr132329 205 --11208 --
NM_012153chr1151860 1721 959 421 268 ------
NM_012156chr2073269 2933 2910 760 677 349 263 ------
NM_012157chr32617 170 ----186
NM_012164chr946462 5226 2965 771 12364 47478 6886 2445 867 1102
NM_012193chr1154835 4518 4083 3697 3595 --13965 --
NM_012199chr192973 2875 1558 1410 1136 1103 687 627 226 34165 3713 67 --12837
NM_012214chr235435 1844 959 --15476 11744
NM_012215chr1031854 342 321 --1146 --
NM_012219chr353123 2690 1055 402 394 2235 65 22272 726 --
NM_012223chr2--2949 879 --1852
NM_012224chr41470 ----1249
NM_012229chr1051307 1051 524 298 28 ------
NM_012234chr383099 3002 1435 1235 1146 1042 948 912 ------
NM_012244chr1461510 1260 1169 708 537 195 1177 ----
NM_012262chr155239 4393 3804 3635 54 --13189 22067 262
NM_012264chr2251412 605 490 308 136 --1178 --
NM_012264chr2251412 605 490 308 136 --1178 --
NM_012279chr532011 1447 165 11347 11574 --
NM_012281chr721524 723 ----12173
NM_012282chrX5809 748 676 205 49 1236 1178 --
NM_012287chr344575 1525 1379 133 --33690 1273 368 --
NM_012288chr6175339 5249 5042 4927 4913 4452 4093 3942 2247 1968 1909 1419 1203 966 366 290 252 ------
NM_012294chr773261 2682 1502 1429 1363 857 571 ------
NM_012296chr1183357 3155 2967 2836 2410 1480 247 92 11189 13023 11583
NM_012297chr432316 2166 464 ------
NM_012300chr531950 434 171 22503 2162 ----
NM_012301chr742067 1408 582 572 --1549 1348
NM_012306chr12103554 3096 3021 3001 1197 1131 845 771 421 223 --42246 1135 833 449 --
NM_012308chr1131685 751 357 1767 12139 --
NM_012309chr1174933 4158 976 881 623 483 274 24184 130 ----
NM_012316chr163636 2168 2134 856 751 200 25589 5335 23702 1554 --
NM_012325chr204228 216 156 39 --11328 --
NM_012334chr553004 2889 1750 1506 1295 14049 23413 1515 --
NM_012338chr72309 230 1120 ----
NM_012347chr611009 22366 66 ----
NM_012382chr544391 4144 4049 1249 --24499 4407 14190
NM_012396chr15589 510 478 464 36 ------
NM_012398chr19102384 1915 1191 1074 805 749 652 614 592 497 --12925 --
NM_012405chr153885 3387 2938 1390 117 ----1135
NM_012408chr204839 741 169 26 --1200 --
NM_012417chr17------199
NM_012420chr1021431 888 ----22059 499
NM_012434chr641524 1421 1104 456 1571 11204 --
NM_012448chr1751825 1710 724 451 52 --22230 879 --
NM_012471chrX1683 21226 256 1309 --
NM_013227chr155811 673 158 69 23 1750 ----
NM_013231chr1484371 4010 3480 3392 1732 1022 688 527 ------
NM_013233chr251054 950 340 101 22 ------
NM_013255chr7118459 6940 6753 6430 3558 2797 672 492 315 187 147 38231 6232 3192 13547 --
NM_013261chr442318 1361 889 873 ----12291
NM_013302chr1674476 3148 2918 2896 1417 889 446 --23474 328 --
NM_013361chr195273 263 236 179 94 ------
NM_013381chr1221515 428 11672 ----
NM_013433chr1981939 1885 1552 1511 1424 672 401 212 11454 ----
NM_013434chr251981 1783 1515 648 502 --21754 1430 --
NM_013434chr251981 1783 1515 648 502 --21754 1430 --
NM_013444chrX1177 ----1319
NM_013446chr731360 320 159 --1133 --
NM_013447chr1933713 3034 255 1968 23733 3598 12834
NM_013449chr1252998 2896 2150 72 24 ----1596
NM_013951chr24902 500 489 297 12385 1813 11743
NM_013952chr25979 577 566 374 48 12462 1890 11820
NM_013953chr25979 577 566 374 48 12462 1890 11820
NM_013992chr25979 577 566 374 48 12462 1890 11820
NM_014011chr2163 22530 860 --12050
NM_014023chr1042952 2148 879 246 --12291 --
NM_014112chr854819 4622 3972 3327 751 --23343 634 --
NM_014117chr1632605 2574 22 12211 12226 12733
NM_014141chr745231 3979 3967 406 21379 1152 ----
NM_014155chr1166747 5607 5570 4705 2543 1277 11946 32763 2255 2237 --
NM_014160chr3--31357 924 275 ----
NM_014166chr1341027 816 266 98 ------
NM_014182chr122505 238 ----1735
NM_014217chr151850 684 569 553 126 ------
NM_014231chr1272092 1965 1595 334 209 89 38 --31912 445 126 --
NM_014232chr1751667 1182 648 419 257 ------
NM_014232chr1751667 1182 648 419 257 ------
NM_014240chr373344 3288 2978 2831 1610 1602 490 1437 12631 --
NM_014268chr1831355 921 205 1236 ----
NM_014280chr11620 1691 --1348
NM_014289chrX31097 565 550 1889 2909 463 --
NM_014293chr22103821 3650 3543 3106 719 553 481 267 146 139 12805 22712 733 --
NM_014309chr2235057 4415 1308 25110 3964 --11638
NM_014313chr131605 1137 65 1155 ----
NM_014331chr4117368 7249 7005 5126 4856 1852 1406 839 638 554 533 ----12660
NM_014333chr1132086 1982 996 ------
NM_014351chr2231033 989 36 21192 411 11097 --
NM_014368chr951865 1699 1666 107 95 1788 11442 11876
NM_014381chr1463182 3097 2735 2320 2130 226 23107 3054 12255 --
NM_014411chr752011 1746 1723 1472 433 ------
NM_014418chr1451838 1322 538 461 338 --1155 --
NM_014423chr534589 3974 83 --14743 --
NM_014445chr3----11555 12169
NM_014452chr63818 477 265 ------
NM_014458chr13462 398 152 ------
NM_014469chr112658 646 180 1567 --
NM_014517chr321371 227 ----11257
NM_014521chr271685 1616 657 639 506 464 139 11865 ----
NM_014585chr23960 925 384 ------
NM_014591chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_014601chr1971617 1244 1148 614 410 305 267 ------
NM_014603chr1761641 1219 1128 1047 490 307 ------
NM_014607chr242050 2043 835 419 ------
NM_014613chr562979 2462 863 842 312 300 ------
NM_014614chr221066 351 1296 1277 --
NM_014615chr1673502 3353 2492 2348 702 258 166 43639 2576 2512 2479 11190 --
NM_014630chr1563850 2748 1498 1148 862 520 21431 962 ----
NM_014636chr9113431 3315 3007 2942 2707 1333 1267 1015 881 298 210 13409 24203 431 --
NM_014637chr841396 1347 1336 1091 ------
NM_014660chr7125 1786 --11044
NM_014663chr141115 765 343 35 --1148 --
NM_014665chr8133273 2480 2415 1343 982 974 652 641 624 608 584 479 447 ------
NM_014683chr1751851 796 415 203 78 --1423 --
NM_014686chr1962191 1939 873 666 631 43 ------
NM_014690chr7113052 2113 2095 2065 1992 1062 1021 952 875 471 424 --22842 2161 --
NM_014701chr1553250 3004 2265 984 958 11359 1687 --
NM_014702chr633300 3181 1144 13256 12803 --
NM_014720chr1031217 110 101 ------
NM_014721chr6106449 5711 5673 5224 5089 4818 2557 1786 1214 161 24899 1127 24789 925 37255 2123 711
NM_014726chr175991 440 172 59 48 ------
NM_014730chr1254605 4546 4024 3557 909 1662 11505 --
NM_014730chr1254605 4546 4024 3557 909 1662 11505 --
NM_014732chr16125652 4338 4258 2070 1430 1096 483 426 399 198 109 75 21951 82 --14244
NM_014735chrX31996 644 630 ------
NM_014739chr644242 3313 1429 42 --12861 --
NM_014747chr1124762 2317 2302 2182 1281 1213 669 630 419 327 236 134 11338 24134 1307 --
NM_014751chr83877 798 380 ------
NM_014755chr272902 1556 1490 1250 886 800 31 1850 --1172
NM_014765chr132481 2107 316 ------
NM_014767chr1093108 3071 3061 2944 2692 2516 2344 1306 647 13522 23541 1088 1281
NM_014774chr152266 2173 979 871 572 11181 22804 75 --
NM_014776chr1272926 2599 1068 856 774 751 589 1268 23057 900 1932
NM_014784chr14797 791 292 273 1926 1915 1969
NM_014800chr74755 138 76 44 1939 ----
NM_014810chr183557 2632 2622 2515 1209 828 737 72 ------
NM_014819chr52811 211 ----1764
NM_014826chr164188 2800 999 775 402 271 23695 901 --11579
NM_014827chr121087 468 --11189 --
NM_014828chr1452401 1729 1579 399 129 --2951 517 --
NM_014830chr1273524 3140 3043 2669 1365 1165 1122 --11530 --
NM_014832chr131717 1109 11576 1472
NM_014835chr2072245 1902 1665 1460 863 181 130 11698 ----
NM_014836chr1031691 1639 432 ------
NM_014838chr2221910 160 12507 11125 --
NM_014840chr1272615 2368 1152 1048 828 667 289 23363 160 23303 341 --
NM_014841chr62475 295 ------
NM_014849chr151267 1182 933 198 101 ------
NM_014850chr394108 4076 3575 3049 3032 1707 1564 1227 818 --11337 --
NM_014873chr174807 3930 3048 1346 411 367 286 --11240 --
NM_014877chr17116799 6449 6060 5799 5595 5589 2964 2741 2298 1273 606 ------
NM_014897chr1722703 2224 22233 893 --11001
NM_014904chr1042485 1179 681 635 --1257 --
NM_014906chr1753567 3296 3086 1365 494 12707 13451 --
NM_014909chr1452887 2876 2667 1131 30 --13202 --
NM_014923chr1322075 912 ------
NM_014932chr331472 1336 682 ------
NM_014935chr172964 1492 1362 1136 928 484 203 --23283 2405 12943
NM_014938chr1272415 2406 1633 1601 1593 783 517 11000 1228 --
NM_014939chr1821450 1345 11556 ----
NM_014947chr111250 --22489 796 --
NM_014948chr2072108 2058 1662 968 560 357 140 12162 1550 1405
NM_014952chr1532031 696 29 --21772 428 --
NM_014961chr431805 1577 854 ------
NM_014962chr2031787 411 330 ------
NM_014982chr1434520 4375 164 --33703 3671 1509 --
NM_014989chr641679 1590 1374 339 1713 ----
NM_014991chr442479 2178 2170 340 --32670 2646 2461 --
NM_015000chr1211896 ----1666
NM_015002chr1252054 1760 1550 472 334 --11523 --
NM_015008chr332433 626 413 --11224 1537
NM_015020chr1653347 1367 1295 1157 734 --33749 2782 958 --
NM_015024chr831305 1038 174 1282 ----
NM_015025chr222123 191 --12292 --
NM_015026chr12------11665
NM_015027chr1631362 1294 813 --11456 --
NM_015033chr992420 2385 652 640 466 451 327 215 174 --12827 13098
NM_015035chr20146453 6152 6020 5917 5327 4275 2226 2204 2193 1636 1135 982 479 328 --25731 4736 --
NM_015039chr161495 1293 729 647 623 509 11161 33993 2879 1637 13801
NM_015042chr15134266 3940 3857 3298 3074 2834 2744 1478 1035 997 385 159 109 11267 --158
NM_015044chr1683193 2869 2539 2231 1986 1231 798 680 --1390 --
NM_015045chr1031536 1530 1514 ------
NM_015064chr1283461 2695 2637 1360 1042 704 475 153 13153 31412 1010 46 --
NM_015068chr753936 3855 3609 1157 908 2959 769 13221 12657
NM_015071chr554742 4653 2322 697 294 25710 321 44969 2487 1089 159 --
NM_015075chrX111841 1777 1768 1646 848 835 772 667 515 459 94 --42078 1812 1734 776 --
NM_015076chr683028 2974 2964 2932 2809 1810 1738 1386 13225 --12776
NM_015077chr17124211 4141 4125 3045 1653 1300 1195 996 847 837 620 481 1989 1546 14324
NM_015082chr542409 1796 1738 813 --1583 --
NM_015086chr1251488 1438 481 124 37 11199 31322 1022 109 --
NM_015090chr1155861 5173 4830 4786 4311 4011 3780 2268 2235 1554 1498 1307 1002 330 163 33897 1565 1476 15295 --
NM_015092chr1664431 3647 670 402 178 46 2191 75 ----
NM_015094chr22144308 4164 4122 3663 2968 1854 1637 1501 1334 1300 1242 382 230 145 13199 ----
NM_015107chrX82219 2156 2019 443 316 289 34 26 ------
NM_015115chr442691 2370 1298 863 13163 2306 52 --
NM_015137chr822331 861 12536 11800 --
NM_015138chr153804 412 217 32829 2641 2418 1993 --
NM_015144chr1633251 2786 397 23528 1183 13161 --
NM_015150chr34624 312 190 141 --1809 --
NM_015153chr62555 178 --1746 --
NM_015155chr1032771 672 66 21274 534 12958 --
NM_015156chr14--21411 483 175 13459
NM_015161chr162115 38 --1250 --
NM_015163chr1451897 1458 1314 496 149 ------
NM_015176chr121551 1171 11743 1609 --
NM_015185chrX52893 2412 2207 2124 303 ------
NM_015192chr2021020 500 1764 ----
NM_015193chr881501 385 328 311 218 212 175 38 --1156 --
NM_015199chr322921 899 12592 12035 --
NM_015206chr1582731 2632 2600 2458 1545 1473 1089 1080 --13125 11282
NM_015208chr18----11009 13573
NM_015215chr11284 22982 934 12878 1997
NM_015221chr1041454 1276 1088 21 ----11059
NM_015233chr1332284 1043 1021 1524 1782 --
NM_015236chr421271 285 --1481 --
NM_015245chr631706 110 83 22692 1776 11870 --
NM_015251chr162931 747 1397 12335 --
NM_015265chr232175 188 153 ------
NM_015267chr1251735 1661 845 278 230 ------
NM_015272chr1612077 ----11650
NM_015277chr1811706 ----1336
NM_015284chr192132 2049 1726 1684 1616 723 537 215 197 ------
NM_015285chr1852306 2261 895 741 117 11831 ----
NM_015288chr563720 2822 2572 2480 835 486 11492 13807 --
NM_015291chr173263 2591 2556 1188 1056 303 268 ------
NM_015299chr1493725 3499 3483 3405 3297 2883 1428 1276 88 12986 --12922
NM_015310chr8128147 7970 7437 5218 2780 2755 1757 1212 885 830 733 480 --27174 2768 --
NM_015313chr1141674 1554 614 222 1447 14214 --
NM_015314chr742442 794 618 583 ------
NM_015315chr563159 2826 2673 2606 1237 338 2948 838 ----
NM_015326chr142457 2055 1932 378 11974 12264 12947
NM_015327chr121301 85 --1498 1381
NM_015347chr1262659 2303 2054 1032 799 568 12561 ----
NM_015349chr642833 2461 2246 251 --1730 --
NM_015361chr21178 ----1772
NM_015365chrX43793 3264 2707 594 ----14317
NM_015375chr184595 4271 4057 3308 3039 1518 51 25 ------
NM_015385chr10----12865 1545
NM_015387chr221921 196 ------
NM_015393chr463594 3542 3029 1496 972 449 --11419 --
NM_015396chr32925 98 11301 ----
NM_015455chr543985 3570 1640 373 22781 271 11197 --
NM_015475chr2174 1732 1371 --
NM_015481chr1261064 892 801 699 305 257 ----1707
NM_015484chr11733 1707 1121 --
NM_015488chr281434 1308 1163 546 480 413 121 70 1108 ----
NM_015493chr1962137 1420 630 488 481 95 --1604 --
NM_015509chr1241291 611 587 163 --11111 --
NM_015513chr36724 684 216 148 77 35 ------
NM_015526chr194510 291 103 74 157 1200 1351
NM_015550chr763556 2797 2779 1132 857 183 22464 435 1419 --
NM_015564chr543124 3066 2995 2883 ------
NM_015568chr2063963 3147 2903 2799 723 245 --43670 2965 2653 1313 --
NM_015569chr174109 1856 1736 1508 1151 923 799 --24058 3806 --
NM_015575chr293433 3104 2866 2350 2321 1309 1295 629 98 --11110 --
NM_015576chr34814 679 615 473 ------
NM_015635chr931745 1534 481 ----1486
NM_015640chr145180 3956 1748 999 34281 4153 128 34747 4005 1949 --
NM_015645chr11133 --171 1372
NM_015651chr972112 1728 1709 907 730 353 213 ------
NM_015678chr1331310 1180 123 ------
NM_015686chrX42427 2201 2170 740 --32391 349 210 --
NM_015691chrX62897 1978 1797 1036 982 549 11991 ----
NM_015726chr141303 660 652 638 11345 ----
NM_015840chr162197 2070 1993 1987 1750 1017 1262 1779 --
NM_015841chr162197 2070 1993 1987 1750 1017 1262 1779 --
NM_015850chr861663 956 241 168 160 154 --42433 711 381 53 --
NM_015894chr2071552 1319 1081 996 140 69 23 --11561 --
NM_015981chr572599 2232 1273 988 689 213 114 ------
NM_015990chr421017 335 ----1782
NM_015995chr15145347 5008 4848 4251 3813 3592 3563 2036 1488 1308 922 212 187 122 25221 3932 ----
NM_016009chr174438 4208 3936 3076 1649 1580 897 --24691 3061 24803 4451
NM_016018chr832785 2176 1808 21069 802 1819 --
NM_016021chr642757 2504 990 104 --12798 --
NM_016025chr1621889 1314 1577 11251 --
NM_016061chr22234 76 1185 --11243
NM_016073chr152853 355 1393 ----
NM_016076chr14715 669 651 454 --12674 --
NM_016083chr633226 1555 1268 11364 12701 --
NM_016089chr341846 1692 1655 222 ------
NM_016131chr23468 130 30 ----1586
NM_016132chr1523325 3073 --13253 --
NM_016172chr9290 78 --1396 --
NM_016195chr103756 701 102 ------
NM_016201chr342214 2185 582 119 11900 ----
NM_016206chr3128253 7815 7459 6277 2817 2326 2153 1919 1828 1612 1124 956 28398 888 12147 --
NM_016231chr1721276 264 1546 2675 217 --
NM_016235chr1631403 405 320 --1962 --
NM_016255chr653293 2783 841 400 108 ----22855 2801
NM_016257chr193086 2662 2617 2488 2397 1262 1242 177 119 --12583 --
NM_016258chr1------1521
NM_016260chr277258 5028 2162 1367 1108 645 227 12174 16659 26541 321
NM_016269chr451125 1080 956 443 151 1362 ----
NM_016272chr2241977 1961 1866 113 4510 500 174 34 3483 206 188 --
NM_016300chr3--1107 --1100
NM_016322chr952545 2417 2289 318 39 ------
NM_016339chr1751717 1244 336 164 140 151 1735 11345
NM_016356chr662604 2394 2015 707 682 301 ------
NM_016376chr17114396 4209 4168 3701 3378 3176 2954 2857 749 79 40 --1223 14176
NM_016396chr1522199 918 ----12965
NM_016418chr22143712 3370 1294 1210 1093 1035 921 861 836 591 473 461 400 143 --32868 1375 1227 --
NM_016436chr2042502 2209 760 613 --1683 --
NM_016475chr1411115 --1410 --
NM_016507chr1752600 2407 2345 643 53 --1744 12944
NM_016510chr210841 691 650 643 302 288 274 260 246 232 ------
NM_016530chr1563606 3364 930 771 610 32 13438 172 --
NM_016531chr453027 2809 1640 514 38 --14049 43276 2800 1021 141
NM_016542chrX31511 684 222 ------
NM_016577chr3104127 3768 3473 3334 3162 1220 1149 891 426 180 --34388 3912 3865 --
NM_016587chr73981 454 166 --1700 --
NM_016588chr64353 120 39 29 ------
NM_016598chr34925 540 485 26 11136 ----
NM_016620chr1----1241 1508
NM_016621chr1164345 4085 4033 3804 3445 596 23012 2965 13908 --
NM_016639chr163391 355 135 --3359 51 32 --
NM_016641chr1621494 1328 ----11257
NM_016936chr1661778 1463 1452 654 542 75 ------
NM_016950chr4--21440 1052 ----
NM_016952chr1163229 2749 1395 1232 670 255 11413 22648 476 --
NM_017409chr121292 --3645 284 280 --
NM_017415chr574165 3816 3149 3102 1604 1058 562 12766 1177 --
NM_017420chr14--22345 345 --13730
NM_017423chr43764 617 328 ------
NM_017426chr41172 1584 ----
NM_017447chr2133708 376 299 13995 1520 --
NM_017544chrX2281 103 1783 ----
NM_017582chr121603 1152 21614 1583 ----
NM_017590chr2251844 999 747 520 176 11730 ----
NM_017594chr9123315 2800 1326 1174 974 926 598 310 228 176 65 48 1285 ----
NM_017610chr1511400 ----11609
NM_017626chr1041639 1263 1186 353 --1172 --
NM_017628chr433938 3239 2025 --55154 4397 3254 1723 1131 --
NM_017633chr663791 3050 2730 2515 2406 426 33920 753 224 12410 --
NM_017634chr831656 208 70 1785 ----
NM_017637chr9139178 6330 6211 5918 3527 3044 2785 2266 1303 1260 612 522 394 --18643 11038
NM_017644chr364897 4127 3893 3873 3819 1191 --13704 --
NM_017645chr933081 2458 974 11018 ----
NM_017650chr765395 4804 4257 4140 1687 479 22223 331 24009 3797 --
NM_017658chr1413922 11084 --23786 3433
NM_017660chr1952844 2532 586 521 362 ------
NM_017709chr133294 3275 150 23357 1513 ----
NM_017736chr1632098 892 35 ------
NM_017742chr185764 550 500 457 424 133 ----
NM_017744chr162052 1683 1557 759 705 453 ----1646
NM_017754chr694927 4068 3811 1308 1096 384 320 127 61 --1400 --
NM_017758chr1781511 1173 997 986 509 501 424 37 11046 ----
NM_017772chr681471 1381 1375 1094 308 151 129 122 1563 ----
NM_017784chr32379 287 1111 ----
NM_017787chr1022771 21 --1287 --
NM_017813chr8115685 5530 5388 5196 4867 2185 2097 1969 1421 1309 694 11086 15354 11576
NM_017826chr132814 36 3514 152 99 1208 --
NM_017831chr1874343 4158 3543 2912 1494 1198 1044 23287 1307 ----
NM_017847chr13792 766 415 11990 21634 31 --
NM_017848chrX73855 3583 3001 2994 761 500 95 ------
NM_017849chr273129 2948 2640 2520 2009 728 64 12724 12312 2277 159
NM_017893chr103559 533 96 2985 461 --11314
NM_017933chr21395 11377 11022 --
NM_017938chrX2376 271 11667 1593 --
NM_017957chr1731587 1068 356 --1373 1412
NM_017966chr114943 331 127 39 ------
NM_017994chr742918 2869 2645 2218 ----22365 836
NM_018003chr1532064 1594 834 --12131 12339
NM_018010chr331555 1494 1030 --1641 --
NM_018027chr1052983 956 518 193 153 1420 1178 --
NM_018030chr182841 117 1996 --1140
NM_018045chr172746 2532 2157 2004 1221 943 557 12402 --11244
NM_018061chr111658 ----21511 186
NM_018084chr2198 23218 2452 --12554
NM_018120chr831467 492 159 ------
NM_018121chr1032640 2424 2385 --12751 --
NM_018182chr1752219 1960 774 291 43 1736 11712 --
NM_018184chr321869 1431 1840 ----
NM_018205chr1052214 1854 755 229 23 1951 ----
NM_018206chr165713 614 215 156 40 --1139 --
NM_018225chr965308 4618 3584 2001 1727 632 13503 --13681
NM_018227chr423179 3029 11129 ----
NM_018234chr241940 851 747 660 12303 ----
NM_018239chr1052214 1854 755 229 23 1951 ----
NM_018243chr453133 1188 538 109 35 ----14097
NM_018246chr862726 2255 888 708 121 115 12658 ----
NM_018286chr171291 --169 161
NM_018302chr42190 128 21824 440 32078 1730 518 --
NM_018307chr174778 756 601 351 ------
NM_018312chr1151943 423 276 102 50 11920 ----
NM_018313chr312496 1987 ----
NM_018320chr1151241 846 400 283 118 ------
NM_018330chr101536 ----11382
NM_018340chr1694728 4586 4052 1937 1591 1160 826 761 651 24779 4718 23965 3797 13266
NM_018367chr1171734 1577 838 828 452 142 35 ----12447
NM_018374chr754513 1946 1894 1517 991 --14674 --
NM_018400chr11164127 4001 3808 3653 3645 3530 3214 3016 3003 1744 1241 1028 265 175 154 122 14531 44098 4043 1037 146 14197
NM_018429chr521844 1082 ----1800
NM_018440chr8147978 7967 7390 5771 5612 2937 2255 1779 1271 927 474 335 262 110 1231 ----
NM_018452chr6_random73100 2503 1218 814 783 644 478 33733 2730 894 ----
NM_018489chr14698 380 337 231 --1916 --
NM_018509chr171562 --11685 11156
NM_018553chr1751354 549 484 248 120 ----1345
NM_018566chr164278 688 414 307 259 44 11063 ----
NM_018644chr1182172 843 729 632 459 342 211 108 ----11942
NM_018667chr1642711 2300 2096 1772 --1701 22444 463
NM_018685chr721082 951 --1945 --
NM_018700chr531432 666 101 ------
NM_018710chr81286 ----11030
NM_018712chr1141445 1268 960 244 --1191 --
NM_018718chr752074 1793 836 814 637 --1532 --
NM_018841chr133940 2516 1184 21228 1208 ----
NM_018912chr571429 1278 535 342 242 166 71 1226 ----
NM_018913chr571429 1278 535 342 242 166 71 1226 ----
NM_018914chr571429 1278 535 342 242 166 71 1226 ----
NM_018915chr571429 1278 535 342 242 166 71 1226 ----
NM_018916chr571429 1278 535 342 242 166 71 1226 ----
NM_018917chr571429 1278 535 342 242 166 71 1226 ----
NM_018918chr571429 1278 535 342 242 166 71 1226 ----
NM_018919chr571429 1278 535 342 242 166 71 1226 ----
NM_018920chr571429 1278 535 342 242 166 71 1226 ----
NM_018921chr571429 1278 535 342 242 166 71 1226 ----
NM_018922chr571429 1278 535 342 242 166 71 1226 ----
NM_018923chr571429 1278 535 342 242 166 71 1226 ----
NM_018924chr571429 1278 535 342 242 166 71 1226 ----
NM_018925chr571429 1278 535 342 242 166 71 1226 ----
NM_018926chr571429 1278 535 342 242 166 71 1226 ----
NM_018927chr571429 1278 535 342 242 166 71 1226 ----
NM_018928chr571429 1278 535 342 242 166 71 1226 ----
NM_018929chr571429 1278 535 342 242 166 71 1226 ----
NM_018945chr623345 190 1590 23090 781 --
NM_018970chr722647 2383 --1153 --
NM_018976chr1232260 1901 1167 --11080 2629 78
NM_018979chr1242326 475 433 397 12179 22279 1880 --
NM_018999chr1041104 741 359 236 --34731 4429 954 --
NM_019008chr2263531 2920 2491 1097 1030 122 13161 11208 1179
NM_019022chr1821994 943 --11113 --
NM_019041chr652533 2458 2361 504 55 --11827 --
NM_019044chr253207 567 433 222 216 1884 159 --
NM_019050chr4----32163 1531 564 --
NM_019084chr1021767 1753 --11771 --
NM_019106chr2252997 2970 2566 2239 32 33399 3095 690 1324 --
NM_019116chr1643303 2307 1445 1213 --13140 11482
NM_019556chrX3293 214 79 ------
NM_019885chr252439 1979 1907 1114 975 1152 ----
NM_019887chr122229 33 1275 1254 --
NM_020039chr1251621 1524 1356 1217 660 11533 ----
NM_020122chr295881 5694 2210 1559 1428 1114 635 536 107 ----11535
NM_020151chr251811 698 590 278 60 --1687 --
NM_020182chr2043511 2308 2292 1402 --12227 --
NM_020200chr101339 1978 1100 --
NM_020205chr132353 718 293 --12479 --
NM_020208chr373317 2897 2694 2470 2348 2232 204 12627 ----
NM_020226chr43238 196 79 ------
NM_020228chr11131 --1137 1104
NM_020240chr532624 1775 848 ------
NM_020245chr654920 4114 3451 1737 686 ------
NM_020248chr152065 2053 1925 698 671 1116 ----
NM_020310chr1772229 2173 1940 1816 707 569 113 --22017 67 --
NM_020336chr2043481 2858 2706 99 22371 1197 2889 511 13032
NM_020338chr1093436 2823 2732 2606 1065 953 643 538 528 2819 56 --21370 1354
NM_020346chr112670 324 11193 2268 208 --
NM_020348chr1062634 2593 2158 1849 1728 135 --22419 1804 --
NM_020384chrX51707 1680 1432 1174 232 ------
NM_020390chr354212 3459 1212 1075 948 ------
NM_020403chr13------1583
NM_020405chr1774136 4007 3624 1527 1022 339 229 ------
NM_020416chr47809 782 716 524 376 48 30 --22017 1038 12651
NM_020429chr792779 2545 2416 2252 1096 216 183 109 55 11025 1229 12730
NM_020455chr632344 519 23 1497 11829 --
NM_020456chr1331920 1660 359 --21669 854 --
NM_020466chr624051 3384 --11610 --
NM_020473chrX3630 373 232 --1495 --
NM_020526chr181751 1527 1319 1275 722 564 540 290 --11825 11677
NM_020647chr831848 1640 520 --1557 --
NM_020651chr221660 639 --21591 294 --
NM_020689chr2031388 240 200 1234 --2592 374
NM_020697chr84280 258 223 137 --11269 --
NM_020699chr1104639 4503 4239 4206 3797 1897 1655 1553 1164 952 1418 24223 757 --
NM_020718chr1685976 5425 5102 1887 1864 804 521 265 ------
NM_020738chr251310 260 84 78 72 --21396 448 --
NM_020739chr1564041 3713 1426 1327 406 281 --13997 --
NM_020742chrX42269 2010 800 159 11932 ----
NM_020749chr821829 1300 --1773 1304
NM_020766chrX53447 3314 1563 1284 931 23133 3029 --13017
NM_020768chr583014 2478 2393 2021 940 909 347 160 ----1486
NM_020772chr1768603 7834 7349 6716 5546 1880 16261 ----
NM_020775chr13202 33 21 1161 ----
NM_020778chr1593907 3589 1857 1731 1574 824 793 415 29 --31914 652 221 --
NM_020779chr232766 2361 239 ----12385
NM_020783chr1821677 919 22260 939 ----
NM_020796chr582721 2668 2581 1164 754 715 212 90 ------
NM_020809chr111844 ----21929 197
NM_020813chr1942215 2195 1985 300 --11890 --
NM_020826chr1153468 2482 1474 960 89 --1474 --
NM_020841chr1223052 523 --12537 --
NM_020845chr1281882 1771 980 894 767 372 356 254 ------
NM_020850chr1693066 3015 2917 2814 2789 2614 2488 2379 587 ------
NM_020856chr192370 122 11049 ----
NM_020858chr1542049 967 616 406 1798 ----
NM_020870chr432193 679 150 ------
NM_020918chr1031030 568 467 --1460 --
NM_020921chr1443293 2700 1240 21 --12986 --
NM_020935chr263947 2978 875 609 428 61 13382 --22848 497
NM_020946chr961498 1308 589 446 416 325 --11350 --
NM_020947chr1631951 828 236 12118 1592 --
NM_020951chr1931617 1568 245 ----1513
NM_020962chr1571704 977 971 685 632 516 166 --42288 1685 935 387 --
NM_020964chr1884431 4088 3880 3662 3331 3069 628 282 1836 33565 3409 400 --
NM_020977chr422036 491 ----1212
NM_020993chr1262606 2418 2401 2081 1151 1020 1201 ----
NM_021020chr853118 2954 2694 2449 370 --13307 --
NM_021032chr332025 1673 33 31496 142 87 163 --
NM_021033chr1332969 901 691 ------
NM_021035chr2081111 1089 1041 859 528 469 419 94 --1448 --
NM_021038chr323169 135 13109 ----
NM_021045chr1042310 1660 759 293 ------
NM_021079chr17103287 3247 3146 3030 2831 2761 2553 1031 781 190 --1539 --
NM_021097chr262688 1918 1211 993 469 164 22341 418 22107 2038 --
NM_021116chr7168843 8392 8218 8079 8019 6854 6797 3598 3033 2650 2432 2266 2207 2123 968 452 28102 217 27105 6616 --
NM_021117chr1151685 869 832 738 185 ------
NM_021135chr682813 2124 1277 1028 575 382 252 83 1980 --1890
NM_021183chrX21908 470 ------
NM_021189chr141030 909 750 123 ----1917
NM_021191chr1252361 1779 444 167 152 --1146 --
NM_021202chr20112881 2872 2332 2150 1125 431 298 216 200 194 187 --1231 1925
NM_021572chr631241 1122 423 ------
NM_021574chr2262469 1564 1542 967 431 178 --12207 --
NM_021629chr344809 4236 3134 1735 11807 ----
NM_021637chrX2383 206 ----1992
NM_021638chr4144925 4413 4379 4320 3901 3811 3485 3427 3331 3313 1861 1338 1235 463 13862 13767 --
NM_021639chr13358 259 235 ------
NM_021647chr472959 1717 1230 884 855 846 105 11427 13293 11216
NM_021813chr684751 1687 1466 1080 1033 984 512 42 --11277 25795 1187
NM_021912chr1583379 3355 3247 2919 1670 1533 1185 392 11231 23091 2913 11293
NM_021945chr6123174 3087 2840 2284 1280 1103 1044 1031 1019 644 405 304 33035 2701 1335 1970 --
NM_021949chrX112598 2482 2465 2197 2168 2138 2125 1155 747 500 93 --12327 --
NM_021961chr11107518 7351 7321 5277 5202 2599 2240 1347 736 134 24866 1730 36325 5286 1272 --
NM_021964chr342441 2057 256 203 --16338 --
NM_021977chr662594 2531 2388 1390 771 555 ------
NM_021980chr10----1940 190
NM_022048chr15115175 5142 4920 3876 2355 1923 1131 967 926 554 359 ------
NM_022093chr11156 --2694 304 --
NM_022114chr184337 3690 3425 3204 3189 963 732 123 1889 --1406
NM_022140chr581999 1742 1578 932 907 885 299 173 --1182 11794
NM_022166chr16155794 5628 5597 5158 5006 3889 2533 2405 1964 1905 1772 1391 1295 1008 235 ------
NM_022169chr1141459 1344 1216 1178 --11517 --
NM_022334chr25796 740 404 348 292 ------
NM_022336chr221792 715 --2673 251 --
NM_022351chr833765 2958 2604 --12680 1248
NM_022405chr373317 2897 2694 2470 2348 2232 204 12627 ----
NM_022459chr1395040 4543 4161 4138 2185 1475 1441 1385 542 11617 24192 1767 --
NM_022463chr1741571 1447 1398 1063 1108 21387 83 --
NM_022473chr1574178 4118 2930 1705 1680 1665 1338 --1316 --
NM_022474chr1412363 1670 --1296
NM_022477chr2021692 1251 --21133 73 --
NM_022484chr7135 ----1456
NM_022497chr342721 940 724 545 13555 1617 --
NM_022572chr281434 1308 1163 546 480 413 121 70 1108 ----
NM_022652chr1241052 967 257 240 ------
NM_022716chr172590 1933 843 744 442 308 55 --12328 --
NM_022726chr62283 166 --1327 --
NM_022744chr1671127 1104 991 853 830 253 207 ------
NM_022745chr11648 --126 12589
NM_022751chr181236 ----2287 226
NM_022753chr152028 923 805 311 140 --12597 --
NM_022756chr151492 1349 1139 99 82 ------
NM_022758chr663062 2648 1971 607 288 126 ------
NM_022763chr332738 2157 668 11965 2534 499 --
NM_022781chr942608 2192 1078 735 ------
NM_022826chr21273 1425 ----
NM_022831chr151251 546 110 81 44 ------
NM_022841chr152990 551 21736 1086 ----
NM_022842chr372196 2070 1223 847 501 488 57 12559 22857 287 --
NM_022843chr131491 ----161
NM_022893chr253169 2663 2189 71 27 ------
NM_022898chr1464363 3555 3179 1833 1068 696 1493 11114 --
NM_022900chr72776 734 --1877 --
NM_022912chr272881 2394 2033 1914 896 380 40 ------
NM_023002chr1961788 1731 1579 524 494 210 --11701 --
NM_023037chr1331085 851 216 ----1377
NM_023076chr1632624 2527 76 --1198 11015
NM_023079chr174675 262 225 110 132 21703 218 --
NM_023105chr861663 956 241 168 160 154 --42433 711 381 53 --
NM_023106chr861663 956 241 168 160 154 --42433 711 381 53 --
NM_023110chr861663 956 241 168 160 154 --42433 711 381 53 --
NM_023111chr861663 956 241 168 160 154 --42433 711 381 53 --
NM_023112chr1492782 2695 2576 2310 2270 2074 1108 816 271 12032 --136
NM_023923chr163438 3285 2965 2833 1227 787 1582 12974 --
NM_023929chr841934 1041 408 390 ----12036
NM_024017chr1751733 556 413 143 48 21411 366 1376 --
NM_024034chr2061066 960 951 886 703 400 ------
NM_024052chr1772666 2419 2215 2056 968 358 236 --22197 2069 --
NM_024055chr55655 633 481 254 242 --1136 --
NM_024076chr1951864 916 413 167 47 ------
NM_024103chr1971282 733 727 520 168 110 34 11598 11447 --
NM_024294chr663062 2648 1971 607 288 126 ------
NM_024312chr1231409 539 253 ------
NM_024341chr1963580 1178 966 641 107 85 --3951 650 251 --
NM_024345chr9116001 5710 4564 4498 2010 1855 1711 1694 1399 488 308 --35761 4609 162 --
NM_024408chr143288 3009 1341 72 --41109 1105 1101 1005 --
NM_024430chr1841752 1443 311 59 ------
NM_024513chr352792 2679 1251 281 56 23587 250 32836 694 31 --
NM_024522chr171773 1764 1479 1285 402 332 33 --2406 340 --
NM_024541chr1041683 1651 1225 584 11244 3760 593 40 --
NM_024557chr1151298 698 351 303 173 ------
NM_024569chr182659 2393 1179 1027 601 540 316 257 12828 ----
NM_024582chr41876 1974 ----
NM_024594chr521864 1548 ----2524 39
NM_024595chr12939 770 ----1204
NM_024611chr1552466 927 898 864 187 12718 ----
NM_024612chr1731101 973 962 --11131 --
NM_024631chr113505 183 63 --180 --
NM_024639chr63899 186 180 1583 2493 254 --
NM_024659chr231025 902 310 ------
NM_024674chr162241 2232 576 472 243 136 --22875 2128 --
NM_024689chrX41715 1305 1149 558 ------
NM_024742chr1661456 692 645 559 429 50 --2596 547 --
NM_024749chr152236 2149 1593 871 124 --158 1238
NM_024761chr994376 3453 3368 1185 996 747 571 155 96 12080 ----
NM_024779chr1241526 1311 1164 130 1509 11206 --
NM_024784chr116833 716 443 394 172 77 --1181 --
NM_024792chr1741134 384 368 50 ------
NM_024798chr153702 489 313 1139 22336 110 --
NM_024811chr1151882 1790 1355 132 56 31671 1403 1299 ----
NM_024830chr551607 474 415 376 93 ------
NM_024835chr172355 37 ------
NM_024850chr53779 299 48 ------
NM_024875chr1051609 1184 276 162 41 ------
NM_024884chr1421067 951 24328 2874 13144 --
NM_024900chr442182 902 682 430 12238 141 --
NM_024900chr442182 902 682 430 12238 141 --
NM_024930chr522728 2503 --1990 --
NM_024946chr1631787 1455 1111 11639 11382 --
NM_024949chr484043 3366 3249 3100 1777 1231 934 539 --23604 789 13234
NM_024963chr7115797 5037 4763 2217 1963 1886 1394 737 586 402 35 --14130 --
NM_024989chr267886 6697 2468 2322 1939 1407 --17800 12521
NM_024991chr10----12865 1545
NM_024993chr231307 645 517 ------
NM_025040chr1911584 22143 1615 22453 2311 --
NM_025054chr844244 3420 2749 1616 --13650 --
NM_025057chr1441107 495 313 217 21166 225 --1974
NM_025058chr14584 493 78 68 ----1278
NM_025073chr121049 499 --11107 34658 4434 3626
NM_025083chr1541998 1955 1866 1583 --1639 --
NM_025134chr1662604 1945 1850 1750 460 380 ------
NM_025138chr1331480 357 247 ------
NM_025147chr221101 320 ------
NM_025151chr841615 1365 532 49 ------
NM_025208chr1142329 2037 1980 737 --12143 --
NM_025224chr2072111 2080 1998 1867 424 95 46 ------
NM_025235chr1042204 1876 1499 1386 ------
NM_025248chr17123043 2901 2717 2412 2257 2215 1299 1183 1076 613 159 43 1620 ----
NM_030576chr1752593 2106 975 942 262 ------
NM_030621chr1422581 1096 11030 21697 1158 --
NM_030625chr1052459 2160 2074 972 418 --2279 102 --
NM_030647chr731633 1448 164 1664 ----
NM_030648chr464366 3473 1896 1720 1452 559 14743 23634 1806 --
NM_030664chr1021737 579 --12349 --
NM_030674chr1283644 3557 2313 2162 1742 1377 648 358 25306 3633 1275 --
NM_030761chr182284 2229 935 790 719 276 78 33 ------
NM_030763chrX------3853 806 351
NM_030786chr141812 1783 1396 126 ----11285
NM_030791chr1431621 1194 164 153 ----
NM_030805chr241207 524 423 206 --137 --
NM_030806chr1148506 8354 8052 7977 7560 7144 6165 3467 3405 3334 3310 2354 2271 296 57495 3320 2425 2115 1597 59044 8214 7169 6407 794 --
NM_030809chr1231805 1594 466 --3938 826 29 --
NM_030816chr133681 2633 644 13164 23685 2945 --
NM_030918chr1155073 4932 4571 4447 4230 4170 3991 3927 3443 1939 1661 1099 848 815 187 --44583 1863 1164 679 --
NM_030923chr24658 454 442 171 ------
NM_030934chr131526 508 255 ------
NM_030981chr116956 919 881 840 793 201 --1945 --
NM_031157chr12------1550
NM_031217chr11------1123
NM_031266chr53360 349 147 ------
NM_031268chr1664210 3935 1782 1452 526 307 24105 168 11966 --
NM_031289chr1251040 992 780 765 129 ------
NM_031305chr451531 635 348 146 90 --21795 1751 --
NM_031314chr1461705 1529 1381 1330 1265 219 ------
NM_031365chr242393 1069 896 98 22231 334 ----
NM_031366chr242393 1069 896 98 22231 334 ----
NM_031418chr1132409 705 611 --1397 12823
NM_031419chr341568 1145 210 34 ------
NM_031431chr131567 21689 26 11334 --
NM_031442chrX33128 1289 173 2432 40 12500 --
NM_031445chr262930 2878 1150 850 666 660 --22632 1290 --
NM_031453chr1032248 519 33 --2468 443 12069
NM_031468chr7177285 6917 6521 5895 5193 3250 3014 2677 2184 2062 1688 978 972 894 518 381 333 32175 1658 866 36670 6006 5519 --
NM_031476chr1682502 2371 2294 2081 1834 868 808 163 21906 1028 12647 --
NM_031483chr2033134 1305 1167 ----12199
NM_031844chr153920 3783 3763 3530 2957 13594 1927 --
NM_031845chr273713 3367 3099 2963 2597 646 116 ----11361
NM_031847chr273713 3367 3099 2963 2597 646 116 ----11361
NM_031858chr1721139 493 11580 ----
NM_031862chr1721139 493 11580 ----
NM_031866chr105774 674 428 368 21 ------
NM_031890chr2272627 2543 2083 1880 967 303 208 --2676 73 --
NM_031940chr822246 1841 --12253 21623 1599
NM_031954chr1252762 2662 2001 1009 61 22805 2258 ----
NM_031990chr1971347 973 528 367 239 171 162 ------
NM_031991chr1971347 973 528 367 239 171 162 ------
NM_032012chr935126 3316 1625 --12120 --
NM_032013chr2021692 1251 --21133 73 --
NM_032088chr571429 1278 535 342 242 166 71 1226 ----
NM_032092chr571429 1278 535 342 242 166 71 1226 ----
NM_032139chr193740 407 246 ------
NM_032182chr10125 ----1665
NM_032186chr1----1241 1508
NM_032189chr13114287 3987 3972 1065 1036 1007 978 970 461 447 356 --24426 242 --
NM_032199chr1021408 51 13769 42387 1313 939 59 1578
NM_032208chr252499 2253 1235 451 239 21422 466 11313 --
NM_032214chr205927 878 382 93 43 --1178 --
NM_032221chr2042042 1271 312 79 --1731 --
NM_032281chr1992947 2192 1236 1176 1159 1073 985 418 251 ------
NM_032283chr181815 1734 1661 1448 1256 643 260 50 179 ----
NM_032287chr2261671 1306 1039 933 833 37 11509 13525 --
NM_032312chr2------1285
NM_032329chr263452 3229 3137 774 694 635 ----14254
NM_032352chr14------1543
NM_032403chr571429 1278 535 342 242 166 71 1226 ----
NM_032408chr731128 858 308 1885 ----
NM_032440chr10--12161 22031 652 --
NM_032445chr1522106 125 --1205 21988 1618
NM_032446chr522720 2404 21529 1111 ----
NM_032449chr172805 2538 1912 1863 1767 788 628 2936 403 ----
NM_032457chr421550 240 13418 --1838
NM_032486chr1642572 2410 1961 75 ----11811
NM_032491chr1251234 1152 831 445 69 11315 ----
NM_032499chr155542 447 379 223 179 11162 ----
NM_032538chr6122499 2310 2029 1904 1792 1085 254 239 138 112 52 38 12700 32273 2122 366 --
NM_032569chr1651768 613 313 101 24 ----11343
NM_032575chr1641693 1562 644 343 --2475 332 --
NM_032578chr1041451 1312 445 263 ------
NM_032582chr1731828 1330 689 ------
NM_032682chr322431 2378 1387 22768 774 --
NM_032711chr1773351 3115 2955 1520 586 430 240 ------
NM_032741chr65934 780 709 192 53 --1385 --
NM_032778chr322128 523 ----22674 1152
NM_032782chr5165 ----1215
NM_032804chr1032099 782 389 ------
NM_032826chr765276 4101 3380 1164 426 394 11925 --13794
NM_032837chr1731998 1792 662 11901 ----
NM_032840chr124761 119 59 39 --191 --
NM_032859chr1343257 2536 951 427 ------
NM_032866chr15113024 2792 2766 2625 2430 2061 2033 807 632 323 233 22468 57 --13221
NM_032873chr1164416 3113 3004 1366 1041 600 24243 3362 ----
NM_032875chr174765 733 179 172 1650 --1756
NM_032924chr751122 877 867 233 59 ------
NM_032947chr531002 167 88 21143 873 ----
NM_032961chr43996 474 93 --11096 --
NM_032966chr1131509 1190 1060 11291 21148 256 1311
NM_032978chr1851098 931 395 375 357 ------
NM_032979chr1851098 931 395 375 357 ------
NM_032981chr1851098 931 395 375 357 ------
NM_033017chr721588 642 11400 11379 --
NM_033055chr141086 85 53 36 ------
NM_033121chr1241831 697 567 169 ------
NM_033129chr20102075 1994 1533 772 754 620 584 473 449 217 --2723 82 --
NM_033133chr1793515 3335 3185 2665 2356 1511 1273 933 817 12685 --11159
NM_033135chr1142329 2037 1980 737 --12143 --
NM_033136chr551334 1257 356 236 48 ------
NM_033137chr551334 1257 356 236 48 ------
NM_033141chr1452022 852 791 623 468 --31559 881 313 --
NM_033143chr464428 4355 4296 3679 245 165 --24504 4311 --
NM_033181chr633226 1555 1268 11364 12701 --
NM_033211chr532029 1781 817 1309 ----
NM_033222chr91495 --1940 --
NM_033224chr7127762 7442 7263 7136 6563 5793 2996 1317 460 338 246 75 133 31998 531 365 --
NM_033225chr82530 516 ----1978
NM_033226chr165664 451 253 173 118 ------
NM_033285chr832872 1476 828 1870 ----
NM_033290chrX33689 3548 443 23495 1059 13526 --
NM_033315chr1782172 2158 2111 1606 772 746 671 402 --1437 --
NM_033326chr1142313 1948 885 43 --1379 --
NM_033331chr993331 3272 2964 2938 2305 2235 1194 400 280 4965 541 265 117 33211 3166 3140 --
NM_033360chr1241269 699 628 474 --11191 --
NM_033387chr982568 2120 1667 1013 936 702 617 70 --12368 --
NM_033425chr112841 41 13174 21194 58 --
NM_033429chr1573278 3074 2525 2270 1191 1006 329 ----1120
NM_033480chr611009 22366 66 ----
NM_033481chr611009 22366 66 ----
NM_033551chr563159 2826 2673 2606 1237 338 2948 838 ----
NM_033624chr1252054 1760 1550 472 334 --11523 --
NM_033626chrX81665 1491 1359 1352 1297 1181 524 118 --11819 --
NM_033631chr183719 3685 1566 926 707 677 660 429 --1201 --
NM_033642chrX--11239 2270 164 181
NM_033644chr531950 434 171 22503 2162 ----
NM_033645chr531950 434 171 22503 2162 ----
NM_033656chr2125739 3754 12133 25752 4675 --
NM_052834chr1852306 2261 895 741 117 11831 ----
NM_052845chr1293211 3160 2934 2613 2147 1996 805 548 536 --22906 99 --
NM_052864chr432030 733 179 11364 11916 --
NM_052874chr164670 600 99 76 ------
NM_052876chr1992348 2307 2056 1895 1846 885 541 487 288 12529 ----
NM_052879chr1254003 3710 2691 902 31 11247 ----
NM_052886chr81339 11744 ----
NM_052896chr192228 2136 2115 2023 1889 635 487 183 159 1940 12208 --
NM_052898chr841675 278 78 32 1187 11823 --
NM_052900chr841356 444 301 113 ------
NM_052904chr651354 1331 581 569 173 --1472 --
NM_052905chr2--11392 --1548
NM_052907chr1273891 3850 3344 3327 1593 1143 27 14049 ----
NM_052910chr1381821 1769 1722 1432 1353 1327 597 305 190 ----
NM_052918chr1042851 860 289 71 13160 2975 944 12326
NM_052934chr171743 890 605 562 538 295 284 11694 1245 --
NM_052938chr14995 842 761 35 1484 --1771
NM_053016chr9137771 7485 7168 7059 5602 5222 3046 2734 1840 1570 1064 164 51 17201 --11914
NM_053023chr1132929 2286 559 ------
NM_053025chr321127 98 ------
NM_053026chr321127 98 ------
NM_053027chr321127 98 ------
NM_053028chr321127 98 ------
NM_053031chr321127 98 ------
NM_053032chr321127 98 ------
NM_053056chr1162806 752 737 663 642 33 1925 12729 1197
NM_053064chr1443062 1938 1242 796 1921 ----
NM_054025chr1182172 843 729 632 459 342 211 108 ----11942
NM_054114chr6------1641
NM_057169chr1272926 2599 1068 856 774 751 589 1268 23057 900 1932
NM_057170chr1272926 2599 1068 856 774 751 589 1268 23057 900 1932
NM_057175chr442360 2287 2134 267 ----1837
NM_058240chr1411212 --1412 1137
NM_078470chr1092627 2527 2060 1047 896 847 676 632 187 1438 ----
NM_078473chr822246 1841 --12253 21623 1599
NM_078485chr62616 584 173 ----
NM_080491chr1183357 3155 2967 2836 2410 1480 247 92 11189 13023 11583
NM_080597chr182841 117 1996 --1140
NM_080645chr63809 766 641 --21474 682 --
NM_080666chr1421611 66 1443 --11440
NM_080676chr2023012 313 --11090 1943
NM_080738chr151850 1379 1334 594 373 ------
NM_080743chr642166 946 722 428 ------
NM_080759chr1332050 904 184 --1403 --
NM_080760chr1332050 904 184 --1403 --
NM_080927chr31649 --43258 2930 1214 968 --
NM_130385chr1163030 2206 236 217 100 41 ------
NM_130386chr182625 76 ----1166
NM_130391chr941173 1124 801 424 23050 1156 12451 --
NM_130392chr941173 1124 801 424 23050 1156 12451 --
NM_130393chr941173 1124 801 424 23050 1156 12451 --
NM_130442chr74755 138 76 44 1939 ----
NM_130446chr354239 1197 251 62 55 13013 31148 883 386 --
NM_130811chr202806 760 ------
NM_130830chr363137 2971 2665 2540 899 328 13647 ----
NM_133171chr204510 322 157 27 11080 ----
NM_133264chr1783395 3327 2860 810 757 577 226 152 ------
NM_133265chrX53386 3035 1335 1089 470 12530 12266 --
NM_133328chr195662 612 544 293 92 ------
NM_133330chr492755 2676 2633 2619 1267 1170 1083 750 239 12608 ----
NM_133331chr492755 2676 2633 2619 1267 1170 1083 750 239 12608 ----
NM_133334chr4116009 5549 5245 5051 4903 4584 4123 4115 3897 1820 55 ----11406
NM_133335chr492755 2676 2633 2619 1267 1170 1083 750 239 12608 ----
NM_133372chr521958 1832 1561 11842 --
NM_133378chr2130 1825 ----
NM_133432chr2130 1825 ----
NM_133437chr2130 1825 ----
NM_133445chr953545 3433 2474 1102 179 --23509 976 --
NM_133476chr122343 332 --2919 229 --
NM_133478chr2273 41 1691 12243 --
NM_133507chr122945 125 --1292 --
NM_133633chr225935 801 475 392 125 ------
NM_133634chr2181672 1485 1469 1332 1199 1175 1155 334 --1349 --
NM_133638chr541372 1353 545 454 1144 ----
NM_133647chr1533436 2663 524 190 ----
NM_134325chr151278 425 140 97 73 11229 ----
NM_138270chrX32934 1118 856 --12364 11212
NM_138286chr1911350 ----13833
NM_138288chr1441949 650 290 152 ------
NM_138338chr2283303 3222 2476 2376 2245 1230 974 530 23274 725 22408 296 --
NM_138444chr1364990 4536 882 257 147 33 14493 11264 --
NM_138459chr643197 540 98 78 1938 ----
NM_138468chr275666 5242 4454 2540 2127 1808 1136 --24567 1319 11239
NM_138471chr113546 504 139 --182 --
NM_138473chr1284993 4777 4627 4556 1797 1494 280 169 ------
NM_138576chr1464363 3555 3179 1833 1068 696 1493 11114 --
NM_138694chr642254 1374 966 356 ------
NM_138701chr7------184
NM_138713chr1686406 6225 3157 1375 1188 873 329 155 17447 22605 2298 --
NM_138714chr1686406 6225 3157 1375 1188 873 329 155 17447 22605 2298 --
NM_138727chr162052 1683 1557 759 705 453 ----1646
NM_138728chr162052 1683 1557 759 705 453 ----1646
NM_138773chr53657 629 247 1724 ----
NM_138927chr211839 1381 ----
NM_138929chr122229 33 1275 1254 --
NM_138930chr122229 33 1275 1254 --
NM_138970chr1421624 719 1866 1947 --
NM_138971chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_138971chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_138972chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_138972chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_138973chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_138973chr11113470 3297 2793 2752 2527 2456 1474 1015 661 245 121 ----13495
NM_139015chr1241654 1172 619 583 ------
NM_139048chr32958 175 ------
NM_139057chr15132811 2380 2295 2283 2254 2020 1883 1165 1128 891 672 92 53 ------
NM_139058chrX148 165 154 --
NM_139071chr1231197 615 177 --11618 --
NM_139076chr431173 216 120 --11439 --
NM_139168chr521709 732 127 11318 1207
NM_139246chr952073 1987 1447 766 644 ------
NM_139283chr1241985 1760 958 36 ------
NM_139321chr2094028 3694 3575 1615 1341 1077 743 303 137 --13458 22565 950
NM_139323chr2052021 1929 1621 1507 36 --11511 --
NM_144498chr2072245 1902 1665 1460 863 181 130 11698 ----
NM_144571chr444636 4231 2676 2259 16144 --14653
NM_144578chr1485232 4758 4488 4289 3861 3363 1677 1249 ----25517 3539
NM_144582chr2102627 2512 2293 2191 2103 1852 1782 1626 952 94 32639 2031 965 11973 --
NM_144590chr1022600 485 12535 11940 --
NM_144628chr20103030 2580 2309 1961 1179 994 974 775 355 45 --11124 --
NM_144778chr1332563 2150 898 --32742 828 482 12747
NM_144949chr2163 22530 860 --12050
NM_144973chr1244820 3539 455 133 --24590 944 --
NM_145055chr1841308 730 473 50 ------
NM_145117chr1162302 1300 1236 641 490 68 --12580 --
NM_145173chr1972098 947 755 693 513 97 29 1504 ----
NM_145259chr2115918 5670 5655 5646 5472 5045 4943 4391 2495 1905 935 --24549 1879 1188
NM_145263chr432259 835 129 ------
NM_145284chrX31978 1621 293 ------
NM_145320chr763556 2797 2779 1132 857 183 22464 435 1419 --
NM_145321chr763556 2797 2779 1132 857 183 22464 435 1419 --
NM_145322chr763556 2797 2779 1132 857 183 22464 435 1419 --
NM_145690chr831627 1571 647 11786 162 --
NM_145727chr631275 1172 1103 2985 330 21223 943 --
NM_145733chr224786 759 355 28 21188 884 ----
NM_145800chrX1360 1196 --1365
NM_145802chrX1309 1145 --1314
NM_145804chr1161390 1216 1208 352 329 152 ------
NM_145808chr742646 1992 1937 75 1268 ----
NM_145861chr151850 1379 1334 594 373 ------
NM_145888chr1982041 1933 1790 1332 810 646 182 168 21924 724 31990 1775 271 21712 302
NM_147150chr943500 3484 2964 196 --13392 13801
NM_147202chr982726 2618 2247 2149 1953 1807 852 215 --51837 774 625 584 270 --
NM_147223chr242225 2090 1924 1521 --11639 --
NM_147233chr232042 1907 1741 --11456 --
NM_148674chr222328 23 1348 ----
NM_152133chr6------1641
NM_152263chr196121 5317 2427 2378 2292 1639 1020 612 475 14652 12174 --
NM_152265chr1188 ----21539 1287
NM_152305chr362183 1976 1646 783 143 85 --1306 --
NM_152320chr125754 708 702 695 597 --1733 --
NM_152330chr1451794 1673 638 483 100 1707 ----
NM_152344chr1731292 265 33 1163 ----
NM_152349chr17------1521
NM_152375chr14999 929 820 180 12487 ----
NM_152376chr131838 1810 1250 11714 1675 --
NM_152407chr573023 2620 2590 1274 655 587 573 --145 --
NM_152409chr53924 517 174 1226 ----
NM_152414chr8------11393
NM_152424chrX114528 4310 4157 3285 3259 3047 1649 1548 1438 665 142 13971 34632 3402 826 22955 1625
NM_152437chr1232089 324 204 --1815 --
NM_152450chr1541904 680 415 102 --21927 1442 --
NM_152470chr1853432 3161 2770 2722 1020 1985 11463 1664
NM_152496chr161085 869 548 538 333 89 ------
NM_152545chr42124 95 --1645 1152
NM_152603chr19------1507
NM_152624chr567010 6269 5435 5305 1532 1096 --11820 11022
NM_152629chr9103537 3384 2996 1130 1074 947 712 428 263 29 --22988 921 1419
NM_152636chr1182800 2761 2495 2470 2088 1911 656 85 --12065 --
NM_152641chr122468 314 12764 ----
NM_152678chr32751 598 11997 ----
NM_152695chrX32165 1549 667 --21840 718 --
NM_152722chr1131842 1392 388 1302 21568 1386 --
NM_152723chr112266 190 --21073 396 --
NM_152740chr72593 68 --1101 --
NM_152754chr722922 516 ----11351
NM_152758chr822223 2017 13024 13080 --
NM_152780chrX2201 100 ----1416
NM_152787chrX2494 248 13740 183 12552
NM_152793chr795167 4755 4515 4005 3312 3305 1591 841 200 1123 34206 1799 1695 --
NM_152838chr20157 --23503 167 --
NM_152860chr1251333 332 180 88 79 ------
NM_152873chr101384 21693 690 ----
NM_152877chr101384 21693 690 ----
NM_152890chr121111 315 --11244 --
NM_152903chr1332593 695 588 1191 12705 --
NM_152919chr1933713 3034 255 1968 23733 3598 12834
NM_152924chr15145442 5399 4427 2440 1956 1863 1780 1208 986 950 557 433 128 59 ----12007
NM_152989chr1261863 1838 1574 1448 289 58 1272 1360 --
NM_152996chr121917 697 12046 ----
NM_153029chr16113700 3594 3520 3363 3081 2909 2810 2793 802 487 463 --32951 2720 1560 --
NM_153035chr133054 1275 405 --11200 1266
NM_153182chr322128 523 ----22674 1152
NM_153188chr584841 4590 3838 2171 1930 687 91 76 11386 14649 --
NM_153207chr1243947 2573 1385 1365 ------
NM_153235chr62878 584 --11648 12121
NM_153257chr1951032 982 803 787 412 ------
NM_153262chr142727 2176 1029 382 ------
NM_153267chr92740 326 ------
NM_153367chr1082471 1242 1201 913 776 421 89 21 --11067 --
NM_153371chr1352413 2153 2056 757 498 --1505 1287
NM_153453chr6175 ----1677
NM_153487chr6174782 4722 4414 4342 4094 3897 3700 3068 1596 1259 1251 1238 1141 1071 646 390 220 ------
NM_153607chr563154 2359 2008 1943 1099 459 ------
NM_153616chr1542049 967 616 406 1798 ----
NM_153617chr1542049 967 616 406 1798 ----
NM_153618chr1542049 967 616 406 1798 ----
NM_153619chr1573287 718 592 520 392 351 130 32636 778 268 1609 --
NM_153649chr131688 854 401 ------
NM_153810chr10135099 5070 4862 4718 4205 4190 3467 3357 3261 1815 1623 1159 93 11920 2681 469 11495
NM_170607chr1781586 1401 1321 1211 1201 619 604 232 ------
NM_170665chr1283483 3339 3308 1680 1312 582 552 288 --1533 12806
NM_170679chr541308 1286 1257 815 ------
NM_170706chr161495 1293 729 647 623 509 11161 33993 2879 1637 13801
NM_170719chr1331480 357 247 ------
NM_170731chr1122447 1905 ----12479
NM_170732chr1122447 1905 ----12479
NM_170733chr1122447 1905 ----12479
NM_170734chr1122447 1905 ----12479
NM_170735chr1122447 1905 ----12479
NM_170740chr652689 1114 1071 975 66 --1122 --
NM_170750chrX2817 257 --1582 --
NM_170768chr1141677 1319 493 270 ------
NM_171825chr572599 2232 1273 988 689 213 114 ------
NM_172058chr841541 1445 1335 453 --1539 --
NM_172059chr841541 1445 1335 453 --1539 --
NM_172060chr841541 1445 1335 453 --1539 --
NM_172071chr197421 6446 6361 6140 5787 5769 2425 425 398 14924 16299 --
NM_172103chr632358 444 306 1921 ----
NM_172105chr632358 444 306 1921 ----
NM_172127chr431833 1622 38 ------
NM_172130chr181755 1383 1351 668 285 271 261 168 2250 103 ----
NM_172169chr1041856 1255 751 485 --3759 755 361 --
NM_172170chr1041856 1255 751 485 --3759 755 361 --
NM_172171chr1041856 1255 751 485 --3759 755 361 --
NM_172173chr1041856 1255 751 485 --3759 755 361 --
NM_172375chr1441213 904 732 82 ------
NM_173075chr42121 88 11458 ----
NM_173082chr61256 --156 11223
NM_173156chr162081 1993 1980 1587 707 285 11779 21874 258 --
NM_173191chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_173192chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_173193chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_173194chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_173195chr1091232 1133 1111 940 835 247 228 96 70 ------
NM_173214chr1686406 6225 3157 1375 1188 873 329 155 17447 22605 2298 --
NM_173216chr342201 1000 787 560 12068 --12706
NM_173217chr342201 1000 787 560 12068 --12706
NM_173359chr341810 1358 1181 270 ------
NM_173468chr434665 1598 463 --14235 --
NM_173476chr1652291 1811 1457 883 850 12212 11634 --
NM_173491chr531456 1093 450 ------
NM_173495chrX127 12104 41721 639 605 508 --
NM_173496chr1052649 1929 1918 1887 951 ----1816
NM_173511chr241558 1430 1316 1215 --1832 --
NM_173546chr33558 199 84 ------
NM_173552chr321911 147 1917 ----
NM_173562chr672846 2477 2388 1214 1122 84 42 1510 11206 23145 2400
NM_173570chr342131 1582 801 724 ------
NM_173595chr12114224 3634 3624 3280 3248 1389 1084 1069 592 408 149 23343 1458 34129 3611 1666 --
NM_173602chr1243652 3392 2692 127 ------
NM_173642chr1148779 7745 7372 6152 5605 3690 2684 2036 1997 1706 1464 773 522 123 37261 1299 199 75900 3283 2563 1480 1100 1059 850 --
NM_173654chr33602 475 51 --2484 318 --
NM_173694chrX12155 12144 1579 --
NM_173808chr143817 3637 1556 1532 21606 941 23258 1162 11038
NM_173812chr122631 56 21431 1006 --1329
NM_173822chr221749 74 --1201 --
NM_173825chr352832 989 712 359 129 --11152 --
NM_174916chr1532309 2199 696 --1281 --
NM_174963chr14708 598 180 63 ----1884
NM_174964chr14708 598 180 63 ----1884
NM_174965chr14727 617 199 82 ----1903
NM_174966chr14708 598 180 63 ----1884
NM_174967chr14727 617 199 82 ----1903
NM_174968chr14708 598 180 63 ----1884
NM_174969chr14708 598 180 63 ----1884
NM_174970chr14727 617 199 82 ----1903
NM_174971chr14708 598 180 63 ----1884
NM_175038chr12------1183
NM_175709chr2262612 1907 824 675 619 259 11227 12444 --
NM_175736chr12197698 7011 6876 6413 6366 6276 5491 4928 4799 3141 2772 1943 1812 1742 1680 1396 1300 668 30 15466 87242 7238 6025 5336 2061 1687 1639 1373 14968
NM_175847chr1971347 973 528 367 239 171 162 ------
NM_175848chr202560 321 ----1400
NM_175848chr202560 321 ----1400
NM_175849chr202560 321 ----1400
NM_175849chr202560 321 ----1400
NM_175850chr202560 321 ----1400
NM_175850chr202560 321 ----1400
NM_175852chr152976 2876 2422 2245 410 ----1741
NM_175861chr1275416 5094 4537 4010 3977 2283 1069 ------
NM_175884chr731314 1087 465 ------
NM_175907chr1852580 2381 2264 1036 918 --11792 --
NM_175920chr51817 --1159 1220
NM_176792chr1041187 518 464 42 --1353 --
NM_176863chr1792033 1963 1755 1739 1581 1477 821 767 654 1225 11590 --
NM_176871chr863060 2363 1299 748 624 32 --22634 405 --
NM_177398chr151746 1667 1501 618 432 ------
NM_177399chr151746 1667 1501 618 432 ------
NM_177438chr1422581 1096 11030 21697 1158 --
NM_177985chr21168 ----11830
NM_177996chr2073269 2933 2910 760 677 349 263 ------
NM_177999chr972798 2431 2404 1333 1161 722 230 12648 188 --
NM_178010chr1261863 1838 1574 1448 289 58 1272 1360 --
NM_178011chr1043025 2462 1318 273 --12871 11252
NM_178037chr1283461 2695 2637 1360 1042 704 475 153 13153 31412 1010 46 --
NM_178038chr1283461 2695 2637 1360 1042 704 475 153 13153 31412 1010 46 --
NM_178126chr1731517 1489 162 --11991 --
NM_178140chr51518 2418 365 1208 --
NM_178151chrX127416 6705 6004 5597 5408 4998 4991 4796 2203 2168 513 506 12623 14945 26338 2605
NM_178152chrX127416 6705 6004 5597 5408 4998 4991 4796 2203 2168 513 506 12623 14945 26338 2605
NM_178153chrX127416 6705 6004 5597 5408 4998 4991 4796 2203 2168 513 506 12623 14945 26338 2605
NM_178229chr17944 929 835 801 332 128 91 21030 23 1862 --
NM_178313chr232114 2004 29 11701 --176
NM_178314chr123339 87 57 --1717 --
NM_178426chr152096 851 688 435 212 ------
NM_178427chr161996 870 751 588 335 112 ------
NM_178505chr1043554 2560 2518 1006 12391 ----
NM_178509chr1732968 2537 676 2901 60 12548 --
NM_178554chr362873 2380 2239 1184 279 22 --1183 --
NM_178565chr831451 1093 364 ------
NM_178568chr1761270 1125 668 503 240 22 --1429 --
NM_178585chr442479 2178 2170 340 --32670 2646 2461 --
NM_178586chr1432274 2035 1579 197 ----
NM_180989chr132979 910 --12182 11775
NM_181291chr142612 149 ----1179
NM_181332chrX42269 2010 800 159 11932 ----
NM_181349chr792779 2545 2416 2252 1096 216 183 109 55 11025 1229 12730
NM_181351chr11102874 2333 1165 1076 932 833 814 561 387 228 12703 ----
NM_181358chr133418 314 89 --13548 --
NM_181443chr2031787 411 330 ------
NM_181481chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_181482chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_181483chr18106219 4692 4529 2443 2042 2022 1800 1216 974 653 35029 1400 708 15810 --
NM_181492chr2221223 1011 1130 ----
NM_181504chr542852 1676 1543 547 ------
NM_181521chr1686842 6202 5820 5556 5193 1503 1037 640 --14743 --
NM_181523chr542852 1676 1543 547 ------
NM_181524chr542852 1676 1543 547 ------
NM_181672chrX31472 687 26 ------
NM_181673chrX31472 687 26 ------
NM_181706chr112653 420 --22157 1853 --
NM_181712chr131952 1447 62 1269 --1261
NM_181762chrX31064 392 62 1892 ----
NM_181777chrX31064 392 62 1892 ----
NM_181782chr642165 2023 1475 100 ----11974
NM_181784chr282117 2080 1741 1670 838 444 214 194 --31866 705 308 --
NM_181828chr22143712 3370 1294 1210 1093 1035 921 861 836 591 473 461 400 143 --32868 1375 1227 --
NM_181829chr22143712 3370 1294 1210 1093 1035 921 861 836 591 473 461 400 143 --32868 1375 1227 --
NM_181830chr22143712 3370 1294 1210 1093 1035 921 861 836 591 473 461 400 143 --32868 1375 1227 --
NM_181832chr22153727 3385 1309 1225 1108 1050 936 876 851 606 488 476 415 158 31 --32883 1390 1242 --
NM_181836chr522668 1878 ----12427
NM_181838chr52519 365 --1369 --
NM_181876chr47809 782 716 524 376 48 30 --22017 1038 12651
NM_181886chr431198 426 300 ------
NM_181887chr431198 426 300 ------
NM_181888chr431198 426 300 ------
NM_181889chr431198 426 300 ------
NM_181890chr431198 426 300 ------
NM_181891chr431198 426 300 ------
NM_181892chr431245 473 347 ------
NM_181893chr431198 426 300 ------
NM_182487chr9134355 4038 3200 3147 1620 1614 994 921 866 639 464 219 158 --23077 675 --
NM_182493chr16134928 4852 4801 4589 4496 1988 1861 1750 1674 960 926 917 829 --14336 --
NM_182503chr665062 4797 4675 4430 1646 1004 --11449 --
NM_182526chr1483067 2956 2878 2789 2297 2084 821 81 ------
NM_182557chr11122080 2047 1877 1823 1814 1723 1441 1399 851 746 460 307 ------
NM_182643chr842056 1930 720 601 12425 ----
NM_182645chr6175 ----1677
NM_182701chr64767 295 106 69 1141 ----
NM_182728chr1461510 1260 1169 708 537 195 1177 ----
NM_182757chr642954 2821 2689 1404 11005 12617 21141 274
NM_182758chr1553851 3668 2392 556 525 13777 12922 --
NM_182764chr204510 322 157 27 11080 ----
NM_182767chr1222031 1704 ----11685
NM_182848chr1331434 630 341 194 21393 1175 --
NM_182898chr765992 5049 1628 1615 1328 569 16605 21362 783 --
NM_182899chr765992 5049 1628 1615 1328 569 16605 21362 783 --
NM_182907chr642235 1981 892 129 11850 --1681
NM_182915chr241940 851 747 660 12303 ----
NM_182936chr1411212 --1412 1137
NM_182948chr152823 1164 163 142 33 --22806 765 --
NM_182964chr1162302 1300 1236 641 490 68 --12580 --
NM_182970chr20144215 4172 4082 3831 3682 3671 3555 2795 1691 1276 953 943 160 46 ----13988
NM_182972chr132785 528 34 --11029 --
NM_183002chr1411212 --1412 1137
NM_183047chr204839 741 169 26 --1200 --
NM_183048chr204839 741 169 26 --1200 --
NM_183078chr663028 2922 2858 2836 1095 962 1125 --13764
NM_183234chr152616 338 --11389 --
NM_183235chr152616 338 --11389 --
NM_183236chr152616 338 --11389 --
NM_183238chr1223764 3306 11162 ----
NM_183422chr132989 162 1808 190 --
NM_183425chr2091553 416 337 240 152 139 128 121 83 ------
NM_194278chr1483289 2856 2762 1428 1180 412 285 235 23364 1409 33500 2644 865 --
NM_194285chr1131144 542 293 ------
NM_194286chr1275504 1252 1047 1030 967 200 161 11624 11330 --
NM_194314chr133883 3817 795 ------
NM_194328chr942608 2192 1078 735 ------
NM_194329chr942608 2192 1078 735 ------
NM_194330chr942608 2192 1078 735 ------
NM_194332chr942608 2192 1078 735 ------
NM_194358chr1251808 571 262 80 53 --11414 --
NM_194359chr1251808 571 262 80 53 --11414 --
NM_194434chr1864701 4210 1746 912 548 410 11070 ----
NM_194452chr1151241 846 400 283 118 ------
NM_194453chr1151241 846 400 283 118 ------
NM_197941chr542244 107 70 53 ------
NM_197968chr131122 ----1706
NM_198053chr14410 389 89 46 124 ----
NM_198056chr382107 1707 1586 1467 1396 699 565 263 ------
NM_198066chr1432283 2110 1190 --12454 --
NM_198081chr662750 2649 2308 2201 860 492 --12373 --
NM_198123chr841356 444 301 113 ------
NM_198124chr841356 444 301 113 ------
NM_198158chr322960 1054 --11131 --
NM_198159chr322960 1054 --11131 --
NM_198177chr322960 1054 --11131 --
NM_198178chr322960 1054 --11131 --
NM_198181chr1532252 1791 291 ------
NM_198204chr1781586 1401 1321 1211 1201 619 604 232 ------
NM_198205chr1781586 1401 1321 1211 1201 619 604 232 ------
NM_198225chr1031691 1639 432 ------
NM_198236chr14797 791 292 273 1926 1915 1969
NM_198240chr121211 1997 ----
NM_198268chr133418 314 89 --13548 --
NM_198269chr133418 314 89 --13548 --
NM_198270chrX33267 2511 302 ------
NM_198291chr202763 478 --21782 666 11742
NM_198392chr662300 1480 1474 562 509 306 1739 22082 249 --
NM_198399chr331743 1383 375 ------
NM_198468chr684149 3500 3492 3408 3210 3070 2992 679 --2921 312 --
NM_198513chr81272 1523 11694 --
NM_198560chr3103849 3314 2476 1378 1307 1172 1107 959 579 69 ------
NM_198581chr296973 6953 6565 5926 5293 5081 4996 1422 31 --26464 1015 12488
NM_198595chr4144925 4413 4379 4320 3901 3811 3485 3427 3331 3313 1861 1338 1235 463 13862 13767 --
NM_198715chr146249 5132 5089 5072 1659 24798 2425 --
NM_198793chr333947 3340 1098 14142 2385 128 --
NM_198834chr1762047 1936 484 404 225 203 ------
NM_198836chr1762047 1936 484 404 225 203 ------
NM_198837chr1762047 1936 484 404 225 203 ------
NM_198838chr1762047 1936 484 404 225 203 ------
NM_198839chr1762047 1936 484 404 225 203 ------
NM_198859chr344654 3783 3266 515 13216 11338 --
NM_198896chr1151795 1710 423 407 396 ------
NM_198900chr12197698 7011 6876 6413 6366 6276 5491 4928 4799 3141 2772 1943 1812 1742 1680 1396 1300 668 30 15466 87242 7238 6025 5336 2061 1687 1639 1373 14968
NM_198935chr2043280 2727 2330 1027 --32809 108 46 --
NM_198990chr762968 2493 2302 2234 1311 401 ------
NM_199000chr741811 1559 824 590 ------
NM_199039chr421017 335 ----1782
NM_199054chr1971828 1713 1597 494 331 303 239 12019 3616 583 34 --
NM_199072chr743244 2924 1994 1122 12276 ----
NM_199131chr10103648 3601 2488 2247 1430 1377 1357 1331 795 441 1715 ----
NM_199160chr951806 1640 1607 48 36 1729 11383 11817
NM_199169chr2043511 2308 2292 1402 --12227 --
NM_199170chr2043511 2308 2292 1402 --12227 --
NM_199171chr2043511 2308 2292 1402 --12227 --
NM_199188chr1254003 3710 2691 902 31 11247 ----
NM_199190chr1254003 3710 2691 902 31 11247 ----
NM_199245chr1292498 2371 2001 740 615 495 444 329 121 --32318 851 532 --
NM_199324chr432594 1125 131 ------
NM_199415chr2072108 2058 1662 968 560 357 140 12162 1550 1405
NM_199437chr11131 --1137 1104
NM_199438chr11131 --1137 1104
NM_199439chr11131 --1137 1104
NM_199454chr184337 3690 3425 3204 3189 963 732 123 1889 --1406
NM_199461chr1093402 1286 963 885 849 556 231 71 23 13110 11232 --
NM_199462chr184595 4271 4057 3308 3039 1518 51 25 ------
NM_199482chr221921 196 ------
NM_201266chr242401 2230 2104 192 ------
NM_201269chr1----1241 1508
NM_201279chr242401 2230 2104 192 ------
NM_201348chr1124439 4369 4274 4160 3468 3120 2859 1060 530 315 215 200 1227 ----
NM_201428chr1131457 1377 1062 11617 11127 --
NM_201429chr1131457 1377 1062 11617 11127 --
NM_201430chr1141383 1303 988 599 11543 11053 --
NM_201559chr694713 3922 3348 1852 913 672 294 201 183 11668 ----
NM_201567chr331381 648 54 11096 --11324
NM_201568chr162081 1993 1980 1587 707 285 11779 21874 258 --
NM_201569chr162081 1993 1980 1587 707 285 11779 21874 258 --
NM_201591chr421273 133 269 61 ----
NM_201592chr421273 133 269 61 ----
NM_201628chr183046 1115 968 659 530 435 275 166 --12346 12162
NM_201634chr551555 674 198 134 50 ------
NM_203305chr96726 698 617 410 173 91 --21843 110 11630
NM_203307chr1961455 1406 1309 637 567 202 ----11204
NM_203327chr2094131 4004 3777 3367 2908 2885 1766 995 328 1812 13484 --
NM_203342chr163630 2690 1168 991 738 238 144 13345 --
NM_203343chr163630 2690 1168 991 738 238 144 13345 --
NM_203413chr174988 718 286 75 ------
NM_203446chr2132554 1872 126 22191 1138 22137 787 --
NM_203458chr152928 2870 1396 1101 143 1134 ----
NM_203459chr11257 ----1631
NM_203463chr2104716 4615 4226 3479 3235 3116 3012 1112 554 305 14378 ----
NM_203487chr13------1583
NM_203499chr173348 301 142 ------
NM_203504chr432316 2166 464 ------
NM_203505chr432316 2166 464 ------
NM_206594chr131248 377 265 ----12271
NM_206595chr131248 377 265 ----12271
NM_206853chr633009 2822 2579 --12985 1260
NM_206854chr654270 4083 3840 588 332 1989 14246 11521
NM_206855chr675235 5048 4805 1553 1297 597 299 11954 15211 12486
NM_206866chr2132868 1247 983 12000 --13234
NM_206876chr243324 2689 894 82 ----1797
NM_206909chr8128147 7970 7437 5218 2780 2755 1757 1212 885 830 733 480 --27174 2768 --
NM_206933chr142733 2465 1131 49 --171 --
NM_207012chr1032791 2773 2305 11283 23395 345 1904
NM_207043chr142187 1895 723 76 ------
NM_207044chr142187 1895 723 76 ------
NM_207047chr142187 1895 723 76 ------
NM_207119chr1052214 1854 755 229 23 1951 ----
NM_207170chr11733 1707 1121 --
NM_207292chr323169 135 13109 ----
NM_207293chr323169 135 13109 ----
NM_207294chr323169 135 13109 ----
NM_207295chr323169 135 13109 ----
NM_207296chr323169 135 13109 ----
NM_207297chr323194 160 13134 ----
NM_207303chr1083749 3632 3474 3247 3063 1097 1026 410 --33261 674 105 --
NM_207304chr1342450 2037 1058 785 --32629 715 369 12634
NM_207321chr1021002 307 --1311 1987
NM_207352chr452184 1887 1816 834 227 1577 2716 236 --
NM_207372chr1042249 707 548 179 --11744 --
NM_207381chr1541209 1081 209 124 149 ----
NM_207406chr4106274 4161 4102 2359 2318 1392 1070 1050 179 74 2695 135 34594 4215 1549 --
NM_207422chrX21065 129 --31097 577 160 --
NM_207444chr1541296 1195 904 502 --1340 --
NM_207518chr1971238 1159 866 393 210 201 120 1411 11094 --
NM_212464chr15101941 1909 1724 1716 1620 827 798 461 248 38 --11603 11584
NM_213589chr274560 4185 3611 2117 2062 746 57 23754 3437 12225 --
NM_213594chr1251234 1152 831 445 69 11315 ----
NM_213662chr1741965 1793 520 50 1568 ----