TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4701-5p
miRNA Sequence: UUGGCCACCACACCUACCCCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1826 --
NM_000038chr51463 --1581 --
NM_000084chrX106928 6182 6066 5746 5024 4470 4309 2796 2285 1645 12629 ----
NM_000089chr71323 ------
NM_000090chr2--1642 ----
NM_000091chr242208 1984 1764 1165 12703 ----
NM_000092chr214054 ----24166 30
NM_000112chr533673 1765 400 12065 23745 114 --
NM_000115chr1312093 12384 22500 1734 --
NM_000125chr673702 3298 3004 1368 1238 1125 432 --21050 137 --
NM_000129chr631169 602 298 155 ----
NM_000163chr541711 573 359 303 1669 12290 --
NM_000167chrX1151 ------
NM_000176chr553263 2985 2791 1148 962 ----11460
NM_000208chr1944562 3903 1146 611 ----1854
NM_000222chr421940 1915 --11630 1151
NM_000237chr81527 --11777 2214 188
NM_000248chr312725 ------
NM_000259chr1535003 4263 1055 11135 1848 --
NM_000274chr10253 25 1486 ----
NM_000280chr112798 334 ------
NM_000289chr123391 143 42 ------
NM_000297chr431810 831 46 ------
NM_000314chr1023134 633 1449 --1375
NM_000332chr646773 4571 2880 29 26197 6050 --16224
NM_000333chr31253 ------
NM_000337chr574823 2153 1973 1892 1625 1343 608 24287 527 12216 16318
NM_000340chr321196 431 ------
NM_000345chr43857 800 239 ------
NM_000346chr1711239 2258 32 21661 242 1232
NM_000361chr201702 1146 ----
NM_000369chr1431217 722 692 ------
NM_000401chr11--11061 ----
NM_000408chr213104 1594 ----
NM_000430chr1733186 2668 247 ------
NM_000437chr141755 1704 825 784 --12103 --
NM_000439chr522533 555 1565 ----
NM_000449chr1187 --11221 --
NM_000461chr324068 444 ------
NM_000489chrX13298 ------
NM_000503chr8----11480 --
NM_000508chr41911 1875 ----
NM_000530chr12754 70 ------
NM_000555chrX77217 6747 5126 5074 4883 2449 1594 1704 ----
NM_000600chr7150 1335 1259 --
NM_000618chr1236567 6381 5498 34371 1523 942 ----
NM_000618chr1236567 6381 5498 34371 1523 942 ----
NM_000621chr1311341 ------
NM_000633chr18125162 5080 3712 3414 3257 1996 1356 1312 1143 1074 389 334 ------
NM_000681chr1031418 218 128 1392 ----
NM_000701chr11319 ------
NM_000721chr122149 516 ------
NM_000725chr121151 ------
NM_000726chr2--182 11386 --
NM_000756chr82446 331 ------
NM_000767chr1911226 21192 382 ----
NM_000792chr12993 904 ------
NM_000801chr202922 715 1327 ----
NM_000807chr41658 ------
NM_000813chr565603 5409 2007 585 346 138 13905 1238 1682
NM_000814chr1553924 3669 2905 826 614 ------
NM_000817chr21268 ------
NM_000818chr101195 ------
NM_000826chr42899 868 ----12291
NM_000827chr51892 --11937 --
NM_000829chr1152119 1649 1626 727 141 ------
NM_000831chr155210 4356 4175 1831 543 24848 1542 1750 --
NM_000834chr122953 867 21164 495 ----
NM_000855chr111232 ------
NM_000875chr15136440 6049 5997 4772 4664 4469 2360 2098 1922 1902 1841 424 412 26810 5543 24758 894 14405
NM_000880chr8--1120 ----
NM_000891chr1731012 514 52 191 ----
NM_000912chr842312 1136 513 321 ------
NM_000921chr122441 113 ------
NM_000926chr1177839 7807 6674 5821 3712 3218 58 --12361 11258
NM_000935chr3175 ------
NM_000950chrX33267 2916 2453 22862 2284 ----
NM_000983chr121641 1406 ----11631
NM_001001132chr2121318 271 ------
NM_001001331chr32859 831 ------
NM_001001344chrX2679 127 32449 2222 837 ----
NM_001001396chr114165 ------
NM_001001433chr2023064 2096 ------
NM_001001481chr8--12844 ----
NM_001001557chr841790 525 330 229 ------
NM_001001661chr72259 111 ------
NM_001001852chr223599 593 45 ----1680
NM_001001890chr2133953 3895 1633 --11568 --
NM_001001924chr821540 1373 ------
NM_001001925chr821540 1373 ------
NM_001001931chr821540 1373 ------
NM_001002762chr1032809 2332 85 --22788 888 --
NM_001002860chr1434261 3124 756 --14077 --
NM_001002876chr222135 51 ----1429
NM_001002909chr1721788 382 --11770 --
NM_001002914chr1731260 441 178 ------
NM_001002919chr2------1481
NM_001003652chr1868323 6139 2970 2788 2174 70 28584 3179 ----
NM_001003674chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_001003675chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_001003712chr1233840 3811 1017 1568 --1769
NM_001003792chr31195 11064 ----
NM_001003793chr31195 11064 ----
NM_001003800chr93788 710 620 ----13251
NM_001004304chr1283036 2712 2089 2050 1145 797 306 157 1978 1854 --
NM_001004317chr634049 1382 819 1916 ----
NM_001004419chr12----11683 --
NM_001005242chr122228 122 ------
NM_001005353chr11197 --21249 35 --
NM_001005353chr11197 --21249 35 --
NM_001005386chr231887 758 601 ------
NM_001005404chr1753444 2876 1289 1095 607 --1696 --
NM_001005473chr576555 5890 5536 4285 4093 2446 536 --15108 --
NM_001005474chr32575 24 ------
NM_001005746chr2--182 11386 --
NM_001005747chr2--182 11386 --
NM_001005845chr811213 ------
NM_001006115chr372683 1767 1730 896 779 339 220 ------
NM_001006617chr931431 1049 216 ------
NM_001006619chr931431 1049 216 ------
NM_001006620chr931431 1049 216 ------
NM_001006621chr931431 1049 216 ------
NM_001006623chr222299 114 1209 12366 --
NM_001006636chr22993 291 ------
NM_001007024chr1744002 1318 1007 152 ------
NM_001007025chr1744002 1318 1007 152 ------
NM_001007102chr611034 1448 ----
NM_001007237chr142522 2470 1838 29 ------
NM_001007245chr71227 ------
NM_001007246chr21--11476 --1596
NM_001007257chr11442 ------
NM_001007466chr664491 3805 3254 1192 916 255 34338 1297 72 ----
NM_001007559chr1831914 1823 131 ------
NM_001008220chr552990 2806 512 440 130 21019 947 13462 1854
NM_001008222chrX51240 1143 878 506 430 --11306 --
NM_001008239chr1833547 1407 868 ------
NM_001008388chr4156 --1260 --
NM_001008392chr352825 1322 1295 1171 719 13201 1131 --
NM_001008405chr721737 24 ------
NM_001008495chr822169 913 ------
NM_001008541chr1021948 1739 ------
NM_001008541chr1021948 1739 ------
NM_001008701chr1962571 2407 1985 576 95 30 --22329 749 --
NM_001008707chr142318 66 ------
NM_001008738chr522236 2007 --12473 --
NM_001008925chr413286 ------
NM_001009554chr434119 3561 2965 --11634 --
NM_001009554chr434119 3561 2965 --11634 --
NM_001009555chr411257 --11361 --
NM_001009899chr344863 2316 2180 413 32137 1490 433 25565 5492 --
NM_001009958chr7----1173 --
NM_001009993chr264220 3887 3631 3171 3144 2809 --1738 --
NM_001010867chr1136366 5954 4377 2185 2020 1809 1627 1448 1417 498 321 278 218 --11157 --
NM_001010888chrX1617 23563 1430 1210 --
NM_001010891chr576783 6417 5665 4189 1484 880 421 ----34934 1748 23
NM_001010927chr61197 ------
NM_001010942chr1211015 ----11174
NM_001010983chr32325 262 ------
NM_001011513chr441473 1151 537 113 21229 617 ----
NM_001011537chr31610 --12087 --
NM_001011538chr43859 774 762 1925 ----
NM_001011666chr725164 4197 11491 ----
NM_001011885chr1531493 1188 270 1230 ----
NM_001012329chr142377 2269 1571 57 ------
NM_001012420chr1522000 183 ------
NM_001012423chr1522000 183 ------
NM_001012426chr642749 2271 425 412 ----11164
NM_001012427chr642749 2271 425 412 ----11164
NM_001012642chr1561653 1539 704 654 585 402 --1792 --
NM_001012751chr101403 ------
NM_001012755chrX71387 1015 908 626 541 454 78 21670 1345 15119 --
NM_001012756chr1923174 2540 12632 ----
NM_001012989chrX1244 ------
NM_001013031chr1042490 2363 1167 512 --2552 522 --
NM_001013415chr411203 --1321 --
NM_001013437chr18--1345 ----
NM_001013439chr31254 ------
NM_001013620chr1243384 914 476 110 37012 2986 680 ----
NM_001013635chr1231081 979 837 ------
NM_001013693chr162509 2147 1072 922 911 340 --1193 --
NM_001013693chr162509 2147 1072 922 911 340 --1193 --
NM_001014283chr1321703 866 ------
NM_001014380chr1335644 5391 3727 11366 --11068
NM_001014797chr1058025 7353 7315 7104 536 3860 596 60 32424 2277 477 --
NM_001015053chr1741501 1208 611 159 ------
NM_001015877chrX32033 2022 1204 12070 ----
NM_001015887chr331549 1344 150 ------
NM_001017368chr1752744 1007 847 549 69 ------
NM_001017395chr353396 3181 709 545 317 ------
NM_001017926chr821595 1437 ------
NM_001018050chr2283475 3173 1298 1219 567 213 207 52 --13001 --
NM_001018052chr2283475 3173 1298 1219 567 213 207 52 --13001 --
NM_001018054chr11271 11355 1435 --
NM_001018065chr943881 2342 1327 108 25651 1442 --25708 5243
NM_001018066chr943881 2342 1327 108 25651 1442 --25708 5243
NM_001018067chr145034 4274 3684 947 2905 463 ----
NM_001018068chr145034 4274 3684 947 2905 463 ----
NM_001018069chr145034 4274 3684 947 2905 463 ----
NM_001018074chr553263 2985 2791 1148 962 ----11460
NM_001018075chr553263 2985 2791 1148 962 ----11460
NM_001018076chr553263 2985 2791 1148 962 ----11460
NM_001018077chr553263 2985 2791 1148 962 ----11460
NM_001018108chr1532109 1740 1395 1628 1661 --
NM_001018111chr721039 475 13057 ----
NM_001024024chr1421024 174 ------
NM_001024070chr1421020 170 ------
NM_001024094chr553263 2985 2791 1148 962 ----11460
NM_001024401chr1632715 2315 1837 --12695 --
NM_001024455chrX31060 964 306 12227 ----
NM_001024463chr151222 21012 211 ----
NM_001024649chr562880 2369 793 776 724 58 ------
NM_001024668chr122785 217 ------
NM_001024845chr15414 301 131 107 23 ------
NM_001024847chr332226 2027 620 ------
NM_001024858chr1432831 537 499 --1823 --
NM_001024934chr62190 78 1228 ----
NM_001024935chr62190 78 1228 ----
NM_001024936chr62190 78 1228 ----
NM_001024948chr1--13182 12308 --
NM_001024959chr35768 655 343 202 24 ------
NM_001024960chr35768 655 343 202 24 ------
NM_001025076chr1035134 1252 572 15277 ----
NM_001025077chr1056492 4864 2610 1930 499 26635 621 ----
NM_001025079chr32597 414 ------
NM_001025081chr183535 377 350 --21504 988 --
NM_001025090chr183535 377 350 --21504 988 --
NM_001025092chr183535 377 350 --21504 988 --
NM_001025101chr183535 377 350 --21504 988 --
NM_001025105chr511266 ------
NM_001025107chr132141 196 83 --12477 --
NM_001025107chr132141 196 83 --12477 --
NM_001025579chr173903 368 281 ------
NM_001025595chr41260 ------
NM_001025603chr1187 --11221 --
NM_001025616chr441586 1515 511 82 ------
NM_001025780chr9--11075 ----
NM_001029858chr652987 1138 1088 769 41 12437 ----
NM_001029882chr11498 ------
NM_001029882chr11498 ------
NM_001029989chr152720 609 ------
NM_001030006chr1722497 565 22372 625 ----
NM_001030055chr1411006 11350 13471 1659
NM_001030272chr111330 ------
NM_001030273chr111330 ------
NM_001031623chr621302 32 ----11371
NM_001031690chr752894 1958 460 242 226 1754 ----
NM_001031695chr2232027 530 55 --11269 --
NM_001031717chr33992 133 63 ------
NM_001031732chr433226 3032 2831 ------
NM_001031740chr151730 1424 1360 337 55 11502 1673 --
NM_001031803chr17--1217 ----
NM_001031804chr1653961 3443 2689 1437 234 ------
NM_001031812chr511855 22197 1748 ----
NM_001032280chr621398 1258 ------
NM_001032296chr1342766 2679 2595 1097 1502 11078 --
NM_001032363chr162017 2005 1883 705 442 202 22095 1844 ----
NM_001032363chr162017 2005 1883 705 442 202 22095 1844 ----
NM_001032380chr1011946 ------
NM_001032393chrX1140 ------
NM_001032999chr20105087 4623 4387 3619 3347 3257 1944 1567 883 683 22024 816 ----
NM_001033047chr422465 383 ------
NM_001033081chr111710 ------
NM_001033082chr111710 ------
NM_001033117chr3134667 4580 4456 4448 4137 3775 3405 1187 686 68 59 39 29 11432 ----
NM_001033551chr1783557 3220 2896 1216 1110 914 279 70 --23019 738 --
NM_001033557chr2----11286 --
NM_001033566chr171171 1215 ----
NM_001033568chr171171 1215 ----
NM_001033925chr1021859 633 1293 11722 --
NM_001034954chr1031211 1012 746 22195 693 ----
NM_001034955chr1031211 1012 746 22195 693 ----
NM_001034956chr1031211 1012 746 22195 693 ----
NM_001034957chr1031211 1012 746 22195 693 ----
NM_001035chr11406 ------
NM_001035254chr952034 1022 763 434 379 ------
NM_001035260chr1041567 1415 1080 543 ------
NM_001035511chr132041 252 104 ------
NM_001035512chr132148 359 211 ------
NM_001035513chr132148 359 211 ------
NM_001035521chr22616 569 ------
NM_001037164chr721566 193 ------
NM_001038707chr132159 1998 179 ------
NM_001038707chr132159 1998 179 ------
NM_001039350chr731728 1116 30 --1304 11331
NM_001039479chr1462224 1984 1890 1647 840 512 ------
NM_001039547chr377388 6337 5639 5491 2818 2069 1306 27466 2143 22484 2429 --
NM_001039569chr242902 2569 1280 1144 32981 2527 1224 ----
NM_001039570chr2294135 3832 3450 3441 2973 1867 1365 1302 739 33273 1443 852 1318 159
NM_001039571chr2294135 3832 3450 3441 2973 1867 1365 1302 739 33273 1443 852 1318 159
NM_001039574chr12928 824 --1831 --
NM_001039590chrX--177 ----
NM_001039591chrX--177 ----
NM_001039618chr1134032 1399 1168 2927 458 14780 --
NM_001039690chr1662041 762 723 522 486 348 --12185 --
NM_001039709chr20105087 4623 4387 3619 3347 3257 1944 1567 883 683 22024 816 ----
NM_001039715chr12993 904 ------
NM_001039716chr121057 968 ------
NM_001039762chr102690 523 ----11493
NM_001039937chr1332627 724 105 13896 ----
NM_001040110chr731287 1190 677 --2583 477 --
NM_001040142chr22261 163 12414 ----
NM_001040143chr22261 163 12414 ----
NM_001040144chr1662041 762 723 522 486 348 --12185 --
NM_001040146chr1662041 762 723 522 486 348 --12185 --
NM_001040151chr1131203 702 28 21410 1160 ----
NM_001040152chr723270 2009 1210 ----
NM_001040272chr921463 34 12320 22120 1487 --
NM_001040284chr1644860 4713 4670 848 14190 ----
NM_001040402chr42927 150 12506 ----
NM_001040429chr131639 ------
NM_001040446chr541101 998 293 148 --1252 --
NM_001040624chr822705 2559 22396 1922 11017 --
NM_001040625chr822705 2559 22396 1922 11017 --
NM_001040626chr822705 2559 22396 1922 11017 --
NM_001040627chr822705 2559 22396 1922 11017 --
NM_001040628chr822705 2559 22396 1922 11017 --
NM_001040629chr822705 2559 22396 1922 11017 --
NM_001040630chr822705 2559 22396 1922 11017 --
NM_001040665chr714409 13290 14173 11542
NM_001040708chr8------1875
NM_001040712chr923332 388 12512 ----
NM_001042355chr1613283 --23859 570 14717
NM_001042361chr102380 305 --11106 --
NM_001042364chr102380 305 --11106 --
NM_001042365chr102380 305 --11106 --
NM_001042371chr1642027 1510 1410 100 22107 1550 ----
NM_001042387chr102380 305 --11106 --
NM_001042388chr181677 ------
NM_001042393chr102380 305 --11106 --
NM_001042396chr102380 305 --11106 --
NM_001042397chr102380 305 --11106 --
NM_001042404chr1297 43 ------
NM_001042406chr62978 413 ------
NM_001042412chr1613283 --23859 570 14717
NM_001042413chr933269 1383 492 ------
NM_001042414chr13121 ------
NM_001042425chr621398 1258 ------
NM_001042472chr202631 227 ------
NM_001042473chr101521 11377 ----
NM_001042479chrX32153 1395 602 1731 ----
NM_001042480chrX32153 1395 602 1731 ----
NM_001042481chr14----11837 1533
NM_001042543chr411410 141 ----
NM_001042599chr287239 6766 5272 2334 1002 786 238 75 22343 573 ----
NM_001042603chr1244143 934 340 291 13248 ----
NM_001042669chr441586 1515 511 82 ------
NM_001042681chr122024 746 ------
NM_001042682chr122024 746 ------
NM_001042682chr122024 746 ------
NM_001042749chrX----21944 1260 --
NM_001042750chrX----21944 1260 --
NM_001042751chrX----21944 1260 --
NM_001044722chr511855 22197 1748 ----
NM_001044723chr511855 22197 1748 ----
NM_001071775chr131167 ------
NM_001079874chr11323 ------
NM_001083620chr42898 867 ----12289
NM_001099678chr324747 4071 14827 15100 --
NM_001106chr386894 6782 6616 2926 2910 2812 1386 1177 36173 2721 2296 ----
NM_001111chr132141 196 83 --12477 --
NM_001113490chrX23569 3533 --1280 --
NM_001117chr1822114 2104 11597 22271 839 11534
NM_001122679chr5----1826 --
NM_001144chr161129 ------
NM_001146chr821912 213 ------
NM_001149chr1011188 ------
NM_001167chrX66025 5684 5343 4165 2059 1464 16105 16345 12579
NM_001173chr1411006 11350 13471 1659
NM_001177chr1222204 1928 11779 ----
NM_001178chr111330 ------
NM_001186chr2142358 1270 674 380 12219 ----
NM_001191chr2061097 1091 1029 589 422 278 11364 ----
NM_001198chr62974 72 --31843 862 470 --
NM_001200chr202914 294 1838 1885 --
NM_001204chr267083 7067 6546 5275 4836 284 26621 4913 ----
NM_001206chr922281 433 1132 ----
NM_001222chr1051402 624 476 355 61 ------
NM_001234chr31291 1664 ----
NM_001237chr41860 1200 --1115
NM_001237chr41860 1200 --1115
NM_001257chr1611262 ------
NM_001278chr101115 ------
NM_001280chr192664 443 ------
NM_001282chr1722497 565 22372 625 ----
NM_001304chr1723520 339 1369 ----
NM_001331chr1142361 777 517 140 ------
NM_001346chr332819 1747 259 ----1422
NM_001356chrX--11004 ----
NM_001364chr1134714 2914 1876 11187 ----
NM_001390chr1843086 2971 2940 1160 --32211 1192 99 --
NM_001396chr2141981 815 694 328 11969 1789 --
NM_001397chr172325 1641 1081 916 799 257 94 ------
NM_001401chr921133 349 --11438 --
NM_001402chr651995 1594 1478 1392 80 21810 316 1721 --
NM_001419chr1964777 3914 1377 1271 1253 545 13172 ----
NM_001438chr1--12531 ----
NM_001440chr872454 2347 2182 1969 1081 1002 103 --22504 2332 --
NM_001448chrX11390 --1127 21735 233
NM_001482chr153824 287 24 ------
NM_001494chr101669 --1179 --
NM_001498chr6142 ------
NM_001521chr22616 569 ------
NM_001527chr634674 3411 3104 14215 14823 1393
NM_001530chr143291 98 42 ------
NM_001542chr142522 2470 1838 29 ------
NM_001543chr584053 3125 1890 1718 1222 1175 522 424 21729 1334 --1885
NM_001550chr71227 ------
NM_001552chr1721082 951 --1909 --
NM_001584chr111474 ------
NM_001604chr112798 334 ------
NM_001614chr174502 283 273 267 ------
NM_001614chr174502 283 273 267 ------
NM_001627chr3--31808 1753 825 1969 --
NM_001635chr72835 346 ------
NM_001650chr1812736 --13672 --
NM_001677chr12776 363 ------
NM_001683chr32859 831 ------
NM_001684chr113882 ------
NM_001695chr81142 24146 3036 ----
NM_001709chr1142695 2604 2468 804 11090 12462 --
NM_001730chr131183 --11536 --
NM_001730chr131183 --11536 --
NM_001742chr71421 ------
NM_001743chr21219 ------
NM_001746chr562880 2369 793 776 724 58 ------
NM_001753chr72421 386 ------
NM_001754chr2133953 3895 1633 --11568 --
NM_001755chr1622270 1407 ------
NM_001759chr1245173 5088 4560 873 24843 3587 ----
NM_001760chr63944 867 688 --2200 27 1764
NM_001773chr121344 351 ------
NM_001777chr32597 414 ------
NM_001781chr12179 ------
NM_001854chr111546 ----1209
NM_001858chr644844 1627 893 787 11445 ----
NM_001873chr42667 61 ------
NM_001892chr511266 ------
NM_001918chr188595 7106 6672 6334 2371 2220 1626 307 59294 7063 2449 1706 387 23437 1667 --
NM_001930chr19181 ------
NM_001936chr731728 1116 30 --1304 11331
NM_001939chrX83702 3689 2489 1097 1056 1041 1001 294 ------
NM_001945chr51879 ------
NM_001949chr652811 2208 1975 1064 370 22524 253 ----
NM_001957chr432302 379 336 ------
NM_001968chr41197 ------
NM_001969chr1483254 3039 2721 2651 1459 1232 952 145 ------
NM_001973chr12388 371 ------
NM_002014chr122503 132 ------
NM_002025chrX99102 8455 6917 3051 2122 1766 1058 370 65 13293 18806 --
NM_002035chr1843926 3139 2920 142 13217 ----
NM_002040chr2132486 1243 279 ------
NM_002047chr71127 ------
NM_002063chrX21160 853 ------
NM_002074chr131512 1382 431 ------
NM_002076chr1242804 823 729 207 ------
NM_002077chr931789 468 202 ------
NM_002093chr3170 ------
NM_002112chr151216 ------
NM_002114chr61370 ------
NM_002126chr1732987 2532 853 --23212 186 --
NM_002130chr52271 206 1213 ----
NM_002137chr732132 622 291 ----11940
NM_002140chr9----1356 --
NM_002146chr172362 121 ------
NM_002147chr172747 161 ------
NM_002165chr201283 ------
NM_002187chr511083 11052 ----
NM_002193chr251665 1281 1173 701 521 11290 ----
NM_002201chr151100 ------
NM_002202chr52988 411 ------
NM_002207chr3--1278 ----
NM_002210chr21848 --13462 --
NM_002222chr311294 162 ----
NM_002228chr11929 ------
NM_002241chr172858 2071 1193 454 444 270 135 ------
NM_002242chr221503 1288 ------
NM_002254chr242169 2022 1683 1646 --1256 --
NM_002264chr384972 3909 3897 3836 1455 968 514 306 24676 4200 14380 --
NM_002267chr1321797 57 ------
NM_002268chr311596 ------
NM_002270chr534964 1831 1501 ------
NM_002271chr1312251 --11742 --
NM_002293chr142233 543 443 419 12279 12254 --
NM_002309chr2252634 2190 745 142 79 ----11114
NM_002310chr565835 4541 2649 2611 2532 1001 26058 4273 11997 --
NM_002336chr1234936 4040 1746 14926 ----
NM_002359chr1774170 3294 2944 1607 1433 963 215 33343 2993 1593 33334 1578 401 --
NM_002372chr5195 1445 ----
NM_002373chr152849 58 ------
NM_002385chr183535 377 350 --21504 988 --
NM_002387chr554229 4114 1957 1869 168 11676 ----
NM_002398chr2179 ------
NM_002399chr1521102 79 ------
NM_002429chr1221159 389 --11482 --
NM_002444chrX31747 708 253 11835 ----
NM_002448chr42674 181 ------
NM_002481chr1107848 6604 6104 6046 5738 2060 1692 1600 1434 780 26899 2138 23171 1452 --
NM_002493chr91217 ------
NM_002499chr1551975 1895 182 164 129 --1313 --
NM_002500chr21274 ------
NM_002505chr621159 141 ------
NM_002507chr1741526 1443 468 181 ------
NM_002509chr201637 ------
NM_002515chr1431425 767 647 ------
NM_002519chr1111451 ------
NM_002520chr5----1254 --
NM_002522chr1773490 3334 1518 1286 1210 1049 346 ------
NM_002526chr611633 --11262 --
NM_002547chrX43703 2651 1335 652 --11345 --
NM_002576chr1151156 1145 987 930 203 11042 ----
NM_002583chr12--161 ----
NM_002595chr121382 ------
NM_002613chr16125389 5101 3686 2062 2004 1629 1393 1309 621 599 450 61 14229 24310 1844 23597 405
NM_002618chr21108 ------
NM_002628chr3157 ------
NM_002629chr101137 --1647 --
NM_002643chr21201 167 ----
NM_002645chr1111213 12529 ----
NM_002651chr11852 ------
NM_002655chr835257 5010 351 23597 579 ----
NM_002657chr2053452 3376 2928 2696 438 ------
NM_002677chr82222 26 ------
NM_002687chr1421068 1039 ------
NM_002703chr42257 239 146 2274 62 --
NM_002706chr2----1569 --
NM_002709chr222195 1069 13125 ----
NM_002710chr12183 ------
NM_002713chr1--1937 ----
NM_002715chr5--1230 ----
NM_002717chr81451 ------
NM_002719chr1412335 ------
NM_002725chr154324 3909 1369 1066 625 22890 367 ----
NM_002731chr122865 355 1421 ----
NM_002734chr1721556 684 12190 2402 96 --
NM_002737chr1746112 4883 2262 1502 15653 25823 4634 --
NM_002740chr312419 1684 22774 2660 --
NM_002745chr221156 --1734 --
NM_002750chr101215 ------
NM_002823chr2----191 --
NM_002827chr2021813 1407 ------
NM_002833chr1531284 161 30 --1265 --
NM_002834chr1262985 2966 1097 1026 843 645 23120 533 2935 923 13025
NM_002837chr1284401 4256 4178 3613 3248 1085 909 436 34502 3340 3205 1642 --
NM_002839chr923332 388 12512 ----
NM_002844chr621281 1069 11082 ----
NM_002849chr121708 ------
NM_002850chr1921020 938 ------
NM_002855chr1132936 1064 234 ------
NM_002857chr142698 2223 1079 908 --1326 --
NM_002868chr1232336 716 386 ------
NM_002874chr932495 1729 1581 ------
NM_002886chr331694 220 110 1446 ----
NM_002888chr3139 ------
NM_002893chrX1106 ------
NM_002906chr111553 ------
NM_002912chr6----1896 --
NM_002923chr12636 235 ------
NM_002924chr11401 ------
NM_002941chr3------11215
NM_002959chr184142 4050 3152 3118 2815 982 492 66 11577 21496 1314 --
NM_002998chr831691 1640 793 ------
NM_003001chr132148 359 211 ------
NM_003010chr171209 ------
NM_003016chr1731333 802 320 ------
NM_003026chr91106 ------
NM_003028chr953242 1412 1346 1278 1050 13557 1547 --
NM_003034chr1247416 6560 5439 2545 177 11434 --
NM_003045chr1373837 1682 1139 948 241 217 195 14369 13226 1870
NM_003068chr81244 ------
NM_003074chr352097 1963 1853 1694 231 ------
NM_003081chr202896 226 --1216 --
NM_003106chr32780 709 ------
NM_003131chr642240 2120 2035 1795 ------
NM_003136chr141353 ------
NM_003139chr111132 ----1343
NM_003140chrY122 1114 ----
NM_003150chr1752278 2145 1741 1667 606 1680 1270 --
NM_003156chr1131060 873 863 ----11104
NM_003161chr1763321 2238 1284 1060 1008 687 1432 ----
NM_003170chr171485 ----1129
NM_003179chrX41350 1044 1023 528 ------
NM_003199chr1854388 3812 1499 1220 1138 14497 12122 --
NM_003211chr12----11320 --
NM_003220chr621398 1258 ------
NM_003234chr31367 1827 11591 --
NM_003242chr332226 2027 620 ------
NM_003247chr6281 72 11949 ----
NM_003255chr1742164 2024 1626 819 --1584 127
NM_003257chr152911 224 ------
NM_003270chrX--1922 ----
NM_003274chr215706 412 148 112 101 ------
NM_003288chr2031255 1226 147 ------
NM_003291chr131162 ------
NM_003298chr356212 5303 1747 1022 637 14753 11975 --
NM_003320chr1144262 3808 3629 376 --34393 656 636 1497
NM_003339chr511390 1555 ----
NM_003340chr41499 ----1289
NM_003342chr1742863 2651 1253 746 12154 ----
NM_003344chr731123 527 174 ----1266
NM_003347chr223739 475 161 ------
NM_003389chr93477 386 349 ------
NM_003390chr11--11027 ----
NM_003392chr333779 1604 1072 11239 ----
NM_003400chr23267 193 116 ------
NM_003403chr141252 ------
NM_003404chr201190 ------
NM_003405chr221677 ------
NM_003406chr81288 --11529 1221
NM_003409chr18--1411 ----
NM_003410chrX21950 588 12671 ----
NM_003412chr32933 455 12245 12084 --
NM_003420chr32256 35 1664 ----
NM_003427chr65604 528 470 85 55 --1104 --
NM_003439chr743555 3543 2617 2254 32946 2335 420 ----
NM_003453chr131691 ------
NM_003458chr353320 3018 2746 395 242 12929 23766 617 --
NM_003459chr23682 593 568 ------
NM_003468chr231695 1203 381 ----23474 3424
NM_003483chr1222405 2344 22993 2441 --12580
NM_003485chr1431144 1011 22 --1224 --
NM_003502chr162172 130 ------
NM_003507chr22436 383 ----1491
NM_003566chr1222878 1066 11351 ----
NM_003576chr1342766 2679 2595 1097 1502 11078 --
NM_003583chr1223645 3240 --23913 3827 --
NM_003590chr213782 11445 ----
NM_003591chr10198 ------
NM_003603chr41354 1294 ----
NM_003618chr2--11042 2845 410 --
NM_003626chr1121121 885 ------
NM_003629chr153083 3032 2656 1391 1205 23493 2833 11166 --
NM_003633chr522447 768 ------
NM_003634chr221781 --1378 --
NM_003635chr104470 418 343 88 ------
NM_003637chr131563 1121 163 ------
NM_003644chr1744724 2625 1900 290 --11145 --
NM_003663chr313196 --13229 --
NM_003677chr1242085 1403 638 402 153 ----
NM_003680chr11478 ------
NM_003704chr41628 ------
NM_003716chr311027 ------
NM_003762chr111452 ------
NM_003763chr2023064 2096 ------
NM_003766chr172457 211 ------
NM_003794chr31143 ------
NM_003800chr6198 ------
NM_003822chr142593 2298 2200 850 --1527 12329
NM_003825chr1511022 ------
NM_003860chr111370 ------
NM_003872chr232604 2028 1050 12467 --22766 213
NM_003873chr105929 844 731 675 382 1151 ----
NM_003908chr20145 11228 ----
NM_003913chr61365 ----12717
NM_003929chr151524 709 630 618 520 11604 ----
NM_003931chr62190 78 1228 ----
NM_003934chr91371 ------
NM_003948chr432542 2267 980 ------
NM_003972chr1021200 479 ------
NM_003981chr153186 110 30 ------
NM_003982chr14152 ------
NM_003983chr1663466 1688 1651 1254 338 238 11582 ----
NM_004019chrX----1380 --
NM_004028chr1812736 --13672 --
NM_004050chr1432109 439 32 12351 ----
NM_004094chr1442588 2508 2185 222 --12108 --
NM_004099chr942079 1534 1432 657 1359 ----
NM_004100chr622504 1769 ----1350
NM_004102chr11504 1460 ----
NM_004114chrX1835 ------
NM_004133chr812407 ------
NM_004136chr15----23078 439 --
NM_004161chr21533 1146 ----
NM_004162chr311047 ------
NM_004171chr1189211 9157 8751 8258 8154 6643 3707 991 12103 12453 11895
NM_004183chr111699 --1707 --
NM_004193chr101423 ------
NM_004227chr772671 2056 260 228 187 168 135 12570 --12299
NM_004235chr9--1118 ----
NM_004253chr91880 ------
NM_004274chr1442842 2424 1177 71 ------
NM_004280chr61333 --1308 --
NM_004296chr1472725 2553 1426 949 869 674 102 --33588 3127 519 --
NM_004302chr1232333 691 421 --2310 110 --
NM_004319chr162797 1234 1222 1119 531 213 1944 ----
NM_004326chr1195 ------
NM_004338chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_004349chr811004 ------
NM_004379chr241658 1602 1523 52 ----11580
NM_004384chr511855 22197 1748 ----
NM_004392chr132913 799 ------
NM_004393chr352145 881 875 818 78 ------
NM_004397chr1112859 ------
NM_004415chr6--1603 ----
NM_004420chr1192231 2171 2121 2061 2011 1846 935 799 179 ------
NM_004427chr12861 327 ------
NM_004430chr832138 692 679 --11764 --
NM_004432chr91943 ------
NM_004434chr142318 66 ------
NM_004438chr232234 526 467 12612 12275 --
NM_004449chr2131269 494 302 ------
NM_004454chr341885 677 634 606 ----124
NM_004459chr172668 132 1159 ----
NM_004474chr11335 ----1781
NM_004484chrX146 ------
NM_004491chr19104214 3572 3504 3107 2830 1631 1423 1378 861 108 11693 13393 13644
NM_004496chr1421019 879 1377 11050 --
NM_004501chr133358 2531 437 ------
NM_004503chr121630 ------
NM_004504chr21674 1239 142 --
NM_004505chr1721552 1497 --1630 --
NM_004514chr1742914 1909 815 693 --1724 --
NM_004516chr191115 11095 ----
NM_004524chr17--1189 ----
NM_004530chr164437 398 347 163 --2799 445 --
NM_004540chr21------1299
NM_004560chr91251 ------
NM_004575chr411222 ------
NM_004580chr1551802 1790 1368 571 35 11880 ----
NM_004586chrX45047 1494 1276 618 24194 1574 ----
NM_004588chr1152624 1141 980 646 370 13285 ----
NM_004606chrX2393 25 ------
NM_004631chr11271 11355 1435 --
NM_004637chr31424 ------
NM_004654chrY175 1391 ----
NM_004687chr1731908 1806 86 ----12040
NM_004703chr1742466 2208 1884 506 ------
NM_004709chrX--1156 11581 21415 72
NM_004713chr142618 327 ------
NM_004714chr191253 ------
NM_004726chrX22034 1054 25399 701 ----
NM_004741chr1021219 381 ------
NM_004745chr876626 6286 5483 4679 1606 1246 228 ------
NM_004748chr153864 817 82 1240 ----
NM_004757chr42449 90 ------
NM_004760chr741987 1728 855 807 172 ----
NM_004763chr21850 21003 986 ----
NM_004774chr1743061 2524 927 510 ------
NM_004781chr151663 1625 1394 1151 657 --11558 --
NM_004781chr151663 1625 1394 1151 657 --11558 --
NM_004788chr1111950 --1942 --
NM_004798chr2053541 2505 1300 1143 123 13339 ----
NM_004799chr11330 ------
NM_004805chr23952 898 224 ------
NM_004808chr1052917 2517 2458 2377 727 32998 2243 805 ----
NM_004815chr164962 3843 3660 3491 1289 575 ------
NM_004822chr1753576 3209 3102 2693 2562 --1857 --
NM_004824chr61308 ------
NM_004845chrX53862 3440 3168 1207 569 12575 ----
NM_004849chr6--11409 ----
NM_004850chr241661 1521 1509 1262 ------
NM_004863chr14115243 4671 4461 3661 1571 1527 974 924 681 634 55 34749 1607 314 2134 93 --
NM_004871chr1744002 1318 1007 152 ------
NM_004896chr1041482 1330 995 458 ------
NM_004898chr422017 936 ------
NM_004901chr8--1223 ----
NM_004904chr725164 4197 11491 ----
NM_004921chr11256 ------
NM_004922chr102887 722 --1951 --
NM_004926chr1411757 ------
NM_004929chr82508 135 ------
NM_004932chr5----152 --
NM_004943chr1941069 376 288 193 ------
NM_004947chr321591 203 --11050 --
NM_004952chr13902 228 112 ------
NM_004956chr743650 3260 3115 3086 --14405 --
NM_004958chr1------1744
NM_004961chrX1528 ------
NM_004965chr21129 ------
NM_004976chr1153327 1543 1327 1284 996 14694 23161 3139 --
NM_004978chr131591 1487 126 --11494 --
NM_004985chr1254394 3178 1332 1158 575 ------
NM_004991chr3128 1459 ----
NM_004992chrX166595 5937 5903 5691 5663 5527 2859 2785 2742 2654 1659 1640 658 562 352 150 --26424 533 --
NM_004992chrX166595 5937 5903 5691 5663 5527 2859 2785 2742 2654 1659 1640 658 562 352 150 --26424 533 --
NM_004993chr1421475 408 ------
NM_005011chr731287 1190 677 --2583 477 --
NM_005020chr71464 ------
NM_005032chrX2435 99 --1959 --
NM_005045chr72762 369 ------
NM_005087chr31254 ------
NM_005093chr20105087 4623 4387 3619 3347 3257 1944 1567 883 683 22024 816 ----
NM_005095chr122042 523 ------
NM_005096chrX----152 1957
NM_005105chr141638 1582 885 543 ------
NM_005109chr321805 265 --1196 --
NM_005114chr41623 ------
NM_005116chr20134341 3705 3675 3191 1600 785 691 581 559 243 237 27 21 --23613 1577 1752
NM_005134chr181677 ------
NM_005160chr2255920 5441 4574 4297 2357 12577 --15733
NM_005164chr12--22611 568 --1475
NM_005168chr2--11720 ----
NM_005171chr12--11161 ----
NM_005180chr1021034 138 ------
NM_005184chr1931374 585 384 ------
NM_005187chr16111909 1902 1877 1870 1845 1838 1813 1806 1781 1774 436 --11930 --
NM_005188chr11147681 7604 6838 5704 5428 5054 2542 2329 2222 1338 1264 1051 817 677 --36826 3070 363 12749
NM_005197chr1445482 4055 2285 329 25848 3931 ----
NM_005206chr1721197 368 11275 136 --
NM_005207chr2263545 3209 3062 2394 1215 399 ------
NM_005215chr18------1614
NM_005222chr71653 ------
NM_005233chr33479 351 39 ------
NM_005235chr287239 6766 5272 2334 1002 786 238 75 22343 573 ----
NM_005238chr1132917 2644 634 ------
NM_005239chr2141859 1622 1608 132 --11672 1120
NM_005249chr14----2846 683 --
NM_005252chr141591 ------
NM_005257chr181572 ------
NM_005259chr211123 ------
NM_005276chr1241468 1085 694 368 ------
NM_005276chr1241468 1085 694 368 ------
NM_005277chr41722 --1523 --
NM_005279chr21124 ------
NM_005342chrX21967 366 --2974 180 --
NM_005359chr1866467 6437 5660 5320 4176 2283 12241 --16504
NM_005381chr21120 ------
NM_005386chr20------1757
NM_005392chr92401 176 --11799 --
NM_005397chr721039 475 13057 ----
NM_005398chr1021395 131 ------
NM_005400chr221927 552 32899 735 581 ----
NM_005410chr51633 ------
NM_005436chr1064038 3813 2971 2693 985 646 1794 ----
NM_005440chr1732841 2300 559 11028 ----
NM_005443chr41387 ------
NM_005455chr121175 186 1432 ----
NM_005465chr11546 ------
NM_005474chr1741501 1208 611 159 ------
NM_005477chr1532476 1578 180 --21614 318 --
NM_005477chr1532476 1578 180 --21614 318 --
NM_005479chr1021054 285 --31468 1423 344 --
NM_005502chr941210 1132 377 25 ----1622
NM_005504chr1246080 5215 1061 96 12033 ----
NM_005507chr111458 ------
NM_005509chr5------149
NM_005520chr5--1151 ----
NM_005537chr133836 390 197 ------
NM_005540chr141386 1355 1203 634 ------
NM_005542chr731318 1240 595 --1545 --
NM_005595chr1--1108 1255 --
NM_005599chr13992 161 98 ------
NM_005603chr182518 219 ------
NM_005614chr73962 716 435 1730 ----
NM_005637chr1831914 1823 131 ------
NM_005659chr222484 467 ------
NM_005668chr524336 3060 2953 819 ----
NM_005670chr63435 372 204 2501 62 ----
NM_005690chr121128 ------
NM_005707chr154899 887 160 24 1977 ----
NM_005717chr11370 ------
NM_005718chr35768 655 343 202 24 ------
NM_005720chr71248 ------
NM_005722chr231887 758 601 ------
NM_005734chr111192 ------
NM_005737chr22732 697 --12634 1894
NM_005738chr721566 193 ------
NM_005748chr1212135 ------
NM_005759chr264595 3765 3337 1479 1058 742 --11403 --
NM_005795chr222684 1901 ------
NM_005808chr352825 1322 1295 1171 719 13201 1131 --
NM_005813chr2--1407 ----
NM_005828chr1731916 1833 154 24185 3306 24202 93 --
NM_005840chrX37682 4671 1430 35398 5158 4957 ----
NM_005853chr16--1610 ----
NM_005859chr511306 1409 11094 --
NM_005868chr72233 167 ----12478
NM_005876chr21222 ------
NM_005877chr2231748 754 498 21575 335 11924 --
NM_005895chr12104065 3063 2688 1525 1158 1123 753 376 278 74 ------
NM_005897chr141112 1099 956 154 ------
NM_005898chr114730 558 322 45 22446 591 ----
NM_005899chr17--1338 ----
NM_005901chr1868323 6139 2970 2788 2174 70 28584 3179 ----
NM_005905chr132341 55 ------
NM_005909chr544055 1149 740 622 ------
NM_005933chr1132450 2277 893 --12334 --
NM_005935chr474487 1738 1273 986 579 516 124 24459 929 14249 --
NM_005938chrX4514 438 345 126 ------
NM_005941chr824160 1503 ------
NM_005955chr195229 5129 3764 2194 2047 1616 877 861 853 12005 ----
NM_005962chr1021948 1739 ------
NM_005962chr1021948 1739 ------
NM_005990chr542411 1846 322 21 ------
NM_005999chr12555 94 ------
NM_006007chr953860 1575 567 368 81 23942 3789 ----
NM_006011chr1543946 3792 1223 28 ------
NM_006016chr631461 734 223 ------
NM_006036chr222185 481 ------
NM_006037chr274659 3534 3327 3312 1371 708 516 14247 24665 786 --
NM_006047chr2033467 2942 394 --13345 --
NM_006067chr16--1824 ----
NM_006095chr433749 2982 1322 1870 ----
NM_006108chr1132334 562 286 22084 1963 ----
NM_006113chr11323 ------
NM_006133chr1191834 1579 747 504 474 447 425 190 46 --11894 --
NM_006135chr11370 --156 --
NM_006141chr1652721 2421 1816 1722 233 ------
NM_006158chr821498 206 ------
NM_006164chr2--1326 ----
NM_006167chr82655 240 21850 472 ----
NM_006178chr1721413 1284 1386 21461 1263 --
NM_006190chr211028 ------
NM_006191chr12--1320 ----
NM_006196chr2170 ------
NM_006197chr812200 --1131 --
NM_006203chr534230 4149 1088 ------
NM_006224chr1731885 794 700 ----142
NM_006251chr532207 555 269 ------
NM_006256chr11175 ----11048
NM_006258chr1031344 510 227 ------
NM_006275chr2012427 --12325 1137
NM_006282chr201197 23330 1177 34189 1659 616 --
NM_006283chr854471 4360 4305 1774 777 --23634 1838 --
NM_006301chr12------1221
NM_006306chrX85101 5095 5037 4450 3880 3611 1540 786 14524 25271 4848 --
NM_006310chr1721234 506 ------
NM_006313chr121349 ------
NM_006315chr494131 3525 3109 1431 1423 1196 1037 944 672 24534 1635 23887 3081 13534
NM_006317chr51724 ------
NM_006321chr392064 1973 1372 791 748 707 518 280 39 ------
NM_006352chr1----11902 --
NM_006357chr21356 ------
NM_006366chr611272 ------
NM_006372chr61488 ------
NM_006375chrX1561 ------
NM_006380chr1723798 3601 12677 12842 --
NM_006415chr93527 78 68 ------
NM_006434chr1031211 1012 746 22195 693 ----
NM_006454chr462931 2783 2262 2226 2104 249 ------
NM_006457chr441473 1151 537 113 21229 617 ----
NM_006460chr17----1702 1324
NM_006465chr1552022 1922 1896 1597 111 ------
NM_006469chr1------11371
NM_006472chr111176 --1145 1464
NM_006475chr13--1266 ----
NM_006482chr1223645 3240 --23913 3827 --
NM_006483chr191253 ------
NM_006484chr191253 ------
NM_006489chr1431425 767 647 ------
NM_006493chr1321411 1316 1196 ----
NM_006496chr11529 ----11652
NM_006504chr1042550 1914 687 38 ------
NM_006529chr411401 132 ----
NM_006540chr8--1411 ----
NM_006546chr1755095 4420 2577 996 699 ------
NM_006547chr711462 ------
NM_006549chr1262488 2401 2388 1942 496 452 --1205 11082
NM_006559chr11125 ------
NM_006561chr1035134 1252 572 15277 ----
NM_006572chr173904 795 164 1712 ----
NM_006595chr1131725 1580 1571 1481 ----
NM_006599chr1667320 6878 6802 3204 1487 942 1491 22219 1214 --
NM_006602chr201696 ------
NM_006603chrX----21944 1260 --
NM_006622chr53468 426 131 ------
NM_006624chr1032059 1923 494 ------
NM_006626chr922074 1836 --1702 --
NM_006628chr1543942 3639 1677 966 ------
NM_006629chr1821934 81 ------
NM_006646chr1342713 1006 271 55 --12814 --
NM_006650chr552990 2806 512 440 130 21019 947 13462 1854
NM_006660chr151116 ------
NM_006667chrX11186 ------
NM_006690chr2071524 1463 867 640 454 80 37 11674 22210 309 --
NM_006698chr204981 308 254 209 --11116 --
NM_006699chr11966 --1253 --
NM_006706chr52658 338 ------
NM_006722chr312725 ------
NM_006726chr411103 ------
NM_006729chrX55645 4837 4705 1071 786 24107 1983 ----
NM_006734chr621325 1055 ------
NM_006738chr1574314 3929 3610 3514 1429 827 44 1496 13596 --
NM_006750chr1697086 5895 5746 5734 5173 2152 1143 596 184 37681 5826 2589 ----
NM_006763chr141540 1531 319 198 1851 ----
NM_006764chr31455 ------
NM_006766chr8--1861 ----
NM_006769chr11489 ------
NM_006771chr173744 230 206 129 ----
NM_006775chr611176 ------
NM_006777chrX32425 781 688 12811 1660 --
NM_006788chr1841326 624 521 296 1753 1409 --
NM_006791chr151524 ------
NM_006805chr51424 --130 --
NM_006807chr172414 92 ------
NM_006808chr9--1169 ----
NM_006815chr122893 58 ------
NM_006823chr831347 218 164 ------
NM_006828chr62178 137 ----136
NM_006833chr72319 131 ------
NM_006838chr12----11482 1569
NM_006852chr1731770 627 257 ------
NM_006854chr741896 1876 1637 132 ------
NM_006856chr1231014 803 384 --1164 --
NM_006857chr2146 ------
NM_006875chrX3229 54 34 ------
NM_006885chr16----13261 13610
NM_006888chr1483384 2345 2294 2181 774 527 305 185 13057 --12144
NM_006892chr202439 289 1337 ----
NM_006892chr202439 289 1337 ----
NM_006898chr22730 635 ------
NM_006899chr201104 --1254 --
NM_006901chr151105 1132 129 --
NM_006902chr132870 720 28 42623 2156 816 83 ----
NM_006914chr91538 ------
NM_006922chr232313 557 251 11624 --22624 2377
NM_006924chr1724172 1601 23212 743 --14205
NM_006930chr51577 ------
NM_006940chr1241352 1256 1180 384 ----172
NM_006950chrX4854 800 769 719 --1233 --
NM_006959chr191349 ------
NM_006981chr911015 ------
NM_006999chr541965 1954 791 154 ------
NM_007007chr1234774 3525 280 ------
NM_007011chr15106362 5394 5252 4591 2529 2426 2311 2198 1830 507 25473 5303 15053 --
NM_007013chr81290 ------
NM_007023chr21807 --1232 --
NM_007030chr585062 4674 4521 4400 1731 1383 760 705 11003 44210 3352 1366 1211 --
NM_007042chr322268 896 1976 1280 --
NM_007047chr642395 755 636 135 21906 257 ----
NM_007050chr2077635 6413 6236 4945 2996 654 133 25523 2311 27189 712 --
NM_007054chr532850 1179 1167 23855 1259 ----
NM_007073chr683721 3592 1590 1581 1546 1532 1524 1511 11655 ----
NM_007084chr13--11383 --1172
NM_007118chr51861 ------
NM_007122chr13511 485 434 ------
NM_007125chrY1374 ------
NM_007137chrX75041 4588 4261 3979 1985 804 352 44858 4601 1439 823 ----
NM_007156chrX------133
NM_007172chr2242631 2511 2439 2026 ----1145
NM_007181chr19----1126 --
NM_007189chr751269 1257 1007 463 241 --11139 --
NM_007197chr121751 ------
NM_007200chr1574314 3929 3610 3514 1429 827 44 1496 13596 --
NM_007216chr112391 356 ------
NM_007219chr202860 844 ------
NM_007222chr821595 1437 ------
NM_007246chr41795 ------
NM_007249chr1336538 1656 362 18585 ----
NM_007285chr16--1358 ----
NM_007294chr175853 359 156 113 59 ------
NM_007295chr175853 359 156 113 59 ------
NM_007296chr175853 359 156 113 59 ------
NM_007297chr175853 359 156 113 59 ------
NM_007298chr175853 359 156 113 59 ------
NM_007299chr175853 359 156 113 59 ------
NM_007300chr175853 359 156 113 59 ------
NM_007302chr175853 359 156 113 59 ------
NM_007303chr175853 359 156 113 59 ------
NM_007304chr175853 359 156 113 59 ------
NM_007305chr175853 359 156 113 59 ------
NM_007308chr41239 ------
NM_007324chr11330 ------
NM_007358chr111579 --11311 --
NM_007364chr15------1605
NM_007373chr1011794 ------
NM_007375chr132649 2623 919 12773 ----
NM_012062chr122765 128 ------
NM_012063chr121128 ------
NM_012072chr2043190 1475 916 583 1477 ----
NM_012081chr533243 3072 728 --12699 11303
NM_012095chr1033346 2252 1325 13089 12997 --
NM_012098chr971311 1292 1125 1071 549 63 54 --131 --
NM_012102chr122024 746 ------
NM_012104chr1142577 1004 242 63 1442 195 --
NM_012104chr1142577 1004 242 63 1442 195 --
NM_012120chr632721 1933 1867 ------
NM_012141chr1332627 724 105 13896 ----
NM_012158chr131169 ------
NM_012160chr61439 ------
NM_012193chr1175188 4130 3706 3411 2030 1996 1314 11098 --11793
NM_012199chr144680 3643 2990 1385 11164 ----
NM_012207chr10--11040 ----
NM_012232chr1731484 763 708 1236 ----
NM_012238chr1021509 1466 1253 ----
NM_012250chr1131079 167 137 1540 ----
NM_012259chr6--1573 ----
NM_012262chr145164 5047 4005 3619 1210 ----
NM_012279chr541991 1334 541 265 ------
NM_012281chr72403 218 --1856 --
NM_012294chr733406 2612 2601 23998 2626 ----
NM_012296chr1133630 572 235 1723 ----
NM_012300chr5152 --160 --
NM_012307chr182816 324 ------
NM_012309chr1154411 1743 637 457 288 1807 13538 1739
NM_012316chr194938 4613 4405 2030 1749 1531 1390 969 932 14143 ----
NM_012329chr1711402 1249 ----
NM_012333chr1--11332 11463 --
NM_012347chr613040 ------
NM_012399chr2221255 645 ------
NM_012402chr1151276 1141 1129 212 24 21219 284 ----
NM_012405chr162851 2674 852 715 699 73 ------
NM_012414chr1--1167 ----
NM_012433chr21107 ------
NM_012448chr1772037 940 824 642 387 369 351 ------
NM_012454chr61197 ------
NM_012458chr1921199 806 --2862 326 --
NM_012465chr1053044 3017 758 445 349 32227 430 176 ----
NM_012479chr71759 ------
NM_012482chr11603 ------
NM_013230chrY31581 1541 293 ------
NM_013233chr21347 ------
NM_013240chr2154100 4007 3929 1581 1301 --11561 --
NM_013254chr122616 117 ------
NM_013262chr621148 439 ------
NM_013267chr123451 406 48 ------
NM_013269chr1211814 --11610 --
NM_013277chr121211 ------
NM_013309chr1512096 --22084 685 --
NM_013372chr1562881 2775 2522 1289 837 312 ------
NM_013381chr1242156 1949 892 96 ------
NM_013386chr11138 ------
NM_013396chr211432 ------
NM_013410chr11197 --21249 35 --
NM_013433chr1941293 808 797 419 ------
NM_013444chrX1796 ------
NM_013447chr1983504 3413 2494 1526 1514 570 252 239 --11338 --
NM_013995chrX1617 172 ----
NM_014011chr222486 509 ------
NM_014021chr1----23223 1367 --
NM_014023chr1022949 176 --12100 12385
NM_014030chr1741042 969 904 46 ------
NM_014043chr31147 1482 ----
NM_014106chr152774 28 22872 731 ----
NM_014110chr1--1937 ----
NM_014112chr875344 5109 4006 3872 3839 539 396 2262 194 11043 14952
NM_014155chr1147451 7101 6978 2441 12099 14980 11306
NM_014159chr32554 255 --132 --
NM_014233chr1732124 1480 520 ------
NM_014240chr383686 3658 3537 3413 2975 2948 1292 69 13424 12560 --
NM_014243chr412009 --1810 --
NM_014245chr34909 686 220 127 ------
NM_014253chrX41556 839 702 609 ------
NM_014283chr111017 ------
NM_014286chr973411 2710 2581 2481 2356 1131 799 2893 522 1570 --
NM_014300chr151427 ------
NM_014309chr2232017 520 45 --11259 --
NM_014325chr1231453 628 73 --12235 --
NM_014331chr456516 5672 1837 1358 1000 --1293 --
NM_014351chr2211179 --21307 1203 --
NM_014372chr111432 ------
NM_014382chr31250 ------
NM_014399chr73951 264 202 ------
NM_014421chr41612 1100 ----
NM_014423chr534886 4402 1853 ------
NM_014447chr41260 ------
NM_014456chr1031766 1444 568 ------
NM_014460chr2261717 1236 1100 204 110 28 1492 31448 1071 150 --
NM_014469chr112826 601 1717 ----
NM_014491chr72884 307 1848 ----
NM_014494chr1621545 891 --1649 --
NM_014496chrX154 ------
NM_014505chr121359 1208 ----
NM_014515chr122855 92 ------
NM_014554chr121501 --1884 --
NM_014573chr17--31884 1773 335 11199 --
NM_014574chr1421543 228 ------
NM_014601chr1941257 1049 483 32 ------
NM_014614chr221396 73 ------
NM_014615chr1623226 988 ------
NM_014616chr343401 2497 1202 75 ------
NM_014630chr1553250 1537 856 292 27 11141 ----
NM_014646chr182979 391 13230 ----
NM_014659chr151222 21012 211 ----
NM_014661chr1063869 3453 1388 992 831 176 13530 43399 3387 3259 2443 --
NM_014665chr892661 2600 2504 2335 1325 1313 620 581 555 --31337 1141 738 --
NM_014666chr5--1535 ----
NM_014667chr332390 1638 404 --11506 --
NM_014671chr71617 11586 2239 176 --
NM_014674chr353428 3130 2888 1229 515 ------
NM_014682chr811673 ------
NM_014686chr1932333 2012 831 ----1863
NM_014690chr752894 1958 460 242 226 1754 ----
NM_014701chr151514 ------
NM_014702chr653500 3251 2142 1180 297 --12867 --
NM_014705chr71417 ------
NM_014707chr721957 515 ------
NM_014709chr23485 252 149 ------
NM_014717chr19152 ------
NM_014730chr1265155 4301 3958 1875 1495 220 ------
NM_014730chr1265155 4301 3958 1875 1495 220 ------
NM_014735chrX11546 ------
NM_014739chr644056 3409 2576 664 1299 ----
NM_014743chr452591 2160 507 457 214 ------
NM_014747chr1114800 4635 4358 3925 1630 920 765 642 534 438 122 14721 ----
NM_014751chr811556 ------
NM_014762chr162595 2467 2376 2222 804 351 --22016 41 --
NM_014766chr773729 3488 2484 2406 751 487 109 ------
NM_014772chr1863468 2887 2355 2244 255 87 23081 742 1135 --
NM_014779chr31301 ------
NM_014781chr81301 ------
NM_014787chr11444 22814 540 --1665
NM_014795chr21985 ------
NM_014803chr1032558 915 847 --12959 --
NM_014807chr112672 220 ------
NM_014810chr133526 3047 2996 ------
NM_014812chr1297 43 ------
NM_014819chr51570 --22513 1642 --
NM_014820chr32278 166 ------
NM_014824chr1161989 456 415 281 140 57 ----1742
NM_014828chr1442429 2398 2284 1608 ------
NM_014830chr1263516 3215 2512 1215 855 842 --23073 2966 --
NM_014832chr132706 564 ------
NM_014836chr1011946 ------
NM_014839chr11612 ------
NM_014840chr1282898 2400 2136 755 640 575 532 507 1134 ----
NM_014850chr3134667 4580 4456 4448 4137 3775 3405 1187 686 68 59 39 29 11432 ----
NM_014857chr1177 ------
NM_014873chr144752 3001 1406 1042 11363 ----
NM_014874chr13485 102 87 11772 11417 --
NM_014876chr2251738 1519 774 555 61 1732 1228 --
NM_014877chr1777145 6109 5573 4712 1737 1593 425 --17398 --
NM_014887chr131783 ------
NM_014897chr1743119 2667 1243 476 12376 ----
NM_014903chr123681 452 125 ------
NM_014904chr101367 11589 ----
NM_014905chr221561 274 ------
NM_014917chr11344 --1666 --
NM_014920chr62966 489 1878 ----
NM_014921chr1962571 2407 1985 576 95 30 --22329 749 --
NM_014923chr1311868 ------
NM_014924chr1462860 2068 1116 903 895 172 11196 1274 --
NM_014925chr121623 1329 ----
NM_014932chr331707 1695 643 ------
NM_014935chr153677 3437 3142 1419 244 --31114 671 399 --
NM_014939chr182519 488 --11209 --
NM_014946chr21220 12197 ----
NM_014949chr14808 755 724 312 1385 ----
NM_014964chr1742392 1981 582 350 1670 ----
NM_014974chr1021666 1540 11320 11281 --
NM_014977chr142547 57 --1147 --
NM_014989chr6------11963
NM_014991chr42776 593 33075 3033 849 1883 --
NM_014992chr141278 ------
NM_014999chr1211230 ------
NM_015000chr1223073 320 ------
NM_015005chr1481713 1705 1563 1119 542 254 203 80 --11523 --
NM_015008chr353396 3181 709 545 317 ------
NM_015027chr1611910 ------
NM_015032chr1322716 229 166 1161 --
NM_015035chr20146507 6379 6044 5278 4970 4515 4380 4296 1698 1674 1169 1149 1090 31 --16196 --
NM_015039chr134042 3530 3278 ------
NM_015040chr251249 1082 1035 509 130 11162 12883 --
NM_015042chr1564237 3883 3804 1224 266 151 --14131 --
NM_015045chr1011417 ------
NM_015049chr2171 ------
NM_015059chr1563677 3535 2834 2827 918 630 12669 ----
NM_015064chr12133412 2890 2867 2624 2600 2582 2387 2351 2209 1388 662 630 559 13492 23032 2398 1343
NM_015069chr162474 128 ------
NM_015074chr1114713 4630 4507 3853 1086 1042 818 745 492 222 107 33933 1164 585 24246 3322 --
NM_015075chrX51467 1385 558 245 231 ----11423
NM_015076chr633130 2941 1349 12898 ----
NM_015077chr1784442 4398 3966 3847 1708 1625 1603 528 ------
NM_015079chr1572468 2053 1092 796 665 630 72 --1370 --
NM_015091chr141118 ------
NM_015092chr1644499 4148 3063 1525 11603 11868 --
NM_015094chr22104514 3117 3104 3061 2905 1328 1281 391 349 119 ------
NM_015097chr322265 1726 ------
NM_015100chr161965 1810 1661 679 550 225 ----1421
NM_015107chrX81624 843 837 831 825 744 610 518 ------
NM_015113chr1741554 1501 927 436 --11896 --
NM_015115chr42927 150 12506 ----
NM_015129chrX21775 1604 ------
NM_015132chr742002 1854 1725 764 1378 ----
NM_015137chr82794 474 ------
NM_015144chr1673399 2621 2577 907 837 351 231 --13621 --
NM_015155chr1073222 3190 2729 490 469 448 317 --23003 688 --
NM_015170chr82662 578 11481 ----
NM_015171chr16193 ------
NM_015176chr111268 ------
NM_015178chr852696 1881 417 355 153 ------
NM_015192chr2042611 2284 524 35 12047 ----
NM_015199chr31917 ------
NM_015206chr1542687 823 785 429 1934 --13468
NM_015208chr1833815 1060 760 23893 564 13950 --
NM_015215chr13985 963 190 --11252 --
NM_015231chr111776 ------
NM_015238chr52730 565 ----160
NM_015247chr1613283 --23859 570 14717
NM_015250chr94428 415 71 25 ----11553
NM_015254chr872826 2099 1245 953 854 359 91 --12129 --
NM_015265chr232377 1661 1039 ------
NM_015271chr443804 2754 1552 1351 ------
NM_015285chr1832388 2231 411 --1224 --
NM_015288chr593717 3318 2791 2608 2455 1206 1042 890 287 13328 13731 13222
NM_015291chr172711 1409 1374 1231 675 596 130 ----1553
NM_015299chr1483382 3175 3124 1444 1236 697 396 21 --12862 --
NM_015310chr888021 7741 5616 3274 2924 2890 2120 30 17456 ----
NM_015313chr1153878 3334 3229 1081 639 --1664 --
NM_015315chr521090 1023 ------
NM_015320chr23858 415 47 --1677 --
NM_015326chr142453 759 547 368 --12260 --
NM_015328chr752741 2399 2277 1142 451 --1308 --
NM_015336chr1222257 2249 22072 385 ----
NM_015354chr91383 ------
NM_015355chr171425 ------
NM_015358chr21--11336 1146 --
NM_015382chr141258 ------
NM_015385chr1031211 1012 746 22195 693 ----
NM_015387chr21783 ------
NM_015396chr32998 582 ------
NM_015416chr122785 217 ------
NM_015443chr1731108 460 444 ------
NM_015455chr521072 78 23669 1566 12830 --
NM_015465chr52271 200 ------
NM_015477chr154885 329 144 126 ------
NM_015485chr1--1322 ----
NM_015497chr15132 ------
NM_015508chr331441 1081 333 11433 ----
NM_015530chr22724 246 ------
NM_015534chr12326 166 ------
NM_015535chr22509 275 13816 11481 --
NM_015550chr713112 ----13445
NM_015555chr621302 32 ----11371
NM_015564chr532784 2274 1094 ------
NM_015565chr2112084 ------
NM_015569chr1--1710 12975 --
NM_015575chr242676 1361 1194 22 1465 12797 --
NM_015576chr31483 ------
NM_015601chr101768 ------
NM_015605chr102380 305 --11106 --
NM_015622chr72204 55 --173 --
NM_015630chr2----1975 --
NM_015640chr145034 4274 3684 947 2905 463 ----
NM_015641chr731186 141 46 ------
NM_015646chr1211015 ----11174
NM_015670chr17--1461 ----
NM_015678chr1311136 ------
NM_015695chr641744 1596 833 88 --11687 --
NM_015726chr141776 1508 1477 378 ------
NM_015840chr132141 196 83 --12477 --
NM_015841chr132141 196 83 --12477 --
NM_015850chr851897 735 592 500 143 ------
NM_015866chr11442 ------
NM_015878chr811802 155 ----
NM_015879chr1877039 6097 5550 5498 3247 1339 1096 37367 1448 375 26843 864 --
NM_015898chr1942402 1754 657 597 ------
NM_015904chr2----1188 --
NM_015906chr144283 4050 3340 3283 13996 ----
NM_015912chr831743 1710 1024 11951 1932 --
NM_015995chr15104909 4189 4114 3990 3964 3769 1825 1476 1427 410 11940 11739 --
NM_015999chr1--1210 ----
NM_016010chr81146 ------
NM_016018chr852042 2018 979 107 32 2397 73 ----
NM_016021chr612724 ------
NM_016032chrX51240 1143 878 506 430 --11306 --
NM_016038chr7174 ------
NM_016075chr1312210 21146 979 ----
NM_016083chr633454 3311 274 ----21569 1002
NM_016094chr33604 531 172 1250 ----
NM_016125chr17146 ------
NM_016129chr4------1263
NM_016131chr232136 750 705 ------
NM_016192chr2123 ------
NM_016201chr341990 933 893 366 1462 ----
NM_016205chr4149 --11462 --
NM_016227chr111017 ------
NM_016231chr1721685 505 11661 ----
NM_016248chr1323911 350 ------
NM_016252chr21377 1750 ----
NM_016257chr193158 2779 2437 1247 549 362 235 44 29 ------
NM_016264chr19--1199 ----
NM_016272chr2241002 746 606 306 ------
NM_016282chr911254 --11707 --
NM_016287chr121647 300 ------
NM_016290chr5172 ------
NM_016308chr142087 1506 168 115 --1803 --
NM_016315chr231797 1595 337 11230 11670 --
NM_016322chr922343 1132 ------
NM_016374chr12627 472 ------
NM_016374chr12627 472 ------
NM_016376chr1751297 1163 617 454 37 ------
NM_016413chr13----1388 --
NM_016418chr2273495 3327 3124 2809 960 686 42 11498 11062 --
NM_016424chr1711817 ------
NM_016441chr242152 1486 389 342 ------
NM_016463chr5154 ------
NM_016512chr81229 ------
NM_016513chr62966 489 1878 ----
NM_016519chr4----1145 --
NM_016530chr1522597 2544 1464 ----
NM_016531chr42460 157 13240 ----
NM_016577chr363379 3292 1380 1205 603 63 24523 1455 33482 1217 1197 --
NM_016584chr121305 ------
NM_016588chr61663 ------
NM_016603chr521960 610 ------
NM_016605chr582721 2479 2428 2190 1759 369 177 50 --11709 --
NM_016620chr111183 11312 ----
NM_016626chr1831390 711 182 11702 ----
NM_016628chr10------1307
NM_016631chr211246 ------
NM_016823chr1721067 238 11145 ----
NM_016829chr36517 328 315 290 271 61 1613 ----
NM_016936chr1632136 437 371 ------
NM_016946chr153311 1017 930 715 212 23079 2254 11376 --
NM_016952chr1144001 1427 1097 1036 12979 ----
NM_017420chr1421001 586 --11440 --
NM_017447chr2144197 3763 102 86 --13596 --
NM_017488chr211523 --11285 1103
NM_017522chr11271 11355 1435 --
NM_017548chr3----1283 --
NM_017553chr15163 ------
NM_017563chr3105705 5382 4709 4463 4288 1877 968 684 383 132 13953 ----
NM_017582chr131717 1495 149 11387 ----
NM_017590chr2272270 1956 1705 1662 928 741 513 --21757 1747 --
NM_017596chr184177 3978 3903 3798 3723 1702 1204 689 --23670 858 14185
NM_017610chr151340 ------
NM_017628chr434936 4884 4795 1365 15297 --
NM_017629chr11103 ------
NM_017637chr976509 6104 6040 3153 1065 942 649 --48973 8020 6650 138 --
NM_017641chr121253 ------
NM_017650chr745976 5208 4072 3821 15086 13778 --
NM_017658chr1433210 3170 320 ------
NM_017693chr1311538 1632 ----
NM_017704chr111958 1673 ----
NM_017709chr131593 1425 995 --14221 --
NM_017719chr312473 ------
NM_017739chr12559 53 ------
NM_017740chr1631566 529 241 --1216 --
NM_017747chr51365 ------
NM_017752chrX12140 ------
NM_017753chr92881 190 ------
NM_017754chr663700 3253 1042 881 700 475 34676 4608 1903 14452 --
NM_017768chr1--1629 ----
NM_017778chr821338 1041 ------
NM_017780chr82663 171 ------
NM_017787chr1052889 2824 2160 813 665 --12276 --
NM_017790chr91139 ------
NM_017813chr845851 3725 2147 1979 11594 ----
NM_017824chr1022575 1979 12178 ----
NM_017830chr4----2879 57 --
NM_017848chrX43323 2840 437 184 23372 208 11736 --
NM_017856chrX32153 1395 602 1731 ----
NM_017873chr962770 2583 807 692 591 366 --12034 13048
NM_017913chr9160 ------
NM_017921chr1731484 521 22 ----11671
NM_017922chr141248 ------
NM_017929chr2211201 2985 518 2494 46 --
NM_017938chrX137 1493 1180 --
NM_017994chr752936 2242 2024 486 310 11951 ----
NM_017998chr911021 --11342 --
NM_018011chr131259 1535 ----
NM_018014chr221324 62 ------
NM_018027chr1031227 617 361 11093 ----
NM_018030chr18--129 ----
NM_018043chr1121492 552 ----11292
NM_018045chr171231 1209 659 488 351 178 53 22168 258 ----
NM_018092chr1611243 1597 ----
NM_018116chr11490 ------
NM_018121chr1042816 2048 781 686 ------
NM_018133chr33886 524 304 --11506 --
NM_018157chr1252691 2473 1277 367 102 --12582 11127
NM_018159chrX21628 462 ------
NM_018167chr141367 ------
NM_018171chr121816 ------
NM_018181chr1811897 ------
NM_018184chr321702 35 ------
NM_018195chr1142019 1868 1645 508 ------
NM_018196chrX2272 44 ------
NM_018197chr20--1258 ----
NM_018201chr921728 1618 1382 ----
NM_018202chr1--1955 ----
NM_018206chr161310 1573 ----
NM_018214chr61191 ------
NM_018217chr20164 ------
NM_018222chr11--11207 ----
NM_018243chr433541 2584 1194 1658 13085 --
NM_018247chr613012 12736 12703 --
NM_018254chr111937 ------
NM_018293chr31111 ------
NM_018299chr8--12844 ----
NM_018307chr171171 1215 ----
NM_018312chr1162129 1904 1881 1862 1839 1808 11398 ----
NM_018315chr411203 --1321 --
NM_018330chr101311 ------
NM_018340chr1654740 4043 1542 798 669 21622 332 1428 --
NM_018351chr1264582 3975 3627 1285 527 220 11365 ----
NM_018364chr153924 3850 3536 677 546 --12684 --
NM_018368chr61118 ------
NM_018371chr8162 ------
NM_018374chr724948 3404 ----24618 1090
NM_018393chr11185 ------
NM_018400chr1131203 702 28 21410 1160 ----
NM_018403chr323890 3883 ------
NM_018424chr931828 1274 411 ------
NM_018436chr2198 ------
NM_018437chr92454 26 ------
NM_018440chr898150 7820 7408 6628 6149 3323 1584 1434 287 26229 5353 28467 2489 --
NM_018445chr151196 ------
NM_018446chr32325 262 ------
NM_018452chr6_random62989 2769 1326 532 512 48 ------
NM_018462chr33823 758 141 ------
NM_018471chr22228 175 ------
NM_018490chr1121491 1444 ------
NM_018492chr82169 25 ------
NM_018509chr1751652 1632 1162 538 338 ------
NM_018553chr1721424 1326 ------
NM_018557chr2--1448 ----
NM_018566chr144361 3438 3131 1772 --11626 --
NM_018650chr12811 85 ----12029
NM_018660chr852915 2812 2393 1141 505 1131 1965 12687
NM_018688chr82874 104 1321 138 --
NM_018689chr153559 525 388 1220 22296 1058 --
NM_018712chr112500 142 1578 ----
NM_018719chr721230 454 ------
NM_018840chr201419 ------
NM_018844chr721979 266 ------
NM_018847chr911218 ----1154
NM_018945chr653671 2787 2725 2716 1401 12865 ----
NM_018959chr192705 511 ------
NM_018970chr743174 904 898 62 ----1254
NM_018983chr41110 ------
NM_018994chr12391 32 ------
NM_018999chr1034053 1198 1136 ----1138
NM_019004chr71377 12377 ----
NM_019006chr151185 ------
NM_019009chr1172521 2096 1845 1815 960 672 583 --11747 --
NM_019032chr11727 --1171 --
NM_019036chr62978 413 ------
NM_019045chrX2360 189 ------
NM_019046chr10--1617 ----
NM_019063chr212147 1871 ----
NM_019071chr7------1252
NM_019072chr52741 44 --14120 --
NM_019091chr22418 325 ------
NM_019096chr64372 351 271 61 11032 1173 --
NM_019106chr2222774 506 --13070 --
NM_019555chr3------11765
NM_019594chr941390 1011 517 112 11069 ----
NM_019597chrX1140 ------
NM_019610chr121406 565 1684 ----
NM_019613chr172283 215 ------
NM_019842chr61427 1175 ----
NM_019843chr221144 ------
NM_019854chr122729 259 ------
NM_019885chr252952 2578 1029 660 104 1897 12190 --
NM_020122chr255720 5351 4713 4122 1778 14788 ----
NM_020123chr101140 1252 ----
NM_020137chrX3456 383 342 ------
NM_020140chr12181 ------
NM_020144chr731899 1878 1856 ------
NM_020151chr241245 633 496 414 ------
NM_020159chr41621 ------
NM_020177chr523190 2760 2590 126 ----
NM_020178chr1711212 ------
NM_020182chr2052953 2881 2681 763 112 11156 ----
NM_020198chr1721452 406 ------
NM_020205chr142773 2519 2449 969 ------
NM_020239chr132159 1998 179 ------
NM_020245chr664397 3711 3160 1098 822 161 24244 1203 ----
NM_020248chr142377 2269 1571 57 ------
NM_020310chr1772722 2539 2365 1987 1851 551 392 ------
NM_020336chr2033306 2870 2457 --21181 1055 13579
NM_020337chr412808 2946 683 ----
NM_020338chr10--13528 ----
NM_020341chr20----1205 --
NM_020342chr242452 989 816 100 --1321 --
NM_020346chr11--1243 ----
NM_020381chr62735 339 1693 ----
NM_020384chrX3450 134 30 --11266 --
NM_020403chr13--11293 ----
NM_020429chr762447 1111 372 270 175 37 --22725 398 --
NM_020443chr156453 6335 5939 4740 2540 --24790 1270 11436
NM_020463chr231356 417 32 ------
NM_020465chr1611747 11674 ----
NM_020466chr63388 309 242 13221 --13405
NM_020526chr141799 1763 1743 1618 --1197 --
NM_020640chr322289 2022 ------
NM_020651chr2198 ------
NM_020654chr311407 ------
NM_020673chr20107369 6501 6252 5957 5934 5899 5870 5729 5628 42 --37114 6555 3016 --
NM_020682chr101118 1198 1903 --
NM_020713chr2062356 1266 1182 570 372 162 11130 31254 1085 965 11017
NM_020717chrX94695 3449 3062 1920 1768 1304 1093 659 157 24773 1507 2996 424 --
NM_020728chr732617 2605 1079 22697 163 ----
NM_020738chr221202 199 ------
NM_020739chr153864 817 82 1240 ----
NM_020749chr821540 1373 ------
NM_020752chr101903 1200 ----
NM_020760chr2--1641 ----
NM_020766chrX53683 3241 828 442 40 --1100 --
NM_020772chr1738192 6679 6420 ------
NM_020774chr1844971 1965 1464 759 21947 1167 ----
NM_020783chr1851765 934 768 649 523 ------
NM_020794chr111095 ------
NM_020796chr522129 973 --1429 --
NM_020801chr521857 1766 12374 1437 --
NM_020805chr181483 ----11230
NM_020807chr162332 223 --21536 1299 --
NM_020808chr1----1717 --
NM_020819chr621234 186 ------
NM_020832chr11687 ------
NM_020841chr1233840 3811 1017 1568 --1769
NM_020850chr1693088 2913 2858 2786 2385 2302 1284 832 506 22097 931 13078 --
NM_020854chr18----11529 --
NM_020858chr153364 219 28 ----1118
NM_020859chr463166 2782 2686 1515 1277 353 --33802 2979 1285 13592
NM_020870chr42879 98 ------
NM_020871chrX22501 2200 ------
NM_020888chr141275 421 412 286 ----1566
NM_020898chr122709 226 ------
NM_020899chr1741733 710 517 461 ------
NM_020925chr111177 ------
NM_020927chr1652327 1879 1483 462 425 ------
NM_020935chr223564 2880 --14471 --
NM_020939chr62439 25 ------
NM_020951chr1921530 126 11835 ----
NM_020956chr1994238 3512 3334 1894 1267 1001 877 830 264 --23611 3557 23039 804
NM_020962chr152551 289 --42156 351 302 67 11837
NM_020964chr1833944 3607 3119 1107 11119 --
NM_020981chr23634 539 175 ------
NM_020987chr1011188 ------
NM_021007chr22261 163 12414 ----
NM_021033chr131772 --12554 11022
NM_021064chr641795 442 315 215 ------
NM_021069chr41354 1294 ----
NM_021097chr211915 ------
NM_021120chrX32482 2106 748 1894 12917 --
NM_021132chr1011248 ----1551
NM_021140chrX1390 1435 ----
NM_021141chr22668 255 ------
NM_021148chr742399 1987 1891 1637 1992 ----
NM_021183chrX21958 24 1284 ----
NM_021189chr12822 231 ------
NM_021190chr111292 ------
NM_021191chr1232464 2262 1003 ------
NM_021194chr11110 ------
NM_021229chr12--1849 ----
NM_021248chr203554 528 253 ------
NM_021249chr1441602 1400 659 218 ------
NM_021255chr1443962 3641 2937 456 ------
NM_021260chr142430 420 ----11211
NM_021614chr5--150 ----
NM_021619chr931179 927 458 --1937 --
NM_021627chr321240 1180 --1390 --
NM_021629chr355073 4019 3201 3189 1727 13279 --14911
NM_021644chr10--11040 ----
NM_021647chr434119 3561 2965 --11634 --
NM_021649chr5123 ------
NM_021705chr621159 141 ------
NM_021728chr14--1884 ----
NM_021813chr654101 1839 611 325 253 35489 3847 846 ----
NM_021814chr6------11255
NM_021825chr11125 ------
NM_021905chr631730 1497 537 ------
NM_021911chr565603 5409 2007 585 346 138 13905 1238 1682
NM_021912chr1553924 3669 2905 826 614 ------
NM_021914chr1441613 948 825 365 1374 ----
NM_021943chr691781 1407 833 540 524 517 494 479 259 ------
NM_021945chr663123 2298 1013 871 364 246 12815 ----
NM_021947chr1711240 --2494 108 --
NM_021949chrX41816 974 422 62 32744 2517 1132 --11871
NM_021956chr621032 273 ------
NM_021959chr61681 --159 --
NM_021961chr1156921 5155 1833 1813 1038 12184 11528 --
NM_021965chr9--1892 --11376
NM_021973chr41531 ------
NM_021984chrX1528 ------
NM_021987chrX1528 ------
NM_021990chrX1528 ------
NM_021998chrX21423 1288 --1430 --
NM_022037chr2131 ------
NM_022048chr1586198 5884 4432 2415 2088 1875 1763 185 12495 11600 --
NM_022060chr1441281 952 367 331 ------
NM_022062chr1121551 1438 --21468 520 11964
NM_022079chr101768 ------
NM_022085chr64417 339 218 94 ------
NM_022130chr51133 ------
NM_022131chr32965 201 ----11342
NM_022133chr811385 ------
NM_022166chr1655127 3863 2456 2356 124 1762 12306 --
NM_022171chr341595 1126 389 377 ------
NM_022173chr2131 ------
NM_022334chr21850 21003 986 ----
NM_022336chr232337 1999 820 ------
NM_022444chr731696 484 71 ------
NM_022455chr51272 ------
NM_022458chr72160 97 ------
NM_022461chr32557 53 ----11036
NM_022462chr1953748 3630 814 224 196 ------
NM_022469chr133151 2679 966 ------
NM_022474chr1422034 1057 12385 ----
NM_022483chr521664 681 11744 ----
NM_022497chr373798 3027 2905 2551 975 598 426 21435 213 ----
NM_022552chr211069 ------
NM_022716chr122714 564 32467 2000 660 ----
NM_022719chr2263451 3260 3111 1271 953 754 --11528 --
NM_022726chr6--1506 ----
NM_022728chr7----128 --
NM_022731chr1198 ------
NM_022742chr7259 45 ------
NM_022750chr73547 493 50 ------
NM_022755chr952322 2230 936 536 463 --22346 790 --
NM_022758chr653123 2941 1015 897 680 --32953 2559 727 --
NM_022763chr332895 2698 1125 ------
NM_022768chr11115 ------
NM_022781chr932605 752 84 12395 12568 --
NM_022824chr51683 ----1591
NM_022842chr352864 2588 1103 882 452 11109 22921 2639 --
NM_022893chr22862 386 ------
NM_022898chr1434015 3683 983 --13012 --
NM_022910chr1611747 11674 ----
NM_022912chr241866 1236 1215 693 ------
NM_022918chr11--21860 1506 1551 --
NM_023016chr212319 22283 1766 ----
NM_023071chr122708 234 1786 ----
NM_023076chr1662585 2568 1828 970 783 334 11044 52772 2644 2540 2242 791 --
NM_023105chr851897 735 592 500 143 ------
NM_023106chr851897 735 592 500 143 ------
NM_023110chr851897 735 592 500 143 ------
NM_023111chr851897 735 592 500 143 ------
NM_023927chr52430 94 ------
NM_023929chr812377 ------
NM_023931chr1621104 297 21418 412 1382 --
NM_023932chr6161 ------
NM_023943chr31200 ------
NM_024054chr71325 ------
NM_024061chr7----1173 --
NM_024086chr17103409 3065 2625 1358 1219 1211 1145 952 407 53 22703 1529 43741 2613 222 199 --
NM_024090chr411733 11338 ----
NM_024117chr931431 1049 216 ------
NM_024293chr23860 329 48 1527 ----
NM_024294chr653123 2941 1015 897 680 --32953 2559 727 --
NM_024295chr821372 494 182 11633 --
NM_024306chr166955 745 482 440 216 97 --3338 289 209 --
NM_024332chrX21858 1547 11125 ----
NM_024336chr16--1352 ----
NM_024345chr964234 2066 1554 856 266 158 24185 2164 ----
NM_024430chr1831825 1504 367 11460 ----
NM_024511chr453308 2453 2294 1241 521 13385 ----
NM_024524chr312085 ----12590
NM_024539chrX21095 791 ------
NM_024551chr1232429 139 71 --11937 --
NM_024551chr1232429 139 71 --11937 --
NM_024554chr141485 1133 157 103 ------
NM_024563chr531820 1349 81 11313 ----
NM_024612chr17----1100 --
NM_024613chr8----135 --
NM_024617chr93887 807 31 ------
NM_024639chr611947 ------
NM_024646chr174020 3700 3574 2746 1559 1335 876 13145 23286 2701 --
NM_024659chr22993 291 ------
NM_024665chr33810 701 101 ------
NM_024674chr132443 1012 300 12521 12919 --
NM_024704chr205732 453 368 244 201 ------
NM_024721chr812443 ------
NM_024751chr442030 1382 1291 576 ------
NM_024770chr236383 6036 803 16451 ----
NM_024798chr1572805 2662 2326 1907 1793 664 264 ------
NM_024828chr91145 ------
NM_024834chr1031952 790 539 ------
NM_024866chr2273005 2605 2566 566 535 377 368 --21407 603 13175
NM_024873chr451071 1063 793 129 48 ------
NM_024881chr1963140 1063 577 460 399 287 23096 1141 ----
NM_024884chr1434223 1688 1128 21837 1084 1359 --
NM_024899chr181506 ------
NM_024920chr421401 1059 ------
NM_024933chr24702 593 490 42 ------
NM_024949chr473922 3901 3290 3037 1974 878 680 ----14712
NM_024953chr1221951 617 12140 ----
NM_024979chr1341389 1340 651 120 1369 1453 --
NM_024989chr256836 6677 2746 2382 1563 12339 ----
NM_024991chr1031211 1012 746 22195 693 ----
NM_025054chr832923 1445 159 23228 727 ----
NM_025073chr144064 3344 3206 1657 13541 --11094
NM_025076chr21578 ------
NM_025079chr12501 292 ------
NM_025106chr121871 145 ------
NM_025133chr211167 ------
NM_025134chr161578 12072 ----
NM_025146chr3--12683 11028 --
NM_025147chr21921 ------
NM_025160chr133012 1675 818 ------
NM_025219chr2042473 2322 1654 44 12164 32268 1527 21 --
NM_025224chr20112120 2103 1831 1797 1522 513 495 483 309 296 27 --1342 --
NM_025243chr262058 1701 1392 795 721 28 31781 1484 1349 ----
NM_030627chr513600 1823 ----
NM_030647chr755983 5045 4901 2511 1584 12488 12265 12384
NM_030648chr444492 2098 1657 382 ------
NM_030650chr224020 907 11341 ----
NM_030660chr1421475 408 ------
NM_030670chr1242360 1616 1542 1524 --1168 --
NM_030671chr1242360 1616 1542 1524 --1168 --
NM_030674chr1253708 1942 620 581 297 ------
NM_030756chr10----1121 --
NM_030759chr101271 ------
NM_030761chr172531 2518 1806 350 261 210 39 ------
NM_030762chr1221441 388 ------
NM_030786chr121466 180 ----11314
NM_030791chr1411205 ------
NM_030806chr198599 8412 6299 3050 2756 2683 2151 1775 925 21898 1745 39109 7078 2796 17465
NM_030808chr173817 282 195 ------
NM_030810chr64417 339 218 94 ------
NM_030820chr6149 1659 ----
NM_030885chr332127 2093 1454 --12080 --
NM_030915chr232174 1600 927 ----11454
NM_030918chr145166 4815 4030 122 25362 1985 1811 1662
NM_030927chr1061527 1131 1113 1013 503 292 --11149 --
NM_030962chr111305 1190 ----
NM_030964chr533114 997 901 --12517 --
NM_031216chr18--12150 ----
NM_031243chr732132 622 291 ----11940
NM_031262chr9----2454 299 --
NM_031263chr9----1356 --
NM_031268chr16125389 5101 3686 2062 2004 1629 1393 1309 621 599 450 61 14229 24310 1844 23597 405
NM_031283chr21122 187 ----
NM_031305chr441586 1515 511 82 ------
NM_031362chr232134 1910 1091 12629 ----
NM_031365chr232270 2046 1826 12765 ----
NM_031366chr232270 2046 1826 12765 ----
NM_031371chr12627 472 ------
NM_031371chr12627 472 ------
NM_031419chr32575 24 ------
NM_031431chr1321837 248 ------
NM_031442chrX12858 ------
NM_031445chr263392 2601 2100 842 322 48 --138 --
NM_031452chr15176 ------
NM_031469chr613373 11062 23332 153 --
NM_031476chr1672256 1801 1124 824 641 534 139 ------
NM_031483chr2042786 2281 751 618 11145 12392 --
NM_031844chr133358 2531 437 ------
NM_031858chr17--1338 ----
NM_031862chr17--1338 ----
NM_031890chr2262372 2322 2092 1865 872 517 12502 1385 --
NM_031954chr1262213 2062 1895 1834 978 561 --11110 --
NM_032012chr983973 3927 3659 2001 1432 1415 569 69 34189 3418 2072 11584 --
NM_032017chr151857 795 610 597 63 ------
NM_032041chr822705 2559 22396 1922 11017 --
NM_032052chr2221307 1240 ------
NM_032102chr1153074 2534 2028 628 337 --12016 12599
NM_032109chr531176 957 330 21393 1295 ----
NM_032116chr1335644 5391 3727 11366 --11068
NM_032121chrX31092 523 342 22616 1037 ----
NM_032128chr41326 ------
NM_032132chr11153 ------
NM_032139chr191300 ------
NM_032153chr312767 ------
NM_032160chr1823815 3667 ------
NM_032174chr131101 536 245 11198 ----
NM_032186chr111183 11312 ----
NM_032189chr1364235 3966 2005 305 146 105 --11707 --
NM_032199chr1043264 2880 1234 330 21542 38 13355 --
NM_032213chr251093 1021 327 86 77 1280 ----
NM_032242chr383076 2406 2124 2037 1239 1097 716 297 1261 12418 --
NM_032246chr15--11223 ----
NM_032271chr1671348 1132 1100 411 367 78 66 ------
NM_032283chr151795 1769 1140 161 139 1547 21677 406 --
NM_032288chr31610 --12087 --
NM_032329chr2113767 3728 3700 3623 3415 3254 3155 3105 2888 1308 217 --43147 2762 672 118 --
NM_032373chr1035368 3903 2050 ------
NM_032374chr1461623 1611 1579 669 316 304 11291 --11247
NM_032412chr5--1246 --1301
NM_032438chr611034 1448 ----
NM_032440chr1012945 ------
NM_032445chr1532386 2057 914 12095 ----
NM_032449chr142489 1827 1144 305 22569 1921 12626 --
NM_032457chr4--23945 433 ----
NM_032458chrX32363 2352 2206 12400 ----
NM_032486chr1642253 1954 1769 467 1991 22367 1755 --
NM_032505chr362608 2120 1103 881 811 716 ----12068
NM_032514chr20----1406 --
NM_032547chr4193 ------
NM_032552chr941928 1464 550 501 --31296 754 150 --
NM_032557chr4129 ------
NM_032560chr142315 90 ------
NM_032580chr171144 ------
NM_032582chr1721520 117 --1645 --
NM_032590chr121987 ------
NM_032638chr331285 1200 379 --1545 --
NM_032682chr323492 2341 11248 12462 --
NM_032711chr1774170 3294 2944 1607 1433 963 215 33343 2993 1593 33334 1578 401 --
NM_032727chr10--11173 ----
NM_032737chr1932009 1784 548 1247 ----
NM_032786chr12----1415 --
NM_032801chr1122113 407 1133 ----
NM_032809chr941242 1069 1048 79 --1405 --
NM_032810chr101963 2949 181 ----
NM_032818chr972483 2275 1859 1846 1784 623 190 11939 1475 --
NM_032846chr141593 --1607 --
NM_032859chr1331467 1241 509 ------
NM_032873chr1133079 1575 1334 ------
NM_032875chr171626 ------
NM_032975chr1843086 2971 2940 1160 --32211 1192 99 --
NM_032980chr1843086 2971 2940 1160 --32211 1192 99 --
NM_032993chr41110 ------
NM_033020chr144283 4050 3340 3283 13996 ----
NM_033082chr12162 ------
NM_033089chr2031457 540 468 ------
NM_033133chr1752879 1371 854 460 441 ----13140
NM_033136chr52412 138 --11594 --
NM_033137chr52412 138 --11594 --
NM_033141chr1431973 1617 557 --1218 --
NM_033143chr432861 1075 97 14031 ----
NM_033161chr91495 21669 29 141 11691
NM_033181chr633454 3311 274 ----21569 1002
NM_033222chr91956 ------
NM_033224chr777245 6799 6650 5100 2624 1849 51 11002 22582 1082 --
NM_033240chr1551711 1687 1441 469 359 11597 ----
NM_033274chr592597 2339 1366 1304 1129 983 517 91 63 ------
NM_033281chr51173 ------
NM_033285chr834340 4067 1683 ------
NM_033290chrX23539 686 ----1623
NM_033300chr11271 11355 1435 --
NM_033315chr1751830 1804 575 334 204 31498 1395 38 ----
NM_033326chr1132401 852 90 ------
NM_033340chr10180 ------
NM_033360chr1254515 3299 1453 1279 696 ------
NM_033389chr1794739 3906 3765 3056 1341 974 691 606 107 ------
NM_033429chr1582386 2148 2092 1227 1018 947 883 872 ----11253
NM_033449chr531872 1405 1387 --11671 --
NM_033480chr613040 ------
NM_033481chr613040 ------
NM_033551chr521090 1023 ------
NM_033632chr411203 --1321 --
NM_033642chrX1835 ------
NM_033644chr5152 --160 --
NM_033645chr5152 --160 --
NM_033656chr2185071 4377 2128 2117 1727 1267 562 529 ------
NM_033668chr10------150
NM_052818chr1311901 ------
NM_052820chr93477 386 349 ------
NM_052828chr621595 402 1422 1190 --
NM_052832chr812286 --12857 --
NM_052834chr1832388 2231 411 --1224 --
NM_052846chr205933 496 445 147 100 ------
NM_052879chr121509 --23555 59 --
NM_052897chr121740 ------
NM_052899chr52964 366 --1199 --
NM_052900chr821714 1255 ------
NM_052906chr22104467 4452 4226 4104 3183 1738 1242 1210 901 684 13807 ----
NM_052910chr1341839 1617 760 434 ------
NM_052918chr1042689 2562 1366 711 --2751 721 --
NM_052928chr1741212 381 82 70 2459 162 ----
NM_052937chr831821 1660 939 12577 ----
NM_053016chr956594 6020 5665 5370 886 17104 12067 --
NM_053024chr31379 ------
NM_057159chr921133 349 --11438 --
NM_057178chr1752744 1007 847 549 69 ------
NM_078476chr631598 1516 217 --197 11321
NM_080415chr171994 1100 ----
NM_080491chr1133630 572 235 1723 ----
NM_080546chr91230 ------
NM_080597chr18--129 ----
NM_080629chr111546 ----1209
NM_080630chr111546 ----1209
NM_080654chr1121293 124 ------
NM_080738chr1--11732 1505 11859
NM_080759chr132913 799 ------
NM_080760chr132913 799 ------
NM_080764chr2242569 1236 1210 511 ------
NM_080867chr1423766 1150 23260 652 23202 712 13270
NM_080872chr853874 3793 2910 1254 33 --12623 --
NM_100264chr10------1307
NM_100486chr10------1307
NM_130391chr923332 388 12512 ----
NM_130392chr923332 388 12512 ----
NM_130393chr923332 388 12512 ----
NM_130434chr15138 ------
NM_130435chr1042550 1914 687 38 ------
NM_130436chr2141981 815 694 328 11969 1789 --
NM_130438chr2152558 1271 905 343 234 12546 11366 --
NM_130439chr1021948 1739 ------
NM_130439chr1021948 1739 ------
NM_130459chr951468 1388 1313 1218 1158 ------
NM_130797chr731728 1116 30 --1304 11331
NM_130798chr1511022 ------
NM_130811chr202896 226 --1216 --
NM_130846chr121708 ------
NM_130847chr1175796 5712 4409 3877 1863 1800 1793 ------
NM_133170chr2077635 6413 6236 4945 2996 654 133 25523 2311 27189 712 --
NM_133264chr1773759 3743 3161 2923 2836 1529 979 ----13752
NM_133265chrX23569 3533 --1280 --
NM_133329chr221691 1159 1501 ----
NM_133370chr433226 3032 2831 ------
NM_133372chr522236 2007 --12473 --
NM_133445chr932552 1426 866 22541 766 ----
NM_133499chrX4924 870 839 789 --1303 --
NM_133631chr3------11215
NM_133638chr521425 963 ------
NM_134442chr241658 1602 1523 52 ----11580
NM_138270chrX13298 ------
NM_138300chr151361 1305 438 287 127 --1262 --
NM_138316chr101330 ----1255
NM_138338chr2283475 3173 1298 1219 567 213 207 52 --13001 --
NM_138385chr451302 1122 571 297 165 --11157 11062
NM_138391chr12226 77 ------
NM_138395chr21322 11068 ----
NM_138426chr732472 819 467 ------
NM_138441chr6191 ------
NM_138457chr642749 2271 425 412 ----11164
NM_138468chr244763 2197 1370 28 55282 4596 2277 1866 1448 12537 15023
NM_138473chr121511 ------
NM_138479chr151917 1732 1667 664 235 ------
NM_138492chr521252 75 11330 ----
NM_138558chr1--1937 ----
NM_138559chr221314 52 ------
NM_138576chr1434015 3683 983 --13012 --
NM_138578chr2061097 1091 1029 589 422 278 11364 ----
NM_138638chr1441613 948 825 365 1374 ----
NM_138713chr1667320 6878 6802 3204 1487 942 1491 22219 1214 --
NM_138714chr1667320 6878 6802 3204 1487 942 1491 22219 1214 --
NM_138779chr131219 ------
NM_138799chr231841 1374 805 11921 11323 --
NM_138811chr711130 1835 ----
NM_138923chrX2393 25 ------
NM_138927chr21--1118 --1374
NM_138969chr841240 471 326 289 ------
NM_138971chr1142577 1004 242 63 1442 195 --
NM_138971chr1142577 1004 242 63 1442 195 --
NM_138972chr1142577 1004 242 63 1442 195 --
NM_138972chr1142577 1004 242 63 1442 195 --
NM_138973chr1142577 1004 242 63 1442 195 --
NM_138973chr1142577 1004 242 63 1442 195 --
NM_139046chr101215 ------
NM_139047chr10181 ------
NM_139049chr10181 ------
NM_139057chr1531805 952 470 --2970 80 --
NM_139072chr21835 ------
NM_139159chr1961027 508 235 125 82 41 ------
NM_139168chr531813 264 244 --1147 --
NM_139170chr163548 243 230 --1236 --
NM_139207chr1211418 ------
NM_139244chr61156 --1757 --
NM_139246chr9102212 1971 1716 1611 934 920 823 394 382 115 --1280 --
NM_139276chr1752278 2145 1741 1667 606 1680 1270 --
NM_139279chr232669 1130 1007 1848 ----
NM_139283chr123495 291 108 --22492 945 --
NM_139316chr72835 346 ------
NM_139323chr201190 ------
NM_144571chr477031 5368 1667 1313 1124 1017 86 26045 637 ----
NM_144579chr282830 2698 2608 2534 2212 588 538 490 12716 1459 --
NM_144582chr252539 2465 2398 2361 622 --32147 1667 370 --
NM_144599chr1575235 4661 4221 1725 1322 126 57 ----15410
NM_144609chr1721181 276 1128 ----
NM_144610chr172387 30 ------
NM_144635chr331232 1139 251 --1892 --
NM_144642chr31260 1218 ----
NM_144664chr1111012 --11944 --
NM_144726chr511042 ------
NM_144767chr1574314 3929 3610 3514 1429 827 44 1496 13596 --
NM_144775chr1764934 3403 1324 884 240 133 ------
NM_144778chr13--11682 ----
NM_144949chr222486 509 ------
NM_144973chr1273433 1644 1415 1301 1014 892 873 11722 ----
NM_144979chr41535 ------
NM_144982chr121529 187 --1672
NM_145008chr111815 ------
NM_145010chr1032212 1944 137 ------
NM_145052chrX1817 --1412 --
NM_145053chr113605 580 60 ------
NM_145055chr1833547 1407 868 ------
NM_145203chr131101 ------
NM_145206chr1042853 2230 679 66 ------
NM_145207chr445376 4815 3487 498 45017 4675 1290 585 ----
NM_145279chr131740 55 25 ----1338
NM_145320chr713112 ----13445
NM_145321chr713112 ----13445
NM_145322chr713112 ----13445
NM_145341chr1031766 1444 568 ------
NM_145349chr173914 880 551 21912 1741 1904 --
NM_145350chr173648 266 232 21264 1093 1256 --
NM_145690chr81288 --11529 1221
NM_145698chr101521 11377 ----
NM_145733chr22----1859 --
NM_145799chrX83106 2935 1230 1215 1156 330 236 207 1215 ----
NM_145808chr732024 409 46 ------
NM_145861chr1--11732 1505 11859
NM_145909chr63914 261 149 ------
NM_147147chr683721 3592 1590 1581 1546 1532 1524 1511 11655 ----
NM_147156chr101140 ------
NM_147202chr952610 2495 2350 1097 929 1301 ----
NM_148174chr811802 155 ----
NM_148898chr72884 307 1848 ----
NM_148899chr72884 307 1848 ----
NM_148912chr7236 24 1116 1427 --
NM_148921chr1742392 1981 582 350 1670 ----
NM_148977chr101330 ----1255
NM_148978chr101330 ----1255
NM_152233chr1441602 1400 659 218 ------
NM_152237chr2251747 1548 1202 280 192 ----11185
NM_152253chr22103794 3769 3577 3037 2900 2683 2648 1667 1358 184 --14039 13253
NM_152261chr1221777 871 11825 ----
NM_152265chr1--1202 ----
NM_152275chr22625 371 ------
NM_152277chr51291 --11681 --
NM_152280chr133424 3161 430 --13139 --
NM_152330chr14----11837 1533
NM_152332chr1412717 ----11020
NM_152344chr1731435 1390 57 --1364 --
NM_152371chr161718 1565 1465 1412 656 249 ------
NM_152409chr543125 2682 916 263 1988 ----
NM_152410chr61125 ------
NM_152414chr81412 ------
NM_152446chr14--1349 1287 1690
NM_152450chr1521910 1428 11803 ----
NM_152484chr1911337 ------
NM_152520chr22993 298 ------
NM_152538chr331549 1344 150 ------
NM_152542chr42591 579 1671 ----
NM_152574chr9--1123 ----
NM_152588chr12------11847
NM_152594chr1532117 700 247 ------
NM_152622chr552896 1233 777 734 402 ------
NM_152624chr556531 6069 5260 5195 1912 26716 5008 ----
NM_152629chr933269 1383 492 ------
NM_152636chr1142320 884 740 192 12401 ----
NM_152653chr31739 ------
NM_152660chr11649 --1329 --
NM_152678chr372721 2204 1987 1787 1696 787 401 1867 ----
NM_152688chr6152 ------
NM_152699chr393691 3110 2887 2302 1194 1124 996 630 576 12394 --1824
NM_152705chr133545 341 145 ------
NM_152713chr11--1227 ----
NM_152721chr18------1176
NM_152787chrX3415 326 137 11125 ----
NM_152788chr12181 ------
NM_152829chr731186 141 46 ------
NM_152835chr12166 70 12805 12531 --
NM_152836chr811385 ------
NM_152837chr811385 ------
NM_152838chr2033467 2942 394 --13345 --
NM_152854chr201211 1611 1187 --
NM_152890chr1137 2360 113 ----
NM_152896chr9134 ------
NM_152919chr1983504 3413 2494 1526 1514 570 252 239 --11338 --
NM_152924chr15106362 5394 5252 4591 2529 2426 2311 2198 1830 507 25473 5303 15053 --
NM_152932chr32325 262 ------
NM_152989chr1241352 1256 1180 384 ----172
NM_152990chr6--1848 --126
NM_152999chr714409 13290 14173 11542
NM_153029chr1663779 3729 3162 2943 2667 2513 22764 1552 33666 912 762 --
NM_153035chr122830 2605 13085 ----
NM_153038chr2--1725 ----
NM_153184chr3158 ------
NM_153188chr534964 1831 1501 ------
NM_153207chr1222782 689 ------
NM_153223chr521592 551 1263 ----
NM_153260chr152600 63 11009 ----
NM_153273chr372683 1767 1730 896 779 339 220 ------
NM_153341chr11119 ------
NM_153343chr431566 878 343 --1445 --
NM_153354chr52668 387 ------
NM_153464chr191223 1688 ----
NM_153499chr1262586 2499 2486 2040 594 550 --1303 11180
NM_153500chr1262586 2499 2486 2040 594 550 --1303 11180
NM_153607chr522717 24 --11162 --
NM_153616chr153364 219 28 ----1118
NM_153617chr153364 219 28 ----1118
NM_153618chr153364 219 28 ----1118
NM_153619chr1531457 1266 409 ----11356
NM_153645chr2242631 2511 2439 2026 ----1145
NM_153693chr121630 ------
NM_153705chr111116 ------
NM_153756chr131363 303 225 ----11618
NM_153759chr211069 ------
NM_153810chr1064800 4569 4413 4218 3542 701 14326 ----
NM_153812chr122235 498 11566 1645 12175
NM_170662chr31186 ------
NM_170674chr1521102 79 ------
NM_170675chr151778 ------
NM_170676chr151778 ------
NM_170677chr1521102 79 ------
NM_170706chr134042 3530 3278 ------
NM_170711chr193881 687 27 ------
NM_170731chr1142695 2604 2468 804 11090 12462 --
NM_170732chr1142695 2604 2468 804 11090 12462 --
NM_170733chr1142695 2604 2468 804 11090 12462 --
NM_170734chr1142695 2604 2468 804 11090 12462 --
NM_170735chr1142695 2604 2468 804 11090 12462 --
NM_170751chr61308 ------
NM_170752chr61308 ------
NM_170768chr113423 237 41 ------
NM_170775chr5--150 ----
NM_171998chrX42203 1019 247 230 ------
NM_171999chr182761 138 ------
NM_172037chr8------11444
NM_172058chr8----11480 --
NM_172059chr8----11480 --
NM_172060chr8----11480 --
NM_172070chr2----1231 --
NM_172071chr125821 2902 11693 ----
NM_172103chr622504 1769 ----1350
NM_172105chr622504 1769 ----1350
NM_172127chr4--1653 ----
NM_172169chr1051402 624 476 355 61 ------
NM_172170chr1051402 624 476 355 61 ------
NM_172171chr1051402 624 476 355 61 ------
NM_172173chr1051402 624 476 355 61 ------
NM_172216chr1262488 2401 2388 1942 496 452 --1205 11082
NM_172226chr1262586 2499 2486 2040 594 550 --1303 11180
NM_172315chr1521102 79 ------
NM_172316chr1521102 79 ------
NM_172337chr14--1884 ----
NM_172344chr221691 1159 1501 ----
NM_172349chr51272 ------
NM_173054chr72762 369 ------
NM_173065chr163116 2736 2322 1242 692 351 13071 13382 --
NM_173074chr23345 78 71 ------
NM_173163chr161477 ------
NM_173165chr161358 ------
NM_173172chr2248 42 ------
NM_173198chr911015 ------
NM_173200chr911015 ------
NM_173214chr1667320 6878 6802 3204 1487 942 1491 22219 1214 --
NM_173359chr311178 1104 ----
NM_173468chr436107 2281 344 ------
NM_173470chrX62810 2781 2770 1957 1138 499 --12213 --
NM_173478chr1711093 ------
NM_173495chrX21857 1804 12427 1598 --
NM_173508chr13850 831 100 11240 ----
NM_173531chr1933523 2529 1562 ------
NM_173552chr31950 148 ----
NM_173582chr1165849 5107 5000 1600 1249 152 41540 1327 145 108 ----
NM_173595chr1244612 3879 3804 32 --21139 810 --
NM_173602chr1223196 105 23329 65 12385 12457
NM_173642chr158591 8312 5621 2452 2044 36205 3254 2796 22428 769 --
NM_173666chr511148 ------
NM_173698chrX1114 --1520 --
NM_173797chr521125 1057 ------
NM_173822chr221847 96 1795 ----
NM_174856chr201104 --1254 --
NM_174890chr101753 ------
NM_174934chr1172729 2670 1388 673 648 430 203 ------
NM_175061chr711767 ------
NM_175610chr152911 224 ------
NM_175629chr211069 ------
NM_175630chr21318 ----158
NM_175634chr811004 ------
NM_175635chr811004 ------
NM_175636chr811004 ------
NM_175848chr202439 289 1337 ----
NM_175848chr202439 289 1337 ----
NM_175849chr202439 289 1337 ----
NM_175849chr202439 289 1337 ----
NM_175850chr202439 289 1337 ----
NM_175850chr202439 289 1337 ----
NM_175854chr1322569 1012 133 ----
NM_175856chr51621 ------
NM_175861chr1225110 3947 ----12403
NM_175876chr121726 262 1884 ----
NM_175898chr1541375 1160 642 497 ------
NM_175931chr16111909 1902 1877 1870 1845 1838 1813 1806 1781 1774 436 --11930 --
NM_176792chr1011014 1551 1542 11172
NM_176815chr342111 1077 1007 147 ------
NM_176871chr893285 3238 2370 2360 1068 1036 718 639 150 12104 2971 312 --
NM_177968chr231898 714 462 11988 ----
NM_177969chr2----1569 --
NM_177972chr1144262 3808 3629 376 --34393 656 636 1497
NM_177990chr20----1205 --
NM_177999chr983333 3146 1370 1255 1154 929 543 469 --22597 444 13611
NM_178010chr1241352 1256 1180 384 ----172
NM_178013chr143912 170 27 12031 ----
NM_178037chr12133412 2890 2867 2624 2600 2582 2387 2351 2209 1388 662 630 559 13492 23032 2398 1343
NM_178038chr12133412 2890 2867 2624 2600 2582 2387 2351 2209 1388 662 630 559 13492 23032 2398 1343
NM_178126chr1731617 642 124 --12005 --
NM_178151chrX77217 6747 5126 5074 4883 2449 1594 1704 ----
NM_178152chrX77217 6747 5126 5074 4883 2449 1594 1704 ----
NM_178153chrX77217 6747 5126 5074 4883 2449 1594 1704 ----
NM_178441chr142430 420 ----11211
NM_178450chr51504 ------
NM_178470chrX21313 76 186 ----
NM_178498chr1153696 3689 3634 2685 658 --11257 --
NM_178505chr1033636 2583 958 33016 2900 1013 12412 --
NM_178539chr12----11512 --
NM_178544chr192474 295 1554 ----
NM_178566chr931818 1521 576 ------
NM_178582chr2031202 264 47 11280 11027 --
NM_178585chr42776 593 33075 3033 849 1883 --
NM_178586chr1412335 ------
NM_178812chr8------11073
NM_181050chr162172 130 ------
NM_181054chr143437 244 188 ------
NM_181349chr762447 1111 372 270 175 37 --22725 398 --
NM_181353chr202540 88 ------
NM_181358chr173702 3517 3415 3187 3077 416 33 22788 2731 ----
NM_181458chr21122 ------
NM_181481chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_181482chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_181483chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_181507chr112391 356 ------
NM_181508chr112391 356 ------
NM_181509chr20----1406 --
NM_181521chr1666513 6044 5981 5459 1665 150 16801 ----
NM_181689chr20------1757
NM_181705chr595004 4820 3827 2301 1850 1450 1406 671 474 21527 434 1758 --
NM_181706chr112959 828 --12123 --
NM_181782chr622146 1874 ------
NM_181784chr211059 ------
NM_181828chr2273495 3327 3124 2809 960 686 42 11498 11062 --
NM_181829chr2273495 3327 3124 2809 960 686 42 11498 11062 --
NM_181830chr2273495 3327 3124 2809 960 686 42 11498 11062 --
NM_181832chr2273510 3342 3139 2824 975 701 57 11513 11077 --
NM_181838chr511390 1555 ----
NM_181839chr831347 218 164 ------
NM_181844chr1731800 309 171 1196 ----
NM_181886chr41499 ----1289
NM_181887chr41499 ----1289
NM_181888chr41499 ----1289
NM_181889chr41499 ----1289
NM_181890chr41499 ----1289
NM_181891chr41499 ----1289
NM_181892chr41546 ----1336
NM_181893chr41499 ----1289
NM_182314chrX1561 ------
NM_182481chr211982 11310 21351 28 11127
NM_182482chr211982 11310 21351 28 11127
NM_182485chr441320 1182 978 51 ------
NM_182488chr131619 2905 611 ----
NM_182501chr242840 1271 1125 691 --22481 698 --
NM_182503chr655409 5227 4149 3955 3493 13502 1336 --
NM_182527chr226735 341 203 177 85 44 --21742 1524 --
NM_182557chr1162086 1840 1468 742 551 514 ------
NM_182641chr172668 132 1159 ----
NM_182646chr441320 1182 978 51 ------
NM_182678chr21356 ------
NM_182691chr7----11068 --
NM_182692chr7----11068 --
NM_182697chr731123 527 174 ----1266
NM_182734chr2042858 2531 771 282 12294 ----
NM_182830chr14--1636 --1256
NM_182848chr133626 606 192 ------
NM_182898chr725164 4197 11491 ----
NM_182899chr725164 4197 11491 ----
NM_182907chr62974 72 --31843 862 470 --
NM_182918chr2131269 494 302 ------
NM_182943chr3175 ------
NM_182948chr122865 355 1421 ----
NM_182970chr2073700 3542 940 623 252 228 211 ------
NM_182972chr142626 2560 2253 650 ------
NM_183004chr1483254 3039 2721 2651 1459 1232 952 145 ------
NM_183234chr1551802 1790 1368 571 35 11880 ----
NM_183235chr1551802 1790 1368 571 35 11880 ----
NM_183236chr1551802 1790 1368 571 35 11880 ----
NM_183237chr35971 748 282 189 44 ------
NM_183376chr1532381 1626 554 ------
NM_183393chr311027 ------
NM_183394chr311027 ------
NM_183397chr20115025 4918 4751 3861 1721 1652 1390 1202 767 252 94 24795 1801 34453 4054 1196 1413
NM_194247chr223438 3150 1853 ----
NM_194285chr1142715 2703 2134 1379 12795 1626 --
NM_194291chr82644 151 ----13042
NM_194328chr932605 752 84 12395 12568 --
NM_194329chr932605 752 84 12395 12568 --
NM_194330chr932605 752 84 12395 12568 --
NM_194332chr932605 752 84 12395 12568 --
NM_194463chrX21095 791 ------
NM_197939chr171194 1295 ----
NM_197941chr522535 131 1412 --1748
NM_197968chr131691 ------
NM_197978chr92454 26 ------
NM_198040chr12861 327 ------
NM_198066chr1442717 2701 2254 946 1548 ----
NM_198081chr622004 128 ----11058
NM_198097chr72204 55 --173 --
NM_198098chr751712 1646 1615 1243 673 2141 103 ----
NM_198123chr821714 1255 ------
NM_198124chr821714 1255 ------
NM_198158chr312725 ------
NM_198159chr312725 ------
NM_198177chr312725 ------
NM_198178chr312725 ------
NM_198217chr133836 390 197 ------
NM_198218chr133836 390 197 ------
NM_198219chr133836 390 197 ------
NM_198225chr1011946 ------
NM_198268chr173702 3517 3415 3187 3077 416 33 22788 2731 ----
NM_198269chr173702 3517 3415 3187 3077 416 33 22788 2731 ----
NM_198270chrX--23238 3056 --1515
NM_198273chr512620 --131 --
NM_198336chr731230 1152 507 --1457 --
NM_198353chr42417 84 ------
NM_198392chr63639 358 89 --1697 --
NM_198396chr172422 134 ------
NM_198468chr644515 1173 791 435 1583 ----
NM_198504chr3------1204
NM_198513chr821779 573 ------
NM_198549chr173064 2884 2851 1128 612 384 203 ------
NM_198562chr362129 2117 2092 663 374 76 1454 21480 362 --
NM_198581chr236615 5762 984 15344 ----
NM_198597chr102887 722 --1951 --
NM_198715chr125283 994 --14760 --
NM_198793chr32593 410 ------
NM_198859chr384671 3870 1918 1438 649 547 247 97 --11662 --
NM_198965chr121153 ------
NM_198966chr121153 ------
NM_198993chr1731368 137 59 11085 ----
NM_199044chr172937 2871 2565 2346 2192 654 617 22648 326 ----
NM_199050chr2143964 3395 3327 2870 11250 13286 --
NM_199131chr1042788 1143 1116 87 12888 ----
NM_199133chr531112 1081 259 ------
NM_199169chr2052953 2881 2681 763 112 11156 ----
NM_199170chr2052953 2881 2681 763 112 11156 ----
NM_199171chr2052953 2881 2681 763 112 11156 ----
NM_199185chr5----1254 --
NM_199188chr121509 --23555 59 --
NM_199190chr121509 --23555 59 --
NM_199262chr1731990 388 81 --12104 --
NM_199320chr42850 833 --22408 876 --
NM_199320chr42850 833 --22408 876 --
NM_199324chr413138 ------
NM_199359chr2031255 1226 147 ------
NM_199360chr2031255 1226 147 ------
NM_199361chr2031255 1226 147 ------
NM_199362chr2031255 1226 147 ------
NM_199363chr2031255 1226 147 ------
NM_199413chr153186 110 30 ------
NM_199421chr1423766 1150 23260 652 23202 712 13270
NM_199426chr20--1258 ----
NM_199436chr21220 12197 ----
NM_199461chr1043180 2910 2257 623 12330 ----
NM_199482chr21783 ------
NM_199483chr201247 ------
NM_201253chr11418 ----1448
NM_201266chr232604 2028 1050 12467 --22766 213
NM_201269chr111183 11312 ----
NM_201279chr232604 2028 1050 12467 --22766 213
NM_201280chr641092 660 556 380 11172 ----
NM_201348chr154324 3909 1369 1066 625 22890 367 ----
NM_201403chr131740 55 25 ----1338
NM_201432chr1744724 2625 1900 290 --11145 --
NM_201433chr1744724 2625 1900 290 --11145 --
NM_201520chr1731290 523 454 --21486 1127 --
NM_201591chr41722 --1523 --
NM_201592chr41722 --1523 --
NM_201599chrX----152 1957
NM_201628chr173348 3295 3248 3012 2622 1109 1095 --1669 --
NM_203282chr1921797 1505 ----1250
NM_203301chr1411254 1273 ----
NM_203305chr952034 1022 763 434 379 ------
NM_203327chr20134341 3705 3675 3191 1600 785 691 581 559 243 237 27 21 --23613 1577 1752
NM_203349chr1531930 1604 214 ------
NM_203350chr1181 1327 ----
NM_203382chr521574 37 ------
NM_203391chrX1151 ------
NM_203394chr1232637 2321 2141 ------
NM_203406chr511949 ------
NM_203446chr2132544 2261 434 ------
NM_203458chr111222 --13598 --
NM_203464chr11197 --21249 35 --
NM_203487chr13--11293 ----
NM_203494chr151189 ------
NM_205768chr1----11902 --
NM_205846chr521252 75 11330 ----
NM_205860chr142593 2298 2200 850 --1527 12329
NM_206539chr6161 ------
NM_206594chr1--12531 ----
NM_206595chr1--12531 ----
NM_206809chr63838 826 774 2916 265 ----
NM_206839chr151524 ------
NM_206853chr664037 4019 3740 3260 2981 363 --1761 --
NM_206854chr685298 5280 5001 4521 4242 3360 1624 545 --12022 --
NM_206855chr686263 6245 5966 5486 5207 4325 1510 650 ------
NM_206866chr2142358 1270 674 380 12219 ----
NM_206876chr222195 1069 13125 ----
NM_206907chr532207 555 269 ------
NM_206909chr888021 7741 5616 3274 2924 2890 2120 30 17456 ----
NM_207005chr13511 485 434 ------
NM_207012chr1033346 2252 1325 13089 12997 --
NM_207043chr142205 2120 1732 1523 --12296 --
NM_207044chr142205 2120 1732 1523 --12296 --
NM_207047chr142205 2120 1732 1523 --12296 --
NM_207122chr11--11061 ----
NM_207171chr161965 1810 1661 679 550 225 ----1421
NM_207299chr92881 190 ------
NM_207321chr1021064 1051 ------
NM_207396chr141628 1195 600 296 1388 ----
NM_207406chr425104 2164 11095 25089 1580 --
NM_207412chr841364 605 275 96 ------
NM_207481chr211317 ------
NM_207577chr1132873 2739 564 ----11121
NM_212460chr721566 193 ------
NM_212471chr1721556 684 12190 2402 96 --
NM_212472chr1721556 684 12190 2402 96 --
NM_213593chr12993 904 ------
NM_213606chr10--21862 240 ----
NM_213609chr31118 ------
NM_213651chr11138 ------
NM_213662chr1752372 2239 1835 1761 700 1774 1364 --