TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4703-3p
miRNA Sequence: UGUAGUUGUAUUGUAUUGCCAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1449 --
NM_000027chr41765 ------
NM_000037chr812408 ------
NM_000038chr531615 1334 682 2606 43 148 --
NM_000052chrX62970 965 937 678 289 273 ------
NM_000061chrX1421 ------
NM_000084chrX106689 6403 6194 6093 4570 4265 2638 2141 900 330 55653 4750 4241 1387 1024 22652 1449 16309
NM_000089chr71629 ------
NM_000091chr232747 2524 24 --22215 232 --
NM_000092chr244139 3421 1603 763 1321 23987 377 --
NM_000093chr912227 ------
NM_000104chr262852 1246 1003 340 130 103 12969 --12111
NM_000109chrX32093 797 614 32102 875 305 ----
NM_000110chr15926 826 445 305 186 ------
NM_000112chr544969 4750 479 296 34524 4291 1231 ----
NM_000115chr1372694 2667 2149 1047 470 427 94 12044 12563 1154
NM_000125chr663602 3381 3069 2912 1584 334 --11145 13672
NM_000126chr152266 200 1104 ----
NM_000127chr81319 --1107 --
NM_000138chr1551740 1731 342 220 167 32117 488 59 --12550
NM_000152chr171521 ------
NM_000153chr1431699 1094 608 11153 ----
NM_000163chr5126 32120 1642 478 --1640
NM_000165chr631627 1597 1444 11460 --11570
NM_000176chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_000189chr252381 2367 2354 1693 1545 ------
NM_000210chr262078 2045 1526 407 225 178 1300 ----
NM_000211chr21199 ------
NM_000212chr1762477 1648 628 587 502 489 --12298 --
NM_000216chrX43864 3340 449 95 1297 23219 888 --
NM_000217chr1285360 4791 4271 3281 1015 537 441 210 21196 544 --1743
NM_000237chr81668 --11187 --
NM_000242chr1012046 11859 ----
NM_000245chr732237 1791 137 32034 1722 636 ----
NM_000248chr332089 540 34 11121 --21919 195
NM_000252chrX11226 1172 ----
NM_000259chr1576144 5969 4612 2289 961 476 228 26300 1715 11211 --
NM_000264chr922406 71 12769 --12594
NM_000267chr1742401 2333 905 712 2843 662 --1253
NM_000278chr1011488 ----11423
NM_000280chr111885 ----1939
NM_000286chr171922 1109 ----
NM_000297chr441804 1759 541 487 11903 ----
NM_000310chr151266 1180 320 212 108 ------
NM_000314chr104696 571 365 256 --12038 --
NM_000318chr872625 1136 886 874 840 393 266 ------
NM_000321chr1351775 1379 1311 543 340 11176 ----
NM_000332chr686524 6024 5930 5338 4426 2457 2082 933 35362 4721 1260 21841 711 --
NM_000337chr576124 5160 4504 4351 794 675 71 24188 2200 11295 --
NM_000340chr341379 1302 1186 337 ------
NM_000346chr1741650 766 543 537 ------
NM_000362chr2263173 3054 2630 1286 329 170 22738 607 ----
NM_000368chr953207 3121 3050 1575 408 34751 4155 869 11693 --
NM_000378chr1161264 1156 1113 228 155 54 ------
NM_000393chr221752 484 22032 552 --12113
NM_000408chr221348 1301 ----13466
NM_000428chr1442366 2215 1974 399 --126 --
NM_000439chr52977 353 12290 ----
NM_000448chr1132400 2176 2033 32988 740 262 ----
NM_000449chr131289 1087 372 ------
NM_000452chr1331286 851 36 156 ----
NM_000459chr91300 ------
NM_000461chr344531 1642 1452 180 ----11025
NM_000462chr1541784 1367 1146 403 21163 658 1559 1212
NM_000474chr71104 1445 ----
NM_000484chr211358 1899 1759 --
NM_000489chrX42606 1188 745 87 1831 ----
NM_000492chr7--11194 1530 1506
NM_000495chrX1326 ------
NM_000516chr20142 ------
NM_000523chr221061 369 ------
NM_000527chr1912485 --11771 11895
NM_000555chrX117807 6638 6361 6226 6021 2864 2842 1857 1763 1464 205 ------
NM_000601chr72315 39 --1108 --
NM_000602chr72408 369 --11307 11187
NM_000610chr113562 345 215 22391 305 ----
NM_000612chr1133436 3216 277 ----1884
NM_000617chr1252266 1914 679 637 493 1383 ----
NM_000618chr1286509 6247 5807 5753 2085 1713 1526 854 36609 4537 2546 15657 --
NM_000618chr1286509 6247 5807 5753 2085 1713 1526 854 36609 4537 2546 15657 --
NM_000633chr1854315 3693 727 199 168 21609 1475 11968 --
NM_000684chr1011287 1959 ----
NM_000686chrX1134 1565 11537 11041
NM_000724chr1021811 52 1686 12028 11649
NM_000726chr21428 1156 --1902
NM_000788chr431403 1170 1048 31290 1279 283 ----
NM_000789chr171236 ------
NM_000793chr1495052 4864 4724 4210 3167 971 836 369 352 ------
NM_000801chr201314 1225 ----
NM_000806chr52476 317 --11380 --
NM_000807chr45734 641 538 530 82 1178 ----
NM_000814chr1563782 3315 2688 1628 1111 268 22574 1551 11235 --
NM_000826chr452377 874 811 633 381 1890 12163 2498 51
NM_000833chr162992 246 1252 ----
NM_000855chr11--1259 ----
NM_000859chr5--1616 11686 --
NM_000875chr1576522 6229 6019 5557 4503 2474 123 26376 5428 14567 --
NM_000891chr1743478 3344 703 522 1398 ----
NM_000899chr1263978 3926 3780 2862 1534 882 54374 4026 3611 3455 398 --13940
NM_000901chr431903 1768 320 11617 ----
NM_000902chr342015 1154 783 434 1769 ----
NM_000910chr441974 1898 1886 1337 1710 --1543
NM_000935chr331166 473 422 ------
NM_000944chr412108 22328 187 22402 1976 --
NM_000945chr251502 793 653 517 153 2754 594 11767 --
NM_000949chr52847 233 ------
NM_000950chrX43590 2732 1050 596 22662 533 ----
NM_000961chr2063374 2708 2634 1414 1185 847 22921 2465 ----
NM_000990chr1153725 2994 2934 590 35 43792 2595 1294 1095 22600 1483 --
NM_001001132chr2141450 1066 1039 516 1238 ----
NM_001001323chr1243084 2487 2396 1088 11241 --11172
NM_001001330chr1021207 182 ----1885
NM_001001344chrX32452 704 119 1371 ----
NM_001001389chr113562 345 215 22391 305 ----
NM_001001390chr113562 345 215 22391 305 ----
NM_001001391chr113562 345 215 22391 305 ----
NM_001001392chr113608 391 261 22437 351 ----
NM_001001395chr1262527 2468 2358 1952 901 438 --12260 --
NM_001001396chr134104 2871 1027 14358 ----
NM_001001419chr544319 3918 3769 23 34847 4236 508 21463 784 14447
NM_001001420chr544319 3918 3769 23 34847 4236 508 21463 784 14447
NM_001001481chr873129 2514 1363 1284 503 190 119 13329 ----
NM_001001484chr1031946 168 159 --1526 --
NM_001001556chr1531271 350 29 ------
NM_001001664chr293602 3190 1571 1306 1295 1125 963 824 669 12577 ----
NM_001001711chr1171028 845 399 145 126 107 54 11063 ----
NM_001001852chr221928 ------
NM_001001890chr2143706 3680 1670 735 22659 1169 --1714
NM_001001928chr2288363 8155 8008 7128 6266 2989 1672 959 26050 1906 22108 757 16398
NM_001001974chr1042244 2090 832 646 12398 --11826
NM_001002233chr842103 1710 735 175 11414 ----
NM_001002258chr251921 1603 648 641 39 21698 237 ----
NM_001002814chr863803 3776 3658 2947 735 175 23232 1414 11179 --
NM_001002838chrX31666 1646 377 41561 1365 1191 723 ----
NM_001002860chr1473577 3346 3251 1791 1763 1735 222 21872 1808 11002 --
NM_001002909chr1731966 1758 1615 ------
NM_001003407chr1074222 4065 3332 1925 1316 101 23 --14230 --
NM_001003408chr1074222 4065 3332 1925 1316 101 23 --14230 --
NM_001003652chr1898211 7862 7821 6568 6473 5424 997 687 134 36739 3108 2723 --11818
NM_001003674chr1856780 5880 4845 2687 1542 12619 ----
NM_001003675chr1856780 5880 4845 2687 1542 12619 ----
NM_001003688chr44469 240 125 32 ------
NM_001003698chr61228 21320 732 ----
NM_001003699chr61228 21320 732 ----
NM_001003712chr122716 532 22832 450 ----
NM_001003800chr953151 2576 850 50 29 12320 ----
NM_001003805chr14--182 ----
NM_001003895chrY138 ------
NM_001003945chr921919 569 11598 ----
NM_001004019chr31453 1414 ----
NM_001004023chr11171 ------
NM_001004065chr963672 3649 3366 2672 985 66 23004 802 1821 21516 1229
NM_001004317chr684514 4486 4180 4150 4095 3094 533 107 1161 --12772
NM_001004354chr911061 --168 --
NM_001004419chr1293952 3752 3719 3323 1779 1357 798 633 96 23492 754 ----
NM_001005353chr141052 984 794 489 1928 ----
NM_001005353chr141052 984 794 489 1928 ----
NM_001005386chr242222 1522 634 479 1868 1199 --
NM_001005473chr5106665 6299 6055 4938 4230 2642 2568 1880 1615 651 11176 ----
NM_001005474chr31267 ------
NM_001005476chr22579 216 ------
NM_001005609chrX--13775 12425 --
NM_001005746chr21428 1156 --1902
NM_001005747chr21428 1156 --1902
NM_001005753chr242277 2142 1635 91 ------
NM_001005781chr21180 ------
NM_001005782chr21231 ------
NM_001005845chr831233 107 95 --21721 484 --
NM_001005849chr174527 212 101 65 175 ----
NM_001005910chr31230 2667 626 ----
NM_001005911chr31230 2667 626 ----
NM_001006600chr542171 609 439 412 --12144 --
NM_001006623chr242286 212 181 125 194 ----
NM_001006684chrX2622 584 ------
NM_001007023chr1495052 4864 4724 4210 3167 971 836 369 352 ------
NM_001007024chr1723567 2963 12682 13889 12812
NM_001007025chr1723567 2963 12682 13889 12812
NM_001007033chr122781 34 ------
NM_001007075chr4--11049 ----
NM_001007097chr964706 3910 1988 1546 833 226 1968 ----
NM_001007102chr62650 553 11685 ----
NM_001007226chr1741431 1384 1085 923 ------
NM_001007227chr1741431 1384 1085 923 ------
NM_001007228chr1741431 1384 1085 923 ------
NM_001007229chr1741431 1384 1085 923 ------
NM_001007230chr1741431 1384 1085 923 ------
NM_001007237chr152836 2780 2583 2242 415 12636 ----
NM_001007466chr645198 4292 1661 1459 21214 756 13268 --
NM_001007467chr222124 114 ------
NM_001007792chr11192 ------
NM_001008215chr22330 323 11090 ----
NM_001008239chr1863836 3444 3104 3030 1436 955 12539 12421 --
NM_001008408chr7106276 5641 5078 4840 4411 4352 4090 1268 1118 1063 26393 2441 14318 --
NM_001008495chr811714 ------
NM_001008539chr885353 4776 4590 4101 3709 3388 1627 1004 11362 ----
NM_001008541chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_001008541chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_001008564chr1332033 1575 1437 22046 1520 1674 12058
NM_001008660chr11282 24 11153 11573 --
NM_001008895chr1321121 1040 11468 ----
NM_001008925chr463416 2817 2354 2156 759 691 1545 1976 --
NM_001008938chr111443 1483 ----
NM_001009552chr81520 ------
NM_001009554chr423373 1539 11044 ----
NM_001009554chr423373 1539 11044 ----
NM_001009555chr43702 410 48 11379 --11157
NM_001009814chr13189 ------
NM_001009881chr1--2528 232 ----
NM_001009882chr1--2528 232 ----
NM_001009894chr1221712 1167 11608 ----
NM_001009899chr376109 5939 5757 5535 2425 1932 698 45063 4178 2247 1465 --1204
NM_001009909chr1193880 3003 2828 654 579 530 430 341 163 21101 392 --13592
NM_001009958chr72452 76 1629 ----
NM_001009959chr252620 2597 2100 2023 1998 12339 ----
NM_001010000chr1853189 2802 920 182 152 1972 23394 2775 1878
NM_001010853chr663153 3108 3029 2790 669 154 12356 ----
NM_001010854chr14----1536 --
NM_001010861chr131021 523 323 1914 ----
NM_001010867chr146169 5299 4705 1410 45275 5065 2442 2118 14533 12202
NM_001010888chrX84664 4569 4155 2973 1132 964 573 79 2940 912 13119 --
NM_001010891chr595713 5242 2659 2291 2066 1449 1186 1003 268 --16734 --
NM_001010895chr911700 1195 ----
NM_001010922chr154034 3874 3289 3229 391 33725 1236 621 13351 --
NM_001010927chr62504 212 ------
NM_001010932chr72315 39 --1108 --
NM_001010934chr72888 406 ----1118
NM_001010942chr1251277 1038 533 427 146 --11160 --
NM_001010986chrX1464 ----21891 27
NM_001011537chr332066 1788 895 1573 ----
NM_001011546chr202704 130 1272 ----
NM_001011666chr7116505 5626 5620 5245 5021 4374 4154 2039 1562 1202 195 ------
NM_001011713chr1421478 558 --125 --
NM_001011885chr1541601 670 603 564 11748 ----
NM_001012393chr1184927 4324 3729 3467 1631 1530 1483 869 1428 --11560
NM_001012398chr1631120 992 735 1815 ----
NM_001012419chr9--21077 853 ----
NM_001012420chr1542690 2673 856 323 --12088 --
NM_001012421chr92762 689 1853 ----
NM_001012423chr1532690 2673 323 --12088 --
NM_001012514chr221099 410 ------
NM_001012516chr221099 410 ------
NM_001012751chr1011567 21918 1394 ----
NM_001013031chr10103542 3514 3196 3160 3111 2367 2247 847 390 355 13520 --1716
NM_001013406chr741568 475 382 255 11286 ----
NM_001013415chr451281 1238 504 389 294 1410 ----
NM_001013438chr32860 41 2903 72 ----
NM_001013620chr12128422 7219 7072 6979 6763 5526 5418 5185 2331 1251 364 66 35424 2421 121 33294 2128 426 --
NM_001013839chr1732394 2308 713 ------
NM_001014342chr141785 1336 396 43 11519 ----
NM_001014380chr1395368 4800 4559 4359 3815 1756 1108 575 136 25056 1250 11908 --
NM_001014797chr10168082 6586 6214 5972 5884 5854 5815 5653 5091 1959 1468 1375 1337 863 548 151 17780 21767 1411 --
NM_001014812chr15----1408 --
NM_001015877chrX52695 2039 597 134 51 12260 ----
NM_001017368chr1762126 2058 1896 890 720 464 11881 12082 --
NM_001017369chr42965 140 ------
NM_001017371chr22904 539 11267 ----
NM_001017415chr14755 748 152 99 ------
NM_001017416chr14755 748 152 99 ------
NM_001017440chr7118165 7730 7026 5155 5053 3064 2016 1469 1190 1099 156 11507 16170 15679
NM_001017923chr1451660 1239 616 607 586 ----1105
NM_001017926chr821719 173 21364 721 ----
NM_001017969chr91540 ------
NM_001017999chr142224 1726 936 446 ------
NM_001017999chr142224 1726 936 446 ------
NM_001018000chr142224 1726 936 446 ------
NM_001018000chr142224 1726 936 446 ------
NM_001018001chr142224 1726 936 446 ------
NM_001018009chr32275 113 11177 ----
NM_001018025chrX2583 124 1178 --2790 547
NM_001018038chr93620 251 67 ------
NM_001018064chr971952 1736 1298 812 748 415 74 ----12050
NM_001018065chr9104946 4872 4692 4450 3687 2315 990 959 869 317 41831 1706 1215 230 ----
NM_001018066chr9104946 4872 4692 4450 3687 2315 990 959 869 317 41831 1706 1215 230 ----
NM_001018067chr174124 3287 1775 805 725 466 82 1521 15017 1399
NM_001018068chr174124 3287 1775 805 725 466 82 1521 15017 1399
NM_001018069chr174124 3287 1775 805 725 466 82 1521 15017 1399
NM_001018074chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_001018075chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_001018076chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_001018077chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_001018090chr1552758 2298 1856 400 61 11888 ----
NM_001018091chr1552868 2408 1966 510 171 11998 ----
NM_001018102chr1552758 2298 1856 400 61 11888 ----
NM_001020825chr52442 91 11013 --1110
NM_001024094chr582967 2616 2403 987 916 618 550 64 33538 3166 1274 11221 12635
NM_001024218chr14178 1131 1341 --
NM_001024372chr841636 876 257 105 2415 341 --11775
NM_001024647chr1297711 7643 7384 6879 5818 2501 2393 907 834 57024 5679 2359 1896 359 47353 7281 5302 2893 --
NM_001024649chr532402 2342 479 ------
NM_001024660chr321297 617 11604 1421 --
NM_001024680chr23523 397 130 --11724 --
NM_001024808chr122105 53 ------
NM_001024924chr43379 167 77 ------
NM_001024947chr541123 1078 319 80 ------
NM_001024948chr153243 2981 2674 1006 383 43062 2991 2472 452 ----
NM_001025076chr1054324 4205 1565 725 457 26069 4111 ----
NM_001025077chr1065682 5563 4789 2923 2083 1815 47427 5469 4624 719 ----
NM_001025079chr363753 3336 3329 991 363 261 ------
NM_001025105chr52954 276 1354 11144 --
NM_001025266chr394915 4804 3448 3249 2982 1934 1495 1383 171 ------
NM_001025356chr1242875 1025 490 151 1879 1114 --
NM_001025366chr6----11330 --
NM_001025366chr6----11330 --
NM_001025367chr6----11330 --
NM_001025367chr6----11330 --
NM_001025368chr6----11330 --
NM_001025368chr6----11330 --
NM_001025369chr6----11346 --
NM_001025369chr6----11346 --
NM_001025370chr6----11330 --
NM_001025370chr6----11330 --
NM_001025580chrX104155 4106 4011 3940 3854 3801 3014 1131 796 147 11609 ----
NM_001025595chr431608 1413 463 ------
NM_001025603chr131289 1087 372 ------
NM_001025780chr92384 160 21180 48 ----
NM_001029858chr693188 3170 2141 1353 993 865 605 370 23 11329 ----
NM_001029875chr532329 2244 689 12850 12370 12050
NM_001029989chr15163 1263 1875 --
NM_001030006chr1732067 1725 125 1726 ----
NM_001030055chr1484688 3510 3025 1891 1780 1485 1199 458 1117 ----
NM_001031695chr2254317 3384 3313 1965 404 --12012 --
NM_001031712chr62338 274 1125 ----
NM_001031804chr1674435 3670 3161 2947 1383 1177 22 1928 14016 14226
NM_001032293chr171135 ------
NM_001032380chr1011434 1587 11931 --
NM_001032394chr642803 2084 1040 559 32485 234 196 ----
NM_001032395chr652670 1951 1091 907 426 32352 101 63 ----
NM_001033025chr131193 999 34 ----11024
NM_001033030chr3144 1181 ----
NM_001033031chr3144 1181 ----
NM_001033032chr3144 1181 ----
NM_001033045chr274398 4275 4115 3615 1571 975 920 1857 44025 3225 1383 517 --
NM_001033047chr432653 1976 604 22475 903 ----
NM_001033049chr211349 ----12291
NM_001033087chr2063255 3148 2804 2707 2549 764 22399 982 ----
NM_001033506chr111298 ------
NM_001033557chr22972 498 11385 1587 --
NM_001033578chr851708 424 365 127 93 11893 1763 --
NM_001033723chr852652 1762 784 232 226 22446 413 ----
NM_001033756chr6----11264 --
NM_001033756chr6----11264 --
NM_001033925chr1052121 2114 2033 1657 1329 2808 264 ----
NM_001034194chr4132 ------
NM_001034841chr1654239 4142 867 804 492 11938 24000 429 --
NM_001034850chr531370 396 306 --11190 --
NM_001034954chr1053235 3112 2578 2309 482 13139 ----
NM_001034955chr1053235 3112 2578 2309 482 13139 ----
NM_001034956chr1053235 3112 2578 2309 482 13139 ----
NM_001034957chr1053235 3112 2578 2309 482 13139 ----
NM_001035chr141339 1332 1223 319 ------
NM_001035003chr461274 1111 984 505 69 43 --11074 --
NM_001035004chr461274 1111 984 505 69 43 --11074 --
NM_001035005chr182527 483 ------
NM_001037126chr71102 ------
NM_001037132chr722241 605 12023 ----
NM_001037133chr722241 605 12023 ----
NM_001037164chr741883 1710 1612 1600 ------
NM_001037172chr321267 518 11275 ----
NM_001037174chr251799 1747 1497 912 861 --1820 --
NM_001037317chr131021 523 323 1914 ----
NM_001037332chr542575 1712 1631 86 ----1271
NM_001037333chr542575 1712 1631 86 ----1271
NM_001037339chr131604 1478 53 11716 ----
NM_001037340chr131604 1478 53 11716 ----
NM_001037341chr131604 1478 53 11716 ----
NM_001037341chr131604 1478 53 11716 ----
NM_001037494chr121180 ------
NM_001037495chr121180 ------
NM_001037535chrX4346 246 187 146 1624 11405 --
NM_001037536chrX4346 246 187 146 1624 11405 --
NM_001037540chrX4346 246 187 146 1624 11405 --
NM_001037553chr2165103 4236 3871 3237 96 88 ------
NM_001037631chr23779 188 115 ------
NM_001037954chr1143522 3476 3194 1371 --22835 1156 --
NM_001038702chr512018 32126 2058 938 ----
NM_001039111chr32467 444 ------
NM_001039348chr23994 897 417 ----1137
NM_001039349chr23994 897 417 ----1137
NM_001039538chr283249 2992 2396 710 584 518 396 237 11275 --13206
NM_001039547chr377848 7180 4934 3041 2527 1690 1371 28043 7722 37543 7282 2220 --
NM_001039573chr171527 ------
NM_001039590chrX53402 3133 2886 1220 99 23894 322 13806 --
NM_001039591chrX53402 3133 2886 1220 99 23894 322 13806 --
NM_001039618chr1185802 5668 4449 4399 2367 1960 1600 584 65275 5178 3842 3757 3626 2200 ----
NM_001039762chr1032193 1917 350 --11976 --
NM_001039840chrX135742 5029 3706 2355 2134 1882 1320 1294 1099 979 902 699 479 --12315 11373
NM_001039937chr1354001 3757 3726 3463 3019 23629 670 ----
NM_001040001chr631909 1711 438 11883 ----
NM_001040057chr72919 61 172 ----
NM_001040135chr71680 ------
NM_001040142chr232398 2333 372 ------
NM_001040143chr232398 2333 372 ------
NM_001040151chr1164487 3696 3134 899 877 303 ------
NM_001040152chr754920 3382 3349 1414 736 24805 796 ----
NM_001040159chr431206 320 143 11280 ----
NM_001040202chr442471 2125 193 171 22541 2368 ----
NM_001040214chr642119 1922 1575 92 11710 12081 --
NM_001040272chr921860 1840 ------
NM_001040284chr16125860 5797 4824 4685 4566 4324 3971 3599 2034 1182 1127 872 --1121 2912 170
NM_001040402chr472964 2887 2323 2241 2230 2050 382 2907 670 ----
NM_001040429chr1322216 303 42456 2270 1343 517 12891 --
NM_001040441chr164289 3378 1516 621 412 243 11969 35176 1799 945 --
NM_001040446chr552039 2026 1781 420 186 12319 ----
NM_001040665chr7114880 4786 4705 4573 3520 3435 3311 1714 757 248 129 14920 21852 1784 --
NM_001040666chr73582 488 275 1622 ----
NM_001040712chr933086 2544 1334 --23461 113 --
NM_001042355chr1653673 3364 1707 758 733 35415 4156 1385 25023 1312 11787
NM_001042403chr1261003 967 929 650 177 167 ------
NM_001042404chr161878 1583 1485 1246 619 181 21531 1357 --1103
NM_001042412chr1653673 3364 1707 758 733 35415 4156 1385 25023 1312 11787
NM_001042413chr953108 2818 1529 1370 718 43556 3006 2899 2542 1391 --
NM_001042453chrX21461 144 ----11536
NM_001042475chr62257 201 ------
NM_001042492chr1742401 2333 905 712 2843 662 --1253
NM_001042494chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_001042495chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_001042496chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_001042497chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_001042533chr393286 3110 2846 2599 2529 2304 865 372 193 11248 ----
NM_001042537chrX22154 1954 2617 175 11826 --
NM_001042550chr941813 198 178 69 1326 ----
NM_001042555chr1264417 3896 3369 1616 1154 143 23421 388 --11243
NM_001042573chr1742222 2076 2046 395 1472 ----
NM_001042599chr2117765 7750 6696 5698 5690 5496 1534 1171 982 616 255 16516 16565 --
NM_001042601chr382587 2245 2106 2058 1310 454 183 49 11025 11057 1686
NM_001042603chr1283609 2115 1832 1527 1170 1019 500 393 14544 ----
NM_001042604chr394704 3581 3497 3105 3055 1393 660 349 219 2671 410 34572 4434 3985 14166
NM_001042681chr12578 139 22677 2326 21738 633 --
NM_001042682chr12578 139 22677 2326 21738 633 --
NM_001042682chr12578 139 22677 2326 21738 633 --
NM_001042749chrX61778 1669 1662 1541 1305 661 1210 ----
NM_001042750chrX61778 1669 1662 1541 1305 661 1210 ----
NM_001042751chrX61778 1669 1662 1541 1305 661 1210 ----
NM_001042784chr4143 ------
NM_001043351chr131950 1882 293 11842 1722 --
NM_001044385chr273906 3624 3370 2921 1035 595 287 1925 ----
NM_001045556chr82488 480 --152 --
NM_001045557chr82488 480 --152 --
NM_001049chr1412474 ----11968
NM_001069chr6--1148 ----
NM_001071775chr133621 182 88 ------
NM_001079874chr11640 ----11964
NM_001083620chr452375 873 810 632 380 1889 12161 2497 51
NM_001083621chr121610 1120 14082 --11554
NM_001100108chr1148264 8138 7270 6502 5811 3280 2860 2830 2667 2268 2131 1929 1776 996 35898 537 244 36217 5579 5389 --
NM_001106chr379762 8577 7970 6577 6516 2572 1659 29513 677 28873 7244 --
NM_001113490chrX63604 3198 3124 2644 2229 1020 13221 21168 586 --
NM_001117chr1842471 2419 594 209 ------
NM_001121chr1061788 1705 1575 1266 284 270 21476 612 1213 --
NM_001122679chr5----1449 --
NM_001123chr102524 235 --1284 --
NM_001124chr112550 447 ------
NM_001126chr141010 970 384 308 ------
NM_001143chrY1114 ------
NM_001146chr872151 1956 1662 313 289 265 219 ------
NM_001148chr411682 2615 338 ----
NM_001149chr102393 248 ------
NM_001151chr41245 ------
NM_001152chrX----1107 --
NM_001153chr21106 ------
NM_001167chrX86442 5187 4937 4846 4747 2013 1178 955 35613 2700 1989 56179 5136 4884 4387 4186 --
NM_001173chr1484688 3510 3025 1891 1780 1485 1199 458 1117 ----
NM_001177chr1212345 41875 800 97 36 --22082 1591
NM_001186chr2123000 2804 42699 2280 587 315 22004 488 --
NM_001198chr622365 1971 --12157 --
NM_001201chr443407 3048 2402 758 12675 ----
NM_001202chr141250 ------
NM_001204chr2147318 7006 6538 6514 6388 6185 5610 2832 2693 2633 1074 740 150 83 26201 978 24990 663 --
NM_001206chr933018 2569 2543 --12580 12896
NM_001233chr762282 2142 1901 1700 423 112 1513 ----
NM_001241chr231520 554 353 22084 44 11726 --
NM_001241chr231520 554 353 22084 44 11726 --
NM_001256chr172526 27 12643 12410 --
NM_001259chr744171 1964 1164 1031 11411 ----
NM_001263chr41137 ------
NM_001271chr1513241 22381 932 22402 655 --
NM_001282chr1732067 1725 125 1726 ----
NM_001289chrX31648 1576 563 ------
NM_001304chr1743504 1222 615 298 148 ----
NM_001310chr1232581 1189 919 53088 2811 2173 2079 710 ----
NM_001316chr201431 ------
NM_001329chr1021327 1265 2569 145 ----
NM_001331chr1152544 2440 905 269 247 12314 22557 105 --
NM_001332chr521361 1036 --21416 1332 --
NM_001364chr1173685 3142 1481 1436 1430 1407 435 ------
NM_001369chr52478 112 11353 ----
NM_001387chr523224 3215 ------
NM_001390chr1853602 3411 2517 898 219 --12256 22755 308
NM_001391chr1851202 975 473 192 161 ------
NM_001396chr2132784 2721 339 22103 1088 --1679
NM_001399chrX--13775 12425 --
NM_001400chr131264 1175 511 ------
NM_001401chr951493 1479 1194 481 296 1289 ----
NM_001402chr621990 632 11454 ----
NM_001412chrX83755 3747 3674 3566 2925 2742 2611 2430 31039 861 253 ----
NM_001423chr1241877 1708 1440 814 ------
NM_001430chr22325 78 --11630 11559
NM_001438chr153378 3240 2810 2348 874 12949 1973 12718
NM_001439chr131193 999 34 ----11024
NM_001440chr8----1331 --
NM_001448chrX41674 1575 694 341 2717 254 11424 --
NM_001453chr641380 1352 702 97 ------
NM_001455chr654594 4353 3026 1929 833 1575 13784 --
NM_001465chr561709 1624 812 748 259 134 1206 ----
NM_001490chr942530 1423 445 371 ------
NM_001527chr684654 4492 3926 3815 3723 3059 853 463 23330 1111 23504 873 --
NM_001542chr152836 2780 2583 2242 415 12636 ----
NM_001560chrX198 1638 1682 1918
NM_001568chr8134 ------
NM_001584chr114963 782 387 46 ----1820
NM_001604chr111885 ----1939
NM_001616chr262599 2345 2291 1392 369 68 ----12997
NM_001620chr111782 1179 ----
NM_001621chr752669 2141 1162 385 129 2995 193 ----
NM_001621chr752669 2141 1162 385 129 2995 193 ----
NM_001624chr651883 1684 1466 1456 1317 ----11427
NM_001650chr1863897 3689 3344 2688 1279 505 ------
NM_001656chr51665 2568 497 ----
NM_001660chr32581 141 ------
NM_001663chr1441944 1835 1032 512 22783 2630 ----
NM_001664chr33846 341 330 --21038 153 --
NM_001678chr1721848 1387 ------
NM_001682chr1242798 2201 2110 802 1955 --1886
NM_001684chr133821 2588 744 14075 ----
NM_001689chr251921 1603 648 641 39 21698 237 ----
NM_001690chr362436 881 781 529 343 21 22366 587 ----
NM_001701chr951530 1134 1080 605 551 11601 ----
NM_001713chr531148 1060 974 1144 ----
NM_001717chr1541443 1366 1251 452 ------
NM_001721chrX2354 305 ------
NM_001723chr61696 1177 ----
NM_001730chr132110 60 11082 ----
NM_001730chr132110 60 11082 ----
NM_001743chr2--1602 ----
NM_001746chr532402 2342 479 ------
NM_001753chr721533 576 --21778 366 --
NM_001754chr2143706 3680 1670 735 22659 1169 --1714
NM_001755chr1662244 2129 558 330 324 197 22191 1740 ----
NM_001777chr363753 3336 3329 991 363 261 ------
NM_001798chr121923 ------
NM_001821chr184171 4007 3792 3090 688 507 386 359 74281 3725 3583 3434 3371 2986 1745 13265 --
NM_001830chrX73864 3709 3701 3625 2903 2890 709 ------
NM_001845chr1331291 1225 143 1497 ----
NM_001854chr131396 984 603 ------
NM_001858chr6104700 4686 3940 3738 3682 3482 3248 1621 1156 494 13834 34956 4387 648 --
NM_001859chr933906 3892 465 --23731 679 --
NM_001882chr52480 79 ------
NM_001890chr41312 1365 ----
NM_001892chr52954 276 1354 11144 --
NM_001895chr201236 11142 ----
NM_001903chr52909 576 2843 718 ----
NM_001904chr32929 864 ------
NM_001918chr1169124 9058 8282 7887 7451 7353 6941 6824 6415 5873 2920 2550 1754 1107 893 760 26327 2808 58603 6817 1960 1790 463 --
NM_001938chr12374 187 1658 ----
NM_001945chr5----1565 --
NM_001949chr633069 2720 548 2474 124 ----
NM_001968chr42802 292 4792 687 303 228 ----
NM_001969chr1483696 3653 3404 2945 2829 2386 858 811 23302 907 ----
NM_001981chr162435 1833 1512 622 81 59 ------
NM_001987chr1222663 178 24322 2943 --14035
NM_001992chr522017 379 --21861 169 --
NM_001998chr31453 1414 ----
NM_001999chr521410 434 ------
NM_002006chr465614 5207 4721 1891 1337 512 1869 --35287 3913 1832
NM_002009chr1572820 1849 1798 558 468 224 122 12181 ----
NM_002015chr1322947 1151 --12867 12261
NM_002024chrX52075 1666 866 832 227 11471 ----
NM_002025chrX139027 8930 8862 8474 6669 3629 3609 3109 2631 2514 1530 1396 1082 59275 9087 8228 7145 1189 11194 37326 6443 3691
NM_002039chr4--2706 635 ----
NM_002040chr2193219 3096 2020 1189 975 864 528 452 370 ------
NM_002044chr1531271 350 29 ------
NM_002047chr72150 55 ------
NM_002054chr21463 1161 ----
NM_002061chr121601 212 1416 31868 1392 715 --
NM_002063chrX51141 1075 1016 997 883 1188 1903 1912
NM_002069chr731339 1230 1165 11581 1646 11766
NM_002077chr932101 1699 741 1100 --22168 1755
NM_002092chr455037 3185 1598 1399 1302 --24826 103 --
NM_002107chr12522 370 ------
NM_002126chr1793876 3822 3625 3092 2917 2817 1533 939 119 12559 ----
NM_002128chr1312235 --11995 --
NM_002129chr4153 ------
NM_002130chr541424 1222 1158 359 ------
NM_002137chr711924 1863 --12091
NM_002139chrX4452 83 71 58 ----1649
NM_002156chr21422 ------
NM_002158chr283661 3539 3409 2456 1228 822 399 105 1383 ----
NM_002161chr9--144 ----
NM_002196chr2021115 1107 1958 ----
NM_002196chr2021115 1107 1958 ----
NM_002203chr563830 3717 2915 2735 2579 1130 23260 141 --1409
NM_002210chr243004 2590 2546 1297 1493 ----
NM_002214chr7115576 5259 5245 4767 4395 4257 4098 3741 1323 1225 489 24726 2236 13880 --
NM_002223chr1243673 3474 2557 1608 21204 365 13414 11058
NM_002247chr1042289 1989 940 902 52162 2066 2054 2032 2008 ----
NM_002252chr22335 185 ------
NM_002264chr394746 4293 4105 3883 3820 3194 3100 1628 922 --1421 11418
NM_002267chr131605 31897 1696 907 1242 1285
NM_002270chr511281 65715 4727 4239 3985 1548 533 ----
NM_002291chr7------148
NM_002293chr122646 628 12492 ----
NM_002296chr121208 1148 21365 596 --11709
NM_002310chr5176099 5905 5868 5232 4533 4492 4441 4327 4155 4062 2425 2100 1657 1644 1528 914 330 26252 1737 ----
NM_002313chr1074222 4065 3332 1925 1316 101 23 --14230 --
NM_002317chr5--1259 ----
NM_002332chr121753 1131 ----
NM_002336chr1244858 513 462 304 34510 4405 3644 ----
NM_002349chr231266 1081 291 --1662 --
NM_002374chr283249 2992 2396 710 584 518 396 237 11275 --13206
NM_002376chr14134 ------
NM_002387chr585085 4151 3698 3657 3287 1823 1595 1431 31799 1381 45 14458 --
NM_002392chr121425 139 ----
NM_002397chr522186 2147 ------
NM_002399chr1551116 569 367 147 63 ------
NM_002426chr111319 ------
NM_002430chr2212143 ------
NM_002435chr151480 ------
NM_002440chr1--1114 ----
NM_002445chr82373 83 31454 1175 537 2479 223 11038
NM_002449chr51983 ------
NM_002451chr973706 3468 3381 3337 2659 1135 646 --11483 --
NM_002481chr165977 5607 3033 2974 2938 610 17506 36053 2215 317 12367
NM_002491chr21116 ------
NM_002500chr221105 368 ------
NM_002515chr1471556 1471 1452 1286 1251 362 127 21658 1459 ----
NM_002519chr1141240 501 440 428 1999 ----
NM_002524chr12435 188 --1393 --
NM_002545chr1184927 4324 3729 3467 1631 1530 1483 869 1428 --11560
NM_002547chrX53670 3593 3506 2748 2624 --11195 --
NM_002556chr1162153 1955 1667 802 692 562 ----12100
NM_002577chr374020 3991 3172 3000 2985 2647 733 ------
NM_002581chr995165 5056 4847 4638 3875 3495 1431 1177 484 24812 2203 --35596 1991 1522
NM_002583chr122104 40 ------
NM_002585chr11337 1365 ----
NM_002586chr621424 1200 1166 1363 --
NM_002590chr131399 1519 ----
NM_002591chr20--1631 ----
NM_002595chr1251874 1573 330 244 73 31193 460 258 ----
NM_002600chr131604 1478 53 11716 ----
NM_002610chr231057 233 113 32176 475 74 1711 --
NM_002613chr1674790 4709 4639 1957 1506 1364 382 15235 ----
NM_002628chr331215 273 29 ------
NM_002635chr121115 ------
NM_002645chr112512 189 ------
NM_002655chr855051 4333 1295 1283 308 34533 2068 935 ----
NM_002656chr63864 365 328 3985 233 156 ----
NM_002667chr641158 1042 526 245 1322 ----
NM_002703chr421843 678 11878 --11802
NM_002709chr223337 800 --32686 1090 498 12557
NM_002715chr521277 428 ------
NM_002716chr1133649 2253 1093 33597 2571 925 21376 1251 --
NM_002718chr351834 1680 1019 767 576 --1963 --
NM_002731chr183137 3075 2911 2547 2148 1208 1098 610 33163 2432 2005 ----
NM_002734chr1771777 1742 1499 794 319 174 63 1751 ----
NM_002736chr742184 1792 1445 401 140 ----
NM_002740chr352446 1082 937 149 80 11029 1760 --
NM_002745chr2274541 4415 4398 3568 3050 1365 944 23883 3003 ----
NM_002747chr1861894 393 372 362 172 161 11632 ----
NM_002755chr15--1273 ----
NM_002767chr172547 477 ------
NM_002822chr1221575 1512 11800 ----
NM_002829chr921050 193 --1813 --
NM_002837chr1274324 3806 3684 934 764 317 90 34027 3180 1033 ----
NM_002839chr933086 2544 1334 --23461 113 --
NM_002848chr1241323 1116 1013 1004 31151 987 917 ----
NM_002849chr1231010 813 53 ------
NM_002852chr3------1472
NM_002858chr12328 129 21257 42 ----
NM_002865chr82270 89 ------
NM_002873chr51494 197 2368 345 --
NM_002874chr95933 749 609 386 185 --11737 --
NM_002886chr345086 1492 1397 1329 15002 ----
NM_002890chr57949 917 811 790 381 370 164 ------
NM_002892chr1431245 498 88 31070 589 67 11259 --
NM_002897chr22153 146 ------
NM_002906chr1152354 2237 1579 895 633 12076 11626 12367
NM_002907chr121329 ------
NM_002955chr61228 21320 732 ----
NM_002971chr341211 1114 984 194 31205 1048 481 ----
NM_002996chr161300 ------
NM_003016chr17----2661 448 11765
NM_003017chr651420 434 405 347 38 ------
NM_003032chr332702 2178 2049 1434 ----
NM_003034chr1287714 7629 2508 2096 1877 1509 811 229 47762 7254 2896 588 26840 1183 --
NM_003042chr322214 767 --11928 --
NM_003046chr885353 4776 4590 4101 3709 3388 1627 1004 11362 ----
NM_003068chr83798 361 224 ------
NM_003100chr52419 372 1114 ----
NM_003108chr277125 6950 6396 1741 1190 512 357 24584 702 ----
NM_003111chr22904 539 11267 ----
NM_003112chr712163 31258 1025 985 1643 --
NM_003128chr21922 12063 1597 --
NM_003133chr13880 147 93 ------
NM_003136chr141376 ------
NM_003137chr62857 540 11887 ----
NM_003142chr21276 ------
NM_003144chr641705 1489 492 278 21735 1611 12170 --
NM_003155chr862174 1714 1106 927 875 666 12676 ----
NM_003161chr1773453 3288 2898 2786 2680 403 226 --12336 --
NM_003178chr342191 768 760 518 ------
NM_003184chr84457 336 213 52 --1397 --
NM_003185chr201209 1921 ----
NM_003198chr11248 1284 ----
NM_003199chr1864837 3843 1376 496 482 169 55105 5066 4903 2057 451 15205 --
NM_003201chr101217 --1907 --
NM_003211chr1271519 1496 1458 1088 644 484 398 1341 ----
NM_003221chr623789 3550 1896 13412 --
NM_003223chr161101 ------
NM_003234chr341928 1636 585 268 ------
NM_003253chr211277 ------
NM_003262chr3114958 4902 4853 4781 4569 3983 3760 1248 1124 540 519 24765 4020 11503 --
NM_003274chr2152707 2509 2057 2034 35 ----11926
NM_003291chr132577 523 2608 320 ----
NM_003292chr121403 24 22008 633 ----
NM_003298chr395747 5628 5465 4507 847 831 741 398 157 35836 4901 4775 --11753
NM_003336chrX2881 227 ------
NM_003342chr1733201 3102 457 22129 2067 22352 636 1903
NM_003348chr1221647 446 11658 11239 --
NM_003352chr21231 ------
NM_003368chr14755 748 152 99 ------
NM_003373chr10--11904 --11271
NM_003376chr6----11330 --
NM_003376chr6----11330 --
NM_003379chr621106 271 1775 ----
NM_003390chr111769 1138 184 --
NM_003392chr323553 3066 --12923 --
NM_003407chr191432 ------
NM_003411chrY2436 338 --11577 --
NM_003412chr342953 2700 588 534 1812 --12250
NM_003419chr191353 1815 ----
NM_003431chr1----1461 --
NM_003436chr191721 1657 ----
NM_003452chr92907 890 --1154 --
NM_003457chr171135 ------
NM_003463chr663408 2488 2414 2167 2093 414 --12078 --
NM_003468chr294334 3750 3581 3401 3316 2688 1704 1484 1449 ------
NM_003471chr342093 1990 1760 865 --1918 --
NM_003472chr641461 1316 957 364 1490 ----
NM_003473chr102722 211 2979 348 1448 --
NM_003477chr111205 1711 ----
NM_003478chr1163308 2196 2096 1252 1238 438 ----1145
NM_003483chr1242108 632 280 236 12763 --12681
NM_003489chr2141153 724 247 196 --13188 --
NM_003558chr9--3693 248 239 ----
NM_003563chr1741431 1384 1085 923 ------
NM_003566chr1252673 1271 1211 1052 79 12483 12612 --
NM_003569chr61637 ------
NM_003574chr1875735 4899 3700 3631 2156 1501 974 35634 4527 1299 --14273
NM_003582chr11171 ------
NM_003583chr1263698 3123 1059 957 933 591 --13621 --
NM_003589chr1321121 1040 11468 ----
NM_003590chr254032 3812 2923 2532 1458 21586 108 ----
NM_003603chr442005 1964 767 514 11363 --11871
NM_003613chr151263 ----1615
NM_003615chr383989 3731 3500 3363 3221 966 209 108 23837 1538 ----
NM_003618chr2--1853 ----
NM_003624chr1941371 908 532 172 11453 --1454
NM_003628chr22579 216 ------
NM_003630chr62772 574 2688 23 2564 477 --
NM_003651chr12------1187
NM_003659chr23359 271 54 --1940 1856
NM_003663chr382849 2493 1192 901 560 526 357 300 12389 13080 --
NM_003670chr311285 ------
NM_003671chr953241 3229 3104 2312 1047 23613 51 ----
NM_003672chr151793 1725 1452 203 183 31444 1429 398 ----
NM_003679chr143470 3023 2339 391 2405 240 22824 159 11127
NM_003713chr121570 1446 21744 1619 ----
NM_003716chr32751 694 2917 783 2128 96 --
NM_003743chr231844 1674 731 --32174 1720 1517 12020
NM_003746chr121180 ------
NM_003758chr1521198 381 21475 1461 ----
NM_003758chr1521198 381 21475 1461 ----
NM_003759chr433336 1653 893 22813 136 ----
NM_003772chr1131225 1079 259 31323 1006 223 ----
NM_003778chr31759 ------
NM_003783chr111127 21160 164 1797 --
NM_003787chr1841520 1505 584 200 ------
NM_003796chr19--1544 --1413
NM_003800chr682435 2229 2061 1693 951 851 681 407 ------
NM_003816chr81572 --21335 98 --
NM_003822chr142400 2381 633 97 1777 12891 12904
NM_003825chr1541578 1565 1415 1333 ------
NM_003828chrX1559 ------
NM_003831chr1841278 679 457 235 21596 662 ----
NM_003885chr1742453 2112 2057 734 22461 2255 ----
NM_003887chr2112312 2215 1962 1871 1740 823 634 575 409 384 261 32023 697 665 ----
NM_003895chr2121970 1860 22132 1487 ----
NM_003901chr1052750 2411 2003 1929 1734 --12487 --
NM_003902chr12773 263 1613 ----
NM_003913chr673084 3058 1551 1436 940 672 589 2872 237 ----
NM_003916chrX31300 1229 338 2560 529 ----
NM_003934chr941200 939 870 525 ------
NM_003941chr752466 2405 2320 2154 196 1872 11780 --
NM_003953chr132816 2785 854 21976 1071 ----
NM_003958chr663644 3140 2861 1229 1060 104 32727 2624 1036 23175 223 --
NM_003966chr597398 6547 6471 5979 5283 2449 964 932 472 12797 27431 4860 --
NM_003983chr1663448 3425 3282 3021 1485 1385 12840 12818 --
NM_003987chr1011488 ----11423
NM_003988chr1011565 ----11500
NM_003989chr1011424 ----11359
NM_003990chr1011424 ----11359
NM_003994chr1263978 3926 3780 2862 1534 882 54374 4026 3611 3455 398 --13940
NM_004006chrX32093 797 614 32102 875 305 ----
NM_004007chrX32093 797 614 32102 875 305 ----
NM_004009chrX32093 797 614 32102 875 305 ----
NM_004010chrX32093 797 614 32102 875 305 ----
NM_004011chrX32093 797 614 32102 875 305 ----
NM_004012chrX32093 797 614 32102 875 305 ----
NM_004013chrX32093 797 614 32102 875 305 ----
NM_004014chrX32093 797 614 32102 875 305 ----
NM_004015chrX32093 797 614 32102 875 305 ----
NM_004016chrX32007 711 528 32016 789 219 ----
NM_004017chrX32093 797 614 32102 875 305 ----
NM_004018chrX32007 711 528 32016 789 219 ----
NM_004020chrX32093 797 614 32102 875 305 ----
NM_004021chrX32007 711 528 32016 789 219 ----
NM_004022chrX32007 711 528 32016 789 219 ----
NM_004023chrX32007 711 528 32016 789 219 ----
NM_004028chr1863897 3689 3344 2688 1279 505 ------
NM_004035chr1784964 4936 4082 3491 967 583 308 188 35172 4895 993 23915 1881 --
NM_004052chr101518 2560 185 ----
NM_004075chr122242 63 ------
NM_004080chr731173 379 156 21465 519 ----
NM_004094chr1442895 2874 1198 740 1425 --11026
NM_004100chr632695 1755 797 --1909 --
NM_004105chr23994 897 417 ----1137
NM_004124chr1473483 3331 2536 2398 1152 558 225 --1959 --
NM_004156chr81520 ------
NM_004162chr341203 991 842 222 ------
NM_004171chr11189433 8936 8841 8701 8440 8223 7988 7164 7125 7005 6672 6237 6116 5985 3225 3154 2925 953 28707 2078 17654 --
NM_004172chr521713 779 1432 ----
NM_004187chrX11480 ------
NM_004229chrX11412 --11420 --
NM_004232chr1832407 954 103 13242 --23016 1453
NM_004239chr141114 ------
NM_004241chr102582 130 ------
NM_004252chr171145 --175 --
NM_004272chr56745 625 514 259 228 26 1222 11543 --
NM_004274chr1452548 2193 370 308 282 --33054 2789 564 --
NM_004282chr62627 73 ------
NM_004316chr122290 191 --11027 1866
NM_004330chr151995 ------
NM_004331chr852307 2154 2010 1925 381 22448 1981 ----
NM_004337chr851992 891 865 811 247 22186 121 22332 2225 --
NM_004338chr1856780 5880 4845 2687 1542 12619 ----
NM_004342chr731612 782 687 22157 584 ----
NM_004344chrX2200 40 ------
NM_004370chr642210 434 353 314 22142 613 11818 11752
NM_004374chr82125 36 ------
NM_004379chr22381 118 --11679 1133
NM_004380chr1632653 1055 96 ------
NM_004389chr22881 667 ------
NM_004397chr1153457 2877 1108 240 108 22903 23 --1703
NM_004411chr71270 ----1624
NM_004430chr8------11053
NM_004432chr93324 290 122 21791 40 --12185
NM_004438chr242664 2104 2071 735 3401 369 72 --1938
NM_004440chr622003 1406 ------
NM_004457chr231668 1327 110 ------
NM_004458chrX32189 1924 1736 2980 602 ----
NM_004459chr174597 445 146 56 1678 2820 720 --
NM_004466chr132785 97 ------
NM_004482chr24873 730 194 98 1325 ----
NM_004490chr2128 ------
NM_004491chr1914081 1750 ----
NM_004496chr14--11236 1120 --
NM_004501chr163869 3837 2610 2579 1365 867 --13989 --
NM_004504chr242331 2205 969 771 12104 ----
NM_004505chr1771978 1826 1800 1449 1414 1403 383 11809 1720 --
NM_004506chr6152 ------
NM_004520chr51551 3771 530 133 ----
NM_004535chr2021267 1208 1230 ----
NM_004537chr1241194 955 529 138 11053 ----
NM_004540chr21172 1324 ----
NM_004561chr112458 283 1662 11856 --
NM_004580chr151608 ----11517
NM_004586chrX74526 4313 4081 4001 3922 1960 1651 14483 ----
NM_004591chr22364 137 ------
NM_004595chrX1469 1477 ----
NM_004612chr954423 3865 3379 1650 139 44334 1941 1129 359 11379 --
NM_004615chrX3757 255 148 155 --2983 323
NM_004655chr1731350 937 221 --173 --
NM_004657chr231515 982 598 21322 477 ----
NM_004660chrY31676 1463 702 1263 ----
NM_004666chr641132 303 281 105 1197 --11185
NM_004667chr151440 ------
NM_004673chr121291 1055 1138 1179 --
NM_004680chrY138 ------
NM_004681chrY2672 176 1764 ----
NM_004690chr61676 ------
NM_004694chr171584 1113 ----
NM_004697chr9--2712 680 1106 --
NM_004713chr141634 ----1693
NM_004717chr71399 11127 11294 --
NM_004726chrX125790 5222 4307 3977 3668 1990 1653 1218 1143 932 463 192 15078 21778 76 14034
NM_004734chr1363294 2598 2296 2148 960 59 22664 2322 ----
NM_004736chr152163 2137 1821 1676 535 ------
NM_004738chr2052511 2418 2322 929 129 12669 ----
NM_004744chr433928 1301 1274 13224 23701 2488 --
NM_004745chr846803 5674 5193 4250 46913 5159 4356 396 16476 --
NM_004755chr1421231 782 ------
NM_004760chr742493 2359 2176 2170 22288 343 ----
NM_004772chr521194 109 ------
NM_004775chr1841920 1741 1578 537 ------
NM_004781chr131140 652 24 ----11218
NM_004781chr131140 652 24 ----11218
NM_004788chr1152605 1801 1067 1039 143 --2360 321 --
NM_004795chr13--11564 ----
NM_004801chr231088 506 380 1991 21048 968 --
NM_004804chr262483 2378 2019 1725 1075 588 32157 934 200 22413 2202 --
NM_004808chr1053385 3073 2600 1029 67 33330 3204 3030 ----
NM_004815chr144954 4687 952 335 11384 13811 --
NM_004820chr82377 39 1366 ----
NM_004824chr611035 21402 195 ----
NM_004834chr233392 3254 2502 23291 2920 --11218
NM_004840chrX22341 624 42237 2048 1791 1748 11546 --
NM_004844chr32275 113 11177 ----
NM_004845chrX64087 3455 3124 2565 1654 733 1753 ----
NM_004850chr211249 1168 21676 577 --
NM_004855chr15--1169 ----
NM_004856chr152471 180 ----1130
NM_004857chr1464719 4501 3359 1194 696 469 24282 1616 1802 --
NM_004859chr1762875 2646 2266 901 881 274 22066 142 12132 --
NM_004867chrX2579 146 2499 215 ----
NM_004869chr181253 21501 440 ----
NM_004871chr1723567 2963 12682 13889 12812
NM_004874chr8167 ------
NM_004898chr462664 2542 2394 895 505 296 --12024 --
NM_004902chr201542 1257 ----
NM_004904chr7116505 5626 5620 5245 5021 4374 4154 2039 1562 1202 195 ------
NM_004906chr61223 ------
NM_004912chr741568 475 382 255 11286 ----
NM_004924chr192768 415 1734 ----
NM_004926chr1431830 1513 1197 1403 --1509
NM_004929chr831533 587 450 1107 ----
NM_004932chr541678 1459 1427 1371 1456 2544 344 --
NM_004948chr1841202 1131 78 61 --11361 --
NM_004953chr31444 ------
NM_004956chr714230 43847 1818 1184 318 33513 2910 1800 --
NM_004965chr21--1696 176 --
NM_004966chr105980 219 200 136 59 ------
NM_004969chr10--1168 ----
NM_004973chr621428 215 ----11537
NM_004985chr1294271 3979 3755 3270 2807 1222 684 648 394 43419 3194 3101 632 22898 1635 --
NM_004992chrX67192 5505 5453 2093 1095 682 15578 18298 --
NM_004992chrX67192 5505 5453 2093 1095 682 15578 18298 --
NM_005006chr24981 344 216 49 1700 ----
NM_005010chr722241 605 12023 ----
NM_005014chr94848 701 685 627 --1740 --
NM_005023chr541505 1221 601 538 ------
NM_005033chr4132 ------
NM_005036chr2288363 8155 8008 7128 6266 2989 1672 959 26050 1906 22108 757 16398
NM_005037chr31187 ------
NM_005044chrX44254 3469 1421 194 21311 63 23575 960 13218
NM_005048chr22828 680 ----1559
NM_005054chr241697 1573 1464 393 ------
NM_005063chr1033672 1117 70 13414 11503 --
NM_005065chr1484999 4636 1957 1552 1023 550 513 304 24863 1287 ----
NM_005067chr3--1704 1111 --
NM_005077chr91133 1100 ----
NM_005080chr222972 961 1609 ----
NM_005086chr1221736 577 1737 ----
NM_005095chr121764 1378 12119 ----
NM_005121chr172722 75 13566 12931 --
NM_005126chr342094 2065 1558 652 ------
NM_005135chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_005141chr4--2363 148 ----
NM_005154chr151258 ----1664
NM_005156chr9114904 4802 4443 3978 3828 3268 1024 849 740 710 401 14215 14188 11795
NM_005160chr2296077 5266 4807 1462 1306 850 658 466 188 35533 5118 2552 26164 1540 --
NM_005164chr1242560 2251 756 478 1830 ----
NM_005168chr2--11452 ----
NM_005171chr1231280 197 186 1440 ----
NM_005187chr164767 556 489 140 11470 41976 1661 1426 218 --
NM_005188chr11178299 7892 7725 7548 7058 6866 6100 5994 5806 3206 2894 2679 1542 1460 1416 807 178 25172 881 11812 --
NM_005197chr1496213 6126 5932 5371 1169 1041 1002 911 294 1945 ----
NM_005202chr122066 1751 ----167
NM_005206chr174956 940 298 277 --21352 190 --
NM_005214chr23742 151 78 ------
NM_005215chr181701 --158 --
NM_005233chr342010 1918 748 472 12312 ----
NM_005235chr2117765 7750 6696 5698 5690 5496 1534 1171 982 616 255 16516 16565 --
NM_005238chr1152395 844 793 495 401 22310 2164 ----
NM_005241chr331378 522 177 1438 ----
NM_005254chr1531358 544 412 1111 11316 --
NM_005259chr2--2247 130 11085 --
NM_005277chr431854 411 49 21430 422 ----
NM_005296chrX1727 2946 188 ----
NM_005302chr72318 126 1452 ----
NM_005316chr112326 44 11134 ----
NM_005324chr173863 805 492 --11555 --
NM_005333chrX3434 59 32 ------
NM_005338chr733082 2688 726 12463 23947 3611 --
NM_005339chr474261 4239 3412 2947 2793 798 641 --1399 --
NM_005342chrX42301 1018 387 353 2696 107 ----
NM_005347chr951636 1427 555 278 126 --1389 --
NM_005359chr18136573 6433 6382 6350 5988 5842 4319 4248 2604 2178 960 699 676 21807 48 ----
NM_005378chr21620 ------
NM_005385chr342354 1856 1784 1038 22486 650 1220 --
NM_005389chr6--183 ----
NM_005399chr164212 3314 1691 1571 1166 252 1318 ----
NM_005400chr262863 2374 2236 1878 240 90 ------
NM_005402chr741778 539 432 89 21190 142 ----
NM_005406chr1831217 1106 497 11136 ----
NM_005407chr141160 ------
NM_005409chr451087 806 269 246 70 --1388 --
NM_005410chr54506 292 203 71 ------
NM_005414chr32254 105 ------
NM_005433chr1862784 2289 2243 1971 789 725 ------
NM_005436chr1064068 3594 3563 3299 2802 395 ------
NM_005437chr1041158 1142 1021 103 ------
NM_005445chr101311 ------
NM_005455chr151772 1362 598 580 361 ------
NM_005465chr142011 588 428 329 11819 11272 --
NM_005475chr1262817 2569 1117 682 648 122 12709 1832 --
NM_005486chr172444 254 ------
NM_005488chr221750 ------
NM_005491chrX12023 ------
NM_005493chr6--1635 1280 --
NM_005497chr1746026 2206 1037 364 11748 35630 5294 4391 --
NM_005502chr942596 2296 2075 824 ------
NM_005504chr12156461 6427 6020 5775 4615 4363 4305 2658 2511 2503 2114 1526 1081 874 43 --16205 1656
NM_005509chr531622 1306 722 11273 1691 --
NM_005511chr92986 925 2893 826 ----
NM_005537chr1321051 763 1223 ----
NM_005540chr14427 369 141 116 --140 --
NM_005566chr113539 221 177 1458 1520 --
NM_005574chr111585 1532 1694 --
NM_005578chr384738 4656 3427 2040 1749 1730 1154 84 41581 1162 724 571 21328 934 --
NM_005584chr132784 326 ------
NM_005593chr122426 164 ------
NM_005596chr965971 4055 1805 1134 111 61 36008 5792 4068 16399 --
NM_005604chr62357 169 ------
NM_005607chr83858 653 363 1756 ----
NM_005613chr141615 1436 694 612 11680 ----
NM_005614chr741029 339 81 57 ------
NM_005638chrX2345 261 11134 11707 --
NM_005639chr1261415 1230 1212 1185 745 386 ------
NM_005665chr174939 3737 3206 1395 1289 364 333 11023 --1297
NM_005668chr543642 3480 3048 1029 14319 33655 3566 144 --
NM_005717chr141034 893 446 351 1150 ----
NM_005721chr221135 842 ------
NM_005722chr242222 1522 634 479 1868 1199 --
NM_005725chr132344 1731 831 ------
NM_005737chr262802 2484 878 760 448 273 --12529 --
NM_005738chr741883 1710 1612 1600 ------
NM_005744chr15160 ------
NM_005746chr752385 1998 951 589 332 2899 485 ----
NM_005749chr17----1485 --
NM_005759chr294362 3978 3969 3907 3504 3427 3283 1504 512 24149 118 1924 --
NM_005776chr142666 313 ------
NM_005779chr573161 2296 1417 1337 1274 1106 616 21116 471 1158 --
NM_005786chr1811251 ------
NM_005788chr11----1813 --
NM_005795chr253058 2814 2049 596 526 --12011 --
NM_005819chr152769 2274 1189 700 628 --12811 --
NM_005822chr632344 1884 900 ----11740
NM_005828chr1733359 3123 265 --14908 --
NM_005840chrX96623 6213 5786 5563 5557 4770 1464 1171 899 15747 11396 --
NM_005845chr1331420 1147 445 2358 278 ----
NM_005859chr541573 1521 1198 172 ------
NM_005862chr31171 ------
NM_005875chr31364 ------
NM_005885chr511510 11426 11581 --
NM_005888chr121115 ------
NM_005898chr1152931 2866 1170 598 188 33220 2241 148 --1466
NM_005900chr44469 240 125 32 ------
NM_005901chr1898211 7862 7821 6568 6473 5424 997 687 134 36739 3108 2723 --11818
NM_005902chr1584054 3897 2964 2829 1465 1401 1370 122 13327 11066 11328
NM_005903chr544319 3918 3769 23 34847 4236 508 21463 784 14447
NM_005906chr631563 526 241 --21478 1440 --
NM_005909chr593815 3789 3738 2608 1569 889 509 286 229 12649 1112 --
NM_005923chr6--1176 1464 --
NM_005924chr72859 317 --21124 791 --
NM_005933chr1132947 2654 598 --1669 --
NM_005935chr494950 4929 4596 3906 3397 1941 1242 240 36 15070 14229 --
NM_005938chrX1235 ------
NM_005941chr884125 4074 4013 3986 1665 1024 735 294 22844 1181 13296 --
NM_005957chr164508 3891 1957 1096 316 139 --24820 4117 --
NM_005962chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_005962chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_006007chr933373 1747 1113 23764 740 ----
NM_006016chr641552 1511 410 170 32276 931 552 ----
NM_006022chr134949 785 695 669 ------
NM_006037chr254298 4226 4037 4016 3912 --11410 --
NM_006038chr2021920 1382 11470 ----
NM_006040chr1611263 ------
NM_006041chr171116 ------
NM_006047chr2052930 2501 2421 2316 740 --12208 --
NM_006054chr1141560 542 372 202 --1509 --
NM_006073chr652156 2129 2074 714 77 --11640 --
NM_006080chr742968 2262 722 144 52522 1073 646 392 347 ----
NM_006085chr121276 1035 --1185 --
NM_006094chr82803 586 22043 109 --11981
NM_006095chr4104296 4146 3593 3258 1542 1456 1288 806 176 49 24479 4233 14219 --
NM_006106chr1142709 2239 345 253 12192 ----
NM_006113chr11640 ----11964
NM_006122chr1552609 2210 1830 1076 287 --12420 --
NM_006135chr141162 1036 898 534 ------
NM_006139chr222920 2912 ----11872
NM_006141chr1632794 909 41 ------
NM_006154chr1582831 2360 2335 928 605 511 370 81 32655 1147 486 12465 --
NM_006158chr841786 1609 1429 381 11165 1551 --
NM_006159chr123179 137 99 ------
NM_006167chr832141 423 38 --11756 --
NM_006180chr971952 1736 1298 812 748 415 74 ----12050
NM_006195chr921191 221 129 1314 --
NM_006197chr862049 1704 1664 1379 831 461 ------
NM_006198chr21----1240 --
NM_006203chr5135504 5175 4897 4779 4770 3773 3713 1699 1524 1474 771 638 137 64925 4468 4388 3402 2088 1569 23722 1611 --
NM_006206chr452173 2136 2049 940 399 ------
NM_006237chr1341785 1685 1414 413 ------
NM_006243chr12702 124 2884 70 ----
NM_006251chr542747 2374 1311 1129 1630 ----
NM_006252chr196644 5283 2901 2317 2256 2092 1942 635 145 57469 6221 2555 1283 266 25772 5029 --
NM_006253chr1211250 ------
NM_006256chr122075 379 12001 ----
NM_006258chr1021464 1396 1140 1638 --
NM_006265chr821289 397 ----1599
NM_006267chr241206 1157 436 290 1716 ----
NM_006275chr2042024 787 613 431 11947 ----
NM_006281chr82104 27 11118 ----
NM_006281chr82104 27 11118 ----
NM_006282chr2031888 1736 1679 --21809 767 --
NM_006283chr894912 4826 4484 4234 3357 3055 1050 579 61 24219 502 ----
NM_006306chrX54408 2116 1439 1067 518 15599 11506 14924
NM_006315chr434468 3971 803 ------
NM_006321chr31333 1361 ----
NM_006323chr41770 2589 522 ----
NM_006330chr821350 578 --11068 --
NM_006333chr21493 ------
NM_006352chr121602 687 12085 ----
NM_006359chrX22154 1954 2617 175 11826 --
NM_006371chr374899 4689 4576 4437 4147 4139 1645 34536 944 144 ----
NM_006379chr741979 1590 926 99 ------
NM_006380chr1754323 4003 3262 1151 332 13172 125 --
NM_006386chr2232040 1750 594 140 ----
NM_006393chr1064567 4066 4000 3989 1547 127 24255 1574 23032 706 --
NM_006403chr61334 --11560 1726
NM_006404chr203517 506 89 ------
NM_006421chr81810 1326 1458 --
NM_006434chr1053235 3112 2578 2309 482 13139 ----
NM_006449chr262210 1677 1668 1515 1355 621 --11475 1585
NM_006460chr1721207 339 ------
NM_006464chr254385 3970 3759 1822 570 34557 1032 473 13431 --
NM_006478chr221192 ------
NM_006482chr1263698 3123 1059 957 933 591 --13621 --
NM_006489chr1471556 1471 1452 1286 1251 362 127 21658 1459 ----
NM_006496chr141952 747 552 450 2657 211 --181
NM_006504chr1042947 2750 2721 982 --12811 --
NM_006526chr2031983 1926 102 ------
NM_006534chr2033116 2109 821 12870 ----
NM_006536chr12791 725 ----156
NM_006537chr154596 555 410 161 --1390 --
NM_006538chr294211 3889 3453 3184 2680 1592 1559 453 160 14159 ----
NM_006544chr14145818 5566 4932 4867 4376 4305 4105 4070 2344 1355 788 749 626 527 2420 270 15397 --
NM_006546chr1784925 4271 2487 2252 1664 1635 1470 738 14633 ----
NM_006548chr341786 1307 523 502 --11434 --
NM_006549chr1252932 910 875 791 366 ------
NM_006558chr81136 ----1422
NM_006561chr1054324 4205 1565 725 457 26069 4111 ----
NM_006565chr1641279 1013 258 170 ------
NM_006575chr1431281 172 101 3978 967 82 ----
NM_006577chr241194 1168 1075 948 ------
NM_006587chr431549 1346 1244 11614 --134
NM_006591chr1131747 734 662 --11281 --
NM_006593chr22778 197 ------
NM_006595chr1131692 1505 163 21762 793 11381 --
NM_006599chr16158046 7979 7200 6538 6210 5886 5457 5277 2602 2527 2062 1812 900 447 176 13293 --18257
NM_006603chrX61778 1669 1662 1541 1305 661 1210 ----
NM_006609chr232757 2557 1022 --12231 --
NM_006614chr352874 988 561 269 136 21032 801 12276 1724
NM_006620chr684818 4157 3648 3135 1648 623 370 190 24315 4076 --13059
NM_006624chr1031504 1427 795 21954 382 11336 --
NM_006628chr1574437 3926 3000 1575 1406 468 223 23817 3091 13271 --
NM_006644chr13282 31 ------
NM_006646chr1342846 2431 2083 1052 23070 847 ----
NM_006654chr1264417 3896 3369 1616 1154 143 23421 388 --11243
NM_006682chr772723 2383 1090 1009 495 222 48 ------
NM_006699chr162378 1654 1023 717 383 123 ----12390
NM_006706chr52737 646 2844 764 ----
NM_006717chr923086 36 ------
NM_006718chr63864 365 328 3985 233 156 ----
NM_006720chr1074222 4065 3332 1925 1316 101 23 --14230 --
NM_006721chr102524 235 --1284 --
NM_006722chr332089 540 34 11121 --21919 195
NM_006726chr44900 438 303 261 ------
NM_006727chr5--1146 ----
NM_006729chrX85401 5288 4688 4341 1581 1169 1152 178 ------
NM_006734chr61573 11590 --11633
NM_006745chr42965 140 ------
NM_006746chrX4346 246 187 146 1624 11405 --
NM_006748chr82488 480 --152 --
NM_006749chr851221 1201 376 200 28 ------
NM_006750chr1687427 6680 5361 5355 2108 2089 1853 130 23027 2899 35903 1255 1182 --
NM_006756chr841096 587 78 54 1408 ----
NM_006766chr842381 2135 864 793 ------
NM_006775chr652482 2145 1923 711 358 2671 234 12334 --
NM_006777chrX62508 2482 2387 2078 2000 1928 22561 1144 11989 12816
NM_006788chr1832148 1608 277 11974 ----
NM_006800chrX3590 498 69 --2250 29 --
NM_006804chr171548 ------
NM_006811chr202933 85 1252 ----
NM_006815chr1221290 1012 11159 ----
NM_006818chr11899 ----1875
NM_006827chr1463061 3055 2893 1290 1248 616 12074 1636 --
NM_006828chr6175 1427 ----
NM_006832chr144777 768 720 165 ------
NM_006852chr1732602 2132 956 --1838 --
NM_006870chr202704 130 1272 ----
NM_006874chr44414 227 205 148 21021 180 11227 --
NM_006885chr1643308 3121 2922 653 23582 82 ----
NM_006888chr1453082 2676 2588 2318 1256 2820 209 ----
NM_006908chr731477 1183 1119 1332 ----
NM_006910chr16131 ------
NM_006915chrX31994 640 440 1674 1701 --
NM_006916chr221227 69 3528 326 184 11369 --
NM_006920chr211972 21999 1616 1369 21911 545
NM_006922chr262366 2300 1968 1903 898 70 21929 296 21833 1657 --
NM_006924chr1794433 3702 3619 3021 2740 1498 1214 1117 769 23734 618 13852 --
NM_006930chr541757 1370 622 182 1380 ----
NM_006937chr174527 212 101 65 175 ----
NM_006940chr1251810 1667 1230 1219 663 ------
NM_006948chr215936 685 522 415 394 32059 430 271 1868 --
NM_006951chr103645 259 32 189 --1656
NM_006963chr1041247 892 379 279 1177 1190 --
NM_006965chr181282 1407 ----
NM_006980chr72757 127 --1222 --
NM_006981chr932038 825 364 13011 12657 --
NM_006988chr212331 174 11092 ----
NM_006990chr132144 1578 768 ----1352
NM_007005chr921322 587 21172 492 ----
NM_007006chr1662348 1288 1149 824 605 54 32394 2287 464 ----
NM_007007chr1264658 4466 4172 3193 1602 1510 54793 3969 1824 1124 862 23813 943 --
NM_007008chr21162 1862 ----
NM_007011chr1536722 5120 1518 16287 15549 25701 2012
NM_007023chr221036 975 11043 1158 --
NM_007030chr554831 4135 4064 3544 425 13603 ----
NM_007034chr14951 900 651 388 1395 2976 316 --
NM_007038chr2175587 4686 4085 2296 1286 492 129 25100 592 35914 5497 902 --
NM_007039chr1422236 2022 31885 1629 569 ----
NM_007043chr1252060 1835 1593 508 29 11346 21946 1666 --
NM_007050chr2086876 6347 6134 5696 5531 1542 1391 342 26550 733 16573 --
NM_007054chr583539 2801 1058 915 865 343 196 99 23869 3862 21335 325 13286
NM_007064chr321297 617 11604 1421 --
NM_007099chr21969 1681 ----
NM_007106chr1382641 2222 2009 1974 1138 481 467 125 ------
NM_007114chr3102756 2653 2171 2016 1163 866 645 456 340 207 13271 ----
NM_007118chr5----1881 --
NM_007124chr651857 1639 1281 524 356 1630 1438 --
NM_007137chrX75568 4578 3695 1935 1752 1637 1629 25289 63 35414 4814 4168 --
NM_007145chr1931331 509 384 1566 ----
NM_007150chrX32179 822 636 --21767 1411 --
NM_007159chr321726 382 11643 1545 --
NM_007166chr11282 24 11153 11573 --
NM_007172chr2232788 1142 201 32612 2094 180 ----
NM_007173chr1132099 287 27 1612 ----
NM_007175chr863349 2896 2559 1357 688 435 23133 651 185 --
NM_007191chr12--1538 ----
NM_007198chr831645 505 27 21618 1570 --11636
NM_007203chr963672 3649 3366 2672 985 66 23004 802 1821 21516 1229
NM_007207chr11366 ------
NM_007212chr152276 2060 1744 1697 192 11864 ----
NM_007218chr84952 891 604 176 ------
NM_007222chr821719 173 21364 721 ----
NM_007238chr2063538 3384 1838 1209 342 101 --21653 1188 14667
NM_007249chr13148303 6279 6063 5943 5900 3084 2991 2717 1921 1864 1605 1546 1184 800 27987 1764 ----
NM_007270chr721471 1448 ------
NM_007282chr36923 806 741 636 292 131 ------
NM_007287chr342015 1154 783 434 1769 ----
NM_007288chr342015 1154 783 434 1769 ----
NM_007289chr342015 1154 783 434 1769 ----
NM_007292chr1784964 4936 4082 3491 967 583 308 188 35172 4895 993 23915 1881 --
NM_007345chr1832332 1583 294 12366 ----
NM_007373chr1021727 1666 11471 ----
NM_007375chr132736 2170 236 1365 11100 --
NM_012069chrX82696 1982 1690 992 849 758 724 87 ----11073
NM_012072chr2073976 1272 1247 830 595 450 438 24399 3291 ----
NM_012082chr81744 188 ----
NM_012089chr13608 510 352 ----11448
NM_012090chr121008 473 --11224 --
NM_012096chr353482 3368 2527 1061 911 33400 264 131 2722 75 --
NM_012097chr251799 1747 1497 912 861 --1820 --
NM_012102chr12578 139 22677 2326 21738 633 --
NM_012120chr611111 2843 413 ----
NM_012141chr1354001 3757 3726 3463 3019 23629 670 ----
NM_012153chr1142217 1848 130 87 11973 --12548
NM_012158chr1321643 1587 ------
NM_012164chr996883 5289 3030 3023 2538 2367 2134 1477 987 15248 47015 6450 4817 2900 --
NM_012175chr112371 74 ------
NM_012193chr1163431 1235 1092 1079 368 117 24063 1413 34088 1657 1245 11036
NM_012199chr154412 4335 3807 3192 911 23884 808 ----
NM_012224chr43873 359 91 ----131
NM_012234chr393680 3139 2752 2560 2537 872 835 319 27 1475 12409 --
NM_012242chr101195 ------
NM_012243chr11924 ------
NM_012247chr102143 65 1800 ----
NM_012249chr2103339 3025 2695 2586 2537 1337 321 291 228 66 3773 648 271 ----
NM_012252chr7155087 4552 4111 4008 3296 3285 2104 2035 1713 1179 1066 982 220 60 28 34232 3331 1318 --1653
NM_012262chr154447 3839 3833 3519 354 11171 11565 --
NM_012281chr752339 2050 1931 887 760 1549 11850 1741
NM_012287chr364263 3456 1667 1569 402 56 34552 1805 1371 ----
NM_012290chr211322 21631 440 ----
NM_012294chr774070 3750 1044 683 672 564 45 13802 31129 865 632 --
NM_012297chr442630 2010 1750 251 1638 ----
NM_012300chr542355 2322 2252 46 1624 12534 --
NM_012301chr732258 1761 235 1421 22139 1955 --
NM_012307chr184977 800 286 93 1239 ----
NM_012316chr165376 4501 3945 1726 1692 832 13411 25102 4779 --
NM_012329chr174318 252 131 41 2657 102 ----
NM_012333chr121378 1043 ------
NM_012334chr563436 3410 3369 1742 1285 352 14725 24241 3951 --
NM_012338chr73798 502 373 11127 ----
NM_012341chr101142 --1434 --
NM_012382chr593580 3303 3260 3218 2755 1806 1182 943 915 43915 3482 2811 967 14256 13515
NM_012388chr1533161 3112 2317 --11149 11955
NM_012417chr173580 450 443 ------
NM_012420chr1042191 780 761 729 31997 788 388 ----
NM_012421chr1--1462 ----
NM_012425chr1032638 2135 833 22557 2043 1256 --
NM_012428chr151207 ----1852
NM_012454chr62504 212 ------
NM_012464chr452707 2662 1947 1801 1160 ------
NM_012478chr17----1126 --
NM_012479chr722618 2542 12004 ----
NM_012484chr52670 109 1758 ----
NM_013230chrY21665 1179 21631 1258 21479 1361 --
NM_013231chr1452727 1684 1049 1020 36 1200 ----
NM_013238chr1331568 1265 603 ------
NM_013257chr851708 424 365 127 93 11893 1763 --
NM_013261chr473622 3578 3561 2335 1238 1185 1151 ------
NM_013262chr631152 408 58 144 1152 --
NM_013269chr1293879 3679 3646 3250 1706 1284 725 560 23 23419 681 ----
NM_013281chr201509 ------
NM_013300chr121229 ------
NM_013302chr1674159 3808 3518 3395 1783 1088 450 34135 3967 1409 23160 177 --
NM_013309chr1542457 916 759 461 --12247 --
NM_013322chr741176 1104 1056 328 ------
NM_013326chr18174 ------
NM_013354chr821105 335 31275 266 36 ----
NM_013357chr82763 300 --1233 --
NM_013372chr1553399 3344 2317 1222 1177 ----13201
NM_013374chr352815 2421 1085 472 142 ------
NM_013377chr121662 ------
NM_013381chr1272167 2065 2022 1744 941 857 844 ------
NM_013390chr941729 1218 1133 367 11441 1586 --
NM_013396chr2141089 1034 1011 254 2346 122 ----
NM_013410chr141052 984 794 489 1928 ----
NM_013417chr9--144 ----
NM_013423chrX11120 2960 857 --1875
NM_013427chrX11120 2960 857 --1875
NM_013433chr1911812 1321 1302 --
NM_013438chr941769 1364 719 556 ------
NM_013943chr133297 2783 2483 22930 2077 ----
NM_013989chr1495052 4864 4724 4210 3167 971 836 369 352 ------
NM_013995chrX42160 745 489 149 22400 2012 --1157
NM_014000chr10--11904 --11271
NM_014011chr252580 2078 1781 1695 29 4919 884 217 198 ----
NM_014016chr331595 1169 626 ----11573
NM_014021chr12958 447 --13106 --
NM_014023chr1012816 ------
NM_014034chr661503 1425 1191 1085 392 53 11471 1176 1496
NM_014041chr32341 291 ------
NM_014043chr311101 21084 664 11024 --
NM_014044chr2182 ------
NM_014048chr1624056 3515 34128 4008 351 34510 4458 1298 --
NM_014057chr951480 1467 1421 517 252 21146 1032 ----
NM_014079chr3----11026 --
NM_014089chr1332033 1575 1437 22046 1520 1674 12058
NM_014112chr895073 5035 4066 3915 1413 1234 1203 892 23 14779 11660 14269
NM_014141chr775320 3983 3774 3653 774 671 41 --25015 1131 --
NM_014155chr1195224 4852 4664 2908 2407 1554 648 499 264 37139 6843 1645 ----
NM_014181chr242130 774 726 649 1638 144 --
NM_014184chr11128 ------
NM_014191chr122993 866 1415 ----
NM_014243chr431813 1572 1443 21645 649 1654 11368
NM_014253chrX72552 2492 2300 2257 2050 991 249 --1127 --
NM_014264chr41626 ------
NM_014267chr111905 1124 ----
NM_014268chr1811245 ------
NM_014280chr13875 827 351 ------
NM_014283chr151510 1383 1098 546 256 1179 ----
NM_014299chr1921496 426 --22158 1349 --
NM_014309chr2254307 3374 3303 1955 394 --12002 --
NM_014329chr161333 ------
NM_014331chr4147215 7069 5929 5723 5461 5098 4942 3016 2901 2452 1905 1511 1257 1167 37351 885 90 1283 --
NM_014335chr1561165 968 419 363 223 30 ------
NM_014345chr621065 958 ------
NM_014363chr1331148 191 86 1264 ----
NM_014376chr542575 1712 1631 86 ----1271
NM_014379chr85863 699 235 216 39 1375 --1176
NM_014388chr175637 4920 2075 1905 1589 902 715 55993 3781 3770 2051 761 35821 2439 2216 --
NM_014421chr442081 1923 513 287 1817 ----
NM_014423chr585521 5405 5266 4547 4374 3711 286 67 --13603 --
NM_014432chr631038 344 124 --1520 --
NM_014445chr392331 1848 1610 1530 1504 800 737 318 273 2389 373 22464 962 1512
NM_014447chr431607 1412 463 ------
NM_014452chr631034 791 30 --21066 1010 --
NM_014491chr741010 932 904 755 ------
NM_014496chrX197 ------
NM_014500chrX165 ------
NM_014522chrX2149 118 ------
NM_014554chr1211541 --11616 11598
NM_014574chr1431426 1303 183 11095 ----
NM_014606chr421329 255 ------
NM_014607chr261385 672 411 333 100 57 1865 ----
NM_014612chr911468 1318 1556 --
NM_014613chr542934 2507 2151 500 --1405 1878
NM_014614chr231478 274 94 ------
NM_014615chr161839 --22637 2516 --
NM_014616chr311146 22678 931 23467 2683 --
NM_014630chr1533116 1581 313 23757 3085 13138 --
NM_014635chr241675 1545 1436 357 ------
NM_014636chr952788 2661 1488 352 287 13747 --13729
NM_014647chr164606 331 280 216 1877 ----
NM_014677chr81214 11090 ----
NM_014682chr851810 1430 1424 208 171 1350 12170 --
NM_014683chr173640 615 116 21495 165 ----
NM_014686chr1922579 934 --11607 --
NM_014701chr1552609 1379 1335 1141 465 22623 2383 ----
NM_014702chr653309 3217 3066 2800 1314 --13003 1538
NM_014705chr722150 714 ----12069
NM_014707chr742110 2016 1664 1537 --1275 --
NM_014717chr191130 1768 1307 --
NM_014729chr8112139 2065 1908 1792 1547 840 788 564 364 297 286 1847 ----
NM_014730chr1264692 3255 1998 1706 1234 127 ------
NM_014730chr1264692 3255 1998 1706 1234 127 ------
NM_014733chr542210 1981 1473 218 1817 ----
NM_014735chrX42160 1642 636 373 1391 11994 --
NM_014736chr15188 1288 1900 --
NM_014739chr653840 3252 1627 970 228 24117 416 ----
NM_014743chr452646 942 171 108 54 23014 305 ----
NM_014746chr253927 3534 3273 507 448 44036 3384 1684 1337 ----
NM_014751chr822017 1649 11525 11496 --
NM_014752chr1151965 1730 1230 650 567 ------
NM_014755chr253837 1021 533 490 21 1393 11463 --
NM_014756chr111443 1483 ----
NM_014757chr542196 2163 692 514 --175 --
NM_014765chr142692 2417 1683 930 1107 ----
NM_014766chr753627 3184 1430 861 54 13297 11378 --
NM_014772chr182868 476 33618 2580 2337 ----
NM_014775chr222124 114 ------
NM_014776chr121245 2882 344 1172 --
NM_014781chr82460 263 11021 ----
NM_014783chr1531821 394 179 21302 370 ----
NM_014787chr111851 41972 1898 1831 606 ----
NM_014791chr92292 98 ------
NM_014795chr23866 341 285 1189 11199 --
NM_014803chr1042899 1939 810 38 ------
NM_014806chr91158 ------
NM_014810chr143275 2455 2313 125 23220 2938 11294 --
NM_014812chr161878 1583 1485 1246 619 181 21531 1357 --1103
NM_014824chr112604 338 ------
NM_014828chr1441976 1906 668 348 --1869 --
NM_014832chr131625 --11810 --
NM_014836chr1011434 1587 11931 --
NM_014838chr2262811 2626 1922 1885 1098 361 --1234 --
NM_014839chr13718 204 141 12204 ----
NM_014870chr121610 1120 14082 --11554
NM_014873chr164725 4212 3498 3345 3067 973 23133 1338 14545 --
NM_014877chr17137775 7650 7641 7309 6654 6518 6064 5011 2403 1552 1125 825 153 66040 5124 2093 1795 1376 715 --21599 302
NM_014893chrY11466 62177 1871 781 644 584 379 11817 --
NM_014897chr1723133 167 12599 12757 1461
NM_014898chr194790 647 487 108 21693 769 22134 1500 --
NM_014899chr552962 2342 326 157 112 22992 2235 --12977
NM_014900chr221125 377 1725 ----
NM_014901chr532144 1692 896 11955 11756 --
NM_014905chr21542 1528 --1455
NM_014906chr1784118 3350 2857 2517 1299 1284 829 769 2431 208 ----
NM_014912chr1032937 2598 750 12363 ----
NM_014920chr673629 2991 2947 2712 2525 2507 1356 22931 1534 ----
NM_014923chr1312142 1812 ----
NM_014926chr33983 381 151 ------
NM_014932chr32313 22 21591 760 1351 --
NM_014936chr652379 2245 1797 263 78 ------
NM_014939chr1821562 1522 11508 21233 1070 --
NM_014942chr672457 2432 2079 1875 814 512 187 22363 2128 31681 776 85 157
NM_014946chr262427 2412 2259 2049 992 879 22899 450 ----
NM_014947chr13905 378 123 ------
NM_014961chr422150 439 12030 ----
NM_014962chr2062727 1949 1883 998 554 189 ------
NM_014969chr12443 51 169 --1382
NM_014974chr1041643 656 541 347 ------
NM_014978chr10--1543 ----
NM_014982chr1463844 3829 3423 3358 2120 337 21575 556 ----
NM_014991chr4113161 3036 2400 2337 1110 923 547 512 467 413 334 22267 1211 --13242
NM_014999chr1221471 129 --1551 --
NM_015000chr1293010 2463 2358 2302 2196 2000 1124 907 155 31225 272 118 ----
NM_015020chr1643426 3087 1155 1126 11483 --13619
NM_015026chr1284209 3698 3276 3245 3102 2953 1927 1637 11505 ----
NM_015027chr16197 11308 1538 --
NM_015032chr1312491 22707 929 11832 --
NM_015035chr2034746 798 517 25622 1317 26302 5434 --
NM_015039chr134376 3933 3000 23658 3638 11719 --
NM_015040chr283376 2948 2932 2580 2196 2075 1046 665 43147 2775 2365 72 11239 --
NM_015042chr1574043 3953 3757 3191 3148 3140 179 --12799 --
NM_015045chr1052044 1902 651 560 410 11812 2354 202 11977
NM_015056chr2142672 2426 2144 1765 22495 361 ----
NM_015057chr131558 1567 ----
NM_015069chr165636 592 561 421 224 1256 ----
NM_015071chr575448 5192 4832 1649 1005 239 22 21518 972 36013 4527 52 16027
NM_015072chr141598 ------
NM_015076chr674428 4233 2872 1561 1279 625 90 54509 3782 3752 1543 758 13622 1860
NM_015082chr542534 2214 770 217 --11970 1670
NM_015087chr1341055 1048 570 317 1359 12214 --
NM_015091chr141558 1298 ----
NM_015092chr1674114 3843 3653 3627 3202 1494 106 --11682 --
NM_015093chr651839 1526 1284 732 435 ------
NM_015097chr342276 2004 1961 1779 42071 1803 1560 510 12252 1409
NM_015110chr972060 1723 1541 791 640 366 67 22214 152 --11697
NM_015115chr472964 2887 2323 2241 2230 2050 382 2907 670 ----
NM_015132chr732009 1392 241 21670 571 ----
NM_015137chr842520 1992 1014 850 12068 ----
NM_015147chr283299 3234 3151 3056 2565 1342 906 322 32289 1169 977 12067 --
NM_015149chr131734 575 246 11705 175 1561
NM_015161chr1641503 1418 1255 486 11009 ----
NM_015170chr851927 884 198 121 30 292 51 --1609
NM_015176chr141410 1338 591 521 ------
NM_015184chr33464 203 117 1132 ----
NM_015187chr43996 939 111 3720 673 158 ----
NM_015192chr2022378 450 22081 812 1461 --
NM_015199chr362870 2669 2637 2521 910 682 31882 526 373 ----
NM_015206chr1543790 1408 647 36 12858 13171 1203
NM_015208chr1863697 3215 2691 1613 233 209 23746 749 13973 --
NM_015209chr142224 1726 936 446 ------
NM_015210chr182444 25 ------
NM_015215chr172662 2209 2148 2121 1961 838 724 ----12360
NM_015216chr551530 1395 1264 1237 524 1620 ----
NM_015219chr1732394 2308 713 ------
NM_015225chr962637 2481 2304 1029 518 203 12022 11196 --
NM_015230chr431817 417 372 21551 80 11195 --
NM_015247chr1653673 3364 1707 758 733 35415 4156 1385 25023 1312 11787
NM_015263chr151920 1807 ----
NM_015265chr22574 370 22400 392 12612 --
NM_015267chr1251887 792 487 423 39 ------
NM_015269chr1--2528 232 ----
NM_015271chr494257 3592 3572 3154 2844 774 517 505 248 44206 3692 3002 228 ----
NM_015272chr1651404 595 491 201 79 ------
NM_015275chr1241769 623 291 77 11873 ----
NM_015277chr1831852 1236 210 2707 232 --11260
NM_015278chr683198 3001 2918 2892 1237 1109 626 278 33054 2828 806 ----
NM_015291chr143541 3206 2909 80 ------
NM_015294chr172313 33 2978 437 ----
NM_015310chr8108088 7406 5788 5543 3312 3025 2873 2093 1865 333 26426 1886 ----
NM_015313chr1194304 3718 3274 3215 1511 1446 1364 1234 734 --33564 2956 458 --
NM_015314chr762592 1947 644 357 168 99 ------
NM_015316chr1431136 1127 88 --2230 37 --
NM_015317chr242680 750 555 117 1850 2649 85 1497
NM_015323chr621655 677 1280 ----
NM_015336chr1262440 2268 1898 1887 966 359 12170 --12327
NM_015346chr1421750 1531 ------
NM_015347chr1251009 204 155 67 35 ------
NM_015349chr662737 2597 2190 1185 901 423 23027 2962 ----
NM_015355chr1721786 597 21496 41 --1442
NM_015358chr2121045 1014 ------
NM_015365chrX104155 4106 4011 3940 3854 3801 3014 1131 796 147 11609 ----
NM_015381chr2222051 1609 11665 ----
NM_015385chr1053235 3112 2578 2309 482 13139 ----
NM_015387chr221704 741 --11576 21547 842
NM_015393chr473849 3834 3249 3232 3123 983 910 1400 11074 12677
NM_015397chr92649 502 21755 372 ----
NM_015429chr32963 738 ------
NM_015435chr83180 71 26 31460 431 62 ----
NM_015436chr463235 2636 2173 1279 578 510 1364 1795 --
NM_015442chr31245 ------
NM_015455chr534023 1571 757 11426 --11587
NM_015458chr854303 3791 1867 705 361 34616 4467 850 14072 --
NM_015460chr332113 390 353 --11729 --
NM_015475chr21314 ------
NM_015483chr721004 781 ----21112 442
NM_015485chr11306 ------
NM_015530chr22633 69 1816 ----
NM_015531chr11------1108
NM_015532chr1552758 2298 1856 400 61 11888 ----
NM_015541chr3----11205 --
NM_015550chr782929 2760 2216 1210 723 431 329 238 12482 12562 --
NM_015553chr664170 3706 1994 1403 1047 694 --15015 --
NM_015554chr1531109 653 335 2686 50 --12283
NM_015564chr543415 2780 2285 784 1718 31162 996 413 --
NM_015569chr1114449 3980 3971 3547 3473 1829 1432 1322 1276 194 24 1866 ----
NM_015570chr731796 1647 590 11521 1604 --
NM_015571chr662463 2199 1908 1730 1040 718 32511 2174 1697 ----
NM_015575chr243683 2385 887 44 23413 2547 12720 --
NM_015576chr342849 2016 1828 442 ------
NM_015578chr192673 510 22020 1409 1551 --
NM_015608chr103657 639 157 ------
NM_015626chr1741215 1051 872 77 ------
NM_015640chr174124 3287 1775 805 725 466 82 1521 15017 1399
NM_015646chr1251277 1038 533 427 146 --11160 --
NM_015660chr71132 ------
NM_015691chrX21033 1026 --1246 --
NM_015713chr873541 3326 2678 2650 2446 1054 773 ------
NM_015720chr31291 ------
NM_015833chr211349 ----12291
NM_015855chr114814 352 313 132 ------
NM_015869chr31187 ------
NM_015879chr18177915 7823 7786 6681 6643 6442 6148 6092 5683 3206 2916 2848 1996 1822 1785 378 295 17077 1513 37208 2733 1247
NM_015886chr8135278 4918 4656 4316 3961 3792 1830 1685 1643 1127 578 475 466 34664 1958 1673 13920 --
NM_015902chr82884 749 1947 ----
NM_015904chr22743 626 ------
NM_015906chr144561 4089 1642 864 14135 33266 3192 935 11368
NM_015955chr2----1474 --
NM_015975chrX11670 ----1190
NM_015990chr4--11049 ----
NM_016009chr184898 1979 1367 1211 1125 633 511 54 13968 23523 1848 1859
NM_016023chr831363 128 22 22152 816 1101 --
NM_016025chr1621356 262 11379 177 --
NM_016047chr2----148 --
NM_016053chr12--123 ----
NM_016072chr12--185 ----
NM_016075chr1342803 974 939 615 12904 ----
NM_016076chr132873 2295 915 --12138 --
NM_016079chr242277 2142 1635 91 ------
NM_016083chr643817 3321 3243 2682 12412 ----
NM_016097chr1821029 442 ----1795
NM_016107chr551362 965 952 303 207 11226 11023 --
NM_016121chr121164 138 ------
NM_016128chr31113 ------
NM_016131chr23913 722 117 12339 --1255
NM_016132chr1542549 1165 697 439 13117 ----
NM_016133chr211504 --11391 --
NM_016166chr15--1170 ----
NM_016206chr3128873 8407 7785 7013 6476 6165 5589 2615 1709 1515 702 231 69025 7696 7523 6634 6505 1093 12651 1925
NM_016224chr641381 432 411 404 1134 ----
NM_016226chr121444 1170 1371 --
NM_016227chr151510 1383 1098 546 256 1179 ----
NM_016230chr62101 31 ------
NM_016231chr1731566 1502 1348 --11665 --
NM_016242chr42568 39 ------
NM_016248chr1394006 3952 3931 3313 3232 2504 560 531 420 42776 1192 1113 339 ----
NM_016252chr21285 1112 1390 --
NM_016255chr642846 2733 2650 129 32861 2662 821 23145 622 --
NM_016260chr2117446 7074 6798 6274 5299 2020 1939 1913 1812 1747 173 35425 626 44 17525 --
NM_016271chr1822357 778 22302 61 --1515
NM_016275chr362544 2261 2200 972 723 621 --1637 --
NM_016277chr621336 1102 21110 31 ----
NM_016279chr51351 ------
NM_016287chr141404 1282 525 241 195 11706 --
NM_016299chr101107 1123 ----
NM_016300chr31492 ------
NM_016308chr141923 1827 240 109 1100 ----
NM_016322chr952922 473 441 168 158 12132 --1826
NM_016351chr72211 194 ------
NM_016376chr1763553 3530 3286 3162 627 553 13677 12818 --
NM_016410chr91588 1127 ----
NM_016422chr1163064 2644 838 595 562 254 --11112 --
NM_016424chr1761544 1283 621 483 464 213 ------
NM_016436chr2042513 2495 1890 873 --12316 12414
NM_016441chr22510 44 --11575 1590
NM_016472chr142574 473 1372 ----
NM_016484chrX5706 668 258 124 52 --1610 1134
NM_016488chr1221545 687 11665 ----
NM_016507chr1732828 2629 637 12619 ----
NM_016513chr673629 2991 2947 2712 2525 2507 1356 22931 1534 ----
NM_016530chr1543931 3660 2929 2696 24142 689 ----
NM_016531chr453930 3479 2936 1245 1212 34017 2997 2986 1894 --
NM_016542chrX21461 144 ----11536
NM_016577chr354171 3779 3736 686 468 --1206 --
NM_016599chr441513 1177 172 65 ------
NM_016607chrX21607 44 ------
NM_016620chr141228 1131 1010 320 1126 ----
NM_016623chr82570 234 --184 --
NM_016644chr52529 510 1519 ----
NM_016651chr1411053 ------
NM_016653chr221035 204 ------
NM_016654chr1531358 544 412 1111 11316 --
NM_016823chr174826 814 168 147 --21222 60 --
NM_016824chr1061788 1705 1575 1266 284 270 21476 612 1213 --
NM_016831chr132318 1682 1489 ------
NM_016836chr22153 146 ------
NM_016839chr22153 146 ------
NM_016937chrX1942 ------
NM_016946chr153267 3082 2806 962 157 --1342 --
NM_016950chr431206 320 143 11280 ----
NM_016952chr1163266 3036 2550 945 598 293 31017 574 48 --1764
NM_016953chr246087 5514 4485 848 65623 5348 923 804 555 35 12246 --
NM_017412chr811084 ----1882
NM_017420chr1453789 3726 3581 3361 1164 32576 674 180 12562 --
NM_017423chr451843 1783 1517 1429 836 --184 11746
NM_017426chr45697 608 591 248 145 ------
NM_017435chr122728 693 ------
NM_017437chr1462434 2152 1569 1535 1498 700 ------
NM_017447chr2174317 4276 3516 1215 335 251 224 14348 --13990
NM_017455chr151207 ----1852
NM_017548chr351599 1396 334 45 34 12031 1403 --
NM_017582chr121168 516 1705 21430 50 1440
NM_017599chr1231536 249 227 31994 657 406 ----
NM_017610chr1531657 807 139 --12060 --
NM_017628chr4105186 5004 4948 4705 3967 3405 1697 1034 747 244 ----11840
NM_017633chr633394 1382 756 ------
NM_017634chr81393 31778 1735 1680 ----
NM_017637chr9159346 7772 7751 7374 6379 5733 3653 3326 1258 1029 991 880 503 335 59 59150 6165 2882 2725 2358 11734 --
NM_017644chr345030 4999 1131 579 54464 1661 1437 686 161 1897 13465
NM_017650chr795588 5461 5146 4693 4420 3725 2316 1874 184 34786 4107 149 ----
NM_017651chr6--1273 ----
NM_017658chr1494580 3995 3566 3470 2858 2839 1796 1762 715 13666 ----
NM_017676chr551772 1144 564 404 371 ------
NM_017694chr21670 42096 478 214 164 ----
NM_017719chr362464 2188 1909 1008 475 111 31626 864 711 ----
NM_017730chr31494 ------
NM_017737chr131952 1690 1383 21771 1700 ----
NM_017740chr1641871 1760 1443 99 ------
NM_017745chrX2535 133 --171 --
NM_017752chrX61681 1638 1573 772 389 358 ------
NM_017761chr141119 1052 1027 201 1989 ----
NM_017769chr1423048 581 22459 2023 ----
NM_017770chr612469 ------
NM_017811chr942937 1964 1031 911 --12965 --
NM_017813chr884848 4064 3714 2101 1589 1306 1226 939 ----1412
NM_017824chr1012713 21956 807 12535 12203
NM_017831chr1853456 1250 363 338 157 21798 928 23707 707 24699 1231
NM_017848chrX64058 1831 1637 1586 1436 644 14304 11223 --
NM_017860chr13591 196 189 ------
NM_017864chr8196 ------
NM_017902chr1031408 1366 664 13663 --15650
NM_017915chr1221075 315 2935 797 ----
NM_017922chr142223 161 1475 ----
NM_017923chr44627 522 265 257 ------
NM_017925chr961913 1619 1399 402 253 229 --1583 --
NM_017933chr241302 545 175 104 ------
NM_017938chrX42207 1678 1670 1601 11576 ----
NM_017987chr10134 32173 2017 151 --2599 464
NM_018027chr1043172 3020 893 789 22538 2217 11312 --
NM_018036chr1454368 3045 2977 1770 924 21776 1304 ----
NM_018043chr1121285 1086 --11423 --
NM_018046chr561280 1210 665 315 287 97 ------
NM_018047chr53706 640 316 ------
NM_018051chr72400 350 ------
NM_018064chr6165 ------
NM_018084chr252367 2250 2209 2154 585 22759 2187 1221 22849 107
NM_018085chr1107754 7089 6626 6268 5796 5614 5602 3246 2320 2099 17261 11760 25750 758
NM_018086chr21771 ----1392
NM_018092chr163623 556 540 11085 1103 --
NM_018117chr101739 ------
NM_018120chr831245 1066 410 11202 ----
NM_018133chr331668 246 60 2630 45 --1193
NM_018147chr3144 1181 ----
NM_018155chr372643 2278 1321 1093 675 350 114 12375 ----
NM_018157chr1222609 1016 ----1665
NM_018169chr121453 ------
NM_018177chr42116 49 1822 11045 1256
NM_018181chr1821632 394 21569 400 --1560
NM_018184chr321939 180 1549 ----
NM_018195chr1161597 1574 1439 1350 450 243 --21311 825 --
NM_018206chr161748 ------
NM_018222chr1141631 1514 1227 70 11831 --1650
NM_018225chr945338 5097 1504 1246 65056 3896 1572 1510 524 355 24330 160 --
NM_018227chr433124 3022 1075 23067 147 22619 359 13016
NM_018241chr43963 754 254 --2134 30 --
NM_018243chr473487 3120 3073 2966 2560 687 130 1629 12740 --
NM_018244chr20------1291
NM_018247chr652226 895 827 797 226 ------
NM_018254chr132437 868 635 12431 ----
NM_018256chr2--169 ----
NM_018261chr43379 167 77 ------
NM_018263chr252496 2451 2308 1950 860 1925 ----
NM_018293chr362597 2126 997 561 320 304 12927 ----
NM_018299chr873129 2514 1363 1284 503 190 119 13329 ----
NM_018302chr481940 1886 1600 813 720 533 466 457 ------
NM_018312chr111378 ------
NM_018313chr332615 2408 682 22241 1821 ----
NM_018314chr113676 508 266 ------
NM_018315chr451281 1238 504 389 294 1410 ----
NM_018323chr431500 603 291 ------
NM_018325chr92436 413 --1300 --
NM_018339chr921563 1208 --1159 --
NM_018360chrX2128 67 ------
NM_018362chr1143571 3439 2464 1216 43662 3305 2877 2627 12611 --
NM_018364chr133830 911 643 --1838 --
NM_018368chr63217 187 90 ------
NM_018371chr821595 1339 --151 --
NM_018374chr774480 3570 3457 3366 1752 980 390 44896 4530 3852 1977 13937 1482
NM_018385chr311258 1849 1327 --
NM_018388chrX51415 1350 1173 546 219 11035 ----
NM_018400chr1164487 3696 3134 899 877 303 ------
NM_018401chr421898 289 1266 ----
NM_018403chr363335 3288 1468 1338 1269 282 23958 1480 12916 --
NM_018416chr1221749 878 22398 356 1835 --
NM_018427chr1631475 1067 459 11323 1311 --
NM_018429chr582574 2487 2342 2080 1168 556 530 223 --1647 159
NM_018433chr22430 183 128 1488 --
NM_018439chr1831796 1711 829 62461 2395 2252 2196 1699 658 ----
NM_018440chr8118374 7900 7059 6982 6643 6604 3417 3386 2684 1307 1013 33355 3237 2586 16308 --
NM_018441chr21143 ------
NM_018444chr822243 799 1594 11803 --
NM_018445chr151482 1127 ----
NM_018452chr6_random21460 1373 2463 230 13698 --
NM_018464chr102382 68 1124 --1431
NM_018469chr1741397 1129 931 186 --1101 --
NM_018471chr22492 455 158 --1540
NM_018475chr42623 75 ------
NM_018477chr1421073 50 --1939 --
NM_018482chr81303 12039 --1500
NM_018490chr1131472 1348 486 21485 558 11665 --
NM_018566chr164276 3689 3584 3218 3155 2008 ------
NM_018569chr441536 1297 360 55 11004 11023 --
NM_018590chr1021661 1559 ------
NM_018640chr1262527 2468 2358 1952 901 438 --12260 --
NM_018650chr131888 1781 689 1177 ----
NM_018667chr1612592 --11121 1629
NM_018682chr71741 ------
NM_018695chr542171 609 439 412 --12144 --
NM_018698chrX71922 1881 1813 1796 597 494 187 21825 1570 --11204
NM_018700chr561273 1117 1101 561 245 72 21170 78 ----
NM_018703chr16131 ------
NM_018712chr1131360 1000 404 11562 ----
NM_018728chr1531576 1166 1106 ------
NM_018841chr163860 3097 2978 1493 226 105 13682 12540 --
NM_018843chr7------132
NM_018890chr731477 1183 1119 1332 ----
NM_018898chr51614 --11493 --
NM_018899chr51614 --11493 --
NM_018900chr51614 --11493 --
NM_018901chr51614 --11493 --
NM_018902chr51614 --11493 --
NM_018903chr51614 --11493 --
NM_018904chr51614 --11493 --
NM_018905chr51614 --11493 --
NM_018906chr51614 --11493 --
NM_018907chr51614 --11493 --
NM_018908chr51614 --11493 --
NM_018909chr51614 --11493 --
NM_018910chr51614 --11493 --
NM_018911chr51614 --11493 --
NM_018934chr51283 ------
NM_018945chr663644 3078 2644 2542 2508 1065 --32941 2757 1033 --
NM_018953chr121689 1833 1802 --
NM_018963chr2151533 1477 514 259 88 11264 1430 --
NM_018970chr752568 2211 783 586 343 12459 11950 --
NM_018976chr1232303 1097 877 22506 2477 161 --
NM_018979chr1241625 855 614 90 11675 ----
NM_018999chr1074380 3243 1757 1313 1148 574 121 13392 24680 82 --
NM_019000chr531370 396 306 --11190 --
NM_019001chr394704 3581 3497 3105 3055 1393 660 349 219 2671 410 34572 4434 3985 14166
NM_019002chr22233 43 ------
NM_019004chr732435 942 797 132 1958 --
NM_019022chr18----22673 1280 1129
NM_019027chr442333 2105 1848 430 12465 --1394
NM_019035chr411542 11619 --11875
NM_019063chr252116 1726 880 863 255 --12134 --
NM_019072chr5123950 3712 3643 3031 2892 1653 1486 1228 886 863 811 700 33207 2613 1201 ----
NM_019080chr1341461 1394 1262 86 ------
NM_019084chr1032270 1974 788 --12313 --
NM_019102chr71445 1282 ----
NM_019102chr71445 1282 ----
NM_019116chr1631051 321 193 ------
NM_019117chrX53293 3107 2360 1160 98 1190 ----
NM_019555chr361572 1216 1144 519 313 164 11839 1201 --
NM_019556chrX21499 100 2593 404 11000 --
NM_019590chr1041190 1061 358 66 21120 396 ----
NM_019593chr2033037 2506 170 1312 12792 1462
NM_019610chr161758 1714 362 88 76 63 --1657 --
NM_019842chr6162 1384 ----
NM_019845chr21109 ------
NM_019885chr252648 2446 2405 577 328 11968 ----
NM_019891chr13171 109 24 ------
NM_019903chr1061788 1705 1575 1266 284 270 21476 612 1213 --
NM_020066chr12720 81 1318 ----
NM_020116chr431527 609 173 3728 534 304 ----
NM_020122chr2125768 4591 4578 4222 3886 2073 1993 1348 710 366 345 173 --35250 3658 66 --
NM_020123chr1031377 1343 197 1379 --1998
NM_020132chr2165103 4236 3871 3237 96 88 ------
NM_020141chr12875 858 2264 191 2777 28 --
NM_020144chr761597 497 467 453 411 271 11656 11661 --
NM_020148chr1842403 2155 523 275 32856 1889 559 --22236 909
NM_020152chr215853 806 333 202 123 ------
NM_020154chr151271 1230 184 --
NM_020177chr573324 3254 2925 2623 2525 1228 1205 22098 1016 --12607
NM_020198chr1761595 1564 1423 1406 1007 114 21477 1297 ----
NM_020199chr541295 986 481 320 --1936 --
NM_020226chr41631 ------
NM_020240chr512018 32126 2058 938 ----
NM_020245chr645104 4198 1567 1365 21120 662 13174 --
NM_020336chr2023867 1004 31383 924 45 ----
NM_020337chr433102 504 140 --22519 55 --
NM_020341chr2042027 1877 1467 1293 22042 1383 ----
NM_020342chr232405 909 634 1493 --1444
NM_020346chr114526 499 478 350 ----1507
NM_020353chr311263 --125 --
NM_020357chr321526 458 1350 1304 --
NM_020381chr61160 31575 1413 668 11386 --
NM_020390chr374863 4695 4545 4110 3237 3167 390 43419 1461 1055 405 21080 863 146
NM_020403chr1341787 1746 1609 1349 --192 --
NM_020432chr762141 1897 697 646 412 102 ------
NM_020440chr132818 2775 1148 1556 1604 1243
NM_020443chr1106412 5895 5532 5276 5012 4521 1802 1743 758 51 --22586 1677 1303
NM_020445chr71680 ------
NM_020455chr642803 2084 1040 559 32485 234 196 ----
NM_020457chr162632 213 ------
NM_020466chr664729 3168 1754 1651 988 287 23340 678 1466 --
NM_020474chr1831391 1265 549 2513 203 ----
NM_020475chr812345 ------
NM_020476chr812345 ------
NM_020477chr812345 ------
NM_020478chr812408 ------
NM_020480chr812345 ------
NM_020525chr12259 29 ------
NM_020532chr21162 1862 ----
NM_020548chr21203 ------
NM_020630chr101186 --1150 --
NM_020640chr342119 1812 1591 854 ------
NM_020647chr852314 1567 1499 1417 32 ------
NM_020651chr251807 1652 1547 637 348 125 ----
NM_020654chr3--21415 1230 ----
NM_020673chr2097192 6759 5947 5197 4999 4688 2935 1283 476 1226 ----
NM_020689chr2021621 1093 --1588 --
NM_020708chr2022210 1963 ------
NM_020711chr252620 2597 2100 2023 1998 12339 ----
NM_020717chrX84426 1642 1415 1408 1040 908 168 97 1528 34850 4586 4140 --
NM_020718chr16116153 5145 5032 4940 4730 4322 2191 1970 832 586 364 25525 1582 12551 --
NM_020727chr2173418 3195 2852 1256 1019 471 153 11414 11499 --
NM_020728chr743158 2136 853 824 --12778 --
NM_020734chr1252990 2867 2230 1149 487 2710 435 --12412
NM_020742chrX2841 259 42246 1938 598 397 ----
NM_020747chr51821 1135 ----
NM_020760chr23726 719 667 21457 1374 ----
NM_020766chrX44049 2979 704 331 33547 2809 679 11259 --
NM_020770chr13903 218 105 11332 ----
NM_020772chr1796612 6568 5845 5659 1693 1552 905 765 184 58582 5368 5277 1135 232 ----
NM_020774chr1895633 3945 3775 1753 1653 1500 1143 723 448 36258 4486 4095 ----
NM_020778chr1563586 3527 3018 1480 1247 551 --21671 517 --
NM_020782chr1234380 1616 158 34838 3103 1518 ----
NM_020783chr1852057 2048 837 255 97 ------
NM_020787chr172617 127 2119 58 --1975
NM_020792chr322124 1972 ----2274 256
NM_020794chr111259 21339 572 ----
NM_020801chr522444 105 ------
NM_020806chr14178 1131 1341 --
NM_020809chr1162224 1714 1658 874 595 160 11831 --1890
NM_020810chr1482524 2416 1145 367 349 306 205 142 1426 ----
NM_020824chr102768 38 ------
NM_020830chr241105 999 258 230 ------
NM_020841chr122716 532 22832 450 ----
NM_020844chr8117449 7184 6799 6470 6321 5056 5020 4866 2140 889 829 25584 1354 17109 --
NM_020854chr1831036 190 156 1587 ----
NM_020865chr31396 ------
NM_020866chr131271 11079 ----
NM_020870chr431955 599 308 ------
NM_020872chr33612 566 257 ------
NM_020873chr3--3798 687 303 1904 --
NM_020886chr112948 240 31197 507 437 21327 390 --
NM_020909chr264013 2963 659 532 166 59 ------
NM_020918chr1063572 3548 3503 3371 2896 327 32461 499 251 ----
NM_020919chr221174 860 2881 461 --1323
NM_020921chr1482578 1309 934 808 651 484 111 97 1768 ----
NM_020922chrX31666 1646 377 41561 1365 1191 723 ----
NM_020935chr254242 4013 3916 1787 1156 23335 3206 23350 1841 --
NM_020940chr1062678 2475 2246 2042 1927 36 ------
NM_020948chr123227 1204 ----23612 3263
NM_020977chr411682 2615 338 ----
NM_020987chr102393 248 ------
NM_020993chr122105 53 ------
NM_021003chr145774 732 539 328 155 ------
NM_021005chr151344 ------
NM_021007chr232398 2333 372 ------
NM_021033chr1373461 3392 2884 1386 806 539 374 2185 115 1311 --
NM_021061chr864443 3598 1597 767 395 183 31573 617 40 ----
NM_021069chr442005 1964 767 514 11363 --11871
NM_021079chr1732823 790 266 1231 22766 2508 23142 2944
NM_021097chr242829 2356 2272 812 ------
NM_021116chr778906 8198 6831 5951 5779 1287 401 58832 8296 8264 7534 7397 17202 16412
NM_021127chr1841535 1453 1372 1312 ------
NM_021133chr151711 662 481 390 31 1185 --1624
NM_021136chr14----1698 --
NM_021145chr72805 318 153 ----
NM_021148chr742415 1856 675 223 51905 1873 1647 743 496 ----
NM_021151chr72723 250 1428 ----
NM_021155chr1912090 2706 27 ----
NM_021159chr431583 1503 591 31156 333 247 ----
NM_021161chr142444 149 1109 ----
NM_021163chr733171 1403 1085 43157 1477 1458 814 23711 2611 1768
NM_021176chr231884 1803 295 1753 11395 --
NM_021183chrX21848 1684 12124 12477 --
NM_021188chr142544 182 ------
NM_021190chr131368 462 194 ------
NM_021191chr1262217 2176 1669 1012 863 305 --1379 11692
NM_021204chr41749 ------
NM_021239chr1461308 1256 1110 410 324 224 --1250 --
NM_021252chr1052097 2038 545 366 73 ------
NM_021255chr1444118 3512 2932 2626 1815 ----
NM_021619chr931302 1259 1156 11111 ----
NM_021622chr1042244 2090 832 646 12398 --11826
NM_021627chr33439 426 256 ------
NM_021629chr394999 4914 4620 3884 3535 3375 1599 1560 144 --23350 1883 --
NM_021639chr14930 874 737 722 ------
NM_021643chr21599 --11238 --
NM_021647chr423373 1539 11044 ----
NM_021722chr72170 153 ------
NM_021723chr72211 194 ------
NM_021813chr655689 5076 4607 4164 3653 1283 13789 --
NM_021818chr1421443 1104 21324 1318 ----
NM_021912chr1563782 3315 2688 1628 1111 268 22574 1551 11235 --
NM_021942chr41776 --1135 --
NM_021946chrX1179 ------
NM_021949chrX32747 999 414 2666 89 1234 --
NM_021954chr1363045 2835 2627 2522 1090 799 1506 12753 --
NM_021956chr631556 1302 326 1304 1488 --
NM_021960chr162583 2274 2107 1968 918 447 --11801 12735
NM_021961chr1187340 6116 5983 2327 1982 1733 1184 516 1609 11411 16589
NM_021964chr396122 4975 4423 1756 1263 1245 687 640 186 44266 2009 1314 153 --15329
NM_021977chr653772 3177 2371 1501 991 11383 --196
NM_021999chr134821 738 649 147 1265 ----
NM_022037chr22285 149 1782 ----
NM_022041chr1632015 1973 194 32545 2361 580 ----
NM_022051chr12229 48 1575 ----
NM_022058chr252065 1987 630 157 144 ------
NM_022075chr15938 784 729 698 50 ------
NM_022080chr2032125 2033 29 12012 ----
NM_022082chr2021087 1078 ------
NM_022114chr134545 4516 902 ------
NM_022118chr132433 148 ------
NM_022121chr63978 490 222 ------
NM_022130chr511167 1595 ----
NM_022138chr6164 ------
NM_022154chr441335 886 414 113 11233 ----
NM_022160chr92440 420 ------
NM_022166chr1656033 5860 1645 726 711 --24958 785 --
NM_022173chr22285 149 1782 ----
NM_022351chr8113659 3648 3113 2992 2723 1002 986 877 790 508 67 11164 ----
NM_022361chr63485 451 136 ----1159
NM_022373chr731024 260 168 ----123
NM_022456chr1297711 7643 7384 6879 5818 2501 2393 907 834 57024 5679 2359 1896 359 47353 7281 5302 2893 --
NM_022459chr1376249 6197 5466 5241 4669 1708 465 36148 2036 1612 ----
NM_022473chr1543905 990 518 42 34162 3847 170 ----
NM_022476chr1631120 992 735 1815 ----
NM_022484chr73407 325 47 1475 ----
NM_022491chr1262768 1372 1224 444 336 107 22850 2181 ----
NM_022494chr10142 ------
NM_022550chr5--1118 ----
NM_022650chr57949 917 811 790 381 370 164 ------
NM_022716chr122983 1219 51049 712 362 344 103 ----
NM_022726chr651525 1342 1152 1076 390 21613 1286 ----
NM_022728chr73766 647 575 --1133 --
NM_022739chr1731186 1032 315 1989 --11053
NM_022753chr132739 2585 2258 ----12090
NM_022763chr363107 2775 2331 2270 809 763 12607 ----
NM_022766chr2242512 986 70 44 --11936 1533
NM_022781chr91165 1349 1460 32061 653 151
NM_022782chr122326 76 1332 ----
NM_022784chr15151 11028 ----
NM_022802chr1021327 1265 2569 145 ----
NM_022818chr1651667 1514 568 435 73 1205 --11222
NM_022824chr531708 1601 1279 21782 407 ----
NM_022826chr231113 71 59 ------
NM_022828chr531438 534 135 1309 ----
NM_022831chr141398 1301 458 257 11843 ----
NM_022841chr1522790 495 12703 ----
NM_022845chr1662198 2083 512 284 278 151 22145 1694 ----
NM_022894chr211359 11096 ----
NM_022898chr1434586 4321 4036 ------
NM_022902chr51294 187 ----
NM_022912chr252542 2405 2342 2230 501 23021 584 ----
NM_022918chr1142131 1820 628 328 11696 ----
NM_022977chrX32189 1924 1736 2980 602 ----
NM_023000chr1431245 498 88 31070 589 67 11259 --
NM_023001chr1431245 498 88 31070 589 67 11259 --
NM_023075chr181813 1146 --192
NM_023076chr1652105 2034 2012 932 620 12074 11119 --
NM_023927chr531252 956 299 ------
NM_024052chr1762952 2471 2362 846 280 249 1858 ----
NM_024060chr11--185 1285 --
NM_024061chr72452 76 1629 ----
NM_024071chr141636 ------
NM_024090chr431535 620 93 ----1611
NM_024102chr111189 --11158 --
NM_024315chr7--2449 390 ----
NM_024416chr951480 1467 1421 517 252 21146 1032 ----
NM_024424chr1161264 1156 1113 228 155 54 ------
NM_024425chr1161264 1156 1113 228 155 54 ------
NM_024426chr1161264 1156 1113 228 155 54 ------
NM_024512chr343397 775 526 298 --12927 --
NM_024520chr21107 ------
NM_024524chr322793 638 12520 22547 908 --
NM_024529chr111159 11030 1174 --
NM_024539chrX147 2954 920 ----
NM_024548chr341241 1230 344 217 ------
NM_024556chr112487 407 ------
NM_024557chr1111209 21307 289 11560 --
NM_024561chr132963 186 1390 ----
NM_024569chr132893 2862 931 22053 1148 ----
NM_024581chr61246 ------
NM_024586chr12585 157 1107 ----
NM_024594chr541776 1489 725 429 ------
NM_024595chr13784 445 68 ------
NM_024604chr121155 1134 ----
NM_024613chr81645 ----21384 637
NM_024617chr93894 627 270 ------
NM_024636chr762806 2679 1997 1065 594 65 ------
NM_024641chr642986 2923 2219 844 42747 2487 2269 617 12659 12578
NM_024665chr3114692 4104 3889 3695 3472 2889 1349 939 887 853 30 14565 ----
NM_024674chr142512 2245 908 847 13075 1882 1665
NM_024686chr1------1373
NM_024692chr231399 221 173 ------
NM_024699chr83853 645 198 1789 ----
NM_024700chr12310 21 1326 --1255
NM_024709chr13908 748 474 21773 549 ----
NM_024713chr1541373 454 300 115 ------
NM_024715chr581482 1462 1329 1268 621 610 175 139 ------
NM_024721chr811731 2104 73 --12217
NM_024740chr1153090 683 294 223 42 32919 780 691 ----
NM_024744chr232653 1965 1861 22180 627 --1563
NM_024763chr121019 438 ------
NM_024770chr2136620 6527 6127 5135 5127 4107 2586 2500 2322 1852 1576 279 54 56431 6047 4140 1552 452 22082 811 15513
NM_024811chr1131674 580 565 --1750 --
NM_024813chr12436 92 --1703 1167
NM_024828chr93580 169 137 11525 ----
NM_024854chr1211367 21379 111 ----
NM_024887chr131716 851 448 --1654 --
NM_024908chr151109 2590 512 ----
NM_024911chr12681 54 ------
NM_024913chr721244 1086 ------
NM_024920chr431467 1274 246 ------
NM_024921chrX61973 1886 1761 1505 623 469 ------
NM_024930chr572704 2321 2016 2005 1829 1037 773 11128 ----
NM_024947chr3109421 8748 8624 8539 6812 6560 3401 3012 2930 2615 29203 7437 16455 --
NM_024948chr101120 1290 ----
NM_024953chr1252079 1730 1058 366 165 --22401 502 --
NM_024989chr296933 5471 5025 2982 1988 1319 1010 874 296 52836 2600 2314 1893 1181 ----
NM_024991chr1053235 3112 2578 2309 482 13139 ----
NM_024993chr211220 21429 147 ----
NM_025040chr1942320 1798 723 636 2989 262 ----
NM_025054chr874213 3223 3176 3077 2886 1494 481 43857 3673 3643 3214 13963 --
NM_025073chr1134205 4022 3701 3430 3251 3052 2999 1549 1391 1097 618 268 227 11332 ----
NM_025074chr492190 1230 1151 764 455 305 233 154 148 1101 ----
NM_025080chr11178 ------
NM_025109chr171475 ------
NM_025114chr12132 ------
NM_025134chr1682601 2534 2228 2221 1976 1839 420 137 32297 474 228 --12126
NM_025146chr332598 771 649 12441 1994 --
NM_025151chr842103 1710 735 175 11414 ----
NM_025152chr1462009 1885 1644 1453 258 187 1239 --11993
NM_025154chr741301 1253 1023 541 ------
NM_025160chr144300 3642 3574 578 13776 --12990
NM_025181chr21791 140 ----
NM_025191chr173523 3452 3068 3037 1053 973 818 12347 --11226
NM_025221chr461274 1111 984 505 69 43 --11074 --
NM_025222chr322841 168 --22420 1888 1381
NM_025235chr102880 734 21711 474 11856 --
NM_025238chr1541398 467 400 361 11545 ----
NM_025248chr171209 ------
NM_030579chr1643305 2346 1443 649 23718 794 ----
NM_030621chr1444051 3860 2839 1209 33631 3536 1462 14205 12738
NM_030623chr261521 1217 671 658 645 369 21285 115 ----
NM_030627chr533676 3629 864 23103 122 ----
NM_030647chr745293 5245 1254 510 11006 ----
NM_030648chr4105369 5130 4012 3782 3524 3448 2115 1739 872 150 25122 1608 1437 11234
NM_030664chr1031946 168 159 --1526 --
NM_030667chr1241323 1116 1013 1004 31151 987 917 ----
NM_030668chr1241323 1116 1013 1004 31151 987 917 ----
NM_030669chr1241323 1116 1013 1004 31151 987 917 ----
NM_030670chr1272355 2148 2045 2036 1649 580 61 32183 2019 1949 ----
NM_030671chr1272355 2148 2045 2036 1649 580 61 32183 2019 1949 ----
NM_030674chr1285861 5227 4768 4760 4346 1339 1000 970 44696 4340 1480 726 ----
NM_030755chr142540 529 1559 --12270
NM_030759chr102633 203 1518 ----
NM_030762chr1231854 1698 1473 11877 ----
NM_030763chrX1828 ------
NM_030773chr2031432 1311 1221 51801 1146 695 524 308 ----
NM_030791chr1491612 1519 1484 1445 1315 692 505 363 307 1425 ----
NM_030806chr1107822 7407 6613 5912 1936 1924 1754 1600 570 31 36131 3116 146 --18664
NM_030816chr163146 3101 2976 2905 494 274 23319 108 ----
NM_030881chr2232040 1750 594 140 ----
NM_030926chr221099 410 ------
NM_030938chr172961 304 122 ----
NM_030949chr621425 448 ------
NM_030963chr6----1480 --
NM_030979chr13170 ------
NM_031208chr162976 742 1633 1267 --
NM_031243chr711924 1863 --12091
NM_031268chr1674790 4709 4639 1957 1506 1364 382 15235 ----
NM_031286chr11376 ------
NM_031291chr4--156 ----
NM_031296chr462631 2549 2488 2084 2049 1793 11866 --191
NM_031362chr222673 2450 --22141 158 --
NM_031365chr232809 2586 86 --22277 294 --
NM_031366chr232809 2586 86 --22277 294 --
NM_031411chr51614 --11493 --
NM_031419chr31267 ------
NM_031422chr18------1460
NM_031427chr1465293 4780 1448 1429 914 624 24718 2239 24301 1691 --
NM_031442chrX42701 2089 1133 487 1440 ----
NM_031445chr232936 2683 271 11105 ----
NM_031459chr111314 ------
NM_031461chr822200 1556 1268 1100 --
NM_031468chr7118165 7730 7026 5155 5053 3064 2016 1469 1190 1099 156 11507 16170 15679
NM_031483chr2033396 3146 1345 1375 --13118
NM_031844chr163869 3837 2610 2579 1365 867 --13989 --
NM_031845chr283249 2992 2396 710 584 518 396 237 11275 --13206
NM_031847chr283249 2992 2396 710 584 518 396 237 11275 --13206
NM_031849chr51614 --11493 --
NM_031857chr51614 --11493 --
NM_031860chr51614 --11493 --
NM_032012chr985294 4591 4192 3688 3260 1976 1597 357 14348 ----
NM_032021chr1111212 ------
NM_032047chr382442 2237 1960 1748 1651 1530 814 584 11665 ----
NM_032105chr166110 5740 3166 3107 3071 743 17639 36186 2348 450 12500
NM_032116chr1395368 4800 4559 4359 3815 1756 1108 575 136 25056 1250 11908 --
NM_032128chr42394 199 --1816 --
NM_032142chr18174 132 ----
NM_032143chr21240 --1334 --
NM_032144chr241225 1199 703 436 ------
NM_032147chr1261003 967 929 650 177 167 ------
NM_032160chr1864242 4225 4144 3246 1441 1008 41218 767 555 423 ----
NM_032182chr1071425 1382 1209 1073 647 333 89 --11520 --
NM_032186chr141228 1131 1010 320 1126 ----
NM_032199chr1043619 1230 804 554 ----13760
NM_032208chr233144 2219 769 53341 2681 2518 2435 269 --1209
NM_032219chr4--1115 ----
NM_032221chr2041792 1475 543 140 1789 ----
NM_032229chr131119 1361 ----
NM_032231chr15----1284 --
NM_032246chr15--1828 ----
NM_032256chr12----1401 --
NM_032265chr171113 ------
NM_032288chr332066 1788 895 1573 ----
NM_032312chr21633 ------
NM_032321chr283141 2903 2028 586 559 319 143 92 53312 3000 2216 706 592 12067 --
NM_032373chr1095637 4577 3687 2354 2147 1590 1087 1052 567 31843 1807 334 --24125 4059
NM_032410chr81238 ------
NM_032438chr62650 553 11685 ----
NM_032439chr101628 11116 2522 132 --
NM_032440chr1062182 951 711 486 400 64 12891 123 --
NM_032445chr1582487 2442 2342 1953 1758 1695 466 278 21969 543 22018 262 --
NM_032446chr5123612 3593 3562 3298 3039 2877 2784 2518 1068 643 497 46 22666 235 ----
NM_032449chr172609 1941 1783 677 614 199 54 12908 12646 22825 1050
NM_032457chr453033 2664 1544 924 815 23152 1256 33844 3804 3636 --
NM_032458chrX63025 2369 927 464 381 174 12590 12152 --
NM_032466chr821462 1120 --192 11153
NM_032468chr821462 1120 --192 11153
NM_032491chr1241258 1201 1135 338 1930 ----
NM_032499chr151255 21678 208 ----
NM_032505chr342512 2225 750 207 --1302 --
NM_032521chr2053119 2892 2635 2353 287 11009 ----
NM_032523chr23100 63 53 ------
NM_032552chr931954 1878 1567 ------
NM_032582chr1761838 1812 1472 1437 1426 394 11821 1743 --
NM_032632chr1441750 352 236 223 21830 1479 11484 --
NM_032689chr1911457 31624 1589 578 ----
NM_032778chr393286 3110 2846 2599 2529 2304 865 372 193 11248 ----
NM_032804chr1062508 2405 2087 917 595 507 --12173 --
NM_032826chr744562 3946 2136 92 --1913 15370
NM_032828chr1994159 3609 3143 1965 1352 1035 821 634 294 54827 3252 1771 1683 404 13793 --
NM_032833chr142667 2620 2526 1819 1844 ----
NM_032837chr1761904 1601 867 833 487 330 ------
NM_032839chr31157 ------
NM_032859chr1352972 2830 2672 2425 1482 1417 ----
NM_032873chr1174497 3649 3578 3365 1056 890 302 24516 1529 24172 3405 13438
NM_032900chr1043543 3506 249 127 22888 2638 1353 --
NM_032949chr131399 1519 ----
NM_032961chr42908 148 21212 1136 ----
NM_032967chrX1413 --2744 338 --
NM_032968chrX73692 3674 3100 946 729 139 101 --23775 746 12820
NM_032969chrX73692 3674 3100 946 729 139 101 --23775 746 12820
NM_032973chrY73684 3666 3095 946 729 139 101 --23767 746 12815
NM_032975chr1853602 3411 2517 898 219 --12256 22755 308
NM_032978chr1851202 975 473 192 161 ------
NM_032979chr1851202 975 473 192 161 ------
NM_032980chr1853602 3411 2517 898 219 --12256 22755 308
NM_032981chr1851202 975 473 192 161 ------
NM_033014chr951480 1467 1421 517 252 21146 1032 ----
NM_033020chr144561 4089 1642 864 14135 33266 3192 935 11368
NM_033030chr241527 362 87 32 ------
NM_033044chr121008 473 --11224 --
NM_033055chr1--1277 1929 --
NM_033081chr201540 31251 934 529 --11486
NM_033138chr731612 782 687 22157 584 ----
NM_033139chr731612 782 687 22157 584 ----
NM_033140chr731612 782 687 22157 584 ----
NM_033157chr731612 782 687 22157 584 ----
NM_033160chr91654 ------
NM_033181chr643817 3321 3243 2682 12412 ----
NM_033196chr1951572 1233 1151 587 227 ------
NM_033211chr552047 1806 1527 1314 111 ----1212
NM_033221chr992725 2686 2076 1942 1838 1135 730 511 417 12425 12479 --
NM_033224chr7137958 7393 7373 7103 7054 6754 5620 4893 3201 2523 2326 2280 283 36866 6430 1705 35896 5242 528 --
NM_033225chr822689 877 1190 1982 --
NM_033226chr164685 662 244 227 ------
NM_033281chr52318 290 ------
NM_033285chr863699 3688 3313 2834 839 764 1250 ----
NM_033326chr111445 32105 1835 1755 --1101
NM_033331chr953241 3229 3104 2312 1047 23613 51 ----
NM_033360chr1294392 4100 3876 3391 2928 1343 805 769 515 43540 3315 3222 753 23019 1756 --
NM_033364chr331845 1401 267 31631 1592 546 ----
NM_033380chrX1326 ------
NM_033381chrX1326 ------
NM_033394chr211537 --11610 --
NM_033407chr12643 458 ------
NM_033425chr1143522 3476 3194 1371 --22835 1156 --
NM_033427chr72831 778 2820 726 ----
NM_033429chr1562868 2839 1038 216 141 50 12316 --1125
NM_033430chr453221 1316 1118 670 362 --12666 --
NM_033437chr453221 1316 1118 670 362 --12666 --
NM_033505chr2106650 6481 5873 5329 4808 4703 1720 1706 1373 201 25471 5369 12361 --
NM_033549chr5--1670 ----
NM_033632chr451281 1238 504 389 294 1410 ----
NM_033644chr542355 2322 2252 46 1624 12534 --
NM_033645chr542355 2322 2252 46 1624 12534 --
NM_033656chr2174567 3944 3708 2087 1755 1694 1103 34699 4068 251 12137 14665
NM_052827chr121923 ------
NM_052832chr853047 2604 2362 407 161 2797 141 141 --
NM_052840chr15--11179 --1435
NM_052879chr1232609 710 427 23500 1552 1926 --
NM_052885chr1294387 4054 3684 3648 3546 3147 1492 1476 824 21458 368 ----
NM_052886chr81542 21763 366 1510 --
NM_052905chr241910 1572 677 48 21500 82 --1528
NM_052910chr1332066 1867 1848 11943 --11745
NM_052917chr263349 2525 1312 1078 475 219 12119 ----
NM_052918chr10103741 3713 3395 3359 3310 2566 2446 1046 589 554 13719 --1915
NM_052923chr61177 ------
NM_052927chr511409 41696 1605 722 255 ----
NM_052932chr112450 52 1722 ----
NM_052937chr822283 1693 ----12748
NM_052951chr201203 ------
NM_052958chr82679 666 ------
NM_052965chr121266 908 1236 1415 --
NM_052978chr1441680 1503 1326 346 21667 1230 ----
NM_053002chr321133 421 1802 1820 --
NM_053006chr221129 ------
NM_053016chr998035 7555 7386 7130 6892 6410 5868 2750 2483 35362 4853 79 26758 3158 --
NM_053023chr1173000 2763 2571 2453 2379 2189 1130 22303 1211 ----
NM_053024chr331537 595 351 ------
NM_053043chr7106276 5641 5078 4840 4411 4352 4090 1268 1118 1063 26393 2441 14318 --
NM_053064chr1472553 2465 2227 1999 1235 329 215 33014 2240 1985 ----
NM_054012chr91227 ------
NM_057159chr951493 1479 1194 481 296 1289 ----
NM_057169chr121245 2882 344 1172 --
NM_057170chr121245 2882 344 1172 --
NM_057175chr472332 2190 1906 895 810 704 316 --12563 --
NM_057178chr1762126 2058 1896 890 720 464 11881 12082 --
NM_057180chr121444 1170 1371 --
NM_058172chr421631 372 ------
NM_058241chr22454 253 11984 11626 --
NM_058241chr22454 253 11984 11626 --
NM_078629chrX3590 498 69 --2250 29 --
NM_078630chrX3590 498 69 --2250 29 --
NM_080425chr20142 ------
NM_080426chr20142 ------
NM_080546chr982246 2214 2202 1903 1747 500 268 59 ------
NM_080604chr61689 ------
NM_080629chr131396 984 603 ------
NM_080630chr131396 984 603 ------
NM_080645chr642210 434 353 314 22142 613 11818 11752
NM_080676chr2063255 3148 2804 2707 2549 764 22399 982 ----
NM_080738chr141939 1376 733 639 --11532 1438
NM_080743chr631943 1917 383 11610 12214 --
NM_080832chrX41702 1356 649 434 11565 ----
NM_080867chr1484675 4097 3722 3263 3252 2017 1457 1288 24581 1722 --11180
NM_080872chr821507 423 24047 894 23450 1516 13328
NM_080927chr363060 2510 2391 2174 985 146 23014 2566 ----
NM_130386chr181138 --2436 118 --
NM_130391chr933086 2544 1334 --23461 113 --
NM_130392chr933086 2544 1334 --23461 113 --
NM_130393chr933086 2544 1334 --23461 113 --
NM_130434chr1521063 246 1745 --11116
NM_130435chr1042947 2750 2721 982 --12811 --
NM_130436chr2132784 2721 339 22103 1088 --1679
NM_130438chr2133361 3298 916 22680 582 --11256
NM_130439chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_130439chr1062249 2237 1982 1503 1492 424 21858 126 ----
NM_130798chr1541578 1565 1415 1333 ------
NM_130809chr582915 2909 2896 2046 1009 919 717 434 ------
NM_130838chr1541784 1367 1146 403 21163 658 1559 1212
NM_130839chr1541784 1367 1146 403 21163 658 1559 1212
NM_130846chr1231010 813 53 ------
NM_130850chr141250 ------
NM_130851chr141250 ------
NM_133170chr2086876 6347 6134 5696 5531 1542 1391 342 26550 733 16573 --
NM_133264chr1743773 2996 2870 1473 13865 --23707 3680
NM_133265chrX63604 3198 3124 2644 2229 1020 13221 21168 586 --
NM_133329chr231832 1206 601 --11464 --
NM_133334chr444288 2513 1502 176 35144 4008 1467 ----
NM_133338chr51494 197 2368 345 --
NM_133339chr51494 197 2368 345 --
NM_133340chr51494 197 2368 345 --
NM_133341chr51494 197 2368 345 --
NM_133342chr51494 197 2368 345 --
NM_133343chr51494 197 2368 345 --
NM_133344chr51494 197 2368 345 --
NM_133433chr51814 2922 859 ----
NM_133445chr993519 3373 2983 2533 2363 1436 797 783 80 ------
NM_133459chr1821917 586 --11891 --
NM_133468chr722549 2339 1176 ----
NM_133473chr1931866 1592 450 11256 1767 --
NM_133478chr222397 894 1850 21585 85 --
NM_133484chr21119 ------
NM_133493chr643898 3392 3338 1259 --24015 3314 --
NM_133496chr194324 4310 3954 1790 1290 1192 836 810 169 23173 3038 ----
NM_133507chr123971 817 711 2274 173 ----
NM_133510chr14--1392 ----
NM_133638chr531228 1012 405 ----141
NM_133647chr1562667 1306 648 415 325 93 33387 2643 1286 ----
NM_134265chr1741215 1051 872 77 ------
NM_134442chr22381 118 --11679 1133
NM_134447chr19--1544 --1413
NM_138270chrX42606 1188 745 87 1831 ----
NM_138288chr1431672 1641 503 ------
NM_138316chr101387 1461 11287 --
NM_138317chr142444 149 1109 ----
NM_138318chr142444 149 1109 ----
NM_138333chr932651 1875 80 1458 --1689
NM_138335chr44845 786 704 72 1856 ----
NM_138348chr586514 5532 4739 4692 4417 4294 1585 967 24965 2419 ----
NM_138391chr1----1173 --
NM_138423chr1532076 570 236 --11992 --
NM_138434chr711457 ----1119
NM_138444chr1364964 4900 4417 4407 3233 601 13826 ----
NM_138448chr2----1172 --
NM_138468chr2146315 6090 6020 5821 5712 5468 4584 4508 4151 1854 1831 1669 1215 883 1253 33887 2353 1525 --
NM_138473chr1295186 4930 4580 3921 3309 3157 2053 1795 717 34517 3424 2006 14373 --
NM_138554chr942762 2226 1128 605 ------
NM_138555chr152471 180 ----1130
NM_138576chr1434586 4321 4036 ------
NM_138621chr294211 3889 3453 3184 2680 1592 1559 453 160 14159 ----
NM_138690chr191106 ------
NM_138694chr683377 2975 2941 2525 2437 786 203 98 43662 3587 3404 799 1917 1411
NM_138711chr31187 ------
NM_138712chr31187 ------
NM_138713chr16158046 7979 7200 6538 6210 5886 5457 5277 2602 2527 2062 1812 900 447 176 13293 --18257
NM_138714chr16158046 7979 7200 6538 6210 5886 5457 5277 2602 2527 2062 1812 900 447 176 13293 --18257
NM_138731chr1463503 3490 3345 1448 1358 258 32763 606 210 12599 --
NM_138735chr231088 506 380 1991 21048 968 --
NM_138768chr112219 74 ----1864
NM_138771chr751289 1276 1106 486 436 21371 611 ----
NM_138773chr5----1898 --
NM_138782chr521928 924 1128 --21881 210
NM_138819chrX2469 124 ------
NM_138959chr176775 6122 5996 5824 2215 578 312 14163 31776 1688 1065 --
NM_138966chr183588 517 25 1131 ----
NM_138967chr15----12245 --
NM_138969chr831339 1006 941 1975 --1539
NM_139136chr1271088 802 711 438 401 285 213 --1857 --
NM_139182chr431817 417 372 21551 80 11195 --
NM_139207chr1281868 1629 812 689 299 283 189 173 11727 --1489
NM_139279chr233509 3087 3049 13384 42901 2370 502 94 --
NM_139283chr1232059 1942 1788 11769 ----
NM_139319chr1211278 ----11330
NM_139321chr2074140 4058 3246 2684 887 502 343 21690 230 ----
NM_144567chr152849 2560 2199 1880 908 22037 385 ----
NM_144571chr496880 6717 6263 6111 5882 4412 1180 532 285 35115 4697 393 27043 2122 16095
NM_144574chr141615 ------
NM_144578chr14105279 4676 4220 3535 1690 1618 1298 1247 296 143 2856 305 ----
NM_144599chr1585380 5265 3679 1823 1750 1560 1209 1051 14266 ----
NM_144609chr1731256 1081 527 1157 ----
NM_144618chr121336 158 1114 11555 --
NM_144718chr351570 955 725 188 149 ------
NM_144721chr431867 1854 205 --22306 1729 12664
NM_144728chr11366 ------
NM_144729chr11366 ------
NM_144778chr1382373 1693 1042 930 464 407 228 48 32555 336 107 12111 11882
NM_144949chr252580 2078 1781 1695 29 4919 884 217 198 ----
NM_144967chrX2833 771 1927 21021 951 --
NM_144973chr1254726 4675 4176 1153 49 22097 838 ----
NM_144974chr13148 ------
NM_145011chr1021541 863 21671 461 --1110
NM_145055chr1863836 3444 3104 3030 1436 955 12539 12421 --
NM_145174chr2231461 1363 576 3978 570 426 1287 --
NM_145176chr621207 824 43289 3042 599 592 1484 23181 2838
NM_145203chr134711 606 275 95 1639 ----
NM_145206chr1043350 3047 1088 273 --12190 --
NM_145244chr451192 585 63 55 48 ----1154
NM_145246chr1021236 181 ------
NM_145251chr141565 ----1110
NM_145259chr286528 6171 6057 5407 4347 2557 1836 706 15571 --25739 2593
NM_145274chr172932 220 1268 ----
NM_145284chrX21551 32 1427 --11674
NM_145307chr1074622 4446 4431 3359 1647 1444 1014 11331 13592 13316
NM_145320chr782929 2760 2216 1210 723 431 329 238 12482 12562 --
NM_145321chr782929 2760 2216 1210 723 431 329 238 12482 12562 --
NM_145322chr782929 2760 2216 1210 723 431 329 238 12482 12562 --
NM_145686chr233392 3254 2502 23291 2920 --11218
NM_145687chr233392 3254 2502 23291 2920 --11218
NM_145727chr631184 981 353 ------
NM_145735chr1372707 1964 1740 1078 853 298 156 11858 ----
NM_145739chr23100 63 53 ------
NM_145753chr341406 1096 675 403 2582 568 ----
NM_145800chrX2660 283 1167 --1350
NM_145802chrX2609 232 1116 --1299
NM_145861chr141939 1376 733 639 --11532 1438
NM_145893chr162486 471 31161 511 262 ----
NM_147150chr963672 3649 3366 2672 985 66 23004 802 1821 21516 1229
NM_147166chr72761 62 1128 1630 --
NM_147175chrX42120 1823 519 449 12208 ----
NM_147181chr461274 1111 984 505 69 43 --11074 --
NM_147182chr461274 1111 984 505 69 43 --11074 --
NM_147183chr461274 1111 984 505 69 43 --11074 --
NM_147189chr842322 2176 856 355 --11572 --
NM_147223chr232027 1857 914 --42357 1903 1700 172 12203
NM_147233chr231844 1674 731 --32174 1720 1517 12020
NM_148894chr41166 ------
NM_148898chr741010 932 904 755 ------
NM_148899chr741010 932 904 755 ------
NM_148904chr12585 157 1107 ----
NM_148905chr12585 157 1107 ----
NM_148906chr12585 157 1107 ----
NM_148907chr12585 157 1107 ----
NM_148908chr12585 157 1107 ----
NM_148909chr12585 157 1107 ----
NM_148977chr101387 1461 11287 --
NM_148978chr101387 1461 11287 --
NM_152230chr102195 175 ------
NM_152236chr221192 ------
NM_152237chr2211686 ------
NM_152261chr1241758 938 111 85 42162 1611 392 72 ----
NM_152263chr135996 5423 2296 11978 34999 4176 1128 --
NM_152277chr562050 1872 1641 1542 552 135 1217 1281 --
NM_152278chrX124 --1573 --
NM_152282chr321267 518 11275 ----
NM_152284chr83951 804 695 --1347 --
NM_152290chr11202 ------
NM_152291chr451095 995 915 819 62 2687 335 ----
NM_152317chr12174 ----136
NM_152325chr13178 ------
NM_152388chr273906 3624 3370 2921 1035 595 287 1925 ----
NM_152407chr553300 2078 771 537 292 22137 1126 --1308
NM_152409chr572645 2605 1064 730 327 229 152 22909 745 ----
NM_152417chr8--1198 ----
NM_152423chrX71354 1326 1244 1225 1018 516 22 1335 ----
NM_152424chrX43463 1348 930 671 14514 13623 --
NM_152429chr1031198 1128 475 1972 --11564
NM_152448chr151502 ------
NM_152450chr1541331 794 710 610 ------
NM_152519chr24857 534 372 24 ------
NM_152523chr21303 1709 ----
NM_152529chr274398 4275 4115 3615 1571 975 920 1857 44025 3225 1383 517 --
NM_152542chr472160 2101 1808 1485 395 306 204 11393 1770 --
NM_152556chr742179 1833 474 222 ------
NM_152570chr92293 73 ------
NM_152586chr1021023 369 130 1226 --
NM_152588chr1261800 1505 1497 1258 1210 401 ------
NM_152589chr121204 ------
NM_152594chr1541956 517 451 278 21791 429 ----
NM_152605chr1931169 1053 908 ------
NM_152622chr583256 2959 2368 2251 2195 598 193 24 2545 136 ----
NM_152624chr5137125 7087 6183 6103 5779 4795 2988 2234 2057 1563 1292 1173 415 16379 1752 --
NM_152629chr953108 2818 1529 1370 718 43556 3006 2899 2542 1391 --
NM_152630chrX61077 967 567 289 162 110 11579 1149 1122
NM_152641chr122971 224 32507 2298 2261 ----
NM_152665chr13505 357 121 ------
NM_152673chr344374 3626 1424 626 33467 1663 1176 23701 880 --
NM_152678chr342477 2379 2355 1801 --22143 943 --
NM_152682chr471591 1274 1130 559 476 461 358 11307 ----
NM_152686chr552417 2114 650 585 525 --22058 1760 --
NM_152688chr641003 740 370 124 1816 ----
NM_152695chrX41795 1650 801 271 21564 242 12024 --
NM_152713chr111230 ------
NM_152723chr112741 130 --1393 --
NM_152724chr1032638 2135 833 22557 2043 1256 --
NM_152734chr645503 4706 3652 85 11304 21905 1011 --
NM_152744chr751257 1236 900 337 162 ------
NM_152756chr563286 2659 698 489 418 155 13225 --11394
NM_152758chr812313 21147 817 --12937
NM_152765chr852306 1536 886 755 190 --22110 1766 --
NM_152774chr762526 2461 2238 1928 1063 1016 11982 ----
NM_152787chrX33447 854 725 11116 ----
NM_152789chr72919 61 172 ----
NM_152793chr735181 4686 4131 25042 500 11196 --
NM_152830chr171236 ------
NM_152835chr122761 2276 ----22774 832
NM_152838chr2052930 2501 2421 2316 740 --12208 --
NM_152890chr1--1398 --1836
NM_152896chr96720 582 331 212 175 115 --1282 --
NM_152902chr112060 21856 1671 1166 --
NM_152903chr1352329 1790 1768 1755 33 --1692 --
NM_152924chr1536722 5120 1518 16287 15549 25701 2012
NM_152989chr1251810 1667 1230 1219 663 ------
NM_152999chr7114880 4786 4705 4573 3520 3435 3311 1714 757 248 129 14920 21852 1784 --
NM_153013chr532249 206 63 ------
NM_153020chr621246 340 21476 419 ----
NM_153035chr122211 717 12964 53161 2023 790 510 390 --
NM_153042chr6--11808 1226 --
NM_153181chr183588 517 25 1131 ----
NM_153182chr393286 3110 2846 2599 2529 2304 865 372 193 11248 ----
NM_153184chr32467 178 ------
NM_153188chr511281 65715 4727 4239 3985 1548 533 ----
NM_153207chr1262845 2797 751 657 623 514 34023 2556 1470 --1386
NM_153223chr531305 289 266 ------
NM_153235chr612360 42427 1742 804 438 ----
NM_153261chr1631280 332 117 11502 1610 --
NM_153262chr173245 2663 2199 2082 2063 1143 752 ------
NM_153267chr94915 840 657 193 ------
NM_153332chr883267 3206 3153 2897 2806 2378 990 246 ------
NM_153333chrX2622 584 ------
NM_153354chr53815 795 738 1186 ----
NM_153362chr61742 ----1636
NM_153365chr42851 831 --12591 --
NM_153374chr153529 123 66 1503 ----
NM_153377chr12--1145 ----
NM_153449chr12--1498 ----
NM_153456chr1315813 25853 4337 14297 25301 1322
NM_153607chr573183 2329 1080 943 929 207 111 ------
NM_153613chr151165 ------
NM_153619chr1553202 2994 2680 1406 261 22822 528 --11110
NM_153634chr1251527 1475 1415 1299 278 21149 593 11038 130
NM_153645chr2232788 1142 201 32612 2094 180 ----
NM_153649chr131950 1882 293 11842 1722 --
NM_153685chr1211198 ------
NM_153689chr232119 721 308 31659 784 469 1646 --
NM_153694chr122258 47 --1184 --
NM_153702chr4--1239 --187
NM_153712chr243172 2636 1300 1165 22716 2326 ----
NM_153748chr1271088 802 711 438 401 285 213 --1857 --
NM_153809chr91627 ------
NM_153810chr1084292 3883 3817 3221 1662 1041 942 625 --23384 3259 --
NM_153828chr21162 1862 ----
NM_153831chr83858 653 363 1756 ----
NM_170665chr1254390 1319 1171 67 42 ------
NM_170672chr231131 195 179 11259 --1599
NM_170674chr1551116 569 367 147 63 ------
NM_170675chr153792 245 43 ------
NM_170676chr153792 245 43 ------
NM_170677chr1551116 569 367 147 63 ------
NM_170706chr134376 3933 3000 23658 3638 11719 --
NM_170709chr851708 424 365 127 93 11893 1763 --
NM_170710chr442682 2584 2390 222 12701 ----
NM_170751chr611035 21402 195 ----
NM_170752chr611035 21402 195 ----
NM_171998chrX111625 1611 1585 1559 702 692 657 514 430 421 337 11861 11995 12410
NM_172037chr851396 1289 537 318 157 --11158 --
NM_172070chr241587 756 315 250 12212 ----
NM_172071chr186066 5995 5875 5011 2355 1611 1251 707 34749 2331 967 1953 --
NM_172097chr151268 1155 ----
NM_172103chr632695 1755 797 --1909 --
NM_172105chr632695 1755 797 --1909 --
NM_172127chr441849 560 374 259 12014 1231 --
NM_172128chr441805 516 330 215 11970 1187 --
NM_172159chr342093 1990 1760 865 --1918 --
NM_172160chr342093 1990 1760 865 --1918 --
NM_172193chr1431325 459 314 21061 212 ----
NM_172216chr1252932 910 875 791 366 ------
NM_172315chr1551116 569 367 147 63 ------
NM_172316chr1551116 569 367 147 63 ------
NM_172344chr231832 1206 601 --11464 --
NM_172373chr1351169 503 376 163 53 ------
NM_173039chr111165 ------
NM_173082chr621069 635 11527 ----
NM_173084chr372032 1916 1850 1725 1499 569 106 ------
NM_173177chr21493 ------
NM_173198chr932038 825 364 13011 12657 --
NM_173200chr932038 825 364 13011 12657 --
NM_173214chr16158046 7979 7200 6538 6210 5886 5457 5277 2602 2527 2062 1812 900 447 176 13293 --18257
NM_173216chr332702 2178 2049 1434 ----
NM_173217chr332702 2178 2049 1434 ----
NM_173355chr21214 ------
NM_173359chr31141 1672 ----
NM_173468chr4145812 5773 5458 4659 4586 4117 4015 4001 3794 1950 1724 1695 1678 308 34837 1815 752 11016 --
NM_173495chrX62387 2235 2210 2107 1041 71 1350 1398 --
NM_173500chr153938 166 131 ------
NM_173510chr2272763 2137 1826 979 812 385 319 ------
NM_173531chr1953413 3182 2729 2446 353 1728 1494 --
NM_173550chr9144 ------
NM_173552chr341810 1605 1554 874 12228 22139 955 --
NM_173554chr10----1269 --
NM_173576chr1032307 2255 220 1925 12008 --
NM_173582chr1164621 4165 2119 1985 1678 148 55057 4204 1108 1008 61 35262 2030 1403 --
NM_173602chr1253338 693 585 504 444 23671 1180 --1253
NM_173607chr144859 820 639 93 12132 --21670 1626
NM_173642chr1149126 7840 7474 7391 6827 6241 3451 3169 2226 1724 1686 1097 882 691 38501 8356 7783 12852 --
NM_173665chr5----1576 --
NM_173666chr551179 1154 1049 921 542 ------
NM_173683chr82624 564 --1463 --
NM_173694chrX3530 65 22 ----21957 93
NM_173794chrX1113 --135 --
NM_173797chr531190 905 312 11075 ----
NM_173808chr1104328 4081 3708 3503 3255 3070 3001 1089 650 243 43940 2988 1469 184 ----
NM_173812chr1241327 1250 332 161 ------
NM_173822chr231379 798 424 11698 1631 --
NM_173825chr372709 2665 2312 2208 2065 2008 72 12800 11899 --
NM_173851chr853670 3320 1136 565 279 43765 1440 1282 908 --11158
NM_174909chr53768 325 176 ------
NM_174911chr873656 3649 3461 3137 2990 2800 800 13612 --13173
NM_174916chr1562023 1990 879 704 385 168 11479 12232 --
NM_174938chr92504 445 ------
NM_175056chr33801 499 48 ------
NM_175061chr752209 1880 1818 1737 1422 11855 ----
NM_175607chr341254 528 449 382 ------
NM_175612chr341254 528 449 382 ------
NM_175623chr1297711 7643 7384 6879 5818 2501 2393 907 834 57024 5679 2359 1896 359 47353 7281 5302 2893 --
NM_175624chr1297806 7738 7479 6974 5913 2596 2488 1002 929 57119 5774 2454 1991 454 47448 7376 5397 2988 --
NM_175625chr1297806 7738 7479 6974 5913 2596 2488 1002 929 57119 5774 2454 1991 454 47448 7376 5397 2988 --
NM_175736chr1287605 7281 7075 6572 6534 5015 2483 345 --22413 683 --
NM_175748chr1421960 1777 12127 ----
NM_175767chr551321 627 261 198 173 21385 68 ----
NM_175854chr1321901 723 12805 ----
NM_175873chr521454 1044 --11056 1339
NM_175907chr1842859 2239 2088 62 12193 1516 --
NM_175931chr164767 556 489 140 11470 41976 1661 1426 218 --
NM_176814chr731462 1367 251 ----1137
NM_176823chr153842 3722 3149 1138 111 ------
NM_177414chr121570 1446 21744 1619 ----
NM_177424chr12139 132 11867 ----
NM_177438chr1444051 3860 2839 1209 33631 3536 1462 14205 12738
NM_177559chr201236 11142 ----
NM_177560chr201236 11142 ----
NM_177947chrX21607 44 ------
NM_177948chrX21607 44 ------
NM_177951chr144904 575 177 82 1320 ----
NM_177952chr145774 732 539 328 155 ------
NM_177966chr321609 1228 21930 1483 ----
NM_177974chr1532076 570 236 --11992 --
NM_177985chr251799 1747 1497 912 861 --1820 --
NM_177990chr2042027 1877 1467 1293 22042 1383 ----
NM_178010chr1251810 1667 1230 1219 663 ------
NM_178011chr1032825 2443 345 32501 727 373 --1645
NM_178123chr24935 876 289 173 1225 ----
NM_178150chr101291 ------
NM_178151chrX117807 6638 6361 6226 6021 2864 2842 1857 1763 1464 205 ------
NM_178152chrX117807 6638 6361 6226 6021 2864 2842 1857 1763 1464 205 ------
NM_178153chrX117807 6638 6361 6226 6021 2864 2842 1857 1763 1464 205 ------
NM_178169chr122412 375 ------
NM_178426chr13872 106 77 ----150
NM_178498chr11123997 3947 3409 3051 3034 2835 2551 2524 1409 677 629 242 42945 2916 520 155 23544 536 --
NM_178509chr1724154 4030 127 --11294
NM_178539chr1252065 1970 1851 1635 344 21891 437 ----
NM_178568chr1721776 709 --2626 605 --
NM_178585chr4113161 3036 2400 2337 1110 923 547 512 467 413 334 22267 1211 --13242
NM_178815chr1052765 2565 795 381 222 11036 12117 --
NM_178868chr3199 ------
NM_180989chr1352389 1648 499 439 276 31793 1549 137 1907 --
NM_180991chr551070 831 818 606 358 ------
NM_181054chr141120 ------
NM_181265chr442682 2584 2390 222 12701 ----
NM_181291chr141780 ------
NM_181302chr141615 ------
NM_181308chr141615 ------
NM_181332chrX2841 259 42246 1938 598 397 ----
NM_181358chr144133 4041 1474 470 ------
NM_181443chr2062727 1949 1883 998 554 189 ------
NM_181453chr241675 1545 1436 357 ------
NM_181458chr231325 488 92 ------
NM_181481chr1856780 5880 4845 2687 1542 12619 ----
NM_181482chr1856780 5880 4845 2687 1542 12619 ----
NM_181483chr1856780 5880 4845 2687 1542 12619 ----
NM_181504chr554083 3467 1431 1003 733 23968 1368 --11443
NM_181521chr1687257 6928 5743 5686 5154 5081 2239 1132 12677 16876 --
NM_181523chr554083 3467 1431 1003 733 23968 1368 --11443
NM_181524chr554083 3467 1431 1003 733 23968 1368 --11443
NM_181581chr72908 724 ------
NM_181659chr2033116 2109 821 12870 ----
NM_181659chr2033116 2109 821 12870 ----
NM_181661chr8--1104 ----
NM_181670chr1211513 11441 ----
NM_181671chr173891 761 754 ------
NM_181672chrX3712 192 24 11612 ----
NM_181673chrX3712 192 24 11612 ----
NM_181706chr1162199 1995 1985 784 521 126 ----11542
NM_181746chr15938 784 729 698 50 ------
NM_181762chrX2881 227 ------
NM_181777chrX2881 227 ------
NM_181783chr1242024 1477 424 302 21450 657 ----
NM_181787chr863859 3608 3495 1296 452 31 23730 1557 12836 11030
NM_181836chr562329 2059 1946 1031 593 321 ----12139
NM_181897chr351834 1680 1019 767 576 --1963 --
NM_182485chr453758 3375 786 709 117 --23703 3086 --
NM_182490chr192423 89 ------
NM_182493chr1694932 4184 4123 1998 1865 1715 1309 346 37 14908 34138 3469 1283 --
NM_182515chr1966554 6392 6086 1875 1675 924 76334 5352 5164 4389 4124 1542 1304 54712 4349 4167 960 757 --
NM_182565chr171260 1233 ----
NM_182569chr17--1154 ----
NM_182594chr52315 84 --1351 --
NM_182641chr174597 445 146 56 1678 2820 720 --
NM_182643chr82803 586 22043 109 --11981
NM_182646chr453758 3375 786 709 117 --23703 3086 --
NM_182700chr741761 1594 1315 1286 ------
NM_182756chr22627 601 3498 57 38 ----
NM_182763chr162572 2263 2096 1957 907 436 --11790 12724
NM_182765chr1031951 1678 893 1558 --1405
NM_182830chr1461808 1446 893 756 110 88 1910 ----
NM_182848chr1321002 100 ------
NM_182896chr341777 1623 325 288 1415 --1554
NM_182898chr7116505 5626 5620 5245 5021 4374 4154 2039 1562 1202 195 ------
NM_182899chr7116505 5626 5620 5245 5021 4374 4154 2039 1562 1202 195 ------
NM_182907chr622365 1971 --12157 --
NM_182917chr31444 ------
NM_182931chr71741 ------
NM_182943chr331166 473 422 ------
NM_182944chr141322 ------
NM_182948chr183137 3075 2911 2547 2148 1208 1098 610 33163 2432 2005 ----
NM_182975chr11416 1209 1942 138
NM_183004chr1483696 3653 3404 2945 2829 2386 858 811 23302 907 ----
NM_183075chr413029 32951 2546 927 12013 1762
NM_183078chr653550 3046 2767 1135 966 32633 2530 942 23081 129 --
NM_183227chr621336 1102 21110 31 ----
NM_183234chr151608 ----11517
NM_183235chr151608 ----11517
NM_183236chr151608 ----11517
NM_183238chr1283226 2660 1472 1135 1112 840 623 507 ------
NM_183376chr1542589 2526 2154 1928 1857 ----
NM_183381chr36923 806 741 636 292 131 ------
NM_183383chr36923 806 741 636 292 131 ------
NM_183384chr36923 806 741 636 292 131 ------
NM_183393chr32751 694 2917 783 2128 96 --
NM_183394chr32751 694 2917 783 2128 96 --
NM_183397chr2073762 3608 2062 1433 566 325 223 --21877 1412 14891
NM_183419chr83180 71 26 31460 431 62 ----
NM_183422chr134949 785 695 669 ------
NM_184234chr201542 1257 ----
NM_194247chr2124331 4169 3590 3546 3301 2868 2860 1477 864 496 250 223 23979 1236 ----
NM_194250chr22456 41 ------
NM_194282chr433084 2502 924 22832 1079 185 --
NM_194283chr522941 100 33892 302 106 11229 --
NM_194285chr1143200 3089 1056 525 12595 12873 --
NM_194292chr131745 1263 1209 --11086 --
NM_194314chr1103698 3494 1925 1541 1282 770 609 435 270 141 25218 4288 --14963
NM_194328chr91165 1349 1460 32061 653 151
NM_194329chr91165 1349 1460 32061 653 151
NM_194330chr91165 1349 1460 32061 653 151
NM_194332chr91165 1349 1460 32061 653 151
NM_194434chr1875735 4899 3700 3631 2156 1501 974 35634 4527 1299 --14273
NM_194442chr121208 1148 21365 596 --11709
NM_194454chr741568 475 382 255 11286 ----
NM_194455chr741568 475 382 255 11286 ----
NM_194456chr741568 475 382 255 11286 ----
NM_194463chrX147 2954 920 ----
NM_197941chr552839 2631 2253 2222 543 32623 651 527 21059 416 --
NM_197970chr241527 362 87 32 ------
NM_197977chr92907 890 --1154 --
NM_198066chr1493086 2803 2287 2091 2071 1104 714 577 493 22553 1910 ----
NM_198128chr1822357 778 22302 61 --1515
NM_198150chr561517 1503 1105 1057 410 93 11087 1272 --
NM_198158chr332089 540 34 11121 --21919 195
NM_198159chr332089 540 34 11121 --21919 195
NM_198177chr332089 540 34 11121 --21919 195
NM_198178chr332089 540 34 11121 --21919 195
NM_198181chr1582846 2454 2437 2208 2040 2028 1841 408 22765 962 ----
NM_198196chr342408 2286 2279 339 22394 436 11966 --
NM_198212chr762244 2104 1863 1662 385 74 1475 ----
NM_198217chr1321051 763 1223 ----
NM_198218chr1321051 763 1223 ----
NM_198219chr1321051 763 1223 ----
NM_198225chr1011434 1587 11931 --
NM_198241chr31444 ------
NM_198242chr31444 ------
NM_198244chr31444 ------
NM_198268chr144133 4041 1474 470 ------
NM_198269chr144133 4041 1474 470 ------
NM_198270chrX73206 3184 1319 1024 536 518 378 23508 443 ----
NM_198273chr552789 2307 2295 1028 160 1878 ----
NM_198391chr201509 ------
NM_198400chr1582831 2360 2335 928 605 511 370 81 32655 1147 486 12465 --
NM_198401chr82660 27 21098 174 ----
NM_198450chrX12133 3157 36 24 ----
NM_198465chrX62786 2779 1964 975 581 527 2929 185 ----
NM_198503chr132407 2111 1678 1340 ----
NM_198513chr82497 279 31606 473 164 ----
NM_198569chr652670 1951 1091 907 426 32352 101 63 ----
NM_198578chr1221229 191 ------
NM_198581chr276569 6279 5626 5297 5000 1995 721 56545 5273 4805 1241 498 22927 2626 --
NM_198714chr11141 1517 ----
NM_198715chr176247 5824 5414 4930 2524 1593 655 86147 4040 2107 2063 1919 1310 794 476 ----
NM_198793chr363749 3332 3325 987 359 257 ------
NM_198794chr1431281 172 101 3978 967 82 ----
NM_198829chr731477 1183 1119 1332 ----
NM_198859chr354133 3732 2017 1026 800 --13893 --
NM_198880chr31494 ------
NM_198900chr1287605 7281 7075 6572 6534 5015 2483 345 --22413 683 --
NM_198904chr52847 346 ----1277
NM_198956chr741761 1594 1315 1286 ------
NM_198992chr1231331 1235 534 ------
NM_199000chr731751 46 26 21945 1840 ----
NM_199039chr4--11049 ----
NM_199044chr132742 539 484 11941 22716 2354 --
NM_199053chr41798 --1157 --
NM_199072chr742987 1282 200 191 --1588 --
NM_199136chr72468 153 ------
NM_199188chr1232609 710 427 23500 1552 1926 --
NM_199190chr1232609 710 427 23500 1552 1926 --
NM_199229chr221227 69 3528 326 184 11369 --
NM_199280chr22125 24 ------
NM_199324chr433246 1467 1032 22928 840 ----
NM_199414chr1521091 428 ------
NM_199421chr1484675 4097 3722 3263 3252 2017 1457 1288 24581 1722 --11180
NM_199436chr262427 2412 2259 2049 992 879 22899 450 ----
NM_199440chr21422 ------
NM_199454chr134545 4516 902 ------
NM_199461chr1043285 3148 2850 728 23372 2718 11343 --
NM_199482chr221704 741 --11576 21547 842
NM_199487chr20------1291
NM_201263chr131821 702 318 ------
NM_201269chr141228 1131 1010 320 1126 ----
NM_201413chr211358 1899 1759 --
NM_201414chr211358 1899 1759 --
NM_201428chr1141560 542 372 202 --1509 --
NM_201429chr1141560 542 372 202 --1509 --
NM_201430chr1141486 468 298 128 --1435 --
NM_201437chr841096 587 78 54 1408 ----
NM_201542chr1158 ------
NM_201548chr241376 1215 566 366 11488 ----
NM_201559chr654594 4353 3026 1929 833 1575 13784 --
NM_201570chr1021811 52 1686 12028 11649
NM_201571chr1021811 52 1686 12028 11649
NM_201572chr1021811 52 1686 12028 11649
NM_201590chr1021811 52 1686 12028 11649
NM_201591chr431854 411 49 21430 422 ----
NM_201592chr431854 411 49 21430 422 ----
NM_201593chr1021811 52 1686 12028 11649
NM_201596chr1021811 52 1686 12028 11649
NM_201597chr1021811 52 1686 12028 11649
NM_201627chr5--166 ----
NM_201999chr44414 227 205 148 21021 180 11227 --
NM_203281chrX2354 305 ------
NM_203301chr14--1657 --1685
NM_203303chrX1205 ------
NM_203350chr151667 1257 493 475 256 ------
NM_203364chr112872 241 1788 ----
NM_203372chr231668 1327 110 ------
NM_203394chr1242206 760 422 335 ----1526
NM_203406chr5112927 2792 1976 1910 1850 921 833 696 653 483 300 22498 732 1906 12018
NM_203446chr2142780 2670 1994 108 22942 2297 ----
NM_203453chr931640 1379 245 21812 1702 11617 1268
NM_203458chr163817 2737 1081 892 808 563 13268 ----
NM_203459chr162456 2297 1885 1596 183 139 ------
NM_203463chr264956 1283 876 568 176 37 1948 14860 13004
NM_203464chr141052 984 794 489 1928 ----
NM_203487chr1341787 1746 1609 1349 --192 --
NM_203488chr141281 ------
NM_203504chr442630 2010 1750 251 1638 ----
NM_203505chr442630 2010 1750 251 1638 ----
NM_205768chr121602 687 12085 ----
NM_205848chr162823 2773 2435 2239 2035 607 ----12326
NM_205860chr142400 2381 633 97 1777 12891 12904
NM_205861chr131716 851 448 --1654 --
NM_206594chr153378 3240 2810 2348 874 12949 1973 12718
NM_206595chr153378 3240 2810 2348 874 12949 1973 12718
NM_206852chr14----1698 --
NM_206853chr674005 3874 3661 3100 2871 748 615 24078 3164 ----
NM_206854chr695266 5135 4922 4361 4132 3693 3552 2009 1876 25339 4425 ----
NM_206855chr676231 6100 5887 5326 5097 4658 4517 26304 5390 ----
NM_206857chr14----1698 --
NM_206866chr2123000 2804 42699 2280 587 315 22004 488 --
NM_206876chr223337 800 --32686 1090 498 12557
NM_206907chr542747 2374 1311 1129 1630 ----
NM_206909chr8108088 7406 5788 5543 3312 3025 2873 2093 1865 333 26426 1886 ----
NM_206914chr1242003 1698 295 121 11756 ----
NM_207015chr362321 2206 1716 1638 545 243 1641 ----
NM_207123chr4--2706 635 ----
NM_207303chr1093561 3435 2755 1485 1017 942 583 317 251 --1684 --
NM_207304chr1362260 929 817 351 294 115 32442 1022 223 11998 11769
NM_207317chr51460 ------
NM_207325chr1941499 1320 396 381 145 ----
NM_207337chr1231108 820 46 ------
NM_207361chr1386282 6127 5037 4337 2236 1935 546 389 45887 5752 4741 3961 25426 1149 --
NM_207372chr1012413 12429 11929 --
NM_207390chr1921049 72 ------
NM_207404chr382259 2241 2009 1859 1722 1387 619 504 --1208 --
NM_207406chr4116472 5476 5316 5300 5118 4906 4195 4169 1647 824 590 66299 5165 5147 5011 581 223 25249 936 --
NM_207422chrX31471 1139 31 --1113 --
NM_207469chr201165 --1621 --
NM_207481chr231257 1247 364 ------
NM_207520chr21162 1862 ----
NM_207521chr21162 1862 ----
NM_207578chr12629 312 ------
NM_207645chr1131117 376 353 11198 ----
NM_207647chr932511 2307 2030 32044 712 313 --12547
NM_212460chr741883 1710 1612 1600 ------
NM_212471chr1771777 1742 1499 794 319 174 63 1751 ----
NM_212472chr1771777 1742 1499 794 319 174 63 1751 ----
NM_212543chr31759 ------
NM_212554chr1041640 447 361 23 1126 ----
NM_212558chr963981 3952 3030 899 650 237 1934 13433 11229
NM_213589chr285507 4824 3729 3625 1242 628 437 122 33735 1618 1210 ----
NM_213594chr1241258 1201 1135 338 1930 ----
NM_213609chr321048 735 1937 1262 --
NM_213611chr121115 ------