TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4703-5p
miRNA Sequence: UAGCAAUACAGUACAAAUAUAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521313 1225 ------
NM_000024chr51542 --1337 --
NM_000037chr81403 12428 ----
NM_000038chr521329 843 --2340 293 --
NM_000052chrX63102 2985 2380 536 282 84 ------
NM_000067chr82667 94 1601 ----
NM_000074chrX2911 888 1760 ----
NM_000081chr141569 614 497 375 11629 ----
NM_000084chrX86949 5502 4950 4734 2153 1855 1653 1343 1251 1677 16505
NM_000088chr1721373 446 ------
NM_000090chr22726 636 ------
NM_000091chr242895 1904 1128 989 --1103 22818 780
NM_000092chr223425 3128 13819 ----
NM_000093chr922216 595 ----1602
NM_000098chr1----1570 --
NM_000108chr731201 574 232 11640 ----
NM_000109chrX52640 2534 2493 1655 515 --22369 241 --
NM_000112chr585432 5391 4910 3585 1971 1672 1542 426 25576 4518 35111 3876 1470 23904 1446
NM_000114chr2021256 1047 ------
NM_000125chr673917 3742 3727 1646 1337 1043 996 ------
NM_000138chr1522602 2297 12042 ----
NM_000161chr1421994 1931 196 2622 449 --
NM_000163chr53782 267 203 ------
NM_000165chr6--1491 ----
NM_000168chr743180 2916 1164 942 1856 1377 1227
NM_000173chr171429 ------
NM_000176chr52594 55 --1107 13192
NM_000192chr12--21517 415 ----
NM_000194chrX2225 159 ----1385
NM_000217chr1255171 2132 1648 833 150 24561 4254 ----
NM_000222chr442114 1726 1575 182 ------
NM_000232chr42604 68 13177 ----
NM_000240chrX21610 1419 1140 ----
NM_000248chr32948 214 ------
NM_000251chr2144 --165 --
NM_000259chr1586332 5916 5883 5550 4804 1545 920 635 22366 1822 22172 853 25678 490
NM_000267chr1763254 3154 3120 1255 948 140 --13439 13203
NM_000276chrX52249 2158 293 195 98 ------
NM_000280chr114959 814 142 37 ------
NM_000297chr421842 59 1124 --1378
NM_000303chr1611175 --11489 --
NM_000304chr171145 --1226 --
NM_000313chr31856 ------
NM_000314chr1023231 2004 22472 2101 22199 2151 --
NM_000321chr1341548 274 251 150 21754 190 21716 1708 --
NM_000325chr4----1636 --
NM_000328chrX2414 38 ------
NM_000329chr13929 802 784 ------
NM_000332chr687138 6926 6865 4868 4614 1281 1234 898 --27177 1853 15378
NM_000345chr42848 412 1940 1320 1979
NM_000346chr1721679 1511 --12002 --
NM_000353chr162448 133 11130 11259 --
NM_000368chr944843 3926 765 426 --24878 37 --
NM_000369chr1441852 1762 711 657 21895 1230 ----
NM_000378chr1131104 1009 364 ------
NM_000390chrX92746 2597 2445 2284 1156 1029 981 923 797 23256 301 --12918
NM_000393chr231891 543 336 ------
NM_000408chr221115 979 --23413 3030 --
NM_000430chr1753778 3589 3220 1488 95 13627 33719 3691 1230 --
NM_000436chr531517 421 409 ------
NM_000448chr1143277 2389 664 180 ------
NM_000452chr1322068 245 --2693 189 --
NM_000459chr93830 653 322 ------
NM_000461chr364077 4044 3771 2830 1725 183 --24210 3303 14467
NM_000462chr1541693 1459 1333 423 ------
NM_000474chr72650 53 ------
NM_000480chr1111620 21673 1556 ----
NM_000484chr212811 46 ------
NM_000489chrX102654 2318 2310 1344 1146 1042 984 532 242 194 21330 29 22224 863 --
NM_000493chr611118 --1956 --
NM_000516chr201312 ------
NM_000522chr721060 56 11301 ----
NM_000523chr21128 ------
NM_000525chr1131626 1619 1542 ------
NM_000551chr321882 133 --11678 --
NM_000555chrX56911 6598 6148 4811 4758 ------
NM_000572chr13976 806 108 ------
NM_000586chr4199 --174 --
NM_000600chr71369 ------
NM_000609chr1031067 809 248 --12977 --
NM_000610chr1142880 439 193 96 --13007 12916
NM_000618chr1265554 4356 1410 1377 411 218 ----14920
NM_000618chr1265554 4356 1410 1377 411 218 ----14920
NM_000619chr12----1494 --
NM_000627chr21719 --1317 --
NM_000633chr1845248 2057 2051 1721 ----13949
NM_000719chr1246646 5064 1541 741 --26235 2261 --
NM_000721chr132381 2302 181 12195 12227 --
NM_000724chr102791 288 --31413 138 132 --
NM_000756chr81319 ------
NM_000780chr81492 1902 2793 790 --
NM_000793chr1443421 2028 1907 396 14137 128 --
NM_000794chr52253 55 ------
NM_000806chr551866 1735 1253 653 87 ----11360
NM_000809chr498582 8272 8208 6825 3530 1697 1514 1016 403 27500 2382 16046 28160 6034
NM_000811chr52289 198 ------
NM_000813chr5125564 5270 4115 3722 3710 1894 1488 1394 1048 876 161 122 11686 14637 --
NM_000814chr1534092 4055 3335 ----1491
NM_000816chr51629 --1154 --
NM_000817chr2----176 1132
NM_000826chr452008 1945 1935 860 222 --1853 32251 758 453
NM_000829chr1112322 ------
NM_000838chr622626 2144 21009 908 ----
NM_000844chr311087 ------
NM_000845chr71371 ------
NM_000859chr521558 248 11512 11408 --
NM_000868chrX31958 1753 225 --199 --
NM_000872chr1031384 435 172 ----11547
NM_000875chr1596942 6435 5550 5411 5297 5069 2249 762 672 12303 ----
NM_000880chr82891 153 ------
NM_000891chr1753637 2954 2816 1202 424 --12944 12649
NM_000899chr1243268 3164 3035 1466 --24399 3765 --
NM_000908chr51613 --1793 --
NM_000910chr451969 1721 1208 638 326 11275 ----
NM_000917chr102199 154 --130 --
NM_000921chr121117 1172 ----
NM_000922chr113791 415 237 ------
NM_000926chr1199435 9115 8874 8104 6349 1630 876 738 674 47855 7709 3184 255 13697 12883
NM_000933chr2041348 682 668 168 1566 ----
NM_000935chr331160 256 163 ------
NM_000944chr432037 409 71 ------
NM_000950chrX73163 2921 2393 1156 1065 975 884 11020 --11160
NM_000958chr511257 --31237 968 444 1502
NM_000959chr163984 3970 3960 2730 651 132 ----12705
NM_000961chr2043549 3249 1442 561 13955 13167 13139
NM_000965chr311230 ------
NM_001001132chr211455 ------
NM_001001323chr1253048 2814 1151 914 359 1927 ----
NM_001001330chr102166 145 ------
NM_001001349chr1721075 443 11741 ----
NM_001001389chr1142880 439 193 96 --13007 12916
NM_001001390chr1142880 439 193 96 --13007 12916
NM_001001391chr1142880 439 193 96 --13007 12916
NM_001001392chr1142926 485 239 142 --13053 12962
NM_001001394chr2----1638 --
NM_001001395chr1272546 2108 1794 587 339 303 289 --1376 --
NM_001001396chr164230 4161 2755 1058 753 710 ----13806
NM_001001419chr575171 4816 3676 1135 809 470 287 14435 45218 3912 3228 2057 23232 31
NM_001001420chr575171 4816 3676 1135 809 470 287 14435 45218 3912 3228 2057 23232 31
NM_001001436chr163356 211 113 1865 ----
NM_001001481chr893256 2883 2559 2498 1316 1206 821 609 308 --13378 --
NM_001001484chr1012007 12293 ----
NM_001001521chr21303 --1233 --
NM_001001549chr732167 438 424 ------
NM_001001550chr732167 438 424 ------
NM_001001555chr732167 438 424 ------
NM_001001556chr15--1114 --1344
NM_001001664chr243203 2703 716 265 --24089 136 --
NM_001001668chr19103815 3517 3426 3059 2792 1025 756 621 490 115 13876 33795 2810 1666 1282
NM_001001706chr63901 301 236 --1304 --
NM_001001715chr131428 1549 ----
NM_001001890chr21----21473 958 13553
NM_001001933chr13539 389 238 ------
NM_001001937chr18146 ------
NM_001001971chr101953 11403 11231 1564
NM_001001995chrX11564 11305 11214 1286
NM_001002026chr332444 2381 849 --12432 --
NM_001002243chr21731 1787 2251 29 --
NM_001002257chr243107 2612 1154 742 12637 --1163
NM_001002259chr12----1243 --
NM_001002838chrX1331 11757 ----
NM_001002843chr153910 797 296 1471 1832 --
NM_001002860chr1483738 3425 3382 3178 1400 533 353 194 --13074 --
NM_001002919chr21531 ------
NM_001003407chr1055059 4768 3712 1787 1253 24354 1906 ----
NM_001003408chr1055059 4768 3712 1787 1253 24354 1906 ----
NM_001003652chr18158559 8474 7976 7661 6462 6374 6122 5819 5595 5561 5281 5273 3139 1160 342 11259 11758 11436
NM_001003674chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_001003675chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_001003681chr2272043 1929 1689 836 614 68 44 --11605 --
NM_001003688chr41229 --11227 --
NM_001003712chr123780 604 360 --11175 13010
NM_001003760chr652855 2495 2253 1109 117 ------
NM_001003792chr311113 ------
NM_001003793chr311113 ------
NM_001003800chr932605 2384 1292 ----13431
NM_001003810chr43650 266 203 1220 ----
NM_001003940chr152466 94 13630 1830 --
NM_001003942chr152466 94 13630 1830 --
NM_001003943chr152470 98 13634 1834 --
NM_001004196chr311078 --21213 1030 1759
NM_001004317chr663928 3505 3067 1677 993 937 --14162 --
NM_001004342chr155666 4631 1811 1113 1027 13882 15891 --
NM_001004419chr1264408 4189 3075 2894 1569 761 13272 13956 --
NM_001004720chr211073 ------
NM_001004722chr211242 ------
NM_001005266chr151110 ------
NM_001005267chr151110 ------
NM_001005268chr151110 ------
NM_001005269chr151110 ------
NM_001005335chr192316 241 ------
NM_001005366chr122856 317 --1366 --
NM_001005377chr19----1233 --
NM_001005386chr22575 54 ----12227
NM_001005404chr1744477 4405 3738 3125 ----11527
NM_001005463chr1032557 790 618 21757 329 ----
NM_001005474chr331527 624 550 1528 --1628
NM_001005753chr24506 419 224 161 1448 ----
NM_001005782chr2----1157 --
NM_001005845chr84683 478 58 47 ------
NM_001005861chr33980 858 314 ------
NM_001006115chr3157 ------
NM_001006117chrY2181 28 181 ----
NM_001006600chr551932 1776 1743 1531 972 ------
NM_001006612chrX2154 148 ----2436 104
NM_001006613chrX2154 148 ----2436 104
NM_001006614chrX2154 148 ----2436 104
NM_001006618chr91254 ------
NM_001006623chr242432 1952 1028 944 --22006 157 1559
NM_001007023chr1443421 2028 1907 396 14137 128 --
NM_001007024chr1734337 3892 245 --14276 --
NM_001007025chr1734337 3892 245 --14276 --
NM_001007075chr41860 11082 11087 --
NM_001007097chr954794 4639 1571 1172 374 --11706 --
NM_001007102chr641438 1049 545 348 --11596 1481
NM_001007156chr1541814 1705 1415 81 ------
NM_001007189chr5140 ------
NM_001007226chr1721488 959 --3584 207 56 --
NM_001007227chr1721488 959 --3584 207 56 --
NM_001007228chr1721488 959 --3584 207 56 --
NM_001007229chr1721488 959 --3584 207 56 --
NM_001007230chr1721488 959 --3584 207 56 --
NM_001007246chr2121596 619 1517 21861 685 --
NM_001007257chr141528 1141 1087 47 --21475 1251 --
NM_001007466chr644983 4614 3661 292 --25203 4702 --
NM_001007559chr1831994 528 48 11367 --12051
NM_001007565chr31129 ------
NM_001007595chr151288 ------
NM_001007794chr12566 527 ------
NM_001008225chr74650 514 299 219 --1504 --
NM_001008226chr1531761 1568 193 ------
NM_001008239chr1853631 2891 2858 2572 667 21370 1361 13587 --
NM_001008388chr41448 1340 ----
NM_001008392chr323545 478 --22557 871 --
NM_001008401chr1931395 1343 530 ----11351
NM_001008408chr766397 4995 1591 520 296 211 12154 ----
NM_001008495chr862257 1887 1753 1683 1507 261 12022 1482 1575
NM_001008539chr865168 5148 5046 4388 1842 322 22157 1222 55133 4579 4528 4494 4401 --
NM_001008540chr2188 --1103 --
NM_001008541chr1012174 21564 680 11546 --
NM_001008541chr1012174 21564 680 11546 --
NM_001008660chr1141587 1431 1270 583 1214 ----
NM_001008701chr1923087 896 ------
NM_001008738chr542829 2122 1098 659 --22248 1126 --
NM_001008783chr62685 568 ------
NM_001008860chr152787 672 135 1226 --
NM_001008892chr152787 672 135 1226 --
NM_001008894chr152787 672 135 1226 --
NM_001008895chr1321413 227 11406 ----
NM_001009555chr4--11104 11319 --
NM_001009567chr103568 151 80 ------
NM_001009571chr761679 1434 1161 508 89 47 ------
NM_001009881chr1----1417 --
NM_001009882chr1----1417 --
NM_001009899chr375380 4008 3948 1820 1364 805 344 1376 --16465
NM_001009909chr1143718 2416 360 40 23974 3508 --1501
NM_001009959chr242427 1784 653 56 ----12475
NM_001009960chr74865 663 336 126 1687 12522 --
NM_001009993chr274588 4531 4210 3577 1404 1025 934 14545 ----
NM_001010000chr1853524 2853 2675 1380 606 13505 --1584
NM_001010844chr6122 ------
NM_001010853chr642700 2545 2206 544 1852 32158 913 871 --
NM_001010854chr141231 ------
NM_001010888chrX74529 4267 3003 1173 970 872 93 11767 24620 4324 --
NM_001010891chr576876 5885 2534 1676 1093 494 38 --22703 309 14909
NM_001010895chr92160 74 ------
NM_001010908chr101498 ------
NM_001010927chr61169 ------
NM_001010934chr711174 1857 ----
NM_001010986chrX42200 1696 621 146 --22447 1682 --
NM_001010989chr161489 1441 ----
NM_001010990chr161489 1441 ----
NM_001011515chr411024 --1143 --
NM_001011516chr411024 --1143 --
NM_001011537chr362095 1905 1513 1489 409 51 ------
NM_001011553chr73979 953 315 ------
NM_001011666chr796447 6190 6048 5444 5204 1542 1366 1104 765 --14266 16469
NM_001011708chr21494 --22813 753 --
NM_001011713chr1451300 1027 192 152 76 --11545 --
NM_001011885chr1511468 11513 ----
NM_001012423chr1542955 770 724 700 --1425 --
NM_001012426chr612577 --11129 --
NM_001012427chr612577 --11129 --
NM_001012751chr1021603 755 --21322 179 11489
NM_001012755chrX84792 4771 4331 3762 3606 3468 1218 931 13597 34823 979 472 --
NM_001012761chr5163 2656 418 ----
NM_001012968chrX32385 194 125 --42741 2722 921 869 12164
NM_001012989chrX3691 521 220 ------
NM_001013031chr1043386 3265 2474 1317 --13278 22628 878
NM_001013406chr7----11214 --
NM_001013415chr421198 515 --21254 619 --
NM_001013620chr12148237 7309 6799 6734 6239 5698 5309 1926 1837 1615 968 742 609 231 27000 1242 37380 1712 619 17843
NM_001013632chr1127 ------
NM_001013699chr123535 94 84 --1181 --
NM_001013843chr152915 138 1578 ----
NM_001014380chr13105414 5293 5253 5046 4599 4182 1759 1663 991 239 21832 436 24936 1095 --
NM_001014434chr11183 ------
NM_001014797chr1098052 6332 2663 2604 2584 1949 1920 1230 934 --1296 --
NM_001014812chr151158 1378 ----
NM_001014831chr191650 ------
NM_001014832chr191650 ------
NM_001014834chr191650 ------
NM_001014835chr191650 ------
NM_001015508chr82488 477 --1526 --
NM_001015877chrX32547 1065 982 --12890 --
NM_001015882chr921096 189 ------
NM_001017368chr171102 12732 ----
NM_001017371chr231350 1218 351 --21175 61 --
NM_001017395chr373593 3414 3325 2928 2898 2231 22 ----1844
NM_001017424chr11317 11493 169 --
NM_001017425chr11317 11493 169 --
NM_001017434chr11160 ------
NM_001017440chr747833 7423 6074 28 25723 5258 26179 268 --
NM_001017926chr821567 390 21587 455 ----
NM_001017930chrX101452 1416 1359 1344 1304 1247 1232 1192 1127 945 ------
NM_001017962chr102199 154 --130 --
NM_001017969chr92659 43 ------
NM_001017999chr12789 449 ------
NM_001017999chr12789 449 ------
NM_001018000chr12789 449 ------
NM_001018000chr12789 449 ------
NM_001018001chr12789 449 ------
NM_001018005chr151149 ------
NM_001018037chr921429 1359 ------
NM_001018053chr111874 --11966 --
NM_001018056chr91418 ------
NM_001018064chr9----1566 --
NM_001018065chr975838 5538 4547 1637 1578 1431 1362 25830 1700 23681 413 12419
NM_001018066chr975838 5538 4547 1637 1578 1431 1362 25830 1700 23681 413 12419
NM_001018067chr175053 4716 1991 1954 1787 1635 1421 23663 1196 2813 283 --
NM_001018068chr175053 4716 1991 1954 1787 1635 1421 23663 1196 2813 283 --
NM_001018069chr175053 4716 1991 1954 1787 1635 1421 23663 1196 2813 283 --
NM_001018074chr52594 55 --1107 13192
NM_001018075chr52594 55 --1107 13192
NM_001018076chr52594 55 --1107 13192
NM_001018077chr52594 55 --1107 13192
NM_001018090chr1542085 1994 235 197 11751 22016 88 --
NM_001018091chr1542195 2104 345 307 11861 22126 198 --
NM_001018102chr1542085 1994 235 197 11751 22016 88 --
NM_001018115chr31620 ------
NM_001023567chr1532345 773 369 ------
NM_001024094chr52594 55 --1107 13192
NM_001024226chr11243 ------
NM_001024227chr11243 ------
NM_001024228chr11243 ------
NM_001024455chrX1843 1490 22639 65 11745
NM_001024463chr151935 1429 ----
NM_001024647chr12107475 7201 6897 6810 4793 4667 2920 2281 687 125 11282 27502 2669 --
NM_001024649chr552951 2162 998 957 440 ------
NM_001024660chr31600 --11518 --
NM_001024668chr121929 ------
NM_001024688chr82785 174 --11487 --
NM_001024847chr332450 2100 891 ------
NM_001024934chr61571 --2513 505 --
NM_001024935chr61571 --2513 505 --
NM_001024936chr61571 --2513 505 --
NM_001024948chr142603 2134 1257 115 --12621 --
NM_001024956chr1175782 5752 4341 1384 1051 933 431 25881 1210 14291 14596
NM_001025068chr321849 205 ------
NM_001025069chr321849 205 ------
NM_001025076chr1064861 4482 3897 1259 257 128 11271 35468 3977 1276 --
NM_001025077chr10126219 5840 5255 5064 4948 4644 2617 1615 1486 1352 991 910 12629 56826 5335 4704 2634 654 1919
NM_001025079chr344076 3643 3267 1082 23054 154 14013 13712
NM_001025105chr541534 1324 1160 250 ------
NM_001025108chr234102 2926 2652 13834 12655 --
NM_001025252chr851277 905 525 420 322 --33126 1288 704 --
NM_001025253chr851277 905 525 420 322 --33126 1288 704 --
NM_001025389chr1111620 21673 1556 ----
NM_001025390chr1111620 21673 1556 ----
NM_001025580chrX44271 4135 2886 711 --1954 24293 3755
NM_001025780chr941579 1512 531 300 --11238 --
NM_001029835chr71347 ------
NM_001029858chr663075 2632 2252 1002 373 68 --23140 313 33232 3100 287
NM_001029860chr81242 --1266 --
NM_001029863chr612769 11071 ----
NM_001029875chr522939 1977 1923 1522 --
NM_001030007chr1663868 3553 1424 1192 596 70 21562 167 ----
NM_001030055chr1484550 4398 1744 1648 1503 1473 306 261 21842 1036 ----
NM_001031679chr1243547 2941 2754 570 167 ----
NM_001031684chr251476 1455 1380 1304 539 1310 ----
NM_001031695chr2275223 4738 4185 3856 1376 983 59 --25376 2072 --
NM_001031712chr6----1299 --
NM_001031716chr22394 60 ----177
NM_001031732chr443671 3313 930 25 2741 584 1648 --
NM_001031746chr1021154 1008 11376 ----
NM_001031801chr22------1187
NM_001031804chr1673792 3378 1618 1609 1341 1093 545 1741 ----
NM_001031812chr571665 1655 1539 1478 879 705 680 ----11669
NM_001032280chr671650 1517 1488 1343 1146 1070 538 ------
NM_001032282chr841196 1147 848 463 ------
NM_001032288chr2031590 1319 1065 ------
NM_001032289chrX1141 ------
NM_001032380chr1022033 1303 ------
NM_001032393chrX2746 724 ------
NM_001032394chr632653 2267 61 ------
NM_001033057chr361955 1578 626 573 306 179 ------
NM_001033087chr2043259 1314 1288 905 --13105 --
NM_001033112chr51864 ------
NM_001033507chr111377 --11594 --
NM_001033551chr1723886 2848 --53093 2851 2744 1296 855 --
NM_001033557chr2----2131 96 --
NM_001033561chr171734 ------
NM_001033578chr812344 ------
NM_001033602chr1342692 1726 976 253 --1871 --
NM_001033756chr61725 11573 ----
NM_001033756chr61725 11573 ----
NM_001033925chr1032191 790 605 ------
NM_001034837chr52772 566 ------
NM_001034838chr52772 566 ------
NM_001034841chr1675261 4219 4053 3652 3365 2066 1626 1715 1264 15184
NM_001034850chr521481 370 ------
NM_001034852chr143590 393 244 ------
NM_001034915chr811235 1543 ----
NM_001034954chr1023126 2492 ----23045 846
NM_001034955chr1023126 2492 ----23045 846
NM_001034956chr1023126 2492 ----23045 846
NM_001034957chr1023126 2492 ----23045 846
NM_001035521chr21512 ----1309
NM_001037132chr73731 586 476 ------
NM_001037133chr73731 586 476 ------
NM_001037165chr738897 7405 1922 ------
NM_001037172chr331386 188 166 --2121 100 --
NM_001037331chr183729 342 87 --1108 --
NM_001037339chr121839 1769 11219 1232 --
NM_001037340chr121839 1769 11219 1232 --
NM_001037341chr121839 1769 11219 1232 --
NM_001037341chr121839 1769 11219 1232 --
NM_001037553chr2154935 4702 4175 4053 3210 --23128 2073 --
NM_001037558chr111208 ------
NM_001037631chr21385 ------
NM_001037954chr1143367 2862 2464 567 --1570 --
NM_001038493chr211343 --31520 1325 1064 21317 1302
NM_001039348chr2------152
NM_001039349chr2------152
NM_001039538chr253705 3687 1128 977 882 1136 13673 --
NM_001039547chr388094 5851 5674 3098 2649 2247 1815 137 17075 1382 --
NM_001039570chr2234699 4087 3547 ------
NM_001039571chr2234699 4087 3547 ------
NM_001039573chr17------1506
NM_001039577chr151663 1173 597 462 380 --41179 1161 1143 806 --
NM_001039585chr174241 4227 4217 2987 908 389 212 ----12962
NM_001039618chr1195683 5381 5122 4896 4857 4270 4115 4015 982 12138 25809 5373 11617
NM_001039690chr1631880 1857 1563 ------
NM_001039693chr221227 554 1152 ----
NM_001039762chr1012196 ------
NM_001039802chr12355 213 ------
NM_001039840chrX136031 5613 5246 4792 3974 2428 2119 1980 1649 821 628 565 341 25891 1306 35391 4807 2277 --
NM_001039937chr1344062 3267 450 100 21664 1637 --13809
NM_001040001chr61135 --31992 1268 451 1750
NM_001040057chr731304 1149 174 --11248 --
NM_001040092chr8----156 --
NM_001040101chr421072 118 ------
NM_001040142chr242234 1872 527 38 ----11645
NM_001040143chr242234 1872 527 38 ----11645
NM_001040144chr1631880 1857 1563 ------
NM_001040146chr1631880 1857 1563 ------
NM_001040152chr735118 5112 4579 24768 4056 25069 173 13711
NM_001040153chr134711 222 165 130 ------
NM_001040158chr52378 155 ------
NM_001040181chr3179 ------
NM_001040182chr3179 ------
NM_001040183chr3179 ------
NM_001040199chr3179 ------
NM_001040200chr3179 ------
NM_001040214chr631878 942 528 1338 ----
NM_001040260chr4--11133 ----
NM_001040261chr4--11133 ----
NM_001040284chr1664841 4254 2171 1266 1020 496 25429 1329 11217 --
NM_001040402chr463006 2583 2244 332 175 68 12170 1262 --
NM_001040409chr23784 418 345 1770 ----
NM_001040429chr1393394 3211 2900 1156 1140 1117 1084 1062 1034 --23530 2525 --
NM_001040441chr175462 5203 3879 3358 1991 707 177 --1193 1635
NM_001040450chr1522251 1852 1923 ----
NM_001040453chr1522251 1852 1923 ----
NM_001040624chr862474 856 715 708 355 237 ------
NM_001040625chr862474 856 715 708 355 237 ------
NM_001040626chr862474 856 715 708 355 237 ------
NM_001040627chr862474 856 715 708 355 237 ------
NM_001040628chr862474 856 715 708 355 237 ------
NM_001040629chr862474 856 715 708 355 237 ------
NM_001040630chr862474 856 715 708 355 237 ------
NM_001040633chr73927 910 893 ------
NM_001040647chr772172 2119 1863 1815 1574 774 76 ------
NM_001040648chr772172 2119 1863 1815 1574 774 76 ------
NM_001040653chr3--1897 22499 675 --
NM_001040668chr191135 ------
NM_001040712chr972631 1373 1182 1024 881 515 323 ------
NM_001042353chr202538 159 ------
NM_001042355chr1624973 156 ------
NM_001042388chr183906 644 347 --1620 --
NM_001042404chr111749 --11475 --
NM_001042406chr641230 995 850 370 ------
NM_001042412chr1624973 156 ------
NM_001042413chr973988 3864 3614 2827 704 552 188 --23454 45 --
NM_001042414chr13------194
NM_001042424chr41554 ------
NM_001042425chr671650 1517 1488 1343 1146 1070 538 ------
NM_001042453chrX21453 1239 --11688 --
NM_001042473chr1022179 106 --1197 --
NM_001042481chr1462498 2398 2224 1847 488 472 ------
NM_001042492chr1763254 3154 3120 1255 948 140 --13439 13203
NM_001042494chr1543741 2542 2455 716 --13132 --
NM_001042495chr1543741 2542 2455 716 --13132 --
NM_001042496chr1543741 2542 2455 716 --13132 --
NM_001042497chr1543741 2542 2455 716 --13132 --
NM_001042506chrX41363 905 413 111 ------
NM_001042510chr841605 1366 554 273 --1763 --
NM_001042511chr841605 1366 554 273 --1763 --
NM_001042537chrX31558 961 885 ------
NM_001042543chr421594 602 ------
NM_001042550chr962081 1868 1731 1571 738 202 ------
NM_001042555chr1274548 3768 3757 956 885 805 791 1375 24782 1351 --
NM_001042599chr247416 7354 2270 2204 14880 17269 --
NM_001042601chr333044 373 125 --1256 1260
NM_001042603chr1255153 4604 3870 2105 408 --22038 95 --
NM_001042604chr363590 1625 1559 938 750 538 --23548 3127 --
NM_001042616chr41163 ------
NM_001042632chr2032597 1973 634 ------
NM_001042633chr2032597 1973 634 ------
NM_001042683chr6----1132 1742
NM_001042749chrX61827 1630 1359 803 533 471 ----11614
NM_001042750chrX61827 1630 1359 803 533 471 ----11614
NM_001042751chrX61827 1630 1359 803 533 471 ----11614
NM_001043351chr141759 1431 772 506 ------
NM_001044722chr571665 1655 1539 1478 879 705 680 ----11669
NM_001044723chr571665 1655 1539 1478 879 705 680 ----11669
NM_001048183chr163700 3133 2627 1521 1364 227 ------
NM_001049chr1412085 --12028 --
NM_001068chr31127 1226 ----
NM_001069chr61155 ------
NM_001071775chr132453 424 1245 ----
NM_001079874chr141896 1830 1761 845 --11843 --
NM_001083620chr452006 1943 1933 859 221 --1852 32249 757 452
NM_001099678chr3116431 6016 5933 5920 5876 5465 4607 4523 4047 1534 1243 36008 1288 652 16401 --
NM_001106chr346533 5985 3686 2441 18411 39351 7786 212 --
NM_001113490chrX23245 2931 --2723 241 --
NM_001116chr1612575 23059 2592 1370 --
NM_001117chr182530 374 --1156 --
NM_001121chr1031791 1619 428 --11892 --
NM_001122679chr521313 1225 ------
NM_001126chr12984 336 --1222 --
NM_001128chr1663868 3553 1424 1192 596 70 21562 167 ----
NM_001148chr451779 1720 650 608 438 --1817 1677
NM_001160chr1252857 610 494 113 101 12099 11966 --
NM_001167chrX106701 6595 6206 5544 5212 2601 2440 1681 470 442 --12617 11779
NM_001173chr1484550 4398 1744 1648 1503 1473 306 261 21842 1036 ----
NM_001177chr12----22139 536 --
NM_001186chr2153305 2584 2564 2385 1097 12061 2946 85 --
NM_001187chr211418 ------
NM_001200chr201880 ------
NM_001201chr463988 3875 3744 3264 1323 420 12583 ----
NM_001204chr2107146 7053 6651 6554 6419 5669 5572 5357 5043 1913 16373 1328 --
NM_001206chr942685 1068 482 161 ------
NM_001219chr722180 70 1547 --11664
NM_001222chr102650 245 ------
NM_001233chr721469 660 --2646 578 --
NM_001239chr5----1122 --
NM_001241chr262258 1926 1767 1674 956 476 1151 31907 450 200 12345
NM_001241chr262258 1926 1767 1674 956 476 1151 31907 450 200 12345
NM_001256chr175738 724 708 695 369 ------
NM_001257chr1631479 1327 122 ------
NM_001259chr795896 5599 5244 4079 2031 1997 1979 1819 1177 21387 97 1944 24836 1150
NM_001270chr531010 873 759 ----1122
NM_001280chr191609 ------
NM_001304chr17113368 3087 3011 2984 2893 2777 2750 1411 890 863 702 1126 --13135
NM_001310chr1262261 2039 1014 852 324 230 --21946 694 --
NM_001326chr112381 113 --1416 --
NM_001329chr1061593 1459 1129 343 232 130 ------
NM_001331chr11196 --22625 702 12388
NM_001332chr51492 --1593 --
NM_001343chr531282 663 128 --1398 --
NM_001356chrX62414 2408 1658 1579 380 218 ------
NM_001358chr41343 ------
NM_001364chr1174687 3824 1842 1581 864 648 93 ------
NM_001378chr21413 ------
NM_001380chr102732 343 ------
NM_001385chr82399 166 ------
NM_001387chr532587 491 45 12671 2724 179 --
NM_001390chr1853500 3481 3367 3250 3137 --23531 3518 --
NM_001395chrX2988 975 ------
NM_001401chr911009 ------
NM_001402chr641903 1242 565 482 --21566 519 1586
NM_001407chr321696 481 ------
NM_001412chrX53269 2366 763 712 279 23487 3080 ----
NM_001416chr171454 ------
NM_001418chr112470 282 ----144
NM_001418chr112470 282 ----144
NM_001419chr1934687 1949 1802 --11585 1752
NM_001420chr1913152 ----12127
NM_001423chr1231967 1423 76 ------
NM_001427chr71111 --1387 --
NM_001429chr221758 ----11099
NM_001430chr261941 1826 1723 1656 516 206 --1412 --
NM_001432chr433723 2590 1327 1332 1798 --
NM_001438chr183564 3177 2756 2451 2313 838 795 628 12705 --23575 2353
NM_001452chr61556 ------
NM_001453chr641758 1717 1298 684 11748 11723 --
NM_001463chr23220 87 58 --1105 --
NM_001465chr511405 1191 1438 --
NM_001491chr6----22756 634 1264
NM_001494chr10176 ------
NM_001495chr831106 1023 111 ------
NM_001497chr91872 1324 12491 --
NM_001498chr621150 865 ------
NM_001514chr1--1445 1136 --
NM_001521chr21512 ----1309
NM_001522chrX176 ------
NM_001527chr6114735 4463 4255 4089 3948 3843 3507 3399 3065 880 165 --1734 24664 4359
NM_001530chr141810 --11138 --
NM_001533chr192316 241 ------
NM_001546chr621101 506 --1443 --
NM_001560chrX32665 2620 709 --1457 --
NM_001584chr1141190 1079 801 117 1255 1402 --
NM_001587chrX52249 2158 293 195 98 ------
NM_001604chr114959 814 142 37 ------
NM_001616chr273488 3386 2969 2241 1382 466 435 33480 2841 610 1151 --
NM_001619chr11199 ------
NM_001621chr752643 2558 1226 1120 968 ----22729 796
NM_001621chr752643 2558 1226 1120 968 ----22729 796
NM_001635chr711002 ------
NM_001649chrX32022 898 198 ------
NM_001650chr1844114 2856 1252 185 ------
NM_001652chr12----11468 --
NM_001656chr521277 473 --11585 --
NM_001658chr11243 ------
NM_001660chr34671 655 288 135 --2679 146 1166
NM_001663chr1452327 2026 1776 647 464 22313 268 1500 --
NM_001677chr11386 --1312 --
NM_001681chr121632 ------
NM_001682chr1252762 2528 865 628 73 1641 ----
NM_001684chr153947 3878 775 470 427 ----13523
NM_001690chr382538 2406 1690 1624 656 479 437 100 12593 ----
NM_001693chr83265 153 142 --2482 254 --
NM_001695chr894254 4248 3843 3326 3076 2775 931 542 325 ----23179 2851
NM_001704chr63521 456 41 ------
NM_001709chr1152830 2755 2083 512 249 --12649 --
NM_001716chr1111570 --124 --
NM_001718chr611128 ------
NM_001726chr11106 ------
NM_001730chr1331531 1496 1390 --11295 --
NM_001730chr1331531 1496 1390 --11295 --
NM_001742chr71738 --21592 171 11665
NM_001743chr23415 211 43 ----1498
NM_001746chr552951 2162 998 957 440 ------
NM_001753chr731795 1420 1144 181 1289 --
NM_001754chr21----21473 958 13553
NM_001755chr1652253 1947 864 728 94 11692 ----
NM_001759chr1231380 985 852 23960 947 31363 1290 248 1748
NM_001769chr121321 1134 ----
NM_001777chr344076 3643 3267 1082 23054 154 14013 13712
NM_001786chr10------158
NM_001788chr73979 953 315 ------
NM_001791chr12355 213 ------
NM_001792chr1821120 860 ------
NM_001797chr161308 --1765 --
NM_001802chr164985 875 116 36 --1369 --
NM_001830chrX33978 2807 1593 11550 1831 --
NM_001839chr12693 111 --2720 499 --
NM_001845chr1311334 --1909 11327
NM_001855chr94766 562 346 82 ------
NM_001858chr694863 4801 4434 4077 1742 1460 1331 471 91 2435 229 23857 3206 --
NM_001859chr962603 1600 1387 1341 1237 201 --13951 --
NM_001866chrX130 ------
NM_001892chr541534 1324 1160 250 ------
NM_001920chr121539 2557 57 ----
NM_001924chr11425 ------
NM_001931chr111186 11172 --1928
NM_001935chr21279 --1232 --
NM_001938chr131650 767 152 ----11525
NM_001939chrX32687 791 269 32744 1147 560 22526 886 --
NM_001949chr652494 2215 873 801 652 --12262 --
NM_001966chr331215 1033 93 ------
NM_001967chr33577 466 390 --141 1521
NM_001969chr1422985 1034 12844 --1415
NM_001977chr42580 157 --41656 1410 662 41 --
NM_001980chr1242288 2268 825 756 ------
NM_001993chr131143 409 38 --11080 --
NM_001999chr521208 1143 1369 11397 --
NM_002006chr475788 5753 5714 4428 1369 756 209 14296 ----
NM_002009chr15----1943 1670
NM_002013chr14194 ------
NM_002015chr1343016 2623 2539 2528 --22667 762 --
NM_002017chr1111322 ------
NM_002024chrX52229 1827 1513 758 216 ------
NM_002025chrX56710 5706 2566 2281 1221 --22569 291 16320
NM_002026chr22988 805 2946 839 ----
NM_002031chr61829 --1288 --
NM_002033chr1153382 2902 1665 1067 240 12845 ----
NM_002035chr1843500 2514 1398 1164 12742 23539 98 --
NM_002039chr41304 --1220 --
NM_002040chr2112733 12657 1418 --
NM_002041chr15----145 --
NM_002044chr15--1114 --1344
NM_002061chr11380 1423 3691 216 199 1772
NM_002063chrX21058 253 ------
NM_002086chr1712116 ------
NM_002114chr62421 142 --1527 --
NM_002126chr1733078 739 543 ------
NM_002128chr131356 --22467 470 --
NM_002136chr121584 ------
NM_002137chr721759 274 ------
NM_002138chr43650 266 203 1220 ----
NM_002140chr91335 --1300 --
NM_002147chr17------1199
NM_002157chr21145 ------
NM_002158chr253826 3492 2693 2635 164 ------
NM_002165chr202327 318 --1360 --
NM_002188chr5----1688 --
NM_002193chr221888 1449 ------
NM_002196chr20--21069 772 ----
NM_002196chr20--21069 772 ----
NM_002199chr42842 137 ------
NM_002202chr51906 ------
NM_002203chr544141 4095 3823 3065 ----14133
NM_002210chr263170 2742 2562 908 836 758 ------
NM_002211chr102452 84 ------
NM_002214chr754761 897 114 95 50 141 1563 --
NM_002222chr331126 188 175 1148 ----
NM_002223chr1253329 3098 1451 1126 958 23962 2991 197 --
NM_002227chr11379 --1530 11167
NM_002232chr1136 ------
NM_002233chr11--1145 ----
NM_002234chr121754 ------
NM_002239chr23843 294 149 1821 ----
NM_002247chr1051883 808 600 541 516 1789 ----
NM_002264chr394519 4181 3573 3299 3228 3115 3103 1541 1212 14033 1811 --
NM_002265chr1711065 1957 ----
NM_002266chr17----159 --
NM_002267chr1312031 12350 12306 --
NM_002269chr61347 ------
NM_002270chr5105619 4922 4735 3680 3663 1978 1144 988 973 171 11361 13804 13501
NM_002271chr1351843 981 927 376 158 --12208 --
NM_002285chr234102 2926 2652 13834 12655 --
NM_002293chr152521 2224 2204 1948 1729 1230 ----
NM_002296chr131517 1302 90 ------
NM_002303chr11115 ------
NM_002310chr5146598 6379 5688 5575 5361 5099 4934 4557 2346 2214 2064 1551 1223 1207 --12015 2105 60
NM_002313chr1055059 4768 3712 1787 1253 24354 1906 ----
NM_002332chr12------1772
NM_002342chr121598 ------
NM_002349chr241306 551 455 236 ------
NM_002351chrX166 ------
NM_002356chr622764 814 11152 32863 748 741 12504
NM_002360chr732606 2266 158 ------
NM_002374chr253705 3687 1128 977 882 1136 13673 --
NM_002399chr1521295 1207 ------
NM_002401chr1732497 2417 76 --22142 2130 --
NM_002408chr142627 545 --1243 1823
NM_002411chr111121 ------
NM_002427chr1111161 1776 1234 --
NM_002430chr2252578 2383 2067 527 415 --1110 1391
NM_002438chr103568 151 80 ------
NM_002444chrX41974 1795 717 591 ------
NM_002457chr111101 ------
NM_002467chr8----1426 --
NM_002480chr1251499 1215 1093 585 227 ------
NM_002481chr185650 5281 5185 3039 2791 1387 1075 894 ------
NM_002482chr1--1709 ----
NM_002485chr82785 174 --11487 --
NM_002487chr152737 175 ------
NM_002499chr1552206 936 908 634 628 --1764 --
NM_002501chr1911303 ------
NM_002509chr202715 575 ------
NM_002515chr142287 26 ------
NM_002519chr1131396 582 270 ------
NM_002524chr111055 11075 196 --
NM_002527chr121271 --178 --
NM_002552chr221241 65 ------
NM_002556chr1121505 592 ------
NM_002577chr341553 1377 940 454 14002 ----
NM_002581chr965476 5231 4857 3892 3639 1335 --23784 1279 15100
NM_002588chr51687 ------
NM_002591chr203573 545 529 ------
NM_002595chr1261922 1609 423 318 306 158 --21809 1344 --
NM_002600chr121839 1769 11219 1232 --
NM_002608chr22158 --190 --
NM_002610chr243105 2407 769 583 ------
NM_002613chr1655227 4069 1478 1203 978 14867 15106 --
NM_002623chr201300 --148 --
NM_002628chr31916 --21123 1077 2991 975
NM_002641chrX21954 1886 ------
NM_002645chr1132875 330 218 1948 ----
NM_002647chr181213 1242 ----
NM_002655chr895190 4968 3953 3827 3486 3418 1958 1374 892 14982 13371 14338
NM_002656chr62241 164 --1896 --
NM_002657chr2053592 3302 3146 1249 1182 ------
NM_002670chr331482 514 38 --1262 --
NM_002677chr852951 2097 1059 836 57 --22941 2922 --
NM_002687chr142908 356 ------
NM_002699chr121013 87 ------
NM_002703chr411914 2653 628 ----
NM_002709chr283603 3014 2595 1271 1121 752 594 182 --33079 2387 362 --
NM_002711chr72823 81 --1255 --
NM_002715chr551170 890 465 224 27 --11281 11101
NM_002718chr332313 2261 603 ------
NM_002719chr1452361 1827 1789 825 710 1454 ----
NM_002721chr9----1158 --
NM_002727chr101548 --1197 --
NM_002729chr101789 ------
NM_002731chr152861 2037 1106 402 134 --42878 2682 412 387 --
NM_002736chr722138 1773 11788 21937 1873 --
NM_002737chr1766596 6380 4714 4660 734 292 --11804 --
NM_002738chr162429 56 1868 ----
NM_002745chr2253609 3515 2904 544 290 13351 21687 274 23709 1455
NM_002747chr18--11888 ----
NM_002788chr14122 ------
NM_002806chr14148 ------
NM_002811chr16--1376 1518 --
NM_002814chrX1209 ------
NM_002819chr1911300 ------
NM_002821chr61127 --1752 --
NM_002822chr1251674 1454 1381 530 453 ------
NM_002834chr1253734 3451 3092 2771 405 22505 1386 1814 --
NM_002835chr73615 602 210 1114 ----
NM_002837chr1274622 4227 3082 2794 598 452 172 ------
NM_002839chr972631 1373 1182 1024 881 515 323 ------
NM_002841chr31497 ------
NM_002843chr1123395 2391 --13385 12328
NM_002845chr183641 446 156 --1545 --
NM_002848chr1241170 1031 398 61 1452 1832 --
NM_002851chr75810 763 649 588 39 ------
NM_002852chr32538 395 1403 ----
NM_002858chr1------1188
NM_002869chr1172078 1790 1589 1553 1544 131 117 11934 ----
NM_002874chr962445 2365 1764 772 496 118 1766 1499 --
NM_002886chr345016 3627 1886 682 --24228 1496 --
NM_002892chr1431556 1282 170 1102 ----
NM_002901chr113139 60 49 ----164
NM_002902chr152541 217 ------
NM_002906chr1111569 ------
NM_002912chr63906 701 227 --1763 --
NM_002923chr1--1532 ----
NM_002924chr11100 1124 1616 --
NM_002941chr311142 --1173 --
NM_002942chr321080 339 1301 ----
NM_002951chr201277 --1250 --
NM_002956chr1211358 ------
NM_002958chr33980 858 314 ------
NM_002971chr341219 462 227 100 --1907 --
NM_002977chr273425 3414 3298 3024 2812 1058 699 --2945 23 --
NM_003010chr1752286 2050 1915 1871 647 --31675 541 90 --
NM_003016chr1771999 1695 1653 1550 594 550 327 --1452 --
NM_003017chr631277 1252 964 1218 ----
NM_003020chr151148 1400 ----
NM_003022chrX31205 972 49 ------
NM_003042chr331991 1547 1459 ----11656
NM_003046chr865168 5148 5046 4388 1842 322 22157 1222 55133 4579 4528 4494 4401 --
NM_003048chr232724 2709 2270 --12015 --
NM_003054chr101278 ------
NM_003068chr821113 343 --1378 --
NM_003069chrX1638 --2574 491 --
NM_003070chr93668 610 203 ------
NM_003074chr3----1420 --
NM_003079chr172857 697 ------
NM_003081chr2011040 --21011 345 --
NM_003094chr16757 379 214 163 140 27 --2479 89 --
NM_003099chr1535855 4751 1889 16478 16547 11621
NM_003106chr31919 ------
NM_003107chr632593 2243 286 ------
NM_003108chr267083 4908 4737 4564 2854 797 --16924 --
NM_003110chr173945 901 159 ------
NM_003111chr231350 1218 351 --21175 61 --
NM_003112chr743045 2790 2129 896 --22894 1266 --
NM_003128chr252836 2794 2447 926 703 ------
NM_003129chr8--1239 ----
NM_003133chr11274 ------
NM_003140chrY----197 --
NM_003144chr651505 1448 740 543 271 11458 2743 153 --
NM_003150chr1732330 2237 2059 --22376 344 --
NM_003155chr831920 816 576 11967 --22669 2404
NM_003161chr17--1672 53457 3328 1054 314 204 --
NM_003174chr10--1134 ----
NM_003176chr1----1218 --
NM_003176chr1----1218 --
NM_003178chr341602 862 513 101 --21868 865 --
NM_003182chr73162 147 107 ------
NM_003182chr73162 147 107 ------
NM_003184chr81437 --1884 --
NM_003185chr2011053 11311 21316 75 --
NM_003188chr62853 148 ------
NM_003189chr133190 2529 2388 ------
NM_003199chr1821026 24 24934 4313 35440 1322 889 15060
NM_003202chr521825 1637 ----11852
NM_003203chr221786 1509 --11613 --
NM_003211chr1251542 1523 1290 1254 560 11777 11505 --
NM_003220chr671650 1517 1488 1343 1146 1070 538 ------
NM_003221chr684212 4174 3900 3737 3274 1447 1364 1316 1535 ----
NM_003222chr2011222 --1805 --
NM_003234chr3----1883 --
NM_003236chr253347 2950 2417 1322 987 13518 41145 1129 708 423 --
NM_003242chr332450 2100 891 ------
NM_003246chr1551888 1737 328 239 50 --1562 --
NM_003255chr1732120 1875 861 ------
NM_003262chr344967 1443 1139 1051 33435 2116 768 13197 --
NM_003269chr62824 507 1980 ----
NM_003274chr2112428 --12177 12949
NM_003286chr201876 11068 ----
NM_003295chr131155 ------
NM_003298chr376147 6125 5060 5012 2229 2177 1564 14175 16206 --
NM_003300chr141491 ------
NM_003304chr351611 1579 1441 600 59 --21350 455 --
NM_003305chr4----1154 --
NM_003319chr22969 166 1957 ----
NM_003336chrX31059 378 290 1317 1908 --
NM_003337chr531100 179 36 --1202 --
NM_003338chr1021526 675 ----21644 731
NM_003339chr5--21233 1129 ----
NM_003340chr421010 919 ------
NM_003342chr1753233 2225 1148 1026 406 --23154 92 12265
NM_003348chr1261721 1619 1546 574 519 220 ------
NM_003349chr2031590 1319 1065 ------
NM_003350chr82816 404 ------
NM_003352chr2----1157 --
NM_003360chr4------156
NM_003369chr1122428 1127 22128 165 ----
NM_003374chr5------1105
NM_003383chr91418 ------
NM_003387chr222272 186 12760 2973 208 149
NM_003392chr383344 3080 2926 2804 2767 1537 1317 1260 --12819 --
NM_003400chr22824 174 --1685 --
NM_003403chr141799 1190 ----
NM_003404chr2031913 550 435 1773 11385 --
NM_003405chr224681 639 190 175 ------
NM_003406chr821924 722 ------
NM_003410chrX32974 2894 555 --22867 899 --
NM_003413chrX41607 1373 744 398 11747 11985 1649
NM_003419chr1931120 954 384 ------
NM_003423chr1951599 1050 445 407 157 12582 11053 --
NM_003432chr51174 1462 ----
NM_003439chr733460 2800 816 --11360 --
NM_003452chr92870 375 --1707 --
NM_003454chr1631392 530 116 1161 11429 --
NM_003458chr334012 3628 47 ------
NM_003463chr653377 2664 2630 881 799 ------
NM_003467chr2188 --1103 --
NM_003470chr1611173 1685 ----
NM_003471chr31240 --1673 1461
NM_003472chr621308 226 ------
NM_003478chr1182591 1244 1098 849 747 564 553 192 12250 2750 330 --
NM_003483chr1242830 2429 691 87 ------
NM_003489chr2121211 820 12268 12809 --
NM_003505chr71407 --11679 --
NM_003507chr211968 ------
NM_003508chr7----1293 --
NM_003557chr131276 1119 337 --11596 --
NM_003563chr1721488 959 --3584 207 56 --
NM_003565chr1241789 1751 1428 617 --11528 --
NM_003566chr1273449 3271 3145 3056 2991 711 421 1536 43452 3039 1060 410 --
NM_003574chr18115508 4594 4421 4321 4149 2288 2148 1658 1534 313 276 35426 3901 400 34549 4324 365 14197
NM_003581chr211073 ------
NM_003583chr1283500 2612 2516 1543 1275 919 732 45 --23906 830 12734
NM_003589chr1321413 227 11406 ----
NM_003590chr2104062 4046 3546 3070 3033 3007 1554 1145 808 328 13296 1384 --
NM_003591chr101362 ------
NM_003597chr222158 1869 --1396 --
NM_003603chr431941 770 411 --1536 --
NM_003607chr174383 4093 3376 952 740 477 253 23223 1655 ----
NM_003615chr333939 2870 82 33977 3591 1116 23764 3666 --
NM_003618chr241315 1131 460 123 1211 1263 --
NM_003622chr1252275 734 479 261 210 --1100 --
NM_003626chr1131188 542 391 11266 11368 --
NM_003629chr163409 3398 3369 2722 2321 672 23350 1142 ----
NM_003630chr61762 1240 ----
NM_003633chr532323 1958 1660 --1679 --
NM_003659chr23910 440 353 --3833 311 308 --
NM_003663chr373455 3182 2881 2863 2252 1106 321 --1608 1176
NM_003664chr51502 ------
NM_003670chr341147 490 250 90 ----11033
NM_003671chr983541 3021 1025 779 722 611 339 105 32845 2790 1234 13074 12381
NM_003672chr121889 339 --2698 689 --
NM_003692chr93875 631 202 1784 ----
NM_003701chr131904 1402 ----
NM_003704chr4------1647
NM_003705chr21297 ------
NM_003718chr71499 ------
NM_003722chr322656 621 --1390 --
NM_003735chr51687 ------
NM_003736chr51687 ------
NM_003743chr242123 1425 799 735 ----12100
NM_003749chr1322274 1633 --12235 --
NM_003758chr153613 449 35 1216 --1259
NM_003758chr153613 449 35 1216 --1259
NM_003759chr444235 3486 3108 992 ----11257
NM_003768chr121884 1193 11257 11798 --
NM_003774chr1212056 42601 2477 2153 422 ----
NM_003778chr32226 110 ------
NM_003783chr1------144
NM_003787chr18--11474 1223 1436
NM_003794chr321124 260 --31073 913 878 1845
NM_003797chr111149 ------
NM_003800chr632424 631 58 --1674 --
NM_003809chr171498 ------
NM_003819chr11232 ------
NM_003822chr163118 2971 2499 1949 861 205 12856 1839 --
NM_003850chr131559 --2283 76 --
NM_003870chr1532078 849 317 21827 702 12081 --
NM_003873chr1032420 2232 937 11847 32332 2222 1010 --
NM_003876chr17----1310 --
NM_003884chr331835 1749 1665 --11427 --
NM_003885chr1732186 2167 2042 --12170 12536
NM_003887chr232225 1861 169 21599 202 ----
NM_003895chr2152079 1923 1700 1632 441 21797 191 12104 --
NM_003901chr1031972 841 254 --11016 --
NM_003902chr11544 ------
NM_003909chr842187 779 710 377 12724 22378 1864 --
NM_003913chr661490 1206 1191 1164 1093 1003 ------
NM_003922chr151353 ------
NM_003924chr421699 94 ------
NM_003927chr182947 383 --1841 --
NM_003930chr732592 2528 900 22385 478 --3528 341 227
NM_003931chr61571 --2513 505 --
NM_003941chr752523 2417 1735 209 120 --11569 --
NM_003958chr653363 2537 1572 935 482 23401 1466 ----
NM_003971chr171429 ------
NM_003972chr102852 27 ------
NM_003983chr1624443 4374 --23343 846 13489
NM_003994chr1243268 3164 3035 1466 --24399 3765 --
NM_003998chr43603 563 254 --1474 --
NM_004006chrX52640 2534 2493 1655 515 --22369 241 --
NM_004007chrX52640 2534 2493 1655 515 --22369 241 --
NM_004009chrX52640 2534 2493 1655 515 --22369 241 --
NM_004010chrX52640 2534 2493 1655 515 --22369 241 --
NM_004011chrX52640 2534 2493 1655 515 --22369 241 --
NM_004012chrX52640 2534 2493 1655 515 --22369 241 --
NM_004013chrX52640 2534 2493 1655 515 --22369 241 --
NM_004014chrX52640 2534 2493 1655 515 --22369 241 --
NM_004015chrX52640 2534 2493 1655 515 --22369 241 --
NM_004016chrX52554 2448 2407 1569 429 --22283 155 --
NM_004017chrX52640 2534 2493 1655 515 --22369 241 --
NM_004018chrX52554 2448 2407 1569 429 --22283 155 --
NM_004020chrX52640 2534 2493 1655 515 --22369 241 --
NM_004021chrX52554 2448 2407 1569 429 --22283 155 --
NM_004022chrX52554 2448 2407 1569 429 --22283 155 --
NM_004023chrX52554 2448 2407 1569 429 --22283 155 --
NM_004024chr131335 1097 277 ------
NM_004028chr1844114 2856 1252 185 ------
NM_004040chr241251 878 870 209 ------
NM_004046chr18146 ------
NM_004056chr8----21044 283 11039
NM_004073chr11242 ------
NM_004080chr71172 1430 11384 --
NM_004087chr342056 1688 1550 492 ------
NM_004093chr1313031 --1979 --
NM_004100chr662666 2656 2114 605 248 153 ------
NM_004105chr2------152
NM_004114chrX31067 956 364 21136 972 1829 --
NM_004117chr622176 494 1883 ----
NM_004124chr1433530 3039 2823 1215 23343 3299 12664
NM_004133chr842567 469 338 331 12377 22617 662 1169
NM_004136chr1533213 2721 2350 1867 33042 2015 1107 2978 207
NM_004152chr191349 --1230 --
NM_004161chr251137 1078 600 555 545 --2644 256 --
NM_004170chr911218 11609 11675 11670
NM_004171chr11159447 8692 8314 8125 7714 7551 7263 7172 6839 6822 6764 6617 6358 6281 1485 17596 26697 1973 --
NM_004181chr41317 ------
NM_004187chrX11255 --1173 --
NM_004202chrY147 --1694 --
NM_004215chr8----1521 --
NM_004226chr2198 ------
NM_004227chr7--12553 13161 --
NM_004229chrX1317 --11796 --
NM_004232chr1873561 3317 2768 1230 1039 750 658 32374 1302 400 ----
NM_004241chr10----1323 --
NM_004249chr4128 ------
NM_004272chr51712 11484 ----
NM_004274chr1423226 1050 12915 11107 --
NM_004290chr521267 34 ------
NM_004293chr943824 3293 3178 3152 13284 1815 11053
NM_004319chr113160 --1826 11065
NM_004326chr12425 315 --11247 --
NM_004330chr1521115 887 --1853 1243
NM_004331chr852115 1011 791 439 52 ------
NM_004338chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_004342chr722256 1930 ------
NM_004346chr4--1250 11401 --
NM_004349chr82378 207 1372 ----
NM_004379chr221706 1362 11385 1671 --
NM_004380chr1632166 634 302 --1637 1876
NM_004384chr571665 1655 1539 1478 879 705 680 ----11669
NM_004388chr12370 138 ----182
NM_004392chr1332635 2232 2027 --1778 11788
NM_004396chr17253 42 ------
NM_004397chr1163583 3303 3121 1718 1578 1071 32781 2684 1692 ----
NM_004405chr2154 --11096 --
NM_004412chr1033816 1109 848 15737 --1205
NM_004418chr21467 ----1640
NM_004430chr862733 2618 2567 2294 1693 376 ------
NM_004432chr941896 575 450 250 ----1160
NM_004438chr253114 2115 538 159 143 --12345 --
NM_004440chr641771 1368 1349 794 --1638 1364
NM_004441chr311222 ----1150
NM_004447chr122303 30 ------
NM_004457chr241601 1217 518 486 --1505 --
NM_004458chrX42599 2156 557 153 --11010 12008
NM_004459chr1741955 1818 689 235 11992 41495 621 427 402 11579
NM_004474chr11775 ------
NM_004480chr141309 ------
NM_004481chr112633 ------
NM_004482chr21976 ------
NM_004491chr1914302 --13771 --
NM_004496chr1431214 1179 183 11249 ----
NM_004500chr142363 157 11492 21497 711 11845
NM_004504chr233063 1040 253 2443 348 1637 --
NM_004516chr191514 --11196 --
NM_004525chr231355 1153 251 --11460 --
NM_004537chr1231378 1132 260 --1453 --
NM_004538chrX3811 744 704 --1644 --
NM_004540chr211754 1636 2190 178 --
NM_004571chr2113409 --32997 1300 1043 --
NM_004575chr441333 1212 657 558 --11454 --
NM_004582chr12149 108 ------
NM_004583chr172739 575 ------
NM_004586chrX65309 5252 5208 4989 4903 4035 1177 25409 597 --
NM_004591chr22406 157 --1389 --
NM_004593chr32275 67 --145 --
NM_004598chr533193 2662 106 12110 1109 --
NM_004602chr2011281 --11172 --
NM_004607chr51182 ------
NM_004612chr9104747 4617 4409 4227 4056 3850 689 351 285 74 --44005 3978 589 108 --
NM_004627chr211632 ------
NM_004654chrY21106 369 ------
NM_004655chr1721369 457 11062 ----
NM_004657chr241559 560 553 388 --11303 --
NM_004660chrY82284 2278 2230 1602 1521 378 211 76 ------
NM_004663chr1521431 1178 21521 638 1253 --
NM_004681chrY1134 --1205 --
NM_004684chr41138 --1333 --
NM_004686chr851747 1412 1375 531 77 --1607 --
NM_004705chr112592 257 --1836 --
NM_004708chr19182 ------
NM_004709chrX41835 1771 1758 42 1125 ----
NM_004718chr22594 201 165 ----
NM_004719chr1242440 1157 759 610 --12818 --
NM_004726chrX44790 4693 1589 563 --13612 --
NM_004727chr1531923 1695 667 --1868 --
NM_004730chr532020 439 294 --1827 --
NM_004733chr31444 ------
NM_004736chr13835 578 282 1820 11963 --
NM_004737chr2211230 ------
NM_004738chr2052083 1740 1012 750 284 --1809 --
NM_004742chr341830 1695 1338 732 1277 --11666
NM_004745chr896941 6652 5558 4674 2670 1327 1193 928 813 12387 --24783 1132
NM_004748chr1564189 3674 3032 2889 2829 1120 ------
NM_004759chr112135 ------
NM_004760chr722469 1949 1420 1879 --
NM_004768chr131162 410 301 ------
NM_004772chr51501 ------
NM_004775chr1851723 1589 739 391 372 --1727 --
NM_004781chr11574 11402 1609 1584
NM_004781chr11574 11402 1609 1584
NM_004787chr4199 ------
NM_004788chr1122326 55 22499 2446 12284 --
NM_004796chr1422160 685 --1931 --
NM_004800chr131199 ------
NM_004808chr1062401 2109 1359 658 382 366 ------
NM_004814chr1--2449 113 1423 --
NM_004815chr164053 3963 1950 1856 1305 54 --23756 1898 11522
NM_004822chr17----13812 --
NM_004831chr191844 ------
NM_004834chr262937 2647 1313 1243 1081 973 12774 ----
NM_004836chr2----1383 --
NM_004841chr1----1316 2302 95
NM_004842chr641599 1376 1259 158 --21799 351 21263 496
NM_004845chrX53476 3385 1450 720 444 --13000 --
NM_004849chr621635 1334 --11327 --
NM_004856chr151384 ------
NM_004857chr1423050 829 53974 3766 971 496 252 --23059 1364
NM_004859chr1742545 2328 793 396 22972 2373 1847 --
NM_004863chr1444853 4717 4327 1836 34263 4051 3897 11946 --
NM_004865chr62303 296 1314 ----
NM_004867chrX3614 448 192 --1114 --
NM_004869chr1831608 149 80 1394 ----
NM_004871chr1734337 3892 245 --14276 --
NM_004872chr11294 --1168 --
NM_004893chr52378 155 ------
NM_004898chr422268 274 22647 1904 ----
NM_004904chr796447 6190 6048 5444 5204 1542 1366 1104 765 --14266 16469
NM_004906chr61698 --1640 1237
NM_004912chr7----11214 --
NM_004921chr152061 1810 955 525 113 11013 ----
NM_004932chr521730 1298 ------
NM_004949chr1832078 785 118 12012 11760 --
NM_004956chr773836 1778 1743 1464 1390 142 67 1511 24410 1229 --
NM_004973chr661706 1500 1437 1326 1137 267 ------
NM_004985chr1254523 3470 2830 2770 1183 13089 12858 --
NM_004992chrX78345 7397 7209 7187 6370 5498 2223 --15570 --
NM_004992chrX78345 7397 7209 7187 6370 5498 2223 --15570 --
NM_004993chr1421458 1396 ----11522
NM_004998chr152261 101 ------
NM_004999chr654164 1711 1379 733 309 13703 22777 680 --
NM_005010chr73731 586 476 ------
NM_005020chr71582 ------
NM_005023chr521224 1105 ------
NM_005028chr101851 ------
NM_005034chr84680 576 539 67 ------
NM_005037chr31204 --1144 --
NM_005044chrX64481 4307 3567 852 544 229 --13788 --
NM_005045chr71858 --147 --
NM_005054chr22633 601 1624 ----
NM_005056chr1255397 4848 4114 3460 652 --1339 --
NM_005065chr1444227 1658 1336 377 --35409 1753 1491 --
NM_005079chr851277 905 525 420 322 --33126 1288 704 --
NM_005086chr121173 1388 11305 11309
NM_005095chr11826 11888 12086 11868
NM_005096chrX11265 --21168 890 --
NM_005109chr342056 729 626 443 1646 158 --
NM_005116chr2074157 3332 1827 1312 1093 871 232 --24469 1114 --
NM_005121chr1783685 3229 3163 3110 1173 650 596 450 --33733 2807 136 1858
NM_005134chr183906 644 347 --1620 --
NM_005135chr1543741 2542 2455 716 --13132 --
NM_005139chr42319 131 --1322 --
NM_005154chr153494 419 182 ------
NM_005156chr9125186 4669 4629 3853 3629 3306 2057 1631 1590 1332 1118 864 --11563 --
NM_005160chr2266576 6521 6154 6104 5999 1725 16530 --15461
NM_005168chr221676 1630 11188 11346 --
NM_005171chr1211283 --11313 --
NM_005180chr1041188 1052 281 195 11119 31533 1487 1412 1551
NM_005188chr1185941 2879 2870 2851 2181 2155 1299 719 --16690 1774
NM_005197chr1496190 6141 6112 5044 4764 4436 2463 1062 301 --16061 1736
NM_005201chr33995 855 126 ------
NM_005203chr101282 ------
NM_005207chr2243351 1016 301 193 ------
NM_005214chr21348 ------
NM_005222chr7--1673 2919 835 --
NM_005233chr352091 1776 877 656 217 1580 1665 --
NM_005235chr247416 7354 2270 2204 14880 17269 --
NM_005238chr1153552 3276 2723 2169 644 182 12400 --
NM_005239chr213526 481 139 ------
NM_005242chr551474 1309 1295 1245 978 1136 ----
NM_005249chr142776 737 1807 ----
NM_005252chr143756 636 582 --2767 233 --
NM_005254chr1521011 254 --21254 1135 --
NM_005256chr111941 ------
NM_005257chr181566 --11147 --
NM_005259chr221469 453 1408 1972 --
NM_005264chr101902 ------
NM_005277chr411386 ------
NM_005279chr22851 76 --1116 --
NM_005302chr72401 322 1288 ----
NM_005311chr732167 438 424 ------
NM_005316chr113855 316 150 1812 ----
NM_005324chr1741582 536 97 84 1203 1184 --
NM_005329chr1611552 --12273 --
NM_005339chr483468 2932 1669 1568 1068 993 388 380 --23201 1728 --
NM_005342chrX52756 2512 2218 130 87 --12636 11785
NM_005349chr41394 ------
NM_005358chr1361746 1706 1540 425 52 29 --1350 1599
NM_005359chr1886118 4647 4222 4009 2381 2115 2080 536 34927 1963 799 31095 441 372 --
NM_005369chrX2437 227 ------
NM_005375chr621032 854 --1872 --
NM_005378chr2------1551
NM_005385chr332622 2567 2517 1130 11842 --
NM_005386chr202789 763 ------
NM_005387chr111548 ------
NM_005388chr93370 58 34 --1263 11585
NM_005398chr1021280 426 --21269 67 --
NM_005400chr243032 2943 2577 137 --13074 --
NM_005402chr72492 110 ------
NM_005406chr182177 127 --11286 --
NM_005410chr51667 --1683 --
NM_005415chr2------1622
NM_005417chr2012012 ------
NM_005433chr1842628 2438 2251 336 12698 22637 896 1358
NM_005436chr1063725 3060 2728 1489 1228 996 13343 11002 --
NM_005456chr111184 ------
NM_005460chr5149 --1490 --
NM_005461chr2061939 1864 1779 1676 1242 595 ------
NM_005475chr12--13290 23225 213 --
NM_005476chr9--11240 21091 954 --
NM_005487chr2272043 1929 1689 836 614 68 44 --11605 --
NM_005493chr63812 131 32 ----1557
NM_005494chr73545 220 175 ------
NM_005497chr1766015 5345 4897 1279 1266 510 16066 ----
NM_005499chr191262 164 --1580
NM_005502chr952961 2742 2013 727 473 22665 721 12940 --
NM_005504chr1286211 5593 2537 2193 1150 854 146 67 26167 5414 35229 2632 2629 --
NM_005509chr51694 --11668 --
NM_005517chr11151 --11465 --
NM_005520chr52738 716 1257 ----
NM_005522chr7--1890 ----
NM_005536chr841232 1153 1045 32 --11109 1944
NM_005537chr13160 --1951 --
NM_005544chr22928 210 ------
NM_005562chr161389 1239 1191 487 477 172 11498 ----
NM_005570chr1831035 325 78 ------
NM_005578chr363978 3480 1631 1168 904 779 13393 14853 13923
NM_005593chr121459 ------
NM_005595chr11845 ----1963
NM_005596chr946237 5349 5262 5170 36347 5120 4389 25997 4688 --
NM_005598chr121274 246 --1222 11266
NM_005600chr11229 ------
NM_005604chr661893 1870 1001 698 451 98 ------
NM_005611chr1611241 --21215 1116 --
NM_005613chr121665 293 --11533 --
NM_005614chr72758 226 ----1324
NM_005626chr11538 1134 1550 --
NM_005627chr64818 747 662 137 ------
NM_005637chr1831994 528 48 11367 --12051
NM_005638chrX1301 ----1395
NM_005639chr1221532 261 ------
NM_005646chr1189 ------
NM_005647chrX53478 3271 1220 877 458 12556 33137 2811 648 --
NM_005651chr41292 --1103 --
NM_005655chr841196 1147 848 463 ------
NM_005668chr584463 3766 3539 3406 3329 2914 1712 693 14480 34600 4573 1479 --
NM_005669chr542053 1689 885 97 --21994 1891 1264
NM_005694chr31109 ------
NM_005711chr52821 257 ------
NM_005715chr612540 ------
NM_005717chr121053 43 1402 ----
NM_005722chr22575 54 ----12227
NM_005733chr5----1244 --
NM_005737chr211933 11843 ----
NM_005742chr22836 201 ------
NM_005744chr152165 132 ------
NM_005746chr74706 548 342 51 12538 12606 --
NM_005748chr125952 883 733 659 162 22165 520 2582 443 --
NM_005749chr171646 ------
NM_005751chr7182 ------
NM_005754chr52836 461 ------
NM_005756chrX41257 1150 1103 1069 11111 11231 11235
NM_005759chr244772 4684 1070 731 --13135 1735
NM_005780chr132936 241 ----1278
NM_005795chr21394 21851 609 22704 1940 --
NM_005807chr1----1182 --
NM_005808chr323545 478 --22557 871 --
NM_005819chr12592 474 1848 2795 342 1863
NM_005822chr672208 1603 1461 928 891 814 614 --12083 --
NM_005826chr11143 1521 ----
NM_005828chr1754497 4116 3650 1550 110 ------
NM_005829chr1521616 769 1573 11224 --
NM_005832chr311401 11162 2930 390 --
NM_005836chr8--133 ----
NM_005840chrX67084 4667 2937 2512 2167 1972 --35269 2310 2230 --
NM_005841chr441080 1032 411 125 ------
NM_005842chr134714 554 517 235 --1606 --
NM_005843chr221319 610 ------
NM_005845chr132429 345 ------
NM_005859chr521458 961 --1424 --
NM_005860chr192280 62 ----1335
NM_005868chr721882 123 --2832 264 1907
NM_005869chr5167 ------
NM_005870chr1331093 154 81 1937 ----
NM_005875chr3----1259 --
NM_005877chr2242399 2203 580 355 ------
NM_005880chr1611132 ------
NM_005884chr191650 ------
NM_005885chr51648 ------
NM_005891chr6--1195 ----
NM_005898chr1153073 2412 2224 879 111 23143 1024 ----
NM_005900chr41229 --11227 --
NM_005901chr18158559 8474 7976 7661 6462 6374 6122 5819 5595 5561 5281 5273 3139 1160 342 11259 11758 11436
NM_005902chr1534363 1341 89 ----14564
NM_005903chr575171 4816 3676 1135 809 470 287 14435 45218 3912 3228 2057 23232 31
NM_005904chr1821330 205 ------
NM_005906chr631484 1142 32 ------
NM_005910chr1734090 3615 2662 --24124 3359 --
NM_005911chr221106 1096 ------
NM_005934chr1912570 ------
NM_005935chr455259 5236 4855 4093 1289 --1599 14589
NM_005941chr873285 2981 1598 1568 1468 798 145 --13698 --
NM_005944chr311078 --21213 1030 1759
NM_005955chr175465 5441 4031 3614 1882 1641 1222 --1414 --
NM_005962chr1012174 21564 680 11546 --
NM_005962chr1012174 21564 680 11546 --
NM_005964chr172226 175 ------
NM_005966chr272339 1752 1574 557 280 200 89 --21764 772 11733
NM_005977chr13158 ----1223
NM_005999chr1190 ------
NM_006007chr994032 3425 3177 1459 1423 1302 1074 1036 677 23362 717 ----
NM_006016chr622221 1665 --1607 --
NM_006036chr252371 2143 2072 1601 629 --12156 --
NM_006037chr263983 3891 3703 1946 1749 1575 --41752 1109 902 689 --
NM_006038chr2022225 2102 ------
NM_006039chr17----11082 --
NM_006040chr1611320 ------
NM_006047chr20113456 3394 3305 2678 2262 2202 811 571 184 100 64 --2525 41 --
NM_006060chr723568 3059 --23701 3518 11199
NM_006070chr31129 ------
NM_006080chr741823 819 726 325 11938 11896 --
NM_006083chr51113 ------
NM_006089chrX11293 --11241 11592
NM_006090chr12566 527 ------
NM_006095chr432775 965 701 14509 13754 12896
NM_006100chr31224 --1115 --
NM_006106chr1153247 2768 845 652 165 13412 22988 182 --
NM_006113chr141896 1830 1761 845 --11843 --
NM_006133chr1112480 --12408 --
NM_006135chr131188 970 522 ------
NM_006136chr72931 101 --21231 1146 --
NM_006141chr1611718 22484 559 ----
NM_006147chr12456 42 --2337 64 --
NM_006152chr12----1235 --
NM_006153chr32539 98 --1224 --
NM_006158chr821419 1236 ----11558
NM_006159chr121495 ------
NM_006162chr1821314 1159 --11348 --
NM_006164chr22412 340 ------
NM_006166chr1252564 2451 1824 609 281 --1250 --
NM_006178chr1731436 1009 368 --11596 --
NM_006180chr9----1566 --
NM_006186chr231138 452 368 1327 --1182
NM_006190chr23781 703 366 ------
NM_006191chr122880 780 ------
NM_006194chr1431233 394 258 --11120 --
NM_006195chr921280 241 ------
NM_006197chr811919 --32054 1963 475 11606
NM_006202chr1911929 ------
NM_006203chr554114 925 851 795 49 15319 11235 --
NM_006206chr452758 1946 644 194 72 --12282 --
NM_006209chr8----156 --
NM_006212chr175430 5061 4450 3281 2020 1669 1064 14061 23687 3553 --
NM_006218chr31277 ------
NM_006226chr251410 1333 1257 378 331 --2968 420 --
NM_006237chr1322001 1837 ------
NM_006241chr34523 124 64 28 12348 ----
NM_006246chr1441297 974 235 83 1292 ----
NM_006251chr553273 2947 2481 2433 696 32625 2398 1080 ----
NM_006252chr1117568 7279 5741 5420 2627 2109 2078 1019 1005 200 28 46011 5945 5193 2334 37018 4617 2353 --
NM_006256chr132719 1720 611 ----1770
NM_006258chr10----1270 --
NM_006259chr4--1929 1310 --
NM_006265chr81945 11338 21502 1483 --
NM_006281chr81384 --2818 310 --
NM_006281chr81384 --2818 310 --
NM_006282chr20104707 4304 4265 3365 3070 1600 1299 960 893 335 --34173 2909 924 --
NM_006283chr831511 1092 737 11945 14676 1453
NM_006284chr11173 ------
NM_006287chr272513 2379 2266 489 181 159 126 --11041 --
NM_006300chr1962449 1681 550 479 427 136 1643 31913 396 170 --
NM_006305chr15133 ------
NM_006306chrX31731 1646 1615 22016 1485 11411 --
NM_006310chr17----11300 --
NM_006313chr1231416 1331 1250 ------
NM_006315chr444393 2958 821 470 12951 13918 --
NM_006323chr42622 603 ------
NM_006325chr121189 ------
NM_006329chr143255 236 164 ------
NM_006330chr841619 1092 547 424 ------
NM_006352chr141917 1574 696 644 --11664 --
NM_006359chrX31558 961 885 ------
NM_006364chr1431253 1218 316 --198 --
NM_006366chr631334 1169 1140 1351 --1469
NM_006371chr375323 5189 5000 3855 3508 1589 1217 --11991 14905
NM_006379chr742162 1870 1502 299 ------
NM_006380chr1733748 3475 982 --22993 1455 14384
NM_006386chr2282349 2168 1971 1827 735 690 567 421 ------
NM_006389chr112392 361 11369 ----
NM_006393chr1064294 4215 3748 3517 1347 768 14557 34033 2980 2868 --
NM_006403chr611652 --1414 --
NM_006415chr911232 1120 ----
NM_006416chr61239 --1213 --
NM_006421chr81913 --1432 --
NM_006434chr1023126 2492 ----23045 846
NM_006459chr1031791 1714 1698 --11701 --
NM_006464chr264472 3885 3458 3204 988 247 --21754 1206 --
NM_006467chr532203 2050 1476 12182 11801 1359
NM_006469chr121158 129 ----1101
NM_006482chr1283500 2612 2516 1543 1275 919 732 45 --23906 830 12734
NM_006489chr142287 26 ------
NM_006520chrX21465 1075 --11640 --
NM_006526chr2022106 502 1601 1586 --
NM_006534chr2052556 1078 991 530 79 12835 23323 3155 --
NM_006538chr274069 2862 2799 2639 1313 627 544 ------
NM_006540chr811310 ------
NM_006544chr1445363 3741 3721 1631 1466 35582 1874 301 --
NM_006546chr1756542 5769 2220 532 263 --12410 1502
NM_006547chr73601 385 55 21787 402 ----
NM_006557chr921133 346 11713 1367 --
NM_006561chr1064861 4482 3897 1259 257 128 11271 35468 3977 1276 --
NM_006565chr161866 --11115 --
NM_006572chr1762880 2811 1146 939 545 439 --12814 --
NM_006577chr221213 899 --1990 --
NM_006585chr21------1141
NM_006593chr21557 ------
NM_006595chr113659 624 505 ------
NM_006597chr112192 28 ------
NM_006599chr1687618 7426 7170 6429 5195 1569 401 168 67877 6660 5187 3143 2846 269 12408 32919 2418 342
NM_006601chr1211051 ------
NM_006603chrX61827 1630 1359 803 533 471 ----11614
NM_006614chr343599 3484 2721 782 12248 31183 1100 210 1344
NM_006620chr614007 24554 3844 21271 1231 --
NM_006624chr1061964 1691 1630 1470 246 80 --11610 --
NM_006625chr13962 924 739 ------
NM_006625chr13962 924 739 ------
NM_006625chr13962 924 739 ------
NM_006628chr1564090 3756 3064 1445 375 141 14296 1989 --
NM_006629chr1842599 2110 745 712 12498 ----
NM_006633chr51786 ------
NM_006636chr23784 418 345 1770 ----
NM_006644chr131589 ------
NM_006646chr13--12174 31977 422 124 --
NM_006653chr6199 --1392 --
NM_006654chr1274548 3768 3757 956 885 805 791 1375 24782 1351 --
NM_006670chr61673 ------
NM_006682chr731854 1071 322 --22895 289 --
NM_006696chr51243 ------
NM_006698chr202526 185 ------
NM_006699chr11826 --2440 287 1862
NM_006704chr133314 65 28 ------
NM_006713chr5197 --2835 736 --
NM_006717chr972558 2408 2234 2224 1049 369 73 13005 12926 11101
NM_006718chr62241 164 --1896 --
NM_006720chr1055059 4768 3712 1787 1253 24354 1906 ----
NM_006722chr32948 214 ------
NM_006726chr421212 1036 1137 ----
NM_006729chrX55200 1394 1028 649 159 1667 1916 --
NM_006750chr16118121 7289 6655 6555 5695 4920 2982 1098 356 319 300 --35561 844 458 --
NM_006751chr22923 400 ------
NM_006754chr781208 1181 1071 952 885 494 337 53 1928 ----
NM_006756chr841319 1213 1156 1038 ------
NM_006759chr21303 --1233 --
NM_006761chr17----2840 561 --
NM_006766chr832138 1928 1066 --1104 1555
NM_006769chr11520 ----1577
NM_006775chr652901 2724 2132 583 169 12766 12242 --
NM_006777chrX42747 1117 991 758 --12396 --
NM_006788chr1832121 1305 854 ------
NM_006791chr154628 510 259 204 ------
NM_006807chr1721245 1020 ------
NM_006813chr6194 --1199 --
NM_006823chr82541 501 ------
NM_006826chr21917 1893 --1926
NM_006836chr121445 ------
NM_006838chr1221237 319 --21813 385 --
NM_006873chr21612 12416 11193 --
NM_006874chr4--1370 ----
NM_006885chr1643076 2680 866 540 --22789 555 --
NM_006888chr1483108 2940 2882 2786 2158 1064 804 635 ------
NM_006912chr151923 886 516 252 155 11830 ----
NM_006914chr93975 359 303 ------
NM_006915chrX61746 974 681 491 391 137 ------
NM_006916chr21435 ------
NM_006918chr1175782 5752 4341 1384 1051 933 431 25881 1210 14291 14596
NM_006920chr221839 37 ------
NM_006922chr232009 206 35 11944 2853 816 11950
NM_006924chr1774120 3949 665 624 505 252 211 22762 893 ----
NM_006930chr531769 1298 733 1770 ----
NM_006936chr2151121 1099 511 240 41 1205 1887 --
NM_006939chr141767 ------
NM_006948chr2132426 2411 1571 1814 ----
NM_006981chr952933 2714 1863 372 194 21957 278 ----
NM_006982chr121253 1101 ----
NM_007005chr921554 1306 --21161 512 --
NM_007006chr1673550 3387 2594 2412 711 511 337 --1138 --
NM_007007chr1223902 1734 --21789 196 --
NM_007008chr22297 201 1841 ----
NM_007011chr1575576 5182 4437 4278 2353 1019 277 1219 --11497
NM_007013chr81399 --1183 --
NM_007017chr51924 1743 ----
NM_007023chr23885 819 84 ------
NM_007033chr13632 588 30 154 ----
NM_007038chr2155610 5068 1803 1784 1265 11166 --11600
NM_007042chr341720 1067 691 539 1532 11932 --
NM_007050chr2047740 2572 2425 180 --12433 --
NM_007054chr593955 3878 2419 1137 747 522 420 214 205 ------
NM_007064chr31600 --11518 --
NM_007068chr222858 23 11043 ----
NM_007078chr1022500 1942 ------
NM_007111chr133688 564 155 --1741 --
NM_007114chr342087 1130 327 138 22563 2461 ----
NM_007115chr2----2491 460 --
NM_007124chr642002 1913 1568 44 11487 1208 --
NM_007137chrX65516 4340 3671 3495 1847 1586 25317 303 --13542
NM_007146chr1762775 2316 1117 985 356 237 --3885 669 464 --
NM_007147chr192916 381 ------
NM_007159chr351665 1607 1537 1446 139 --11617 --
NM_007166chr1141587 1431 1270 583 1214 ----
NM_007172chr2253234 3206 2476 38 29 ------
NM_007173chr11167 --1682 --
NM_007174chr1232263 2131 2005 --21817 1543 --
NM_007178chr121465 ------
NM_007191chr122643 456 ------
NM_007192chr14----1263 --
NM_007195chr1843637 2566 2465 1452 1907 ----
NM_007197chr12------1872
NM_007204chr13503 225 159 ------
NM_007218chr83752 687 221 ------
NM_007220chrX44646 4145 3915 1908 24940 65 --14001
NM_007222chr821567 390 21587 455 ----
NM_007235chr124343 212 114 101 ------
NM_007236chr1542115 775 623 119 12159 12445 12045
NM_007249chr1369270 9081 7721 2044 662 249 --59231 8170 8045 7211 1689 11699
NM_007269chr11432 --2186 68 --
NM_007276chr721098 214 --11087 1822
NM_007315chr211391 --11549 --
NM_007345chr1821595 197 11556 ----
NM_007350chr1264433 4253 1149 778 517 69 ------
NM_007353chr762911 2774 2717 2591 2538 2205 12819 ----
NM_007358chr151998 1928 1479 540 173 --1753 --
NM_007363chrX----2866 200 --
NM_007372chr172654 315 ----1677
NM_007373chr1041730 411 393 358 --41478 1365 1131 478 --
NM_007375chr122344 74 12120 ----
NM_012064chr121906 ------
NM_012073chr52496 268 ----187
NM_012081chr553087 2959 1354 1346 68 23066 910 ----
NM_012082chr84995 759 295 284 ------
NM_012090chr121179 506 --11084 194
NM_012096chr343497 2953 1097 594 12328 22674 1248 --
NM_012110chr41224 ------
NM_012120chr632908 2701 246 1748 2878 697 --
NM_012124chr112956 916 1759 ----
NM_012129chr712169 ----12329
NM_012141chr1344062 3267 450 100 21664 1637 --13809
NM_012153chr1131628 452 275 --22194 455 --
NM_012158chr131138 11151 ----
NM_012164chr977357 6971 5140 4797 1847 1414 664 --15323 --
NM_012175chr113745 165 81 --1119 --
NM_012177chr6180 122 ----
NM_012180chr41485 ------
NM_012193chr1153726 1620 1261 1053 895 25313 4292 24544 3494 --
NM_012199chr154378 3465 3276 1285 596 --23542 1613 --
NM_012214chr2116200 5701 5684 5643 5247 5085 4128 2571 2234 1098 834 --11047 2998 292
NM_012215chr1021926 190 ------
NM_012223chr221187 1130 --1843 --
NM_012224chr42767 132 ----11213
NM_012234chr353173 2513 385 342 211 ------
NM_012238chr1041640 661 140 30 --11359 --
NM_012242chr101203 1321 ----
NM_012245chr141408 ------
NM_012247chr10------1236
NM_012249chr262486 2464 2314 1395 420 403 13081 ----
NM_012250chr1111311 11173 ----
NM_012252chr795055 4845 4829 4700 4611 3971 1866 1251 637 15214 54984 4415 3378 2015 83 15244
NM_012255chr202337 183 --2394 164 --
NM_012262chr195127 4938 4700 4592 3818 3779 3415 967 83 13446 13335 15214
NM_012281chr732350 2297 890 ------
NM_012286chrX3578 498 248 1192 ----
NM_012289chr19152 ------
NM_012294chr783731 3629 2663 753 706 277 95 72 ------
NM_012297chr472564 2450 2311 2155 2067 1884 959 1193 12518 --
NM_012300chr552568 1587 807 560 287 22524 2458 1367 --
NM_012301chr731974 670 489 ------
NM_012302chr121155 866 ------
NM_012311chr101421 ------
NM_012316chr145663 3431 1631 599 --24473 3981 11953
NM_012325chr2031571 1520 1342 ------
NM_012328chr71586 1496 --11072
NM_012329chr1751312 1238 1109 1066 378 ------
NM_012330chr1021572 422 ----1657
NM_012342chr101332 ------
NM_012347chr642874 2167 269 171 ------
NM_012382chr533988 1203 156 21171 708 34447 3638 1613 --
NM_012399chr22----11400 11770
NM_012414chr11541 ----1286
NM_012416chr931181 1096 275 --11252 1279
NM_012421chr11415 ------
NM_012432chr1167 ------
NM_012448chr1732444 866 602 ------
NM_012454chr61169 ------
NM_012464chr472836 2738 1951 1847 894 676 430 12855 32588 937 923 12845
NM_012479chr722232 1962 ----22434 289
NM_012482chr13618 598 500 1562 ----
NM_013229chr1252857 610 494 113 101 12099 11966 --
NM_013230chrY21735 547 --2558 495 --
NM_013231chr1423503 251 --14241 --
NM_013232chr51411 ------
NM_013233chr241467 1245 920 406 21352 938 21409 261 --
NM_013254chr121139 ------
NM_013257chr812344 ------
NM_013261chr442791 2373 1242 77 11056 13699 12902
NM_013262chr621273 484 --1923 --
NM_013269chr1264335 4116 3002 2821 1496 688 13199 13883 --
NM_013280chr112284 223 ------
NM_013283chr53853 685 317 --1864 --
NM_013293chr71196 --1153 --
NM_013305chr181125 ------
NM_013309chr1552399 1993 1626 680 439 ----1574
NM_013316chr71312 1431 1302 --
NM_013320chr122129 26 ------
NM_013330chr12216 85 ------
NM_013341chr21494 --22813 753 --
NM_013351chr171685 --1606 --
NM_013361chr193593 162 138 ------
NM_013371chr11257 ------
NM_013374chr343093 3068 907 197 32883 737 494 --1795
NM_013381chr123479 362 253 ----1611
NM_013386chr121655 725 ------
NM_013396chr2141433 1116 460 276 --184 --
NM_013400chr71829 2956 940 ----
NM_013411chr12405 161 --22254 1958 --
NM_013437chr841419 1056 1011 253 --1221 --
NM_013438chr92405 231 11661 21541 399 --
NM_013448chr14143 ------
NM_013449chr1222869 1137 --11078 --
NM_013943chr143301 2210 1138 821 2485 363 33289 597 504 --
NM_013960chr8--1653 1670 --
NM_013989chr1443421 2028 1907 396 14137 128 --
NM_013995chrX32614 787 501 22115 1672 1676 --
NM_013996chr73162 147 107 ------
NM_013996chr73162 147 107 ------
NM_013997chr73162 147 107 ------
NM_013997chr73162 147 107 ------
NM_013998chr73162 147 107 ------
NM_013998chr73162 147 107 ------
NM_014010chr91618 ------
NM_014011chr262364 2112 2103 979 893 780 --1911 --
NM_014021chr173428 3286 2876 2663 2587 972 324 ------
NM_014028chr643143 2542 1174 701 --22439 1049 1457
NM_014034chr611415 ------
NM_014043chr31623 11384 21665 411 --
NM_014048chr1665256 5067 1406 1190 920 94 --14787 --
NM_014056chr322021 370 --21680 80 22356 748
NM_014059chr131247 ------
NM_014060chrX140 ------
NM_014106chr1542718 2632 2264 241 --22887 2741 --
NM_014112chr864443 2052 2039 1669 1359 429 24320 1872 21962 1910 15293
NM_014117chr1642673 2258 407 227 --11877 --
NM_014154chr331215 341 201 --1349 --
NM_014155chr1197380 7314 7290 7216 5878 1561 1283 1015 458 22540 557 15398 --
NM_014170chr3189 ------
NM_014181chr23937 818 512 --1790 12886
NM_014191chr122970 56 ------
NM_014203chr191329 ------
NM_014211chr531721 430 161 ------
NM_014217chr11317 11493 169 --
NM_014228chr511114 11428 ----
NM_014230chr17151 ------
NM_014243chr471839 760 584 535 491 450 159 ----1250
NM_014248chr222140 31 ------
NM_014250chr2272043 1929 1689 836 614 68 44 --11605 --
NM_014251chr72909 784 --1793 1594
NM_014253chrX2342 66 --2583 164 11960
NM_014263chr1041005 548 183 37 ------
NM_014267chr11------145
NM_014278chr43454 347 176 --1356 1461
NM_014279chr91683 ------
NM_014280chr12941 898 --1377 --
NM_014283chr111325 --21280 1195 --
NM_014294chr81120 --11203 1170
NM_014296chr341049 631 550 413 ----11006
NM_014309chr2275213 4728 4175 3846 1366 973 49 --25366 2062 --
NM_014317chr10----1262 --
NM_014319chr1251819 1705 1487 1390 1244 --1469 --
NM_014322chr121177 982 --11132 --
NM_014333chr1132345 2220 319 --12507 11794
NM_014342chr111591 1540 1923 --
NM_014345chr63838 809 401 ------
NM_014351chr221317 --11074 --
NM_014363chr132118 58 2948 100 11226 --
NM_014372chr131947 1818 411 21904 1712 21618 257 --
NM_014374chr71829 2956 940 ----
NM_014379chr82976 284 --2789 136 --
NM_014382chr341557 1437 662 365 11476 ----
NM_014392chr421072 118 ------
NM_014393chr862367 2286 2251 2096 1810 1723 11730 22273 942 1450
NM_014399chr73945 875 178 1843 1741 --
NM_014415chr331475 1085 225 11250 ----
NM_014421chr431419 361 354 31865 494 464 --11500
NM_014423chr565290 5076 3415 1897 1458 565 44091 3811 3699 1723 24750 1593 1871
NM_014445chr312040 31780 1538 237 22363 622 --
NM_014458chr111371 11094 ----
NM_014469chr11--1200 ----
NM_014478chr772172 2119 1863 1815 1574 774 76 ------
NM_014487chr4--1253 ----
NM_014488chr111591 --1264 --
NM_014494chr163587 523 511 11720 11882 12355
NM_014515chr121387 ------
NM_014548chr1531506 463 188 1135 ----
NM_014552chr231423 1096 181 ------
NM_014554chr1272118 2056 1967 1942 1835 1766 795 11564 11983 --
NM_014570chr221102 --2935 657 --
NM_014575chr3------2213 71
NM_014577chr221570 --165 --
NM_014592chr52772 566 ------
NM_014606chr43496 286 97 21450 1128 ----
NM_014608chr152435 221 ------
NM_014612chr931202 999 586 --21096 1086 --
NM_014613chr513089 12813 11100 11234
NM_014615chr1623570 382 21196 713 13618 1845
NM_014616chr343459 3358 1353 965 --1295 12487
NM_014620chr122744 714 --1542 --
NM_014630chr1513184 --1869 --
NM_014636chr974293 4116 4024 3911 2687 1165 425 ------
NM_014644chr11701 1991 --1914
NM_014647chr1631923 1883 812 11999 ----
NM_014659chr151935 1429 ----
NM_014660chr72310 125 --1807 --
NM_014666chr511190 ----11047
NM_014667chr311906 ----12044
NM_014670chr251497 617 539 229 155 ------
NM_014671chr73456 254 197 --11073 --
NM_014682chr81526 11679 ----
NM_014683chr1741559 1535 847 594 ------
NM_014685chr161489 1441 ----
NM_014701chr152548 400 13050 ----
NM_014702chr632732 264 250 12495 ----
NM_014705chr762121 577 542 319 166 148 11544 11843 --
NM_014707chr752073 1531 862 767 541 --12248 --
NM_014709chr21564 1600 ----
NM_014711chr1631496 767 412 ------
NM_014712chr162635 210 ------
NM_014717chr19----1677 1868
NM_014720chr1031830 1576 1185 ----11840
NM_014721chr6147422 7059 6914 6129 6085 5587 4839 2208 1424 1332 1082 721 369 76 14987 11306 11339
NM_014723chr2022914 2084 ------
NM_014727chr191221 ------
NM_014729chr84923 722 204 62 1111 22019 876 --
NM_014730chr1235284 3832 619 ------
NM_014730chr1235284 3832 619 ------
NM_014733chr522071 28 --1705 --
NM_014735chrX--1331 ----
NM_014741chr111766 ----11376
NM_014743chr422299 1262 1831 22319 27 --
NM_014746chr254338 3568 1376 899 852 13913 33554 1490 706 11099
NM_014751chr862168 2053 1998 1931 1595 1561 12066 ----
NM_014755chr2103952 3888 2765 1646 1447 1204 1069 507 370 262 13709 21260 586 11309
NM_014757chr522273 866 ----12261
NM_014772chr1872834 2728 2707 2455 723 697 445 ------
NM_014779chr331101 876 730 ------
NM_014781chr841140 947 844 485 ----21155 969
NM_014783chr152552 228 1100 ----
NM_014787chr132796 2165 1821 --11780 --
NM_014790chr5150 ------
NM_014791chr91246 ------
NM_014795chr211129 ----3417 180 50
NM_014802chr122873 827 1389 ----
NM_014803chr1042504 1078 937 687 11913 12120 --
NM_014810chr142978 1282 961 549 --1969 --
NM_014812chr111749 --11475 --
NM_014819chr512328 22389 1716 22447 834 --
NM_014826chr174383 4093 3376 952 740 477 253 23223 1655 ----
NM_014827chr13372 214 65 ------
NM_014828chr1411566 12009 --11812
NM_014830chr1233896 2767 2704 --23807 2797 --
NM_014832chr1332033 634 413 --22111 1740 2743 212
NM_014836chr1022033 1303 ------
NM_014839chr142533 2520 1815 850 12123 ----
NM_014860chr241628 804 728 268 --22001 1039 --
NM_014873chr1144429 4183 3888 3705 3586 2953 1786 1565 1506 1194 901 530 507 316 --13658 --
NM_014874chr141903 1799 745 301 11200 1188 --
NM_014877chr1776814 5939 2924 2190 1232 801 132 --26576 6557 1253
NM_014892chr61173 ------
NM_014893chrY31660 930 182 --11957 --
NM_014897chr1753169 3049 2498 1233 1167 11187 ----
NM_014900chr221064 780 ------
NM_014903chr1211948 22103 1869 12390 --
NM_014904chr1033070 2541 123 --23018 2926 11330
NM_014906chr1733769 3122 1061 11628 13422 --
NM_014910chr191656 ------
NM_014912chr1053024 1179 885 559 376 13163 --13420
NM_014913chr1811430 11385 21492 190 11127
NM_014918chr1531578 430 334 1378 ----
NM_014920chr663472 3258 2963 2329 2313 399 --13754 --
NM_014921chr1923087 896 ------
NM_014923chr1332212 1740 1542 --170 1151
NM_014924chr1453201 3147 3130 2223 481 --1999 --
NM_014932chr33425 212 199 --11800 --
NM_014945chr511943 --11988 --
NM_014946chr272559 2385 2244 2152 1250 606 318 --1945 --
NM_014947chr193104 3010 2906 2284 1969 1114 948 758 430 12624 33107 2872 626 1838
NM_014950chr1411755 ------
NM_014951chr1062546 2535 2362 1922 1757 558 ------
NM_014961chr42584 380 --22207 183 --
NM_014962chr2062842 2683 2471 2369 2098 738 12263 1534 --
NM_014965chr332357 2322 2064 ------
NM_014969chr121025 471 ------
NM_014974chr1031830 412 48 1478 ----
NM_014978chr1031836 1456 532 --11786 --
NM_014982chr1445385 5334 4569 3652 13858 14204 --
NM_014988chr442056 1840 849 616 --22469 181 --
NM_014989chr631526 817 86 1150 ----
NM_014990chr141526 --1360 11082
NM_014991chr443110 2946 2551 423 ------
NM_014996chr32986 658 ------
NM_014999chr1221688 1424 --11085 --
NM_015000chr1232957 2734 1061 13100 11211 --
NM_015008chr373593 3414 3325 2928 2898 2231 22 ----1844
NM_015015chr1931807 1452 471 --1369 --
NM_015018chr6----1186 --
NM_015020chr1683884 3797 3733 3218 3199 3112 2615 702 --13899 --
NM_015024chr821255 590 --11258 --
NM_015025chr282727 2638 2539 2439 2175 1829 934 702 --22470 519 22285 1047
NM_015026chr1274718 4414 3671 3327 2980 820 608 ----11869
NM_015027chr16--21412 1335 138 --
NM_015032chr1322752 881 32898 2482 2472 ----
NM_015039chr151611 1489 1266 1230 1197 ----14334
NM_015040chr273311 2834 2716 2424 2275 1266 325 --22597 534 --
NM_015042chr1554231 3790 3406 2695 262 --13376 --
NM_015045chr1031498 1457 1429 12276 ----
NM_015046chr932480 814 40 1465 ----
NM_015049chr242719 2077 1071 101 12841 23236 415 --
NM_015061chr9--1675 ----
NM_015068chr743970 3964 3431 1597 23620 2908 13921 12563
NM_015069chr163478 468 211 ------
NM_015071chr566381 2144 1777 1754 1569 434 ----1118
NM_015074chr1103585 3571 2001 1940 1889 1866 1660 1313 337 169 44421 3816 1396 1048 ----
NM_015076chr643956 3352 1529 939 --12765 --
NM_015092chr16104335 3999 3354 3327 3134 1825 1508 1422 1096 801 --23025 485 --
NM_015097chr32766 641 --1106 1429
NM_015100chr11413 1455 ----
NM_015115chr463006 2583 2244 332 175 68 12170 1262 --
NM_015130chr421202 205 --11304 --
NM_015137chr852321 1967 651 357 231 12291 --22413 2255
NM_015138chr1522845 2039 11911 ----
NM_015144chr1653589 3072 948 174 81 12865 ----
NM_015153chr61240 --1541 --
NM_015156chr1463412 3013 2824 2719 2642 520 ------
NM_015158chr9290 52 --1235 --
NM_015161chr1621284 342 --11354 --
NM_015176chr121653 1637 ------
NM_015185chrX2852 351 --2704 433 --
NM_015191chr111383 --21680 163 2934 443
NM_015192chr2032788 2150 438 --22813 573 --
NM_015197chr1413321 --1592 13347
NM_015199chr351893 905 794 324 248 --12649 --
NM_015200chr431811 1776 284 1964 2753 634 --
NM_015203chr1----168 --
NM_015206chr1563549 3462 2739 2363 1214 461 13149 ----
NM_015208chr1873279 1093 772 534 500 237 26 1104 --12987
NM_015209chr12789 449 ------
NM_015215chr142285 2276 1180 38 22868 1076 --12874
NM_015216chr531268 579 219 21201 491 ----
NM_015225chr933057 2702 710 ------
NM_015230chr441892 498 335 43 ------
NM_015231chr11--1687 ----
NM_015233chr1342692 1726 976 253 --1871 --
NM_015234chr661325 1123 1099 970 518 283 1179 11076 --
NM_015236chr411541 ------
NM_015245chr61270 22603 902 22493 2490 --
NM_015247chr1624973 156 ------
NM_015250chr91686 ----11733
NM_015263chr153911 898 217 --1342 --
NM_015265chr252581 2546 2112 1904 174 12661 12164 --
NM_015269chr1----1417 --
NM_015271chr453607 3549 2884 1089 399 --22778 1715 --
NM_015272chr1622136 1919 --11950 --
NM_015275chr122635 89 41638 1333 568 47 11576 --
NM_015278chr693369 3320 3259 2773 2554 2258 1228 569 453 --23346 2928 --
NM_015285chr1831874 465 86 1539 3490 300 61 --
NM_015286chr151594 12192 22415 2184 12353
NM_015291chr173481 3429 2870 2657 2240 1181 112 --12860 --
NM_015296chr1311254 1820 --1803
NM_015308chr112206 75 --135 --
NM_015310chr8158322 8265 8240 8109 7813 7627 6186 5901 2902 2699 2511 1778 1740 523 133 1822 15168 18060
NM_015313chr1134299 3696 1560 21601 1002 13792 --
NM_015314chr742604 2437 670 380 --32471 577 457 --
NM_015317chr242722 710 687 236 ------
NM_015323chr661704 1613 1561 653 366 147 --11639 --
NM_015326chr142901 1096 969 574 --22150 1903 --
NM_015328chr742865 2508 1974 884 --22800 2144 --
NM_015336chr123602 438 416 --129 --
NM_015344chr831689 142 22 2687 658 --1767
NM_015345chr642794 994 908 878 ------
NM_015347chr1272760 2705 2497 1955 815 584 338 1345 ----
NM_015349chr632905 1968 575 --2973 520 13033
NM_015355chr1741740 730 656 490 --11684 --
NM_015358chr2141215 279 196 156 11083 ----
NM_015359chr822982 1865 --22829 1878 --
NM_015361chr22833 318 ------
NM_015365chrX44271 4135 2886 711 --1954 24293 3755
NM_015379chr71284 ------
NM_015385chr1023126 2492 ----23045 846
NM_015387chr231389 812 272 --11776 --
NM_015393chr453824 2453 1248 1222 642 --12480 --
NM_015394chr1262491 1727 809 725 427 121 22440 2062 31749 691 356 12214
NM_015396chr331447 1206 475 1548 ----
NM_015397chr931890 380 254 ----21854 258
NM_015416chr121929 ------
NM_015419chrX2156 24 ------
NM_015423chr1131540 1377 586 11318 --21707 1332
NM_015429chr331036 997 155 --1766 --
NM_015439chr61507 ------
NM_015455chr553477 3314 2914 2672 523 --12861 --
NM_015457chr111274 ----1332
NM_015458chr875015 4865 4753 1779 1250 935 903 1738 25107 3223 --
NM_015460chr31541 --11733 --
NM_015461chr183754 202 114 185 ----
NM_015464chr72263 59 --11010 --
NM_015497chr153950 733 717 1448 ----
NM_015508chr311521 1210 ----
NM_015520chr342653 2276 1004 877 11757 ----
NM_015525chr63918 768 247 --1381 --
NM_015528chr171192 ------
NM_015532chr1542085 1994 235 197 11751 22016 88 --
NM_015534chr1--159 ----
NM_015535chr244079 4040 3131 1373 --1465 --
NM_015553chr6114220 4070 3861 3451 1579 1164 1082 889 493 310 59 --15182 --
NM_015554chr1542903 2684 2538 541 1324 12370 12471
NM_015565chr2131698 1423 181 12151 ----
NM_015567chr1331115 1097 1013 ------
NM_015569chr144823 3637 299 154 14122 ----
NM_015570chr741714 1702 1531 408 ----1580
NM_015575chr273624 3385 3343 3079 2477 1426 1403 ------
NM_015577chr52677 82 ------
NM_015578chr1911356 --22056 1556 --
NM_015602chr141431 1188 390 46 --11459 --
NM_015622chr7--1274 ----
NM_015626chr171986 --1322 11022
NM_015635chr921540 93 22212 2156 1579 --
NM_015640chr175053 4716 1991 1954 1787 1635 1421 23663 1196 2813 283 --
NM_015652chr101617 ------
NM_015678chr1341672 1656 1253 515 --1264 --
NM_015693chr4160 1233 --2244 128
NM_015695chr632041 2008 1374 ------
NM_015702chr2------1262
NM_015723chr72603 486 --1279 --
NM_015866chr141528 1141 1087 47 --21475 1251 --
NM_015869chr31204 --1144 --
NM_015872chr12247 224 ------
NM_015874chr41394 ------
NM_015878chr832091 1987 1796 ------
NM_015879chr1868500 6522 3151 1565 587 227 26910 840 --18168
NM_015886chr855663 4326 2155 1304 230 34073 4033 1757 35748 3834 2147 --
NM_015888chr143132 2448 2220 939 --1859 --
NM_015891chr631960 1287 797 ------
NM_015906chr164824 4660 4070 3824 3697 26 1287 191 --
NM_015980chr51258 --21382 205 --
NM_015981chr53880 737 28 ------
NM_015990chr41860 11082 11087 --
NM_015995chr1535484 5146 1999 --15536 --
NM_016009chr184409 4155 3147 1946 1778 1048 1020 345 34601 4552 1036 14359 --
NM_016018chr8102485 2123 1898 1886 1748 1128 754 660 448 303 ------
NM_016019chr71775 1676 157 --
NM_016021chr662971 2651 1950 499 307 77 --22658 2591 --
NM_016025chr1631630 660 356 11464 11954 --
NM_016039chr141142 --1149 --
NM_016045chr2021245 1198 ------
NM_016048chr53916 863 340 ------
NM_016060chr1721108 183 ----1153
NM_016072chr1232406 2275 36 --12171 --
NM_016073chr1521200 934 --21065 883 1887
NM_016075chr1352439 2305 1169 997 735 ----22991 1038
NM_016076chr11776 --12644 12030
NM_016078chr174950 872 419 85 11039 ----
NM_016079chr24506 419 224 161 1448 ----
NM_016083chr693938 3686 3642 3368 1392 956 936 573 72 13789 --13693
NM_016087chr711179 11527 ----
NM_016090chr1131014 324 22 ------
NM_016096chr841605 1366 554 273 --1763 --
NM_016097chr184985 824 242 170 1280 1301 --
NM_016101chr1611354 --11388 1310
NM_016120chrX1124 --1479 --
NM_016124chr121358 62 --11252 --
NM_016125chr171562 ------
NM_016127chr81228 --1741 --
NM_016131chr221843 1532 --11971 --
NM_016132chr1593422 3330 3275 2961 2578 1351 998 326 80 --11129 --
NM_016133chr221664 183 --1346 --
NM_016147chr113985 788 176 ------
NM_016152chr311230 ------
NM_016162chr121622 ------
NM_016195chr103707 117 67 ------
NM_016203chr73927 910 893 ------
NM_016205chr421335 1232 --2905 902 1539
NM_016206chr368100 3435 2540 2004 1660 480 --46710 2890 774 655 --
NM_016227chr111325 --21280 1195 --
NM_016231chr1721365 347 ------
NM_016247chr3----1434 --
NM_016248chr1333977 3958 2472 --43668 3049 2561 1001 --
NM_016260chr266962 6197 5189 4922 2909 1280 34707 1184 506 37078 5944 215 --
NM_016269chr4--1990 ----
NM_016270chr192388 365 ------
NM_016271chr1842106 1433 819 350 --22343 309 12314
NM_016272chr221597 --12775 --
NM_016275chr331016 810 654 21731 1708 1775 --
NM_016277chr62633 190 --1138 1330
NM_016279chr51364 ------
NM_016281chr1231018 842 100 --1346 --
NM_016284chr161791 ------
NM_016290chr5186 ------
NM_016297chr253272 2773 1263 182 111 13328 12717 --
NM_016300chr32468 116 ------
NM_016303chrX2154 148 ----2436 104
NM_016308chr111574 --144 11485
NM_016315chr211628 ------
NM_016322chr963184 2561 2450 2183 1277 1091 --31996 950 431 --
NM_016338chr511055 ------
NM_016340chr51456 2101 83 --1311
NM_016351chr7----1429 --
NM_016374chr171577 1228 1169 1073 444 203 118 ------
NM_016374chr171577 1228 1169 1073 444 203 118 ------
NM_016376chr1743779 2847 1573 1550 ------
NM_016377chr641599 1376 1259 158 --21799 351 21263 496
NM_016395chr151168 11901 21918 378 --
NM_016396chr1522929 2129 12807 ----
NM_016410chr93419 164 132 ------
NM_016422chr1123074 1136 --1526 127
NM_016424chr174756 611 528 201 --147 --
NM_016436chr2052390 2115 1744 969 477 --32669 1911 889 --
NM_016441chr231832 1586 435 1237 41808 882 864 414 --
NM_016467chr231314 1122 558 ------
NM_016470chr201471 ----1500
NM_016480chr51864 ------
NM_016486chr11349 1370 ----
NM_016505chr12649 603 ------
NM_016507chr1752687 2670 1189 1058 965 --11125 --
NM_016513chr663472 3258 2963 2329 2313 399 --13754 --
NM_016531chr473210 3192 3116 3046 2895 2624 1691 13255 23887 3335 --
NM_016542chrX21453 1239 --11688 --
NM_016544chr243361 871 738 462 12914 --12997
NM_016570chr12170 1489 ----
NM_016575chr1275488 4194 3960 3931 1894 1513 1287 --33596 2175 83 11783
NM_016577chr323917 232 --21106 51 11138
NM_016584chr121255 ------
NM_016587chr721098 214 --11087 1822
NM_016603chr542210 2079 411 255 ------
NM_016607chrX31520 1120 119 --1210 --
NM_016613chr41583 1440 1432 --
NM_016641chr1641572 1447 1409 166 --21354 206 --
NM_016651chr143979 968 844 --1143 --
NM_016654chr1521011 254 --21254 1135 --
NM_016655chr15----145 --
NM_016824chr1031791 1619 428 --11892 --
NM_016834chr1734090 3615 2662 --24124 3359 --
NM_016835chr1734090 3615 2662 --24124 3359 --
NM_016841chr1734090 3615 2662 --24124 3359 --
NM_016931chr111358 ------
NM_016936chr1612213 12183 11702 --
NM_017410chr1211202 ------
NM_017412chr841140 915 157 145 ------
NM_017415chr544406 3062 1771 1503 13271 13769 --
NM_017420chr1453551 1509 1093 394 187 --42990 2623 1173 763 --
NM_017423chr422239 2208 ----189
NM_017426chr41269 ------
NM_017435chr121315 --1698 1733
NM_017440chr12--1150 156 --
NM_017447chr2143942 3337 1091 919 --14371 --
NM_017452chr2011281 --11172 --
NM_017453chr2011281 --11172 --
NM_017454chr2011281 --11172 --
NM_017488chr2----11534 --
NM_017544chrX1190 --1220 --
NM_017548chr321993 134 1199 21344 867 --
NM_017569chr131243 1145 ----
NM_017580chr1042194 663 626 305 11850 ----
NM_017595chr1721075 443 11741 ----
NM_017610chr1531530 467 259 12085 ----
NM_017615chr10168 ------
NM_017633chr653767 3387 3336 1187 829 --13329 --
NM_017634chr811593 1437 1239 --
NM_017637chr9118336 7721 6564 6048 2623 2463 2133 1699 1385 883 404 --39075 3283 2153 --
NM_017641chr1231112 729 249 --1230 11188
NM_017643chr1722318 557 1277 ----
NM_017644chr3115079 4653 4622 4238 3544 3404 1666 1454 924 603 582 --24422 838 --
NM_017645chr953068 3053 2550 2035 1036 12043 1443 12775
NM_017649chr101335 ------
NM_017650chr7125906 5868 5751 5616 5311 5256 4974 4914 4858 2243 2041 1723 --26063 5114 --
NM_017657chr21731 1787 2251 29 --
NM_017658chr1453779 1380 615 172 95 14179 23261 3252 24229 1654
NM_017661chr153910 797 296 1471 1832 --
NM_017666chrX--1168 11663 12226
NM_017672chr152378 82 1886 21379 1070 --
NM_017676chr531592 1371 27 --11891 --
NM_017680chr91213 1776 ----
NM_017709chr131621 1519 538 13241 1676 --
NM_017736chr1632691 440 222 --156 11213
NM_017737chr13843 452 171 --1273 --
NM_017738chr93230 152 24 ------
NM_017742chr1811222 21724 1475 21404 781 --
NM_017745chrX2708 605 ------
NM_017747chr51315 ------
NM_017752chrX31876 1762 1698 11711 --1373
NM_017757chr1811099 --1815 --
NM_017762chr1531984 1969 1588 166 21836 956 --
NM_017769chr1452516 2394 2287 1052 868 12940 ----
NM_017778chr821082 168 --21108 1085 --
NM_017780chr82916 182 --1844 --
NM_017787chr1042872 2786 1964 411 ------
NM_017789chr21816 ------
NM_017813chr8105769 5704 5301 4963 4643 1790 1053 1038 203 185 1296 ----
NM_017824chr101199 12338 12587 --
NM_017830chr42258 183 ------
NM_017831chr1864796 4247 3307 2922 1697 1282 1246 --24766 138
NM_017845chr43677 246 102 --140 --
NM_017847chr111876 12288 ----
NM_017848chrX84375 4158 3889 3816 1610 769 726 132 ------
NM_017890chr821736 1402 11550 ----
NM_017893chr1011353 ------
NM_017905chr131539 ------
NM_017915chr1231118 438 145 ------
NM_017919chr955811 5425 4129 3576 511 24491 914 24372 1676 15706
NM_017925chr971955 1752 1689 1433 1262 324 153 ------
NM_017926chr141634 --3302 261 41 1833
NM_017938chrX4758 569 340 33 1863 22138 677 --
NM_017944chr1142821 1091 663 312 ------
NM_017953chr13887 270 88 11244 ----
NM_017954chr761679 1434 1161 508 89 47 ------
NM_017972chr141634 --3302 261 41 1833
NM_017987chr1051833 735 572 301 177 ------
NM_017988chr12----1936 --
NM_017994chr742822 2706 1933 438 11820 --12205
NM_017998chr941332 1042 492 134 11063 2507 383 --
NM_018004chr3152 --1387 --
NM_018011chr132570 206 --1496 1469
NM_018024chr82478 389 ----1527
NM_018036chr1474177 3956 1165 801 592 571 95 --23981 1016 --
NM_018046chr541461 570 548 458 ----1595
NM_018048chr1242027 1957 1604 335 1689 ----
NM_018061chr141221 1098 219 168 1192 1236 --
NM_018078chr41815 ----11014
NM_018084chr21514 --1881 --
NM_018092chr1621290 133 --1228 --
NM_018098chr321125 914 1269 ----
NM_018101chr111296 --21266 80 --
NM_018103chr12313 271 ------
NM_018105chr8------11157
NM_018112chr9160 2753 430 ----
NM_018120chr841007 969 201 57 ------
NM_018121chr1032252 980 831 1202 ----
NM_018133chr342104 877 868 296 22093 129 11988 --
NM_018149chr171180 --1168 --
NM_018155chr333453 2261 345 1632 ----
NM_018157chr1223261 2864 --131 --
NM_018159chrX31644 1081 26 --11463 --
NM_018171chr122298 262 ------
NM_018176chr441546 1115 1107 616 ----11558
NM_018182chr1721605 756 --11595 1409
NM_018189chr341606 1371 1261 341 --21649 170 --
NM_018195chr1121668 694 --1421 --
NM_018200chr1552392 899 755 692 511 11992 --11744
NM_018202chr1195 1669 ----
NM_018221chr2--163 --146
NM_018227chr442659 2091 1998 1078 --12269 1893
NM_018230chr12378 24 ------
NM_018243chr432767 1358 765 13870 ----
NM_018247chr653048 2920 2164 1077 692 12632 12542 12043
NM_018254chr132128 1971 1875 --21543 567 --
NM_018257chr2042435 1603 230 41 --1401 --
NM_018266chr311111 ----1377
NM_018272chr12123 ------
NM_018287chr1031220 403 186 21181 878 ----
NM_018293chr321187 910 ----12080
NM_018299chr893256 2883 2559 2498 1316 1206 821 609 308 --13378 --
NM_018312chr114583 353 229 187 --2595 235 1653
NM_018313chr352350 2342 1689 297 108 ----11715
NM_018315chr421198 515 --21254 619 --
NM_018320chr111248 ------
NM_018323chr43462 400 212 21668 95 ----
NM_018326chr71539 --1809 --
NM_018328chr23420 379 369 ------
NM_018330chr1041425 1227 685 106 ------
NM_018339chr941723 1693 703 462 11265 ----
NM_018351chr1253859 2902 1168 912 136 --13252 --
NM_018361chr83631 561 75 ------
NM_018362chr1153807 3199 3047 1117 515 21520 679 ----
NM_018364chr113234 34054 3440 1136 33616 1499 775 11024
NM_018373chr14105804 5128 4862 4854 4720 4573 4265 4022 784 412 25262 1585 1184 --
NM_018374chr764768 3882 3639 3357 1198 1048 21635 461 25126 941 --
NM_018375chr1411511 ------
NM_018403chr32847 840 --11593 --
NM_018416chr1252617 2570 2345 1000 434 --12371 --
NM_018429chr542731 2606 636 591 12242 ----
NM_018439chr1842136 635 404 74 ----12645
NM_018444chr842074 1592 803 429 ----12285
NM_018448chr1231191 1113 157 ------
NM_018452chr6_random42821 1231 962 112 13364 12683 11240
NM_018466chrX----1678 --
NM_018469chr1761502 1457 1385 1287 1004 29 --11102 --
NM_018471chr22560 475 ------
NM_018482chr852595 2420 1874 1728 963 22404 1630 ----
NM_018488chr17----138 1264
NM_018489chr122275 225 ------
NM_018553chr1741530 1202 604 375 ------
NM_018557chr241728 1429 1157 129 ------
NM_018559chr13167 1223 ----
NM_018602chr151132 ----11588
NM_018638chr1294612 4515 4437 3618 2092 2054 1828 1277 808 --24099 937 1882
NM_018640chr1272546 2108 1794 587 339 303 289 --1376 --
NM_018641chr7----1140 --
NM_018650chr141824 484 282 230 ------
NM_018662chr111299 --14246 --
NM_018667chr1622668 2386 --12597 --
NM_018686chr122239 130 ------
NM_018695chr551932 1776 1743 1531 972 ------
NM_018700chr521700 576 --21210 303 1630
NM_018710chr831147 413 179 --11400 --
NM_018712chr1131350 1326 208 ------
NM_018718chr731697 1582 560 --12242 --
NM_018719chr71146 ------
NM_018834chr51103 ------
NM_018841chr123906 610 --13232 --
NM_018844chr741957 305 179 136 ------
NM_018898chr5--22140 1595 11523 12386
NM_018899chr5--22140 1595 11523 12386
NM_018900chr5--22140 1595 11523 12386
NM_018901chr5--22140 1595 11523 12386
NM_018902chr5--22140 1595 11523 12386
NM_018903chr5--22140 1595 11523 12386
NM_018904chr5--22140 1595 11523 12386
NM_018905chr5--22140 1595 11523 12386
NM_018906chr5--22140 1595 11523 12386
NM_018907chr5--22140 1595 11523 12386
NM_018908chr5--22140 1595 11523 12386
NM_018909chr5--22140 1595 11523 12386
NM_018910chr5--22140 1595 11523 12386
NM_018911chr5--22140 1595 11523 12386
NM_018912chr51687 ------
NM_018913chr51687 ------
NM_018914chr51687 ------
NM_018915chr51687 ------
NM_018916chr51687 ------
NM_018917chr51687 ------
NM_018918chr51687 ------
NM_018919chr51687 ------
NM_018920chr51687 ------
NM_018921chr51687 ------
NM_018922chr51687 ------
NM_018923chr51687 ------
NM_018924chr51687 ------
NM_018925chr51687 ------
NM_018926chr51687 ------
NM_018927chr51687 ------
NM_018928chr51687 ------
NM_018929chr51687 ------
NM_018945chr633171 2344 613 1852 1948 --
NM_018948chr131446 1429 1024 --3993 913 438 --
NM_018951chr741230 1017 397 261 1846 11236 --
NM_018958chr1543353 2867 1163 635 23873 977 13452 --
NM_018970chr722813 818 33157 659 618 1446 --
NM_018975chr162795 291 --2724 129 --
NM_018976chr1262385 1954 1045 996 494 316 ----1737
NM_018981chr22905 367 ------
NM_018999chr1074176 4078 4007 3564 3122 1085 677 --34834 4081 3509 --
NM_019000chr521481 370 ------
NM_019001chr363590 1625 1559 938 750 538 --23548 3127 --
NM_019004chr71749 11517 --21695 1603
NM_019022chr1842932 2905 2740 1219 ----12855
NM_019027chr41944 12511 12378 --
NM_019036chr641230 995 850 370 ------
NM_019050chr421509 516 ------
NM_019072chr521383 1022 13704 23974 559 --
NM_019074chr15162 ------
NM_019084chr1011798 1518 12227 --
NM_019088chr19140 ------
NM_019091chr231027 1020 336 --1865 268 37
NM_019094chr1283695 3430 3310 3282 2813 2796 853 369 1993 ----
NM_019098chr82406 364 31816 1408 232 11744 --
NM_019106chr2253452 3417 2855 2557 775 --22262 1274 13421
NM_019116chr1643064 2914 1195 819 --13757 --
NM_019117chrX42922 1261 150 120 13173 12678 --
NM_019555chr331484 1314 331 ------
NM_019593chr2062740 2036 1038 860 708 76 --1940 --
NM_019597chrX2746 724 ------
NM_019600chr153811 593 231 2770 564 ----
NM_019610chr11208 --31971 1582 1530 --
NM_019852chr141112 ------
NM_019860chr1031463 514 251 ----11626
NM_019884chr19--1385 ----
NM_019895chr3179 ------
NM_019903chr1031791 1619 428 --11892 --
NM_020066chr12764 153 --2847 705 --
NM_020116chr431262 142 62 --21416 1265 --
NM_020119chr752901 2879 1225 877 456 --14024 --
NM_020122chr235948 4890 4376 24474 817 11582 --
NM_020123chr1021283 486 --11246 --
NM_020130chr83950 533 481 ------
NM_020132chr2154935 4702 4175 4053 3210 --23128 2073 --
NM_020141chr122297 891 ----1782
NM_020147chr15175 ------
NM_020148chr1832171 202 142 --33035 2910 542 --
NM_020150chr1031945 1581 705 --1742 --
NM_020156chr7----3526 417 414 --
NM_020159chr431072 354 278 11558 21655 1186 1500
NM_020168chr1521350 1013 ------
NM_020177chr553136 3014 2973 2474 770 --2420 199 --
NM_020180chr182941 534 ------
NM_020184chr21856 --12013 --
NM_020190chr12452 443 ------
NM_020198chr1741261 1141 469 372 --1375 --
NM_020199chr521268 61 --2531 251 --
NM_020204chr11183 ------
NM_020209chr19----189 --
NM_020228chr1142502 2191 1902 333 --32352 1922 615 --
NM_020245chr644889 4520 3567 198 --25109 4608 --
NM_020297chr1252965 2915 2223 1382 1103 --2391 172 12836
NM_020311chr21666 1495 ----
NM_020315chr221963 ------
NM_020337chr432505 999 481 --22801 2095 11149
NM_020338chr101972 --13085 13688
NM_020342chr242128 1768 948 81 ------
NM_020347chr3--1404 21996 1780 11713
NM_020357chr341188 1159 543 431 1550 ----
NM_020362chr11333 --1317 --
NM_020379chr11613 ------
NM_020381chr621591 567 1131 --127
NM_020390chr3134485 4324 4232 3779 3275 3146 1857 1830 1448 1427 573 445 119 --14699 --
NM_020403chr1361674 1318 715 619 475 256 --11263 --
NM_020422chr162717 350 --1639 --
NM_020428chr1911165 ------
NM_020432chr752168 1900 1739 398 326 1732 ----
NM_020438chr911395 ------
NM_020440chr112709 11110 13314 --
NM_020443chr145337 4466 2766 945 --12198 12193
NM_020449chrX1645 1169 3678 201 144 --
NM_020455chr632653 2267 61 ------
NM_020456chr133615 556 531 --12144 --
NM_020457chr162157 66 --1247 --
NM_020463chr22335 186 --11361 --
NM_020466chr684547 4001 3980 3172 3144 1930 696 49 ------
NM_020473chrX21954 1886 ------
NM_020475chr81340 12365 ----
NM_020476chr81340 12365 ----
NM_020477chr81340 12365 ----
NM_020478chr81403 12428 ----
NM_020480chr81340 12365 ----
NM_020529chr142306 145 --2446 172 --
NM_020532chr22297 201 1841 ----
NM_020640chr31647 1884 ----
NM_020648chr1842803 2019 742 194 --1900 --
NM_020651chr231784 368 314 --11512 --
NM_020654chr341585 1147 424 164 1615 11470 --
NM_020659chr191578 ------
NM_020673chr2097355 6298 5460 2492 2015 1480 1048 911 480 --37691 7563 868 --
NM_020689chr2041716 1687 1307 493 ------
NM_020708chr20----22449 2218 --
NM_020711chr242427 1784 653 56 ----12475
NM_020715chr141634 ------
NM_020718chr1655995 5507 5341 958 172 --11564 25688 4073
NM_020727chr2163974 2761 2498 1568 1197 198 2757 117 ----
NM_020728chr762805 1280 1015 983 770 139 ----11193
NM_020734chr1233391 2655 662 22684 262 22807 789 12757
NM_020739chr1564189 3674 3032 2889 2829 1120 ------
NM_020742chrX22162 1754 --12025 --
NM_020747chr51769 --1164 --
NM_020750chr611406 --21458 1276 --
NM_020751chr1311264 --1198 --
NM_020752chr1042905 2250 763 494 1632 ----
NM_020755chr631465 1319 389 --140 --
NM_020760chr221776 1518 ------
NM_020765chr1--1105 ----
NM_020766chrX134533 4369 4023 3740 3337 3053 2857 968 789 599 450 338 73 1608 64346 3973 3831 1159 585 130 --
NM_020772chr17118678 6827 6561 6367 5863 5760 3398 2844 1909 1823 1293 --68031 7598 6048 5633 2997 2506 --
NM_020774chr1865247 4174 1826 1353 1310 645 14299 26209 4859 15620
NM_020783chr1842437 2232 959 801 ----1122
NM_020794chr131560 1462 88 ------
NM_020795chr1712040 ------
NM_020796chr522894 605 --22466 710 --
NM_020800chr3--179 --11429
NM_020801chr542170 1701 888 776 --22629 2026 --
NM_020805chr182396 345 ------
NM_020808chr131071 757 400 1929 11080 --
NM_020809chr1122058 1956 2589 120 12041 --
NM_020815chr41410 ------
NM_020819chr631204 1167 295 --1769 2891 356
NM_020824chr102790 239 189 ----
NM_020825chr1653835 3714 2377 373 307 ------
NM_020839chr33590 527 483 ------
NM_020841chr123780 604 360 --11175 13010
NM_020853chr1242758 2727 2182 1780 12717 ----
NM_020854chr18--1388 1456 --
NM_020858chr1532363 1881 1809 ------
NM_020859chr422465 775 33856 3473 474 ----
NM_020860chr42969 884 --11047 11116
NM_020861chr621187 1069 ------
NM_020865chr3156 ------
NM_020866chr1321015 687 ----1923
NM_020870chr42827 293 ------
NM_020872chr331676 1209 508 11564 11684 --
NM_020873chr3--2699 244 ----
NM_020917chr1942800 988 903 578 1981 53349 2817 2524 1358 350 --
NM_020918chr1043634 3257 2292 667 --22793 1336 --
NM_020921chr1433122 2706 2533 ----13126
NM_020922chrX1331 11757 ----
NM_020924chr9------1433
NM_020927chr1642348 2211 2164 814 ------
NM_020929chr111153 ------
NM_020937chr142122 68 ------
NM_020940chr1062715 2561 2451 858 845 231 12643 1114 12628
NM_020948chr153591 2909 2834 1338 597 1789 ----
NM_020951chr193518 193 151 --22116 290 --
NM_020962chr1542089 1864 532 129 ------
NM_020964chr1854743 4070 1889 62 32 --1511 --
NM_020977chr451779 1720 650 608 438 --1817 1677
NM_021003chr142639 573 ------
NM_021005chr151930 1877 --1312
NM_021007chr242234 1872 527 38 ----11645
NM_021033chr1373375 3264 3019 2762 1066 896 314 12954 23421 3119 --
NM_021038chr393286 3189 3026 3015 2572 736 197 143 85 12080 42914 2622 2246 715 12103
NM_021061chr854429 2853 670 470 412 ------
NM_021069chr431941 770 411 --1536 --
NM_021072chr531998 940 776 22429 456 1797 --
NM_021083chrX53623 3242 2965 2907 2807 12822 ----
NM_021090chr2224637 3863 12015 34612 4384 3157 --
NM_021097chr242991 2895 956 949 22853 2605 1390 --
NM_021116chr799113 7860 7655 7460 6438 5696 3436 2888 2618 28946 7264 ----
NM_021120chrX32790 1030 295 --23110 923 --
NM_021131chr931449 1043 388 ------
NM_021132chr102946 930 --11308 --
NM_021140chrX21184 828 --21063 854 11144
NM_021141chr2--1222 ----
NM_021145chr721049 138 --1141 --
NM_021146chr11897 ------
NM_021148chr73869 345 105 11864 11708 --
NM_021159chr431697 1586 1555 --1238 --
NM_021165chr12832 673 ------
NM_021183chrX51831 1733 1617 848 137 11944 12280 --
NM_021189chr12962 931 ------
NM_021190chr131202 856 38 ----1329
NM_021191chr1212507 ------
NM_021194chr1--1343 ----
NM_021202chr2021891 1222 13054 ----
NM_021204chr41228 2781 286 ----
NM_021222chr12590 98 ------
NM_021240chr92647 227 ------
NM_021249chr1441463 1167 615 377 ------
NM_021252chr1071887 1846 1734 1652 779 640 108 ------
NM_021255chr1494069 4022 3979 3923 3338 1652 1571 993 181 23494 3398 11174 --
NM_021614chr52220 68 ----1209
NM_021627chr31323 --11216 --
NM_021629chr374556 4343 3877 1654 1428 558 252 11374 24750 3854 --
NM_021637chrX31338 1317 1265 ------
NM_021638chr434712 4106 310 ------
NM_021639chr1----1170 --
NM_021722chr7----1388 --
NM_021723chr7----1429 --
NM_021728chr143889 641 372 ------
NM_021738chr10--1134 ----
NM_021807chr73944 486 271 ------
NM_021809chr2042036 1650 907 627 --11955 11716
NM_021813chr665774 5650 5584 4988 3743 1981 25806 5725 14176 --
NM_021814chr621395 267 21686 1580 ----
NM_021911chr5125564 5270 4115 3722 3710 1894 1488 1394 1048 876 161 122 11686 14637 --
NM_021912chr1534092 4055 3335 ----1491
NM_021914chr141789 --12114 --
NM_021946chrX31453 1297 220 21359 209 1469 --
NM_021951chr92902 604 2837 802 ----
NM_021954chr1363254 2509 2257 1096 883 662 ------
NM_021961chr1186940 6270 6204 6163 5569 4939 4522 785 ------
NM_021964chr3105854 5803 5685 5583 5423 4675 4617 2308 1290 300 15166 ----
NM_021979chr141349 --1103 --
NM_021988chr2031590 1319 1065 ------
NM_021998chrX41528 1284 1223 467 ------
NM_022037chr22270 166 ------
NM_022041chr1662561 2476 1898 1701 698 612 1291 ----
NM_022048chr1586358 1512 1265 1171 802 748 716 280 12320 --15818
NM_022051chr15637 594 514 208 142 ----144
NM_022080chr2062788 2147 1051 955 304 101 --32636 153 129 --
NM_022091chr61169 12267 --12021
NM_022103chr19----1942 --
NM_022114chr144363 1496 559 535 14197 11723 --
NM_022137chr143590 393 244 ------
NM_022138chr611521 ------
NM_022154chr4----11347 --
NM_022173chr22270 166 ------
NM_022337chr113590 535 42 ------
NM_022351chr852863 2781 2674 1421 311 --13438 13442
NM_022361chr6--2390 203 --1545
NM_022442chr2031590 1319 1065 ------
NM_022443chr32160 36 ------
NM_022456chr12107475 7201 6897 6810 4793 4667 2920 2281 687 125 11282 27502 2669 --
NM_022459chr1365643 4456 1886 1175 998 55 ------
NM_022463chr1711492 ------
NM_022465chr1243010 2982 1946 1076 ----12591
NM_022475chr43689 616 220 ------
NM_022477chr2011382 21749 1405 11534 --
NM_022484chr721231 1046 11395 ----
NM_022552chr221130 371 ------
NM_022574chr711385 --12007 1262
NM_022648chr244579 1730 1022 570 --32898 1723 1710 --
NM_022716chr133163 2346 1003 ------
NM_022726chr621561 1408 11214 11675 --
NM_022728chr71136 ------
NM_022733chr131215 1100 116 --1183 --
NM_022735chr141843 1754 1241 540 ------
NM_022739chr171977 ------
NM_022745chr132402 2329 967 --11113 12297
NM_022758chr623231 822 ------
NM_022763chr333068 2798 2615 --12500 --
NM_022771chr1241013 822 280 39 1408 ----
NM_022780chr22740 638 --1695 --
NM_022781chr952491 2415 1168 635 623 1189 1290 --
NM_022783chr81280 ------
NM_022784chr152299 37 --11048 --
NM_022802chr1061593 1459 1129 343 232 130 ------
NM_022825chrX1308 ------
NM_022831chr13655 636 213 1717 11675 --
NM_022832chr422177 925 2411 247 11654 --
NM_022840chr1831248 1190 37 ------
NM_022841chr1552765 2718 1986 1926 50 --22431 2398 --
NM_022843chr132392 124 --1445 --
NM_022845chr1652207 1901 818 682 48 11646 ----
NM_022893chr243079 842 412 288 --32967 2319 428 --
NM_022898chr1434530 3971 1190 --24703 4597 21505 1100
NM_022918chr1121839 1330 --21778 179 --
NM_022977chrX42599 2156 557 153 --11010 12008
NM_023000chr1431556 1282 170 1102 ----
NM_023001chr1431556 1282 170 1102 ----
NM_023016chr242021 894 804 594 ------
NM_023039chr52420 383 --1392 --
NM_023073chr551298 1087 1060 1008 897 ----11043
NM_023075chr18--1868 1785 --
NM_023923chr163700 3133 2627 1521 1364 227 ------
NM_023925chr12----1243 --
NM_023927chr51995 ------
NM_023929chr852260 2069 1721 1117 66 --1118 --
NM_024007chr512511 33104 3076 750 22761 642 --
NM_024016chr171740 1686 ----
NM_024019chr41229 ------
NM_024036chr111268 ------
NM_024045chr101208 ------
NM_024076chr1912356 ------
NM_024294chr623231 822 ------
NM_024315chr71358 ------
NM_024345chr965162 4065 2143 812 657 53 34395 4044 576 --15485
NM_024408chr133511 2360 691 13554 --12662
NM_024424chr1131104 1009 364 ------
NM_024425chr1131104 1009 364 ------
NM_024426chr1131104 1009 364 ------
NM_024429chr73927 910 893 ------
NM_024430chr18----21879 1785 --
NM_024524chr312683 22403 268 53117 2342 2057 582 27 --
NM_024546chr1331225 841 334 --21137 165 --
NM_024557chr1141710 1629 1111 282 ----11579
NM_024563chr531591 1435 1366 --21735 1687 --
NM_024581chr6--165 ----
NM_024582chr4166 --1360 --
NM_024583chr22921 746 --1168 --
NM_024595chr11387 ------
NM_024613chr811277 11223 ----
NM_024615chr51249 ----193
NM_024617chr91766 1154 ----
NM_024620chr1931401 1124 138 --11276 --
NM_024626chr1--139 1403 --
NM_024632chr5195 ------
NM_024636chr741960 843 352 145 --22017 920 --
NM_024639chr622119 998 ----12055
NM_024664chr1132 ------
NM_024665chr364658 4512 4493 1786 1640 966 --24682 1647 --
NM_024670chr1031458 1300 435 ----11418
NM_024674chr122929 442 11256 ----
NM_024676chr1----11331 --
NM_024692chr221289 289 --11156 11478
NM_024713chr1521540 247 ------
NM_024721chr872629 2324 2045 1813 669 657 131 --22684 1684 --
NM_024740chr1164092 4011 3681 1370 870 277 --31291 704 262 --
NM_024751chr431990 1846 115 ------
NM_024755chr152915 138 1578 ----
NM_024769chr112747 218 ------
NM_024779chr12----1262 --
NM_024780chr1631012 240 195 ----2701 392
NM_024814chr71303 --1322 --
NM_024817chr1545874 5547 5304 561 15405 ----
NM_024818chr351386 462 348 230 22 1123 ----
NM_024824chr1451615 1351 1344 355 130 --1107 --
NM_024828chr9--11415 21511 1420 --
NM_024834chr1031618 359 82 11284 21917 284 --
NM_024852chr12253 163 ------
NM_024854chr1221495 1370 --11100 --
NM_024900chr432214 1936 811 --11622 --
NM_024900chr432214 1936 811 --11622 --
NM_024911chr1--1255 ----
NM_024915chr842619 656 512 254 ------
NM_024941chr521360 1346 ------
NM_024944chr211371 ------
NM_024947chr3169596 9518 9122 8974 8894 8765 8352 8040 7336 6779 3418 2849 2711 1456 1233 97 27849 761 49575 9507 1255 912 17200
NM_024949chr434539 1153 249 14631 14636 --
NM_024953chr1242604 2568 2303 178 --12427 --
NM_024969chr2180 1343 ----
NM_024979chr1311653 ------
NM_024989chr277536 7066 6397 5843 5726 5370 1632 23170 865 26937 3049 --
NM_024991chr1023126 2492 ----23045 846
NM_024993chr231386 1346 1177 --11235 --
NM_025047chr32369 58 ------
NM_025054chr873990 2937 2635 1667 1129 855 37 --23105 656 --
NM_025065chr11879 ------
NM_025073chr144727 3471 3186 655 --24689 672 14748
NM_025076chr21437 ------
NM_025126chr122696 511 --1514 --
NM_025134chr1642372 1824 938 465 ------
NM_025146chr332731 1090 196 2709 528 ----
NM_025147chr221092 825 1254 --1419
NM_025160chr121246 641 --23001 339 13739
NM_025164chr1142239 2092 2083 488 11466 11682 --
NM_025179chr124897 4886 ------
NM_025191chr193283 2931 2603 2196 2167 772 724 545 448 --13414 --
NM_025222chr322447 892 32082 2029 1863 ----
NM_025235chr1052131 1970 1898 884 445 --1506 --
NM_025237chr17188 21584 1338 11539 --
NM_030576chr1722268 749 ------
NM_030594chr1521239 847 ------
NM_030625chr1052356 1916 675 570 463 1486 21923 683 --
NM_030627chr523667 208 12814 13822 1358
NM_030629chr161777 1500 11872 1704
NM_030640chr121891 ------
NM_030648chr465300 4279 3787 1594 1301 223 15577 13886 --
NM_030660chr1421458 1396 ----11522
NM_030664chr1012007 12293 ----
NM_030665chr1711464 --11340 --
NM_030667chr1241170 1031 398 61 1452 1832 --
NM_030668chr1241170 1031 398 61 1452 1832 --
NM_030669chr1241170 1031 398 61 1452 1832 --
NM_030670chr1232202 2063 1430 11484 11864 --
NM_030671chr1232202 2063 1430 11484 11864 --
NM_030674chr1245419 5319 4972 4938 ------
NM_030751chr101359 ----21166 643
NM_030751chr101359 ----21166 643
NM_030755chr1482727 2710 2475 2080 1176 876 318 99 ------
NM_030759chr102778 685 ------
NM_030771chr11161 ------
NM_030777chr2052067 1785 852 495 297 11531 11858 --
NM_030780chr851713 1507 1404 361 112 ------
NM_030789chr201283 ------
NM_030799chr532003 1749 1687 --12084 11848
NM_030806chr179162 8542 3616 2248 1283 242 128 23651 518 1223 29421 181
NM_030809chr122650 146 12281 ----
NM_030816chr143453 3074 2805 617 13257 13709 --
NM_030817chr1233803 3403 2698 --11480 --
NM_030820chr61957 ------
NM_030881chr2282349 2168 1971 1827 735 690 567 421 ------
NM_030885chr342069 1921 773 724 --11737 --
NM_030918chr135411 5369 2030 --1312 --
NM_030920chr142048 660 507 185 ------
NM_030922chr152787 672 135 1226 --
NM_030945chr52740 96 11066 ----
NM_030954chr8------1346
NM_030962chr1121003 566 1147 ----
NM_030964chr543677 2586 1470 577 1443 --13761
NM_030965chr11297 1670 ----
NM_031157chr121584 ------
NM_031215chr2062204 2082 1862 1643 858 824 ------
NM_031216chr1831605 472 44 --1654 --
NM_031243chr721759 274 ------
NM_031262chr91278 --1243 --
NM_031263chr91335 --1300 --
NM_031267chr71499 ------
NM_031268chr1655227 4069 1478 1203 978 14867 15106 --
NM_031289chr122803 669 ------
NM_031296chr462687 2452 2014 1759 1716 1084 ------
NM_031314chr142363 157 11492 21497 711 11845
NM_031362chr242821 1830 1054 915 --129 22744 706
NM_031365chr242957 1966 1190 1051 --1165 22880 842
NM_031366chr242957 1966 1190 1051 --1165 22880 842
NM_031369chr43650 266 203 1220 ----
NM_031370chr43650 266 203 1220 ----
NM_031371chr171577 1228 1169 1073 444 203 118 ------
NM_031371chr171577 1228 1169 1073 444 203 118 ------
NM_031372chr42671 283 1620 ----
NM_031407chrX142 ------
NM_031411chr5--22140 1595 11523 12386
NM_031412chr1221265 288 ------
NM_031419chr331527 624 550 1528 --1628
NM_031424chr202538 159 ------
NM_031427chr1435919 4328 899 --14969 --
NM_031431chr1361846 1577 1359 1301 647 523 ------
NM_031435chr1253408 3318 2534 2248 355 ------
NM_031439chr841934 1792 1717 263 --11680 --
NM_031442chrX42440 2041 737 334 22579 942 12443 --
NM_031443chr71347 ------
NM_031445chr253438 2157 1231 635 487 --23138 1234 11348
NM_031461chr862079 1918 1812 887 544 282 --11981 1233
NM_031468chr747833 7423 6074 28 25723 5258 26179 268 --
NM_031469chr633982 3443 175 1674 12903 --
NM_031471chr11----1391 --
NM_031479chr1221158 1101 ------
NM_031483chr2072950 2553 2174 1362 717 655 68 --33318 2731 511 11034
NM_031845chr253705 3687 1128 977 882 1136 13673 --
NM_031847chr253705 3687 1128 977 882 1136 13673 --
NM_031849chr5--22140 1595 11523 12386
NM_031857chr5--22140 1595 11523 12386
NM_031860chr5--22140 1595 11523 12386
NM_031866chr101910 1113 ----
NM_031889chr4----11963 --
NM_031911chr442648 2564 1050 315 --12324 --
NM_031953chr43438 424 328 1398 ----
NM_031990chr1911300 ------
NM_031991chr1911300 ------
NM_032012chr975098 4951 4713 4558 1480 1224 666 ----21261 414
NM_032013chr2011382 21749 1405 11534 --
NM_032041chr862474 856 715 708 355 237 ------
NM_032042chr531016 603 99 --22825 2685 --
NM_032047chr351834 1627 744 667 333 22085 778 --32337 2289 392
NM_032052chr2221250 313 11139 --11106
NM_032088chr51687 ------
NM_032092chr51687 ------
NM_032102chr1162623 998 980 676 634 208 --33064 2974 1178 --
NM_032105chr185783 5414 5318 3172 2924 1520 1208 1027 ------
NM_032116chr13105414 5293 5253 5046 4599 4182 1759 1663 991 239 21832 436 24936 1095 --
NM_032119chr51280 ------
NM_032124chr182502 46 1771 ----
NM_032128chr43849 702 69 ------
NM_032132chr11149 --1585 --
NM_032142chr181186 ------
NM_032144chr241646 1446 1410 1401 11790 ----
NM_032145chr631725 1485 107 1495 --11832
NM_032153chr332645 2355 2183 11918 --12425
NM_032156chr12----1243 --
NM_032160chr1883646 3479 3375 2897 1699 860 384 146 ------
NM_032181chr23605 152 101 ------
NM_032189chr1314671 14913 ----
NM_032199chr1043597 2895 2738 1525 12807 2786 664 --
NM_032208chr243652 2714 2319 362 13576 22912 2694 1672
NM_032213chr231237 1066 259 ------
NM_032217chr41394 ------
NM_032228chr1152737 2605 1330 810 618 23531 2147 ----
NM_032229chr133461 427 341 ------
NM_032231chr15134 1254 ----
NM_032233chr141276 ------
NM_032236chr11976 ------
NM_032256chr1231059 219 159 1707 ----
NM_032281chr1913152 ----12127
NM_032288chr362095 1905 1513 1489 409 51 ------
NM_032291chr121593 232 --1351 1208
NM_032320chr112805 123 ------
NM_032321chr242793 2187 939 677 --23101 2048 --
NM_032329chr222729 1158 --14419 --
NM_032373chr1095493 5301 4824 1750 1559 1350 856 366 318 15650 1859 25508 4218
NM_032379chr113827 740 103 ----1306
NM_032403chr51687 ------
NM_032408chr751212 1187 1021 427 407 ------
NM_032410chr83844 447 363 ------
NM_032420chr51360 --1794 --
NM_032431chr1111047 ------
NM_032435chr132196 1812 162 1904 1181 --
NM_032438chr641438 1049 545 348 --11596 1481
NM_032439chr1021570 245 --1572 --
NM_032440chr1062562 1840 1029 165 72 58 12242 22913 2361 --
NM_032445chr1542515 1674 428 167 ------
NM_032446chr573325 3064 1219 674 330 257 217 21178 1094 1333 22867 469
NM_032452chr143331 291 257 ------
NM_032457chr423904 2923 --13728 12852
NM_032471chr611111 ------
NM_032472chr23419 53 37 ------
NM_032491chr1211021 ------
NM_032494chr2------1552
NM_032505chr332795 1866 587 ------
NM_032510chr1832031 910 155 --12227 --
NM_032521chr2042831 2046 688 522 1161 12728 --
NM_032523chr22546 384 ------
NM_032547chr441410 522 206 33 ----11215
NM_032549chr72333 24 ------
NM_032557chr41693 ------
NM_032594chr141814 ------
NM_032595chr172497 48 --11536 --
NM_032622chr451251 1075 416 403 235 ------
NM_032626chr16160 ------
NM_032632chr143680 316 200 --11920 --
NM_032682chr332980 2601 84 --23087 597 --
NM_032804chr1092229 2009 1809 1802 1790 946 772 460 202 ----22457 1794
NM_032810chr1021113 255 ------
NM_032828chr1923723 1143 --21058 447 --
NM_032829chr12----11171 --
NM_032832chr61145 ----11679
NM_032834chr123977 503 231 11254 ----
NM_032838chr19--1370 1865 --
NM_032857chr151163 --1203 --
NM_032858chr11132 ------
NM_032859chr1321093 22 --2363 266 1285
NM_032860chr61179 ------
NM_032869chr851840 1746 559 408 331 1357 11566 --
NM_032873chr1154426 4346 3565 3272 1445 --22998 562 --
NM_032918chr122125 81 ------
NM_032943chr113827 740 103 ----1306
NM_032960chr111508 ------
NM_032961chr42550 163 --11272 --
NM_032966chr1111570 --124 --
NM_032967chrX1356 ------
NM_032968chrX94245 4224 4173 4073 3966 3359 3256 3107 2789 --1612 --
NM_032969chrX94245 4224 4173 4073 3966 3359 3256 3107 2789 --1612 --
NM_032971chrY1383 ------
NM_032972chrY1383 ------
NM_032973chrY94237 4216 4165 4065 3958 3354 3251 3102 2784 --1612 --
NM_032975chr1853500 3481 3367 3250 3137 --23531 3518 --
NM_032980chr1853500 3481 3367 3250 3137 --23531 3518 --
NM_032982chr742588 2095 367 231 ------
NM_032983chr743402 2909 1181 1045 ------
NM_032991chr4--1250 11401 --
NM_033012chr131904 1402 ----
NM_033016chr22158 --190 --
NM_033020chr164824 4660 4070 3824 3697 26 1287 191 --
NM_033031chrX1164 --2207 138 --
NM_033044chr121179 506 --11084 194
NM_033055chr11434 --11059 --
NM_033089chr2031073 458 229 11479 11519 --
NM_033116chr14----1198 --
NM_033119chr16------3119 103 85
NM_033121chr1251805 1453 1381 660 367 ----1615
NM_033132chr1321904 773 11543 ----
NM_033138chr722256 1930 ------
NM_033139chr722256 1930 ------
NM_033140chr722256 1930 ------
NM_033157chr722256 1930 ------
NM_033181chr693938 3686 3642 3368 1392 956 936 573 72 13789 --13693
NM_033211chr541839 1646 461 137 --1339 --
NM_033222chr9----1963 --
NM_033224chr776193 2339 1744 891 826 709 441 --22419 1923 13153
NM_033225chr842217 2050 1230 1180 12989 2870 327 --
NM_033254chr3----136 --
NM_033281chr52886 200 ------
NM_033285chr864397 4150 3115 1799 1544 1076 13872 ----
NM_033290chrX43768 3758 2797 1506 11440 ----
NM_033305chr921429 1359 ------
NM_033326chr1172413 2378 2268 997 722 460 124 --1199 1194
NM_033331chr983541 3021 1025 779 722 611 339 105 32845 2790 1234 13074 12381
NM_033342chr51115 ------
NM_033360chr1254644 3591 2951 2891 1304 13210 12979 --
NM_033379chr10------158
NM_033394chr231387 1073 274 --1355 --
NM_033402chr84356 186 66 47 1347 ----
NM_033425chr1143367 2862 2464 567 --1570 --
NM_033430chr453253 1074 996 575 259 --12856 --
NM_033437chr453253 1074 996 575 259 --12856 --
NM_033480chr642874 2167 269 171 ------
NM_033481chr642874 2167 269 171 ------
NM_033495chrX1252 ------
NM_033503chr152466 94 13630 1830 --
NM_033505chr2156787 6746 6717 6551 6449 5789 5772 5335 5070 4522 4409 2553 2412 2066 701 36585 2141 1395 ----
NM_033512chr822938 765 12883 22941 2515 --
NM_033515chr621370 1072 ------
NM_033547chr111154 ------
NM_033550chr2032122 1446 333 --2676 487 --
NM_033631chr143641 3409 1320 824 ------
NM_033632chr421198 515 --21254 619 --
NM_033642chrX31067 956 364 21136 972 1829 --
NM_033644chr552568 1587 807 560 287 22524 2458 1367 --
NM_033645chr552568 1587 807 560 287 22524 2458 1367 --
NM_033656chr2155988 5653 5310 4207 4078 --15170 14160
NM_052832chr832302 1971 310 --12759 --
NM_052834chr1831874 465 86 1539 3490 300 61 --
NM_052840chr152550 163 --21533 361 --
NM_052879chr1243971 985 953 492 --13234 --
NM_052900chr841834 1531 1121 503 --1620 11181
NM_052904chr62249 216 11409 ----
NM_052905chr221410 1218 --11420 --
NM_052907chr1243412 3285 2719 394 1298 ----
NM_052910chr131474 ------
NM_052911chr182275 58 --1172 --
NM_052917chr262446 2276 928 393 281 129 13220 11089 --
NM_052918chr1043585 3464 2673 154 --13477 22827 1077
NM_052927chr542185 2092 2083 841 ----12067
NM_052936chrX3910 256 65 ------
NM_052937chr842019 782 485 464 2841 352 ----
NM_052950chr1332219 1729 262 --1334 --
NM_052996chr1611711 --11383 --
NM_053016chr965906 5206 1257 769 571 129 31993 1503 482 21683 860 --
NM_053023chr1122477 1225 --1188 1898
NM_053024chr321238 38 --21445 1399 21313 1297
NM_053043chr766397 4995 1591 520 296 211 12154 ----
NM_053056chr1132204 2032 1960 --12644 --
NM_053064chr142770 385 12925 ----
NM_053067chr91231 ------
NM_054012chr9168 ------
NM_057159chr911009 ------
NM_057168chr711179 11527 ----
NM_057175chr432163 749 80 --11920 12464
NM_057178chr171102 12732 ----
NM_057749chr811366 11161 --11225
NM_058170chr131472 605 124 ------
NM_058237chr142902 350 ------
NM_058241chr262158 1826 1667 1574 856 376 151 31807 350 100 12245
NM_058241chr262158 1826 1667 1574 856 376 151 31807 350 100 12245
NM_078469chr10--1407 ----
NM_079420chr2127 ------
NM_079422chr2127 ------
NM_080422chr181283 ------
NM_080423chr181283 ------
NM_080425chr201312 ------
NM_080426chr201312 ------
NM_080605chr131492 628 439 ------
NM_080647chr22----1311 --
NM_080651chr83246 190 44 ------
NM_080669chr1731967 841 526 ----11518
NM_080676chr2043259 1314 1288 905 --13105 --
NM_080717chr12--21517 415 ----
NM_080742chr6----193 --
NM_080743chr642561 2488 1845 989 --1831 --
NM_080752chr20----1407 1129
NM_080759chr1332635 2232 2027 --1778 11788
NM_080760chr1332635 2232 2027 --1778 11788
NM_080798chr101282 ------
NM_080799chr101282 ------
NM_080800chr101282 ------
NM_080801chr101282 ------
NM_080802chr101282 ------
NM_080803chr101282 ------
NM_080804chr101282 ------
NM_080805chr101282 ------
NM_080806chr101282 ------
NM_080807chr101282 ------
NM_080808chr101282 ------
NM_080809chr101282 ------
NM_080810chr101282 ------
NM_080811chr101282 ------
NM_080812chr101282 ------
NM_080813chr101282 ------
NM_080814chr101282 ------
NM_080815chr101282 ------
NM_080867chr1454510 3913 1860 353 167 --31530 1527 899 --
NM_080872chr893806 3444 3107 2884 2876 2792 1299 962 814 --22572 1259 --
NM_080927chr362617 2152 2044 587 515 507 ----13277
NM_130385chr1133020 2573 1250 11294 33079 1988 1280 --
NM_130391chr972631 1373 1182 1024 881 515 323 ------
NM_130392chr972631 1373 1182 1024 881 515 323 ------
NM_130393chr972631 1373 1182 1024 881 515 323 ------
NM_130439chr1012174 21564 680 11546 --
NM_130439chr1012174 21564 680 11546 --
NM_130787chr191329 ------
NM_130810chr15------129
NM_130811chr2011040 --21011 345 --
NM_130838chr1541693 1459 1333 423 ------
NM_130839chr1541693 1459 1333 423 ------
NM_130847chr1175846 5680 5172 4382 3673 1038 958 ------
NM_130902chr4131 ------
NM_133170chr2047740 2572 2425 180 --12433 --
NM_133265chrX23245 2931 --2723 241 --
NM_133330chr41554 ------
NM_133331chr41554 ------
NM_133334chr486210 4686 2299 1233 689 603 473 337 15135 25383 4265 --
NM_133335chr41554 ------
NM_133370chr443671 3313 930 25 2741 584 1648 --
NM_133372chr542829 2122 1098 659 --22248 1126 --
NM_133378chr22969 166 1957 ----
NM_133432chr22969 166 1957 ----
NM_133433chr53832 643 242 --1737 --
NM_133437chr22969 166 1957 ----
NM_133445chr973450 3185 2748 2651 2608 896 388 1361 ----
NM_133468chr721638 814 --1222 --
NM_133477chr442680 2547 2155 1138 22482 1240 12632 --
NM_133493chr632998 2985 58 --11508 24614 4226
NM_133496chr184249 4082 3900 3588 1474 1045 553 517 --22817 1121 --
NM_133503chr121539 2557 57 ----
NM_133504chr121539 2557 57 ----
NM_133505chr121539 2557 57 ----
NM_133506chr121539 2557 57 ----
NM_133507chr121717 2735 235 ----
NM_133510chr142421 119 ------
NM_133625chr31295 ------
NM_133631chr311142 --1173 --
NM_133642chr2211230 ------
NM_133646chr2105368 5186 5107 4832 4818 1769 1747 891 589 404 --35332 5239 2096 13899
NM_133647chr1543741 2542 2455 716 --13132 --
NM_134265chr171986 --1322 11022
NM_134428chr9--1334 1326 --
NM_134442chr221706 1362 11385 1671 --
NM_134470chr3--1643 1169 1182
NM_138270chrX102654 2318 2310 1344 1146 1042 984 532 242 194 21330 29 22224 863 --
NM_138286chr1973351 1144 876 844 664 417 132 14177 1879 12818
NM_138288chr1442214 1968 890 390 ------
NM_138290chr7----3296 119 92 --
NM_138316chr102940 55 --11256 --
NM_138340chr18--1198 ----
NM_138350chr11104 ------
NM_138370chr21774 ------
NM_138391chr12400 300 --1403 --
NM_138423chr1552042 1778 1738 858 182 11573 ----
NM_138426chr742373 1848 867 788 --1842 --
NM_138444chr1353988 3224 3103 1331 369 ------
NM_138457chr612577 --11129 --
NM_138459chr653663 3231 3023 2283 717 --3697 626 516 --
NM_138473chr1244874 3909 721 526 ----13459
NM_138485chr3189 ------
NM_138494chr74865 663 336 126 1687 12522 --
NM_138555chr151384 ------
NM_138576chr1434530 3971 1190 --24703 4597 21505 1100
NM_138609chr52378 155 ------
NM_138610chr52378 155 ------
NM_138621chr274069 2862 2799 2639 1313 627 544 ------
NM_138633chr641599 1376 1259 158 --21799 351 21263 496
NM_138635chr712074 --21226 284 12008
NM_138638chr141789 --12114 --
NM_138639chr191135 ------
NM_138689chr11------1187
NM_138711chr31204 --1144 --
NM_138712chr31204 --1144 --
NM_138713chr1687618 7426 7170 6429 5195 1569 401 168 67877 6660 5187 3143 2846 269 12408 32919 2418 342
NM_138714chr1687618 7426 7170 6429 5195 1569 401 168 67877 6660 5187 3143 2846 269 12408 32919 2418 342
NM_138731chr1474280 3476 3225 2853 1286 871 389 12868 1837 --
NM_138736chr1614180 ------
NM_138771chr761513 1326 978 593 463 73 --21405 1332 --
NM_138782chr521859 1616 12298 ----
NM_138792chr15137 ------
NM_138819chrX1463 1381 ----
NM_138927chr211759 --1342 --
NM_138959chr196291 6126 5686 2643 1170 795 522 350 103 11948 15764 --
NM_138966chr182421 201 ------
NM_138970chr1422160 685 --1931 --
NM_139035chrX1638 --2574 491 --
NM_139045chr93668 610 203 ------
NM_139048chr3--1130 ----
NM_139057chr1552695 2174 2070 816 595 ----1175
NM_139072chr21706 ----1743
NM_139076chr421462 1022 --166 --
NM_139126chr6----1681 1212
NM_139131chr111548 ------
NM_139168chr541666 794 608 544 --21426 395 --
NM_139182chr441892 498 335 43 ------
NM_139201chr122717 131 ------
NM_139207chr1252052 1806 1530 1499 553 1232 1461 --
NM_139244chr62974 726 ------
NM_139276chr1732330 2237 2059 --22376 344 --
NM_139281chr542743 1181 657 236 --2975 483 1983
NM_139283chr1221598 557 22272 824 ----
NM_139312chr1041005 548 183 37 ------
NM_139316chr711002 ------
NM_139319chr1231848 1493 62 ------
NM_139321chr2054127 4051 3762 436 256 ------
NM_139323chr2031913 550 435 1773 11385 --
NM_144563chr2----1821 1169
NM_144563chr2----1821 1169
NM_144567chr152380 2322 782 498 224 12257 144 --
NM_144571chr475746 5419 4481 2452 1199 769 252 25440 5068 --137
NM_144574chr142548 394 ------
NM_144578chr1475476 4543 3987 1485 848 541 79 --44792 1343 1325 772 22118 337
NM_144591chr10----3453 393 137 --
NM_144595chr134711 222 165 130 ------
NM_144599chr1585461 5019 4878 4623 1202 860 513 399 --1941 --
NM_144600chr1641429 1364 1192 63 --1207 --
NM_144604chr161537 ------
NM_144609chr1721417 397 --2433 117 --
NM_144610chr172190 85 ------
NM_144632chr222250 2215 22161 115 21683 759 1844
NM_144633chr3--1373 11005 --
NM_144643chr41125 1404 ----
NM_144644chr41184 ------
NM_144657chrX4580 196 112 79 ------
NM_144660chr10----1394 --
NM_144664chr1152443 2350 1027 975 613 1819 ----
NM_144721chr451756 976 724 576 243 12652 1851 --
NM_144778chr1332041 1813 318 158 ----
NM_144949chr262364 2112 2103 979 893 780 --1911 --
NM_144967chrX31088 980 715 11046 ----
NM_144973chr1265257 4753 3589 1463 481 160 1440 15174 15190
NM_144979chr4----172 1653
NM_144981chr11131 ------
NM_144982chr122793 638 ------
NM_145011chr1051794 1436 884 641 620 ------
NM_145012chr101970 ------
NM_145025chr631131 836 141 --21124 188 --
NM_145036chr172386 81 ------
NM_145044chr341811 1587 1472 362 --21602 386 --
NM_145049chr51401 --21055 994 --
NM_145055chr1853631 2891 2858 2572 667 21370 1361 13587 --
NM_145117chr11----32329 254 241 --
NM_145175chr241378 1311 1287 891 21437 990 ----
NM_145206chr1052310 2041 1059 598 84 --1390 --
NM_145234chrX2914 358 ------
NM_145251chr1431164 377 293 11646 2654 117 --
NM_145259chr255950 5294 2270 2109 1594 15264 37056 2781 488 --
NM_145263chr42421 184 ------
NM_145274chr172620 312 ------
NM_145284chrX62241 748 589 471 335 254 12332 31780 773 607 --
NM_145305chrX31373 1221 42 11321 ----
NM_145306chr101506 --1473 --
NM_145307chr1054700 1828 1756 1265 247 13602 21721 511 --
NM_145313chr1011353 --11419 --
NM_145315chr62137 63 ------
NM_145331chr62853 148 ------
NM_145332chr621001 296 ------
NM_145333chr621001 296 ------
NM_145649chr6----22756 634 1264
NM_145655chr6----22756 634 1264
NM_145686chr262937 2647 1313 1243 1081 973 12774 ----
NM_145687chr262937 2647 1313 1243 1081 973 12774 ----
NM_145690chr821924 722 ------
NM_145693chr212584 --11007 --
NM_145698chr1022179 106 --1197 --
NM_145725chr141491 ------
NM_145726chr141491 ------
NM_145728chr151594 12192 22415 2184 12353
NM_145733chr2231241 1206 346 --151 11210
NM_145735chr1342756 2746 2370 2060 --12776 --
NM_145739chr22546 384 ------
NM_145793chr101902 ------
NM_145800chrX1124 ------
NM_145802chrX173 ------
NM_145805chr152579 468 ----2571 116
NM_145808chr763132 2832 2207 2028 604 169 --22127 1144 --
NM_145909chr631033 253 182 2537 339 ----
NM_147171chr7182 ------
NM_147175chrX42054 1742 267 133 --21996 1929 --
NM_147185chr7182 ------
NM_147189chr832062 1475 329 --1105 --
NM_147190chr12----1719 --
NM_147202chr922336 140 ------
NM_147223chr242306 1608 982 918 ----12283
NM_147233chr242123 1425 799 735 ----12100
NM_148174chr832091 1987 1796 ------
NM_148894chr42974 861 --1170 --
NM_148955chr1535855 4751 1889 16478 16547 11621
NM_148957chr1362577 2538 824 759 563 158 1808 --12515
NM_148977chr102940 55 --11256 --
NM_148978chr102940 55 --11256 --
NM_152132chr14122 ------
NM_152233chr1441463 1167 615 377 ------
NM_152237chr221446 11677 11132 --
NM_152261chr1232145 2072 1933 21945 58 11936 --
NM_152265chr111162 ------
NM_152282chr331386 188 166 --2121 100 --
NM_152298chr1--1709 ----
NM_152305chr342103 1740 645 415 ------
NM_152323chr12----2156 153 --
NM_152330chr1462498 2398 2224 1847 488 472 ------
NM_152390chr23523 455 104 --2638 532 --
NM_152400chr441596 1528 547 22 --11608 --
NM_152407chr542759 2362 1059 80 ----12102
NM_152408chr5------188
NM_152409chr543037 2560 2375 1091 13057 11235 --
NM_152412chr8173 1320 --11494
NM_152414chr831231 1042 629 11158 ----
NM_152422chr921876 259 ----1496
NM_152424chrX43590 3520 3414 1639 13359 13480 14386
NM_152429chr1031520 1453 1378 --1395 --
NM_152437chr121116 12429 12363 --
NM_152447chr14197 ------
NM_152450chr152800 95 1605 1407 --
NM_152487chr121416 387 1102 1974 --
NM_152493chr111318 ------
NM_152522chr22167 46 --123 1874
NM_152536chr331217 901 859 --11128 --
NM_152556chr742027 1649 282 48 ------
NM_152557chr721481 121 ------
NM_152564chr821736 1402 11550 ----
NM_152574chr91409 --1338 --
NM_152588chr12--1222 ----
NM_152605chr1911390 ------
NM_152608chr132503 1768 825 --11820 --
NM_152613chr221932 ------
NM_152622chr543139 1391 1201 930 13411 --13270
NM_152624chr597432 6217 6005 4824 2669 2080 1828 1364 234 11773 17135 --
NM_152629chr973988 3864 3614 2827 704 552 188 --23454 45 --
NM_152641chr121339 --11781 12632
NM_152660chr11957 1769 ----
NM_152665chr12326 234 ----1511
NM_152676chr18----122 --
NM_152678chr32573 146 ------
NM_152682chr421695 1531 11153 ----
NM_152688chr61282 1395 ----
NM_152699chr342718 2557 2466 883 --1179 1124
NM_152716chr1121646 1356 ------
NM_152721chr181689 1727 --1617
NM_152726chr132487 454 --133 --
NM_152727chr16--1281 ----
NM_152731chr63913 776 146 1879 ----
NM_152737chr621985 387 12131 ----
NM_152739chr741111 790 435 211 --1848 --
NM_152744chr742823 1216 955 832 1858 12323 --
NM_152745chr74910 862 400 89 --11087 --
NM_152754chr743739 2836 1366 285 13826 11396 --
NM_152756chr534144 1624 666 34359 3929 2687 ----
NM_152758chr833074 2257 511 1866 ----
NM_152773chr3------165
NM_152774chr742395 866 233 144 ------
NM_152787chrX73542 3495 3367 3159 1404 543 460 23377 307 --13032
NM_152789chr731304 1149 174 --11248 --
NM_152793chr755074 4977 4197 3454 3177 --13513 --
NM_152826chr1535855 4751 1889 16478 16547 11621
NM_152835chr122764 2430 12748 12921 --
NM_152838chr20113456 3394 3305 2678 2262 2202 811 571 184 100 64 --2525 41 --
NM_152890chr14967 810 502 47 --1516 --
NM_152896chr93807 798 617 --1620 --
NM_152902chr111371 21983 1847 11392 --
NM_152905chr12----177 --
NM_152924chr1575576 5182 4437 4278 2353 1019 277 1219 --11497
NM_152991chr111679 ------
NM_152994chr21241 --1112 --
NM_153020chr62124 29 --11695 11359
NM_153035chr132733 2097 1100 1258 21221 1185 --
NM_153038chr21784 ------
NM_153042chr63687 569 294 ------
NM_153050chr2224637 3863 12015 34612 4384 3157 --
NM_153051chr2224637 3863 12015 34612 4384 3157 --
NM_153181chr182421 201 ------
NM_153184chr341872 1719 703 232 ----11548
NM_153186chr9290 52 --1235 --
NM_153188chr5105619 4922 4735 3680 3663 1978 1144 988 973 171 11361 13804 13501
NM_153201chr112192 28 ------
NM_153207chr1251205 1084 1062 1046 673 24056 1235 22537 2477 --
NM_153261chr1661290 1124 1072 1049 636 613 ------
NM_153262chr133093 2587 520 32206 2075 232 13036 --
NM_153273chr3157 ------
NM_153321chr171145 --1226 --
NM_153322chr171145 --1226 --
NM_153331chr31451 ------
NM_153353chr31156 --143 --
NM_153354chr52828 348 1199 1619 --
NM_153367chr1053754 3196 2987 2734 186 --13067 --
NM_153426chr4----1636 --
NM_153427chr4----1636 --
NM_153456chr1356242 5271 4257 2497 565 32346 799 607 12204 26265 1808
NM_153464chr192151 107 --1789 --
NM_153499chr1241172 516 372 27 12445 ----
NM_153500chr1241172 516 372 27 12445 ----
NM_153605chr321505 1356 --1634 --
NM_153607chr5113171 2925 1280 1193 898 891 793 392 321 175 123 --22030 407 --
NM_153616chr1532363 1881 1809 ------
NM_153617chr1532363 1881 1809 ------
NM_153618chr1532363 1881 1809 ------
NM_153619chr1543601 3119 3047 503 ------
NM_153633chr122744 714 --1542 --
NM_153634chr1251488 1366 334 206 184 --1295 --
NM_153645chr2253234 3206 2476 38 29 ------
NM_153649chr141759 1431 772 506 ------
NM_153689chr242259 893 673 291 22072 317 21719 800 --
NM_153695chr91255 ------
NM_153715chr741230 1017 397 261 1846 11236 --
NM_153758chr11257 ------
NM_153759chr221130 371 ------
NM_153809chr9----1578 --
NM_153810chr1064563 4521 4476 3922 3838 190 11713 13804 --
NM_153812chr111690 1315 11640 12345
NM_153816chr61308 ------
NM_153828chr22297 201 1841 ----
NM_170606chr72621 321 ------
NM_170607chr1731545 1118 1094 ------
NM_170665chr1274467 2934 1161 777 764 684 401 11693 2509 56 11648
NM_170674chr1521295 1207 ------
NM_170675chr153971 883 310 ------
NM_170676chr153971 883 310 ------
NM_170677chr1521295 1207 ------
NM_170679chr541074 310 134 38 175 ----
NM_170692chr1----1316 2302 95
NM_170706chr151611 1489 1266 1230 1197 ----14334
NM_170709chr812344 ------
NM_170721chr1731343 1188 177 135 ----
NM_170724chr631110 354 120 11000 ----
NM_170725chr11160 ------
NM_170731chr1152830 2755 2083 512 249 --12649 --
NM_170732chr1152830 2755 2083 512 249 --12649 --
NM_170733chr1152830 2755 2083 512 249 --12649 --
NM_170734chr1152830 2755 2083 512 249 --12649 --
NM_170735chr1152830 2755 2083 512 249 --12649 --
NM_170750chrX1355 ------
NM_170775chr52220 68 ----1209
NM_171825chr53880 737 28 ------
NM_172070chr21549 11615 ----
NM_172071chr1127211 6851 6758 5895 5419 4828 4550 2868 2230 1849 1397 1152 --47344 5035 2079 1080 --
NM_172103chr662666 2656 2114 605 248 153 ------
NM_172105chr662666 2656 2114 605 248 153 ------
NM_172127chr43747 720 217 11514 1378 11661
NM_172128chr43703 676 173 11470 1334 11617
NM_172159chr31240 --1673 1461
NM_172160chr31240 --1673 1461
NM_172164chr1--1709 ----
NM_172169chr102650 245 ------
NM_172170chr102650 245 ------
NM_172171chr102650 245 ------
NM_172173chr102650 245 ------
NM_172193chr1411306 ------
NM_172226chr1241172 516 372 27 12445 ----
NM_172230chr1111047 ------
NM_172315chr1521295 1207 ------
NM_172316chr1521295 1207 ------
NM_172337chr143889 641 372 ------
NM_172373chr1321056 30 2261 113 --1938
NM_172387chr1821267 1112 --11301 --
NM_172388chr1821314 1159 --11348 --
NM_172389chr1821314 1159 --11348 --
NM_173054chr71858 --147 --
NM_173075chr451770 469 258 249 94 11388 ----
NM_173082chr61522 ----1479
NM_173083chr141224 219 167 38 ------
NM_173084chr361858 960 809 779 641 302 147 3573 270 134 --
NM_173156chr141656 1415 1407 419 --11709 --
NM_173171chr231138 452 368 1327 --1182
NM_173172chr221446 32 1635 --1490
NM_173173chr231138 452 368 1327 --1182
NM_173198chr952933 2714 1863 372 194 21957 278 ----
NM_173199chr91169 ------
NM_173200chr952933 2714 1863 372 194 21957 278 ----
NM_173214chr1687618 7426 7170 6429 5195 1569 401 168 67877 6660 5187 3143 2846 269 12408 32919 2418 342
NM_173354chr211368 --11946 --
NM_173468chr495917 5693 5478 5414 5246 1967 275 91 26 15082 --1172
NM_173469chr1561431 1352 1020 596 561 490 1526 2380 36 --
NM_173475chr161707 --1444 --
NM_173478chr17------1870
NM_173491chr53368 246 49 ------
NM_173494chrX3636 141 74 ------
NM_173495chrX22513 426 --1359 12274
NM_173496chr1062953 2914 2710 1957 1094 965 11065 12203 --
NM_173508chr11900 11086 ----
NM_173510chr2242356 2120 1934 580 --1655 1500
NM_173511chr243580 1437 1192 565 1892 13940 23899 2954
NM_173515chr62701 337 ------
NM_173519chr832039 532 277 --11712 --
NM_173548chr19----1529 --
NM_173550chr9152 ------
NM_173552chr321633 758 22115 1678 --1282
NM_173557chr181196 1501 ----
NM_173560chr63512 408 120 ------
NM_173563chr62293 122 ------
NM_173576chr1041612 931 500 144 ------
NM_173582chr11125613 4556 4370 4263 4133 3914 2033 1973 1870 1648 1430 263 1463 12078 12049
NM_173602chr1253160 1486 732 709 263 ------
NM_173609chr151110 ------
NM_173626chr172759 565 ------
NM_173631chr193932 858 53 --11190 1943
NM_173642chr1159188 9142 8561 8282 8234 7565 6964 6925 6750 3443 2879 1821 1774 1335 656 --1292 --
NM_173644chr2042003 1954 1843 1651 --21886 657 11754
NM_173645chr21474 1140 ----
NM_173654chr332307 2033 1955 1189 --1140
NM_173665chr53778 754 607 1200 ----
NM_173667chr552328 2155 1664 725 275 ------
NM_173683chr821688 1093 --11736 --
NM_173694chrX52266 1762 687 212 34 --22513 1748 --
NM_173797chr531375 231 89 ------
NM_173803chr1621526 386 --11645 --
NM_173808chr173457 2746 1718 1429 474 352 140 24424 3386 13908 --
NM_173814chr152530 518 ------
NM_173822chr221771 1524 --21961 1613 --
NM_173825chr362776 2203 1038 723 405 364 --12069 --
NM_173829chr555837 5108 3963 2480 883 --25880 368 --
NM_173830chr62246 188 ------
NM_173851chr841562 1473 1216 785 --13594 12450
NM_174900chr4199 --169 --
NM_174916chr1532354 1857 1645 --1160 --
NM_174921chr421116 394 --1127 --
NM_175056chr352214 1371 773 356 309 --1419 1174
NM_175061chr752032 1445 318 298 45 --1306 --
NM_175607chr341515 1169 1077 1055 --188 11716
NM_175612chr341515 1169 1077 1055 --188 11716
NM_175613chr3----188 --
NM_175623chr12107475 7201 6897 6810 4793 4667 2920 2281 687 125 11282 27502 2669 --
NM_175624chr12107570 7296 6992 6905 4888 4762 3015 2376 782 220 11377 27597 2764 --
NM_175625chr12107570 7296 6992 6905 4888 4762 3015 2376 782 220 11377 27597 2764 --
NM_175629chr221130 371 ------
NM_175634chr82378 207 1372 ----
NM_175635chr82378 207 1372 ----
NM_175636chr82378 207 1372 ----
NM_175736chr1245778 5290 5036 2724 --199 11168
NM_175747chr61875 ------
NM_175839chr201260 ------
NM_175840chr201260 ------
NM_175841chr201260 ------
NM_175842chr201260 ------
NM_175847chr1911300 ------
NM_175854chr1332263 1876 621 --11968 --
NM_175856chr5272 51 ----2102 82
NM_175907chr1832210 2095 2002 --22490 277 --
NM_175921chr544021 3581 3132 316 ----12710
NM_176081chr1033816 1109 848 15737 --1205
NM_176083chr1033816 1109 848 15737 --1205
NM_176823chr133577 2416 1556 --23746 2800 --
NM_177398chr111377 --11594 --
NM_177399chr111377 --11594 --
NM_177422chr12253 163 ------
NM_177424chr141405 811 542 334 ------
NM_177452chr142538 90 --32346 2088 443 12376
NM_177553chr111941 ------
NM_177938chr31162 ------
NM_177939chr31162 ------
NM_177947chrX31520 1120 119 --1210 --
NM_177948chrX31520 1120 119 --1210 --
NM_177952chr142639 573 ------
NM_177966chr321300 362 --11587 11803
NM_177968chr252091 1651 1449 1416 586 1515 ----
NM_177974chr1552042 1778 1738 858 182 11573 ----
NM_177995chr921876 259 ----1496
NM_178000chr931449 1043 388 ------
NM_178001chr931449 1043 388 ------
NM_178003chr931449 1043 388 ------
NM_178011chr1051289 716 617 320 170 2828 29 --11299
NM_178120chr211165 --31342 1147 886 21139 1124
NM_178123chr21780 1992 ----
NM_178140chr532427 2406 1924 ------
NM_178151chrX56911 6598 6148 4811 4758 ------
NM_178152chrX56911 6598 6148 4811 4758 ------
NM_178153chrX56911 6598 6148 4811 4758 ------
NM_178154chr141309 ------
NM_178155chr141309 ------
NM_178156chr141309 ------
NM_178157chr141309 ------
NM_178270chrX3910 256 65 ------
NM_178313chr242141 1935 685 212 --11889 --
NM_178424chr51661 1480 ----
NM_178443chr111390 ------
NM_178450chr5136 ------
NM_178539chr1221342 561 1240 ----
NM_178558chr75936 905 473 434 176 184 1939 --
NM_178566chr911901 ------
NM_178568chr1711177 ------
NM_178581chr201283 ------
NM_178585chr443110 2946 2551 423 ------
NM_178586chr1452361 1827 1789 825 710 1454 ----
NM_178812chr831430 1161 1061 ------
NM_178864chr11140 ------
NM_181054chr141956 --11284 --
NM_181291chr142687 511 ------
NM_181302chr142548 394 ------
NM_181308chr142548 394 ------
NM_181332chrX22162 1754 --12025 --
NM_181353chr202584 575 --1617 --
NM_181354chr841648 1327 567 60 --11503 --
NM_181358chr1103947 3900 3542 1623 1548 670 411 404 302 186 1612 --23781 3047
NM_181361chr311401 11162 2930 390 --
NM_181427chr15----145 --
NM_181443chr2062842 2683 2471 2369 2098 738 12263 1534 --
NM_181481chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_181482chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_181483chr1866554 5525 2588 1342 1067 417 --46996 4345 1310 776 36637 5901 1566
NM_181486chr12--21517 415 ----
NM_181504chr564167 3376 3210 3180 2771 1381 14011 41179 903 890 459 --
NM_181523chr564167 3376 3210 3180 2771 1381 14011 41179 903 890 459 --
NM_181524chr564167 3376 3210 3180 2771 1381 14011 41179 903 890 459 --
NM_181656chr17134 ------
NM_181659chr2052556 1078 991 530 79 12835 23323 3155 --
NM_181659chr2052556 1078 991 530 79 12835 23323 3155 --
NM_181672chrX42003 1990 1908 105 ------
NM_181673chrX42003 1990 1908 105 ------
NM_181689chr202789 763 ------
NM_181711chr12----2652 649 --
NM_181713chr2----1276 --
NM_181714chr641947 1584 690 381 ------
NM_181723chr862115 1738 1478 922 642 566 12044 31867 680 454 1893
NM_181741chr221241 65 ------
NM_181742chr221241 65 ------
NM_181762chrX31059 378 290 1317 1908 --
NM_181777chrX31059 378 290 1317 1908 --
NM_181782chr642242 1503 657 518 ------
NM_181794chr611111 ------
NM_181795chr611111 ------
NM_181836chr532186 1807 973 2903 408 22586 44 --
NM_181838chr5--21233 1129 ----
NM_181839chr82541 501 ------
NM_181861chr1252857 610 494 113 101 12099 11966 --
NM_181868chr1252857 610 494 113 101 12099 11966 --
NM_181869chr1252942 695 579 198 186 12184 12051 --
NM_181872chr9--1214 ----
NM_181886chr421010 919 ------
NM_181887chr421010 919 ------
NM_181888chr421010 919 ------
NM_181889chr421010 919 ------
NM_181890chr421010 919 ------
NM_181891chr421010 919 ------
NM_181892chr421057 966 ------
NM_181893chr421010 919 ------
NM_181897chr332313 2261 603 ------
NM_182485chr462843 1469 1449 1436 890 803 13315 33740 2719 456 23623 460
NM_182492chr221297 ------
NM_182493chr1674807 3390 1906 1756 1615 1094 439 ----14426
NM_182502chr43401 269 85 ------
NM_182503chr645435 3550 1573 1321 24284 695 21271 100 1620
NM_182511chr182338 118 --1301 --
NM_182515chr1956692 4194 2315 1179 633 26235 6145 22484 1680 --
NM_182540chrX2202 100 --164 1782
NM_182551chr243107 2612 1154 742 12637 --1163
NM_182560chr14198 ------
NM_182569chr173657 210 187 ------
NM_182641chr1741955 1818 689 235 11992 41495 621 427 402 11579
NM_182646chr462843 1469 1449 1436 890 803 13315 33740 2719 456 23623 460
NM_182648chr14143 ------
NM_182691chr731408 575 256 ------
NM_182692chr731408 575 256 ------
NM_182700chr721862 96 --11475 11800
NM_182710chr112412 394 ------
NM_182715chr781208 1181 1071 952 885 494 337 53 1928 ----
NM_182758chr1583937 3522 3417 2783 970 902 231 87 ------
NM_182762chr766097 5549 4891 3828 3801 1309 --14649 13811
NM_182765chr1022328 536 ----1604
NM_182767chr1232002 1578 768 ------
NM_182796chr53853 685 317 --1864 --
NM_182797chr2041368 702 688 188 1586 ----
NM_182898chr796447 6190 6048 5444 5204 1542 1366 1104 765 --14266 16469
NM_182899chr796447 6190 6048 5444 5204 1542 1366 1104 765 --14266 16469
NM_182920chr321171 253 --1351 1381
NM_182943chr331160 256 163 ------
NM_182948chr152861 2037 1106 402 134 --42878 2682 412 387 --
NM_182964chr11----32329 254 241 --
NM_182972chr112197 11764 31012 893 422 --
NM_182975chr121104 1091 --11145 --
NM_182976chr13706 228 101 ----1294
NM_183004chr1422985 1034 12844 --1415
NM_183043chr13158 ----1223
NM_183044chr13158 ----1223
NM_183078chr653269 2443 1478 841 388 23307 1372 ----
NM_183227chr62633 190 --1138 1330
NM_183353chrX1124 --1479 --
NM_183398chr521267 34 ------
NM_183399chr521267 34 ------
NM_183400chr521267 34 ------
NM_183401chr521267 34 ------
NM_183416chr111497 11821 --1133
NM_194247chr233904 1258 327 24307 491 11638 --
NM_194271chr122696 511 --1514 --
NM_194285chr1133059 1038 456 --1317 12531
NM_194301chr141354 --1188 1910
NM_194314chr1105495 5095 4719 4055 4020 3933 3734 1432 1315 1032 35150 978 685 13544 --
NM_194328chr952491 2415 1168 635 623 1189 1290 --
NM_194329chr952491 2415 1168 635 623 1189 1290 --
NM_194330chr952491 2415 1168 635 623 1189 1290 --
NM_194332chr952491 2415 1168 635 623 1189 1290 --
NM_194356chr1252411 2391 948 879 78 --11483 --
NM_194434chr18115508 4594 4421 4321 4149 2288 2148 1658 1534 313 276 35426 3901 400 34549 4324 365 14197
NM_194442chr131517 1302 90 ------
NM_194452chr111248 ------
NM_194453chr111248 ------
NM_194454chr7----11214 --
NM_194455chr7----11214 --
NM_194456chr7----11214 --
NM_197941chr532943 2853 967 --12867 --
NM_197972chr12216 85 ------
NM_197977chr92870 375 --1707 --
NM_198047chr21588 ------
NM_198087chr1631392 530 116 1161 11429 --
NM_198088chr1631392 530 116 1161 11429 --
NM_198120chr8----1521 --
NM_198123chr841834 1531 1121 503 --1620 11181
NM_198124chr841834 1531 1121 503 --1620 11181
NM_198128chr1842106 1433 819 350 --22343 309 12314
NM_198150chr52993 607 --11005 --
NM_198158chr32948 214 ------
NM_198159chr32948 214 ------
NM_198177chr32948 214 ------
NM_198178chr32948 214 ------
NM_198181chr1512718 ------
NM_198182chr231423 1096 181 ------
NM_198186chr91618 ------
NM_198187chr91618 ------
NM_198188chr91357 ------
NM_198204chr1731545 1118 1094 ------
NM_198205chr1731545 1118 1094 ------
NM_198212chr71622 --2608 540 --
NM_198217chr13160 --1951 --
NM_198218chr13160 --1951 --
NM_198219chr13160 --1951 --
NM_198225chr1022033 1303 ------
NM_198240chr1211358 ------
NM_198268chr1103947 3900 3542 1623 1548 670 411 404 302 186 1612 --23781 3047
NM_198269chr1103947 3900 3542 1623 1548 670 411 404 302 186 1612 --23781 3047
NM_198270chrX33313 2897 939 11272 ----
NM_198271chr331518 519 373 --1329 --
NM_198273chr532982 1225 849 23089 1951 32943 2375 2325 --
NM_198281chr463097 2641 2387 1139 447 310 42374 428 143 130 22521 638 --
NM_198291chr2012012 ------
NM_198329chr351386 462 348 230 22 1123 ----
NM_198390chr161777 1500 11872 1704
NM_198395chr52836 461 ------
NM_198399chr321849 205 ------
NM_198401chr841296 1102 195 133 ----21285 512
NM_198465chrX22980 2950 ------
NM_198467chr71589 ------
NM_198468chr664309 3360 3086 928 892 55 ------
NM_198484chr3106386 6175 6001 5928 5889 5340 1239 778 728 558 14797 --11410
NM_198485chr362449 2374 2361 2295 1730 725 --1306 22453 1628
NM_198503chr132373 2282 264 11848 ----
NM_198507chr51142 --1521 --
NM_198513chr822047 383 21654 557 ----
NM_198521chr12--1107 ----
NM_198581chr2127542 7504 7145 6249 5968 5502 5009 4875 2218 1887 606 249 1961 27093 794 --
NM_198584chr872577 2516 2442 1966 1842 537 375 22663 2354 --1815
NM_198595chr434712 4106 310 ------
NM_198793chr344072 3639 3263 1078 23050 150 14009 13708
NM_198844chr1711048 --3976 265 247 --
NM_198859chr334924 4221 302 14123 13457 --
NM_198889chr41394 ------
NM_198896chr1172078 1790 1589 1553 1544 131 117 11934 ----
NM_198900chr1245778 5290 5036 2724 --199 11168
NM_198903chr51629 --1154 --
NM_198904chr521955 629 --1154 --
NM_198935chr2033231 2605 226 12070 22715 767 --
NM_198956chr721862 96 --11475 11800
NM_198965chr123131 83 34 ------
NM_198966chr123131 83 34 ------
NM_198989chr131381 --1535 --
NM_198992chr121345 --1149 --
NM_199000chr712230 12145 11784 --
NM_199003chr8------11441
NM_199039chr41860 11082 11087 --
NM_199040chr1283695 3430 3310 3282 2813 2796 853 369 1993 ----
NM_199044chr111107 --12111 --
NM_199072chr72615 124 22360 1052 --12098
NM_199076chr101335 ------
NM_199144chr2031590 1319 1065 ------
NM_199168chr1021492 204 ------
NM_199188chr1243971 985 953 492 --13234 --
NM_199189chr51103 ------
NM_199190chr1243971 985 953 492 --13234 --
NM_199203chr2031590 1319 1065 ------
NM_199229chr21435 ------
NM_199235chr22268 229 ------
NM_199244chr9----1913 --
NM_199321chr1711048 --3976 265 247 --
NM_199324chr421201 1035 --13193 --
NM_199327chr441080 1032 411 125 ------
NM_199421chr1454510 3913 1860 353 167 --31530 1527 899 --
NM_199436chr272559 2385 2244 2152 1250 606 318 --1945 --
NM_199437chr1142502 2191 1902 333 --32352 1922 615 --
NM_199438chr1142502 2191 1902 333 --32352 1922 615 --
NM_199439chr1142502 2191 1902 333 --32352 1922 615 --
NM_199454chr144363 1496 559 535 14197 11723 --
NM_199461chr1042433 1160 1017 773 --1474 --
NM_199482chr231389 812 272 --11776 --
NM_201413chr212811 46 ------
NM_201414chr212811 46 ------
NM_201434chr172739 575 -----<