TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4705
miRNA Sequence: UCAAUCACUUGGUAAUUGCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001003652chr18138575 8407 8388 7629 5668 3233 2836 2715 2545 2204 1655 1256 655 15660 --11386
NM_001014797chr10108050 6427 6089 6079 5246 2661 2248 1875 1860 1567 13200 13114 --
NM_001025079chr383794 3241 2911 1612 884 545 384 125 33282 2762 1146 1151 --
NM_001039538chr233626 3050 442 --13685 23184 622
NM_001777chr383794 3241 2911 1612 884 545 384 125 33282 2762 1146 1151 --
NM_002025chrX79190 8417 7506 6927 2987 1646 1389 26192 815 27259 6906 11902
NM_002270chr575158 4830 4745 4135 3627 1358 1253 ----1897
NM_002310chr5116274 4932 4585 4416 2623 2368 1469 1247 958 763 354 14886 11307 25602 5133
NM_002374chr233626 3050 442 --13685 23184 622
NM_002709chr293168 2418 1417 1388 815 631 592 368 351 13545 13383 --
NM_003108chr2126873 6686 6121 6044 5098 4729 4696 2852 1155 818 574 326 1871 22172 385 --
NM_005056chr1285551 4879 4831 1956 1255 492 317 78 15231 --15403
NM_005504chr1286656 6264 6198 4742 4149 1584 1507 933 15758 1144 1822
NM_005901chr18138575 8407 8388 7629 5668 3233 2836 2715 2545 2204 1655 1256 655 15660 --11386
NM_006252chr197566 7111 7034 5739 4821 4686 2870 2601 331 36384 6303 2888 26947 2277 24588 1036
NM_006393chr1064042 3611 1749 1488 317 260 13554 13862 14424
NM_006599chr1697972 6333 6180 3067 3015 2899 2843 458 59 22696 1797 --13241
NM_007358chr171958 1575 1413 1402 621 339 332 1271 11336 --
NM_014382chr31660 11736 --2601 224
NM_017644chr335210 1458 1449 24196 3146 34620 4354 219 13326
NM_020342chr242482 2463 1835 872 12007 1649 12374
NM_020772chr1777678 6634 5508 3273 2965 340 312 ----16277
NM_020782chr1264771 4558 4167 3895 3661 1116 23644 1249 --14263
NM_024989chr267880 3137 2412 1366 1333 833 18223 48018 6646 5724 888 --
NM_030627chr533349 3111 1111 --12839 13638
NM_031427chr1485968 4434 4132 3788 2125 1339 1106 699 --21394 1016 --
NM_031845chr233626 3050 442 --13685 23184 622
NM_031847chr233626 3050 442 --13685 23184 622
NM_138713chr1697972 6333 6180 3067 3015 2899 2843 458 59 22696 1797 --13241
NM_138714chr1697972 6333 6180 3067 3015 2899 2843 458 59 22696 1797 --13241
NM_152624chr5147166 5513 5384 5179 4907 4639 4615 2933 2711 2137 2042 1664 676 663 15820 25172 363 --
NM_153188chr575158 4830 4745 4135 3627 1358 1253 ----1897
NM_173214chr1697972 6333 6180 3067 3015 2899 2843 458 59 22696 1797 --13241
NM_173470chrX102942 2801 2751 2726 2468 2335 782 465 311 302 --12084 --
NM_173642chr1138232 7655 7563 7504 7352 7301 7095 6779 6723 6124 2718 170 84 --19186 --
NM_182503chr654833 4324 3679 3398 1961 23417 1717 15391 15099
NM_198793chr383790 3237 2907 1608 880 541 380 121 33278 2758 1142 1147 --
NM_206876chr293168 2418 1417 1388 815 631 592 368 351 13545 13383 --