TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4708-5p
miRNA Sequence: AGAGAUGCCGCCUUGCUCCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51354 --1405 --
NM_000038chr521321 355 1829 ----
NM_000052chrX33333 1067 756 12212 ----
NM_000055chr32362 142 ----1169
NM_000070chr151502 ------
NM_000074chrX3892 794 373 ------
NM_000075chr124192 111 82 43 ------
NM_000080chr17131 1343 ----
NM_000081chr151826 1637 1451 1253 675 ------
NM_000084chrX116176 5036 4740 4729 4561 4349 2184 2021 1672 1630 758 15837 15162 15618
NM_000089chr74702 675 101 60 1619 ----
NM_000092chr254351 3956 3360 1508 711 44200 3711 1679 469 --2981 358
NM_000096chr32864 287 ------
NM_000103chr1521283 116 --134 --
NM_000109chrX52597 2375 2129 358 340 1673 --12669
NM_000110chr131229 1043 378 --11059 --
NM_000125chr693636 2932 1491 1227 1000 563 327 172 45 --13676 --
NM_000126chr15--1109 ----
NM_000129chr651449 1408 1300 304 33 ------
NM_000135chr162895 726 ----11012
NM_000138chr15--32467 1871 551 11889 --
NM_000142chr41607 --1191 --
NM_000151chr1721846 1207 ------
NM_000158chr31603 2681 230 --2662 623
NM_000163chr522225 1833 11869 ----
NM_000165chr61627 1426 ----
NM_000167chrX2691 498 ----11284
NM_000168chr752661 2645 2201 966 600 2207 114 12560 12602
NM_000170chr95517 464 121 77 53 --1542 --
NM_000173chr172407 299 ------
NM_000176chr523254 430 22707 2512 ----
NM_000183chr21324 162 ----
NM_000188chr102280 189 ------
NM_000189chr25838 584 563 374 267 12298 --2677 149
NM_000192chr1221071 29 1116 ----
NM_000208chr1953945 1850 1549 1176 134 1145 --1869
NM_000214chr2011220 --11456 1188
NM_000216chrX53550 2670 1017 285 162 13054 ----
NM_000217chr1255202 3817 3590 1918 431 11788 13652 --
NM_000220chr112922 205 --2701 170 --
NM_000222chr421602 681 11357 ----
NM_000230chr752639 714 503 315 252 --167 11908
NM_000245chr712259 ------
NM_000248chr333075 1087 235 12506 12330 1991
NM_000252chrX167 11323 --1974
NM_000259chr1575646 4083 1912 626 315 111 35 36216 6179 5708 ----
NM_000264chr923340 3070 22882 2588 21261 838 --
NM_000266chrX2248 200 ------
NM_000267chr1742522 1374 1191 224 13426 ----
NM_000276chrX72230 1810 1631 1413 853 743 562 --2588 571 1697
NM_000277chr121218 ----1280
NM_000280chr112863 273 ------
NM_000282chr131262 ------
NM_000284chrX21702 403 1494 ----
NM_000291chrX2166 53 --163 1157
NM_000297chr441947 1614 609 354 11858 1718 --
NM_000304chr1741078 915 376 172 ------
NM_000310chr141146 1076 484 176 1534 ----
NM_000314chr1043254 919 660 565 1748 ----
NM_000325chr42620 198 ------
NM_000329chr1--1651 1807 --
NM_000332chr696653 6620 6509 6445 6062 6044 4860 1121 731 22754 1265 35798 2009 1156 11186
NM_000337chr5106533 4838 4517 4235 2644 2592 2263 1670 1377 493 44798 1951 1514 1444 ----
NM_000346chr1731850 1291 797 --11586 --
NM_000351chrX74339 3868 2875 1384 1297 1150 47 --11620 --
NM_000362chr2231246 385 221 1466 12896 --
NM_000368chr944453 3884 1035 549 1885 ----
NM_000369chr1451832 1810 1293 614 151 31796 1682 360 ----
NM_000389chr631039 230 63 ------
NM_000393chr251608 1426 1338 711 644 --11517 --
NM_000397chrX22335 1789 1355 ----
NM_000399chr101770 ------
NM_000401chr1111131 ------
NM_000408chr293251 3146 2828 2254 1295 999 826 524 258 1732 ----
NM_000411chr2162317 2188 1233 958 441 47 ------
NM_000414chr51237 ------
NM_000430chr171433 --12869 --
NM_000436chr541531 479 264 197 1209 11558 --
NM_000437chr12719 440 21942 872 11684 --
NM_000439chr51218 1315 ----
NM_000444chrX2156 113 ----1334
NM_000448chr1152439 2099 1235 659 580 1825 ----
NM_000451chrX41999 1481 420 310 11990 11828 --
NM_000452chr1341768 1446 470 316 ------
NM_000461chr384296 3996 3523 1369 1189 911 876 863 22912 52 1188 11422
NM_000462chr151480 11795 ----
NM_000477chr4------122
NM_000480chr1151658 1426 1140 1059 22 2449 396 ----
NM_000489chrX83415 3302 2908 2446 904 822 460 168 12831 ----
NM_000493chr61735 --1381 --
NM_000503chr831240 471 323 ------
NM_000508chr4----1897 --
NM_000509chr4------1179
NM_000522chr731098 447 130 --1909 --
NM_000530chr111136 ------
NM_000533chrX21909 698 176 3746 307 68 --
NM_000538chr1331267 169 137 --1677 --
NM_000546chr1741105 1078 405 47 ------
NM_000555chrX157848 7627 7143 7122 6923 5883 5262 3135 2745 2677 2518 2403 1702 841 668 27232 2411 47111 6666 5510 5345 --
NM_000565chr14909 704 673 456 22218 96 --1624
NM_000574chr141153 1080 496 489 ----11303
NM_000586chr41235 ------
NM_000598chr731526 627 506 --1196 --
NM_000599chr254620 4487 3480 1436 1143 23963 93 ----
NM_000600chr72414 299 ------
NM_000601chr71452 ------
NM_000609chr1042194 2069 1265 1237 --12990 --
NM_000612chr1143621 2915 2378 626 1836 1208 --
NM_000615chr1142198 1955 1216 1042 2949 128 165 --
NM_000618chr1286110 5198 4197 2318 1618 1587 625 599 24239 1487 ----
NM_000618chr1286110 5198 4197 2318 1618 1587 625 599 24239 1487 ----
NM_000619chr12------1460
NM_000624chr141868 ------
NM_000627chr22335 195 ------
NM_000633chr1853269 1914 1636 894 750 14811 34865 2033 496 24527 1825
NM_000675chr222637 293 --1255 --
NM_000679chr51513 ------
NM_000685chr31818 ------
NM_000685chr31818 ------
NM_000686chrX--1249 11417 1530
NM_000689chr91334 --146 --
NM_000693chr1531639 242 82 11519 ----
NM_000702chr122015 415 21853 1483 12254 --
NM_000719chr12166668 6628 5991 5465 5365 5115 5092 4667 2504 1906 1508 1378 994 189 121 110 14101 12485 --
NM_000721chr1--22428 2258 --1499
NM_000726chr221285 1047 21357 72 ----
NM_000756chr82431 33 ------
NM_000759chr17132 --2585 123 --
NM_000782chr201126 1290 1170 --
NM_000783chr101168 --1395 --
NM_000800chr541520 1438 1289 529 --1583 --
NM_000806chr511280 21928 1472 ----
NM_000807chr42552 159 ------
NM_000808chrX2815 698 1249 ----
NM_000809chr4118807 8356 7987 7739 7166 6569 6258 5760 3578 3190 2793 17437 --18076
NM_000813chr565444 5222 2052 826 639 367 1145 13603 --
NM_000814chr1553522 3251 1588 1207 863 43443 2676 910 837 1724 --
NM_000816chr5--1498 1587 --
NM_000817chr251128 976 902 822 769 196 ----
NM_000824chr43821 623 108 139 ----
NM_000826chr441886 336 299 249 12194 11857 --
NM_000829chr112785 731 1643 ----
NM_000833chr1621353 477 ------
NM_000834chr1231146 444 185 ------
NM_000855chr111333 ------
NM_000864chr131116 980 107 ------
NM_000866chr341867 1680 710 449 2482 319 11641 --
NM_000868chrX21904 348 1338 ----
NM_000870chr521146 354 ----11496
NM_000872chr1011035 1204 ----
NM_000875chr15106745 6465 6102 6001 5947 5938 5663 5347 4920 1816 45132 4451 2810 2670 15534 14862
NM_000876chr63917 485 367 ----1288
NM_000880chr82909 137 ------
NM_000891chr1733621 3195 2822 33291 1095 685 ----
NM_000899chr1253932 3247 3012 989 120 42941 2802 1553 941 ----
NM_000901chr431729 658 600 ------
NM_000902chr353091 2511 1273 696 215 --21176 1066 --
NM_000917chr10160 1334 ----
NM_000921chr122138 121 ------
NM_000926chr11169407 9286 9076 8477 8226 8205 7946 2279 2039 1829 1669 1396 1343 1113 904 319 17863 15961 --
NM_000927chr73393 114 102 --1606 --
NM_000933chr2011686 11754 1173 --
NM_000944chr472043 1938 1914 1769 1503 896 847 ------
NM_000945chr261322 808 564 308 289 48 ------
NM_000950chrX53242 2415 1439 757 735 12380 1726 --
NM_000956chr14137 1979 ----
NM_000961chr2054035 3792 1358 1123 920 --13726 --
NM_000964chr1721179 325 ------
NM_000965chr3--1219 ----
NM_000983chr141263 1254 400 330 --179 11503
NM_001001132chr21----1576 --
NM_001001323chr1223036 2171 22945 598 ----
NM_001001331chr342738 2309 623 614 --12111 --
NM_001001395chr1252769 2491 564 382 152 1684 12674 --
NM_001001396chr154279 3236 3198 2731 1090 ------
NM_001001419chr554977 4081 3933 2004 667 --14165 --
NM_001001420chr554977 4081 3933 2004 667 --14165 --
NM_001001433chr2052509 2187 1975 722 480 22349 1028 11127 --
NM_001001481chr842483 1084 564 136 12312 12625 --
NM_001001483chr111382 ------
NM_001001484chr1051930 1632 906 632 114 12189 ----
NM_001001556chr1521452 399 1187 11074 --
NM_001001557chr822220 1595 1738 1478 --
NM_001001664chr224082 468 2561 415 --24110 145
NM_001001870chr172801 200 --1553 --
NM_001001890chr2182810 2784 2697 1464 1173 774 532 475 ------
NM_001001924chr851921 1769 1480 689 37 1548 1282 11402
NM_001001925chr851921 1769 1480 689 37 1548 1282 11402
NM_001001931chr851921 1769 1480 689 37 1548 1282 11402
NM_001001933chr12447 144 --1113 --
NM_001001974chr1022272 910 22152 221 ----
NM_001001977chr20134 ------
NM_001001995chrX1472 --1146 --
NM_001002009chr73432 201 64 ------
NM_001002010chr73432 201 64 ------
NM_001002233chr841860 1610 1417 112 ------
NM_001002257chr253115 3062 940 545 77 1492 ----
NM_001002295chr103961 326 64 ------
NM_001002814chr863910 3668 3156 1417 1122 112 23328 3290 13742 --
NM_001002838chrX41700 1407 1398 308 ------
NM_001002843chr15144 ------
NM_001002860chr14134594 4212 4081 3567 3386 2869 1604 1457 936 715 392 237 198 ----14703
NM_001002901chr11457 ------
NM_001002909chr1762129 1749 1714 507 496 286 --1658 1549
NM_001003407chr1044269 3531 3505 3343 ----11432
NM_001003408chr1044269 3531 3505 3343 ----11432
NM_001003665chr153548 3220 2536 933 159 --32352 800 595 --
NM_001003674chr18106918 6731 6314 5951 5907 5594 5461 4405 2644 940 26649 2433 25289 869 --
NM_001003675chr18106918 6731 6314 5951 5907 5594 5461 4405 2644 940 26649 2433 25289 869 --
NM_001003688chr4--11076 ----
NM_001003694chr32564 99 ------
NM_001003712chr1293970 3651 2877 2501 1583 1071 862 226 150 13349 13168 --
NM_001003760chr622388 802 11165 ----
NM_001003792chr31103 ------
NM_001003793chr31103 ------
NM_001003794chr312252 22928 2411 ----
NM_001003800chr931112 683 531 --33362 2853 294 --
NM_001003940chr1523694 1164 ------
NM_001003942chr1523694 1164 ------
NM_001004065chr953885 2898 903 75 25 ------
NM_001004127chr131366 ------
NM_001004303chr13685 271 223 ------
NM_001004303chr13685 271 223 ------
NM_001004304chr1223194 2203 --22109 201 --
NM_001004317chr664548 4043 3844 3226 2839 1171 24460 813 12809 --
NM_001004330chr1241522 1411 735 110 1569 --1373
NM_001004346chr4----1164 --
NM_001004360chr231498 348 150 ------
NM_001004419chr1254444 4361 3574 3281 1479 33406 3398 1470 ----
NM_001004439chr152302 129 11145 ----
NM_001004440chr1------2492 102
NM_001004441chr5123 21508 390 ----
NM_001004720chr23947 730 147 ------
NM_001004722chr241116 899 316 120 ------
NM_001005209chr21704 ------
NM_001005242chr1221584 1573 ------
NM_001005335chr192207 43 1305 ----
NM_001005386chr242429 2105 1957 264 --1454 --
NM_001005404chr17104368 4237 3367 3042 2842 1698 1504 749 197 145 --33248 1563 1072 --
NM_001005463chr1041839 590 243 96 --1444 --
NM_001005473chr566445 6410 4200 2012 741 195 26368 5856 15696 --
NM_001005474chr32217 62 --11576 --
NM_001005739chr21713 ------
NM_001005743chr142298 23 11257 ----
NM_001005744chr142298 23 11257 ----
NM_001005745chr142298 23 11257 ----
NM_001005746chr221285 1047 21357 72 ----
NM_001005747chr221285 1047 21357 72 ----
NM_001005753chr222302 2181 22163 891 ----
NM_001005781chr21118 ------
NM_001005782chr22271 107 ------
NM_001005849chr173577 196 132 ------
NM_001005861chr32698 79 ------
NM_001006600chr552292 2058 819 694 376 ------
NM_001006610chr162743 399 --1243 --
NM_001006612chrX----2126 61 1143
NM_001006613chrX----2126 61 1143
NM_001006614chrX----2126 61 1143
NM_001006618chr91205 ------
NM_001006635chr22247 129 ------
NM_001006636chr21705 ------
NM_001006641chr91603 2340 69 1395 --
NM_001006642chr91603 2340 69 1395 --
NM_001006643chr91603 2340 69 1395 --
NM_001006657chr282683 2646 2419 2051 857 799 624 532 --32563 2245 2069 --
NM_001006665chr11761 ------
NM_001006681chrX1117 ------
NM_001006682chrX1117 ------
NM_001006683chrX1117 ------
NM_001006684chrX267 55 ----1139
NM_001006945chr12546 194 ------
NM_001007024chr1754376 3210 2944 1112 517 13955 2997 881 --
NM_001007025chr1754376 3210 2944 1112 517 13955 2997 881 --
NM_001007094chr1043820 768 558 327 54427 4406 3401 3092 1050 --14273
NM_001007097chr955127 4986 4127 3534 1395 13444 13693 21749 944
NM_001007102chr631507 335 212 --21286 666 --
NM_001007156chr1531832 1668 1600 --21865 304 --
NM_001007214chr12454 144 ------
NM_001007226chr1721280 319 --11108 11310
NM_001007227chr1721280 319 --11108 11310
NM_001007228chr1721280 319 --11108 11310
NM_001007229chr1721280 319 --11108 11310
NM_001007230chr1721280 319 --11108 11310
NM_001007246chr2161870 1679 1587 1308 1270 126 ------
NM_001007257chr151517 1098 1057 498 173 11180 ----
NM_001007267chr22129 62 ------
NM_001007277chr111382 ------
NM_001007466chr6104780 4711 4444 4014 3712 1691 1471 633 577 328 1319 ----
NM_001007471chr92356 178 ----1856
NM_001007527chr52224 214 1733 ----
NM_001007553chr12270 75 ------
NM_001007559chr182209 31 ------
NM_001007565chr31112 1322 ----
NM_001008220chr531373 1057 557 11011 ----
NM_001008222chrX2882 149 ------
NM_001008239chr1853076 2525 752 490 110 1431 --1718
NM_001008388chr441033 421 363 206 ------
NM_001008392chr363081 2946 1334 705 463 216 ------
NM_001008401chr19--11167 ----
NM_001008405chr711498 ------
NM_001008408chr755596 5503 4477 1804 1424 ----14394
NM_001008495chr841956 1721 1650 1637 --22195 357 --
NM_001008541chr1042206 1734 943 889 1570 ----
NM_001008541chr1042206 1734 943 889 1570 ----
NM_001008564chr1352145 1932 1505 617 168 22084 785 1437 --
NM_001008567chr91100 135 ----
NM_001008660chr1131396 1185 1103 ------
NM_001008701chr1933013 1893 1176 --12501 --
NM_001008726chr1441450 527 424 340 --1569 --
NM_001008738chr532895 247 71 ------
NM_001008801chr1912115 ------
NM_001008895chr1371298 449 389 219 180 144 75 ------
NM_001008925chr453105 2965 1325 525 214 ----13040
NM_001009183chr142128 29 1156 ----
NM_001009552chr81172 ------
NM_001009555chr441435 649 543 265 11672 ----
NM_001009571chr751732 1292 1229 650 321 ------
NM_001009899chr3146547 6389 6212 5810 5403 4477 4145 2613 2175 1040 765 444 295 242 14285 14389 --
NM_001009993chr274040 3754 3651 2925 1598 1312 476 11820 ----
NM_001010000chr1873528 3326 3105 3090 1401 811 451 13462 ----
NM_001010853chr673140 2981 2958 2796 1003 860 288 ----1701
NM_001010861chr132483 1798 979 22715 509 ----
NM_001010862chrX92985 2872 2681 2210 2035 762 648 592 90 12927 12647 --
NM_001010867chr1146679 6660 6530 6467 6458 6200 5686 4999 4746 4688 1954 1776 847 616 --26061 5967 --
NM_001010888chrX21828 476 11120 21697 1013 --
NM_001010895chr932048 802 626 ------
NM_001010923chr621666 1316 11093 ----
NM_001010927chr61544 ------
NM_001010932chr71452 ------
NM_001010983chr3----130 --
NM_001010986chrX52474 910 699 390 135 2415 43 ----
NM_001011513chr4113946 3835 3394 3267 3021 2989 2773 1642 928 636 194 1277 12701 --
NM_001011515chr441003 712 406 257 ------
NM_001011516chr441003 712 406 257 ------
NM_001011546chr205796 554 335 318 116 --2809 654 --
NM_001011553chr73934 818 806 --2958 722 --
NM_001011663chr103387 294 178 1332 --159
NM_001011666chr796558 6524 6413 6322 4437 2406 1824 617 70 34251 1764 430 1562 --
NM_001011705chr131283 ------
NM_001011708chr272759 2529 2491 2241 2083 562 46 22922 2097 12790 --
NM_001011713chr1421035 607 1391 ----
NM_001011720chr851169 984 540 478 230 1558 ----
NM_001011885chr1551157 735 721 462 224 ------
NM_001012264chr142730 52 ----1722
NM_001012393chr1174755 4547 4345 4336 4075 716 595 1858 33908 1056 1011 --
NM_001012398chr161827 ------
NM_001012410chr32478 397 --1318 --
NM_001012751chr1011520 ------
NM_001012755chrX105046 4424 4383 4172 3402 3177 1627 804 727 109 14605 24683 3169 --
NM_001012761chr512660 --11818 1764
NM_001012968chrX82389 2274 2205 1076 983 638 484 403 ------
NM_001012974chr6--130 ----
NM_001012979chrX170 ------
NM_001012989chrX3266 120 70 ------
NM_001013031chr1032340 1055 478 --12382 13510
NM_001013398chr731526 627 506 --1196 --
NM_001013399chr61721 1251 ----
NM_001013406chr711119 1364 ----
NM_001013438chr32926 63 ------
NM_001013439chr31772 ------
NM_001013615chr13878 815 140 ------
NM_001013620chr12137887 7319 6937 6929 5690 5502 5116 3250 2276 1978 1548 1533 51 57628 5753 5414 513 244 ----
NM_001013690chr1232458 2416 247 21751 1683 11787 --
NM_001013699chr124512 119 98 24 ------
NM_001013843chr152789 376 ------
NM_001014435chr16139 --1564 --
NM_001014797chr1098035 7453 5443 3079 2819 2632 2417 2033 374 17788 27194 1630 15148
NM_001014839chr11759 --162 --
NM_001014841chr11759 --162 --
NM_001015045chr442374 632 603 206 ------
NM_001015508chr81143 ------
NM_001015877chrX52542 2444 2316 2244 333 32855 2673 2386 21170 1118 --
NM_001015880chr1021263 100 1235 ----
NM_001015882chr94911 902 734 432 ------
NM_001015887chr341828 1228 617 439 11657 11840 --
NM_001017395chr343193 2919 2612 2588 ------
NM_001017396chr221868 414 --1595 1816
NM_001017415chr12641 268 ------
NM_001017416chr12641 268 ------
NM_001017423chr102512 276 162 ----
NM_001017424chr141854 1638 1320 79 ------
NM_001017425chr141854 1638 1320 79 ------
NM_001017440chr7107956 6010 5823 5580 3172 1011 710 313 307 179 15015 25698 793 26344 1054
NM_001017523chr1221554 673 --1766 --
NM_001017920chr21123 ------
NM_001017930chrX1238 1248 11034 --
NM_001017962chr10160 1334 ----
NM_001017969chr91152 1212 ----
NM_001017992chr551102 553 441 412 132 1305 1966 --
NM_001017999chr1--12161 22018 1833 --
NM_001017999chr1--12161 22018 1833 --
NM_001018000chr1--12161 22018 1833 --
NM_001018000chr1--12161 22018 1833 --
NM_001018001chr1--12161 22018 1833 --
NM_001018003chr83273 219 117 ------
NM_001018004chr151202 ------
NM_001018006chr151202 ------
NM_001018007chr151202 ------
NM_001018009chr311169 --11053 --
NM_001018020chr151202 ------
NM_001018037chr93353 313 247 ------
NM_001018053chr161919 1619 666 546 303 254 --11899 --
NM_001018054chr131253 1219 399 ------
NM_001018056chr91222 ------
NM_001018057chr1141328 574 152 101 ------
NM_001018064chr941833 225 207 66 11878 ----
NM_001018065chr994924 4892 4355 3797 1937 1612 814 240 119 45867 5424 3789 2175 ----
NM_001018066chr994924 4892 4355 3797 1937 1612 814 240 119 45867 5424 3789 2175 ----
NM_001018067chr184948 3505 2041 1855 1845 1507 1491 1243 1781 24622 302 --
NM_001018068chr184948 3505 2041 1855 1845 1507 1491 1243 1781 24622 302 --
NM_001018069chr184948 3505 2041 1855 1845 1507 1491 1243 1781 24622 302 --
NM_001018072chr1221554 673 --1766 --
NM_001018074chr523254 430 22707 2512 ----
NM_001018075chr523254 430 22707 2512 ----
NM_001018076chr523254 430 22707 2512 ----
NM_001018077chr523254 430 22707 2512 ----
NM_001018108chr1532234 1595 528 11613 ----
NM_001018111chr753981 2517 2500 927 583 33259 1257 1157 --21457 834
NM_001018676chr81498 ------
NM_001018677chr81498 ------
NM_001020658chr141527 1445 527 311 ------
NM_001020658chr141527 1445 527 311 ------
NM_001023567chr1541754 899 893 218 2440 234 12388 11584
NM_001024024chr142789 680 ------
NM_001024094chr523254 430 22707 2512 ----
NM_001024218chr142327 123 ------
NM_001024226chr121145 408 ------
NM_001024227chr121145 408 ------
NM_001024228chr121145 408 ------
NM_001024596chr1953581 2755 2445 2343 863 12797 1694 --
NM_001024649chr541115 927 745 282 12433 11866 --
NM_001024660chr331709 642 301 192 --11341
NM_001024680chr221834 480 1571 11292 --
NM_001024808chr1211983 12856 21915 762 --
NM_001024809chr1721179 325 ------
NM_001024847chr33905 779 473 ------
NM_001024934chr6--1168 ----
NM_001024935chr6--1168 ----
NM_001024936chr6--1168 ----
NM_001024937chr172662 479 ------
NM_001024947chr511002 1847 1145 --
NM_001024948chr152668 2643 954 789 743 --12340 --
NM_001025076chr1065885 5352 4914 4031 1537 51 12045 11947 199
NM_001025077chr1097243 6710 6272 5389 4806 4722 2895 1409 1065 --2857 345 11457
NM_001025079chr344039 3523 1169 1075 23554 3102 32618 1307 555 --
NM_001025105chr541404 608 254 50 1375 ----
NM_001025107chr172281 2109 1777 1029 945 333 298 ------
NM_001025107chr172281 2109 1777 1029 945 333 298 ------
NM_001025108chr293878 3663 3381 1382 1318 921 767 116 94 --1874 --
NM_001025201chr21628 ------
NM_001025252chr822745 62 23103 694 ----
NM_001025253chr822745 62 23103 694 ----
NM_001025356chr12133014 2986 2944 2422 2324 2158 2121 2050 794 424 391 339 123 22697 601 ----
NM_001025366chr631895 1345 399 ------
NM_001025366chr631895 1345 399 ------
NM_001025367chr631895 1345 399 ------
NM_001025367chr631895 1345 399 ------
NM_001025368chr631895 1345 399 ------
NM_001025368chr631895 1345 399 ------
NM_001025369chr631911 1361 415 ------
NM_001025369chr631911 1361 415 ------
NM_001025370chr631895 1345 399 ------
NM_001025370chr631895 1345 399 ------
NM_001025389chr1151658 1426 1140 1059 22 2449 396 ----
NM_001025390chr1151658 1426 1140 1059 22 2449 396 ----
NM_001025579chr172993 842 ------
NM_001025580chrX64170 3409 3078 2608 182 82 ------
NM_001025595chr441382 1084 633 422 ------
NM_001029858chr662364 2290 2256 2115 1132 60 ------
NM_001029859chr1162410 2293 1982 716 353 326 --171 --
NM_001029860chr8------1296
NM_001029863chr642675 2170 743 725 12572 --12317
NM_001029875chr552953 2377 1182 1159 591 22547 1961 ----
NM_001029884chr652683 2424 2359 2210 2153 1447 ----
NM_001030006chr17--22056 340 ----
NM_001030007chr1643803 2619 1137 463 22531 1040 ----
NM_001030055chr1454184 2918 707 571 557 24101 3223 13851 --
NM_001030272chr11--2335 128 ----
NM_001030273chr11--2335 128 ----
NM_001031623chr621323 1279 11726 ----
NM_001031679chr1233317 2423 784 32786 2378 952 ----
NM_001031681chr1732175 777 415 11578 12304 --
NM_001031684chr221142 1085 1427 --11281
NM_001031689chr91121 ------
NM_001031690chr742803 1996 1937 879 32451 2110 421 13066 --
NM_001031695chr2251218 784 416 378 234 1642 21560 285 --
NM_001031700chr452521 2006 1970 733 44 ----12351
NM_001031711chr521696 1523 ------
NM_001031716chr221141 217 1272 ----
NM_001031722chr62140 22 ------
NM_001031732chr453703 2838 2387 2258 792 --13184 --
NM_001031804chr1663999 3857 3731 3261 1164 591 23802 883 ----
NM_001031812chr562247 2123 1604 1543 334 70 ------
NM_001032221chr951786 1564 1501 212 87 1557 --1603
NM_001032281chr2----121 --
NM_001032282chr82469 204 ------
NM_001032296chr1332790 2716 961 --12220 12339
NM_001032363chr12531 144 ------
NM_001032363chr12531 144 ------
NM_001032380chr1031578 1547 145 11696 --11357
NM_001032999chr2094770 4178 4055 1710 919 899 849 455 322 23311 1907 1955 --
NM_001033045chr2114260 4149 4094 3891 3167 1737 1624 1155 861 719 458 34377 4087 627 22824 1100 12885
NM_001033047chr442583 2454 1931 62 --31858 1680 1619 12020
NM_001033057chr341782 1407 141 96 --1832 --
NM_001033087chr2043189 2891 855 147 --1235 --
NM_001033088chr151337 ------
NM_001033117chr333225 542 435 24269 1957 1487 11892
NM_001033506chr111412 ------
NM_001033507chr111698 --1160 --
NM_001033557chr211241 1941 ----
NM_001033561chr171196 1223 ----
NM_001033578chr831860 873 707 --12068 1173
NM_001033602chr1342522 2413 1871 799 --21799 493 1848
NM_001033756chr631829 1279 333 ------
NM_001033756chr631829 1279 333 ------
NM_001033925chr1011915 1701 ----
NM_001034837chr53702 637 260 ------
NM_001034838chr53702 637 260 ------
NM_001034841chr1675164 4924 3632 3626 1249 733 187 23995 1232 13788 14789
NM_001034845chr441366 167 90 62 --1298 --
NM_001035chr11519 ------
NM_001035003chr431300 574 410 21168 228 ----
NM_001035004chr431300 574 410 21168 228 ----
NM_001035260chr1041469 1372 234 64 ----1580
NM_001035505chr2142 ------
NM_001037131chr22436 402 --1931 11310
NM_001037132chr741666 748 692 30 --1741 --
NM_001037133chr741666 748 692 30 --1741 --
NM_001037164chr721813 347 ------
NM_001037165chr788937 7382 6899 6519 6313 5613 1607 1039 38724 6123 5649 26681 321 --
NM_001037172chr311390 ------
NM_001037317chr132483 1798 979 22715 509 ----
NM_001037332chr592563 2557 2194 1945 911 516 478 361 180 1742 ----
NM_001037333chr592563 2557 2194 1945 911 516 478 361 180 1742 ----
NM_001037334chr182295 58 32432 2305 1569 ----
NM_001037738chr51251 --1289 --
NM_001037872chr21135 1473 ----
NM_001037954chr1173206 2942 2772 1397 1344 1112 747 32606 1362 980 32284 929 888 --
NM_001038493chr251528 1046 966 307 195 ------
NM_001038640chr154960 286 144 83 ------
NM_001038702chr52765 500 22244 817 32485 810 114 --
NM_001038707chr12569 29 1918 1817 --
NM_001038707chr12569 29 1918 1817 --
NM_001039029chr1211943 ------
NM_001039091chrX41184 1096 565 171 11402 ----
NM_001039111chr32365 183 --1321 --
NM_001039199chr2094980 4329 3575 3340 1958 1864 1368 317 24 34674 3742 3131 14082 11700
NM_001039348chr261031 911 159 101 94 29 ------
NM_001039349chr261031 911 159 101 94 29 ------
NM_001039350chr731773 1491 1380 ------
NM_001039395chr932294 948 793 22354 2136 ----
NM_001039459chr731137 814 749 --1175 --
NM_001039538chr241316 856 609 290 21153 362 13611 --
NM_001039550chr22246 84 --1298 --
NM_001039574chr13655 398 224 ------
NM_001039577chr121523 607 --2428 54 --
NM_001039580chr4104938 4932 4379 3857 3537 2005 1140 1095 489 167 31181 841 683 --11539
NM_001039590chrX13070 ------
NM_001039591chrX13070 ------
NM_001039618chr1195773 5388 5022 4530 2089 1405 991 302 82 45006 4184 356 98 1773 --
NM_001039690chr1652378 1707 1473 207 192 ------
NM_001039693chr274146 4037 3847 3638 2695 2575 1312 12671 23149 451 13264
NM_001039709chr2094770 4178 4055 1710 919 899 849 455 322 23311 1907 1955 --
NM_001039762chr101649 32209 1980 608 ----
NM_001039840chrX115564 4416 2197 1863 1522 1028 1016 943 853 167 39 86060 3996 2301 1958 1502 1459 922 806 15882 --
NM_001039888chr11320 1236 ----
NM_001039916chr1251052 970 947 932 112 ------
NM_001039917chr1251052 970 947 932 112 ------
NM_001039918chr1251052 970 947 932 112 ------
NM_001039919chr1251052 970 947 932 112 ------
NM_001039920chr1251052 970 947 932 112 ------
NM_001039937chr1374055 3986 3975 3332 2714 1471 744 ------
NM_001039938chr1321489 1197 21471 939 ----
NM_001040001chr662046 1925 1831 1547 827 343 1628 ----
NM_001040020chr741283 638 223 103 ----11172
NM_001040101chr431480 1170 330 21595 66 2629 436 1192
NM_001040108chr1441315 895 381 255 1513 1775 --
NM_001040110chr71161 ------
NM_001040135chr71697 ------
NM_001040142chr232346 1616 519 11759 ----
NM_001040143chr232346 1616 519 11759 ----
NM_001040144chr1652378 1707 1473 207 192 ------
NM_001040146chr1652378 1707 1473 207 192 ------
NM_001040152chr794636 3869 3367 3173 3147 1747 1245 92 60 34383 1831 1135 ----
NM_001040153chr132866 363 ------
NM_001040157chr432201 425 418 ------
NM_001040159chr441485 1347 1181 35 --2458 444 --
NM_001040167chr721001 941 ------
NM_001040172chr521146 354 ----11496
NM_001040173chr521146 354 ----11496
NM_001040181chr32353 204 ------
NM_001040182chr32353 204 ------
NM_001040183chr32353 204 ------
NM_001040199chr32353 204 ------
NM_001040200chr32353 204 ------
NM_001040202chr412154 32009 1854 359 ----
NM_001040214chr652386 2324 813 434 248 ----172
NM_001040260chr431096 477 342 ----1908
NM_001040261chr431096 477 342 ----1908
NM_001040284chr16175758 5658 5142 4937 4636 4149 4134 3981 3938 3771 2349 1571 1494 1098 961 852 410 25190 640 15891 --
NM_001040402chr41622 --1354 1413
NM_001040409chr21804 --1331 --
NM_001040429chr1353382 2407 774 551 30 1655 ----
NM_001040437chr6189 ------
NM_001040438chr6189 ------
NM_001040441chr174887 4565 4049 1743 1181 888 760 21910 1056 159 --
NM_001040446chr531932 496 197 21765 416 --12725
NM_001040450chr1542923 1970 1833 967 ------
NM_001040453chr1542923 1970 1833 967 ------
NM_001040455chr111359 1347 21332 1313 --
NM_001040619chr14329 126 119 90 --1656 11085
NM_001040653chr352403 2359 872 788 725 1692 1828 --
NM_001040665chr784834 4604 4467 3490 1747 1626 763 475 ------
NM_001040708chr81781 ------
NM_001040712chr972752 2361 2260 1402 1033 544 234 1311 ----
NM_001040876chr411719 21558 241 ----
NM_001042355chr16105210 4846 3958 3298 2032 1902 1753 1556 1407 190 14638 25195 2017 157
NM_001042371chr1632126 706 84 11787 1535 --
NM_001042388chr181306 ------
NM_001042403chr121330 ----1954
NM_001042404chr131983 1283 355 ------
NM_001042412chr16105210 4846 3958 3298 2032 1902 1753 1556 1407 190 14638 25195 2017 157
NM_001042413chr933290 1184 621 12863 12978 --
NM_001042424chr443218 2832 2600 185 11100 ----
NM_001042440chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042441chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042442chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042443chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042444chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042445chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042446chr571935 1642 1509 1334 559 29 22 ----1673
NM_001042453chrX1603 ------
NM_001042459chr31248 ------
NM_001042473chr1012003 ------
NM_001042476chr1622189 243 1766 1130 --
NM_001042481chr1421994 743 --22452 2063 11912
NM_001042486chr2011464 ------
NM_001042492chr1742522 1374 1191 224 13426 ----
NM_001042506chrX31323 1280 311 ------
NM_001042510chr81587 11818 ----
NM_001042511chr81587 11818 ----
NM_001042533chr342645 2052 745 107 12463 ----
NM_001042537chrX52251 2050 2012 1544 533 --12219 --
NM_001042555chr1274059 4040 4016 3030 971 819 76 1656 1137 13330
NM_001042599chr2107293 7248 7075 6812 6785 6407 5624 2159 1522 221 36920 6895 5927 ----
NM_001042601chr332181 1229 351 1718 12073 13073
NM_001042603chr1234894 4695 4108 --13967 --
NM_001042681chr142444 2152 1883 1778 ------
NM_001042682chr142444 2152 1883 1778 ------
NM_001042682chr142444 2152 1883 1778 ------
NM_001042683chr631295 417 255 --1589 --
NM_001042724chr191818 2212 30 --123
NM_001042749chrX41981 1369 1350 327 ------
NM_001042750chrX41981 1369 1350 327 ------
NM_001042751chrX41981 1369 1350 327 ------
NM_001042762chr731061 906 335 --127 --
NM_001043318chr1464144 3345 3279 2575 1640 673 13266 21660 882 1540
NM_001043351chr11705 31830 896 848 12091 --
NM_001044305chr621051 60 ------
NM_001044385chr242866 2738 829 128 32710 2624 204 ----
NM_001044722chr562247 2123 1604 1543 334 70 ------
NM_001044723chr562247 2123 1604 1543 334 70 ------
NM_001045478chr131035 205 82 --141 1722
NM_001046chr542680 2022 1889 522 1199 ----
NM_001048183chr153523 3178 2572 2395 837 23531 1447 --1152
NM_001071775chr1331411 562 397 1206 11540 --
NM_001079874chr121968 1415 --1105 11902
NM_001083620chr441884 335 298 248 12192 11855 --
NM_001083621chr184153 3580 1713 1468 1164 795 620 182 11332 --1106
NM_001094chr171827 1261 ----
NM_001096chr172797 279 ------
NM_001099678chr3135570 5552 5068 4846 4643 4458 4342 2583 2208 1518 1194 1060 813 35013 3930 100 16105 15453
NM_001100108chr1137849 6792 6355 6163 5330 5142 5105 3239 3042 2148 1952 1712 35 57957 7658 5687 1297 162 ----
NM_001106chr387912 7758 7682 3460 3134 2149 1692 384 38846 8086 356 46711 2540 1762 1599 --
NM_001111chr172281 2109 1777 1029 945 333 298 ------
NM_001113490chrX72923 2715 2384 1196 1076 878 704 23239 620 ----
NM_001117chr1822284 2145 ------
NM_001121chr1021209 169 ------
NM_001123chr101333 2255 176 ----
NM_001124chr111538 ------
NM_001126chr11790 ------
NM_001128chr1643803 2619 1137 463 22531 1040 ----
NM_001144chr162927 192 --1530 --
NM_001148chr441535 1433 305 280 --32121 1978 136 --
NM_001149chr1021283 226 1296 ----
NM_001152chrX1169 ------
NM_001153chr2--2578 87 --1202
NM_001167chrX96539 5991 5722 4496 4130 2682 1368 1362 101 ------
NM_001172chr141253 ------
NM_001173chr1454184 2918 707 571 557 24101 3223 13851 --
NM_001177chr1252445 2418 1932 1733 1660 ----11688
NM_001178chr11--2335 128 ----
NM_001186chr2153214 1109 1043 769 57 1841 ----
NM_001199chr81229 ------
NM_001200chr2021110 908 ----11162
NM_001201chr431492 1202 102 31386 789 364 ----
NM_001204chr2157412 7129 6607 6283 6003 4932 4776 2141 1730 1130 1058 889 766 606 485 36444 5924 5103 --1809
NM_001211chr151358 ------
NM_001222chr1041881 1827 1455 763 ------
NM_001233chr75785 776 671 321 86 21894 1668 ----
NM_001237chr43181 133 93 --1938 --
NM_001237chr43181 133 93 --1938 --
NM_001241chr22935 280 ------
NM_001241chr22935 280 ------
NM_001254chr172822 43 --1252 1385
NM_001256chr172672 432 --1545 --
NM_001257chr161370 --1184 --
NM_001259chr7136395 4903 4503 4496 4391 2472 2456 1708 1647 1125 1116 800 543 24567 4192 34777 4575 613 --
NM_001260chr133336 280 111 ------
NM_001261chr9290 77 ----1758
NM_001268chr132250 37 1932 --11050
NM_001270chr52950 452 ------
NM_001271chr1523285 663 1704 32454 2191 1103 --
NM_001273chr121112 --1448 --
NM_001280chr192246 121 ------
NM_001282chr17--22056 340 ----
NM_001283chr7----1706 --
NM_001290chr41733 --1278 --
NM_001300chr101444 ------
NM_001304chr1782944 2730 2637 2367 1303 1265 571 21 23672 2606 12336 11360
NM_001310chr1252115 1237 1117 589 116 --22779 2333 1801
NM_001315chr652168 1934 1776 1660 809 --1776 --
NM_001316chr201118 1462 ----
NM_001319chr1911059 ------
NM_001326chr111355 ------
NM_001331chr1162161 1743 1143 781 667 629 --22200 1097 --
NM_001332chr531152 1086 59 ------
NM_001343chr52690 649 11733 ----
NM_001347chr441513 1434 1098 36 --1140 --
NM_001356chrX22289 268 ------
NM_001364chr11114205 3336 3201 3152 1180 1021 886 554 445 97 39 11849 24298 1917 --
NM_001378chr2----1173 --
NM_001385chr81277 ------
NM_001389chr212581 210 ------
NM_001390chr1863324 3180 2807 2759 975 406 --13372 --
NM_001391chr1841014 1006 200 151 ------
NM_001396chr2132226 564 204 22338 875 ----
NM_001401chr931524 1329 204 ------
NM_001406chr1771349 505 463 421 396 145 91 --1530 --
NM_001412chrX43397 2594 2389 29 ------
NM_001416chr17198 ------
NM_001417chr1221397 104 ------
NM_001418chr113738 209 60 ------
NM_001418chr113738 209 60 ------
NM_001419chr1943823 3611 1177 851 13471 21703 1335 --
NM_001421chrX31259 428 51 1342 --194
NM_001423chr1221577 1539 21830 1455 ----
NM_001427chr732083 1980 1443 ----1395
NM_001429chr221442 ------
NM_001430chr232016 1845 668 --1468 --
NM_001431chr62978 199 1874 ----
NM_001438chr163202 2424 2278 512 227 203 12976 13302 12905
NM_001447chr511460 --1235 --
NM_001448chrX3499 316 269 21699 1344 ----
NM_001449chrX31256 183 35 1972 ----
NM_001457chr331455 1319 363 1314 ----
NM_001460chr172578 2462 1399 1356 1262 783 50 23190 968 ----
NM_001466chr17--1108 ----
NM_001482chr151114 3693 683 639 1818 --
NM_001489chr92254 39 --1109 --
NM_001490chr983345 3337 2962 2704 2371 2251 1302 711 42272 1352 685 561 12866 --
NM_001494chr10----1650 1660
NM_001497chr92907 661 --12419 11869
NM_001527chr6104776 4717 4449 3761 3201 3072 1807 782 405 307 33888 3273 3263 14742 --
NM_001530chr1411161 ------
NM_001533chr192207 43 1305 ----
NM_001539chr9133 ------
NM_001543chr584652 4214 4194 4037 3531 3420 3223 446 1573 23356 1663 --
NM_001546chr621370 263 1529 ----
NM_001552chr172986 787 --11035 --
NM_001584chr1111095 ------
NM_001587chrX72230 1810 1631 1413 853 743 562 --2588 571 1697
NM_001604chr112863 273 ------
NM_001608chr22960 276 ------
NM_001614chr173550 142 26 ------
NM_001614chr173550 142 26 ------
NM_001616chr231179 821 439 2854 404 33236 2974 760 --
NM_001617chr241257 457 419 63 ----11013
NM_001621chr752679 2441 2333 2247 946 42415 1061 467 255 ----
NM_001621chr752679 2441 2333 2247 946 42415 1061 467 255 ----
NM_001650chr1823676 1240 33714 1383 600 14119 --
NM_001655chr1141918 1600 1517 1474 21592 1399 --11421
NM_001656chr53745 625 451 181 ----
NM_001658chr121145 408 ------
NM_001659chr1272488 1994 1874 1011 898 777 350 --11813 --
NM_001660chr3296 77 ------
NM_001661chr173621 565 198 ------
NM_001663chr1422603 2087 ------
NM_001664chr32894 127 ----1789
NM_001665chr112507 374 ------
NM_001677chr13710 390 141 ------
NM_001678chr1741592 1466 518 24 ----1404
NM_001681chr121641 ------
NM_001682chr1232750 1885 1086 22659 312 ----
NM_001683chr342738 2309 623 614 --12111 --
NM_001684chr143996 2953 2915 807 ------
NM_001688chr11311 ------
NM_001690chr331825 464 320 179 ----
NM_001693chr811159 --11009 --
NM_001695chr831270 892 447 33836 3216 1062 --1151
NM_001699chr1921494 1355 ------
NM_001701chr931613 1586 1463 11227 ----
NM_001704chr62512 75 ------
NM_001709chr111422 12013 --12091
NM_001720chr14867 657 628 186 ------
NM_001721chrX152 ------
NM_001729chr41361 ------
NM_001731chr122952 815 ------
NM_001742chr751862 1203 584 65 43 ------
NM_001744chr5139 ------
NM_001746chr541115 927 745 282 12433 11866 --
NM_001748chr1183 ------
NM_001750chr571935 1642 1509 1334 559 29 22 ----1673
NM_001753chr711565 ------
NM_001754chr2182810 2784 2697 1464 1173 774 532 475 ------
NM_001755chr1672221 2206 1543 1432 549 520 79 --1233 --
NM_001759chr1264299 3491 1330 1251 1099 190 14565 1883 --
NM_001760chr62224 105 --1192 --
NM_001777chr344039 3523 1169 1075 23554 3102 32618 1307 555 --
NM_001788chr73934 818 806 --2958 722 --
NM_001792chr181396 ------
NM_001795chr16--11083 11160 --
NM_001797chr161652 1577 ----
NM_001806chr1962460 2050 1151 1127 1054 95 1612 ----
NM_001812chr42321 272 ------
NM_001822chr21628 ------
NM_001826chr12290 61 ------
NM_001827chr91277 ------
NM_001830chrX3812 668 187 --33128 2601 1214 --
NM_001839chr13653 537 304 --1727 --
NM_001845chr1321216 1097 21194 1004 ----
NM_001854chr121296 421 ------
NM_001855chr91883 ------
NM_001859chr9103873 3674 3292 3184 3042 2929 2881 2520 622 229 33842 790 279 ----
NM_001873chr41512 ------
NM_001885chr11123 ------
NM_001892chr541404 608 254 50 1375 ----
NM_001895chr2041098 1070 789 345 --1414 --
NM_001901chr61975 159 --1318
NM_001904chr3------1392
NM_001918chr1169269 8948 8534 6988 5963 5915 5735 5608 2937 2685 2468 2203 1725 1049 721 79 56790 6281 1593 1312 573 13664 28919 6761
NM_001920chr123731 623 204 ------
NM_001933chr1431324 1249 1105 ------
NM_001935chr22885 244 2159 61 ----
NM_001936chr731773 1491 1380 ------
NM_001938chr141848 1628 473 350 1704 2357 97 --
NM_001942chr1831874 1496 270 11331 ----
NM_001944chr1872299 2293 2101 1477 802 752 531 21886 706 ----
NM_001945chr531376 1117 205 ------
NM_001946chr1221073 364 ------
NM_001949chr622095 945 22109 862 11267 1413
NM_001955chr61181 1390 ----
NM_001957chr432243 2172 2125 ------
NM_001962chr51546 ------
NM_001964chr51306 1296 ----
NM_001967chr32453 443 ------
NM_001968chr42828 99 1118 1350 1715
NM_001969chr1483043 2912 2692 2414 1372 756 536 513 3672 589 378 ----
NM_001977chr42301 58 1434 ----
NM_001981chr131593 1467 493 ------
NM_001987chr1233880 1406 1138 34330 3288 3161 --12887
NM_001992chr541801 1642 1615 1535 21971 451 ----
NM_001999chr52980 59 ------
NM_002006chr474186 3623 2019 1811 1225 263 213 2652 29 ----
NM_002009chr153997 487 154 1741 ----
NM_002010chr131390 ------
NM_002015chr1322432 1244 --23141 529 --
NM_002017chr111985 1865 1243 --
NM_002023chr151718 1619 1230 568 45 21555 1306 ----
NM_002024chrX2363 38 1432 ----
NM_002025chrX157931 7911 7438 7334 6911 6109 5820 5781 2542 2372 1770 1379 1231 253 224 16555 26083 236 19112
NM_002027chr81498 ------
NM_002031chr62277 162 ------
NM_002033chr1162824 2524 1296 1139 798 705 --171 --
NM_002035chr1863720 3236 2592 917 899 772 ------
NM_002039chr41176 ------
NM_002040chr212720 320 --1347 --
NM_002044chr1521452 399 1187 11074 --
NM_002051chr103961 326 64 ------
NM_002056chr22819 790 --1286 --
NM_002061chr121812 1336 11502 --11529
NM_002063chrX21280 974 ------
NM_002069chr761456 1394 1219 665 113 28 ------
NM_002072chr92671 220 ------
NM_002077chr952025 1759 1434 571 333 --21487 621 --
NM_002078chr33667 453 55 ------
NM_002080chr164765 200 139 108 1869 ----
NM_002092chr4114063 4020 3877 3288 2007 1724 1637 1581 1289 958 58 ----146
NM_002106chr4--127 184 --
NM_002107chr12389 328 127 ----
NM_002126chr1744052 943 842 141 13573 12965 22612 1325
NM_002129chr4----1338 --
NM_002130chr51440 ------
NM_002137chr71686 1115 ----
NM_002139chrX1576 ------
NM_002140chr951178 1170 1076 420 154 --190 --
NM_002141chr72620 547 ------
NM_002143chr1--1779 1741 --
NM_002146chr171397 1472 ----
NM_002148chr23622 537 429 ------
NM_002149chr22791 720 --1760 --
NM_002154chr52199 155 ------
NM_002156chr21304 ------
NM_002158chr293752 3453 3403 3188 2699 1520 1331 1222 716 1641 ----
NM_002160chr92570 107 1440 ----
NM_002163chr164489 313 295 47 ------
NM_002192chr72497 408 --1555 --
NM_002202chr51324 1332 1732 --
NM_002203chr543569 1510 1448 630 33290 3157 1260 ----
NM_002205chr122925 285 ------
NM_002207chr32606 58 1600 ----
NM_002214chr785676 4180 4089 4072 3655 3645 2095 1014 34484 2118 908 12240 14551
NM_002222chr321308 524 2998 205 ----
NM_002232chr131106 270 84 --1940 --
NM_002233chr112378 183 --139 --
NM_002234chr121717 ------
NM_002235chr1221190 68 ------
NM_002239chr23799 354 254 ------
NM_002242chr231901 1381 606 ----172
NM_002247chr1071993 1687 924 686 550 48 36 ------
NM_002253chr43250 111 99 ------
NM_002254chr241511 879 505 404 168 ----
NM_002264chr394567 3700 1844 1663 1459 1289 1235 1157 804 23687 3355 15048 --
NM_002265chr173301 244 54 ------
NM_002267chr1342405 2278 1665 1621 --22227 22 --
NM_002268chr331694 517 377 ------
NM_002270chr555220 5006 4512 2283 1018 43783 3573 1581 763 --14096
NM_002271chr1352346 2103 1861 1590 833 1708 ----
NM_002285chr293878 3663 3381 1382 1318 921 767 116 94 --1874 --
NM_002293chr162741 2273 1108 911 780 477 12243 21703 484 --
NM_002294chrX1132 1380 ----
NM_002310chr5106631 6443 6128 5278 4293 4170 2600 1972 1555 1349 56225 5777 5744 4226 34 26347 5025 22096 280
NM_002312chr13196 1939 ----
NM_002313chr1044269 3531 3505 3343 ----11432
NM_002333chr1931208 283 63 --11003 --
NM_002334chr1151920 1841 1307 517 241 ------
NM_002351chrX31489 1418 134 --1101 --
NM_002355chr1231274 1107 1068 196 21345 143 --
NM_002356chr632802 2638 897 2683 197 31875 1068 324 --
NM_002373chr153501 487 249 1381 ----
NM_002374chr241316 856 609 290 21153 362 13611 --
NM_002376chr14----199 --
NM_002382chr1431194 1162 188 149 ----
NM_002384chr182956 232 ------
NM_002387chr584936 4494 3573 2005 1571 935 466 397 --14128 --
NM_002397chr532050 1970 736 11765 1653 --
NM_002398chr221201 409 ------
NM_002401chr1731849 1802 922 11539 1440 --
NM_002402chr71767 11103 ----
NM_002406chr52135 107 ------
NM_002408chr141283 ------
NM_002409chr223886 471 63 13182 12188 --
NM_002430chr2222465 865 ------
NM_002442chr1221505 183 ----11093
NM_002445chr831562 1157 670 31342 474 41 --11556
NM_002449chr531279 1254 943 1370 ----
NM_002465chr12183 ------
NM_002473chr2221151 173 ------
NM_002480chr1211396 21275 1103 ----
NM_002486chr92746 543 1461 --1446
NM_002499chr1522391 370 --32043 1632 899 1302
NM_002500chr22404 23 ------
NM_002505chr621260 415 2332 245 ----
NM_002508chr141224 706 638 560 ------
NM_002515chr1421846 1764 21674 1481 11994 --
NM_002516chr192310 43 ------
NM_002518chr221148 147 --2934 306 --
NM_002519chr1111365 ------
NM_002520chr5150 ------
NM_002522chr1773513 3044 1406 1363 750 489 382 11243 173 13757
NM_002526chr64577 308 101 40 ------
NM_002536chrX21528 644 ------
NM_002538chr53154 45 37 ------
NM_002539chr22328 260 ------
NM_002540chr91656 --1644 --
NM_002544chr172291 125 ------
NM_002545chr1174755 4547 4345 4336 4075 716 595 1858 33908 1056 1011 --
NM_002546chr82576 168 ------
NM_002547chrX93918 3495 1601 1510 1448 1352 945 801 191 ------
NM_002556chr1132011 680 393 ------
NM_002570chr1531203 1017 119 --1136 --
NM_002576chr113327 207 110 159 ----
NM_002577chr353864 1605 1585 689 291 ------
NM_002581chr955450 4670 3807 2277 1979 32169 2079 1741 ----
NM_002583chr121490 1197 ----
NM_002586chr651314 1285 1160 1049 228 1566 ----
NM_002588chr52627 320 ------
NM_002594chr2021968 456 11766 ----
NM_002595chr1241316 517 437 403 ------
NM_002599chr111336 --1449 --
NM_002601chr22420 194 123 ----
NM_002605chr1521228 1105 11172 ----
NM_002613chr1684683 4127 3917 3744 2027 1347 1289 134 22165 1971 1545 --
NM_002616chr172539 21 ------
NM_002628chr351197 1137 494 478 364 ------
NM_002629chr102794 106 ------
NM_002636chr61433 --1220 --
NM_002645chr1152967 2793 2759 2477 1980 ----1157
NM_002649chr751572 1236 1225 1138 473 ----1110
NM_002655chr854972 1668 1230 1124 594 --21352 683 --
NM_002657chr2063090 3001 2792 2634 863 849 21521 609 ----
NM_002663chr17------1545
NM_002674chr12246 23 ------
NM_002687chr1421031 262 ------
NM_002699chr121469 1333 ------
NM_002703chr441488 732 284 182 2597 372 ----
NM_002706chr22524 69 1224 ----
NM_002709chr243024 2883 2574 252 12945 --1766
NM_002710chr121150 ------
NM_002716chr1133677 1192 395 11361 32875 1460 645 --
NM_002718chr312034 21690 493 12577 --
NM_002719chr1452376 2290 1990 1803 306 --22269 1703 --
NM_002731chr122736 272 --22724 792 --
NM_002734chr1711480 ------
NM_002736chr73705 290 90 ------
NM_002737chr1796368 6120 5827 4450 4258 2339 2327 1122 404 1758 12162 --
NM_002738chr1631125 705 30 1778 1169 --
NM_002740chr342382 2315 1759 315 1390 --22005 1800
NM_002742chr143659 173 142 ------
NM_002745chr2294169 3577 3334 2882 1652 1624 1534 1012 569 24537 3797 14446 21065 415
NM_002747chr1821479 152 ------
NM_002748chr1531212 795 424 ------
NM_002752chr51427 1239 ----
NM_002753chr43536 77 46 1685 ----
NM_002755chr15------1101
NM_002758chr17191 --1547 --
NM_002760chrY95368 5227 4895 4491 3720 1644 763 682 296 34134 3714 699 ----
NM_002764chrX1885 1201 ----
NM_002765chrX41184 1096 565 171 11402 ----
NM_002776chr1931513 694 157 11362 ----
NM_002786chr111232 ------
NM_002806chr141253 --1301 --
NM_002822chr1231832 1693 1194 11174 ----
NM_002825chr72601 63 ------
NM_002827chr2051464 1323 1289 446 154 ----11665
NM_002828chr181931 1160 1688 --
NM_002829chr9------11138
NM_002830chr22335 88 ------
NM_002833chr1531198 403 226 11527 ----
NM_002837chr1244568 4345 3714 1161 13849 14166 --
NM_002838chr141167 1008 460 214 ------
NM_002839chr972752 2361 2260 1402 1033 544 234 1311 ----
NM_002840chr11401 --1282 --
NM_002841chr31175 1193 ----
NM_002843chr1131139 1018 653 --12883 --
NM_002844chr62361 162 1216 ----
NM_002846chr21542 --162 --
NM_002847chr711485 11353 3998 555 455 --
NM_002857chr152534 2388 1689 557 200 --22543 2458 --
NM_002858chr121205 1014 ------
NM_002860chr102512 276 162 ----
NM_002863chr14----1110 --
NM_002865chr81211 ------
NM_002868chr1252396 1979 906 534 304 --1834 --
NM_002869chr1122082 378 --1661 --
NM_002874chr932338 1918 1523 --11958 --
NM_002886chr344880 4197 3987 1233 13401 --24906 3723
NM_002890chr54928 902 301 292 ------
NM_002892chr1431222 1081 140 ----11685
NM_002902chr151435 ------
NM_002906chr1142371 1732 708 677 1746 ----
NM_002911chr191460 1307 1395 151
NM_002912chr64830 756 346 271 ------
NM_002924chr12523 147 2446 167 ----
NM_002926chr41386 ------
NM_002940chr411719 21558 241 ----
NM_002941chr31323 1637 ----
NM_002953chr11761 ------
NM_002956chr1241418 1209 452 384 ------
NM_002957chr933469 3328 437 13311 ----
NM_002958chr32698 79 ------
NM_002959chr143487 2911 2751 377 --13791 --
NM_002968chr16----1821 --
NM_002973chr121190 ------
NM_002977chr23655 632 313 ----12258
NM_002994chr421849 1752 11316 11336 --
NM_002996chr162617 470 1365 ----
NM_002998chr831715 1465 875 1151 ----
NM_002999chr202760 706 --1113 --
NM_003010chr1742144 1806 1784 313 1303 ----
NM_003011chr951164 1049 568 460 446 ------
NM_003013chr43702 617 55 --1161 --
NM_003016chr1721963 272 ------
NM_003017chr61105 ------
NM_003026chr91912 1311 1380 --
NM_003030chr321563 1543 21897 1550 1150 --
NM_003031chr162743 399 --1243 --
NM_003032chr331656 392 297 11838 ----
NM_003036chr1----11166 --
NM_003042chr342186 2053 451 391 190 ----
NM_003043chr354327 4274 3798 1186 990 21036 495 23427 1043 --
NM_003045chr1384182 3056 1537 1481 1230 845 799 420 25030 1360 ----
NM_003048chr232704 721 106 ------
NM_003051chr151541 1445 1255 752 614 11751 ----
NM_003068chr8180 1357 2309 38 --
NM_003074chr332312 1815 1518 --1253 --
NM_003075chr121334 ------
NM_003076chr122183 74 --11156 --
NM_003077chr172621 290 ------
NM_003081chr203975 821 281 ------
NM_003088chr7------31065 866 840
NM_003107chr632326 2094 1616 11830 ----
NM_003108chr286609 6366 5401 4414 1839 1825 1556 1140 16183 22847 2150 11316
NM_003110chr171790 ----1312
NM_003112chr732225 2171 281 23244 2574 --32746 784 582
NM_003113chr2141 ------
NM_003115chr13461 326 186 ------
NM_003118chr532062 1539 630 21793 389 ----
NM_003128chr262234 2039 877 802 550 181 22766 946 42715 2629 906 143 12613
NM_003130chr741276 1117 1092 906 ------
NM_003133chr131027 351 225 ------
NM_003136chr142336 316 ------
NM_003137chr62482 64 ------
NM_003140chrY1133 ------
NM_003144chr622188 467 --1575 --
NM_003145chr12330 87 ------
NM_003149chr321419 136 2450 62 ----
NM_003155chr862352 1976 1800 686 650 624 1880 1615 --
NM_003157chr34721 701 124 111 ------
NM_003161chr1743558 3485 789 247 23387 864 11424 13047
NM_003174chr103742 677 240 1806 ----
NM_003182chr7--1497 1420 --
NM_003182chr7--1497 1420 --
NM_003185chr203398 338 225 ------
NM_003188chr63828 212 137 ------
NM_003189chr1123261 3071 2976 2885 2293 2237 2078 1308 1222 1028 485 471 ------
NM_003193chr11161 ------
NM_003198chr1----1273 --
NM_003199chr1885704 4885 4660 3735 3480 2126 2082 327 34609 4339 3767 ----
NM_003200chr1921967 324 --31825 705 293 --
NM_003201chr102674 122 ------
NM_003204chr1721761 612 1363 ----
NM_003206chr61311 ------
NM_003216chr2252937 2628 773 503 374 1143 --1694
NM_003217chr1251893 1729 714 197 54 ------
NM_003221chr673421 1614 1479 1434 1325 837 491 31663 979 478 ----
NM_003223chr163620 558 301 ------
NM_003234chr352288 1525 1500 236 121 ------
NM_003238chr11189 1226 ----
NM_003242chr33905 779 473 ------
NM_003244chr18----1339 --
NM_003246chr154363 339 264 218 21784 834 ----
NM_003253chr2131735 1679 1665 ------
NM_003255chr1742089 2001 438 375 --12073 --
NM_003257chr1541187 918 334 123 ------
NM_003262chr395056 4819 3974 3800 3452 1611 664 640 86 55215 1182 704 407 379 11295 --
NM_003270chrX31080 770 747 ------
NM_003274chr2122272 1892 ----1864
NM_003275chr91345 --11137 --
NM_003286chr2051117 1104 1095 834 125 1451 ----
NM_003290chr1941206 362 247 93 1993 ----
NM_003291chr132596 76 ------
NM_003292chr141690 786 503 160 1496 --1664
NM_003295chr131202 ------
NM_003298chr3136173 6047 5860 5424 4869 4680 4348 2113 1344 952 767 458 112 --11260 --
NM_003299chr12159 ------
NM_003304chr351373 1361 1012 449 417 --11214 --
NM_003305chr44363 347 279 175 ------
NM_003314chr5----1440 1101
NM_003319chr21683 1149 ----
NM_003320chr1153520 3486 3377 2828 672 23830 2965 24306 1285 --
NM_003336chrX51075 939 823 260 126 ------
NM_003337chr51157 ----11068
NM_003338chr1051933 1583 1451 1222 194 --1260 --
NM_003339chr54994 624 531 108 --21580 1088 11176
NM_003340chr421377 107 11399 ----
NM_003341chr32667 163 1451 ----
NM_003342chr1763070 2975 2749 573 537 209 13162 23132 2465 --
NM_003345chr161130 --1478 --
NM_003348chr1241198 266 120 70 ------
NM_003350chr81757 1372 ----
NM_003352chr22271 107 ------
NM_003358chr92151 116 ------
NM_003359chr41346 --21343 907 --
NM_003363chr33535 519 60 ------
NM_003367chr19----1153 --
NM_003368chr12641 268 ------
NM_003369chr1172788 2387 2292 942 661 579 380 21970 796 ----
NM_003373chr1031981 1289 600 ------
NM_003374chr5170 ------
NM_003376chr631895 1345 399 ------
NM_003376chr631895 1345 399 ------
NM_003379chr61436 ------
NM_003383chr91222 ------
NM_003385chr2--21039 256 1347 --
NM_003387chr252574 2351 1874 711 565 12082 12937 --
NM_003392chr344121 1743 1368 547 21474 1408 13258 14268
NM_003400chr22233 197 --1757 --
NM_003404chr202476 173 ------
NM_003405chr222591 251 ------
NM_003406chr831676 1305 210 ------
NM_003409chr1811318 ------
NM_003410chrX72073 1967 1011 785 740 648 409 ------
NM_003411chrY2611 364 ------
NM_003412chr383113 2837 2808 2670 2606 2305 672 418 ------
NM_003413chrX41264 216 207 119 12018 ----
NM_003418chr32713 168 ------
NM_003420chr3------1161
NM_003421chr1043820 768 558 327 54427 4406 3401 3092 1050 --14273
NM_003430chr1921575 1349 1163 ----
NM_003435chr19154 1190 ----
NM_003439chr783207 2765 2354 1241 1191 719 593 27 23374 2519 1767 --
NM_003442chr112362 45 ------
NM_003445chr193801 108 84 ------
NM_003453chr131567 181 ----
NM_003454chr1621025 209 31477 189 141 ----
NM_003458chr343548 3154 1348 217 1765 22508 2491 --
NM_003463chr672864 2561 2308 2120 1363 1275 512 22350 455 --1613
NM_003469chr22157 60 ------
NM_003471chr352109 1842 858 514 311 1489 ----
NM_003473chr10--1775 ----
NM_003474chr1052200 2164 1763 1659 246 1474 --11633
NM_003482chr1241804 975 832 319 --1227 1277
NM_003483chr1242713 2469 2188 850 ------
NM_003489chr2153073 3013 3005 867 332 11314 --32641 1063 1006
NM_003506chr831189 974 388 1165 ----
NM_003507chr231879 1456 633 11824 11866 --
NM_003563chr1721280 319 --11108 11310
NM_003566chr1253491 3406 2696 2294 195 12148 1930 21359 1039
NM_003567chr12441 54 1368 ----
NM_003574chr1895143 4856 4214 4157 4037 3920 3545 2261 1556 44824 3912 1497 76 23733 2320 11831
NM_003575chr711272 21266 497 ----
NM_003576chr1332790 2716 961 --12220 12339
NM_003580chr82570 49 ------
NM_003581chr23947 730 147 ------
NM_003583chr12103570 3184 3061 2975 2905 2853 2452 837 312 118 22446 898 12521 --
NM_003589chr1371298 449 389 219 180 144 75 ------
NM_003590chr2103836 3138 2813 1606 1509 571 470 340 217 93 23113 2842 ----
NM_003591chr102392 328 ------
NM_003592chr7--1184 ----
NM_003597chr231949 1442 187 ------
NM_003603chr471984 1681 1421 678 438 369 122 21634 362 11464 --
NM_003607chr133788 894 66 33388 1688 1490 23058 1409 33824 3549 1538
NM_003613chr152644 597 137 ----
NM_003615chr331328 1185 492 1466 ----
NM_003617chr174994 4878 4814 4632 3806 3104 1081 34415 3409 1677 24044 62 13186
NM_003618chr2--1906 ----
NM_003620chr171847 --11104 --
NM_003622chr1231942 972 265 ------
NM_003626chr1141395 1019 386 51 ------
NM_003629chr142369 2231 1099 36 ----22587 615
NM_003630chr6--1135 --1163
NM_003633chr532190 1753 352 ------
NM_003654chr112497 105 ------
NM_003659chr211199 1238 ----
NM_003663chr363248 2781 2738 2670 812 756 ----12833
NM_003664chr52539 160 ------
NM_003668chr12196 ------
NM_003672chr151514 1381 1349 631 102 ------
NM_003677chr122796 293 ------
NM_003679chr163257 2873 2420 2255 647 177 12762 1139 12455
NM_003688chrX1236 ------
NM_003702chr83843 805 245 --189 --
NM_003705chr23765 320 304 --1716 --
NM_003711chr5----178 --
NM_003713chr111733 11375 ----
NM_003714chr532357 2265 611 11021 12482 12743
NM_003716chr32975 902 1747 ----
NM_003718chr71213 1525 ----
NM_003725chr121306 ------
NM_003735chr52627 320 ------
NM_003736chr52627 320 ------
NM_003737chr111416 ------
NM_003743chr271860 1800 1758 1661 1598 533 120 189 --11623
NM_003744chr142298 23 11257 ----
NM_003749chr132802 651 12032 ----
NM_003750chr102758 675 ------
NM_003758chr152113 27 1510 ----
NM_003758chr152113 27 1510 ----
NM_003759chr454283 3069 3035 1205 333 34151 3810 234 14088 --
NM_003762chr1--11457 1948 --
NM_003763chr2052509 2187 1975 722 480 22349 1028 11127 --
NM_003768chr11364 ------
NM_003772chr112879 125 1398 ----
NM_003783chr11303 ------
NM_003787chr1811630 ------
NM_003790chr11211 ------
NM_003794chr311045 --1959 2808 786
NM_003795chr61483 --1627 --
NM_003797chr11165 ------
NM_003799chr18104456 3014 2880 1341 1177 561 431 408 390 64 33669 3025 1242 ----
NM_003800chr632018 1745 487 1216 --11975
NM_003816chr821076 216 21408 1092 ----
NM_003821chr8151 ------
NM_003825chr1521500 981 ------
NM_003829chr921204 203 21022 1001 ----
NM_003831chr1831734 1230 413 21601 204 ----
NM_003838chr121602 318 ----1572
NM_003846chr11511 --2706 302 --
NM_003850chr131152 ------
NM_003858chr142682 611 ------
NM_003861chr1432706 2443 628 1418 11048 11116
NM_003870chr1511395 --22104 604 --
NM_003872chr272662 2008 1159 611 597 483 268 11217 ----
NM_003873chr1022134 278 21916 1856 --1444
NM_003877chr12----141 --
NM_003884chr351704 1603 1556 1225 641 ------
NM_003885chr1742207 1951 503 41 ------
NM_003887chr232043 1700 209 --1701 --
NM_003888chr1531758 1331 521 1508 1274 --
NM_003895chr2141670 1526 381 345 11658 ----
NM_003899chr1362472 2419 2392 2305 2135 2100 1245 ----
NM_003901chr1032043 1002 265 32707 1845 388 12300 --
NM_003908chr2021352 1030 ------
NM_003909chr882450 2309 1091 521 185 98 66 46 ------
NM_003913chr674305 3947 2911 2638 1294 554 282 13546 --13485
NM_003916chrX21277 1009 ----2415 37
NM_003919chr72191 64 ------
NM_003921chr141423 590 346 295 --11494 --
NM_003922chr151283 ------
NM_003924chr411227 1178 11138 --
NM_003931chr6--1168 ----
NM_003932chr2271762 1677 1610 1594 1169 457 165 ------
NM_003934chr931038 507 483 1296 21318 1103 --
NM_003939chr1063503 1546 1335 1229 1185 63 11099 33326 1050 986 --
NM_003941chr722347 914 12452 ----
NM_003947chr331310 430 402 1982 --11149
NM_003948chr462281 1051 633 129 109 53 11001 ----
NM_003953chr172888 2788 2230 1961 1913 1805 420 ------
NM_003958chr683877 3276 3232 2674 2511 1319 757 22 1446 23812 3068 --
NM_003966chr5107714 7630 7071 7025 6609 6213 2329 1369 1036 550 36094 1985 107 --37616 1284 118
NM_003968chr31189 ------
NM_003971chr173474 120 37 ------
NM_003972chr1021297 46 11316 ----
NM_003983chr1634454 890 449 32895 1110 1010 ----
NM_003993chr11281 --129 --
NM_003994chr1253932 3247 3012 989 120 42941 2802 1553 941 ----
NM_003995chr91231 ------
NM_003998chr43594 239 206 ------
NM_004004chr1331331 902 323 --192 --
NM_004006chrX52597 2375 2129 358 340 1673 --12669
NM_004007chrX52597 2375 2129 358 340 1673 --12669
NM_004009chrX52597 2375 2129 358 340 1673 --12669
NM_004010chrX52597 2375 2129 358 340 1673 --12669
NM_004011chrX52597 2375 2129 358 340 1673 --12669
NM_004012chrX52597 2375 2129 358 340 1673 --12669
NM_004013chrX52597 2375 2129 358 340 1673 --12669
NM_004014chrX52597 2375 2129 358 340 1673 --12669
NM_004015chrX52597 2375 2129 358 340 1673 --12669
NM_004016chrX52511 2289 2043 272 254 1587 --12583
NM_004017chrX52597 2375 2129 358 340 1673 --12669
NM_004018chrX52511 2289 2043 272 254 1587 --12583
NM_004020chrX52597 2375 2129 358 340 1673 --12669
NM_004021chrX52511 2289 2043 272 254 1587 --12583
NM_004022chrX52511 2289 2043 272 254 1587 --12583
NM_004023chrX52511 2289 2043 272 254 1587 --12583
NM_004028chr1823676 1240 33714 1383 600 14119 --
NM_004050chr14--22390 1060 ----
NM_004067chr72272 72 ------
NM_004071chr21239 ------
NM_004074chr11173 ------
NM_004077chr1241229 1093 874 291 ------
NM_004080chr721207 272 31219 559 83 1193 11407
NM_004087chr31721 --154 --
NM_004093chr1352599 2112 2038 1169 265 --1413 --
NM_004094chr1462995 958 805 460 284 208 1230 ----
NM_004096chr1061501 1441 1320 716 692 182 --1805 --
NM_004097chr21628 --1302 --
NM_004100chr642382 1986 1832 674 ------
NM_004105chr261031 911 159 101 94 29 ------
NM_004113chr341597 534 469 67 ------
NM_004114chrX1217 ------
NM_004117chr632112 1437 498 21478 274 ----
NM_004124chr1493127 2738 2376 2184 1389 700 535 516 167 33248 1334 1101 --1643
NM_004130chr3163 1482 ----
NM_004132chr103810 369 170 11142 ----
NM_004136chr1542830 2672 2335 964 23095 113 ----
NM_004156chr81172 ------
NM_004162chr33464 323 71 ------
NM_004170chr941408 506 454 42 21882 58 ----
NM_004171chr11169662 9379 8716 8238 8202 8087 7971 7308 7060 6539 6413 3751 3711 2375 1052 644 49571 8410 3139 970 16609 --
NM_004172chr531928 773 102 3586 217 67 ----
NM_004180chr22530 504 ------
NM_004200chr1182899 2840 2796 1060 914 849 778 221 11144 12274 --
NM_004208chrX169 ------
NM_004215chr8--1564 ----
NM_004229chrX72082 1924 1871 1554 666 597 175 2580 220 --11444
NM_004232chr1863880 3035 2847 1315 861 673 43247 1482 1394 345 122 --
NM_004235chr92636 138 ------
NM_004236chr152459 167 ------
NM_004237chr53746 209 78 1833 ----
NM_004249chr41106 ------
NM_004253chr93949 270 121 ------
NM_004261chr13985 817 220 1887 ----
NM_004267chr31375 ----1171
NM_004272chr51546 --11260 --
NM_004274chr1433031 2885 1056 135 --1617
NM_004277chr62243 60 --11224 1365
NM_004279chr752117 742 534 363 304 1923 ----
NM_004280chr6--1313 ----
NM_004281chr10--1414 --170
NM_004293chr953674 3143 2972 2457 219 --152 1594
NM_004296chr1472868 2777 1601 781 579 511 438 ------
NM_004301chr3183 ------
NM_004302chr1241796 1110 742 298 1870 12164 --
NM_004327chr2271997 1898 1739 874 480 407 256 ------
NM_004330chr1531149 283 75 --1304 --
NM_004331chr872213 1732 1706 622 388 315 175 1767 ----
NM_004338chr18106918 6731 6314 5951 5907 5594 5461 4405 2644 940 26649 2433 25289 869 --
NM_004342chr72355 278 1483 ----
NM_004346chr451492 1421 1019 493 426 11382 ----
NM_004349chr821222 154 ------
NM_004352chr163220 173 128 ------
NM_004354chr43823 776 574 ------
NM_004360chr1632008 1444 706 ------
NM_004363chr1931105 171 67 2337 27 ----
NM_004365chr5--145 --1126
NM_004370chr662196 1876 1838 818 560 525 ----1224
NM_004378chr151207 ------
NM_004379chr231779 1622 95 ------
NM_004380chr1632216 860 67 --1516 --
NM_004384chr562247 2123 1604 1543 334 70 ------
NM_004385chr51276 2577 36 1224 --
NM_004386chr1952264 1943 1705 815 592 ------
NM_004389chr21856 ------
NM_004392chr1342431 1703 1000 366 ------
NM_004393chr31841 --21813 1501 --
NM_004397chr1153775 3567 1556 491 93 24318 3320 23704 3220 21488 392
NM_004405chr21847 2943 138 1231 --
NM_004408chr91516 ------
NM_004411chr7157 --1202 --
NM_004419chr10--2301 73 ----
NM_004423chr342389 2228 1673 765 22556 744 1664 --
NM_004426chr1251974 1813 1645 707 321 1242 1589 --
NM_004428chr11694 ------
NM_004429chrX1541 ------
NM_004430chr842654 983 389 256 12597 ----
NM_004432chr952069 1723 912 658 304 ------
NM_004438chr233308 2544 1056 ------
NM_004440chr621618 571 ------
NM_004441chr31168 11040 1118 --
NM_004442chr111115 ------
NM_004446chr1162 ------
NM_004449chr2131396 1201 1083 --1928 --
NM_004454chr3--1490 ----
NM_004457chr21531 ------
NM_004458chrX12228 11868 --11042
NM_004459chr172763 497 12055 --11880
NM_004475chr1761054 953 387 239 142 106 ------
NM_004480chr14--163 ----
NM_004481chr132504 912 666 12373 ----
NM_004482chr21123 ------
NM_004492chr15132 ------
NM_004498chr151332 ------
NM_004499chr51392 ----1119
NM_004500chr1432048 1320 96 ------
NM_004501chr183583 3572 3151 1337 898 769 735 355 --1973 --
NM_004503chr121580 ------
NM_004504chr292995 2985 2684 2437 1235 934 813 705 53 --13049 --
NM_004506chr62475 227 ------
NM_004514chr174925 638 629 482 1683 22262 1132 1468
NM_004516chr1921048 367 ------
NM_004520chr52753 218 2684 138 ----
NM_004529chr941452 1411 1058 184 --1338 --
NM_004561chr1151772 1406 1263 646 198 ------
NM_004569chr141642 ----1131
NM_004575chr431142 527 481 ------
NM_004578chr13915 85 32 ------
NM_004583chr171772 ------
NM_004586chrX125040 4724 4209 3383 3376 1988 1593 1516 1315 1145 486 75 23635 3334 ----
NM_004588chr1194072 3997 3669 3055 2919 2888 2594 1226 37 23755 1399 1149 --
NM_004593chr31172 ------
NM_004594chr161972 ----1839
NM_004598chr582913 2117 1096 999 990 728 70 64 --13323 --
NM_004599chr222704 505 --163 --
NM_004600chr121322 507 ------
NM_004603chr721194 198 1807 ----
NM_004606chrX191 ------
NM_004612chr931792 930 327 ------
NM_004614chr1642459 742 677 135 1348 2649 163 --
NM_004615chrX----1668 --
NM_004627chr213694 667 277 ------
NM_004631chr131253 1219 399 ------
NM_004634chr32564 99 ------
NM_004637chr341172 861 539 162 ------
NM_004640chr62211 150 ------
NM_004642chr124492 192 62 32 --1686 --
NM_004654chrY2548 437 ------
NM_004660chrY31590 1490 266 1556 ----
NM_004663chr1531134 431 43 ------
NM_004670chr1021263 100 1235 ----
NM_004673chr131541 1112 409 21462 1377 ----
NM_004684chr41325 ------
NM_004685chr1321085 990 12921 1182 --
NM_004686chr831338 421 301 1189 1327 1669
NM_004687chr1781891 1768 1577 1524 1454 740 386 118 ----11498
NM_004690chr63660 601 308 ------
NM_004703chr1732235 320 50 ------
NM_004709chrX31307 447 312 11523 11563 --
NM_004713chr14--2587 296 ----
NM_004723chr13921 778 770 ------
NM_004725chr1031452 1186 519 1940 ----
NM_004726chrX54612 3989 2260 1486 1347 24028 2214 ----
NM_004730chr541417 672 525 109 --1446 --
NM_004731chr121503 1391 ----
NM_004734chr1353078 3013 2850 2336 249 ------
NM_004736chr161862 1413 862 366 271 27 --12245 11504
NM_004737chr2221319 120 1292 ----
NM_004742chr3--1121 ----
NM_004744chr442432 1069 1000 895 12598 --11314
NM_004745chr896446 5885 4641 4280 2783 2241 2071 1963 694 35082 4844 1057 11881 --
NM_004748chr1584081 4026 3932 3460 2837 701 555 23 22817 152 ----
NM_004762chr1721373 1272 --21508 758 --
NM_004766chr31179 1254 ----
NM_004768chr13906 829 282 186 ----
NM_004770chr81192 ------
NM_004772chr541476 1467 1016 446 ------
NM_004774chr1742878 2250 1066 438 12924 12320 --
NM_004775chr1832166 2111 957 11755 ----
NM_004776chr2031022 757 279 ----12264
NM_004779chr511220 11099 ----
NM_004781chr121490 95 ------
NM_004781chr121490 95 ------
NM_004787chr41155 ------
NM_004796chr1422413 2140 --1182 --
NM_004798chr2083615 3214 2894 816 525 427 201 37 --12395 1216
NM_004800chr132263 192 ------
NM_004801chr241592 1147 530 276 ----1161
NM_004805chr221001 317 ------
NM_004808chr1043182 3017 2193 824 1992 1389 --
NM_004814chr1--1167 ----
NM_004815chr174365 3448 3422 3408 3092 1977 607 14088 2854 485 --
NM_004818chr121625 --133 --
NM_004824chr621365 389 ------
NM_004830chr62271 175 ------
NM_004831chr192434 34 ----1420
NM_004834chr22801 498 ------
NM_004835chr31818 ------
NM_004835chr31818 ------
NM_004840chrX22051 193 --143 --
NM_004841chr171129 1123 856 850 420 201 53 ------
NM_004842chr631773 1453 364 11684 11571 --
NM_004844chr311169 --11053 --
NM_004845chrX104060 3899 3810 3744 1315 1285 1043 970 882 237 13393 ----
NM_004846chr21119 ------
NM_004850chr241785 1620 1170 332 --1419 --
NM_004857chr14104101 3877 1861 1833 1431 1184 1056 745 539 103 --170 --
NM_004859chr1742922 2795 2322 408 ----11200
NM_004860chr172392 34 ------
NM_004863chr1485104 4768 3919 3568 2005 1626 1175 1045 34562 3472 98 1932 --
NM_004866chr5144912 4206 3528 3465 3359 3277 1647 1152 1057 1023 608 538 508 322 44378 3770 3577 3519 ----
NM_004867chrX2503 103 ------
NM_004869chr1821543 330 1120 ----
NM_004871chr1754376 3210 2944 1112 517 13955 2997 881 --
NM_004879chr111260 ------
NM_004896chr1031384 1287 149 ----1495
NM_004898chr452890 2847 2621 2553 623 21067 881 ----
NM_004902chr203550 533 56 --1623 --
NM_004904chr796558 6524 6413 6322 4437 2406 1824 617 70 34251 1764 430 1562 --
NM_004906chr61556 ------
NM_004912chr711119 1364 ----
NM_004922chr1011001 --11031 --
NM_004926chr14--21635 524 ----
NM_004929chr8141 ------
NM_004930chr12228 143 1687 ----
NM_004932chr511714 1361 ----
NM_004937chr1742540 1775 780 236 21943 285 12669 --
NM_004938chr93458 445 283 2854 176 ----
NM_004947chr362383 786 703 664 233 227 ------
NM_004948chr1851469 1122 1113 525 283 ------
NM_004956chr793680 1836 1517 1429 1045 725 562 437 375 23219 788 11754 11196
NM_004964chr11578 ------
NM_004969chr102511 71 ------
NM_004972chr931165 788 751 11190 1407 --
NM_004973chr61652 11216 ----
NM_004974chr1195 ------
NM_004976chr1175192 5106 4594 3958 1453 1233 633 54096 3985 3941 3931 1020 --14250
NM_004978chr121318 1061 1488 ----
NM_004979chrX2756 475 11111 ----
NM_004982chr121485 1592 --1701
NM_004985chr1284198 4097 3248 1818 1722 1582 662 78 23658 1606 ----
NM_004992chrX98033 7908 7775 6940 6265 6196 2453 1985 1232 38453 1890 1250 11535 12935
NM_004992chrX98033 7908 7775 6940 6265 6196 2453 1985 1232 38453 1890 1250 11535 12935
NM_004993chr1441365 1058 416 293 --1451 --
NM_004996chr1621308 491 --21628 1497 1627
NM_004999chr641753 1605 1538 920 34443 4108 847 --14352
NM_005010chr741666 748 692 30 --1741 --
NM_005011chr71161 ------
NM_005014chr91307 2705 160 ----
NM_005016chr12--1300 ----
NM_005023chr531228 449 317 ------
NM_005028chr1092164 1861 1472 1454 938 595 268 127 97 --1671 --
NM_005032chrX21102 282 --1718 --
NM_005034chr82481 59 ------
NM_005044chrX94591 3890 3746 3414 1274 903 625 576 113 1567 ----
NM_005045chr73726 705 343 ------
NM_005054chr251490 1432 1119 339 145 11424 ----
NM_005056chr1235138 4939 4352 --24211 104 --
NM_005057chr141408 732 368 361 11573 ----
NM_005063chr1053513 3261 3225 2947 973 --11022 --
NM_005065chr14115320 4837 4007 2065 1711 1388 1365 1122 912 366 66 33709 3280 3267 1942 --
NM_005066chr12770 75 --1762 --
NM_005078chr1511561 ------
NM_005079chr822745 62 23103 694 ----
NM_005080chr222734 228 ----1191
NM_005087chr31772 ------
NM_005088chrX2889 177 ------
NM_005093chr2094770 4178 4055 1710 919 899 849 455 322 23311 1907 1955 --
NM_005095chr152076 1917 1680 1519 227 ----11465
NM_005096chrX31025 1009 26 ------
NM_005097chr101259 ------
NM_005109chr32416 406 --21783 51 --
NM_005110chr51719 ------
NM_005112chr44639 410 147 72 ------
NM_005113chr141504 ------
NM_005114chr44645 513 192 84 ------
NM_005116chr20124276 4026 3584 3361 2933 1568 1028 882 842 771 186 44 24206 741 ----
NM_005119chr121225 1131 1357 ----
NM_005121chr1773510 2614 1137 945 818 803 410 --1434 --
NM_005126chr362174 2149 2053 1481 1443 129 1704 22260 195 --
NM_005128chr21----1507 --
NM_005134chr181306 ------
NM_005151chr182295 58 32432 2305 1569 ----
NM_005155chr61721 1580 ----
NM_005156chr995340 4880 4866 4726 4719 3781 1374 1135 351 11723 ----
NM_005157chr941903 1327 600 217 --31801 1787 519 --
NM_005159chr1542140 1761 1509 84 ------
NM_005160chr22136617 6606 5739 5576 5250 5230 4703 4451 1919 1911 1127 1040 78 45925 1535 836 303 12007 25147 1797
NM_005168chr261680 1520 1265 465 326 140 --11172 --
NM_005171chr121360 ----11119
NM_005178chr193389 263 109 ------
NM_005180chr1011132 11449 ----
NM_005181chr82250 231 ------
NM_005182chr16139 --1564 --
NM_005184chr191209 21297 364 ----
NM_005188chr11138279 7224 5200 3092 3023 2420 2272 2249 2085 1797 1768 1356 214 57849 6843 6040 3017 2449 ----
NM_005190chr61721 1251 ----
NM_005191chr331158 558 120 11174 ----
NM_005197chr1476085 5743 5560 5241 5159 4481 551 1651 ----
NM_005202chr122092 831 12154 ----
NM_005203chr10------1102
NM_005204chr102799 209 ------
NM_005206chr1731294 979 400 ------
NM_005215chr183730 583 237 ------
NM_005219chr521691 1602 1313 ----
NM_005220chr1741479 1456 1430 313 ------
NM_005222chr72906 69 ----1305
NM_005227chr12547 517 ------
NM_005230chr122398 155 ------
NM_005231chr1141340 1274 1131 1100 ------
NM_005233chr322382 2295 ----12065
NM_005235chr2107293 7248 7075 6812 6785 6407 5624 2159 1522 221 36920 6895 5927 ----
NM_005238chr1113035 12356 --11349
NM_005239chr2121831 1302 21330 441 ----
NM_005241chr3----1294 --
NM_005242chr521374 1266 ------
NM_005245chr43543 206 156 1526 ----
NM_005249chr143288 240 109 1265 ----
NM_005252chr14182 ------
NM_005254chr15--11410 ----
NM_005256chr111792 ------
NM_005257chr1851426 1013 994 454 328 ------
NM_005259chr231421 948 173 21367 1033 ----
NM_005275chr6236 22 ------
NM_005277chr41478 --11434 --
NM_005296chrX2885 268 ------
NM_005308chr101453 ------
NM_005312chr91294 32671 1838 937 22656 2577 --
NM_005316chr112949 859 ------
NM_005324chr1751644 676 513 122 101 1801 11976 --
NM_005327chr43576 219 126 ------
NM_005329chr1662398 2230 1984 1850 1725 253 ------
NM_005334chrX21085 703 ------
NM_005339chr422972 504 11205 13633 --
NM_005342chrX42289 324 305 65 22295 605 ----
NM_005358chr1351722 1668 732 708 411 11815 1245 --
NM_005359chr1875053 4520 4387 4359 4160 1948 1116 --12461 --
NM_005373chr121503 1435 1212 11401 --
NM_005375chr63984 846 145 ------
NM_005378chr2------1856
NM_005382chr81370 ------
NM_005384chr9128 1104 ----
NM_005386chr201567 --154 --
NM_005387chr111150 --1712 --
NM_005388chr931502 397 253 ------
NM_005389chr61590 1100 ----
NM_005391chrX132 ------
NM_005392chr951778 1477 713 141 127 --1616 --
NM_005397chr753981 2517 2500 927 583 33259 1257 1157 --21457 834
NM_005398chr1021145 970 ------
NM_005399chr163572 3111 2776 2763 986 153 1568 34166 53 42 --
NM_005400chr232169 1918 1152 12187 ----
NM_005402chr721593 1586 ------
NM_005407chr142999 986 ------
NM_005409chr42413 38 --1349 --
NM_005410chr53587 60 52 ------
NM_005413chr21415 ------
NM_005417chr20--21601 662 11483 --
NM_005430chr121138 --1945 --
NM_005431chr742137 1981 1357 1332 21533 695 ----
NM_005433chr183851 465 305 ------
NM_005436chr1063808 3732 3532 3203 1418 1343 21205 1066 ----
NM_005443chr41201 --176 --
NM_005455chr12407 282 31792 357 126 ----
NM_005456chr112735 695 ------
NM_005458chr932341 2314 2124 11757 ----
NM_005460chr51519 ------
NM_005465chr171997 1629 1594 1427 567 336 33 --1791 1215
NM_005475chr1273179 3073 2889 2285 2260 1200 1032 ------
NM_005477chr1532449 804 507 ------
NM_005477chr1532449 804 507 ------
NM_005479chr1021586 509 --1300 --
NM_005493chr61197 ------
NM_005494chr71471 ------
NM_005497chr1754333 3729 2460 2288 1405 23798 2025 --25768 1420
NM_005502chr932375 2107 2097 --12565 1940
NM_005504chr12106187 5714 5601 4217 2437 2269 2245 1775 416 71 25025 4248 35956 2181 601 --
NM_005509chr541822 1363 614 481 2625 420 1308 --
NM_005511chr91117 1898 ----
NM_005517chr121186 508 1550 ----
NM_005522chr721031 352 11203 136 --
NM_005524chr31256 ------
NM_005537chr131212 ------
NM_005539chr1011052 ------
NM_005544chr23720 357 273 2372 150 ----
NM_005545chr151657 --1719 --
NM_005561chr132141 132 --1765 --
NM_005563chr1----1245 --
NM_005566chr11--125 ----
NM_005574chr11151 --3546 62 21 --
NM_005575chr53869 712 163 ------
NM_005578chr344107 3909 750 421 34339 894 180 13345 14386
NM_005589chr141447 ------
NM_005593chr121524 1565 ----
NM_005596chr956044 5496 4550 1798 1576 42535 1683 509 40 --14321
NM_005602chr361294 1258 1180 173 164 139 ------
NM_005604chr621964 681 ------
NM_005605chr82199 112 ------
NM_005607chr81874 1350 ----
NM_005611chr1631340 526 61 ------
NM_005613chr111957 --11360 12207
NM_005627chr62232 114 194 ----
NM_005637chr182209 31 ------
NM_005638chrX41246 1207 1176 97 1403 11195 --
NM_005639chr1251763 1729 1673 55 26 1504 ----
NM_005647chrX63313 2725 2355 2324 2224 130 --11277 --
NM_005649chr51396 ------
NM_005651chr41299 1287 ----
NM_005652chr164872 456 382 171 ------
NM_005655chr82469 204 ------
NM_005660chrX2252 214 ------
NM_005665chr133464 3286 1129 14596 ----
NM_005667chr2137 ------
NM_005668chr554198 4097 3828 1543 1325 23005 2927 ----
NM_005686chr131544 492 322 11606 ----
NM_005708chr13132 ------
NM_005711chr521044 1024 11063 150 --
NM_005716chr193615 546 497 ------
NM_005717chr1195 1236 ----
NM_005721chr221080 714 ------
NM_005722chr242429 2105 1957 264 --1454 --
NM_005725chr151889 1824 1804 1582 965 ------
NM_005730chr1263445 2976 2288 1051 953 539 ------
NM_005731chr21386 ------
NM_005737chr252589 2250 1851 904 785 --1464 --
NM_005738chr721813 347 ------
NM_005739chr153863 282 50 1728 1300 12201
NM_005742chr22830 765 ----1171
NM_005746chr752356 2255 2143 1952 178 ------
NM_005748chr1272774 2634 2318 1159 1070 796 184 ----12417
NM_005749chr17--1471 ----
NM_005754chr551130 1050 1030 321 77 ------
NM_005756chrX21437 195 11342 ----
NM_005766chr1341012 401 279 171 ------
NM_005775chr83273 219 117 ------
NM_005776chr141683 ------
NM_005779chr523337 266 --1391 11306
NM_005786chr18----21117 415 1470
NM_005789chr1732171 2145 1454 ------
NM_005795chr272846 2610 2523 2150 1042 823 470 1726 ----
NM_005802chr92808 774 ------
NM_005808chr363081 2946 1334 705 463 216 ------
NM_005813chr22830 309 11751 ----
NM_005819chr113449 --32602 484 357 --
NM_005822chr62492 32 --12255 --
NM_005826chr12105 93 ------
NM_005832chr311224 --1972 --
NM_005836chr8--167 ----
NM_005839chr11285 ------
NM_005840chrX147564 7498 6961 6864 5697 5310 3068 2917 2819 1944 1586 1572 189 69 1639 15810 --
NM_005842chr13------1677
NM_005843chr231248 750 552 21743 1526 --1395
NM_005857chr161259 1222 1143 953 170 31 ------
NM_005862chr32810 784 ------
NM_005871chr103944 157 26 ------
NM_005880chr165599 441 282 189 147 11255 ----
NM_005885chr53657 605 272 --11070 --
NM_005898chr1153154 1240 1228 1146 223 12562 --1471
NM_005900chr4--11076 ----
NM_005903chr554977 4081 3933 2004 667 --14165 --
NM_005904chr1811050 1324 ----
NM_005906chr621499 176 ------
NM_005907chr631646 1495 248 1614 ----
NM_005908chr41125 --147 --
NM_005909chr54821 520 309 246 1679 13775 --
NM_005910chr1743785 673 281 206 14050 22980 1075 --
NM_005911chr21512 ------
NM_005924chr72977 779 --1126 --
NM_005933chr1152951 2565 1861 1852 473 22974 660 ----
NM_005935chr4115265 4160 3411 3349 3295 2087 1721 1513 813 797 296 23758 385 --13600
NM_005937chr1734105 2713 2596 33657 3025 748 12620 --
NM_005938chrX11345 ------
NM_005941chr853604 1513 759 373 203 34165 3822 3201 --11563
NM_005943chr621315 55 --1598 --
NM_005955chr154231 3980 1582 1043 927 11236 14647 --
NM_005962chr1042206 1734 943 889 1570 ----
NM_005962chr1042206 1734 943 889 1570 ----
NM_005964chr173996 492 240 ------
NM_005966chr212313 11849 12023 --
NM_005968chr19----1214 --
NM_005986chr1342378 1032 600 439 12666 1609 12491
NM_005999chr151475 1226 1198 1154 174 ------
NM_006007chr953094 2902 1643 848 824 13515 1871 --
NM_006011chr1573759 2902 1589 1264 1103 275 36 ------
NM_006015chr1--1386 ----
NM_006016chr642252 2090 1543 868 21525 434 --1627
NM_006022chr131141 195 ----
NM_006036chr252445 1827 782 703 402 1158 ----
NM_006037chr2104325 4103 3853 3436 3225 3048 1465 1223 855 471 --11021 --
NM_006038chr2031893 1812 616 21837 178 --12087
NM_006040chr1641390 919 411 219 ------
NM_006047chr2022631 2396 12228 ----
NM_006055chr273016 2818 2722 2493 2486 1096 219 11981 11159 --
NM_006070chr31112 1322 ----
NM_006076chr71991 --22054 87 --
NM_006079chr6--1677 --187
NM_006080chr743019 2214 2047 1037 12767 --12924
NM_006088chr91143 ------
NM_006089chrX2483 233 ------
NM_006094chr832376 1967 952 ----11927
NM_006095chr4103573 3482 1652 1300 1276 678 499 258 193 123 ------
NM_006106chr1153257 1040 871 701 388 ------
NM_006107chr17----1461 --
NM_006113chr121968 1415 --1105 11902
NM_006134chr2141545 631 290 63 ----11156
NM_006135chr131370 1261 961 ----1528
NM_006136chr71513 ------
NM_006141chr1612515 --2620 569 --
NM_006145chr191730 ------
NM_006148chr1722824 2359 12774 ----
NM_006152chr12149 ------
NM_006154chr1592504 2396 2264 2147 995 430 345 193 138 11866 --12724
NM_006158chr831678 1355 187 --11652 --
NM_006164chr21396 ------
NM_006166chr1262568 2147 1750 1638 499 98 ------
NM_006180chr941833 225 207 66 11878 ----
NM_006186chr22218 119 1432 ----
NM_006190chr2--1810 ----
NM_006194chr1411324 1868 ----
NM_006195chr9--11151 1969 --
NM_006197chr83639 316 135 ------
NM_006203chr595146 3730 3539 3506 2104 2052 1918 893 208 52195 1406 1218 1194 1159 11121 --
NM_006206chr432383 2272 542 ----1221
NM_006207chr81284 ------
NM_006216chr21664 --171 --
NM_006218chr31284 ------
NM_006224chr1741689 1660 296 271 ----11673
NM_006226chr221358 1144 133 ----
NM_006237chr1331862 115 51 ------
NM_006243chr121064 969 ------
NM_006246chr143516 499 443 11083 ----
NM_006251chr543192 1132 1099 450 ------
NM_006252chr1107010 6748 6724 6293 6042 5462 4972 3007 2858 1766 32407 317 170 12559 27479 827
NM_006255chr1421135 252 ------
NM_006256chr131088 1073 717 --22586 1992 --
NM_006258chr1011058 ------
NM_006264chr4133 1567 127 --
NM_006265chr82497 170 ------
NM_006267chr221836 1740 11767 ----
NM_006281chr851130 1108 939 886 176 ------
NM_006281chr851130 1108 939 886 176 ------
NM_006282chr20114339 4323 3864 3098 2918 1897 1516 752 563 174 101 24040 211 1422 --
NM_006283chr884439 4152 3856 1921 1677 1199 313 35 13600 24635 3668 --
NM_006293chr1511008 ------
NM_006298chr681280 1067 966 675 628 540 369 208 ------
NM_006310chr172433 380 ------
NM_006313chr1251499 1476 1084 510 49 11306 ----
NM_006315chr494488 4328 4278 3696 3601 2869 2835 2799 1645 ----11134
NM_006317chr54308 112 87 75 ------
NM_006322chr132335 191 ------
NM_006323chr42246 93 ------
NM_006327chr101256 ------
NM_006330chr821024 150 --11405 --
NM_006334chr92220 97 ------
NM_006335chr131034 315 213 ------
NM_006345chr431050 888 324 ------
NM_006350chr51269 ----1132
NM_006352chr121720 1477 ------
NM_006357chr2--1510 143 --
NM_006359chrX52251 2050 2012 1544 533 --12219 --
NM_006366chr61167 ------
NM_006367chr121041 283 ------
NM_006373chr1741008 947 559 352 ----183
NM_006375chrX--11471 11652 --
NM_006377chr92333 271 --11227 --
NM_006379chr741824 603 488 157 ------
NM_006380chr1743961 3783 1686 693 11161 ----
NM_006386chr2262454 1924 1635 764 578 442 11696 --1758
NM_006390chr1231253 480 40 1313 ----
NM_006393chr1094302 3622 3333 3094 1803 1158 758 596 182 1962 1626 --
NM_006401chr91332 ------
NM_006403chr631369 370 221 31766 1173 557 --1311
NM_006411chr64898 659 277 39 1738 ----
NM_006416chr61669 ------
NM_006417chr12231 86 ------
NM_006420chr2083311 2976 2199 2151 2118 235 70 55 22905 822 22669 104 12624
NM_006421chr8128 ------
NM_006424chr421557 338 ------
NM_006431chr121209 ------
NM_006449chr2------22086 1561
NM_006454chr453111 2190 1243 943 635 22724 2022 11939 --
NM_006457chr4113946 3835 3394 3267 3021 2989 2773 1642 928 636 194 1277 12701 --
NM_006460chr172448 277 ------
NM_006465chr1561823 1766 1694 889 656 354 22193 79 ----
NM_006469chr1--1275 --11254
NM_006471chr18----196 --
NM_006475chr132483 245 ------
NM_006476chr112567 505 --1696 --
NM_006482chr12103570 3184 3061 2975 2905 2853 2452 837 312 118 22446 898 12521 --
NM_006489chr1421846 1764 21674 1481 11994 --
NM_006496chr131606 1531 476 ----11542
NM_006504chr1072682 2381 1906 1025 1008 919 439 --12021 --
NM_006510chr62864 394 --162 --
NM_006513chr1136 --1223 --
NM_006516chr121453 528 11406 11101 --
NM_006517chrX31967 1548 65 2772 755 --1117
NM_006519chr6--1236 ----
NM_006526chr2031903 816 672 ----1694
NM_006534chr2062951 2873 2646 2275 1263 94 ------
NM_006536chr12960 953 ------
NM_006537chr15147 ------
NM_006538chr294062 3628 3579 1171 907 884 844 724 694 11415 ----
NM_006540chr81994 --1595 --
NM_006541chr101202 ------
NM_006544chr1445794 4276 1530 1313 --11071 --
NM_006546chr1776104 4593 4555 1202 722 575 391 25555 2418 --12172
NM_006547chr752012 1996 1913 825 551 ------
NM_006548chr331383 1159 386 ------
NM_006549chr1282858 2439 2227 2019 696 424 261 123 ------
NM_006554chr22247 129 ------
NM_006557chr91306 ----11739
NM_006559chr1--1462 161 --
NM_006561chr1065885 5352 4914 4031 1537 51 12045 11947 199
NM_006565chr1621162 793 ----161
NM_006566chr182872 356 ------
NM_006570chr93374 304 129 ------
NM_006575chr1441347 1209 508 181 ----11309
NM_006582chr1182 ------
NM_006595chr1152019 1395 1313 1283 333 11738 ----
NM_006599chr16118173 6852 6578 5377 5319 5147 3221 2510 2187 2131 196 37130 5882 5269 37061 2571 936 --
NM_006601chr121233 1303 ----
NM_006602chr201271 1230 ----
NM_006603chrX41981 1369 1350 327 ------
NM_006608chr11433 ------
NM_006609chr231180 1159 963 --12309 --
NM_006614chr353297 2885 1275 822 253 ------
NM_006618chr111327 ------
NM_006620chr653655 3146 2948 1504 288 1805 11142 13791
NM_006621chr12381 276 1136 11352 --
NM_006624chr1032088 1857 250 21555 734 ----
NM_006625chr12473 171 ------
NM_006625chr12473 171 ------
NM_006625chr12473 171 ------
NM_006626chr932241 1852 74 1205 ----
NM_006628chr1522872 1815 34282 2854 330 21856 495 --
NM_006629chr1832578 2027 902 --11793 --
NM_006633chr51752 ------
NM_006636chr21804 --1331 --
NM_006644chr132689 460 1677 ----
NM_006646chr1342945 2937 657 255 22768 2474 ----
NM_006648chr91117 ------
NM_006650chr531373 1057 557 11011 ----
NM_006654chr1274059 4040 4016 3030 971 819 76 1656 1137 13330
NM_006675chr1243356 2949 549 228 --1474 --
NM_006690chr2022368 897 ----12312
NM_006699chr122568 2529 21684 606 ----
NM_006706chr53332 127 28 ------
NM_006710chr23921 419 29 ------
NM_006717chr9123311 3238 2916 2857 2426 2415 2364 2088 2061 397 391 177 ------
NM_006720chr1044269 3531 3505 3343 ----11432
NM_006721chr101333 2255 176 ----
NM_006722chr333075 1087 235 12506 12330 1991
NM_006726chr441198 906 334 324 ------
NM_006727chr5187 1486 ----
NM_006729chrX125602 4467 4311 4259 4194 4119 3682 1678 1131 1035 146 54 25580 569 44868 3830 465 106 1637
NM_006732chr1942077 1952 1749 538 11387 11500 --
NM_006734chr651441 619 319 279 27 11330 ----
NM_006735chr71288 ------
NM_006750chr16117175 7053 6946 6666 6012 5845 5445 4888 2954 2572 921 32262 587 241 1985 16692
NM_006751chr21900 1251 ----
NM_006754chr721200 313 ------
NM_006756chr831353 604 580 ------
NM_006766chr842342 1912 1793 466 22333 423 12584 --
NM_006769chr12262 158 137 1525 --
NM_006772chr631717 529 161 ------
NM_006775chr643015 2077 991 288 12329 ----
NM_006777chrX42685 2175 893 204 1344 ----
NM_006788chr18------22034 54
NM_006791chr152491 63 1196 ----
NM_006803chr8145 --11716 --
NM_006807chr1721259 382 --1339 --
NM_006808chr9153 ------
NM_006811chr201403 ------
NM_006814chr2032372 892 344 12563 ----
NM_006815chr1211368 1855 ----
NM_006823chr85462 398 322 68 57 ------
NM_006825chr121200 --2952 611 --
NM_006826chr241245 522 283 53 1231 11205 --
NM_006827chr1463309 2787 2081 831 530 295 22549 849 ----
NM_006832chr1421073 710 ------
NM_006838chr1221596 1566 1452 11834 --
NM_006851chr1242901 2486 1945 176 42595 873 782 101 12450 --
NM_006852chr1752439 2222 2183 1064 449 1731 ----
NM_006854chr741493 1473 510 25 11913 21598 183 --
NM_006856chr1231154 1008 307 169 ----
NM_006868chr1873172 2949 2606 2461 2214 869 259 12509 33148 1956 795 --
NM_006870chr205796 554 335 318 116 --2809 654 --
NM_006873chr273580 2864 2243 1139 521 369 359 12303 ----
NM_006874chr431208 862 394 ------
NM_006884chr321563 1543 21897 1550 1150 --
NM_006885chr1633506 1309 1151 13327 ----
NM_006886chr20134 ------
NM_006888chr1443548 3532 3094 1101 --1711 --
NM_006892chr2031020 970 963 ----11157
NM_006892chr2031020 970 963 ----11157
NM_006896chr741079 936 846 48 ------
NM_006898chr21734 1571 ----
NM_006901chr151364 ------
NM_006912chr121656 962 1724 ----
NM_006915chrX1580 22371 2041 ----
NM_006920chr221812 413 ----1364
NM_006922chr242358 2333 2322 863 --1385 12015
NM_006924chr1764196 2962 2780 2705 1363 1302 1423 ----
NM_006930chr541403 1243 653 164 11978 ----
NM_006931chr1212094 31974 1602 243 ----
NM_006937chr173577 196 132 ------
NM_006940chr122707 569 21860 1754 --11483
NM_006943chr2033342 3144 99 23185 2206 ----
NM_006948chr2121663 775 21957 1819 ----
NM_006951chr102779 265 1693 ----
NM_006963chr1021207 199 ------
NM_006965chr1841025 915 482 435 ------
NM_006981chr9187 22679 2321 ----
NM_006991chr32721 252 ------
NM_006996chr151768 1189 578 450 354 --1105 --
NM_006997chr101399 ------
NM_006999chr551921 1881 607 347 165 --11375 --
NM_007005chr92554 85 ------
NM_007006chr1623276 103 33557 3099 2302 ----
NM_007007chr1294742 4282 4073 3954 3072 1799 1715 1651 1556 ------
NM_007008chr2133 1193 1317 --
NM_007011chr15135844 5807 5735 5659 4323 2694 2644 1568 921 780 576 270 81 11809 26466 4702 --
NM_007013chr82951 35 ------
NM_007015chr131283 ------
NM_007017chr52830 298 1620 ----
NM_007019chr201172 ------
NM_007023chr241099 420 261 246 1730 ----
NM_007033chr161934 1674 1638 1476 1392 654 1520 --11965
NM_007034chr11217 --11026 --
NM_007035chr121608 --1684 --
NM_007036chr52820 651 ------
NM_007038chr2175614 5486 5109 4920 1036 677 637 45299 4078 1729 935 16051 --
NM_007040chr193824 689 184 ------
NM_007042chr372488 2443 1941 1703 1652 995 320 32558 735 396 --11751
NM_007043chr1232071 285 32 11987 ----
NM_007045chr61228 ----1118
NM_007052chrX246 31 ------
NM_007064chr331709 642 301 192 --11341
NM_007067chr1741369 1127 518 72 ----11004
NM_007078chr1052637 2484 1221 934 170 42976 2222 2172 954 ----
NM_007084chr13--1222 11194 --
NM_007106chr1362693 2546 1791 1725 419 145 --1751 --
NM_007111chr13----1872 --
NM_007114chr3113014 3000 2823 2814 2592 2211 1312 1139 980 349 42 ------
NM_007124chr631617 1263 757 --1733 --
NM_007125chrY1378 ------
NM_007129chr1311026 ------
NM_007137chrX74268 4033 3905 2170 2062 1859 708 21748 133 35521 5253 773 23645 2086
NM_007144chr1721010 490 --11295 --
NM_007145chr1931325 1295 451 ------
NM_007146chr1752138 2082 1081 521 135 ----1507
NM_007152chr11145 ------
NM_007157chrX81991 1971 1095 837 781 575 298 92 12060 ----
NM_007158chr12270 75 ------
NM_007159chr31161 11523 ----
NM_007166chr1131396 1185 1103 ------
NM_007174chr1262194 2144 1537 804 234 31 ----11953
NM_007175chr853556 3032 2443 834 655 --1700 --
NM_007185chr141001 749 282 217 ------
NM_007187chr132989 268 ------
NM_007191chr121555 ------
NM_007203chr953885 2898 903 75 25 ------
NM_007204chr1----1100 --
NM_007212chr12805 463 22056 553 12290 --
NM_007214chr6----11350 --
NM_007220chrX43158 2989 1204 92 23607 1732 2772 117 --
NM_007231chrX42502 884 573 286 ------
NM_007235chr12--1439 ----
NM_007236chr1542462 1647 795 251 ------
NM_007249chr13229387 9343 8990 8752 8578 7877 7638 7357 7018 6931 6623 6599 6496 5878 5818 5741 5733 2907 1882 1453 1105 845 36036 5781 2892 48601 7726 2359 2118 --
NM_007271chr63635 195 166 ------
NM_007276chr71258 ------
NM_007282chr3------1782
NM_007283chr312252 22928 2411 ----
NM_007285chr163324 109 43 ------
NM_007286chr511927 1778 11939 --
NM_007287chr353091 2511 1273 696 215 --21176 1066 --
NM_007288chr353091 2511 1273 696 215 --21176 1066 --
NM_007289chr353091 2511 1273 696 215 --21176 1066 --
NM_007308chr42148 93 2596 564 2172 116 --
NM_007313chr941903 1327 600 217 --31801 1787 519 --
NM_007315chr251384 1273 1033 593 21 11022 --1199
NM_007320chr191234 ------
NM_007331chr422679 1746 ----1481
NM_007345chr1831924 630 503 22336 1915 11448 --
NM_007349chr71338 --1164 --
NM_007350chr12104293 4201 3461 3197 2992 1527 865 749 356 63 1879 --14640
NM_007358chr131563 1498 188 --1724 --
NM_007361chr141556 --1515 --
NM_007363chrX4981 814 778 334 ------
NM_007372chr171359 1732 ----
NM_007373chr1021215 72 ------
NM_007375chr142452 2406 1725 669 1547 ----
NM_009585chr31818 ------
NM_009585chr31818 ------
NM_012062chr121847 1400 ----
NM_012064chr1221126 1103 --11042 --
NM_012069chrX41762 472 294 127 147 156 --
NM_012081chr522381 739 43596 2822 1230 945 32964 938 168 --
NM_012082chr82393 362 ------
NM_012089chr121232 555 ----11508
NM_012090chr1--21098 391 1365 --
NM_012092chr22398 114 ----1410
NM_012096chr372799 1503 1232 681 602 419 237 1890 ----
NM_012098chr931008 577 369 11085 11474 21172 500
NM_012102chr142444 2152 1883 1778 ------
NM_012104chr1143463 3025 1421 687 22728 707 ----
NM_012104chr1143463 3025 1421 687 22728 707 ----
NM_012117chr12125 ------
NM_012120chr622955 2557 ------
NM_012124chr112209 175 ----1116
NM_012134chr141464 1226 690 169 --11330 --
NM_012137chr152787 2655 2647 1024 948 21951 1793 ----
NM_012141chr1374055 3986 3975 3332 2714 1471 744 ------
NM_012154chr8----1648 --
NM_012156chr2032579 2322 269 13129 32171 471 26 --
NM_012158chr133448 357 212 ------
NM_012161chr431104 125 77 11065 ----
NM_012164chr9137371 7306 7065 6813 6617 6381 5728 5553 2350 1892 1218 280 268 12073 47471 7451 5521 5352 17349
NM_012175chr111690 1757 ----
NM_012193chr1194896 4463 3473 1863 1762 941 703 521 53 14515 11813 --
NM_012199chr154513 3234 1129 921 232 13853 11517 --
NM_012207chr102934 40 ------
NM_012210chr941050 1009 627 143 11137 ----
NM_012214chr275548 5296 4291 2483 1779 132 66 25982 1536 --14662
NM_012215chr1041705 1605 621 372 ------
NM_012219chr362510 2391 2376 2263 1140 83 --13235 --
NM_012223chr231271 1205 831 ----11234
NM_012224chr4142 ------
NM_012229chr1031101 314 176 11271 ----
NM_012234chr363146 2994 2543 1273 767 150 ------
NM_012238chr1041470 1301 518 234 ------
NM_012243chr11176 ----1765
NM_012249chr282901 2270 1276 651 382 344 191 36 11332 ----
NM_012250chr1151231 1073 171 73 47 2499 439 ----
NM_012252chr794574 4341 2117 1608 1205 1159 688 394 388 11960 ----
NM_012255chr20--1418 ----
NM_012257chr721095 785 --1770 --
NM_012259chr631292 1085 1001 147 ----
NM_012262chr1115190 5088 4862 3551 3198 1800 1421 1291 937 345 193 35265 4103 1926 14157 --
NM_012264chr2232039 1614 1373 ------
NM_012264chr2232039 1614 1373 ------
NM_012281chr752290 2001 1887 1853 1767 --1177 --
NM_012286chrX137 1183 ----
NM_012287chr374427 4013 3127 1689 1259 1192 268 13548 1353 --
NM_012288chr682015 1742 1469 1166 1019 631 589 521 25137 107 13634 --
NM_012290chr231234 466 69 ------
NM_012293chr24858 661 350 175 2645 113 --11624
NM_012294chr753051 1539 1447 920 28 --1472 --
NM_012296chr1153414 3390 2813 1517 59 --137 --
NM_012297chr472647 2511 2473 1026 586 544 109 --1129 --
NM_012300chr52699 165 ------
NM_012307chr182253 103 ------
NM_012308chr1162490 2218 1751 906 793 755 12135 1452 --
NM_012309chr1174789 4328 3627 1881 1571 604 535 13525 21108 1047 --
NM_012311chr101654 ------
NM_012316chr1105223 4920 4721 4397 3933 3721 3537 1961 1637 1232 14889 ----
NM_012325chr2011090 1431 ----
NM_012327chr182643 26 ------
NM_012328chr721385 483 ------
NM_012329chr1721133 451 --21054 531 --
NM_012330chr103525 484 219 ----1414
NM_012343chr53849 719 420 ------
NM_012382chr552872 1673 1579 1406 756 ------
NM_012384chr2052446 1858 1807 1640 752 ------
NM_012398chr1922656 246 22099 1860 ----
NM_012399chr2221831 110 11648 ----
NM_012419chr63637 575 443 ------
NM_012420chr1042292 1749 549 292 ----11544
NM_012421chr1------1431
NM_012425chr1032661 2298 202 1573 ----
NM_012454chr61544 ------
NM_012464chr432874 2416 442 12629 ----
NM_012465chr1052170 1241 908 839 622 13389 --11230
NM_012467chr16----123 --
NM_012471chrX31645 465 136 1228 ----
NM_012479chr742693 1981 394 230 1418 ----
NM_012481chr173638 570 523 ------
NM_012482chr12566 523 3554 493 463 ----
NM_013231chr1494116 4049 3617 3458 2757 1152 752 120 112 23415 1729 ----
NM_013233chr23954 108 84 ------
NM_013236chr224782 502 243 57 ------
NM_013253chr1141328 574 152 101 ------
NM_013254chr12--1655 ----
NM_013257chr831860 873 707 --12068 1173
NM_013261chr442967 2943 2621 2517 1419 11392 --
NM_013262chr631304 1135 503 ------
NM_013269chr1254371 4288 3501 3208 1406 33333 3325 1397 ----
NM_013272chr151354 ------
NM_013275chr163628 604 191 ------
NM_013280chr113855 752 571 --1601 --
NM_013281chr2021185 590 ------
NM_013286chr323276 99 ------
NM_013293chr72221 130 ------
NM_013302chr1693417 3329 3269 1300 1001 858 839 462 101 13488 --11185
NM_013309chr1542656 2552 2118 339 12354 ----
NM_013313chr2273194 3117 2169 1044 470 148 77 2799 638 ----
NM_013316chr74785 212 175 90 ------
NM_013323chr1741189 1010 770 406 --2867 309 --
NM_013341chr272759 2529 2491 2241 2083 562 46 22922 2097 12790 --
NM_013368chr19140 1129 ----
NM_013372chr1532978 1065 492 ------
NM_013376chr19131 ------
NM_013377chr121467 ------
NM_013381chr1232400 2071 768 1818 ----
NM_013388chr23425 233 44 ------
NM_013390chr9167 --11184 --
NM_013391chr5--1104 ----
NM_013433chr1951494 1326 548 474 278 ------
NM_013436chr22566 33 ------
NM_013437chr821261 401 ------
NM_013438chr96705 639 422 287 226 131 --2626 510 --
NM_013444chrX51025 440 357 142 33 --2842 766 --
NM_013448chr141195 ------
NM_013449chr1252714 2267 2246 2127 707 --135 --
NM_013450chr221045 790 --1863 --
NM_013451chr101198 122 ----
NM_013943chr163040 2892 2390 724 633 288 11110 ----
NM_013958chr81332 --141 --
NM_013959chr81332 --141 --
NM_013961chr81332 --141 --
NM_013962chr81332 --141 --
NM_013996chr7--1497 1420 --
NM_013996chr7--1497 1420 --
NM_013997chr7--1497 1420 --
NM_013997chr7--1497 1420 --
NM_013998chr7--1497 1420 --
NM_013998chr7--1497 1420 --
NM_014000chr1031981 1289 600 ------
NM_014011chr262615 1811 1677 949 294 126 21901 1642 ----
NM_014016chr32445 123 ----11545
NM_014021chr152990 2473 2226 215 88 11085 ----
NM_014023chr1022706 392 1648 ----
NM_014034chr631294 976 587 ------
NM_014038chr71374 ------
NM_014039chr112916 495 1250 ----
NM_014043chr341153 1046 632 405 11354 ----
NM_014044chr22186 58 ------
NM_014048chr1665298 4585 4566 4022 3989 1271 45284 3627 951 168 12025 24960 4013
NM_014055chr123394 227 97 ------
NM_014057chr951521 1401 1352 1305 393 ----1106
NM_014089chr1352145 1932 1505 617 168 22084 785 1437 --
NM_014106chr1592556 2442 2351 2072 1160 348 232 117 73 1438 ----
NM_014109chr84840 429 417 378 --21215 96 --
NM_014112chr865419 3663 2204 2007 1053 256 45213 3401 1938 1515 23948 974 --
NM_014117chr1642684 2171 372 91 ------
NM_014149chr71803 ------
NM_014155chr1187096 6789 5902 5654 5138 5025 1375 819 36945 6009 104 25123 1874 11274
NM_014157chr1673757 3701 3267 759 646 246 135 1900 --13814
NM_014181chr232797 2522 278 22723 2643 1364 --
NM_014191chr121952 --1159 --
NM_014217chr141854 1638 1320 79 ------
NM_014223chr12579 293 ------
NM_014233chr1761983 1427 1370 1339 677 665 ------
NM_014243chr441783 1503 1497 551 11983 ----
NM_014245chr32318 161 ------
NM_014246chr2211526 ----1372
NM_014251chr74816 653 234 101 ------
NM_014252chr131410 2143 56 ----
NM_014253chrX51921 866 510 412 336 11847 12370 --
NM_014263chr1011143 ------
NM_014264chr41501 ------
NM_014268chr182389 284 11352 ----
NM_014278chr42169 58 --1383 --
NM_014280chr12647 42 ------
NM_014284chr11759 --162 --
NM_014288chr13299 210 47 ------
NM_014289chrX2352 166 11190 --1459
NM_014293chr2243476 1531 294 130 1362 13364 1213
NM_014294chr861235 1223 1108 1015 151 136 --11083 --
NM_014299chr1922237 661 --3710 680 299 --
NM_014309chr2251208 774 406 368 224 1632 21550 275 --
NM_014316chr1622189 243 1766 1130 --
NM_014317chr101239 ------
NM_014319chr1241737 1693 271 117 --11768 --
NM_014325chr1221785 1384 2697 123 ----
NM_014331chr4127354 7031 6943 6343 5337 2173 2044 1621 1456 1075 1038 868 57644 6719 4790 2524 773 35609 5549 1982 --
NM_014333chr1152745 2258 1973 1782 786 12365 --12238
NM_014342chr1121441 28 1495 1949 --
NM_014345chr61357 187 --1124
NM_014351chr2221045 381 --11471 --
NM_014368chr93529 411 22 ------
NM_014372chr131938 1721 418 ------
NM_014376chr592563 2557 2194 1945 911 516 478 361 180 1742 ----
NM_014381chr1441315 895 381 255 1513 1775 --
NM_014382chr321711 1117 1421 ----
NM_014388chr1125725 5524 4708 4226 3784 3703 2269 2225 1779 689 205 142 1445 --11001
NM_014391chr10143 ------
NM_014392chr431480 1170 330 21595 66 2629 436 1192
NM_014393chr831988 293 247 ------
NM_014396chr761975 1470 660 636 507 70 22183 1636 11824 --
NM_014397chr92440 296 ------
NM_014399chr72774 277 1345 ----
NM_014405chr1741588 914 533 335 ----12211
NM_014415chr351458 1215 367 337 34 11587 --1480
NM_014421chr431909 1409 765 11897 ----
NM_014423chr555240 5215 4381 2265 747 25552 4020 --35360 3956 795
NM_014445chr322340 543 12316 ----
NM_014447chr441381 1083 633 422 ------
NM_014452chr6----1432 --
NM_014455chr12183 165 143 ----
NM_014456chr1021879 512 --1119 --
NM_014462chr8182 ------
NM_014470chr122731 541 ------
NM_014494chr1641907 886 865 196 21930 420 11867 --
NM_014502chr11--2128 37 ----
NM_014504chr741510 622 489 111 11336 --11975
NM_014517chr341693 1243 746 367 11963 ----
NM_014521chr231191 717 298 ----1457
NM_014547chr152189 126 ------
NM_014547chr152189 126 ------
NM_014548chr1541648 576 387 103 21549 1065 ----
NM_014552chr241325 1134 171 153 ------
NM_014554chr1232282 1691 277 12199 --1175
NM_014571chr182686 2631 2619 2552 2385 2088 235 158 11159 22255 2168 --
NM_014573chr1741865 1176 281 102 ------
NM_014575chr31197 ------
NM_014577chr224920 634 215 164 ------
NM_014584chr1421352 365 ------
NM_014586chr21124738 4585 4240 4030 3882 3725 3268 3231 1921 1617 1021 616 23021 1474 24447 28 14672
NM_014588chr20156 --1598 --
NM_014591chr1031312 995 372 --1194 --
NM_014592chr53702 637 260 ------
NM_014600chr241647 1619 1140 527 ------
NM_014602chr3----167 --
NM_014607chr231764 1471 405 --1565 11741
NM_014608chr15----192 --
NM_014612chr941513 1003 379 237 ------
NM_014614chr241353 1296 1256 238 2386 377 11201 --
NM_014616chr343347 2898 577 237 ----1285
NM_014623chr6292 86 ------
NM_014630chr1573520 3146 2784 1556 1214 998 253 --22924 2799 12445
NM_014633chr112159 28 ------
NM_014635chr241462 303 159 109 11401 ----
NM_014636chr994362 3750 3683 3435 2972 1698 1348 539 280 24199 1012 ----
NM_014647chr1642305 2161 790 237 1124 11568 --
NM_014660chr71949 ------
NM_014665chr853633 3499 1134 597 271 12258 ----
NM_014667chr342435 2014 739 581 22263 1697 ----
NM_014670chr231213 586 82 ------
NM_014671chr731182 575 488 ----1290
NM_014674chr3113747 3108 2652 1572 1529 1329 1084 937 843 823 25 --1284 --
NM_014676chr141527 1445 527 311 ------
NM_014677chr811006 ------
NM_014682chr842232 438 353 107 11455 ----
NM_014683chr1711904 11862 1472 --
NM_014686chr1932551 502 232 11717 12295 --
NM_014689chr2--1458 ----
NM_014690chr742803 1996 1937 879 32451 2110 421 13066 --
NM_014701chr1543235 1202 175 26 2619 71 ----
NM_014702chr693368 3202 3078 2455 2272 1398 858 494 168 --12521 --
NM_014705chr731725 1712 665 ------
NM_014707chr7--11861 11921 --
NM_014709chr2----1182 --
NM_014711chr1641352 746 370 212 12130 ----
NM_014713chr23517 340 125 ------
NM_014720chr102694 61 1251 1219 --
NM_014721chr6116502 5735 5252 5054 4558 2835 2047 1587 1185 1064 40 11804 45312 4764 2267 660 11419
NM_014726chr1731005 408 151 --1553 --
NM_014727chr19156 ----199
NM_014729chr821435 421 ------
NM_014731chr2051763 1332 1249 77 22 ------
NM_014733chr52301 268 ------
NM_014735chrX51552 782 742 551 446 1486 ----
NM_014743chr463099 2675 2201 1156 536 407 12623 22255 1143 1299
NM_014746chr263103 1515 1200 568 469 90 31451 1139 748 1713 --
NM_014747chr175291 3730 1942 1533 795 783 272 25449 1766 25671 1106 14277
NM_014751chr811412 ------
NM_014752chr1181938 1541 1453 1274 1244 748 585 334 ------
NM_014755chr231562 511 438 --11329 --
NM_014764chr123511 491 201 ----1872
NM_014765chr141948 856 747 612 12115 1805 --
NM_014773chr521392 215 ----11086
NM_014776chr1261973 1933 1000 657 636 572 2707 624 32447 2315 483 12816
NM_014779chr32831 258 ------
NM_014781chr82380 90 ------
NM_014787chr142830 2684 2018 1073 12059 ----
NM_014790chr51193 ------
NM_014795chr231282 1124 267 ------
NM_014800chr731137 814 749 --1175 --
NM_014803chr1032691 1085 381 22334 820 11025 --
NM_014810chr183269 3153 2539 1305 1092 1070 884 519 1820 ----
NM_014812chr131983 1283 355 ------
NM_014813chr14613 121 93 53 ------
NM_014819chr532517 2198 905 ------
NM_014820chr362048 2038 1917 1822 1765 1567 ------
NM_014822chr41137 --132 1258
NM_014824chr114703 593 402 209 1815 ----
NM_014826chr133788 894 66 33388 1688 1490 23058 1409 33824 3549 1538
NM_014827chr141441 1041 223 90 ------
NM_014829chr532218 2094 383 21647 930 1610 --
NM_014830chr1232758 888 741 --11537 --
NM_014835chr2032273 1939 195 1178 ----
NM_014836chr1031578 1547 145 11696 --11357
NM_014839chr1----12270 11951
NM_014840chr1242410 711 629 229 --1326 13223
NM_014841chr621263 1044 --1428 --
NM_014844chr1433802 1405 39 31104 775 686 13706 12910
NM_014846chr81105 ------
NM_014848chr1572683 2448 1008 994 764 745 476 12328 22160 306 --
NM_014850chr333225 542 435 24269 1957 1487 11892
NM_014857chr1121 ------
NM_014862chr1534075 3846 123 ------
NM_014870chr184153 3580 1713 1468 1164 795 620 182 11332 --1106
NM_014871chr122672 564 ------
NM_014872chr932015 950 347 --21622 167 --
NM_014873chr174845 4780 4493 3685 1896 951 417 ------
NM_014876chr2231912 1655 635 22037 102 ----
NM_014877chr17137408 7226 7089 6125 5709 4725 2947 2887 2620 2577 1561 372 187 11207 56597 5329 5295 1367 498 --
NM_014883chr442374 632 603 206 ------
NM_014885chr4134 ------
NM_014888chr741283 638 223 103 ----11172
NM_014890chr31248 ------
NM_014891chr721347 145 21514 605 --1234
NM_014893chrY32239 2045 171 32385 2305 297 ----
NM_014897chr1753289 2885 879 795 238 22838 1072 178 --
NM_014899chr553058 2241 589 389 26 11929 ----
NM_014901chr542134 1714 468 177 --1120 --
NM_014902chr2011464 ------
NM_014903chr1252447 940 803 410 210 ------
NM_014904chr1063638 1629 1488 1470 1390 495 12696 ----
NM_014905chr231966 1737 338 1113 ----
NM_014906chr1783935 3740 3239 3126 2602 2526 749 77 34027 1198 816 1905 --
NM_014909chr1443722 3712 1012 726 43923 3886 3397 2894 --1395
NM_014914chr22436 402 --1931 11310
NM_014917chr12792 688 ------
NM_014918chr1541190 1140 526 186 1444 ----
NM_014920chr683119 2934 2839 2654 2608 1237 286 258 13306 23238 3071 --
NM_014921chr1933013 1893 1176 --12501 --
NM_014923chr1332157 1437 92 ------
NM_014932chr311690 ------
NM_014933chr42325 123 ------
NM_014934chr1343252 2769 2527 1002 23259 1344 12807 --
NM_014935chr133887 3881 3176 13650 23753 2416 12932
NM_014936chr682764 2265 2091 1925 1157 336 226 168 ----1497
NM_014939chr1821349 958 2623 272 --11435
NM_014945chr521735 29 12027 ----
NM_014946chr22998 933 12127 ----
NM_014947chr112742 ------
NM_014949chr1160 1229 ----
NM_014950chr1421742 99 ------
NM_014953chr1384115 3459 2849 1645 1011 469 158 135 1300 ----
NM_014961chr441884 1653 746 393 ------
NM_014962chr2042552 2382 632 246 22002 1158 ----
NM_014969chr131134 1010 814 ------
NM_014970chr12233 215 ------
NM_014974chr1031745 1612 1239 1255 ----
NM_014977chr142216 184 --1404 --
NM_014978chr1021171 410 --2727 231 --
NM_014982chr14113641 1983 1844 1621 1437 1422 1410 1349 804 329 26 1869 23748 1758 --
NM_014988chr472582 775 502 207 138 100 35 11029 --1472
NM_014989chr631993 1262 366 --1617 --
NM_014990chr1411284 --11182 1861
NM_014991chr452686 2009 764 636 101 13296 1659 1319
NM_014992chr143702 608 328 1850 ----
NM_014997chr762902 1880 1028 1019 849 569 1172 12715 --
NM_014999chr1221140 196 ------
NM_015000chr1232666 2105 458 --12277 --
NM_015002chr1271990 1743 694 401 372 357 75 ----1527
NM_015008chr343193 2919 2612 2588 ------
NM_015020chr1652741 1214 417 410 82 1741 ----
NM_015023chr131670 261 113 11387 ----
NM_015025chr212482 12705 22195 895 --
NM_015026chr12134527 4204 4075 3781 3316 3109 1876 1711 1162 849 539 268 82 14098 13999 11690
NM_015027chr1652011 1796 754 742 628 11359 ----
NM_015032chr1322856 528 32405 2372 2154 ----
NM_015035chr20156626 6611 6367 6275 6161 5090 4575 4535 2386 2171 2061 1764 1465 848 422 35544 1798 987 ----
NM_015037chr101245 ------
NM_015039chr17960 948 899 280 180 85 41 24301 4008 ----
NM_015044chr16103116 2800 2593 2561 2344 1047 816 787 490 281 128 22004 265 --
NM_015045chr1042018 1985 1815 167 ------
NM_015051chr953101 2618 1261 693 234 22835 2790 --23112 406
NM_015052chr72354 269 11323 ----
NM_015063chr1931167 1123 1058 1483 ----
NM_015064chr1223261 1148 22709 532 22788 2480 13313
NM_015068chr763488 2721 1192 1080 599 97 23235 683 --11090
NM_015071chr5155756 5687 5495 4887 4318 2225 2174 1873 1656 1473 1093 573 231 163 76 24035 176 11988 --
NM_015072chr141386 ------
NM_015074chr153952 1961 1183 162 62 24119 3478 23712 597 --
NM_015076chr654517 4076 3483 1550 252 1726 33148 1327 289 --
NM_015085chr1773984 3933 3391 2636 1190 1013 222 12845 --12877
NM_015090chr196088 4913 4608 4402 4023 1572 1419 1150 1134 15118 55919 5452 5197 565 382 --
NM_015091chr14----1825 --
NM_015092chr1681847 1270 1224 1077 964 854 755 707 --24606 3722 11396
NM_015093chr641624 1433 1217 557 --11343 --
NM_015094chr2234372 1783 1645 ------
NM_015097chr352034 1907 1876 1849 667 1271 ----
NM_015100chr121562 470 ------
NM_015107chrX3870 599 461 ------
NM_015110chr952294 822 811 520 492 31702 1621 805 ----
NM_015115chr41622 --1354 1413
NM_015125chr19298 78 ------
NM_015132chr72506 461 41893 1260 282 251 11977 --
NM_015135chr71129 ------
NM_015137chr82559 363 ------
NM_015138chr1552659 2408 714 487 184 ------
NM_015141chr352408 1928 752 596 543 1479 ----
NM_015143chr431272 134 50 124 ----
NM_015144chr1663407 3339 2980 2483 955 814 11027 33514 2455 224 --
NM_015149chr12647 296 1762 12162 --
NM_015150chr3------154
NM_015153chr6296 54 ------
NM_015155chr1082825 2080 902 882 838 560 412 275 --12230 12785
NM_015156chr144768 574 259 94 ----1215
NM_015157chr111413 ----11175
NM_015158chr91584 ------
NM_015170chr821649 342 ------
NM_015173chr411384 11526 11460 11758
NM_015176chr131116 1101 445 ------
NM_015192chr2042362 2064 1002 90 12918 ----
NM_015197chr1412565 172 159 --
NM_015198chr721140 1071 ------
NM_015199chr311864 12926 11113 --
NM_015200chr431837 1674 851 12317 12431 --
NM_015203chr1123 ------
NM_015206chr1592893 2816 2797 2710 2642 1353 845 216 56 22992 2971 1119 11515
NM_015208chr1834082 3912 3385 33175 2843 923 --1830
NM_015209chr1--12161 22018 1833 --
NM_015213chr111601 ------
NM_015215chr172850 774 547 329 241 198 58 1992 12711 --
NM_015216chr52977 71 ----1372
NM_015226chr1663246 3232 2354 935 878 431 1119 1195 --
NM_015233chr1342522 2413 1871 799 --21799 493 1848
NM_015236chr42410 327 ------
NM_015247chr16105210 4846 3958 3298 2032 1902 1753 1556 1407 190 14638 25195 2017 157
NM_015250chr9----11664 --
NM_015251chr1642030 1476 43 35 ------
NM_015263chr151246 131 --1823
NM_015265chr272365 2253 2246 424 267 166 58 --1885 --
NM_015270chr12----21937 927 --
NM_015271chr464036 3455 3238 2615 1678 1484 --24301 2919 --
NM_015272chr1641625 852 566 291 12096 124 --
NM_015275chr1241615 1536 1429 105 11560 ----
NM_015277chr1831144 447 60 1237 ----
NM_015282chr23887 828 350 11007 1997 --
NM_015288chr533071 2976 74 --13197 --
NM_015294chr173944 415 117 11045 ----
NM_015296chr133860 52 30 1132 ----
NM_015310chr8128326 7769 7674 7596 7135 5750 5387 3259 2647 2462 1678 862 37803 7577 667 46868 6595 3306 3069 --
NM_015313chr1174636 4501 4469 4447 4073 3550 1568 1888 23112 1914 --
NM_015315chr583383 3217 2551 2512 2331 1330 1300 580 12391 ----
NM_015317chr222406 963 12655 ----
NM_015326chr152834 2807 2304 853 139 --1395 --
NM_015327chr1------1316
NM_015328chr733049 2671 2386 23014 832 ----
NM_015329chr1941829 814 772 284 --22071 43 12135
NM_015335chr1232457 2410 1651 ----1864
NM_015336chr1262213 2090 2011 961 420 192 1472 ----
NM_015338chr2041799 1708 1259 412 --11245 --
NM_015339chr2031031 898 294 ------
NM_015344chr82550 397 ------
NM_015346chr1431618 1592 674 --1319 --
NM_015347chr1292677 2663 2345 2095 1112 776 677 242 229 ------
NM_015349chr652678 926 559 449 284 22893 256 ----
NM_015355chr1741921 1695 1596 333 1620 ----
NM_015359chr832776 2412 837 ------
NM_015361chr22784 52 --1716 1175
NM_015365chrX64170 3409 3078 2608 182 82 ------
NM_015367chr221553 11522 11260 --
NM_015375chr144916 4226 1043 801 34394 2012 1158 --21664 519
NM_015387chr231961 1423 718 21918 1383 ----
NM_015393chr473506 3315 2993 2637 2424 1239 1088 23655 362 1766 --
NM_015409chr1232710 2005 1810 1254 1785 --
NM_015419chrX2993 457 ------
NM_015423chr1121686 343 ------
NM_015435chr81468 ------
NM_015436chr452924 2784 1144 344 33 ----12859
NM_015446chr121176 533 --1609 --
NM_015455chr554040 3762 3449 2957 932 12687 ----
NM_015458chr863887 1501 1348 1323 1233 487 24182 1713 14348 --
NM_015460chr311848 1172 21466 469 --
NM_015464chr71225 ------
NM_015472chr3143 --1397 --
NM_015472chr3143 --1397 --
NM_015475chr241105 692 211 132 ------
NM_015477chr152695 387 ------
NM_015483chr71808 1846 ----
NM_015484chr13781 310 127 --1868 --
NM_015488chr241722 1544 397 263 1368 11732 --
NM_015493chr1932018 820 58 11628 12087 --
NM_015497chr1521012 56 1172 ----
NM_015503chr162735 613 --1482 --
NM_015507chrX3311 189 79 ------
NM_015508chr321316 49 ------
NM_015509chr1261119 334 287 207 199 89 1367 ----
NM_015520chr362480 2105 839 794 696 358 ------
NM_015523chr112251 235 --1107 --
NM_015525chr621186 25 ------
NM_015530chr22391 100 1674 2888 288 --
NM_015535chr283036 2694 2680 1485 1183 860 497 229 24073 710 14050 --
NM_015542chr1031125 1103 37 31199 94 22 ----
NM_015548chr63988 237 37 ------
NM_015549chr14--1602 ----
NM_015550chr73629 543 220 --22981 2271 --
NM_015553chr675049 4649 4016 3402 1413 1283 881 44731 1324 708 180 14409 --
NM_015554chr1542264 2181 545 200 ------
NM_015555chr621323 1279 11726 ----
NM_015557chr162413 2372 1252 653 322 38 --1756 --
NM_015560chr322602 1788 21104 862 ----
NM_015564chr553319 3038 1177 775 737 12350 --13383
NM_015565chr2121801 1644 ------
NM_015567chr1341136 930 852 33 --1822 --
NM_015571chr672515 2186 1921 821 686 204 23 --1486 --
NM_015576chr3102708 2265 1087 1032 860 655 452 332 316 230 1972 ----
NM_015584chr172480 342 ------
NM_015602chr131346 684 220 1189 ----
NM_015607chr11146 ------
NM_015608chr10--1606 ----
NM_015609chr142967 1172 1131 759 ------
NM_015622chr7--1220 ----
NM_015626chr172346 134 ------
NM_015630chr22732 376 ------
NM_015635chr92406 123 1778 21376 1366 --
NM_015640chr184948 3505 2041 1855 1845 1507 1491 1243 1781 24622 302 --
NM_015641chr72226 197 --154 --
NM_015649chr191343 ------
NM_015676chr141358 ------
NM_015678chr132378 69 11604 --21110 447
NM_015691chrX42880 660 523 213 --1683 --
NM_015713chr8113567 3548 3416 3113 2856 2545 2303 990 822 503 150 21166 1046 1588 --
NM_015714chr13367 286 256 ------
NM_015716chr172662 479 ------
NM_015719chr19152 ----1823
NM_015831chr71323 ------
NM_015840chr172281 2109 1777 1029 945 333 298 ------
NM_015841chr172281 2109 1777 1029 945 333 298 ------
NM_015844chr182956 232 ------
NM_015846chr182956 232 ------
NM_015847chr182956 232 ------
NM_015850chr822235 2034 ------
NM_015866chr151517 1098 1057 498 173 11180 ----
NM_015872chr1--11622 --11630
NM_015878chr81698 ------
NM_015879chr18158638 8219 8012 7300 6505 6075 5262 3111 2445 1520 591 480 474 466 231 67739 5753 2318 2238 493 451 46945 5964 822 777 28006 1261
NM_015881chr1141328 574 152 101 ------
NM_015885chr111584 --1166 --
NM_015886chr874493 4399 3995 1287 1244 1176 510 11553 15422 11581
NM_015888chr152928 2883 2637 2115 193 32558 1213 244 ----
NM_015891chr642079 1980 1797 75 --1285 --
NM_015902chr82913 895 ------
NM_015905chr72158 112 ------
NM_015906chr164345 3831 3415 3347 3046 926 24025 3949 14015 --
NM_015912chr862269 2242 2093 894 776 388 187 --21986 413
NM_015920chr15--1610 ----
NM_015933chr32181 80 ------
NM_015934chr21182 ------
NM_015939chr202224 174 ------
NM_015955chr21424 ------
NM_015975chrX41833 1173 741 296 11413 --129
NM_015981chr531046 968 199 11237 --1718
NM_015982chr17145 ------
NM_015986chr1721059 97 31282 1009 357 ----
NM_015995chr1565376 5294 4944 4157 1627 397 ------
NM_015999chr14684 471 241 178 ------
NM_016009chr164848 4744 3119 2994 504 81 14205 13711 --
NM_016018chr832005 1028 51 12790 ----
NM_016019chr72364 131 --1879 --
NM_016021chr632892 590 271 --12069 --
NM_016022chr11761 ------
NM_016023chr83874 796 744 1371 ----
NM_016032chrX2882 149 ------
NM_016040chr152493 2312 969 828 257 22764 581 21951 506 --
NM_016045chr20--11529 ----
NM_016057chr122910 99 --11241 --
NM_016059chr62327 210 --1131 --
NM_016061chr271659 1593 1583 1515 1092 248 23 ------
NM_016071chr7293 59 ------
NM_016072chr1251846 1602 1586 728 374 --1430 --
NM_016073chr151997 ------
NM_016075chr1332640 832 601 11066 ----
NM_016076chr193037 2863 2686 2301 2081 2053 695 619 284 11052 12960 --
NM_016078chr173958 885 341 ------
NM_016079chr222302 2181 22163 891 ----
NM_016081chr422026 1732 1162 11527 --
NM_016083chr683590 2827 2784 2629 2415 848 748 621 23925 3204 --13509
NM_016090chr1121067 115 11001 ----
NM_016096chr81587 11818 ----
NM_016097chr184974 858 833 329 1996 11089 --
NM_016106chr14--1181 ----
NM_016107chr51895 21231 1166 ----
NM_016121chr131038 169 123 ------
NM_016129chr4376 66 33 199 ----
NM_016131chr261738 1692 1626 1510 1483 737 2313 113 1767 1260
NM_016132chr1532680 2510 873 33258 2101 1183 ----
NM_016147chr1131183 1038 1001 ------
NM_016152chr3--1219 ----
NM_016156chr1152212 1817 1574 1509 315 ------
NM_016169chr10113292 2877 2802 2313 2025 1301 1265 1076 999 877 426 12277 1639 --
NM_016192chr21107 ------
NM_016201chr332021 1997 1467 171 ----
NM_016205chr43965 121 79 ------
NM_016206chr3178133 7876 7700 7607 7322 7216 6909 6872 6416 5711 2276 1502 1055 942 544 394 193 27351 6513 27145 6434 28161 6485
NM_016211chr42325 123 ------
NM_016231chr17------11576
NM_016252chr21713 ------
NM_016255chr653280 2522 2043 413 308 13220 ----
NM_016257chr193123 2753 2593 2342 1366 1148 725 676 566 12158 --13112
NM_016258chr12690 38 ------
NM_016260chr2177330 6879 6837 6438 5635 5609 5590 5090 2738 2549 2526 2478 2391 1787 958 722 267 12079 36872 6848 1253 --
NM_016269chr441167 1018 942 403 --1354 --
NM_016270chr192420 352 --1493 --
NM_016271chr1851968 1686 675 168 45 21620 858 124 --
NM_016272chr2232137 685 294 ------
NM_016275chr352083 1857 1751 891 488 1914 --12235
NM_016277chr631260 1199 1004 ------
NM_016281chr1241001 976 958 228 ------
NM_016284chr162188 122 1617 ----
NM_016287chr141850 1795 156 67 1614 ----
NM_016289chr262283 2118 1441 796 353 40 1224 11721 1742
NM_016301chr121413 ------
NM_016302chr33661 611 304 ------
NM_016303chrX----2126 61 1143
NM_016308chr131796 1783 500 1105 ----
NM_016312chr122471 383 ------
NM_016316chr21135 1473 ----
NM_016320chr111109 1992 1833 --
NM_016322chr973205 3069 2971 2092 1194 938 518 2802 92 ----
NM_016333chr161479 ------
NM_016338chr511075 ------
NM_016353chr842436 737 709 267 22098 943 ----
NM_016357chr1221168 825 ------
NM_016374chr111394 ------
NM_016374chr111394 ------
NM_016376chr1763877 3832 2927 2735 1332 321 2704 157 21019 946 --
NM_016377chr631773 1453 364 11684 11571 --
NM_016396chr1552258 2046 1943 692 96 2425 174 11952 --
NM_016422chr112896 778 13121 12193 --
NM_016424chr173788 396 332 --11966 --
NM_016436chr2052708 2259 999 752 567 12427 ----
NM_016441chr222241 753 --2833 632 --
NM_016442chr552354 2145 805 673 98 31731 1550 653 1919 --
NM_016451chr11168 ------
NM_016454chr15----1327 --
NM_016470chr202448 100 ----1145
NM_016485chr631575 911 207 11860 --11921
NM_016486chr13507 358 197 2491 429 ----
NM_016489chr73432 201 64 ------
NM_016507chr1753128 2170 1114 872 108 22404 566 1609 --
NM_016513chr683119 2934 2839 2654 2608 1237 286 258 13306 23238 3071 --
NM_016516chr21713 ------
NM_016522chr11----11282 --
NM_016525chr92244 238 ------
NM_016529chr133887 117 68 ------
NM_016530chr1593693 3368 3097 2977 877 692 555 487 407 13328 13726 --
NM_016531chr444124 3300 1183 897 --13412 --
NM_016536chr192219 73 1226 ----
NM_016542chrX1603 ------
NM_016544chr243385 2799 1213 185 42881 297 226 154 --12789
NM_016546chr1221628 1416 1281 1422 --
NM_016575chr1285353 5261 2164 2097 1631 1560 1245 363 --1872 --
NM_016577chr333999 1712 1277 --34347 3397 2881 --
NM_016587chr71258 ------
NM_016591chr52791 336 1424 ----
NM_016603chr521829 567 21762 1541 ----
NM_016605chr562452 2285 2164 1752 1687 996 ------
NM_016607chrX31333 1041 219 ------
NM_016617chr1351918 1536 1470 415 82 ------
NM_016621chr1143959 3726 3377 1234 --1744 --
NM_016623chr81521 191 ----
NM_016625chr31390 1128 ----
NM_016626chr1831277 617 30 ------
NM_016628chr105906 634 585 568 80 ------
NM_016645chr151337 ------
NM_016649chr202338 35 ------
NM_016654chr15--11410 ----
NM_016823chr1731164 849 270 1516 ----
NM_016824chr1021209 169 ------
NM_016834chr1743785 673 281 206 14050 22980 1075 --
NM_016835chr1743785 673 281 206 14050 22980 1075 --
NM_016841chr1743785 673 281 206 14050 22980 1075 --
NM_016929chr673936 3075 1823 1583 1377 422 122 13691 14011 13442
NM_016946chr163447 2870 501 377 245 33 11325 ----
NM_016950chr441485 1347 1181 35 --2458 444 --
NM_016952chr1173950 3233 2900 1240 859 333 148 13059 ----
NM_016953chr295455 5432 5042 4823 4747 4266 4196 2232 1403 36077 2355 107 14779 --
NM_017409chr121767 1632 ----
NM_017410chr1221188 868 ------
NM_017412chr81265 ------
NM_017413chrX32348 945 226 ------
NM_017416chrX1154 ------
NM_017420chr1473713 3444 3211 3008 2952 555 509 33381 3335 3056 ----
NM_017423chr451703 1467 554 451 232 --12079 --
NM_017425chr112269 72 ------
NM_017426chr41501 --140 --
NM_017447chr2154048 1753 1341 540 139 23700 2686 12975 13686
NM_017449chr111115 ------
NM_017451chr1721115 1013 ------
NM_017456chr1721373 1272 --21508 758 --
NM_017483chr241257 457 419 63 ----11013
NM_017488chr221592 398 ----21348 1085
NM_017491chr44639 410 147 72 ------
NM_017519chr63951 431 327 ------
NM_017522chr131253 1219 399 ------
NM_017540chr563113 2640 2068 876 702 673 33026 2730 2180 ----
NM_017544chrX--1114 ----
NM_017545chr202598 533 ------
NM_017548chr341909 1898 1713 1458 1288 11688 --
NM_017551chr1052697 2593 2141 1994 438 12183 12388 --
NM_017553chr1521283 188 --192 1242
NM_017558chr162440 48 1431 ----
NM_017569chr131309 ------
NM_017580chr1032338 2071 1738 --1332 --
NM_017590chr2232609 2216 145 --12506 --
NM_017593chr4298 75 ------
NM_017594chr962917 2607 2280 1102 415 114 12527 11218 --
NM_017596chr124644 3265 23226 3200 ----
NM_017599chr1231873 561 302 ------
NM_017602chrX2821 28 --1596 --
NM_017610chr1521581 712 11835 1264 --
NM_017628chr4115283 4752 4737 4421 3280 1228 1189 965 517 229 186 43894 3203 1112 1072 21562 1089 --
NM_017629chr111840 ------
NM_017633chr673565 3520 3192 3166 2772 329 160 137 11564 --
NM_017634chr841890 354 338 294 11653 ----
NM_017635chr1111361 ------
NM_017636chr19--1332 ----
NM_017637chr9188704 8455 8323 8199 7684 7211 7064 6490 6338 5925 3412 2808 1958 1940 1444 1307 1210 120 27438 7160 26706 3102 17121
NM_017640chr63248 199 74 1866 ----
NM_017643chr1762873 2808 1242 847 551 453 ------
NM_017644chr355168 4776 1257 769 83 22074 1196 13414 14103
NM_017646chr12483 242 ------
NM_017650chr7105301 4300 3929 3762 2247 1599 1515 1361 278 152 --11509 1827
NM_017651chr631440 592 436 ------
NM_017658chr1464207 4159 3503 1483 1260 1020 ------
NM_017660chr1922338 952 ------
NM_017661chr15144 ------
NM_017666chrX32004 1806 314 ------
NM_017672chr15------11227
NM_017680chr92732 208 ------
NM_017686chr151082 1053 791 344 280 1866 2878 767 --
NM_017694chr231985 1766 1473 ------
NM_017709chr12251 87 ----13146
NM_017714chr201312 ----239 28
NM_017730chr3----1171 1464
NM_017734chr12242 52 ------
NM_017736chr1631932 1165 603 1942 ----
NM_017737chr151377 1352 749 697 565 1587 1160 --
NM_017738chr93478 208 88 1776 ----
NM_017741chr452762 2178 1937 709 26 12343 ----
NM_017742chr1831535 134 101 ------
NM_017744chr182260 1773 1725 909 444 301 122 57 2902 472 ----
NM_017745chrX1111 ------
NM_017753chr9140 ----2913 762
NM_017754chr674957 4724 4634 4579 4180 3580 1643 1317 34513 3612 3062 --
NM_017762chr1541778 622 457 393 ------
NM_017769chr1433134 2735 2479 22596 722 ----
NM_017770chr632961 2792 2718 ------
NM_017772chr631128 649 38 ------
NM_017774chr63344 78 41 ------
NM_017778chr83991 463 129 11033 ----
NM_017780chr81165 ------
NM_017787chr1051824 442 261 157 146 --12856 1419
NM_017789chr2----1213 --
NM_017798chr202280 156 --1113 --
NM_017799chr1441732 1272 659 112 1223 ----
NM_017811chr922594 294 139 --12162
NM_017812chr71726 1153 ----
NM_017813chr8105455 5267 4127 4057 3561 2243 1814 1437 1075 718 1417 24094 709 15505
NM_017822chr122265 72 ------
NM_017824chr1032565 771 158 32717 2242 662 ----
NM_017831chr1884636 3141 1747 1377 1286 693 650 148 1817 13135 --
NM_017847chr11223 1705 1202 --
NM_017848chrX84396 3944 3350 3014 485 372 277 141 23997 3747 21803 1392 13780
NM_017857chr111671 ------
NM_017869chr161119 --1628 --
NM_017870chr11--1220 ----
NM_017880chr22406 291 ------
NM_017890chr861692 678 509 377 198 175 ------
NM_017896chr2053486 2733 1298 675 196 22167 760 31365 983 136 1995
NM_017902chr10105379 5140 4793 4636 1888 1655 1299 478 415 362 14626 24853 4173 --
NM_017910chr22369 91 1260 ----
NM_017922chr141271 ------
NM_017925chr911367 31709 686 398 ----
NM_017933chr231457 462 267 11087 11430 --
NM_017938chrX52037 2026 1837 1807 314 --2650 541 --
NM_017943chr142791 139 ----21078 202
NM_017954chr751732 1292 1229 650 321 ------
NM_017958chr282968 2578 1976 1969 1853 1226 857 287 --171 --
NM_017964chr21254 1130 ----
NM_017966chr1151311 399 362 314 304 ------
NM_017974chr221243 917 ------
NM_017982chr12847 56 1876 --1142
NM_017988chr123868 131 65 3827 628 599 ----
NM_017990chr16144186 4034 4025 3989 3873 3747 3144 2987 1629 1478 700 122 115 37 11535 --22792 341
NM_017994chr711142 22915 132 22656 443 --
NM_017998chr941459 1410 1387 1177 ------
NM_017999chr14------179
NM_018000chr222201 2150 1866 1521 --
NM_018003chr1541644 691 483 25 11809 ----
NM_018010chr311287 ----11473
NM_018015chrX1852 2752 177 --1739
NM_018018chr1241683 759 341 222 --11617 1559
NM_018027chr1013318 ------
NM_018030chr18--1971 --2883 135
NM_018036chr1494059 3473 3246 3025 2981 1628 1511 236 120 54297 4040 3699 3691 105 --24018 1309
NM_018045chr142269 2225 1179 277 --13067 --
NM_018051chr71339 ------
NM_018060chr12351 246 ------
NM_018061chr141469 228 126 119 11627 ----
NM_018078chr42854 178 2674 367 ----
NM_018084chr253129 1053 936 855 818 12239 ----
NM_018086chr271871 1606 1547 1511 1424 1317 597 --1137 --
NM_018092chr162513 221 1458 ----
NM_018098chr321036 226 ------
NM_018103chr12106 88 ------
NM_018107chr146756 726 718 668 270 77 ------
NM_018117chr102492 162 ------
NM_018120chr81483 ----1137
NM_018121chr10113161 3052 2835 2775 2658 2613 2597 2130 968 561 166 ------
NM_018126chr431375 561 231 --1129 11089
NM_018128chr1751494 1019 402 310 285 11088 ----
NM_018133chr33653 504 354 ------
NM_018144chr101256 ------
NM_018155chr383410 3381 3374 2925 2851 762 538 457 22845 1353 ----
NM_018157chr1243269 2827 2050 618 32378 2142 245 22236 44 --
NM_018159chrX21101 321 --1134 --
NM_018172chr1121142 274 ------
NM_018181chr1841778 1528 1272 1265 11453 ----
NM_018182chr1772211 1922 1413 900 639 295 274 11708 2678 620 --
NM_018184chr332025 1977 724 3554 522 295 11412 11860
NM_018195chr1141905 1824 1741 851 ------
NM_018198chr121317 1242 ------
NM_018200chr1552241 831 480 276 270 --11586 --
NM_018202chr12845 114 1710 162 --
NM_018206chr161116 ------
NM_018211chr131567 1422 425 --146 2396 218
NM_018227chr412468 ------
NM_018243chr4114009 3462 3414 3164 2972 2683 1448 1421 632 427 410 11085 21497 59 13317
NM_018247chr652168 2106 815 740 513 ------
NM_018254chr132023 1949 93 22466 1697 2948 491 --
NM_018257chr2031847 1830 726 --11931 --
NM_018263chr262464 2379 1923 1708 929 397 22626 595 ----
NM_018287chr102866 421 ----1244
NM_018293chr322889 2796 12954 ----
NM_018299chr842483 1084 564 136 12312 12625 --
NM_018313chr342637 2195 671 112 1476 ----
NM_018327chr2021885 1771 ------
NM_018328chr2157 ------
NM_018334chr71187 ------
NM_018340chr1684817 4438 3756 3447 1641 673 465 244 24706 3441 21040 188 --
NM_018351chr1274682 1384 1307 900 881 506 261 11552 24094 2951 13652
NM_018361chr8113609 3241 2640 1619 1448 1176 1169 443 419 321 253 --14110 --
NM_018362chr1153591 2631 1394 807 521 ------
NM_018364chr173416 3391 2568 1273 612 474 186 --23633 1416 --
NM_018368chr6154 ------
NM_018372chr12546 194 ------
NM_018374chr765039 4756 4082 1900 1567 659 24871 3381 ----
NM_018375chr141464 11546 1107 --
NM_018387chr92219 126 ------
NM_018388chrX3989 951 463 ------
NM_018398chr3------1125
NM_018401chr441528 226 161 40 --11880 --
NM_018403chr384029 3645 3537 3267 3133 2859 599 129 14087 --12737
NM_018409chr463191 3137 2980 2944 2679 2338 12210 1569 --
NM_018424chr951520 1462 1360 747 426 31450 688 529 ----
NM_018429chr532192 204 170 1755 ----
NM_018433chr23574 516 92 ------
NM_018440chr8137997 7935 7856 6854 5979 5838 5625 5436 5317 3087 2852 1632 240 67739 6418 3032 2322 2247 295 12122 11001
NM_018441chr2146 ----1647
NM_018444chr851867 1752 333 108 86 ------
NM_018445chr15----1514 --
NM_018446chr3----130 --
NM_018448chr1241308 1089 301 172 21234 508 ----
NM_018449chr91725 --1710 --
NM_018452chr6_random73349 3013 2639 2633 2561 2476 1264 23332 2581 13596 13403
NM_018460chr2162 ------
NM_018462chr32807 221 ------
NM_018464chr103388 307 145 ------
NM_018469chr1741024 555 501 175 21521 991 ----
NM_018471chr22481 157 1182 1144 --
NM_018482chr872091 1865 981 804 600 253 239 12523 ----
NM_018488chr172275 175 --1754 --
NM_018489chr12303 29 ----12350
NM_018490chr1121456 72 ------
NM_018534chr21112 --1244 --
NM_018557chr211289 ------
NM_018566chr194994 4412 4337 4073 3635 3358 1939 1718 1128 34528 3999 1447 --11511
NM_018584chr13960 325 135 ------
NM_018602chr154623 481 404 243 ------
NM_018638chr1265645 4441 4217 3817 1654 585 44530 3598 1559 983 ----
NM_018640chr1252769 2491 564 382 152 1684 12674 --
NM_018652chr154960 286 144 83 ------
NM_018653chr171390 ------
NM_018657chr32290 50 ------
NM_018667chr1632672 2409 379 --2577 326 --
NM_018682chr72715 197 --1546 --
NM_018685chr7185 145 ----
NM_018686chr121347 ------
NM_018689chr1552633 2443 2072 1026 920 1866 --1661
NM_018695chr552292 2058 819 694 376 ------
NM_018704chr161560 1547 1393 765 740 194 ------
NM_018710chr841123 440 237 69 ------
NM_018712chr114597 231 183 135 ----11439
NM_018715chr142149 1699 118 51 --21597 1565 --
NM_018717chr412874 1180 ----
NM_018718chr72288 78 11449 161 --
NM_018834chr54825 818 787 744 ------
NM_018837chr204950 740 717 250 ------
NM_018840chr201443 ----1383
NM_018841chr1103980 3774 3720 3403 3357 3185 2595 1396 1056 671 ----13787
NM_018844chr711740 ------
NM_018847chr92316 65 --1541 --
NM_018898chr552253 2185 1856 1695 157 ------
NM_018899chr552253 2185 1856 1695 157 ------
NM_018900chr552253 2185 1856 1695 157 ------
NM_018901chr552253 2185 1856 1695 157 ------
NM_018902chr552253 2185 1856 1695 157 ------
NM_018903chr552253 2185 1856 1695 157 ------
NM_018904chr552253 2185 1856 1695 157 ------
NM_018905chr552253 2185 1856 1695 157 ------
NM_018906chr552253 2185 1856 1695 157 ------
NM_018907chr552253 2185 1856 1695 157 ------
NM_018908chr552253 2185 1856 1695 157 ------
NM_018909chr552253 2185 1856 1695 157 ------
NM_018910chr552253 2185 1856 1695 157 ------
NM_018911chr552253 2185 1856 1695 157 ------
NM_018912chr52627 320 ------
NM_018913chr52627 320 ------
NM_018914chr52627 320 ------
NM_018915chr52627 320 ------
NM_018916chr52627 320 ------
NM_018917chr52627 320 ------
NM_018918chr52627 320 ------
NM_018919chr52627 320 ------
NM_018920chr52627 320 ------
NM_018921chr52627 320 ------
NM_018922chr52627 320 ------
NM_018923chr52627 320 ------
NM_018924chr52627 320 ------
NM_018925chr52627 320 ------
NM_018926chr52627 320 ------
NM_018927chr52627 320 ------
NM_018928chr52627 320 ------
NM_018929chr52627 320 ------
NM_018945chr652884 986 979 911 132 13050 21442 661 13541
NM_018948chr1----11095 --
NM_018951chr72811 126 ------
NM_018963chr2131307 460 28 --21149 105 --
NM_018970chr742992 2500 1132 911 3849 433 358 ----
NM_018976chr1242480 1966 1020 933 ------
NM_018977chrX1945 ------
NM_018979chr1242418 2271 1789 104 ------
NM_018999chr1064600 1862 1400 1334 517 401 54425 4408 3482 959 928 ----
NM_019003chrX1117 ------
NM_019004chr72765 643 --12014 --
NM_019006chr15298 33 ----1620
NM_019010chr171257 1341 ----
NM_019016chr17----2152 88 --
NM_019022chr1852784 2751 1137 1117 832 12573 ----
NM_019027chr451804 1057 766 246 208 12392 ----
NM_019028chr111382 ------
NM_019042chr72379 65 ------
NM_019049chr13560 140 113 ------
NM_019050chr43852 649 197 ------
NM_019066chr151136 1317 ----
NM_019071chr7----197 --
NM_019080chr1351483 1277 469 188 168 ------
NM_019083chr121453 1202 --1213 --
NM_019084chr1032520 596 337 3910 578 382 ----
NM_019091chr21992 --1228 --
NM_019106chr2232538 860 808 12222 1124 --
NM_019116chr1673407 2703 2457 1318 1265 802 403 --1757 --
NM_019555chr31136 ----139
NM_019556chrX31133 1009 69 11426 ----
NM_019593chr2073061 2765 2497 2162 808 481 441 12881 13159 --
NM_019594chr941004 487 365 166 ------
NM_019596chr2142567 1130 982 536 31104 988 748 ----
NM_019600chr151526 1569 ----
NM_019606chr72356 220 ----1399
NM_019842chr6----1358 --
NM_019860chr1011114 1283 ----
NM_019862chr1621308 491 --21628 1497 1627
NM_019885chr242924 2083 818 442 --1417 --
NM_019891chr121267 964 ------
NM_019895chr32353 204 ------
NM_019898chr1621308 491 --21628 1497 1627
NM_019899chr1621308 491 --21628 1497 1627
NM_019900chr1621308 491 --21628 1497 1627
NM_019903chr1021209 169 ------
NM_020062chr202898 677 ------
NM_020066chr13920 401 284 ------
NM_020122chr285421 5100 4807 4291 1899 1824 648 163 44428 3976 2154 1813 11453 --
NM_020123chr1031061 978 334 1619 ----
NM_020135chr6--1305 ----
NM_020137chrX1352 ------
NM_020141chr152151 1755 1696 612 128 11677 ----
NM_020143chr22842 379 21152 410 ----
NM_020144chr752074 1793 1505 1365 1311 11422 1122 --
NM_020147chr152736 64 ------
NM_020148chr1822438 939 12464 1413 --
NM_020150chr1032252 1473 888 1302 11704 --
NM_020152chr213952 703 669 ------
NM_020154chr15124 1303 ----
NM_020159chr421683 126 11596 ----
NM_020168chr15--1985 11326 --
NM_020177chr582743 2683 2385 2367 2291 1089 435 308 22224 838 ----
NM_020178chr172966 178 ------
NM_020180chr182213 192 --1481 --
NM_020182chr2033451 3023 1422 ------
NM_020189chr8--1176 ----
NM_020193chr1121342 1229 ------
NM_020198chr1741128 1099 1064 80 ------
NM_020200chr1011035 --194 --
NM_020205chr143446 3385 3225 803 ------
NM_020225chr42302 76 ----195
NM_020226chr41313 --1498 --
NM_020228chr112424 169 12313 21794 1038 --
NM_020239chr12569 29 1918 1817 --
NM_020240chr52765 500 22244 817 32485 810 114 --
NM_020245chr6104686 4617 4350 3920 3618 1597 1377 539 483 234 1225 ----
NM_020307chr31299 ------
NM_020317chr11108 ------
NM_020336chr2073765 3547 3526 3007 2951 2796 1486 1607 --1311
NM_020337chr43761 676 467 11952 ----
NM_020338chr1093696 3171 3066 2830 2365 996 734 577 383 13511 --13726
NM_020340chr642147 886 190 74 ------
NM_020341chr2012045 --2182 159 --
NM_020342chr222204 55 11763 ----
NM_020346chr1161468 1275 1262 471 219 193 1321 ----
NM_020348chr1032755 1004 128 1425 --11786
NM_020357chr331412 1227 509 --11107 --
NM_020360chr171418 --1612 --
NM_020390chr353706 1537 1415 1231 105 34790 3517 1655 11526 --
NM_020403chr132305 260 ------
NM_020416chr442422 2132 2046 909 ------
NM_020423chr11237 ------
NM_020426chr17167 ------
NM_020432chr71748 1820 --21906 1590
NM_020443chr197027 6370 6339 5360 2746 2068 1869 1191 915 12464 ----
NM_020445chr71697 ------
NM_020449chrX----1113 --
NM_020452chr122114 1353 --21649 74 --
NM_020453chr431696 271 109 1631 164 --
NM_020456chr1332274 609 201 ------
NM_020463chr22926 518 ------
NM_020465chr1621967 1572 1200 ----
NM_020466chr6105034 4007 3850 3486 3454 3108 1957 408 178 53 13267 --11123
NM_020474chr1821792 62 --11293 --
NM_020526chr131852 1241 641 ----1673
NM_020532chr2133 1193 1317 --
NM_020546chr563041 2886 1174 883 679 374 --1911 --
NM_020640chr32570 148 1249 --12205
NM_020644chr111749 --1860 --
NM_020647chr842319 789 593 380 1528 --1727
NM_020654chr331512 648 64 --11208 --
NM_020666chr52775 673 ------
NM_020699chr154861 4694 2136 924 841 14750 --15334
NM_020703chr12465 387 ------
NM_020715chr1431774 1726 1549 --11873 --
NM_020718chr16105376 4175 2627 2544 2065 1651 1431 1024 962 655 34791 4053 1197 11264 --
NM_020727chr2163289 2881 2827 2767 841 817 12451 --13528
NM_020728chr733066 2716 469 22888 148 ----
NM_020732chr63951 431 327 ------
NM_020734chr1273090 2928 2064 1067 963 827 476 --1847 --
NM_020739chr1584081 4026 3932 3460 2837 701 555 23 22817 152 ----
NM_020742chrX62745 2188 2113 1669 416 244 32459 2087 315 ----
NM_020747chr51686 1120 ----
NM_020748chr1731763 739 191 11576 ----
NM_020749chr851921 1769 1480 689 37 1548 1282 11402
NM_020750chr62947 43 ------
NM_020752chr1022772 2080 1244 11037 --
NM_020753chr17------1220
NM_020760chr261659 1539 1391 483 378 23 --11447 --
NM_020762chr123868 687 173 ------
NM_020765chr11287 ------
NM_020766chrX64604 3582 3145 1302 1167 935 13565 11063 --
NM_020768chr522524 107 ------
NM_020769chrX1341 2943 637 ----
NM_020772chr17168211 8069 7940 7853 7699 7391 7273 7120 6753 6653 6245 5639 2491 1952 1482 419 45621 2632 2349 1877 15248 --
NM_020774chr18125664 5580 5037 4352 4310 1886 1293 1267 1065 747 297 37 22282 369 22049 613 15756
NM_020776chr1853090 1026 483 453 227 22484 308 ----
NM_020779chr282683 2646 2419 2051 857 799 624 532 --32563 2245 2069 --
NM_020783chr1852134 1783 1506 518 230 2586 528 21705 1688 --
NM_020786chr1621912 1430 21565 1412 ----
NM_020791chr1711133 1960 ----
NM_020792chr342774 2254 1890 1779 ------
NM_020796chr522920 2748 21161 1085 ----
NM_020800chr311153 ------
NM_020801chr532089 805 74 --21692 48 --
NM_020803chr472457 2032 967 907 703 587 465 ----11481
NM_020805chr1861817 1784 1600 681 545 385 2569 229 ----
NM_020806chr142327 123 ------
NM_020809chr1111512 1754 31758 775 287 --
NM_020810chr1493631 3357 3215 3072 3041 2877 1061 908 22 13399 ----
NM_020824chr101614 ------
NM_020825chr1673073 2909 2671 2553 2340 1323 833 21343 284 42942 2491 332 94 --
NM_020834chr1441826 1686 1285 526 1429 ----
NM_020839chr321510 1333 1552 --1596
NM_020841chr1293970 3651 2877 2501 1583 1071 862 226 150 13349 13168 --
NM_020843chr151412 ------
NM_020850chr1653108 2232 2036 1086 340 23275 2412 ----
NM_020854chr1811352 1627 ----
NM_020856chr192379 312 --1364 --
NM_020858chr1532261 517 228 1448 2647 538 --
NM_020860chr431188 253 38 --1388 --
NM_020866chr1321108 435 ------
NM_020868chr231498 348 150 ------
NM_020870chr431594 468 423 1894 ----
NM_020871chrX32534 852 622 11936 ----
NM_020872chr321710 1339 ------
NM_020899chr1742514 2507 378 176 ------
NM_020909chr274058 3970 3650 2710 913 804 791 22739 2568 126 --
NM_020918chr1053432 3403 3050 1342 1107 --32724 2375 2238 11470
NM_020922chrX41700 1407 1398 308 ------
NM_020925chr11136 ----1516
NM_020935chr244096 3791 1714 1111 11650 1979 --
NM_020940chr1022498 365 149 1275 --
NM_020948chr183520 2950 2647 1137 1015 492 319 242 12420 ----
NM_020951chr1911519 11698 191 --
NM_020952chr92356 178 ----1856
NM_020958chr14----1270 --
NM_020960chr994856 4764 4333 4223 3564 3458 3262 1769 309 14417 ----
NM_020962chr1572489 2160 2123 1658 796 768 580 --11778 1504
NM_020972chr411105 ----188
NM_020977chr441535 1433 305 280 --32121 1978 136 --
NM_020980chr153695 146 60 --1308 --
NM_020981chr21289 1243 --1815
NM_020983chr12----21937 927 --
NM_020987chr1021283 226 1296 ----
NM_020988chr1621067 238 21158 281 ----
NM_020993chr1211983 12856 21915 762 --
NM_021005chr1531082 1022 323 ------
NM_021007chr232346 1616 519 11759 ----
NM_021012chr1763214 3173 2362 1983 1069 880 ------
NM_021032chr341597 534 469 67 ------
NM_021033chr1362847 1074 952 548 222 157 13457 12736 --
NM_021035chr2031218 495 214 --11304 11266
NM_021069chr471984 1681 1421 678 438 369 122 21634 362 11464 --
NM_021072chr53994 447 77 --11697 --
NM_021079chr1753291 2907 2618 1180 1085 23344 964 12216 --
NM_021083chrX13371 2791 538 13493 --
NM_021088chr221868 414 --1595 1816
NM_021090chr2244342 1642 1631 529 23447 3052 11763 --
NM_021097chr262499 2427 1124 758 571 218 ------
NM_021101chr331677 663 380 1682 ----
NM_021116chr7139033 8595 7969 7624 7543 7423 6809 6349 6217 5793 3309 2066 877 ----15884
NM_021120chrX53147 3093 2880 743 484 1214 2677 420 --
NM_021132chr103506 446 30 ------
NM_021136chr141468 ------
NM_021140chrX2394 85 1265 ----
NM_021148chr742347 1932 1823 119 ------
NM_021149chr1631199 1151 1036 2419 191 1336 --
NM_021155chr1942585 2049 1133 503 --12189 --
NM_021156chr2011103 2965 756 ----
NM_021163chr763434 2618 1515 1108 771 112 13874 ----
NM_021174chr81229 ------
NM_021176chr241410 1309 1293 416 11584 ----
NM_021180chr13774 738 621 1716 ----
NM_021183chrX52339 1737 1644 894 698 ------
NM_021189chr11242 ------
NM_021190chr141326 843 530 339 ------
NM_021191chr1262012 2002 1731 1701 605 317 ------
NM_021202chr2042206 2074 222 153 ------
NM_021204chr41959 ------
NM_021222chr131449 1317 356 ------
NM_021227chr41356 ------
NM_021229chr1221083 148 ------
NM_021238chr1241908 1614 628 163 ------
NM_021239chr141903 128 ----
NM_021240chr93475 80 62 ------
NM_021245chr10130 ------
NM_021252chr1071808 1786 1387 1315 811 696 49 ------
NM_021253chr641149 1083 377 114 ----11338
NM_021255chr1433592 2848 744 11233 13694 --
NM_021260chr1441137 1076 278 239 ------
NM_021572chr62992 505 1845 1976 --
NM_021574chr2271997 1898 1739 874 480 407 256 ------
NM_021622chr1022272 910 22152 221 ----
NM_021629chr3114770 4252 3937 3498 3298 1826 888 879 841 480 329 54709 4317 3655 1993 806 14785 --
NM_021637chrX21119 226 11165 ----
NM_021638chr464529 4355 3507 3476 3423 288 ------
NM_021643chr22584 381 ------
NM_021644chr102934 40 ------
NM_021705chr621260 415 2332 245 ----
NM_021738chr103742 677 240 1806 ----
NM_021785chrX170 ------
NM_021803chr4161 ------
NM_021809chr2031678 1580 114 --12346 --
NM_021813chr665838 5197 4813 4705 4557 1497 54930 4483 1300 1182 346 ----
NM_021814chr621518 198 11234 ----
NM_021871chr41152 --148 --
NM_021905chr652063 2018 1997 429 370 11466 ----
NM_021911chr565444 5222 2052 826 639 367 1145 13603 --
NM_021912chr1553522 3251 1588 1207 863 43443 2676 910 837 1724 --
NM_021913chr1921494 1355 ------
NM_021914chr1472263 2192 2179 2046 1885 1527 44 ------
NM_021935chr3--141 ----
NM_021940chr621051 60 ------
NM_021943chr622072 2024 ------
NM_021947chr17--1853 --1486
NM_021949chrX31038 446 203 --1773 --
NM_021950chr1162229 2065 1386 855 110 78 ------
NM_021951chr91790 ------
NM_021954chr1343694 2705 1390 452 --22957 929 --
NM_021956chr61266 ------
NM_021960chr122142 1791 12124 12212 --
NM_021961chr11127081 6613 6363 5883 5825 5623 2921 2829 2505 1418 1351 362 25274 1305 54589 2117 1807 1362 1092 --
NM_021964chr395925 4586 2655 2330 2243 2102 1252 1155 1010 24271 2508 26548 157 24631 1296
NM_021973chr45507 490 191 179 115 1285 ----
NM_021980chr1011410 ------
NM_021998chrX31523 982 236 ------
NM_021999chr132537 311 1135 ----
NM_022006chr191372 ------
NM_022036chr171390 ------
NM_022037chr22945 683 ------
NM_022041chr1622632 330 12584 ----
NM_022048chr15126075 5311 4455 2514 2152 1992 1841 1492 1396 1005 189 70 24204 2103 34159 4090 1041 15417
NM_022049chr121835 1481 11226 1176 --
NM_022062chr1121883 552 --11762 --
NM_022067chr142659 34 1752 1799 --
NM_022068chr181207 --183 --
NM_022080chr2052630 471 394 375 188 ------
NM_022085chr631180 1058 130 --11405 --
NM_022093chr11162 1699 ----
NM_022114chr1104673 3524 1893 1863 1690 1523 1440 967 660 201 ------
NM_022116chr731061 906 335 --127 --
NM_022118chr131187 ------
NM_022123chr142108 58 ------
NM_022124chr103461 251 188 1556 ----
NM_022130chr51435 ------
NM_022131chr331530 1272 1038 --1393 --
NM_022133chr871868 1669 1357 1251 723 509 414 ------
NM_022138chr621259 265 ------
NM_022154chr4255 37 ------
NM_022166chr1665764 5522 5176 4512 1752 1701 12178 21828 478 11134
NM_022167chr172856 850 1113 ----
NM_022170chr741644 1607 1152 191 ------
NM_022171chr351463 1211 1154 1112 487 11569 ----
NM_022173chr22945 683 ------
NM_022346chr42422 346 ------
NM_022351chr813174 ------
NM_022361chr6----1409 --
NM_022373chr7--1256 1787 --
NM_022374chr22500 358 1150 ----
NM_022444chr751950 1890 437 310 198 1321 1530 --
NM_022459chr13116056 5609 4691 4345 4156 2098 1949 1810 1728 1677 1604 25122 887 15337 --
NM_022461chr34507 440 122 42 11208 --1493
NM_022465chr1232991 524 75 --11212 --
NM_022473chr1574166 3410 3144 2982 1388 1026 901 22845 1548 ----
NM_022474chr1432782 2394 936 21890 756 1320 --
NM_022475chr4140 1602 ----
NM_022476chr161827 ------
NM_022477chr2021088 222 169 ----
NM_022484chr7----11108 --
NM_022490chr9164 ----1444
NM_022497chr353776 3255 2854 1116 248 ------
NM_022550chr52103 52 ------
NM_022572chr241722 1544 397 263 1368 11732 --
NM_022640chr171244 ------
NM_022650chr54928 902 301 292 ------
NM_022652chr1221073 364 ------
NM_022659chr8------1145
NM_022716chr162594 2254 1073 908 654 555 22196 771 ----
NM_022719chr2283868 3723 3538 2888 2619 2454 1402 283 2726 332 ----
NM_022730chr22652 69 11064 ----
NM_022737chr1921294 1269 ------
NM_022739chr172852 281 1414 ----
NM_022753chr162579 2495 2475 2280 1961 1717 21109 716 --162
NM_022758chr652830 2640 2354 2121 332 ------
NM_022763chr363170 2873 2207 2201 1981 397 ------
NM_022778chr131507 1089 129 --11206 11074
NM_022780chr241148 588 493 214 ----155
NM_022781chr942753 2252 953 440 22695 2132 --1910
NM_022818chr1641409 1346 633 500 ------
NM_022824chr521641 1271 --11190 --
NM_022826chr21930 ------
NM_022828chr52166 141 21115 287 ----
NM_022841chr1542020 1114 763 33 21078 313 --12730
NM_022843chr1341408 1330 1077 185 ------
NM_022845chr1672175 2160 1497 1386 503 474 33 --1187 --
NM_022875chr52380 83 ------
NM_022877chr52380 83 ------
NM_022893chr222018 292 ----12680
NM_022894chr251440 1410 1283 519 260 --11136 --
NM_022898chr1474482 3708 3513 3161 3119 1401 1121 34785 4676 1314 ----
NM_022902chr5----1324 --
NM_022910chr1621967 1572 1200 ----
NM_022912chr263075 2936 2820 2447 834 459 1627 ----
NM_022913chr52257 43 ------
NM_022918chr1141575 641 465 41 ------
NM_022965chr41607 --1191 --
NM_022977chrX12228 11868 --11042
NM_023000chr1431222 1081 140 ----11685
NM_023001chr1431222 1081 140 ----11685
NM_023010chrX----1660 --
NM_023012chr121536 ------
NM_023015chr12706 508 ------
NM_023016chr292511 2299 2170 2016 696 492 486 370 267 12743 ----
NM_023071chr122993 238 ------
NM_023072chr192988 775 1838 11144 187
NM_023079chr171201 --189 --
NM_023105chr822235 2034 ------
NM_023106chr822235 2034 ------
NM_023110chr822235 2034 ------
NM_023111chr822235 2034 ------
NM_023923chr153523 3178 2572 2395 837 23531 1447 --1152
NM_023927chr541129 1066 1054 251 11331 ----
NM_023929chr832642 853 34 ------
NM_024007chr543005 1981 630 578 12126 ----
NM_024016chr171522 --1172 --
NM_024019chr411082 1112 1164 --
NM_024052chr1732414 1998 1045 ------
NM_024054chr7--1312 1336 --
NM_024060chr11----1222 --
NM_024085chr21705 --1851 --
NM_024087chrX3628 165 154 ------
NM_024089chr131134 ------
NM_024090chr43630 368 214 --21906 760 --
NM_024094chr84916 299 136 115 1129 ----
NM_024165chr61209 ------
NM_024294chr652830 2640 2354 2121 332 ------
NM_024295chr82366 41 ------
NM_024312chr1251568 1452 425 47 36 ------
NM_024321chr191129 ------
NM_024336chr161340 ------
NM_024344chr151502 ------
NM_024345chr984676 4521 4507 4103 2286 1651 725 208 45701 3946 3933 3925 25915 180 --
NM_024408chr183436 3218 3059 2610 2529 1490 333 181 --1434 --
NM_024411chr2031411 1387 142 ------
NM_024416chr951521 1401 1352 1305 393 ----1106
NM_024422chr181388 --1711 --
NM_024482chr1182 ------
NM_024490chr15------1541
NM_024491chr32525 227 ------
NM_024496chr142791 280 ------
NM_024522chr13762 136 130 ----11410
NM_024524chr3102956 2668 2532 2097 2041 1958 824 797 611 248 --13094 --
NM_024529chr12340 21 ------
NM_024539chrX2972 359 ------
NM_024548chr341507 1386 1341 1164 --11260 --
NM_024551chr1222527 2216 ------
NM_024551chr1222527 2216 ------
NM_024561chr1331096 1087 73 ------
NM_024569chr172965 2865 2307 2038 1990 1882 497 ------
NM_024582chr41252 ------
NM_024586chr11600 1122 ----
NM_024594chr541944 1884 1396 556 11780 ----
NM_024612chr1721089 1082 ------
NM_024617chr91787 172 ----
NM_024624chr221280 335 --11503 --
NM_024645chr841223 1042 605 107 --143 --
NM_024646chr193276 3196 1540 1396 1185 1018 815 500 242 34012 3010 1057 ----
NM_024659chr21705 ------
NM_024665chr3124639 4405 4251 4198 3637 3506 3063 1852 1616 1586 1332 250 14222 ----
NM_024670chr101592 ------
NM_024674chr182540 2388 2078 1176 770 699 690 457 11969 --1113
NM_024680chr111491 ------
NM_024692chr211282 --1294 --
NM_024699chr82694 321 ------
NM_024700chr141147 814 796 228 1927 ----
NM_024713chr1551620 1356 1283 263 26 ------
NM_024721chr842711 984 514 437 11794 ----
NM_024740chr1163994 3385 1659 668 397 34 2600 272 23693 1102 --
NM_024749chr121678 459 11845 21436 65 --
NM_024755chr152789 376 ------
NM_024757chr911127 ------
NM_024769chr1131147 726 151 --1408 1214
NM_024770chr285060 4349 4286 4220 2664 1802 1004 148 16297 26009 5895 --
NM_024779chr1261599 1557 1493 1425 1159 299 ------
NM_024786chr54913 260 214 202 1145 ----
NM_024811chr1121394 1383 --149 --
NM_024817chr1595627 4459 4428 4091 1844 1825 1407 804 250 25418 4862 ----
NM_024824chr1411556 --11588 --
NM_024828chr921545 65 ------
NM_024834chr105752 524 460 298 118 ------
NM_024852chr12686 266 ------
NM_024874chr131231 106 94 ------
NM_024911chr11629 ------
NM_024917chrX21022 671 --1856 --
NM_024930chr532142 787 80 ------
NM_024939chr161514 --21377 260 --
NM_024944chr2111218 ----1462
NM_024946chr1611692 1686 --11731
NM_024947chr3129618 9393 7856 6647 6533 3592 3294 2827 1533 357 177 146 47062 6045 2597 806 --18822
NM_024949chr454937 3856 3725 3420 427 24956 4367 13797 11854
NM_024953chr1242695 2146 295 54 ----12075
NM_024969chr22821 576 1251 ----
NM_024971chr92356 178 ----1856
NM_024989chr297472 7371 6417 6012 5132 1924 1877 1600 1452 21157 373 --11958
NM_024993chr211289 --125 --
NM_025054chr872955 2909 2736 2610 1547 1449 464 33370 1177 406 11465 --
NM_025057chr142915 555 ------
NM_025065chr1195 ------
NM_025073chr183807 3573 1528 1515 1374 316 299 243 21761 1142 13642 --
NM_025076chr21623 --1240 --
NM_025079chr11639 --1247 --
NM_025106chr121418 1371 --11804 --
NM_025126chr122632 526 154 ----
NM_025134chr1621921 1807 1111 ----
NM_025138chr131159 11062 ----
NM_025146chr332458 1038 388 11961 ----
NM_025147chr2196 ------
NM_025151chr841860 1610 1417 112 ------
NM_025152chr1451388 798 743 666 242 22014 1249 --11233
NM_025154chr731273 424 281 --1288 --
NM_025160chr184027 3670 3512 3405 3315 2994 2760 129 13613 ----
NM_025164chr1142052 1519 245 65 --1885 --
NM_025179chr184562 4518 4241 3856 3689 3031 795 465 14410 --14528
NM_025182chr91986 156 ----
NM_025184chrX1835 1212 ----
NM_025191chr142965 882 871 517 ------
NM_025195chr871775 1465 727 439 427 241 52 1295 2267 46 --
NM_025208chr1152443 2311 706 590 215 32284 742 530 1484 --
NM_025212chr4131 ------
NM_025221chr431300 574 410 21168 228 ----
NM_025222chr342944 2364 1152 182 12531 1306 --
NM_025235chr1062208 2032 1848 1730 371 95 1524 11618 --
NM_025236chr63811 710 79 ------
NM_025237chr1741299 1146 312 62 ------
NM_025238chr155587 532 518 259 21 ------
NM_025244chr2181 ------
NM_025248chr1742863 308 74 53 --12288 --
NM_025250chr772799 2272 887 815 517 476 123 12528 12862 --
NM_025263chr651249 1221 665 327 236 ------
NM_030621chr1473539 3075 1645 1389 1312 1275 415 12929 ----
NM_030625chr1041680 867 740 473 2107 98 ----
NM_030627chr543936 3271 1602 488 --1883 --
NM_030634chr172184 1788 525 515 509 469 180 --22051 616 --
NM_030647chr7126048 5049 4044 1690 1515 1373 1344 882 875 822 815 147 32531 1943 420 36017 5894 5520 --
NM_030648chr485295 4712 4695 4678 3649 494 445 232 21650 556 25338 859 11200
NM_030650chr2114285 4119 3686 3532 3240 3221 3176 2908 1689 1255 889 33895 1426 148 --12668
NM_030660chr1441365 1058 416 293 --1451 --
NM_030664chr1051930 1632 906 632 114 12189 ----
NM_030674chr1231946 1133 882 11335 15426 --
NM_030751chr1021738 350 11912 ----
NM_030751chr1021738 350 11912 ----
NM_030758chr222577 394 21224 948 ----
NM_030759chr101662 ----1186
NM_030762chr1242005 1946 1367 336 --1667 --
NM_030763chrX2903 132 ------
NM_030777chr2042388 391 255 51 --11740 --
NM_030786chr141751 1451 765 356 11521 ----
NM_030791chr1441141 605 484 148 ------
NM_030799chr532117 1887 1365 1847 1145 --
NM_030803chr221243 917 ------
NM_030806chr1149168 8841 8530 8444 6507 3773 3623 2638 2557 2333 2308 1640 643 442 --1415 36708 6429 5798
NM_030808chr172907 756 --1440 --
NM_030809chr1211736 22234 68 --11591
NM_030810chr631180 1058 130 --11405 --
NM_030816chr173116 2411 2338 1472 1331 608 434 1628 ----
NM_030817chr1293541 3442 2792 2666 2355 2325 1494 736 545 ------
NM_030820chr6--2796 391 --161
NM_030821chr43761 568 207 ------
NM_030881chr2262454 1924 1635 764 578 442 11696 --1758
NM_030885chr331728 222 85 12366 --12103
NM_030912chr101909 ------
NM_030915chr232343 533 40 1574 ----
NM_030918chr155299 4986 1379 1085 138 24682 880 ----
NM_030920chr121400 59 11864 --1338
NM_030935chr73373 317 152 ------
NM_030939chr63305 250 124 1168 ----
NM_030949chr611379 --11102 --
NM_030962chr1131402 1110 214 --11057 --
NM_030963chr62616 93 ------
NM_030978chr92123 83 ------
NM_030981chr1141158 853 135 97 ------
NM_031203chr19----1214 --
NM_031208chr165930 753 715 209 184 1371 ----
NM_031216chr1851974 1861 1763 645 542 ------
NM_031226chr1521283 116 --134 --
NM_031243chr71686 1115 ----
NM_031262chr951121 1113 1019 363 97 --133 --
NM_031263chr951178 1170 1076 420 154 --190 --
NM_031266chr51392 ----1119
NM_031267chr71213 1525 ----
NM_031268chr1684683 4127 3917 3744 2027 1347 1289 134 22165 1971 1545 --
NM_031271chr831526 1338 609 ------
NM_031296chr472751 1969 847 550 238 148 103 12445 --12334
NM_031314chr1432048 1320 96 ------
NM_031371chr111394 ------
NM_031371chr111394 ------
NM_031372chr431078 468 48 1245 ----
NM_031407chrX2477 146 --1410 --
NM_031411chr552253 2185 1856 1695 157 ------
NM_031412chr1211151 11142 2825 793 --
NM_031419chr32217 62 --11576 --
NM_031422chr181503 ------
NM_031438chr521839 505 1271 11664 --
NM_031442chrX22223 499 13172 2594 63 --
NM_031445chr223300 2111 1211 ----
NM_031461chr822067 381 ------
NM_031468chr7107956 6010 5823 5580 3172 1011 710 313 307 179 15015 25698 793 26344 1054
NM_031483chr2051248 1221 418 149 75 12911 23326 574 --
NM_031844chr183583 3572 3151 1337 898 769 735 355 --1973 --
NM_031845chr241316 856 609 290 21153 362 13611 --
NM_031847chr241316 856 609 290 21153 362 13611 --
NM_031849chr552253 2185 1856 1695 157 ------
NM_031850chr31818 ------
NM_031850chr31818 ------
NM_031857chr552253 2185 1856 1695 157 ------
NM_031860chr552253 2185 1856 1695 157 ------
NM_031890chr2233021 2376 862 --1778 --
NM_031899chr31507 137 ----
NM_031908chr551388 987 870 271 209 ------
NM_031922chr62393 154 ------
NM_031935chr12970 389 ------
NM_031989chr12--1300 ----
NM_031992chr741644 1607 1152 191 ------
NM_032012chr931810 1531 905 1977 --24338 3637
NM_032013chr2021088 222 169 ----
NM_032015chr112619 77 1786 ----
NM_032047chr322131 1862 2372 196 22322 622 --
NM_032049chr31818 ------
NM_032049chr31818 ------
NM_032052chr223985 335 325 ------
NM_032088chr52627 320 ------
NM_032092chr52627 320 ------
NM_032105chr1127783 7146 6811 3136 2809 2568 1820 1592 1270 1035 781 174 12458 ----
NM_032121chrX32758 1056 457 11760 1486 --
NM_032124chr1821069 832 ------
NM_032142chr181171 ------
NM_032144chr241550 1140 228 37 --1513 --
NM_032146chr31118 ------
NM_032147chr121330 ----1954
NM_032153chr322762 1925 --3849 119 59 --
NM_032154chr103387 294 178 1332 --159
NM_032160chr1854019 3407 1525 1099 869 11644 1402 11123
NM_032174chr121483 500 ------
NM_032189chr1354410 4115 3521 1921 1058 24935 1286 24146 1230 --
NM_032195chr214509 492 472 344 --2485 101 --
NM_032199chr1053369 2511 2406 2366 1359 1753 --1366
NM_032208chr222415 1373 --22796 599 --
NM_032217chr421200 213 ------
NM_032221chr2032005 1615 570 ----11568
NM_032228chr1153498 3408 2884 2388 1393 2107 79 ----
NM_032229chr131898 ------
NM_032233chr143760 349 192 1322 ----
NM_032236chr1------1708
NM_032239chr411215 --1906 --
NM_032242chr323018 2466 ----1969
NM_032256chr122790 288 ------
NM_032287chr2264132 4022 2839 1216 994 26 --13718 14105
NM_032290chr535