TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4714-3p
miRNA Sequence: CCAACCUAGGUGGUCAGAGUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001014380chr1365874 4959 4781 4189 3981 1956 --11853 11183
NM_001033576chr1742499 2309 809 64 --2276 56 1322
NM_001100108chr178370 6544 6263 2744 2332 2142 235 12684 --26585 5058
NM_003034chr1267354 2520 2318 1798 447 47 12783 --15018
NM_003112chr722879 691 ----2835 705
NM_004171chr1198473 6997 5824 3395 2289 2269 2131 1490 1483 ------
NM_004501chr153689 3095 1656 1526 1187 13659 23754 1638 1141
NM_006750chr16117811 5700 2998 2765 2053 1782 969 824 754 556 267 --17312 --
NM_012164chr9107355 7004 5138 2917 2299 2061 1845 1396 623 274 14989 11529 --
NM_024947chr398786 8469 8394 7895 7325 6427 758 745 417 37395 7141 877 ----
NM_031844chr153689 3095 1656 1526 1187 13659 23754 1638 1141
NM_032116chr1365874 4959 4781 4189 3981 1956 --11853 11183
NM_033224chr755291 2871 2480 2268 824 --27385 394 27839 6922
NM_172071chr126647 371 --26921 5779 25093 2254
NM_173167chr1742499 2309 809 64 --2276 56 1322
NM_173468chr455560 5361 5117 128 104 12332 --25615 1883