TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4714-5p
miRNA Sequence: AACUCUGACCCCUUAGGUUGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000264chr962816 2810 2444 973 884 260 ----22472 936
NM_000390chrX23423 2627 1730 22303 55 12355
NM_000448chr1163176 3133 2777 2365 1004 852 --2838 676 --
NM_000555chrX57694 6862 6448 5972 5274 130 36246 2035 22 --
NM_000813chr542238 962 643 288 54182 3917 3592 1118 749 24461 1002 22094 1782
NM_001001928chr22158315 7602 7522 6913 6583 3253 3218 3080 2998 2938 2589 2204 1384 1013 112 ----18328
NM_001004065chr993704 3411 2786 2718 1349 1012 909 461 375 --13942 --
NM_001004317chr663833 980 942 523 197 173 --33938 3442 1369 --
NM_001005473chr555815 4124 1531 1227 702 12210 15227 --
NM_001008239chr1863859 3759 2332 1247 1141 1104 ----12746
NM_001012393chr1175009 4601 4178 3385 3227 1487 202 --24842 4465 --
NM_001012755chrX41204 1110 890 235 11519 11716 23576 529
NM_001014797chr10137988 7701 7275 7046 6269 6191 6005 5690 2299 1715 1423 1069 110 16473 47621 7185 5403 2244 --
NM_001018065chr966043 2093 2084 1330 849 582 24739 2403 11266 --
NM_001018066chr966043 2093 2084 1330 849 582 24739 2403 11266 --
NM_001031732chr453339 3286 2697 972 306 ----23531 3158
NM_001032394chr622688 439 --12497 1407
NM_001032395chr622555 306 --12364 1274
NM_001033576chr17112627 2543 2111 1937 1869 1009 873 727 546 178 47 ------
NM_001039547chr357639 5232 2802 1802 69 26735 1823 --16796
NM_001040665chr784553 4037 3257 1954 1442 1420 1082 144 --11230 --
NM_001042599chr2116488 5455 2539 2520 2498 2489 2474 2298 1880 996 171 ----11848
NM_001042603chr1285303 4825 2022 1267 1065 365 119 69 ----14222
NM_001100108chr1146559 6310 5881 5372 5064 3135 2679 2543 2049 1943 1343 857 475 233 16851 37025 2385 546 --
NM_001106chr3149338 8352 8168 7540 6728 6042 3691 3333 2315 2256 2223 1122 1030 699 18515 ----
NM_001167chrX76275 5668 4710 4677 4483 1647 477 16628 22512 391 1182
NM_001204chr256332 5089 4892 2986 258 17324 16576 21629 1410
NM_001259chr776389 6159 6115 5844 5053 2315 1284 --26369 1747 14452
NM_001609chr1073973 3892 3458 2904 1253 695 314 13025 23086 138 1587
NM_001616chr242420 1330 1284 1006 12389 --11188
NM_001695chr833203 2935 2917 14033 1237 13985
NM_001759chr1264427 3888 1762 1430 340 305 21977 298 11321 --
NM_001918chr189170 8696 8063 7688 6945 5756 3558 2056 15796 1222 --
NM_002336chr1263411 1814 1605 1189 413 90 14439 --13777
NM_002387chr5123984 3213 3175 3155 1853 1511 1451 1412 1076 835 788 21 ----13709
NM_002545chr1175009 4601 4178 3385 3227 1487 202 --24842 4465 --
NM_002837chr1283889 3742 1810 1408 814 695 650 532 14422 ----
NM_002977chr243140 3065 2942 2661 ----1695
NM_003034chr1287873 7067 6804 6376 6201 3109 1662 1593 134 ----
NM_003607chr183878 3718 3391 3051 2919 1338 530 359 --2728 249 --
NM_003679chr193419 2954 2905 2508 1271 927 668 490 299 1135 1900 --
NM_004171chr11189128 8784 8578 8528 8361 7160 7132 6289 6145 3695 3351 3078 2747 1959 1883 1247 806 139 12876 28764 1889 18675
NM_004272chr531945 1799 581 --11616 11350
NM_004586chrX54620 4591 3887 3322 1747 14640 --1838
NM_004612chr963926 1923 1707 1293 437 418 13071 13297 11714
NM_004726chrX95571 5158 5004 4870 4050 3595 1379 1132 316 1430 ----
NM_004745chr8116428 5095 5085 4745 4611 4567 4392 2463 1950 374 293 --21411 164 1951
NM_004834chr263022 2975 1200 439 83 36 12881 --13062
NM_004866chr573597 3561 1923 1754 1414 667 360 --13493 13704
NM_004992chrX128051 7262 6851 6447 2898 2415 1930 1710 873 726 510 359 --45941 1823 157 141 --
NM_004992chrX128051 7262 6851 6447 2898 2415 1930 1710 873 726 510 359 --45941 1823 157 141 --
NM_005036chr22158315 7602 7522 6913 6583 3253 3218 3080 2998 2938 2589 2204 1384 1013 112 ----18328
NM_005056chr1285547 5069 3423 1511 1309 609 363 313 ----14466
NM_005065chr1454741 1611 1499 1046 169 11006 --1284
NM_005188chr11137251 6755 6567 6106 6043 5889 5601 5279 5038 1979 1848 1605 29 11868 ----
NM_005235chr2116488 5455 2539 2520 2498 2489 2474 2298 1880 996 171 ----11848
NM_005359chr1886371 5953 4939 4194 4137 1495 314 212 --35664 5586 4546 --
NM_005840chrX107315 6531 3047 2778 2473 1977 1953 1867 1152 136 15681 ----
NM_005955chr1114957 4108 3426 1868 1725 1646 1434 911 841 529 483 --35068 3443 580 11174
NM_006420chr205883 626 539 468 388 --22675 2252 --
NM_006544chr1495607 5528 5209 4621 4342 3773 2054 1813 1525 ------
NM_006620chr654624 4545 3829 3026 1440 13300 --11025
NM_006628chr1544613 639 206 161 ----11580
NM_006646chr132732 487 12903 1392 12314
NM_007038chr2175544 3988 3924 3724 2422 2290 270 15158 25656 4768 --
NM_007050chr20126740 6732 6395 6230 3039 2650 2511 2487 2284 2212 486 28 ----26464 5158
NM_007203chr993704 3411 2786 2718 1349 1012 909 461 375 --13942 --
NM_007249chr1399319 9206 9179 9095 7666 7256 7058 6039 3522 16577 17143 --
NM_012164chr9116147 5083 2395 2228 1879 1609 1394 966 755 615 259 ------
NM_012234chr323502 1334 ----23236 38
NM_012382chr574307 3864 3734 3053 2894 1493 1289 --31509 1416 1025 1445
NM_014586chr21134388 3953 3933 3902 3862 3640 2930 1311 1174 1069 987 530 454 --171 --
NM_014721chr687016 6362 6108 5381 2352 1790 1496 554 24671 4533 27462 1514 --
NM_014826chr183878 3718 3391 3051 2919 1338 530 359 --2728 249 --
NM_014864chr194294 3147 1365 665 620 522 467 184 121 11301 13476 13426
NM_014877chr17106938 6857 6340 5926 5422 3072 2894 2157 1360 620 15143 15433 14782
NM_014912chr1063268 2350 796 414 204 72 ----1523
NM_015071chr5116455 5922 5908 5516 5484 5245 4746 4451 2519 1698 1462 15608 11576 --
NM_015092chr1663212 2866 1852 338 215 181 11074 11085 13744
NM_015310chr897530 6453 5862 5673 5528 5333 3038 1616 839 18230 11343 12233
NM_016206chr377191 6832 3016 2132 1717 1553 510 --18919 --
NM_016248chr1373593 3395 3178 3154 979 374 286 --13332 --
NM_016275chr322129 1701 --11074 1568
NM_016315chr211494 ----21298 603
NM_016422chr1153058 2908 2374 2361 1244 --1912 --
NM_016530chr1542819 2660 1187 629 --13201 13555
NM_016531chr443382 2781 1311 712 --22850 1357 24169 355
NM_016936chr1661897 1474 603 401 384 249 21657 1443 --1376
NM_017637chr9119040 8568 8365 7124 6521 3565 3058 3011 2275 1590 1221 28175 264 1252 --
NM_017644chr385043 5033 4071 3958 3202 1690 1384 1060 24571 3283 14969 11915
NM_017919chr974831 4633 4338 4279 3828 1860 455 --44786 4109 4052 918 --
NM_017994chr7102616 2599 2556 2402 2139 2110 1978 1193 1126 867 --1873 --
NM_018036chr1474000 3927 3812 3637 3380 1050 73 --33888 3279 54 --
NM_018084chr242665 2505 2381 528 12488 13162 11226
NM_018085chr1108056 7570 7275 5960 5827 3198 2679 2019 792 582 --17899 --
NM_018999chr1094309 4213 3801 1926 1554 1303 1190 962 27 13681 --14865
NM_020455chr622688 439 --12497 1407
NM_020456chr1382117 1678 1653 1600 1509 873 604 337 ----1645
NM_020673chr20116155 5986 5941 5913 5889 5640 5617 2842 1553 1376 421 17728 15846 --
NM_020772chr1773469 3212 2675 2549 1477 563 42 11684 --13029
NM_020774chr1834693 1953 1939 1121 --24334 573
NM_020956chr19174537 4474 4449 4418 3759 3293 2882 1888 1864 1786 1708 1630 1498 1362 1034 598 153 --11491 13722
NM_021090chr22134897 4874 4311 4138 1685 1460 1427 1232 1203 760 456 369 121 14787 21022 948 --
NM_021116chr7218139 7745 7709 7214 6985 6032 5852 3483 3298 2280 1926 1788 1611 1425 1366 857 712 510 361 350 121 ------
NM_021148chr752402 2034 1877 855 572 22093 272 1630 21798 719
NM_021629chr373958 3630 3102 1979 1723 1237 648 --34123 4117 267 --
NM_021911chr542238 962 643 288 54182 3917 3592 1118 749 24461 1002 22094 1782
NM_022166chr16105785 5673 5423 5381 5190 4191 2360 2210 1892 1536 1474 1381 22256 1780
NM_024639chr682514 2111 1845 1152 667 499 91 50 ----1937
NM_024646chr142555 2494 1040 582 12997 1333 13433
NM_024770chr276531 6310 5284 4198 2395 850 530 12410 15089 --
NM_024947chr398075 7192 6012 3241 3049 2677 1750 750 656 15906 29178 9130 --
NM_030816chr133516 3224 1403 ----13443
NM_030918chr1115268 5109 4935 4517 4486 4313 4299 2163 2017 1847 1493 23472 889 13690 --
NM_030920chr131912 429 48 ----11886
NM_031427chr14105616 5395 5228 4900 4606 3741 3706 1302 1267 566 14398 25464 2159 --
NM_031483chr2062569 2453 1324 1062 606 102 --23294 2892 --
NM_031890chr2292983 2849 2581 2020 1992 913 716 130 116 1923 187 11024
NM_032160chr1853075 1409 1093 284 254 14082 23053 1648 --
NM_032458chrX33211 658 346 ----12915
NM_032582chr1731899 1492 332 ----1379
NM_033224chr767803 6611 6419 5868 5692 2557 26143 2640 27377 1279 14879
NM_033389chr17134735 4144 3269 1892 1884 1542 1413 1263 575 480 372 258 134 --1517 --
NM_033429chr1563129 2154 1073 660 646 639 1952 ----
NM_080764chr223507 318 311 ----22125 990
NM_133170chr20126740 6732 6395 6230 3039 2650 2511 2487 2284 2212 486 28 ----26464 5158
NM_133370chr453339 3286 2697 972 306 ----23531 3158
NM_138959chr1156685 6414 6383 6353 6133 5769 5253 4938 4370 2596 2120 1941 1209 1013 538 ------
NM_145055chr1863859 3759 2332 1247 1141 1104 ----12746
NM_145259chr264705 4334 2731 1971 1033 412 35086 1737 1284 14553 --
NM_145686chr263022 2975 1200 439 83 36 12881 --13062
NM_145687chr263022 2975 1200 439 83 36 12881 --13062
NM_147150chr993704 3411 2786 2718 1349 1012 909 461 375 --13942 --
NM_152263chr176009 5948 5582 4581 4527 2157 378 11361 --15291
NM_152624chr535520 1934 37 --16085 26739 4858
NM_152999chr784553 4037 3257 1954 1442 1420 1082 144 --11230 --
NM_153050chr22134897 4874 4311 4138 1685 1460 1427 1232 1203 760 456 369 121 14787 21022 948 --
NM_153051chr22134897 4874 4311 4138 1685 1460 1427 1232 1203 760 456 369 121 14787 21022 948 --
NM_173167chr17112627 2543 2111 1937 1869 1009 873 727 546 178 47 ------
NM_173468chr475495 5085 2407 1822 1770 1036 800 --14611 12164
NM_173582chr1176226 5602 4763 4730 4508 1896 1714 --1716 1513
NM_173642chr1139000 8933 8730 8208 8188 7999 7805 6807 6549 5760 3632 3050 467 --12040 --
NM_173808chr154114 4019 3270 703 251 13849 --12944
NM_178151chrX57694 6862 6448 5972 5274 130 36246 2035 22 --
NM_178152chrX57694 6862 6448 5972 5274 130 36246 2035 22 --
NM_178153chrX57694 6862 6448 5972 5274 130 36246 2035 22 --
NM_181489chr3126632 6521 5070 5054 4556 2460 2450 2279 2053 1146 903 843 24869 1784 34994 2177 544 --
NM_182935chr382334 1831 1742 1618 529 323 224 170 --31029 346 340 --
NM_194314chr155017 4992 4199 1337 1311 --24555 3939 --
NM_198569chr622555 306 --12364 1274
NM_203406chr522010 117 1364 21002 635 12145
NM_206853chr643906 3248 2863 1416 23810 2551 23025 292 12774
NM_206854chr635167 4509 4124 25071 3812 24286 1553 14035
NM_206855chr666132 5474 5089 924 555 64 26036 4777 25251 2518 15000
NM_206909chr897530 6453 5862 5673 5528 5333 3038 1616 839 18230 11343 12233