TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4716-5p
miRNA Sequence: UCCAUGUUUCCUUCCCCCUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr191779 1767 1681 1394 1277 1223 1202 252 221 ------
NM_000084chrX75801 5330 5312 2740 2582 958 313 24834 1606 ----
NM_000112chr585329 5046 4769 4090 3943 3757 3602 1370 11507 ----
NM_000115chr1352380 2212 679 661 650 21775 186 12411 12268
NM_000168chr733071 2715 364 --22088 647 22439 529
NM_000176chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_000202chrX103347 1419 1144 1054 899 758 616 500 155 129 ------
NM_000216chrX113703 2920 2888 2646 2491 1346 1218 1116 1098 896 68 ----1222
NM_000217chr12125242 5035 4700 4479 4283 1931 1326 1096 866 486 412 394 13368 --15021
NM_000259chr1566127 2458 1856 1771 804 521 26407 4167 36242 2382 1140 14052
NM_000314chr1063181 2868 2699 2207 889 596 ----12216
NM_000332chr6106769 5712 5196 4506 2775 2656 2330 1073 808 470 --127 --
NM_000448chr1183221 2878 2625 2290 2202 2011 602 549 --12067 --
NM_000618chr12115827 5760 5630 5038 4693 2500 1969 1575 1302 315 32 15619 --13998
NM_000618chr12115827 5760 5630 5038 4693 2500 1969 1575 1302 315 32 15619 --13998
NM_000633chr1895133 4557 4520 1338 1295 1277 1221 62 29 11190 34220 1554 1196 --
NM_000813chr5165580 5382 5240 4976 4079 4063 3954 3777 3507 1879 1624 1458 1419 800 675 232 ------
NM_000826chr492627 2261 2129 1032 700 513 373 286 136 ----21769 388
NM_000831chr1156104 5678 5340 5215 5207 4789 4088 2426 2303 2201 2118 1515 1479 1295 541 24231 2461 36287 6053 454 --
NM_000875chr15107058 6152 6087 5823 1627 650 527 233 191 35 1484 26806 660 --
NM_000899chr12124088 3170 3125 3077 3020 2756 1712 1693 1397 588 557 338 2232 153 11023 --
NM_000926chr11109272 8811 8513 7763 6864 6500 6120 5921 2904 1204 26140 2898 12494 16773
NM_001001395chr1252316 2042 1774 710 222 22123 132 ----
NM_001001396chr164327 4012 3574 1608 1440 706 22795 919 12888 --
NM_001001419chr575116 3190 1825 1715 1437 830 272 11916 24897 1392 --
NM_001001420chr575116 3190 1825 1715 1437 830 272 11916 24897 1392 --
NM_001001890chr2144061 3286 1510 619 --33715 2964 1413 12737
NM_001002860chr1484666 4223 3943 3876 3234 1478 1334 155 --1922 --
NM_001003652chr1888275 8008 7751 6535 5981 3111 1210 781 1857 ----
NM_001003674chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_001003675chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_001003760chr683304 3109 2956 2436 2298 1458 125 58 11469 --11125
NM_001005386chr222469 1692 188 22373 1903 11736
NM_001005473chr576359 6049 5018 4375 2665 1753 1715 12093 24993 4843 --
NM_001007214chr151889 1700 1580 580 174 --21843 1263 --
NM_001007267chr26923 732 693 219 112 35 1886 ----
NM_001007278chr1374763 4238 4181 4064 1788 1263 341 --1713 --
NM_001008539chr8105415 5375 4154 3683 3544 1954 1445 896 286 81 --11692 --
NM_001008564chr1332152 602 446 --11994 11646
NM_001008738chr532679 624 66 ----11147
NM_001009899chr386333 5582 4383 1106 819 362 207 73 --11055 --
NM_001009909chr1163353 2708 1574 809 280 94 1614 --13162
NM_001009960chr772787 2708 2517 1002 781 429 318 --22268 1772 --
NM_001010861chr162562 2426 1913 1119 1058 484 --1956 --
NM_001010888chrX94553 4539 3732 3559 3301 3036 1155 600 34 1877 13140 --
NM_001011666chr786419 4975 4943 4524 2161 2024 2008 996 --1908 1752
NM_001012418chr6----14158 34279 3354 2739
NM_001012755chrX74147 3702 3088 2025 1702 258 126 13508 1905 13685
NM_001013620chr12118469 8318 8148 7726 7565 6595 6586 5148 2521 2245 663 16470 --185
NM_001014797chr1078215 7071 5987 5766 5188 5039 56 --26046 5940 11554
NM_001017440chr778138 8100 7843 6279 5801 5733 5617 ----11803
NM_001018067chr1114375 3698 3622 3261 1863 1689 1459 684 473 459 296 --1190 15080
NM_001018068chr1114375 3698 3622 3261 1863 1689 1459 684 473 459 296 --1190 15080
NM_001018069chr1114375 3698 3622 3261 1863 1689 1459 684 473 459 296 --1190 15080
NM_001018074chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_001018075chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_001018076chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_001018077chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_001024094chr553007 2741 2687 967 267 1446 23042 1136 23923 1507
NM_001024855chr331812 1652 436 11865 --2204 37
NM_001025266chr374932 4451 3396 3207 3114 1854 723 23268 1162 --11028
NM_001025580chrX74224 4205 4181 2777 2770 2760 1146 ------
NM_001030055chr1493718 3712 3632 3288 1869 919 648 187 54 ------
NM_001031679chr1263511 3143 994 416 341 280 23066 398 23090 770 --
NM_001032999chr2065336 3632 3609 3541 808 209 1753 25085 2029 14597
NM_001037132chr751599 1413 302 174 88 --1360 --
NM_001037133chr751599 1413 302 174 88 --1360 --
NM_001037165chr798486 6029 3561 2627 2421 2088 934 513 296 --17885 1596
NM_001037174chr272128 2082 2037 1721 1634 742 689 1736 ----
NM_001037317chr162562 2426 1913 1119 1058 484 --1956 --
NM_001039199chr2065005 4924 4123 3607 831 142 1197 34315 3561 3139 13178
NM_001039547chr3107972 7383 4913 3152 2989 2541 1221 788 548 537 25691 1716 47757 7471 7346 5576 --
NM_001039569chr263376 3212 1228 959 921 880 --12986 --
NM_001039585chr143651 3138 745 306 --24072 3758 163
NM_001039618chr11155418 5363 4509 4160 4047 3684 2096 1912 1796 1707 1487 1075 558 186 150 --12027 --
NM_001039709chr2065336 3632 3609 3541 808 209 1753 25085 2029 14597
NM_001039840chrX95707 5510 2222 2104 706 660 473 458 313 --25154 4851 --
NM_001040202chr442568 2442 1914 112 ----12112
NM_001040284chr1675527 5230 4855 4031 2369 2221 1766 ----14725
NM_001040441chr155150 4094 3461 1542 919 25503 2100 34551 874 749 11730
NM_001040665chr774443 3122 1518 1333 937 630 187 25024 3163 ----
NM_001042494chr1533506 2649 1500 13065 21455 564 1834
NM_001042495chr1533506 2649 1500 13065 21455 564 1834
NM_001042496chr1533506 2649 1500 13065 21455 564 1834
NM_001042497chr1533506 2649 1500 13065 21455 564 1834
NM_001042510chr821557 207 12119 --1779
NM_001042511chr821557 207 12119 --1779
NM_001042555chr1283922 3359 1632 1574 1164 451 444 268 --24589 4202 13630
NM_001042599chr277887 7235 6629 3004 2689 2682 230 14802 --11151
NM_001042603chr1264491 4315 4274 3759 931 26 3792 155 38 55221 3496 3438 3380 3322 --
NM_001042604chr364822 4781 3949 1820 806 106 21272 414 13884 --
NM_001048183chr152337 1310 1023 611 233 23653 67 41485 1263 823 30 --
NM_001083620chr492625 2259 2127 1031 699 512 372 285 136 ----21767 387
NM_001099678chr3116466 6365 5942 5524 4742 1783 1648 1408 1326 1028 550 --14832 --
NM_001100108chr177989 7291 7084 3320 3301 1390 263 11464 36149 5868 573 --
NM_001167chrX106153 6109 5318 5239 2361 1302 1160 715 612 131 1624 --14117
NM_001173chr1493718 3712 3632 3288 1869 919 648 187 54 ------
NM_001201chr421480 709 23703 1423 1618 1226
NM_001204chr276640 6236 4964 3063 2418 2374 51 17216 --17267
NM_001241chr231841 97 61 139 21940 1503 1318
NM_001241chr231841 97 61 139 21940 1503 1318
NM_001412chrX83769 2663 2296 2290 1382 1077 752 95 13718 --13121
NM_001438chr143126 2440 2260 1197 --11093 22933 610
NM_001455chr664741 4442 3758 3307 3118 1565 1552 14648 13715
NM_001609chr1074305 3415 2896 1657 1507 901 820 13280 ----
NM_001682chr1292675 2667 2346 2190 1948 1163 1070 992 717 --1274 --
NM_001684chr164044 3729 3291 1325 1157 423 1636 12605 11569
NM_001720chr172154 2038 1904 813 682 602 565 ----21888 694
NM_001754chr2144061 3286 1510 619 --33715 2964 1413 12737
NM_001759chr1285186 5118 4520 3898 3811 514 480 311 11274 1327 --
NM_001858chr665095 3728 3671 1370 358 261 ------
NM_001918chr1138511 8457 7629 7458 6844 5978 5923 5892 3404 3375 2964 2240 302 --89149 8520 7547 5884 2454 1711 392 239 --
NM_002006chr4105686 5532 4451 4104 2317 2051 1668 1641 1172 143 14372 21878 692 --
NM_002025chrX138951 8601 8313 8005 7363 7156 7096 7018 3546 3079 2711 2394 1565 25675 2785 11844 12503
NM_002035chr1853923 3648 3009 2632 2504 --13222 1202
NM_002092chr485099 4931 4714 3202 1558 1549 1488 796 --1262 --
NM_002130chr571382 1350 1228 543 376 191 43 1136 1304 --
NM_002203chr573809 2931 761 650 343 321 304 --13683 --
NM_002210chr283604 3569 3081 3074 2360 1352 1149 524 1798 ----
NM_002214chr765720 5524 4584 4234 3819 406 14521 --14280
NM_002223chr1253813 3502 718 559 377 ----21232 913
NM_002264chr355038 4159 3692 3255 1166 24685 3657 1361 --
NM_002270chr5135285 4150 3990 3821 3455 2096 2089 1991 1427 1285 1234 928 237 --25244 5029 14532
NM_002336chr1274680 3755 3714 2026 1322 1177 281 24701 435 14637 --
NM_002581chr975130 3756 1419 1008 547 538 303 11528 21602 1399 --
NM_002610chr242745 2120 1202 746 --1446 12813
NM_002641chrX52009 1747 1544 1359 697 11875 ----
NM_002655chr874744 4647 3469 1437 1024 752 676 11723 ----
NM_002959chr154137 3908 3715 1780 358 11044 11734 23513 29
NM_003034chr12158032 4997 3035 2890 2677 2078 1916 1809 1117 1025 982 818 267 215 99 17793 ----
NM_003046chr8105415 5375 4154 3683 3544 1954 1445 896 286 81 --11692 --
NM_003108chr2107046 7012 6759 6331 6262 6102 4987 4704 1074 198 --12419 --
NM_003161chr1773123 2561 2463 2217 1300 757 419 --12515 1149
NM_003199chr1885414 3701 3614 3503 2183 2119 1217 994 ----1773
NM_003262chr394914 4742 4268 4168 3962 1401 927 203 81 --21822 1690 12097
NM_003298chr356060 4807 4191 4132 2408 --1635 24878 4740
NM_003342chr1782963 2926 2217 1250 893 439 274 150 --158 --
NM_003410chrX62998 2680 2245 1222 981 222 ----1486
NM_003423chr1972479 2456 1038 698 547 222 56 ------
NM_003463chr673144 2218 1270 828 819 480 74 --22874 2319 --
NM_003489chr21113081 3058 2989 2705 2373 2354 2179 1125 1068 153 77 --195 --
NM_003566chr1253465 2977 2943 598 588 1390 11347 --
NM_003574chr1885706 5210 4792 4381 1720 1630 663 383 15070 1890 --
NM_003590chr273970 3368 2999 1544 1181 1038 540 149 --23466 1472
NM_003913chr6104354 4015 3915 3836 3793 2768 1701 426 253 116 14234 ----
NM_003916chrX41406 1120 451 197 --11375 11454
NM_003994chr12124088 3170 3125 3077 3020 2756 1712 1693 1397 588 557 338 2232 153 11023 --
NM_004035chr1775113 4833 3801 3508 3192 1852 1334 --21804 1258 --
NM_004171chr11139178 8894 8428 8177 8002 3614 2754 2544 2429 1744 1272 1088 340 21013 506 ----
NM_004225chr841433 1246 470 441 ----2201 189
NM_004232chr1852964 2797 1565 1493 793 12655 23544 3468 --
NM_004279chr751966 1515 873 614 73 1829 --12244
NM_004338chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_004449chr2151436 1307 525 268 72 --11366 1218
NM_004464chr484192 4111 2905 2696 1502 1448 623 485 ----1551
NM_004586chrX33828 1625 226 12123 23641 1579 14187
NM_004744chr463166 3136 807 468 260 44 12921 11382 13218
NM_004745chr8107009 6567 6538 6397 5354 4262 2479 1730 1168 1033 --11697 --
NM_004857chr1494465 4173 4032 3688 3617 3069 3008 590 571 33815 1064 266 ----
NM_004866chr564532 3839 3725 755 596 130 --34439 4242 4192 1106
NM_004904chr786419 4975 4943 4524 2161 2024 2008 996 --1908 1752
NM_004956chr784596 4562 3765 1766 1630 1379 1025 804 23297 1350 13697 --
NM_005010chr751599 1413 302 174 88 --1360 --
NM_005056chr1264735 4559 4518 4003 1175 270 31036 399 282 65465 3740 3682 3624 3566 3404 --
NM_005065chr1474489 4441 4242 3826 1568 987 437 1222 ----
NM_005093chr2065336 3632 3609 3541 808 209 1753 25085 2029 14597
NM_005121chr1763700 3591 832 381 369 344 11069 23675 2523 1333
NM_005135chr1533506 2649 1500 13065 21455 564 1834
NM_005188chr1167336 7052 3273 1925 1187 1168 --17776 17240
NM_005197chr14105978 5551 5433 4886 2230 1760 1366 1359 394 50 11255 11119 --
NM_005235chr277887 7235 6629 3004 2689 2682 230 14802 --11151
NM_005358chr1381890 1801 1695 1639 1618 1278 1176 75 1458 ----
NM_005402chr761345 1312 595 485 419 129 1581 21244 180 --
NM_005497chr1795896 5268 5133 4575 4231 4149 2104 1670 794 1842 35565 5223 4319 --
NM_005596chr975726 4709 4573 4471 3897 1387 1324 25591 487 --15008
NM_005668chr5104183 4065 4000 3725 3341 2881 1806 1196 304 25 --13319 11415
NM_005669chr54940 688 624 478 1453 --11601
NM_005722chr222469 1692 188 22373 1903 11736
NM_005725chr152386 2073 1682 784 235 ----1612
NM_005746chr762752 2727 1825 1800 780 616 --1521 12765
NM_005765chrX3597 278 211 ----1608
NM_005798chr1374763 4238 4181 4064 1788 1263 341 --1713 --
NM_005828chr17105092 4620 4424 4266 4207 3848 3820 3489 418 80 --23897 830 14260
NM_005840chrX147101 6685 6479 6437 4977 4866 4850 2195 2064 1446 1108 961 687 266 44749 2860 2811 1962 17290 1311
NM_005898chr1173237 2784 2404 839 699 530 60 1178 1711 12670
NM_005901chr1888275 8008 7751 6535 5981 3111 1210 781 1857 ----
NM_005903chr575116 3190 1825 1715 1437 830 272 11916 24897 1392 --
NM_005955chr195393 4448 4222 4204 4189 3733 1445 1367 739 --15301 --
NM_006007chr994275 4185 4087 3687 3593 1572 1078 819 78 23457 957 22967 975 --
NM_006060chr7104110 4030 3905 3508 3488 3163 3074 1275 1241 1175 11449 ----
NM_006106chr1153381 3206 2488 2199 440 13028 13034 12496
NM_006154chr1552438 2369 861 696 663 12200 --12174
NM_006203chr555532 4656 3925 1640 417 24188 1716 34806 4678 4579 --
NM_006251chr563364 2890 2175 168 144 40 12312 ----
NM_006283chr864521 4168 3091 1819 1672 1604 --24225 838 24273 1337
NM_006287chr231978 333 100 12564 --12053
NM_006300chr1961627 874 716 403 41 24 12045 1576 --
NM_006379chr792344 2226 1572 1546 558 507 277 188 152 ------
NM_006420chr2043393 437 394 48 23031 1297 --1706
NM_006493chr1331153 397 312 ----1250
NM_006544chr14135919 5746 4789 4775 4755 3903 3809 3730 2368 2247 1783 954 894 --25617 4730 15004
NM_006546chr1786421 5848 4873 2604 1852 1596 1254 350 11526 12301 1258
NM_006614chr363589 3330 1388 635 470 95 1728 --11406
NM_006628chr1584603 4112 3749 2991 2878 1767 200 54 11222 ----
NM_006629chr1872664 2636 2620 992 913 388 246 11753 22832 340 11956
NM_006654chr1283922 3359 1632 1574 1164 451 444 268 --24589 4202 13630
NM_006717chr962503 2188 2159 904 707 621 1946 ----
NM_006750chr16117147 6718 6405 5877 5542 2846 2604 2381 2323 1888 1773 11171 25831 249 --
NM_006922chr232582 1841 996 ----11786
NM_007005chr921177 507 1498 --1229
NM_007007chr1274771 4002 3695 3535 1659 1385 1264 1660 14809 --
NM_007050chr2097177 6028 5451 5429 2585 2550 2446 1050 585 --38067 6790 2849 15567
NM_007054chr553526 3352 3133 3062 1174 11222 33974 2969 1264 --
NM_007146chr1772873 1967 1905 1845 1069 537 516 --125 11146
NM_007231chrX3553 482 413 1495 --1840
NM_007249chr13178637 8556 8319 8207 8093 7911 6752 6709 6649 6526 6004 3052 2783 2031 1340 953 489 23731 747 ----
NM_007292chr1775113 4833 3801 3508 3192 1852 1334 --21804 1258 --
NM_012097chr272128 2082 2037 1721 1634 742 689 1736 ----
NM_012120chr662870 859 766 737 184 109 --1343 22268 1976
NM_012262chr144668 4607 3348 1574 --25062 620 14193
NM_012309chr1173964 3246 1462 1006 986 279 220 1755 21587 159 1250
NM_012329chr1731667 1460 1223 --1463 1631
NM_012338chr731069 329 85 --1286 11230
NM_012382chr5114371 4333 3818 3269 1778 1524 751 679 261 173 111 --13225 --
NM_013232chr52426 123 ----2357 34
NM_013255chr7108511 8283 7690 5982 5376 2366 2352 2097 1496 1277 58899 8852 8155 7914 3337 28209 7377 --
NM_014021chr152884 2805 2598 1077 1024 --23220 2684 13173
NM_014048chr16114404 4160 3843 3781 3578 3204 1638 1490 977 108 45 ----11381
NM_014089chr1332152 602 446 --11994 11646
NM_014112chr875433 4490 1724 968 606 266 121 35276 5178 4358 13617 --
NM_014141chr795249 4729 4675 4633 4464 3416 2054 1518 637 11103 24889 372 25045 941
NM_014155chr11127523 7448 7349 7282 6194 4609 2625 2126 1793 1090 480 48 ------
NM_014319chr1271598 1453 1411 1324 754 537 331 --1503 --
NM_014331chr4117697 7489 6858 6666 6402 5377 1486 1353 896 363 204 ----11443
NM_014423chr585483 4824 4178 4139 3570 3550 1038 624 25005 4003 ----
NM_014674chr373859 3280 1262 1190 851 672 251 1231 ----
NM_014683chr172466 38 --11351 2561 517
NM_014701chr1583474 3023 2920 2723 2616 2443 2318 1066 1911 ----
NM_014702chr673268 2471 1234 813 441 395 294 ----1950
NM_014721chr687294 6815 5995 5593 5421 4505 1029 702 --12509 11146
NM_014747chr1125815 5780 5514 4583 4170 4018 3632 1794 622 615 319 251 21735 1508 24490 4356 --
NM_014755chr284079 4067 3394 3273 3125 2896 1390 517 34250 3857 2712 13257 --
NM_014819chr532273 1626 230 ----1988
NM_014877chr1786458 6363 5804 4989 2310 2134 1015 116 25856 5750 17176 --
NM_014923chr1332324 847 412 ----1712
NM_014934chr13103769 3616 3440 2844 2801 913 738 347 244 202 ----13328
NM_014982chr1444049 3766 2157 398 34197 4153 3416 14283 13901
NM_014988chr442297 1968 901 418 1912 31978 275 232 --
NM_015040chr2103357 3274 3213 2592 2542 1213 1166 522 380 255 ------
NM_015046chr932424 1917 637 12754 --2765 122
NM_015051chr953415 3392 2410 1224 52 22386 685 --12135
NM_015172chr141623 1604 443 216 --1545 149
NM_015192chr2052270 1070 579 482 32 21191 1175 12602 1686
NM_015208chr18103146 3091 2958 2710 1571 1372 1239 709 595 248 13770 ----
NM_015310chr8108380 6791 6303 6285 5570 3361 2472 2448 950 531 16054 21913 1600 --
NM_015317chr242153 1873 970 856 ----21956 1896
NM_015336chr1242434 979 327 102 22174 904 --1173
NM_015365chrX74224 4205 4181 2777 2770 2760 1146 ------
NM_015394chr1252462 2426 2374 2254 419 --11840 12447
NM_015569chr184690 4354 3375 3218 3118 3031 1462 1089 24751 830 13486 --
NM_015576chr331167 1102 69 1567 1754 11074
NM_015640chr1114375 3698 3622 3261 1863 1689 1459 684 473 459 296 --1190 15080
NM_015886chr875527 4488 775 427 413 401 156 166 31850 1650 45 --
NM_015912chr8102178 2129 1871 1722 1583 880 670 362 262 140 ------
NM_015967chr12951 107 --127 1802
NM_016087chr731175 654 444 11124 --1358
NM_016096chr821557 207 12119 --1779
NM_016132chr1563265 3010 2779 2358 2223 374 --11150 --
NM_016206chr3138986 8568 8303 8217 8202 6301 3617 3539 2858 1930 1872 1696 1690 12032 ----
NM_016248chr1343854 1202 935 250 ----1966
NM_016507chr1762976 2569 2206 2144 2073 2006 11222 1713 1262
NM_016531chr463551 2745 2663 921 297 154 1608 --1705
NM_017563chr394570 4194 1761 1515 1393 1313 1135 302 79 1206 36177 6020 5790 --
NM_017637chr998448 8377 8347 8034 7383 6739 3031 2099 1478 --2706 511 --
NM_017644chr385207 4614 3523 3397 3316 1591 1426 620 ------
NM_017650chr785889 5789 5513 4840 4652 1791 418 338 15839 1552 --
NM_017658chr1484518 3975 2863 1439 999 686 536 119 13361 1318 24132 740
NM_017770chr652012 1847 889 872 609 ----22873 318
NM_017813chr884722 2327 1556 1355 865 751 493 92 ------
NM_017902chr1055432 5093 3507 2200 1818 25540 5100 15659 11378
NM_018085chr1127536 7008 6586 6242 2123 1734 1688 1312 921 870 767 224 27432 5119 28061 6195 --
NM_018225chr9105219 5177 4304 3368 1988 1588 1311 1184 880 35 23646 1224 24985 4260 --
NM_018227chr462985 2886 977 674 307 207 32541 690 328 ----
NM_018247chr652786 2049 1184 1177 788 --22973 2088 --
NM_018374chr7125262 5145 5028 5020 4802 3821 1822 1315 1140 969 747 466 --14463 --
NM_018403chr353842 3829 3314 1546 1078 --23935 2845 --
NM_018439chr1822563 1626 ----2720 121
NM_018440chr8137294 6589 6282 6233 6021 5818 5642 5245 2498 2228 1421 949 762 --28119 7817 --
NM_018566chr154886 4755 4689 4548 3890 13517 34358 3701 3314 --
NM_018640chr1252316 2042 1774 710 222 22123 132 ----
NM_018958chr1522756 192 11563 --11506
NM_019001chr364822 4781 3949 1820 806 106 21272 414 13884 --
NM_019022chr1852698 2003 1035 157 100 32946 424 133 ----
NM_019593chr2072911 1974 1250 898 773 513 504 --12383 --
NM_020122chr244675 1468 823 243 14659 44501 4119 2057 1936 --
NM_020297chr1292564 2273 1433 1409 1119 820 432 250 179 --12444 --
NM_020336chr2043726 3654 3117 1031 --31511 950 694 1456
NM_020390chr374159 4060 3973 3690 2992 599 180 13563 24045 3723 --
NM_020466chr633784 3550 2007 11420 1394 1853
NM_020473chrX52009 1747 1544 1359 697 11875 ----
NM_020673chr20127735 7431 6885 6498 5410 4829 2738 2157 2142 2043 1784 562 --15868 11625
NM_020718chr1696015 5942 4389 4287 4244 4183 4088 1457 728 --14361 16362
NM_020734chr1252714 2426 1181 911 725 ----12539
NM_020752chr1072911 2629 1791 290 249 137 107 ----12671
NM_020772chr17128141 7910 7694 6030 5524 5516 2989 2669 1930 1315 583 237 17533 --11746
NM_020774chr1894638 4502 3979 2085 1844 1833 1209 1162 458 ------
NM_020783chr1852426 2219 1720 931 328 --12355 11937
NM_020801chr542600 2567 481 193 ----11873
NM_020802chr1192768 2401 2106 1099 1010 796 632 607 91 13356 22859 2357 --
NM_020810chr1453446 3142 2253 467 246 ----1684
NM_020825chr1643650 2560 866 691 1750 1128 23218 553
NM_020830chr253206 2866 2776 2432 2212 11266 1760 1190
NM_020844chr8106982 6937 6681 5984 5431 2706 2461 1057 615 64 26365 2828 1677 --
NM_020940chr1082837 2801 2349 1137 890 797 598 476 --12872 12514
NM_021033chr1373468 3256 3094 2639 2336 2235 2225 1602 ----
NM_021190chr14985 909 396 383 --21148 890 --
NM_021255chr1494008 3169 3148 1594 1309 827 723 662 135 --1149 --
NM_021911chr5165580 5382 5240 4976 4079 4063 3954 3777 3507 1879 1624 1458 1419 800 675 232 ------
NM_021961chr1195552 5153 4996 1822 1676 1648 1630 1607 1163 1914 ----
NM_021964chr3106291 6239 6214 6037 5621 5118 2496 1678 992 652 --36495 4657 1377 12615
NM_022048chr1575929 3978 2545 2145 1614 1482 1086 --44080 2500 880 788 12046
NM_022817chr231963 785 201 ----1773
NM_022900chr73929 795 184 ----11172
NM_023923chr152337 1310 1023 611 233 23653 67 41485 1263 823 30 --
NM_023929chr862400 1905 833 685 339 46 1216 191 --
NM_024511chr453193 2654 1136 675 195 13259 --11207
NM_024639chr662469 2312 1787 848 809 135 --11168 12524
NM_024721chr852378 1720 1662 1644 334 --22566 1976 22135 228
NM_024770chr276157 5812 5781 2358 1279 905 785 --35921 5105 740 --
NM_024817chr1585225 5097 4442 4035 3763 3664 1724 1327 1294 25812 3754 --
NM_024947chr3179332 9081 8571 8553 7824 6911 6847 6443 2503 2231 1900 1262 1228 1164 1076 497 86 --25965 3229 12792
NM_024989chr2167987 7910 7641 7627 7145 6493 6067 6005 1725 1654 1389 1029 946 676 635 241 --1176 --
NM_025208chr1172463 2419 2354 2318 2219 869 397 --1558 --
NM_030621chr1484137 3617 3299 2939 2820 2778 1036 864 ----12658
NM_030627chr583106 3040 2993 2948 1556 1546 572 189 1224 23062 1319 --
NM_030806chr177271 6194 3657 2171 2127 1887 578 26939 6028 18459 16664
NM_030816chr153179 2959 2401 1421 815 1412 --22838 934
NM_031271chr841550 422 234 125 ----11727
NM_031427chr1485897 5633 4957 4099 1067 1013 651 537 12073 34229 1620 462 --
NM_031442chrX133192 3068 3051 2818 2796 2726 2431 2281 2257 2062 2053 625 240 12788 ----
NM_031468chr778138 8100 7843 6279 5801 5733 5617 ----11803
NM_032102chr11112485 2457 2158 2023 1964 1953 869 787 397 359 27 --22113 939 2888 455
NM_032373chr1084629 4272 4062 3728 2321 2229 1423 113 --13987 --
NM_032445chr1582477 2397 1871 1686 1653 479 334 318 ------
NM_032446chr5103566 3470 3106 2994 1104 522 445 278 248 124 ------
NM_032457chr463550 2497 1529 1432 856 388 1898 33941 3815 2884 --
NM_032828chr19114441 4342 4318 4058 3968 3960 3767 3501 601 476 456 --1685 --
NM_032842chr761615 1598 1378 1075 172 103 ------
NM_032873chr1174214 3236 1776 1560 824 787 491 ----1968
NM_032932chr1795524 5384 5041 2536 2519 1307 1267 1224 769 16172 35655 4582 1989 --
NM_032973chrY64137 4047 3856 3310 2922 649 13438 13708 --
NM_033135chr1172463 2419 2354 2318 2219 869 397 --1558 --
NM_033143chr484523 4442 3236 3027 1833 1779 954 816 ----1882
NM_033224chr7117728 6736 6090 5924 5775 5216 3116 2666 1367 1361 352 1669 15171 1928
NM_033389chr17113129 1875 1722 1329 910 861 710 596 339 73 62 ----14596
NM_033505chr2136266 6051 5880 5765 5607 5154 4549 4259 4234 4082 2670 1088 97 14142 25107 710 --
NM_033512chr852801 2399 2026 922 470 --1130 22857 317
NM_033656chr2174287 4092 2370 1665 940 273 208 ----12012
NM_052811chr1374763 4238 4181 4064 1788 1263 341 --1713 --
NM_052832chr883040 3004 2931 2832 2470 2207 916 788 23024 936 1262 --
NM_052907chr1264312 4010 1721 1691 1550 533 12736 --13942
NM_052932chr1121542 146 11728 --11697
NM_053016chr9106678 6002 5010 4997 2794 2064 1441 755 302 177 25793 2776 26732 2638 13083
NM_053023chr1173303 2060 942 816 666 606 24 --22077 2019 --
NM_057168chr731175 654 444 11124 --1358
NM_080867chr1434712 4534 1574 ----11057
NM_080874chr451600 1559 457 427 80 1616 1434 --
NM_130809chr573139 3131 3071 2924 2102 392 367 --1551 13051
NM_133170chr2097177 6028 5451 5429 2585 2550 2446 1050 585 --38067 6790 2849 15567
NM_133334chr4116369 6303 5349 4573 4392 1648 1613 1487 1472 1295 777 25906 2067 15806 21964 1659
NM_133372chr532679 624 66 ----11147
NM_133477chr463250 3156 2955 2796 2365 434 11272 1406 --
NM_133647chr1533506 2649 1500 13065 21455 564 1834
NM_138286chr1974289 4042 3343 3020 1490 863 564 --11757 --
NM_138426chr772153 2076 2031 806 718 708 204 --12448 --
NM_138468chr2106080 5832 5066 4942 4757 4061 3861 2192 1095 412 --44556 4397 2282 1453 1322
NM_138494chr772787 2708 2517 1002 781 429 318 --22268 1772 --
NM_138731chr14104111 3722 3652 2883 1618 1566 789 485 352 318 23681 1588 12949 13131
NM_138771chr731393 1347 1236 ----1328
NM_144571chr4115196 4980 4955 4773 2610 2077 1986 1779 609 552 224 --15207 --
NM_144599chr15145451 5360 4491 4382 3409 1977 1680 1468 1233 1192 1119 967 606 462 15010 21111 148 24888 3839
NM_144664chr1132475 1615 300 ----11833
NM_144973chr12135332 5300 4299 4159 4106 3927 3839 3292 3282 2022 1573 368 227 ------
NM_145176chr652564 2224 1394 1285 400 12638 11068 126
NM_145259chr2156833 6816 6702 6645 6509 5457 2697 2376 1776 1357 1312 512 416 402 140 26048 6003 1167 --
NM_152309chr1021439 91 11419 12129 11426
NM_152352chr1872479 2430 2023 1952 1943 924 673 12085 ----
NM_152409chr563188 2964 2855 1445 1434 587 --1993 --
NM_152542chr431696 404 50 11756 1676 12175
NM_152636chr1162870 2315 2277 1068 690 263 --22741 2406 12693
NM_152641chr1242391 2383 2156 1002 21085 332 --12519
NM_152754chr763866 3079 2652 1524 756 141 ----1368
NM_152756chr533759 3240 2789 --23376 1259 12902
NM_152774chr7102730 2292 2095 1736 1664 1086 752 651 585 315 ------
NM_152793chr764872 4465 3853 3352 672 472 13543 2925 395 11230
NM_152999chr774443 3122 1518 1333 937 630 187 25024 3163 ----
NM_153013chr542031 1842 905 506 ----1782
NM_153188chr5135285 4150 3990 3821 3455 2096 2089 1991 1427 1285 1234 928 237 --25244 5029 14532
NM_153207chr1264030 3742 3114 2493 1027 391 --13621 --
NM_153367chr1073151 2956 2605 2558 650 503 98 11266 1693 11221
NM_153456chr13106211 5606 5373 4999 4578 4345 1525 1357 1039 553 45076 4396 1935 1103 ----
NM_153695chr9------2222 180
NM_153712chr2143704 3499 3464 3436 3260 3112 3034 2810 1441 1318 752 702 685 474 13301 1734 --
NM_170710chr473112 2886 2602 2457 994 756 321 1762 1949 --
NM_172070chr231802 1379 482 21868 1510 --11435
NM_173082chr621379 1313 --1562 1555
NM_173468chr455965 2278 2268 2219 1867 1915 14961 11112
NM_173496chr1042329 2306 883 201 ----12671
NM_173511chr273409 3069 2770 1586 822 363 118 11033 --13281
NM_173517chr74460 435 428 377 ----1197
NM_173642chr1108737 7451 6116 3620 3214 2826 1242 1138 530 375 23680 253 12474 --
NM_173851chr8103625 3028 2980 2768 2640 2484 1229 859 535 50 11288 ----
NM_175056chr362183 2113 1730 1672 400 193 22055 1715 ----
NM_175861chr1275996 5161 5107 4860 1764 1715 530 1637 15591 --
NM_177438chr1484137 3617 3299 2939 2820 2778 1036 864 ----12658
NM_177538chr2117709 6065 2294 1990 1898 1344 1115 941 615 479 361 --67847 7131 6607 5444 1945 889 12787
NM_177985chr272128 2082 2037 1721 1634 742 689 1736 ----
NM_178505chr1083012 2907 2794 2675 2252 1412 751 296 --1978 --
NM_178539chr1251509 483 442 181 46 ----12046
NM_181265chr473112 2886 2602 2457 994 756 321 1762 1949 --
NM_181481chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_181482chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_181483chr1886709 6505 2797 1525 1107 1024 484 95 ------
NM_181504chr593698 3578 3409 2983 2788 1640 1166 709 168 13045 ----
NM_181521chr16126820 6761 6405 5921 5652 2890 2878 2437 2393 1513 879 352 16997 1673 11395
NM_181523chr593698 3578 3409 2983 2788 1640 1166 709 168 13045 ----
NM_181524chr593698 3578 3409 2983 2788 1640 1166 709 168 13045 ----
NM_182501chr2113331 3276 3198 2960 2769 2734 2353 1251 592 472 323 12813 12838 --
NM_182503chr675514 5149 4981 4971 3964 1400 521 --12072 --
NM_182515chr1966021 5448 2575 2550 2301 1087 --44642 1666 350 267 26730 4968
NM_182898chr786419 4975 4943 4524 2161 2024 2008 996 --1908 1752
NM_182899chr786419 4975 4943 4524 2161 2024 2008 996 --1908 1752
NM_182918chr2151436 1307 525 268 72 --11366 1218
NM_194247chr254276 4139 3058 1625 610 --13865 11692
NM_194283chr563732 3681 3632 3437 690 401 13919 13852 1951
NM_194285chr1133128 2710 853 1534 12800 11166
NM_194314chr184756 3781 2056 1355 1250 903 757 163 --13571 --
NM_194434chr1885706 5210 4792 4381 1720 1630 663 383 15070 1890 --
NM_198270chrX123518 3297 3093 2809 2254 2247 1106 829 706 654 627 508 13070 12232 --
NM_198400chr1552438 2369 861 696 663 12200 --12174
NM_198715chr196307 5600 5571 4991 4192 1927 1719 1362 245 ----1643
NM_198904chr562122 2031 1563 831 461 25 ------
NM_198935chr2062985 2684 2598 2256 715 89 ----11209
NM_198947chr1161036 921 674 328 294 29 21068 895 --1793
NM_198968chr13103769 3616 3440 2844 2801 913 738 347 244 202 ----13328
NM_198990chr762857 2503 2426 1078 835 183 --33182 584 247 13317
NM_199072chr7113062 3021 2682 2423 1980 1290 1039 936 222 177 168 --1517 199
NM_199421chr1434712 4534 1574 ----11057
NM_201559chr664741 4442 3758 3307 3118 1565 1552 14648 13715
NM_203459chr132209 981 721 11682 22638 326 12123
NM_206594chr143126 2440 2260 1197 --11093 22933 610
NM_206595chr143126 2440 2260 1197 --11093 22933 610
NM_206853chr662908 2782 1323 629 468 446 --1399 --
NM_206854chr6104169 4043 1890 1729 1707 1151 1077 1002 895 488 23712 704 11660 --
NM_206855chr695134 5008 4197 2116 2042 1967 1860 1453 748 24677 1669 13975 --
NM_206907chr563364 2890 2175 168 144 40 12312 ----
NM_206909chr8108380 6791 6303 6285 5570 3361 2472 2448 950 531 16054 21913 1600 --
NM_207303chr1054162 1633 1388 1132 297 ----1716
NM_207361chr13114976 4821 4376 4358 4213 3836 1974 1444 760 684 125 --12517 --
NM_207406chr4105964 5022 4818 4430 4367 4073 2297 1875 1743 1343 1384 --14714
NM_212558chr994070 3597 3061 3012 2834 1554 1286 886 37 ------
NM_213589chr285178 4565 2092 1955 1177 1166 967 695 33485 1214 793 11042 11379
NM_213590chr1374763 4238 4181 4064 1788 1263 341 --1713 --