TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4718
miRNA Sequence: AGCUGUACCUGAAACCAAGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51103 1531 1202 --
NM_000038chr531565 1296 608 --11531 1239
NM_000044chrX--1337 1121 --
NM_000067chr8--1514 ----
NM_000084chrX86048 5203 2767 2759 2636 2300 1741 665 11692 ----
NM_000089chr71176 ------
NM_000110chr1--1822 ----
NM_000115chr1352582 2395 2277 1056 244 32403 2242 182 --11710
NM_000141chr101163 ------
NM_000163chr532231 642 319 ------
NM_000165chr6--11114 ----
NM_000166chrX--1637 ----
NM_000170chr9--1155 ----
NM_000176chr541207 844 504 416 13909 1599 --
NM_000217chr1254831 4614 3999 1306 1300 25000 1386 ----
NM_000245chr772183 1811 1439 853 813 568 219 ------
NM_000248chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_000259chr1554610 2515 2387 1452 593 1207 24593 933 --
NM_000264chr922441 2404 42772 2339 1046 834 ----
NM_000314chr1043191 2653 724 603 11119 --23128 2601
NM_000332chr676779 5395 5124 2709 871 648 373 26259 144 1750 --
NM_000337chr556547 5382 4955 4074 728 ------
NM_000362chr2233538 2396 933 1630 ----
NM_000408chr21717 1881 12284 --
NM_000411chr211343 43121 2762 2643 2235 1931 --
NM_000430chr17--23707 972 ----
NM_000444chrX1343 ------
NM_000448chr112866 742 22991 2212 --21135 547
NM_000461chr374421 4048 3501 3242 3060 650 548 2508 34 11021 --
NM_000462chr1541523 1407 660 292 --11172 --
NM_000489chrX42389 2342 2235 224 --22708 668 --
NM_000555chrX147433 7302 7023 6802 6729 6601 5913 5873 5318 4958 2979 1707 1548 335 31262 933 370 ----
NM_000663chr162511 21 ----12895
NM_000689chr9154 ------
NM_000719chr1265965 5873 5034 4812 2062 1124 1338 16510 --
NM_000722chr7--174 ----
NM_000726chr2--11282 ----
NM_000756chr81112 163 --1187
NM_000786chr711420 ------
NM_000806chr551961 1439 1242 648 185 11714 1520 --
NM_000807chr41557 1575 167 2108 34
NM_000813chr555567 4520 3913 3629 278 --157 --
NM_000814chr1564026 2716 1553 748 481 266 ------
NM_000826chr43892 442 420 12427 ----
NM_000833chr1611242 ------
NM_000844chr3--1765 1384 --
NM_000866chr341905 1620 1527 1502 ----1615
NM_000875chr1565256 5201 2346 1617 1258 1161 16198 ----
NM_000877chr212340 13007 --13053
NM_000899chr1242926 1674 400 286 --1517 --
NM_000901chr442079 998 933 418 --12438 --
NM_000912chr863173 2420 2359 1062 666 532 --127 --
NM_000924chr1211369 --11231 --
NM_000944chr442148 857 629 420 12119 1884 --
NM_000959chr163357 2941 2517 1454 959 347 1799 ----
NM_000965chr3--1820 ----
NM_001001323chr12--12542 12759 --
NM_001001330chr1011090 ----1942
NM_001001419chr594648 4634 4238 1086 1052 750 369 105 69 --12072 --
NM_001001420chr594648 4634 4238 1086 1052 750 369 105 69 --12072 --
NM_001001481chr822189 1282 1215 --1675
NM_001001787chr11420 --1466 --
NM_001001928chr22118312 8100 7990 7964 7078 5605 5180 5054 2517 917 240 26088 5328 18332 --
NM_001001974chr1021822 1685 21679 1581 11994 --
NM_001002243chr21809 ------
NM_001002255chr6--1111 ----
NM_001002294chr11144 ------
NM_001003652chr1888452 6741 5652 2617 2152 1820 1724 309 37044 1451 843 --12642
NM_001003674chr1835072 2133 1806 35565 5272 1022 ----
NM_001003675chr1835072 2133 1806 35565 5272 1022 ----
NM_001003679chr122075 705 11435 ----
NM_001003681chr2232096 1831 589 11512 ----
NM_001003688chr41849 1975 1274 --
NM_001003712chr1263932 3537 3266 3199 2903 1544 23675 2629 12694 13889
NM_001003792chr311204 1827 ----
NM_001003793chr311204 1827 ----
NM_001003800chr963407 2658 808 705 563 27 32296 453 273 ----
NM_001003945chr911907 1734 ----
NM_001004065chr963973 3006 2651 1372 1212 857 1455 22670 401 --
NM_001004106chr52273 63 ------
NM_001004304chr1253213 2297 2020 473 285 1219 ----
NM_001004317chr653078 2731 1672 333 62 23071 1254 13781 11168
NM_001005266chr152749 612 ------
NM_001005267chr152749 612 ------
NM_001005268chr152749 612 ------
NM_001005269chr152749 612 ------
NM_001005366chr121711 ------
NM_001005404chr1733627 3494 1091 21704 1447 ----
NM_001005473chr566567 6559 6053 5962 4302 1679 25692 4212 ----
NM_001005739chr22762 201 ------
NM_001005746chr2--11282 ----
NM_001005747chr2--11282 ----
NM_001005781chr21586 --1439 --
NM_001005782chr221035 801 --1888 --
NM_001006605chr1--1799 ----
NM_001006605chr1--1799 ----
NM_001006612chrX141 --1347 --
NM_001006613chrX141 --1347 --
NM_001006614chrX141 --1347 --
NM_001006623chr22679 96 ------
NM_001006946chr2------11235
NM_001007024chr17104389 3997 3529 3352 2881 2825 2684 758 682 341 ------
NM_001007025chr17104389 3997 3529 3352 2881 2825 2684 758 682 341 ------
NM_001007067chr8--2732 387 ----
NM_001007068chr8--2732 387 ----
NM_001007069chr8--2732 387 ----
NM_001007070chr8--2732 387 ----
NM_001007097chr924312 970 31744 1392 276 14647 --
NM_001007466chr675059 4567 3872 2067 1646 1357 49 ------
NM_001007471chr91777 ------
NM_001007527chr52246 240 ------
NM_001008215chr22373 336 21033 1006 11156 --
NM_001008393chr452395 2247 1826 1156 445 --11806 --
NM_001008540chr22474 423 --2481 93 --
NM_001008564chr13--11864 ----
NM_001008738chr542731 2535 415 267 ----12136
NM_001009554chr443825 3253 382 209 14704 13721 --
NM_001009554chr443825 3253 382 209 14704 13721 --
NM_001009569chr101128 2562 483 ----
NM_001009909chr1133859 3707 1103 13738 ----
NM_001009993chr264146 1612 1321 813 440 34 23319 3208 1642 --
NM_001010861chr112734 --12281 --
NM_001010867chr1106714 5215 4943 4175 4059 2569 2554 2535 1340 1230 11773 --16197
NM_001010888chrX54486 4170 1082 1075 464 23844 3137 ----
NM_001010924chr101836 ------
NM_001011513chr434101 959 843 13696 ----
NM_001011553chr7--1718 ----
NM_001011645chrX--1337 1121 --
NM_001011657chrX2403 103 ------
NM_001011663chr101142 ------
NM_001011666chr764000 1937 1382 1316 1028 287 26410 1408 ----
NM_001012393chr1185183 4891 4793 4453 3425 3328 3284 1714 11928 1826 --
NM_001012614chr4----1266 --
NM_001012751chr1011396 --11647 1340
NM_001012761chr552682 2461 676 348 320 --1440 --
NM_001012979chrX1155 ------
NM_001013399chr61398 ------
NM_001013406chr731361 1288 438 ------
NM_001013415chr421245 116 11222 1525 --
NM_001013438chr32179 74 ----1784
NM_001013439chr3125 ----1630
NM_001014797chr1047754 6820 6487 5852 12486 45343 2882 1455 363 26582 5578
NM_001015877chrX32930 1912 257 ----12215
NM_001017371chr211240 21270 44 ----
NM_001017523chr12--11575 11850 11198
NM_001017922chr12674 248 1284 21727 659 --
NM_001017926chr811366 2445 258 ----
NM_001018009chr3--11166 ----
NM_001018072chr12--11575 11850 11198
NM_001018074chr541207 844 504 416 13909 1599 --
NM_001018075chr541207 844 504 416 13909 1599 --
NM_001018076chr541207 844 504 416 13909 1599 --
NM_001018077chr541207 844 504 416 13909 1599 --
NM_001018676chr82491 398 ------
NM_001018677chr82491 398 ------
NM_001020658chr131422 1173 248 --11237 --
NM_001020658chr131422 1173 248 --11237 --
NM_001023587chr31232 1294 11110 --
NM_001024094chr541207 844 504 416 13909 1599 --
NM_001024226chr111170 ------
NM_001024227chr111170 ------
NM_001024228chr111170 ------
NM_001024847chr32360 346 --1636 --
NM_001024934chr61186 ------
NM_001024935chr61186 ------
NM_001024936chr61186 ------
NM_001024948chr172979 2330 2281 1341 1054 1039 454 22271 2216 ----
NM_001025076chr1064505 4374 4189 4065 2188 753 35039 2478 2373 ----
NM_001025077chr1075863 5732 5547 5423 5068 2111 1108 16397 ----
NM_001025079chr343818 2681 931 530 14022 ----
NM_001025105chr5--11479 ----
NM_001025108chr294091 3891 3825 3734 3420 3097 2795 1327 1109 1438 13853 12597
NM_001025580chrX53372 3310 1640 1381 424 1232 13536 --
NM_001029875chr51368 12530 ----
NM_001030055chr1441897 1874 1753 857 33523 2999 1044 --11678
NM_001030272chr11164 ------
NM_001030273chr11164 ------
NM_001031695chr2235227 4243 3394 45248 4112 1556 89 ----
NM_001031710chr7144 1797 ----
NM_001031716chr221028 305 1155 ----
NM_001031804chr1634035 3317 703 21677 1067 ----
NM_001031812chr5--11891 22002 577 1331
NM_001032280chr6--11458 ----
NM_001033057chr341522 1373 718 593 11357 ----
NM_001033087chr2092857 2802 2547 2401 2330 1164 1116 826 629 ------
NM_001033503chr51460 --1419 --
NM_001033557chr221352 85 --11376 --
NM_001033561chr17------1696
NM_001033566chr171689 1829 ----
NM_001033568chr171689 1829 ----
NM_001033925chr1052129 1770 1622 1399 810 ------
NM_001034850chr521673 342 --11219 --
NM_001034954chr1042960 2767 2307 96 --22746 821 1616
NM_001034955chr1042960 2767 2307 96 --22746 821 1616
NM_001034956chr1042960 2767 2307 96 --22746 821 1616
NM_001034957chr1042960 2767 2307 96 --22746 821 1616
NM_001035003chr4--21126 932 ----
NM_001035004chr4--21126 932 ----
NM_001037132chr732205 834 294 2663 140 1500 1546
NM_001037133chr732205 834 294 2663 140 1500 1546
NM_001037164chr7176 --1572 --
NM_001037165chr7128455 8303 7712 7462 7031 6538 6092 5725 3053 1983 1761 1704 18738 ----
NM_001037174chr212054 ------
NM_001037317chr112734 --12281 --
NM_001037339chr11576 --11312 --
NM_001037340chr11576 --11312 --
NM_001037341chr11576 --11312 --
NM_001037341chr11576 --11312 --
NM_001037872chr24688 303 268 254 ------
NM_001037954chr1123360 669 2405 375 13300 --
NM_001039538chr233679 3208 1415 33112 3104 765 13000 --
NM_001039585chr153614 3198 2774 1216 604 11056 ----
NM_001039590chrX43525 1381 192 52 ------
NM_001039591chrX43525 1381 192 52 ------
NM_001039618chr1165218 4260 3704 2007 1789 1363 14393 24397 4204 --
NM_001039840chrX15971 32191 2154 1130 ----
NM_001039937chr1344084 3417 430 156 13601 --32953 1414 926
NM_001040020chr731536 479 97 ------
NM_001040092chr8----124 --
NM_001040100chr32219 52 ------
NM_001040157chr422224 2168 21978 271 ----
NM_001040181chr31786 ------
NM_001040182chr31786 ------
NM_001040183chr31786 ------
NM_001040199chr31786 ------
NM_001040200chr31786 ------
NM_001040214chr662199 2056 2020 1494 599 351 --12207 --
NM_001040402chr442947 2190 2030 1161 ----13176
NM_001040429chr1321261 689 11280 ----
NM_001040441chr154799 4041 3759 2188 1971 34884 3496 1458 14246 --
NM_001040446chr532411 1833 78 12168 ----
NM_001040633chr71935 2923 374 ----
NM_001040665chr754278 4022 1983 892 298 --13560 --
NM_001042361chr102623 298 11117 11235 --
NM_001042364chr102623 298 11117 11235 --
NM_001042365chr102623 298 11117 11235 --
NM_001042387chr102623 298 11117 11235 --
NM_001042388chr181392 ----1185
NM_001042393chr102623 298 11117 11235 --
NM_001042396chr102623 298 11117 11235 --
NM_001042397chr102623 298 11117 11235 --
NM_001042425chr6--11458 ----
NM_001042453chrX51701 1538 1339 644 328 ----1620
NM_001042475chr61326 ------
NM_001042481chr1422352 25 12333 11652 1210
NM_001042537chrX22392 730 1620 12123 1921
NM_001042555chr1221923 1915 23824 3626 11371 23656 214
NM_001042599chr227221 6340 ------
NM_001042601chr332829 981 98 12131 --12971
NM_001042604chr344335 3429 1824 201 23843 1234 1851 --
NM_001042683chr621432 145 ------
NM_001042749chrX51760 334 212 91 77 11902 ----
NM_001042750chrX51760 334 212 91 77 11902 ----
NM_001042751chrX51760 334 212 91 77 11902 ----
NM_001042762chr7--1854 138 --
NM_001043318chr1473849 3754 3055 2657 1208 364 89 --34012 3124 195 --
NM_001044305chr631603 1505 299 11640 ----
NM_001044722chr5--11891 22002 577 1331
NM_001044723chr5--11891 22002 577 1331
NM_001069chr6--1151 ----
NM_001083620chr43891 441 419 12425 ----
NM_001100108chr1125969 5900 2979 2570 1815 1258 933 784 625 290 191 153 22121 351 27670 1774 --
NM_001106chr379515 7058 6380 3550 2776 2533 110 28693 2435 22070 820 --
NM_001117chr1862290 2055 1992 787 279 32 ------
NM_001121chr1011487 1482 ----
NM_001126chr11122 ------
NM_001149chr10--1882 ----
NM_001173chr1441897 1874 1753 857 33523 2999 1044 --11678
NM_001178chr11164 ------
NM_001186chr2152790 2747 2511 967 808 32702 1049 318 ----
NM_001201chr443817 2857 1407 776 13971 23656 3532 --
NM_001206chr91741 12315 --13045
NM_001256chr1722769 610 --12926 --
NM_001259chr752380 1882 1625 371 196 14923 ----
NM_001304chr1723637 50 23182 219 11193 --
NM_001328chr4----1266 --
NM_001364chr1164292 4221 1880 1373 1351 733 1963 14214 11723
NM_001394chr81605 ------
NM_001396chr2142747 2433 2206 1090 ----12236
NM_001408chr1----11615 11707
NM_001427chr711986 --11511 --
NM_001438chr183452 3407 2691 2549 2330 1252 818 721 --1693 --
NM_001452chr61687 ------
NM_001453chr621665 1487 ------
NM_001483chr72178 118 ------
NM_001498chr631079 877 175 147 ----
NM_001527chr664191 4105 1860 1157 546 449 14714 ----
NM_001584chr111934 1487 1919 1838
NM_001609chr1053679 1447 1041 343 318 ------
NM_001616chr232417 2409 75 ----1546
NM_001649chrX--12018 ----
NM_001650chr1853760 3696 3026 371 102 23285 431 ----
NM_001656chr522056 576 21896 622 21983 408 --
NM_001658chr111170 ------
NM_001663chr1452537 1914 1738 608 133 ----12714
NM_001668chr131867 709 285 11605 11719 --
NM_001677chr111058 --11104 1341
NM_001679chr3----1215 --
NM_001682chr12--12256 12473 --
NM_001706chr311041 ------
NM_001709chr1112346 1135 1139 --
NM_001716chr11--11529 ----
NM_001730chr1341572 1084 1004 653 1455 1305 --
NM_001730chr1341572 1084 1004 653 1455 1305 --
NM_001735chr9127 ------
NM_001755chr1642115 1849 639 472 1546 11781 --
NM_001759chr1244709 4688 4453 4403 24756 619 12068 1212
NM_001777chr343818 2681 931 530 14022 ----
NM_001788chr7--1718 ----
NM_001830chrX31192 1000 193 1723 ----
NM_001839chr1--2494 211 1274 --
NM_001855chr9196 ------
NM_001858chr643880 1429 1223 997 21108 164 11119 --
NM_001881chr101399 ------
NM_001882chr5--1476 --1416
NM_001892chr5--11479 ----
NM_001901chr61947 ------
NM_001918chr1108316 7880 7202 6949 3178 2777 1843 1731 1229 806 26341 2743 18829 --
NM_001938chr11319 21251 672 ----
NM_001950chr16--2737 691 1763 --
NM_001964chr5----1406 --
NM_001968chr4--1231 1954 --
NM_001969chr1463890 3057 2848 1243 1206 273 1220 --13533
NM_001981chr132412 1524 597 ------
NM_001995chr42392 179 189 1417 --
NM_002009chr1532578 2467 598 1905 ----
NM_002015chr1383167 3050 2573 2263 1060 663 209 187 ------
NM_002017chr1121058 1027 --11119 --
NM_002024chrX41559 1423 812 403 1360 ----
NM_002025chrX88994 8892 8375 7890 3687 1918 1866 1042 12410 12629 19161
NM_002027chr82491 398 ------
NM_002039chr41637 ------
NM_002040chr2132339 1089 672 23228 2453 2110 58 --
NM_002041chr15--1108 ----
NM_002053chr1--21010 736 1409 --
NM_002061chr111445 ------
NM_002069chr71493 182 --1469
NM_002072chr9----1207 --
NM_002077chr932030 751 316 ------
NM_002082chr52236 26 ------
NM_002107chr1--1402 ----
NM_002126chr1743330 2915 2730 1585 23872 1557 --11458
NM_002128chr1372258 2228 1894 558 411 338 144 --1128 1225
NM_002193chr221549 160 11522 21903 102 --
NM_002203chr533482 3171 991 12584 ----
NM_002210chr241053 458 426 339 23079 857 23547 2870 --
NM_002227chr1--1481 ----
NM_002232chr111258 ------
NM_002270chr564488 4359 2023 1009 858 399 22280 130 ----
NM_002271chr1321507 553 11878 ----
NM_002279chr17------128
NM_002285chr294091 3891 3825 3734 3420 3097 2795 1327 1109 1438 13853 12597
NM_002293chr122698 872 21807 1699 1292 --
NM_002310chr542238 1238 839 184 36465 5045 2002 --11217
NM_002335chr11----1168 --
NM_002349chr211515 ----1245
NM_002351chrX2365 78 ------
NM_002356chr622077 730 1988 22754 2404 --
NM_002374chr233679 3208 1415 33112 3104 765 13000 --
NM_002376chr143465 389 68 ------
NM_002387chr533664 1746 608 43902 3144 496 48 ----
NM_002408chr141651 ----1347
NM_002448chr41756 ------
NM_002467chr8--1312 ----
NM_002487chr152647 90 --1128 --
NM_002500chr24508 456 208 51 1239 --11113
NM_002508chr121994 1717 ------
NM_002519chr1111518 --1251 --
NM_002544chr17----150 --
NM_002545chr1185183 4891 4793 4453 3425 3328 3284 1714 11928 1826 --
NM_002577chr343428 2538 1143 702 --13155 --
NM_002581chr985502 4205 3650 3538 1329 560 247 241 --11811 13941
NM_002594chr204976 773 198 101 12111 ----
NM_002595chr1241939 276 260 242 11864 1198 --
NM_002600chr11576 --11312 --
NM_002610chr222178 1219 --11195 --
NM_002613chr1665003 4715 4171 4159 1651 1057 34872 1327 131 15205 --
NM_002645chr113708 382 104 11177 12274 --
NM_002655chr875263 5246 4378 4153 3801 1800 937 33629 1330 651 1871 --
NM_002657chr2033306 2577 1310 --12942 --
NM_002706chr21635 --1659 --
NM_002709chr272559 1274 1236 1213 756 666 644 ------
NM_002710chr121872 ------
NM_002715chr521074 351 ----123
NM_002717chr81145 ------
NM_002721chr9--1177 ----
NM_002745chr2283952 3387 2912 1401 1390 782 547 365 31088 1052 555 ----
NM_002822chr122285 57 31787 1723 534 ----
NM_002833chr1531609 1601 1169 ------
NM_002838chr15912 436 186 106 88 ------
NM_002848chr121178 21154 990 --1279
NM_002851chr7--1227 ----
NM_002873chr5----1441 --
NM_002874chr93682 400 167 22173 863 ----
NM_002886chr344886 4364 722 661 43951 1535 990 230 ----
NM_002892chr1431063 671 591 ------
NM_002906chr1111500 12092 1597 --
NM_002941chr321527 446 2543 375 ----
NM_002942chr321172 901 --21233 1115 --
NM_002968chr161948 ----1817
NM_002973chr121498 ------
NM_002997chr2------11235
NM_003010chr1762277 2168 862 554 548 338 ------
NM_003013chr4--1624 ----
NM_003017chr661344 937 539 403 62 30 ----11161
NM_003034chr1247462 1933 1446 590 22006 210 15884 17531
NM_003036chr13220 92 44 1896 168 11174
NM_003081chr20--11128 ----
NM_003092chr20144 ------
NM_003108chr245890 5223 1451 39 --35323 1188 982 14825
NM_003110chr17----1892 --
NM_003111chr211240 21270 44 ----
NM_003112chr742721 2691 2215 943 32860 2534 419 --13140
NM_003113chr21141 ----1217
NM_003143chr7----137 --
NM_003161chr17--33373 3341 1087 ----
NM_003183chr22646 274 ------
NM_003199chr18105228 5068 4629 3742 1725 1648 1485 1195 863 268 24290 1422 ----
NM_003220chr6--11458 ----
NM_003242chr32360 346 --1636 --
NM_003244chr181155 1335 ----
NM_003253chr2121277 748 21237 299 1441 --
NM_003257chr1521199 104 11099 --1497
NM_003262chr314459 53960 3424 887 554 230 1186 --
NM_003298chr396004 5994 5705 4020 2150 1739 1248 1097 541 21514 1437 24081 864 --
NM_003300chr14--1485 ----
NM_003305chr4--133 1371 --
NM_003337chr531280 1143 682 11264 ----
NM_003340chr4135 2525 408 11169 --
NM_003352chr221035 801 --1888 --
NM_003387chr241887 1008 809 223 22535 2491 ----
NM_003390chr111140 ------
NM_003392chr341501 1481 1263 270 13696 160 --
NM_003403chr14----1626 --
NM_003404chr2021779 413 1709 --11951
NM_003410chrX22835 462 --13098 --
NM_003413chrX31719 1501 570 11519 1709 --
NM_003416chr8144 ------
NM_003442chr11--2896 236 ----
NM_003463chr63663 584 177 12506 ----
NM_003467chr22474 423 --2481 93 --
NM_003468chr294068 3940 3846 3756 3450 3266 1372 1270 549 --12788 --
NM_003473chr10--1727 --1701
NM_003474chr102423 223 12171 --11756
NM_003482chr1222482 2294 ----12588
NM_003483chr1212963 ------
NM_003489chr2142938 2915 2586 1181 ------
NM_003507chr222040 270 --1420 11922
NM_003566chr1222530 573 --12374 --
NM_003574chr1835636 1413 460 24276 724 1119 1887
NM_003583chr1243856 3627 2411 1503 12739 --12375
NM_003590chr273670 2898 1079 919 782 309 223 1111 ----
NM_003620chr172871 112 ------
NM_003626chr111975 2502 48 21328 981 11194
NM_003629chr152210 1368 1249 316 47 ----1387
NM_003630chr62748 25 ------
NM_003663chr312368 22572 2241 12903 --
NM_003672chr111579 21858 747 1318 --
NM_003677chr12--1262 ----
NM_003682chr11----2848 248 --
NM_003716chr311002 ------
NM_003722chr332056 552 207 1357 ----
NM_003758chr1551249 1113 1052 357 108 21478 414 11003 --
NM_003758chr1551249 1113 1052 357 108 21478 414 11003 --
NM_003759chr454215 3718 3545 1213 263 1923 11607 --
NM_003799chr1853847 2909 1483 1256 113 2428 350 1456 --
NM_003818chr203989 207 169 ------
NM_003825chr152507 141 ------
NM_003870chr1531768 1525 292 ------
NM_003887chr252146 2025 1865 667 573 12209 --11496
NM_003888chr1521437 1199 --1176 --
NM_003895chr214793 460 416 141 ----12152
NM_003907chr3--1140 ----
NM_003909chr842292 998 536 483 11129 --11941
NM_003919chr7--149 ----
NM_003930chr722010 1698 22484 322 1567 --
NM_003931chr61186 ------
NM_003939chr1033777 2767 453 --53412 3392 3110 564 412 --
NM_003941chr732508 1762 1589 1612 --2636 402
NM_003958chr643193 3053 2855 2754 33751 2788 2717 12734 1953
NM_003966chr577679 7547 6484 6477 5675 3002 2865 1602 --17767
NM_003993chr1--137 1312 --
NM_003994chr1242926 1674 400 286 --1517 --
NM_004028chr1853760 3696 3026 371 102 23285 431 ----
NM_004060chr5----21078 1038 --
NM_004061chr5------1427
NM_004067chr731444 1115 360 ------
NM_004094chr1422122 1022 22365 1029 ----
NM_004113chr31573 ------
NM_004124chr1422631 102 23269 638 ----
NM_004130chr3193 ----1584
NM_004171chr1198951 8678 8498 8116 6718 3023 2934 2627 2124 49385 7090 3030 2256 38816 7986 1989 --
NM_004177chr1121772 688 ------
NM_004180chr2----1621 --
NM_004225chr81494 31416 1238 342 ----
NM_004229chrX21656 196 12232 ----
NM_004241chr101224 ----1158
NM_004274chr1432641 2419 2103 2612 521 --11076
NM_004280chr6192 ------
NM_004296chr1453178 3084 1516 472 229 12815 24029 248 --
NM_004331chr832652 2008 1638 11932 ----
NM_004337chr832188 1996 349 22042 425 1326 --
NM_004338chr1835072 2133 1806 35565 5272 1022 ----
NM_004341chr2----1226 --
NM_004370chr621935 33 --1714 --
NM_004384chr5--11891 22002 577 1331
NM_004392chr131245 --11734 1810
NM_004395chr51173 --1214 --
NM_004397chr1111735 1855 12936 --
NM_004426chr1251922 1701 723 571 229 ----11344
NM_004432chr942260 1950 789 219 ----22318 1957
NM_004438chr232102 403 137 12089 12874 --
NM_004440chr621943 471 --11821 --
NM_004454chr352196 1914 1829 1704 922 ------
NM_004457chr231571 362 31 ------
NM_004463chrX4653 635 486 199 ------
NM_004474chr11244 --1903 --
NM_004482chr21321 1251 ----
NM_004496chr1411204 1543 11127 --
NM_004504chr22861 594 --12921 --
NM_004520chr51664 ------
NM_004586chrX24269 1226 2480 315 ----
NM_004593chr31243 ----1640
NM_004598chr563073 2622 1217 664 406 321 21024 387 --23142 3049
NM_004606chrX------188
NM_004612chr964492 4116 4066 3512 1598 1459 34304 1726 121 13147 --
NM_004621chr1111304 1858 ----
NM_004622chr231630 541 177 2736 418 ----
NM_004637chr32931 379 ------
NM_004641chr101128 2562 483 ----
NM_004642chr123146 103 55 1272 ----
NM_004655chr17----1343 21146 1095
NM_004660chrY22143 1611 ----1744
NM_004685chr1352707 2161 1041 761 526 ----11910
NM_004687chr1762103 2057 1378 1338 1310 1302 ------
NM_004712chr17140 --1477 --
NM_004719chr12----1294 --
NM_004726chrX34805 4036 1391 15081 ----
NM_004734chr1322916 2208 22333 421 ----
NM_004738chr2042416 2088 1927 207 --22177 764 12173
NM_004745chr857026 4887 4742 2003 1598 17061 2635 57 --
NM_004748chr1533968 1689 1354 23651 1136 ----
NM_004760chr722446 1636 --1200 --
NM_004768chr131127 1104 104 1288 11149 --
NM_004774chr172714 628 22768 1918 --12717
NM_004775chr1822137 155 1545 ----
NM_004801chr22993 30 21299 328 11069 --
NM_004824chr61499 --21315 1258 11354
NM_004830chr6--1826 ----
NM_004831chr19--1273 --11000
NM_004844chr3--11166 ----
NM_004849chr62632 534 31233 671 494 --11470
NM_004850chr231314 1203 402 11388 ----
NM_004859chr1762889 2616 2342 2098 1879 819 ------
NM_004860chr17------1569
NM_004863chr1445076 4284 3796 2122 ----11922
NM_004865chr61128 ------
NM_004866chr534086 1185 96 34918 1845 1229 --1991
NM_004871chr17104389 3997 3529 3352 2881 2825 2684 758 682 341 ------
NM_004874chr81455 ------
NM_004891chr21228 ------
NM_004902chr20129 ------
NM_004904chr764000 1937 1382 1316 1028 287 26410 1408 ----
NM_004906chr62530 27 ----1464
NM_004912chr731361 1288 438 ------
NM_004926chr1421551 245 --11577 --
NM_004955chr6----1521 --
NM_004956chr733903 2843 1175 34585 1690 964 24312 385 --
NM_004960chr161277 ------
NM_004973chr621637 222 ----11350
NM_004974chr1187 ------
NM_004985chr1264546 4282 4134 3640 3368 965 23458 750 ----
NM_004992chrX88149 7653 7555 5812 3175 2971 806 424 --18384 28030 1726
NM_004992chrX88149 7653 7555 5812 3175 2971 806 424 --18384 28030 1726
NM_004993chr1421261 1023 161 11072 --
NM_005010chr732205 834 294 2663 140 1500 1546
NM_005034chr8--194 174 --
NM_005036chr22118312 8100 7990 7964 7078 5605 5180 5054 2517 917 240 26088 5328 18332 --
NM_005045chr71255 ------
NM_005063chr102946 624 ----1127
NM_005065chr1464865 3987 3697 2108 1816 1017 14944 --11827
NM_005077chr9--1496 ----
NM_005087chr3125 ----1630
NM_005103chr111284 --1111 --
NM_005121chr1742627 2603 2478 720 22568 800 1663 1751
NM_005134chr181392 ----1185
NM_005154chr152660 87 ------
NM_005160chr2286765 5654 5208 4518 2492 1823 1766 703 ------
NM_005171chr1231257 1041 951 ------
NM_005180chr1021196 69 --11624 11164
NM_005190chr61398 ------
NM_005224chr191681 ------
NM_005235chr227221 6340 ------
NM_005238chr1143253 2312 811 147 22995 2511 11248 --
NM_005254chr1521046 229 --2472 79 --
NM_005259chr21111 2386 133 --1506
NM_005264chr101790 --176 --
NM_005284chr61188 1352 ----
NM_005302chr7--1337 ----
NM_005318chr22----11153 --
NM_005339chr443312 3131 2648 1638 13032 ----
NM_005347chr931591 1571 132 ------
NM_005359chr1886380 5696 4848 2516 2131 1207 1006 986 25330 1533 ----
NM_005389chr6185 ------
NM_005399chr124283 2740 24455 1758 24179 3427 --
NM_005406chr18----1231 --
NM_005415chr22790 78 ------
NM_005445chr101303 ------
NM_005455chr121500 246 --1143 --
NM_005465chr111937 21822 261 ----
NM_005475chr1232567 916 706 23149 906 12726 --
NM_005487chr2232096 1831 589 11512 ----
NM_005497chr1796167 6003 5627 5432 4772 1688 1558 1193 216 --16083 21665 305
NM_005499chr191584 ------
NM_005504chr1245908 4831 838 423 35453 4477 2483 ----
NM_005506chr452888 2359 964 738 258 --12031 --
NM_005509chr5166 ------
NM_005520chr5--136 ----
NM_005522chr72408 97 --1373 --
NM_005573chr5158 ------
NM_005578chr353570 3351 1904 1833 1066 14467 ----
NM_005596chr974838 4362 3991 1714 1238 1099 642 25360 253 --14654
NM_005607chr82843 106 --11030 --
NM_005625chr8--2732 387 ----
NM_005639chr12----1489 --
NM_005647chrX63261 2827 2650 1227 722 66 --23289 2297 --
NM_005648chr8--182 ----
NM_005649chr5--1393 ----
NM_005665chr144728 4356 4057 153 22982 1321 ----
NM_005668chr554321 3814 1452 1358 234 14243 1710 14584
NM_005669chr5--12222 11774 21468 542
NM_005725chr112191 2608 562 ----
NM_005738chr7176 --1572 --
NM_005739chr1562372 2085 2061 789 543 38 11485 --1164
NM_005742chr21671 1731 ----
NM_005746chr732061 90 55 --1679 --
NM_005749chr171503 2243 229 ----
NM_005783chr21123 ------
NM_005786chr1821078 837 ----11231
NM_005813chr25960 941 867 399 163 1670 --1972
NM_005840chrX86290 2832 2748 2001 1824 1727 1039 162 ------
NM_005841chr42807 337 ------
NM_005842chr13--2566 26 1559 --
NM_005845chr131229 --1492 11343
NM_005863chr10----157 --
NM_005871chr101769 2697 256 1757 --
NM_005872chr11204 --1438 --
NM_005896chr22168 148 ------
NM_005899chr171111 21353 151 11166 --
NM_005900chr41849 1975 1274 --
NM_005901chr1888452 6741 5652 2617 2152 1820 1724 309 37044 1451 843 --12642
NM_005902chr1542800 1633 927 765 33230 1546 1331 12827 --
NM_005903chr594648 4634 4238 1086 1052 750 369 105 69 --12072 --
NM_005906chr631671 1551 640 127 11644 1434
NM_005907chr61158 11134 1303 --
NM_005909chr554125 4025 3083 2671 1357 1867 --11281
NM_005924chr72847 412 1723 ----
NM_005935chr465110 4382 3881 3843 1434 992 11109 ----
NM_005940chr22----1703 --
NM_005941chr832776 961 723 12576 ----
NM_005955chr161898 1457 1080 1070 949 604 ----11179
NM_005964chr1721070 31 11145 ----
NM_005966chr252289 2120 1924 379 139 11608 ----
NM_005967chr12------1706
NM_005977chr13--1854 --1339
NM_005985chr202776 309 --1789 --
NM_005986chr1322480 98 12744 --1261
NM_006007chr9114488 4402 4318 4266 4130 3256 2759 1488 1401 1226 187 31096 801 325 ----
NM_006047chr2043232 1039 548 115 1197 11166 --
NM_006051chr5179 1282 ----
NM_006060chr744340 3539 3430 2857 24108 1593 13597 --
NM_006135chr12458 155 ------
NM_006153chr31264 1588 ----
NM_006154chr1541848 1179 777 340 ----1890
NM_006159chr121107 ----2462 252
NM_006203chr555545 4988 4509 1860 1243 11898 ----
NM_006209chr8----124 --
NM_006226chr211365 ------
NM_006246chr1411053 2126 97 ----
NM_006251chr531309 1302 207 2220 31 --12254
NM_006252chr177066 6916 5910 5901 1806 1250 1046 34830 2339 1286 1942 --
NM_006256chr132625 2011 643 --21911 1042 --
NM_006275chr2042109 1949 641 227 11983 ----
NM_006282chr2054281 3086 1254 1138 429 11439 24494 436 --
NM_006306chrX55807 5744 4541 1737 658 --24051 3776 13681
NM_006313chr122210 150 ----11114
NM_006323chr4--1592 1266 --
NM_006324chr16178 ------
NM_006335chr1173 1256 ----
NM_006357chr2169 ------
NM_006359chrX22392 730 1620 12123 1921
NM_006364chr141222 ------
NM_006379chr7--11630 ----
NM_006386chr221260 ------
NM_006393chr1042822 1595 1313 403 --14383 12853
NM_006407chr381333 1060 1011 1002 523 303 136 46 2313 30 ----
NM_006415chr9--11052 ----
NM_006424chr4----11219 21554 1408
NM_006434chr1042960 2767 2307 96 --22746 821 1616
NM_006451chr521023 403 --1221 --
NM_006457chr434101 959 843 13696 ----
NM_006460chr172570 45 ------
NM_006482chr1243856 3627 2411 1503 12739 --12375
NM_006496chr12734 32 ----11474
NM_006504chr1052802 2773 2259 935 146 ------
NM_006526chr2051938 1661 864 473 165 ------
NM_006538chr231382 404 97 21092 1076 13544 12736
NM_006544chr1465386 4318 2436 2291 898 849 15791 11734 1576
NM_006546chr1756111 5175 4677 1729 461 24942 544 --11306
NM_006557chr931551 677 31 ------
NM_006561chr1064505 4374 4189 4065 2188 753 35039 2478 2373 ----
NM_006577chr211052 ------
NM_006595chr1121764 1745 ----1534
NM_006599chr16137937 6975 6968 6514 5852 5600 3289 2611 1898 1828 1354 1202 565 2976 780 1305 --
NM_006603chrX51760 334 212 91 77 11902 ----
NM_006606chr2013108 ------
NM_006614chr32507 383 --1986 --
NM_006618chr131496 1031 651 11571 --1316
NM_006620chr633809 3096 35 44271 4131 3786 3458 --14213
NM_006622chr52512 172 ------
NM_006629chr1862625 2603 2222 2162 1924 1085 12191 ----
NM_006654chr1221923 1915 23824 3626 11371 23656 214
NM_006660chr15270 30 ------
NM_006667chrX21046 263 --1892 --
NM_006690chr20----21741 124 --
NM_006698chr2011033 ------
NM_006703chr6----1442 --
NM_006704chr13--1332 ----
NM_006722chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_006726chr41275 ------
NM_006727chr5--1383 ----
NM_006731chr995749 5550 5016 4950 4905 4225 1011 324 204 13605 ----
NM_006734chr61233 2109 88 1460 11480
NM_006750chr1656182 2086 2012 1758 1224 48025 6510 1129 448 --27572 2611
NM_006756chr8--21081 1066 ----
NM_006775chr662758 2193 956 819 569 544 --22653 108 --
NM_006805chr52428 235 ------
NM_006885chr161421 ------
NM_006894chr11144 ------
NM_006914chr921335 145 ------
NM_006915chrX----1626 --
NM_006924chr1734401 808 43 11360 --11160
NM_006939chr14----1753 --
NM_006948chr2152405 2055 1623 1610 465 1922 ----
NM_006951chr10--1169 2787 542 --
NM_006956chr752285 2046 1756 905 41 1557 ----
NM_006996chr111879 21918 30 ----
NM_007005chr921466 470 --11252 --
NM_007006chr1622326 62 12829 --11080
NM_007007chr1254368 3810 3363 1002 243 23162 1011 14378 --
NM_007013chr8----196 --
NM_007034chr131016 834 173 ------
NM_007039chr1421586 46 ------
NM_007050chr2077990 7771 7124 5357 2242 1956 347 --27808 1905 --
NM_007054chr553871 2692 913 284 244 33971 3473 2535 ----
NM_007106chr1322446 808 32776 2690 704 ----
NM_007107chr332022 1983 889 12159 11527 --
NM_007114chr321196 164 --12859 --
NM_007124chr61632 21540 304 139 --
NM_007137chrX64676 4256 4183 1709 1178 479 11453 --1411
NM_007146chr1711022 1698 ----
NM_007157chrX32123 85 46 22881 639 ----
NM_007203chr963973 3006 2651 1372 1212 857 1455 22670 401 --
NM_007222chr811366 2445 258 ----
NM_007246chr411000 ------
NM_007249chr1369069 3546 3127 3035 1713 1485 21561 1131 ----
NM_007271chr651539 1430 570 426 351 ------
NM_007282chr33812 351 118 --2283 249 --
NM_007317chr16_random162 ------
NM_007347chr151909 1319 --1201
NM_007373chr1051839 1242 648 484 309 ------
NM_012081chr553472 3406 2803 770 548 ------
NM_012082chr85680 652 322 288 154 ------
NM_012092chr2------21644 1639
NM_012095chr1033247 2924 2369 23280 2584 1384 --
NM_012096chr342969 1468 1178 535 --13770 --
NM_012097chr212054 ------
NM_012120chr632300 1169 902 1846 ----
NM_012129chr732245 2115 1725 ------
NM_012141chr1344084 3417 430 156 13601 --32953 1414 926
NM_012154chr8--2816 644 ----
NM_012158chr132430 276 11536 ----
NM_012164chr977220 6403 4800 2803 1281 1170 1028 25025 439 22787 818 1726
NM_012175chr11--195 ----
NM_012224chr421013 756 21117 87 ----
NM_012229chr10----11375 --
NM_012238chr1031610 1397 22 ------
NM_012247chr1011018 1662 1880 --
NM_012250chr11----11378 --
NM_012252chr734531 3598 3525 --12052 1268
NM_012255chr20142 1102 ----
NM_012257chr71910 ----1300
NM_012287chr363525 1311 1286 1094 641 54 34452 1010 682 ----
NM_012289chr19131 ------
NM_012290chr211291 --21579 1482 --
NM_012297chr422490 777 12644 1840 1943
NM_012300chr542377 1956 938 659 12144 ----
NM_012325chr20--11206 ----
NM_012328chr721102 122 1556 ----
NM_012333chr151642 1211 449 342 62 --1367 --
NM_012342chr101179 ------
NM_012347chr652878 2085 1855 1189 50 ------
NM_012384chr2042289 1742 1669 592 21663 749 --2396 333
NM_012399chr221480 11981 ----
NM_012419chr6192 ------
NM_012425chr10--12068 ----
NM_012428chr151327 1829 --1394
NM_012465chr1012524 1708 --1102
NM_012479chr752549 1067 1022 933 609 22261 594 ----
NM_013231chr1453371 3057 2994 2870 265 24385 3614 ----
NM_013243chr153944 574 53 1125 ----
NM_013261chr463750 2596 2333 1168 1149 653 --1958 --
NM_013296chr1196 184 ----
NM_013354chr821384 1093 1552 ----
NM_013374chr362835 2778 2644 2109 241 140 ------
NM_013386chr121799 502 1481 ----
NM_013412chr21971 11245 ----
NM_013423chrX11006 --1300 --
NM_013427chrX11006 --1300 --
NM_013436chr2--1168 ----
NM_013437chr8171 ------
NM_013438chr921284 610 2682 622 11446 2394 148
NM_013444chrX2877 865 1762 1934 --
NM_013448chr141181 1226 ----
NM_013450chr21824 ----1834
NM_013943chr152663 2093 1129 327 146 1927 ----
NM_013952chr242388 2131 1705 970 ----1755
NM_013953chr242388 2131 1705 970 ----1755
NM_013992chr242388 2131 1705 970 ----1755
NM_013995chrX32396 2014 1681 1218 ----
NM_014021chr163455 2858 2260 938 559 241 12803 ----
NM_014023chr1072304 1080 979 742 530 162 57 ------
NM_014048chr1654806 3345 1952 1065 195 1319 1815 --
NM_014055chr121439 ----194
NM_014056chr3----11696 --
NM_014071chr20----195 --
NM_014089chr13--11864 ----
NM_014109chr8----11247 --
NM_014112chr823754 1556 25243 4782 --1597
NM_014141chr764598 4562 4473 1741 1573 198 35010 4913 931 ----
NM_014155chr1177305 6707 5015 1994 1681 1324 1299 36761 6548 2368 16616 --
NM_014157chr1653685 3379 1214 878 586 --13044 --
NM_014181chr2--12529 22273 348 --
NM_014184chr1140 ------
NM_014212chr121690 ------
NM_014243chr431449 651 467 1343 ----
NM_014250chr2232096 1831 589 11512 ----
NM_014252chr132359 48 ------
NM_014253chrX12465 --1660 12022
NM_014267chr11--1228 ----
NM_014283chr131457 1028 181 ----11137
NM_014294chr841161 1001 124 94 11192 ----
NM_014309chr2235217 4233 3384 45238 4102 1546 79 ----
NM_014331chr457522 7423 5298 5290 5208 15605 ----
NM_014333chr1182707 2525 2485 2287 2062 958 804 723 ----12281
NM_014342chr11180 ------
NM_014368chr931995 1947 480 --21684 1590 --
NM_014415chr321527 1071 --1324 --
NM_014423chr575461 5426 1782 1100 1093 739 577 2720 223 ----
NM_014445chr361981 1855 1784 661 595 417 1247 ----
NM_014488chr11----1455 --
NM_014506chr951671 1169 382 176 125 ----11473
NM_014554chr1222032 60 ----12067
NM_014577chr22199 ------
NM_014604chr171118 ----147
NM_014606chr441503 1187 1059 499 ----1159
NM_014607chr2--11777 11520 --
NM_014612chr91356 ------
NM_014614chr21980 11339 11315 11407
NM_014616chr353177 2680 1157 1041 898 11140 23464 922 --
NM_014646chr1833243 2853 181 13202 --13187
NM_014667chr351984 1828 1562 927 642 --1954 --
NM_014673chr8--1103 ----
NM_014676chr131422 1173 248 --11237 --
NM_014677chr81400 --11306 --
NM_014683chr1721469 62 --1301 12167
NM_014702chr621195 1184 13420 ----
NM_014707chr7--21507 606 12055 1740
NM_014711chr1611749 1492 ----
NM_014719chr711121 ------
NM_014735chrX--2394 187 ----
NM_014743chr433030 940 453 12034 22564 971 12897
NM_014747chr145048 2267 528 230 1613 14828 25797 5667
NM_014752chr1131963 1447 274 --1315 11538
NM_014755chr263130 1717 1277 563 451 234 ----13702
NM_014786chr11------1388
NM_014787chr11608 11834 ----
NM_014795chr2----1211 11033
NM_014803chr102554 97 11867 ----
NM_014810chr153477 2808 2801 357 170 11277 --13286
NM_014819chr5--1869 ----
NM_014832chr1342116 1628 1602 1280 11366 ----
NM_014839chr152506 2089 1958 767 440 21946 391 ----
NM_014848chr1562027 1999 1855 930 898 849 --12360 12494
NM_014868chr121170 --1739 --
NM_014876chr2221846 69 ----1508
NM_014877chr1767700 7691 7430 6747 5824 2809 11853 36979 5956 2697 --
NM_014888chr731536 479 97 ------
NM_014897chr1732911 2514 589 23026 2786 ----
NM_014899chr543116 713 239 120 12238 ----
NM_014901chr542012 1623 886 726 21672 1533 ----
NM_014905chr2--11436 1362 --
NM_014906chr1743497 3223 2638 356 12987 21578 160 --
NM_014912chr102159 80 ----12498
NM_014920chr683619 2788 2648 2468 1466 455 294 87 11172 ----
NM_014923chr1341968 1864 1699 927 1116 ----
NM_014934chr1333399 808 668 4771 616 345 166 13759 --
NM_014946chr232984 2907 2377 --13089 11157
NM_014950chr1451193 523 439 285 64 ------
NM_014962chr2042868 2236 2127 160 22785 174 ----
NM_014969chr11983 128 --21031 799
NM_014978chr1011624 11754 ----
NM_014982chr1453731 3577 1608 1515 1090 65400 2008 1703 1690 572 462 1484 --
NM_014991chr453175 1063 1017 902 168 11214 --13047
NM_015020chr1673621 3214 3168 1004 803 183 38 13888 12815 --
NM_015025chr252217 2070 1959 1741 248 --12039 --
NM_015026chr1243681 3657 1542 1172 33261 1332 250 2518 301 --
NM_015027chr162728 464 ----11263
NM_015032chr131887 12441 1307 12177
NM_015045chr10--12159 ----
NM_015049chr243147 3015 2638 2092 ----1834
NM_015056chr2152154 1871 1755 961 40 1680 ----
NM_015069chr161222 --1643 --
NM_015071chr566023 5893 4262 2466 2371 99 25820 5180 ----
NM_015072chr14--1415 ----
NM_015074chr144207 3262 1424 1400 1674 35003 4909 964 --
NM_015092chr1624715 2873 1599 23446 875 --
NM_015093chr641579 1166 710 642 --2611 252 --
NM_015094chr22104655 4586 4416 3712 3372 1465 1382 1294 1257 474 177 24670 439 --
NM_015097chr331824 1799 512 ------
NM_015115chr442947 2190 2030 1161 ----13176
NM_015138chr1531122 679 159 --1950 12636
NM_015147chr23938 812 671 1949 12617 --
NM_015156chr1453622 3511 2864 1170 993 --22971 593 --
NM_015172chr121580 1522 ----1576
NM_015184chr31134 ------
NM_015205chr1344818 3387 1967 1108 --23517 54 --
NM_015206chr15--23099 71 23735 26 --
NM_015208chr1843242 2805 684 538 1707 1474 --
NM_015215chr122279 1129 1598 --12157
NM_015263chr15151 1243 ----
NM_015271chr454067 3152 2931 2803 1188 1465 --13828
NM_015272chr1621828 1381 ------
NM_015275chr1231745 399 125 ----1541
NM_015310chr898210 5832 5624 5196 5071 3269 2857 1325 157 48308 2272 2215 790 1550 --
NM_015317chr232572 1125 678 22170 627 12353 1357
NM_015335chr1211616 22541 2484 22545 1663 22557 672
NM_015344chr831953 1826 543 11362 --197
NM_015358chr2111181 11162 152 --
NM_015360chr5155 ------
NM_015361chr24839 819 378 125 ----1324
NM_015365chrX53372 3310 1640 1381 424 1232 13536 --
NM_015375chr124754 508 24892 3956 ----
NM_015381chr222817 355 22027 2002 ----
NM_015385chr1042960 2767 2307 96 --22746 821 1616
NM_015387chr251549 1489 258 111 94 11728 --11444
NM_015396chr33510 299 56 11361 ----
NM_015443chr171365 ------
NM_015446chr121682 410 ------
NM_015455chr554152 3908 3307 881 430 --23796 2811 --
NM_015460chr311743 ------
NM_015496chr8--1283 ----
NM_015508chr331449 1001 477 ------
NM_015530chr21741 1767 --1780
NM_015534chr1--11062 1149 --
NM_015542chr102879 483 1472 ----
NM_015554chr1542795 2641 2074 270 22843 2059 ----
NM_015560chr342693 2540 2396 2298 1409 ----
NM_015569chr123006 1118 --14563 1247
NM_015571chr62774 62 11009 1733 --
NM_015576chr331181 1154 73 182 32918 2514 2098 --
NM_015578chr191257 --21478 656 --
NM_015584chr1711181 --1993 --
NM_015602chr12286 231 21766 599 ----
NM_015605chr102623 298 11117 11235 --
NM_015633chr12----1112 --
NM_015652chr101107 1433 1271 --
NM_015723chr71570 ------
NM_015850chr842401 1791 1648 630 1431 ----
NM_015906chr153604 785 508 330 110 11371 --14011
NM_015912chr831914 377 220 ----21866 439
NM_015933chr31168 --194 --
NM_015975chrX31382 660 315 11585 ----
NM_015995chr1575406 5393 4580 4000 3637 3414 706 13703 25414 3655 11780
NM_016019chr72353 211 --1225 1128
NM_016066chr1----130 --
NM_016072chr1221538 661 --1130 --
NM_016076chr133060 2692 2266 33182 2078 281 ----
NM_016083chr63931 782 200 23824 1123 ----
NM_016090chr114890 682 141 89 ------
NM_016097chr1811005 ------
NM_016103chr51460 --1419 --
NM_016107chr521290 1080 21030 470 1153 --
NM_016132chr1522194 1117 ------
NM_016152chr3--1820 ----
NM_016192chr2--157 ----
NM_016203chr71935 2923 374 ----
NM_016206chr388613 8043 7438 7080 5983 2704 1389 275 38513 6569 32 1723 17726
NM_016224chr621563 541 ----11672
NM_016227chr131457 1028 181 ----11137
NM_016234chr101743 1712 ----
NM_016260chr277603 7241 5524 1796 1527 1506 1485 1610 --26887 5241
NM_016271chr1832304 2213 1536 180 ----
NM_016275chr332542 516 107 2947 531 1228 --
NM_016277chr61577 11436 --11220
NM_016297chr222838 547 --23476 176 --
NM_016303chrX141 --1347 --
NM_016316chr24688 303 268 254 ------
NM_016322chr952539 1983 1207 1061 350 12187 --1765
NM_016333chr16------1503
NM_016339chr1761801 1770 1601 1453 1438 1197 21475 316 ----
NM_016374chr121466 1232 21421 296 ----
NM_016374chr121466 1232 21421 296 ----
NM_016395chr1541816 1495 351 55 ------
NM_016441chr242348 663 580 164 1156 1120 --
NM_016451chr11132 ------
NM_016475chr14--1510 ----
NM_016513chr683619 2788 2648 2468 1466 455 294 87 11172 ----
NM_016516chr22762 201 ------
NM_016522chr11--11028 ----
NM_016525chr91916 ------
NM_016530chr1533839 3637 2850 32577 413 26 11156 1874
NM_016531chr443174 1033 599 508 54121 3732 3457 3437 375 23711 488 1807
NM_016542chrX51701 1538 1339 644 328 ----1620
NM_016545chr1------1873
NM_016577chr353777 3442 1660 822 740 14282 --11632
NM_016578chr111502 1647 ----
NM_016628chr10------1695
NM_016654chr1521046 229 --2472 79 --
NM_016655chr15--1108 ----
NM_016824chr1011487 1482 ----
NM_017420chr1453144 2667 1024 676 190 ----13504
NM_017423chr4----1104 --
NM_017455chr151327 1829 --1394
NM_017580chr1031889 1760 206 ----12032
NM_017635chr1121520 1483 --1272 1142
NM_017637chr968171 7195 6881 1783 948 604 39354 1286 765 12967 12538
NM_017643chr1752286 581 560 360 74 12185 ----
NM_017645chr912238 12423 ----
NM_017650chr795222 5144 4047 1813 1758 1274 774 738 642 ------
NM_017657chr21809 ------
NM_017658chr1421740 1725 14034 --1790
NM_017672chr15--1840 --1265
NM_017694chr221778 295 1167 --11716
NM_017714chr202920 658 1757 ----
NM_017719chr362452 2016 1840 1628 877 513 12254 11886 --
NM_017734chr11115 ------
NM_017744chr11941 ------
NM_017745chrX----125 --
NM_017753chr91801 ------
NM_017758chr1721465 1314 ----11503
NM_017762chr1521977 1646 --12217 --
NM_017768chr1--2671 312 ----
NM_017769chr1421039 151 ------
NM_017778chr821323 1272 --21054 218 1524
NM_017787chr1022719 2505 --3949 167 101 --
NM_017813chr845483 4227 2337 232 --124 --
NM_017831chr1873531 3332 1546 1148 964 760 409 11028 11714 14110
NM_017857chr114191 176 149 122 1668 ----
NM_017867chr4------128
NM_017907chr11--191 ----
NM_017913chr91353 ------
NM_017915chr122829 115 ------
NM_017919chr964056 4018 3957 3872 2330 1129 ------
NM_017926chr141281 1859 --1750
NM_017934chr6----146 --
NM_017964chr21845 ------
NM_017972chr141281 1859 --1750
NM_017987chr101601 ------
NM_018008chr31340 199 ----
NM_018011chr131560 ------
NM_018046chr531945 1897 144 11181 11426 --
NM_018078chr4--1989 ----
NM_018084chr212695 1495 ----
NM_018086chr2------1651
NM_018094chrX--1276 ----
NM_018155chr3150 --13028 --
NM_018171chr121641 --2934 729 --
NM_018177chr41258 ------
NM_018195chr112632 45 2437 274 ----
NM_018200chr151106 12129 1237 11986
NM_018202chr11219 ------
NM_018227chr433204 539 532 12314 12144 --
NM_018247chr622724 2072 --1552 --
NM_018254chr141866 685 537 368 1957 ----
NM_018286chr172629 375 1680 ----
NM_018293chr31239 --1964 --
NM_018299chr822189 1282 1215 --1675
NM_018307chr171689 1829 ----
NM_018315chr421245 116 11222 1525 --
NM_018323chr41153 --11741 --
NM_018325chr91138 --11603 --
NM_018328chr2178 ----1375
NM_018339chr951269 1141 707 409 107 11813 ----
NM_018340chr1674110 3835 3810 3700 1471 1082 607 34647 3171 1143 ----
NM_018362chr1153215 2879 2746 2608 444 23588 482 1580 --
NM_018364chr131530 1285 436 33725 1213 1046 --1204
NM_018373chr1455678 5468 4919 2469 1619 46419 4206 2316 1642 34182 2014 1287 --
NM_018374chr753515 878 788 759 515 --23423 128 --
NM_018375chr1431810 1754 356 ------
NM_018383chr221722 1288 --21818 343 --
NM_018387chr9--141 ----
NM_018403chr343703 3627 3218 1622 34026 3961 632 --1648
NM_018409chr412298 2278 65 --1565
NM_018425chr1042304 1717 716 67 12642 11674 --
NM_018431chr202583 245 ------
NM_018440chr8117574 7327 6972 6537 6144 5664 3118 2948 2868 2300 178 37419 6637 2959 16707 12751
NM_018482chr852444 1589 496 296 84 12076 ----
NM_018509chr1711727 ------
NM_018557chr22502 398 1218 ----
NM_018566chr154580 4083 3794 1263 196 23984 3497 ----
NM_018569chr4--1270 1513 --
NM_018571chr21105 ------
NM_018602chr1551442 1350 1110 1081 177 ------
NM_018638chr1245713 3435 2280 2259 --14976 --
NM_018650chr13622 297 217 --153 --
NM_018682chr72571 503 1593 --1651
NM_018710chr811168 1961 ----
NM_018712chr11----1124 --
NM_018834chr5--1162 ----
NM_018843chr7134 ------
NM_018846chr7144 1797 ----
NM_018898chr522316 928 ----12261
NM_018899chr522316 928 ----12261
NM_018900chr522316 928 ----12261
NM_018901chr522316 928 ----12261
NM_018902chr522316 928 ----12261
NM_018903chr522316 928 ----12261
NM_018904chr522316 928 ----12261
NM_018905chr522316 928 ----12261
NM_018906chr522316 928 ----12261
NM_018907chr522316 928 ----12261
NM_018908chr522316 928 ----12261
NM_018909chr522316 928 ----12261
NM_018910chr522316 928 ----12261
NM_018911chr522316 928 ----12261
NM_018948chr121282 75 1433 --11399
NM_018955chr17155 ------
NM_018976chr1232533 137 110 42084 1847 1141 399 ----
NM_018977chrX1926 1138 ----
NM_018999chr1074506 4234 3770 3764 1956 799 344 44622 4400 3601 1768 24102 792 1271
NM_019000chr521673 342 --11219 --
NM_019001chr344335 3429 1824 201 23843 1234 1851 --
NM_019004chr772099 1869 1562 929 846 597 39 12346 --1655
NM_019030chr5149 ------
NM_019049chr11621 ------
NM_019063chr231978 1693 164 1932 ----
NM_019084chr1022499 851 1427 ----
NM_019098chr8130 ------
NM_019102chr71162 ------
NM_019102chr71162 ------
NM_019555chr321200 1184 11598 --150
NM_019590chr101209 1545 ----
NM_019593chr2032789 339 144 1978 12859 --
NM_019605chr1--1737 --1168
NM_019857chrX21542 607 ------
NM_019885chr222403 305 ------
NM_019895chr31786 ------
NM_019903chr1011487 1482 ----
NM_020116chr41730 31598 1576 687 ----
NM_020122chr254641 4051 595 387 212 45925 5578 4574 4342 11157 --
NM_020123chr1021578 988 1243 ----
NM_020140chr12122 ------
NM_020154chr151232 ------
NM_020156chr71435 1198 ----
NM_020159chr441392 484 474 467 ------
NM_020177chr543084 2939 693 444 22237 581 ----
NM_020193chr112998 239 ------
NM_020199chr511096 1816 ----
NM_020205chr122814 694 ------
NM_020245chr664965 4473 3778 1973 1552 1263 ------
NM_020307chr3151 ------
NM_020336chr2023622 1213 11222 ----
NM_020337chr41862 33092 2615 1961 22697 128 --
NM_020338chr1082813 2592 2548 2481 2334 1215 1138 145 13168 13446 --
NM_020353chr321472 67 ------
NM_020357chr31489 11260 ----
NM_020416chr472443 2179 2090 1974 1055 790 282 11718 ----
NM_020432chr721433 511 12319 --22030 1865
NM_020452chr112004 ------
NM_020466chr643317 1448 1035 670 --13840 23725 106
NM_020475chr842441 2148 654 354 ----1982
NM_020476chr842441 2148 654 354 ----1982
NM_020477chr842441 2148 654 354 ----1982
NM_020480chr842441 2148 654 354 ----1982
NM_020640chr31719 ------
NM_020645chr111527 ------
NM_020647chr821883 676 --12303 --
NM_020651chr241282 1157 387 361 ------
NM_020686chr162511 21 ----12895
NM_020697chr81152 ------
NM_020718chr1646573 4971 4766 4031 36078 5528 1455 --16355
NM_020727chr2144003 2936 720 184 ------
NM_020731chr593176 3039 2782 1239 1164 1104 850 500 480 --1926 1153
NM_020734chr1232203 456 222 --11359 --
NM_020739chr1533968 1689 1354 23651 1136 ----
NM_020742chrX41078 1045 635 561 --1548 12351
NM_020747chr51793 ------
NM_020752chr1022522 619 32909 2861 1130 --1690
NM_020760chr2------11260
NM_020766chrX44500 3743 3517 1518 14063 --14320
NM_020769chrX--2957 653 ----
NM_020772chr1778482 8281 7984 5259 3058 1344 1301 136 18342 11313
NM_020774chr1876215 5718 4555 4439 4184 4066 1214 25285 4098 ----
NM_020801chr53662 518 367 2794 169 ----
NM_020805chr18--31645 1487 591 --11920
NM_020810chr1453651 3521 1068 788 662 21303 975 12908 11018
NM_020824chr104536 161 148 98 ----1301
NM_020825chr1653660 3245 2722 1447 874 13089 ----
NM_020830chr253126 2449 2327 2166 361 12595 ----
NM_020841chr1263932 3537 3266 3199 2903 1544 23675 2629 12694 13889
NM_020850chr1673148 2866 2011 1235 1050 644 83 1707 1211 --
NM_020858chr1521855 1625 1175 --12278
NM_020860chr41247 ------
NM_020873chr31305 --1157 --
NM_020940chr1012776 ------
NM_020948chr122335 1439 1694 1761 --
NM_020952chr91777 ------
NM_020987chr10--1882 ----
NM_021003chr141654 --152 --
NM_021005chr1511035 ------
NM_021032chr31573 ------
NM_021033chr1342958 1371 187 117 12496 ----
NM_021045chr1032274 727 42 1996 ----
NM_021083chrX33343 2646 905 23489 3364 ----
NM_021090chr22114783 4445 4254 3916 3565 3527 3285 1837 1724 816 118 --11818 --
NM_021097chr232193 1142 224 13018 ----
NM_021151chr731113 1005 803 1214 ----
NM_021183chrX32126 606 259 2760 131 ----
NM_021229chr121173 ------
NM_021252chr1021765 200 ----1693
NM_021255chr1453523 2886 1626 1033 399 1818 1495 --
NM_021622chr1021822 1685 21679 1581 11994 --
NM_021629chr334574 63 56 24659 307 15069 --
NM_021647chr443825 3253 382 209 14704 13721 --
NM_021648chr652560 2431 1760 737 247 ----11814
NM_021813chr655398 4182 1343 414 121 ----1838
NM_021814chr611082 11089 ----
NM_021911chr555567 4520 3913 3629 278 --157 --
NM_021912chr1564026 2716 1553 748 481 266 ------
NM_021940chr631603 1505 299 11640 ----
NM_021956chr611087 --1437 --
NM_021961chr1177236 5492 5355 2059 898 611 381 11378 32263 265 216 17106
NM_021964chr3126415 6141 5971 5703 5144 4866 4415 2432 2173 1648 781 88 45280 5036 1566 1374 1745 --
NM_021970chr42607 538 --1740 --
NM_021998chrX11065 1374 ----
NM_022048chr15115192 4315 4023 2410 2363 2333 2270 1939 1060 286 58 1922 15125 1547
NM_022116chr7--1854 138 --
NM_022351chr843565 3431 3241 3165 1659 11127 --
NM_022459chr1335015 1298 147 45924 5841 1862 1526 11969 --
NM_022469chr121299 1106 52931 2804 2065 1071 900 ----
NM_022483chr541901 1398 481 87 1686 ----
NM_022491chr1243243 3151 2973 1429 --12570 --
NM_022497chr343646 3446 766 514 --23669 536 --
NM_022659chr82530 169 123 ----
NM_022735chr141581 1331 1195 381 --2557 430 11867
NM_022739chr1731055 991 859 ------
NM_022745chr152669 703 611 593 338 1836 --11202
NM_022771chr121230 1383 ----
NM_022774chr12818 343 ------
NM_022781chr952478 2172 2148 1302 303 1361 ----
NM_022784chr15--2863 154 ----
NM_022828chr51311 ------
NM_022841chr1532554 2045 362 32706 2188 1930 --22273 1922
NM_022843chr131261 21260 1136 --1182
NM_022845chr1642069 1803 593 426 1500 11735 --
NM_022893chr2----1514 --
NM_022894chr241383 404 251 56 21766 244 ----
NM_022901chr931815 649 90 1180 ----
NM_022913chr5152 ------
NM_022970chr101163 ------
NM_023000chr1431063 671 591 ------
NM_023001chr1431063 671 591 ------
NM_023012chr121614 ------
NM_023071chr1221136 74 11076 ----
NM_023074chr1931382 93 28 1913 ----
NM_023105chr842401 1791 1648 630 1431 ----
NM_023106chr842401 1791 1648 630 1431 ----
NM_023110chr842401 1791 1648 630 1431 ----
NM_023111chr842401 1791 1648 630 1431 ----
NM_023929chr822058 1914 52679 2224 277 189 149 1370 --
NM_024007chr552988 2930 2696 672 192 11268 13066 --
NM_024071chr14--1442 --1604
NM_024324chr221190 ------
NM_024411chr20--1615 ----
NM_024429chr71935 2923 374 ----
NM_024501chr2--1663 ----
NM_024539chrX--11126 ----
NM_024546chr131369 ------
NM_024551chr1272401 2353 2080 2032 2026 1871 561 --42238 2039 715 646 --
NM_024551chr1272401 2353 2080 2032 2026 1871 561 --42238 2039 715 646 --
NM_024556chr113466 320 156 ----1474
NM_024567chr81543 189 ----
NM_024586chr12616 109 ------
NM_024594chr541851 1754 225 196 ------
NM_024613chr811386 ------
NM_024631chr112623 218 ------
NM_024640chr11785 ------
NM_024646chr173153 3102 2609 2584 613 354 280 21194 784 ----
NM_024665chr353599 1760 424 142 113 24379 453 ----
NM_024670chr1031765 413 251 21361 1256 ----
NM_024686chr11375 1548 ----
NM_024704chr20--2863 124 --21043 926
NM_024713chr1531457 1041 1021 --1452 --
NM_024721chr8--1107 21818 602 1966
NM_024740chr1183480 2902 2745 1526 1471 1065 789 221 23629 939 ----
NM_024828chr911495 21093 613 ----
NM_024887chr111641 ----11824
NM_024899chr181267 ------
NM_024920chr4--11025 ----
NM_024921chrX41943 1448 487 396 1644 ----
NM_024930chr522687 2163 2310 195 ----
NM_024942chr102291 197 ------
NM_024944chr211386 ------
NM_024947chr389205 8355 7352 6832 6663 3857 3018 1781 --28103 2567 --
NM_024949chr444471 3269 1933 1771 11383 31709 1276 492 --
NM_024971chr91777 ------
NM_024989chr2107941 7843 6543 5864 5054 4960 3078 2229 1467 466 22978 335 17815 --
NM_024991chr1042960 2767 2307 96 --22746 821 1616
NM_025054chr834230 3272 2865 ------
NM_025073chr164696 3913 3699 3104 1334 545 ----13822
NM_025126chr121704 1620 1609 --
NM_025134chr1642386 2363 2128 366 ------
NM_025138chr132332 322 ----1353
NM_025181chr23235 212 44 1623 ----
NM_025191chr143329 2573 1240 1232 22982 237 ----
NM_025203chr211268 ------
NM_025221chr4--21126 932 ----
NM_025222chr373045 2631 1975 1201 766 287 30 ------
NM_025235chr1021696 476 --1176 --
NM_025238chr1541551 1010 616 333 --1637 --
NM_025268chr141393 ------
NM_030623chr22595 56 ----1556
NM_030627chr522614 1302 23933 1057 ----
NM_030647chr775909 5481 5402 5314 1183 103 53 24093 1009 --16077
NM_030660chr1421261 1023 161 11072 --
NM_030667chr121178 21154 990 --1279
NM_030668chr121178 21154 990 --1279
NM_030669chr121178 21154 990 --1279
NM_030674chr1244925 4823 4698 112 24569 2149 ----
NM_030755chr1432006 1080 561 12110 ----
NM_030758chr22--11044 ----
NM_030762chr1221912 1897 ------
NM_030806chr1119372 7119 7040 6889 6373 5734 3376 2831 1797 825 148 48786 3119 277 106 --16504
NM_030816chr183566 3261 2884 2675 2537 2331 510 141 --12818 13672
NM_030881chr221260 ------
NM_030918chr134468 1512 1466 23936 2140 --1450
NM_030953chr541612 1287 1070 378 1553 ----
NM_031216chr1821945 167 --1624 --
NM_031268chr1665003 4715 4171 4159 1651 1057 34872 1327 131 15205 --
NM_031283chr21144 ------
NM_031371chr121466 1232 21421 296 ----
NM_031371chr121466 1232 21421 296 ----
NM_031372chr421142 149 ------
NM_031411chr522316 928 ----12261
NM_031431chr1331236 705 656 1683 11766 11583
NM_031453chr1012169 11693 12264 11003
NM_031461chr831554 260 86 ------
NM_031492chr11------1506
NM_031845chr233679 3208 1415 33112 3104 765 13000 --
NM_031847chr233679 3208 1415 33112 3104 765 13000 --
NM_031849chr522316 928 ----12261
NM_031857chr522316 928 ----12261
NM_031858chr171111 21353 151 11166 --
NM_031860chr522316 928 ----12261
NM_031862chr171111 21353 151 11166 --
NM_031942chr221181 298 ------
NM_031953chr4----1333 --
NM_032012chr9104886 4717 4606 4519 3994 3820 3270 2102 1190 1069 14115 ----
NM_032154chr101142 ------
NM_032181chr2--1367 ----
NM_032199chr1021501 458 13661 ----
NM_032208chr242520 2386 223 211 ------
NM_032221chr2021434 526 2642 267 ----
NM_032229chr13----11100 --
NM_032242chr343289 2979 2033 32 12801 21278 117 12617
NM_032287chr2274267 3678 3115 2802 1033 1025 31 11270 23688 544 --
NM_032291chr1--31727 604 183 ----
NM_032373chr1074875 4805 4607 4238 3784 1323 1081 15915 21588 831 --
NM_032408chr71927 --1486 1482
NM_032440chr1052190 1054 792 189 138 1947 ----
NM_032441chrX2403 103 ------
NM_032445chr1552591 2519 286 259 88 11023 --1680
NM_032446chr533047 1329 381 13080 1401 13606
NM_032457chr413667 --23885 540 13057
NM_032458chrX33260 2242 587 ----12545
NM_032491chr1211256 --11285 --
NM_032505chr322243 1855 ------
NM_032509chr81828 1211 ----
NM_032539chrX----1680 --
NM_032547chr4--182 ----
NM_032558chr911497 ------
NM_032594chr141432 --1869 --
NM_032598chr17--136 ----
NM_032689chr192486 109 1559 ----
NM_032758chr222553 45 ----1564
NM_032784chr6--1390 ----
NM_032810chr10----3541 260 22 --
NM_032813chr13--1153 ----
NM_032826chr723657 3399 35298 699 381 24797 4600 1594
NM_032858chr1161 ------
NM_032859chr1362944 2510 1270 756 602 43 --23734 710 --
NM_032866chr1563157 2825 2701 1054 379 50 12178 1398 --
NM_032867chr11--1549 ----
NM_032873chr1174495 4188 3686 3027 1359 1072 648 33441 1016 943 ----
NM_032875chr171789 ------
NM_032900chr1042890 1047 608 92 2698 269 ----
NM_032918chr1211032 1402 11078 1916
NM_032966chr11--11529 ----
NM_032968chrX42761 1437 663 137 14106 --2282 241
NM_032969chrX42761 1437 663 137 14106 --2282 241
NM_032973chrY52756 2687 1437 663 137 14098 --2282 241
NM_033020chr153604 785 508 330 110 11371 --14011
NM_033081chr20--11164 ----
NM_033132chr13--1733 21855 1577 --
NM_033143chr453783 3397 3019 1352 866 --1133 --
NM_033181chr63931 782 200 23824 1123 ----
NM_033208chr161123 ------
NM_033211chr521686 658 --1247 1281
NM_033224chr788056 7903 7756 3111 2457 2380 2324 1017 ------
NM_033225chr853165 2913 2518 1105 108 1844 1142 --
NM_033227chr51586 1426 1513 --
NM_033228chr51626 1466 1553 --
NM_033254chr31103 ----1486
NM_033285chr8104469 3638 3137 1604 1369 778 709 668 589 252 14369 171 --
NM_033360chr1264667 4403 4255 3761 3489 1086 23579 871 ----
NM_033394chr231207 439 433 1643 ----
NM_033425chr1123360 669 2405 375 13300 --
NM_033430chr453820 1204 1105 650 83 ----1152
NM_033437chr453820 1204 1105 650 83 ----1152
NM_033480chr652878 2085 1855 1189 50 ------
NM_033481chr652878 2085 1855 1189 50 ------
NM_033495chrX------11011
NM_033505chr245976 4191 2452 432 35662 4514 2306 --11945
NM_033632chr421245 116 11222 1525 --
NM_033637chr1033777 2767 453 --53412 3392 3110 564 412 --
NM_033644chr542377 1956 938 659 12144 ----
NM_033645chr542377 1956 938 659 12144 ----
NM_033656chr2135992 5542 913 21346 258 --15095
NM_044472chr11648 ------
NM_052855chr171597 ------
NM_052879chr1253078 2763 1258 1207 366 23845 2531 --11081
NM_052907chr1224036 788 12818 ----
NM_052923chr61104 --1191 --
NM_052932chr11----1130 --
NM_052937chr842669 2463 2367 583 ----12053
NM_053016chr947719 6043 4840 1418 46175 2739 1497 567 12993 18016
NM_053023chr1163154 2918 2761 2450 1155 730 12481 ----
NM_053024chr331492 1422 1208 21016 517 ----
NM_057158chr81605 ------
NM_057749chr821247 524 2534 394 ----
NM_058175chr212687 244 ------
NM_078483chr563806 3370 3134 2632 1642 23 11191 ----
NM_080599chr102879 483 1472 ----
NM_080645chr621935 33 --1714 --
NM_080676chr2092857 2802 2547 2401 2330 1164 1116 826 629 ------
NM_080759chr131245 --11734 1810
NM_080760chr131245 --11734 1810
NM_080867chr1424936 3078 14241 14517 --
NM_080881chr51173 --1214 --
NM_080921chr15912 436 186 106 88 ------
NM_100264chr10------1695
NM_100486chr10------1695
NM_130435chr1052802 2773 2259 935 146 ------
NM_130436chr2142747 2433 2206 1090 ----12236
NM_130438chr2133324 3010 2783 ----12813
NM_130470chr11----2848 248 --
NM_130471chr11----2848 248 --
NM_130472chr11----2848 248 --
NM_130473chr11----2848 248 --
NM_130474chr11----2976 376 --
NM_130475chr11----2976 376 --
NM_130476chr11----2848 248 --
NM_130798chr152507 141 ------
NM_130811chr20--11128 ----
NM_130831chr342693 2540 2396 2298 1409 ----
NM_130832chr342693 2540 2396 2298 1409 ----
NM_130833chr342693 2540 2396 2298 1409 ----
NM_130834chr342693 2540 2396 2298 1409 ----
NM_130835chr342693 2540 2396 2298 1409 ----
NM_130836chr342693 2540 2396 2298 1409 ----
NM_130837chr342693 2540 2396 2298 1409 ----
NM_130838chr1541523 1407 660 292 --11172 --
NM_130839chr1541523 1407 660 292 --11172 --
NM_130847chr11115718 5269 3815 3658 1939 1721 1290 881 695 284 28 --11138 --
NM_133170chr2077990 7771 7124 5357 2242 1956 347 --27808 1905 --
NM_133172chr5179 1282 ----
NM_133173chr5179 1282 ----
NM_133174chr5179 1282 ----
NM_133334chr465959 5005 4980 4961 3919 1934 54417 1470 596 566 299 ----
NM_133338chr5----1441 --
NM_133339chr5----1441 --
NM_133340chr5----1441 --
NM_133341chr5----1441 --
NM_133342chr5----1441 --
NM_133343chr5----1441 --
NM_133344chr5----1441 --
NM_133369chr5----1801 --
NM_133372chr542731 2535 415 267 ----12136
NM_133433chr53753 745 680 ----1184
NM_133496chr154563 2866 1526 727 416 ----13440
NM_133631chr321527 446 2543 375 ----
NM_133646chr255192 4835 4587 4522 4419 35019 4222 451 --11676
NM_138270chrX42389 2342 2235 224 --22708 668 --
NM_138423chr1542195 330 219 197 12061 --1854
NM_138468chr225729 195 ----11874
NM_138621chr231382 404 97 21092 1076 13544 12736
NM_138694chr653618 1028 931 413 201 23647 596 ----
NM_138713chr16137937 6975 6968 6514 5852 5600 3289 2611 1898 1828 1354 1202 565 2976 780 1305 --
NM_138714chr16137937 6975 6968 6514 5852 5600 3289 2611 1898 1828 1354 1202 565 2976 780 1305 --
NM_138727chr11941 ------
NM_138728chr11941 ------
NM_138731chr1433501 1672 244 11007 ----
NM_138735chr22993 30 21281 328 11069 --
NM_138779chr133247 184 34 ------
NM_138782chr532086 1883 866 11690 ----
NM_138792chr15----142 --
NM_138811chr711146 ----11040
NM_138923chrX------188
NM_138927chr211983 ------
NM_138931chr311041 ------
NM_138933chr10----1136 --
NM_138959chr1106616 6137 4810 4122 2340 1963 1519 687 576 262 1875 15613 25393 1602
NM_138966chr181481 ------
NM_139048chr31182 1795 11008 --
NM_139068chr51728 ------
NM_139069chr51728 ------
NM_139169chr1052153 1593 1511 138 54 ------
NM_139207chr1241964 810 599 72 --1281 --
NM_139279chr233487 804 321 33430 1263 104 11021 --
NM_139283chr121571 ------
NM_139318chr14--164 ----
NM_139323chr2021779 413 1709 --11951
NM_144571chr446947 6679 1556 540 1402 25816 51 --
NM_144599chr1533478 799 187 --2933 424 21044 965
NM_144618chr1--1117 1604 --
NM_144633chr331429 1235 213 122 ----
NM_144657chrX3684 160 29 ------
NM_144664chr1132514 787 596 1151 --1619
NM_144665chr11--180 ----
NM_144778chr1322682 338 1531 ----
NM_144963chr81774 --12624 --
NM_145049chr511003 ------
NM_145176chr643123 2840 2579 890 22979 2616 1410 --
NM_145251chr141473 11594 ----
NM_145259chr246838 6030 4677 1231 35992 5355 615 --1116
NM_145330chr21154 ------
NM_145725chr14--1485 ----
NM_145726chr14--1485 ----
NM_145735chr133533 321 263 31014 787 484 22837 2448 12762
NM_145793chr101790 --176 --
NM_145808chr742850 2692 2566 1211 22606 771 12111 --
NM_145810chr221181 298 ------
NM_145891chr16--1392 11549 --
NM_145892chr16--1392 11549 --
NM_145893chr16--1514 11671 --
NM_147150chr963973 3006 2651 1372 1212 857 1455 22670 401 --
NM_147175chrX31640 867 142 ------
NM_147181chr4--21126 932 ----
NM_147182chr4--21126 932 ----
NM_147183chr4--21126 932 ----
NM_147223chr232267 849 281 --156 --
NM_148904chr12616 109 ------
NM_148905chr12616 109 ------
NM_148906chr12616 109 ------
NM_148907chr12616 109 ------
NM_148908chr12616 109 ------
NM_148909chr12616 109 ------
NM_152253chr2273951 3486 3366 3353 612 136 41 12623 1853 11093
NM_152261chr1222011 1969 --22274 2217 --
NM_152265chr151423 1410 1346 327 222 ------
NM_152317chr12--1230 ----
NM_152330chr1422352 25 12333 11652 1210
NM_152352chr1832704 309 22 43031 2550 2510 2471 ----
NM_152373chr1--1648 ----
NM_152409chr523069 2686 1368 ----
NM_152437chr12--12459 ----
NM_152442chr1211171 ------
NM_152581chrX3410 368 210 1126 ----
NM_152588chr1211635 11455 ----
NM_152622chr532763 781 129 22822 1296 23498 236 134
NM_152624chr596932 6381 5584 5474 2582 1702 1578 1324 358 36839 5355 2048 ----
NM_152625chr5156 ------
NM_152630chrX1124 21432 1092 2391 101 --
NM_152636chr1132095 558 75 23072 2823 ----
NM_152641chr1242799 2493 1130 657 12626 ----
NM_152678chr332688 2258 2023 ------
NM_152699chr353106 3008 2734 841 542 23736 3134 1320 --
NM_152724chr10--12068 ----
NM_152737chr631959 1697 759 --11561 --
NM_152740chr71733 ------
NM_152756chr534298 3536 715 ------
NM_152758chr81639 11089 12995 12143
NM_152774chr742275 2255 2210 670 31731 773 761 --11059
NM_152787chrX32602 1118 374 11011 1691 --
NM_152788chr12122 ------
NM_152835chr12736 626 --12554 --
NM_152838chr2043232 1039 548 115 1197 11166 --
NM_152996chr121369 558 1547 ----
NM_152999chr754278 4022 1983 892 298 --13560 --
NM_153035chr122966 2854 --1902 12251
NM_153050chr22114783 4445 4254 3916 3565 3527 3285 1837 1724 816 118 --11818 --
NM_153051chr22114783 4445 4254 3916 3565 3527 3285 1837 1724 816 118 --11818 --
NM_153181chr181481 ------
NM_153184chr32262 247 12002 ----
NM_153188chr564488 4359 2023 1009 858 399 22280 130 ----
NM_153207chr1233896 2558 1510 13184 --1727
NM_153252chrX------1400
NM_153260chr15--1103 ----
NM_153262chr122897 1225 22826 904 ----
NM_153371chr1321864 518 31882 1795 1648 ----
NM_153607chr532729 1981 257 11961 12834 --
NM_153616chr1521855 1625 1175 --12278
NM_153617chr1521855 1625 1175 --12278
NM_153618chr1521855 1625 1175 --12278
NM_153619chr1543093 2863 1083 232 11413 --23516 2588
NM_153634chr1231608 1151 355 --11133 --
NM_153690chr31618 ------
NM_153702chr41241 ------
NM_153810chr1045135 4747 1406 973 33743 3254 453 13381 1458
NM_153816chr6----1313 --
NM_153831chr82843 106 --11030 --
NM_170665chr1274383 1638 1165 1076 1019 673 212 --24289 268 14198
NM_170695chr181155 1335 ----
NM_170696chr1521437 1199 --1176 --
NM_170697chr1521437 1199 --1176 --
NM_170719chr132332 322 ----1353
NM_170731chr1112346 1135 1139 --
NM_170732chr1112346 1135 1139 --
NM_170733chr1112346 1135 1139 --
NM_170734chr1112346 1135 1139 --
NM_170735chr1112346 1135 1139 --
NM_170751chr61499 --21315 1258 11354
NM_170752chr61499 --21315 1258 11354
NM_171998chrX1922 ----12139
NM_172037chr8--21268 565 ----
NM_172070chr221774 504 22164 683 ----
NM_172127chr411491 11750 ----
NM_172375chr14--1998 ----
NM_173054chr71255 ------
NM_173082chr611169 ------
NM_173207chr181155 1335 ----
NM_173208chr181155 1335 ----
NM_173209chr181155 1335 ----
NM_173210chr181155 1335 ----
NM_173211chr181155 1335 ----
NM_173214chr16137937 6975 6968 6514 5852 5600 3289 2611 1898 1828 1354 1202 565 2976 780 1305 --
NM_173468chr455357 5297 2019 1584 1098 45629 2403 2066 1291 ----
NM_173469chr152391 163 192 --11538
NM_173495chrX42020 2003 831 711 --32143 1663 974 --
NM_173500chr1511434 1373 ----
NM_173511chr263753 3482 3354 2974 2583 1297 ------
NM_173515chr6159 ------
NM_173545chr232062 1798 455 --12132 --
NM_173582chr1154338 1976 1833 604 563 ----1356
NM_173595chr1264822 3819 3425 2060 1595 1433 --34699 1938 1403 --
NM_173609chr152749 612 ------
NM_173642chr198818 8239 7984 6405 6069 3041 1717 380 262 17513 11977 --
NM_173797chr511077 --11223 --
NM_173808chr143869 3845 1292 849 34015 3066 963 2576 71 13530
NM_173827chr442840 1032 727 557 --12881 12123
NM_173829chr585841 5258 4038 1856 1610 1410 814 542 14625 25141 227 --
NM_174886chr181155 1335 ----
NM_174907chr3139 ------
NM_174938chr91185 ------
NM_175607chr3--1155 1458 2600 563
NM_175610chr1521199 104 11099 --1497
NM_175612chr3--1155 1458 2600 563
NM_175733chr11--11360 12123 1878
NM_175736chr1267858 7566 6322 5982 4877 2624 15059 12313 --
NM_175854chr1342109 1043 498 65 --1702 12783
NM_175856chr5------1820
NM_175859chrX21542 607 ------
NM_175876chr182215 2176 2115 1996 1112 392 367 207 2575 279 1658 --
NM_176814chr721294 445 ----11165
NM_177424chr121869 321 ----11721
NM_177538chr278436 8349 8274 7346 5569 3047 2304 17707 ----
NM_177952chr141654 --152 --
NM_177969chr21635 --1659 --
NM_177974chr1542195 330 219 197 12061 --1854
NM_177985chr212054 ------
NM_178011chr1053053 981 905 729 206 12904 21206 918 21001 357
NM_178126chr1771930 1734 1659 1547 838 813 484 11457 ----
NM_178140chr542030 1856 1806 99 ------
NM_178151chrX147433 7302 7023 6802 6729 6601 5913 5873 5318 4958 2979 1707 1548 335 31262 933 370 ----
NM_178152chrX147433 7302 7023 6802 6729 6601 5913 5873 5318 4958 2979 1707 1548 335 31262 933 370 ----
NM_178153chrX147433 7302 7023 6802 6729 6601 5913 5873 5318 4958 2979 1707 1548 335 31262 933 370 ----
NM_178313chr22688 242 21388 290 ----
NM_178335chr3--140 ----
NM_178423chr7--1226 --1323
NM_178425chr7--1226 --1323
NM_178426chr131967 809 385 11705 11819 --
NM_178427chr131867 709 285 11605 11719 --
NM_178498chr1153857 3750 2624 1571 97 ------
NM_178585chr453175 1063 1017 902 168 11214 --13047
NM_178839chr21372 ------
NM_178842chr1512114 1550 11868 --
NM_180989chr13166 ------
NM_181332chrX41078 1045 635 561 --1548 12351
NM_181354chr82137 85 11334 --11402
NM_181356chr6--1924 1940 --
NM_181358chr122777 1665 --22653 1081 13757
NM_181427chr15--1108 ----
NM_181443chr2042868 2236 2127 160 22785 174 ----
NM_181481chr1835072 2133 1806 35565 5272 1022 ----
NM_181482chr1835072 2133 1806 35565 5272 1022 ----
NM_181483chr1835072 2133 1806 35565 5272 1022 ----
NM_181504chr583388 2687 1467 1031 1018 961 309 172 12801 ----
NM_181523chr583388 2687 1467 1031 1018 961 309 172 12801 ----
NM_181524chr583388 2687 1467 1031 1018 961 309 172 12801 ----
NM_181672chrX21819 1487 ----196
NM_181673chrX21819 1487 ----196
NM_181712chr12523 389 11717 1639 11728
NM_181714chr62723 365 156 ----
NM_181780chr31206 1428 --1691
NM_181782chr61257 --1392 --
NM_181876chr472443 2179 2090 1974 1055 790 282 11718 ----
NM_181886chr4135 2525 408 11169 --
NM_181887chr4135 2525 408 11169 --
NM_181888chr4135 2525 408 11169 --
NM_181889chr4135 2525 408 11169 --
NM_181890chr4135 2525 408 11169 --
NM_181891chr4135 2525 408 11169 --
NM_181892chr4182 2572 455 11216 --
NM_181893chr4135 2525 408 11169 --
NM_182493chr1655269 4822 4386 1772 971 34417 1420 1106 24171 860 --
NM_182515chr19126506 5375 4391 4385 4249 2590 2378 1896 1466 1306 1098 324 25926 5355 15080 --
NM_182648chr141181 1226 ----
NM_182678chr2169 ------
NM_182717chr1041029 469 441 167 151 ----
NM_182720chr1041029 469 441 167 151 ----
NM_182721chr1041029 469 441 167 151 ----
NM_182722chr1041029 469 441 167 151 ----
NM_182723chr1041029 469 441 167 151 ----
NM_182762chr735911 1684 1177 45606 5264 5144 4405 12277 14670
NM_182765chr1032372 2051 338 1256 1316 --
NM_182789chr521023 403 --1221 --
NM_182830chr1421806 268 11680 ----
NM_182853chr1041029 469 441 167 151 ----
NM_182898chr764000 1937 1382 1316 1028 287 26410 1408 ----
NM_182899chr764000 1937 1382 1316 1028 287 26410 1408 ----
NM_182931chr72571 503 1593 --1651
NM_182976chr11201 ------
NM_183004chr1463890 3057 2848 1243 1206 273 1220 --13533
NM_183011chr1041029 469 441 167 151 ----
NM_183012chr1041029 469 441 167 151 ----
NM_183013chr1041029 469 441 167 151 ----
NM_183043chr13--1854 --1339
NM_183044chr13--1854 --1339
NM_183078chr653099 2959 2761 2660 1501 33657 2694 2623 12640 1859
NM_183227chr61577 11436 --11220
NM_183238chr1233449 2575 1149 23838 1539 11110 --
NM_183323chr521023 403 --1221 --
NM_183381chr33812 351 118 --2283 249 --
NM_183383chr33812 351 118 --2283 249 --
NM_183384chr33812 351 118 --2283 249 --
NM_183393chr311002 ------
NM_183394chr311002 ------
NM_184234chr20129 ------
NM_194071chr763682 1967 1911 1649 1248 199 34854 4776 549 ----
NM_194247chr251488 1266 423 161 23 23982 1239 1221 --
NM_194271chr121704 1620 1609 --
NM_194278chr1473849 3754 3055 2657 1208 364 89 --34012 3124 195 --
NM_194314chr135373 4955 3436 21595 1190 ----
NM_194318chr1332295 1967 396 1276 ----
NM_194328chr952478 2172 2148 1302 303 1361 ----
NM_194329chr952478 2172 2148 1302 303 1361 ----
NM_194330chr952478 2172 2148 1302 303 1361 ----
NM_194332chr952478 2172 2148 1302 303 1361 ----
NM_194434chr1835636 1413 460 24276 724 1119 1887
NM_194454chr731361 1288 438 ------
NM_194455chr731361 1288 438 ------
NM_194456chr731361 1288 438 ------
NM_194463chrX--11126 ----
NM_197962chr1----130 --
NM_198128chr1832304 2213 1536 180 ----
NM_198158chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_198159chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_198177chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_198178chr372595 2264 1985 1123 929 705 230 22976 502 12048 --
NM_198196chr332398 976 107 1293 11645 --
NM_198220chr20144 ------
NM_198261chr121614 ------
NM_198262chr121614 ------
NM_198268chr122777 1665 --22653 1081 13757
NM_198269chr122777 1665 --22653 1081 13757
NM_198270chrX23500 3199 32668 760 142 ----
NM_198279chrX31106 384 214 2810 185 ----
NM_198353chr4151 ------
NM_198400chr1541848 1179 777 340 ----1890
NM_198402chr31348 ------
NM_198428chr73799 732 273 ------
NM_198459chr11864 1238 ----
NM_198465chrX4738 591 163 44 1188 ----
NM_198581chr266097 6031 5190 2562 967 146 46108 2572 2208 1395 16478 --
NM_198715chr186166 6149 4496 2478 2335 1875 1033 478 1543 --11752
NM_198793chr343814 2677 927 526 14018 ----
NM_198900chr1267858 7566 6322 5982 4877 2624 15059 12313 --
NM_198935chr202474 220 ----13169
NM_198968chr1333399 808 668 4771 616 345 166 13759 --
NM_199051chr1147 ------
NM_199072chr711249 12246 ----
NM_199136chr7170 ------
NM_199160chr931936 1888 421 --21625 1531 --
NM_199188chr1253078 2763 1258 1207 366 23845 2531 --11081
NM_199189chr5--1162 ----
NM_199190chr1253078 2763 1258 1207 366 23845 2531 --11081
NM_199246chr5----21078 1038 --
NM_199320chr432694 1971 322 31989 561 503 1871 --
NM_199320chr432694 1971 322 31989 561 503 1871 --
NM_199327chr42807 337 ------
NM_199421chr1424936 3078 14241 14517 --
NM_199436chr232984 2907 2377 --13089 11157
NM_199462chr124754 508 24892 3956 ----
NM_199464chr131131 ------
NM_199482chr251549 1489 258 111 94 11728 --11444
NM_201437chr8--21081 1066 ----
NM_201613chr12--1302 --1850
NM_203350chr121395 141 --138 --
NM_203364chr1111033 ------
NM_203372chr231571 362 31 ------
NM_203379chr101743 1712 ----
NM_203380chr101743 1712 ----
NM_203382chr541499 541 492 437 ------
NM_203403chr9--1240 ----
NM_203406chr532148 919 892 1556 1592 --
NM_203416chr121111 1383 ----
NM_203437chr21809 ------
NM_203446chr212951 424 ----12962
NM_203459chr132424 2198 169 2578 550 42603 2497 2341 2165 --
NM_203463chr294512 3006 1951 1527 1335 997 916 507 481 ------
NM_203500chr19131 ------
NM_203504chr422490 777 12644 1840 1943
NM_203505chr422490 777 12644 1840 1943
NM_205833chrX167 --1913 --
NM_205842chr2--1168 ----
NM_205861chr111641 ----11824
NM_206594chr183452 3407 2691 2549 2330 1252 818 721 --1693 --
NM_206595chr183452 3407 2691 2549 2330 1252 818 721 --1693 --
NM_206853chr644080 3946 3486 208 13276 ----
NM_206854chr645341 5207 4747 1469 24537 29 ----
NM_206855chr666306 6172 5712 2434 504 475 25502 994 1613 1778
NM_206866chr2152790 2747 2511 967 808 32702 1049 318 ----
NM_206876chr272559 1274 1236 1213 756 666 644 ------
NM_206907chr531309 1302 207 2220 31 --12254
NM_206909chr898210 5832 5624 5196 5071 3269 2857 1325 157 48308 2272 2215 790 1550 --
NM_206944chr91777 ------
NM_206945chr91777 ------
NM_206946chr91777 ------
NM_206947chr91777 ------
NM_207012chr1033247 2924 2369 23280 2584 1384 --
NM_207043chr131941 570 533 ------
NM_207044chr131941 570 533 ------
NM_207047chr131941 570 533 ------
NM_207123chr41637 ------
NM_207299chr91801 ------
NM_207303chr1053176 2964 1483 1375 237 23985 808 2380 120 11520
NM_207304chr1322569 225 21025 418 ----
NM_207325chr19------12025
NM_207405chr442223 2068 1393 445 21920 433 12024 --
NM_207406chr445013 4960 4293 2476 35896 2623 1766 ----
NM_207517chr15--1233 --11783
NM_207577chr11----12847 --
NM_212460chr7176 --1572 --
NM_213589chr264713 1363 1273 1239 1141 634 14748 25537 170 11723
NM_213594chr1211256 --11285 --
NM_213609chr31166 --1878 --