TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4721
miRNA Sequence: UGAGGGCUCCAGGUGACGGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr17138 1124 ----
NM_000020chr1242087 419 371 230 11846 11877 --
NM_000037chr851945 1816 1726 1611 1549 1536 ----
NM_000046chr562299 1990 788 721 251 104 --21185 1109 --
NM_000051chr1172756 2566 2435 1363 752 56 35 --1700 --
NM_000052chrX72479 2439 2127 903 807 266 175 12853 ----
NM_000053chr1331830 254 196 1625 ----
NM_000068chr194988 609 546 226 ------
NM_000080chr174626 275 258 247 1213 ----
NM_000084chrX77006 6286 4483 2604 2469 1744 1218 15243 16915 26512 2647
NM_000088chr1741238 1160 532 356 ------
NM_000092chr243312 3012 2957 1659 13107 1148 --
NM_000093chr921772 539 ------
NM_000109chrX32320 2078 48 ------
NM_000125chr6114134 4077 1384 1240 1217 1180 1127 1006 988 683 276 --31555 832 231 --
NM_000127chr8157 ------
NM_000129chr651308 1048 391 323 81 ----21330 253
NM_000135chr163669 386 70 1357 ----
NM_000141chr1031051 966 305 ------
NM_000151chr1751775 1678 628 389 263 1193 11288 --
NM_000163chr511801 --1710 --
NM_000176chr553052 2674 1312 928 833 --11370 13238
NM_000208chr1974570 4008 3159 1326 788 446 181 21560 1339 ----
NM_000214chr2021749 659 ------
NM_000217chr1284720 4634 3983 3784 3754 3469 3337 1780 13601 24059 1600 --
NM_000222chr442003 1671 427 291 1372 ----
NM_000227chr181414 ------
NM_000237chr831328 403 137 ------
NM_000244chr112613 514 148 ----
NM_000248chr342887 2051 775 683 ------
NM_000252chrX1145 ------
NM_000253chr44845 798 382 76 ------
NM_000258chr32242 194 ------
NM_000259chr1556232 5005 4672 4436 2405 14640 24142 2519 11946
NM_000262chr2241440 1142 217 58 ------
NM_000264chr973329 3172 2066 1121 1003 770 599 ------
NM_000266chrX--2317 264 ----
NM_000267chr1772741 726 417 373 367 165 76 12686 ----
NM_000278chr1042144 876 590 584 1806 22018 1989 --
NM_000280chr111986 ------
NM_000284chrX21894 1495 --11611 --
NM_000286chr172334 182 --1648 --
NM_000304chr1721036 264 ----1869
NM_000314chr1063086 3008 2678 2661 2495 2338 ------
NM_000315chr11176 ------
NM_000319chr122937 265 ------
NM_000321chr134349 316 302 116 ------
NM_000325chr4157 1184 ----
NM_000329chr11895 --1372 --
NM_000330chrX42055 833 485 343 --22017 1395 --
NM_000332chr6146636 6577 6487 6287 6237 4618 4362 2491 1270 959 937 497 287 32 --25399 4525 --
NM_000335chr34820 767 94 41 11871 11533 1590
NM_000337chr585175 4467 2145 1627 1600 1348 1050 465 --15349 --
NM_000340chr31269 1123 ----
NM_000345chr41960 ------
NM_000346chr17----1415 --
NM_000358chr53499 376 142 --2399 39 --
NM_000361chr2021784 1535 31825 1464 271 3518 439 314 --
NM_000367chr622176 1717 --11661 --
NM_000368chr934670 4118 702 1404 ----
NM_000369chr1441868 1560 1367 1357 1102 ----
NM_000380chr91494 ------
NM_000390chrX43217 3204 3195 1228 --13126 --
NM_000391chr1131663 1576 82 ------
NM_000408chr263421 2928 2688 2470 2266 2179 ------
NM_000411chr2142558 2089 1173 251 --32390 665 229 --
NM_000424chr12125 ------
NM_000430chr1773694 3569 3060 2506 2403 1183 78 13723 ----
NM_000434chr63202 185 121 3209 48 34 ----
NM_000435chr192973 687 ------
NM_000439chr51278 ------
NM_000449chr131317 596 60 ------
NM_000450chr131438 389 93 1187 ----
NM_000458chr171676 --1915 --
NM_000461chr3114132 3626 3329 3272 3231 1207 582 453 352 129 69 34031 3162 1718 ----
NM_000462chr1521728 368 ----1665
NM_000484chr211364 ------
NM_000489chrX3702 659 261 --23147 3043 --
NM_000516chr20131 ------
NM_000523chr2--1743 --2758 474
NM_000530chr13957 782 217 3719 298 160 ----
NM_000533chrX3634 410 105 ------
NM_000537chr1126 133 1155 --
NM_000555chrX67825 6992 6971 5899 5808 5750 17819 26459 2294 --
NM_000575chr23950 406 113 ------
NM_000594chr62635 298 ------
NM_000599chr243696 3445 1407 419 12893 11274 1874
NM_000609chr1082390 2377 941 927 851 693 374 45 ----1604
NM_000610chr1162570 1978 1076 1056 602 413 ------
NM_000611chr11146435 6412 6396 6194 5352 4589 2536 2508 2282 2259 2243 2040 1050 176 15603 24819 1818 24534 316
NM_000615chr1122898 2003 12059 12801 12325
NM_000618chr1255949 4657 2562 1172 1064 --12058 25184 4256
NM_000618chr1255949 4657 2562 1172 1064 --12058 25184 4256
NM_000633chr18114794 4448 3475 3417 3189 1955 1686 1259 1252 1165 788 21035 698 ----
NM_000634chr231243 1146 363 1345 ----
NM_000665chr73186 146 24 ------
NM_000678chr20----1170 --
NM_000680chr8173 ------
NM_000688chr31121 ------
NM_000689chr94423 211 189 28 ------
NM_000719chr12166561 6331 5867 5426 4749 4479 4456 4391 2637 2375 1852 827 515 422 248 163 24314 319 25196 2047 12085
NM_000722chr72252 58 165 ----
NM_000723chr1781614 1555 1424 1280 444 360 331 273 1178 ----
NM_000725chr121638 1301 ----
NM_000726chr231433 1099 166 ------
NM_000756chr82440 386 ------
NM_000757chr14875 665 244 109 1672 ----
NM_000793chr1494979 4336 4157 4093 3556 1262 459 223 88 23591 555 ----
NM_000800chr51169 152 ----
NM_000801chr20----1706 --
NM_000806chr511256 --132 --
NM_000813chr575372 5352 4393 3725 1898 1769 1165 ------
NM_000814chr1533172 3125 3019 ------
NM_000815chr14448 284 164 90 --179 --
NM_000816chr5----1168 --
NM_000817chr21995 1882 ----
NM_000818chr10--148 ----
NM_000826chr421655 129 ------
NM_000829chr1132160 1879 62 ------
NM_000831chr1156094 5860 5790 5265 5257 4807 4741 4431 4420 4390 3914 2177 1822 356 325 2168 142 1428 --
NM_000832chr93797 727 255 ------
NM_000833chr162555 230 ----11187
NM_000834chr1221135 263 ----11011
NM_000838chr632611 1755 330 --2559 235 --
NM_000845chr71428 ------
NM_000860chr411701 11301 --11561
NM_000868chrX2931 254 ------
NM_000870chr52651 382 ------
NM_000872chr1021320 1069 ------
NM_000875chr1544798 1924 1523 127 25127 1595 1389 --
NM_000876chr621065 1002 ----1259
NM_000891chr1732631 1303 288 ------
NM_000899chr1213159 ------
NM_000908chr51696 ------
NM_000917chr103873 676 655 ------
NM_000918chr172622 596 ------
NM_000919chr51238 ------
NM_000922chr112935 311 ----1247
NM_000924chr1261345 1238 1193 1093 1085 517 ------
NM_000926chr11188394 8316 8211 7998 7982 7574 7352 6231 6148 6052 5880 2627 2547 1737 1622 1155 724 103 27800 3168 37667 7565 2173 --
NM_000935chr33965 945 193 ------
NM_000944chr41672 ------
NM_000945chr221799 82 ------
NM_000960chr194761 533 497 259 ------
NM_000966chr124754 680 359 101 ------
NM_000971chr8--158 ----
NM_001001132chr2141250 1146 134 97 ----21179 42
NM_001001323chr1243148 817 651 603 --1161 --
NM_001001330chr102352 326 ------
NM_001001331chr322262 2216 133 1265 12162
NM_001001389chr1162570 1978 1076 1056 602 413 ------
NM_001001390chr1162570 1978 1076 1056 602 413 ------
NM_001001391chr1162570 1978 1076 1056 602 413 ------
NM_001001392chr1162616 2024 1122 1102 648 459 ------
NM_001001394chr21244 ------
NM_001001395chr1242577 2085 1973 1965 ------
NM_001001396chr1134297 3879 3870 3847 3445 3397 3316 1739 1580 1411 1367 1132 820 --1257 --
NM_001001433chr2032666 521 160 12456 ----
NM_001001436chr16--1734 ----
NM_001001438chr21177 2127 47 ----
NM_001001481chr832819 917 37 1300 ----
NM_001001484chr1041899 978 203 145 ----11829
NM_001001549chr742779 2480 922 540 --1600 1940
NM_001001550chr742779 2480 922 540 --1600 1940
NM_001001555chr742779 2480 922 540 --1600 1940
NM_001001556chr15----1156 --
NM_001001557chr851675 1637 1568 694 551 1766 1169 --
NM_001001586chr13386 128 43 ------
NM_001001668chr1954242 4094 4017 3737 723 ------
NM_001001787chr1185 ------
NM_001001852chr224616 311 285 187 1351 ----
NM_001001890chr2153099 2976 223 100 44 12608 14245 --
NM_001001936chr102952 369 1473 ----
NM_001001974chr1022062 949 2837 40 ----
NM_001001995chrX140 1422 11511 --
NM_001002243chr21181 ------
NM_001002252chr12163 ------
NM_001002255chr6--1355 ----
NM_001002257chr263396 3037 2345 1022 665 615 --21111 560 --
NM_001002259chr12--176 ----
NM_001002762chr1082582 2518 980 619 374 239 223 80 --22084 513 --
NM_001002843chr151335 ------
NM_001002860chr1474242 4174 4003 3449 3341 1244 598 14392 1687 --
NM_001002901chr11435 ------
NM_001002909chr1782117 1907 1839 1545 1386 903 431 203 11663 ----
NM_001003396chr61533 142 ----
NM_001003397chr61533 142 ----
NM_001003398chr12132 --144 --
NM_001003407chr1085005 4865 3951 2045 1689 1625 1143 562 1362 24791 1898 --
NM_001003408chr1085005 4865 3951 2045 1689 1625 1143 562 1362 24791 1898 --
NM_001003652chr1898664 8315 7286 7205 6931 5964 5464 3407 2449 27272 760 --12304
NM_001003674chr1875132 4478 2506 2481 2354 2293 1809 1971 16305 22489 2221
NM_001003675chr1875132 4478 2506 2481 2354 2293 1809 1971 16305 22489 2221
NM_001003676chr119929 650 641 361 335 248 222 216 160 --1732 --
NM_001003679chr111645 ----12080
NM_001003681chr2251924 1495 1465 668 480 11360 --1814
NM_001003682chr141339 1219 505 278 --11372 11420
NM_001003683chr2138 ------
NM_001003688chr431151 97 40 ------
NM_001003698chr641633 1258 175 79 ------
NM_001003699chr641633 1258 175 79 ------
NM_001003800chr982282 1481 1138 860 597 337 303 226 23612 2724 11309 1217
NM_001003805chr14264 46 ------
NM_001003940chr1563795 3385 3349 1047 858 189 --43636 2978 2821 426 --
NM_001003942chr1563795 3385 3349 1047 858 189 --43636 2978 2821 426 --
NM_001003943chr1563799 3389 3353 1051 862 193 --43640 2982 2825 430 --
NM_001003945chr961277 394 317 263 143 108 1101 1201 --
NM_001004051chrX249 31 ------
NM_001004127chr1321005 917 --1172 --
NM_001004128chr13457 205 172 156 ----
NM_001004304chr12113038 3020 2923 2859 2083 2071 2023 1060 942 451 173 12785 32278 809 486 --
NM_001004317chr623294 1733 --1954 --
NM_001004323chr7128 ------
NM_001004354chr9129 1423 ----
NM_001004360chr211519 1320 ----
NM_001004441chr511373 ------
NM_001004720chr22676 415 --1425 --
NM_001004722chr23845 162 146 ------
NM_001005158chr32122 87 ------
NM_001005159chr32122 87 ------
NM_001005209chr2138 ------
NM_001005271chr176816 397 368 207 166 21 --184 --
NM_001005273chr176816 397 368 207 166 21 --184 --
NM_001005354chr122143 46 --192 --
NM_001005366chr123748 682 648 ------
NM_001005377chr193214 71 53 ------
NM_001005386chr242213 1784 820 108 11873 ----
NM_001005404chr1732798 967 609 ------
NM_001005408chr17--1147 ----
NM_001005415chr191459 1327 ----
NM_001005416chr191459 1327 ----
NM_001005463chr101251 22443 660 ----
NM_001005473chr556654 6494 6136 5541 4566 24168 1721 1849 --
NM_001005474chr3153 1263 ----
NM_001005476chr21193 ------
NM_001005502chr12104374 3914 3479 3281 2063 2043 1894 1614 1607 571 --21699 998 --
NM_001005505chr351705 1221 707 324 130 ------
NM_001005611chrX1511 ------
NM_001005732chr21132 ------
NM_001005733chr212224 32 ------
NM_001005739chr21671 --2646 636 --
NM_001005746chr231433 1099 166 ------
NM_001005747chr231433 1099 166 ------
NM_001005781chr21486 ------
NM_001005782chr22935 337 ------
NM_001005861chr31720 ------
NM_001005910chr31427 ------
NM_001005911chr31427 ------
NM_001006115chr3112624 2148 2070 1069 1019 963 488 371 349 297 193 1504 52604 2235 2170 1791 943 --
NM_001006600chr51341 1398 ----
NM_001006610chr161756 ------
NM_001006617chr91139 --21072 91 --
NM_001006619chr91139 --21072 91 --
NM_001006620chr91139 --21072 91 --
NM_001006621chr91139 --21072 91 --
NM_001006634chr161142 --122 --
NM_001006636chr21250 ------
NM_001006641chr971586 1365 1319 629 610 406 377 --21778 1576 --
NM_001006642chr971586 1365 1319 629 610 406 377 --21778 1576 --
NM_001006643chr971586 1365 1319 629 610 406 377 --21778 1576 --
NM_001006665chr11164 ------
NM_001006938chrX3568 190 64 ------
NM_001006946chr251383 1293 1275 312 78 ------
NM_001007023chr1494979 4336 4157 4093 3556 1262 459 223 88 23591 555 ----
NM_001007067chr81193 --182 --
NM_001007068chr81193 --182 --
NM_001007069chr81193 --182 --
NM_001007070chr81193 --182 --
NM_001007098chr12641 315 --1275 1286
NM_001007156chr154451 430 71 52 1758 11684 --
NM_001007214chr1----1116 --
NM_001007226chr1731297 1179 494 --1563 --
NM_001007227chr1731297 1179 494 --1563 --
NM_001007228chr1731297 1179 494 --1563 --
NM_001007229chr1731297 1179 494 --1563 --
NM_001007230chr1731297 1179 494 --1563 --
NM_001007237chr122514 48 ------
NM_001007246chr2111192 --1379 --
NM_001007250chr13866 120 32 ------
NM_001007277chr114234 176 53 43 ------
NM_001007279chr222776 107 ------
NM_001007538chr1331252 720 275 ------
NM_001007559chr1831989 1872 152 --1696 --
NM_001007565chr3----1366 --
NM_001007794chr11538 ------
NM_001008220chr5103732 3712 3500 3455 3252 2585 1303 960 501 369 13132 1153 --
NM_001008222chrX51253 1103 998 959 244 --1317 --
NM_001008239chr1863501 2897 2362 1377 564 298 --12503 --
NM_001008392chr343193 2763 2321 315 2832 70 ----
NM_001008393chr412269 --22280 1810 --
NM_001008405chr731754 360 108 ------
NM_001008407chr751607 1330 453 287 229 21809 1515 2563 193 --
NM_001008408chr7146062 5960 5683 5487 5307 4483 3999 3962 3938 3895 2216 1901 1716 719 35913 2148 1373 21894 761 1476
NM_001008410chr252054 1927 1712 1610 845 12237 ----
NM_001008495chr812230 11396 ----
NM_001008529chr1761322 1176 1054 256 197 82 21134 457 ----
NM_001008541chr1032121 1575 604 22143 723 ----
NM_001008541chr1032121 1575 604 22143 723 ----
NM_001008660chr1111036 ----2454 313
NM_001008701chr1972837 2309 2281 859 771 223 136 --22491 1227 --
NM_001008707chr1431891 1245 123 ------
NM_001008738chr532128 2099 929 ----12222
NM_001008777chr171224 ------
NM_001008860chr152809 749 186 ----
NM_001008892chr152809 749 186 ----
NM_001008894chr152809 749 186 ----
NM_001008938chr111385 ----157
NM_001009554chr463648 1315 1152 792 293 87 ----21714 508
NM_001009554chr463648 1315 1152 792 293 87 ----21714 508
NM_001009555chr421735 485 ------
NM_001009566chr131129 577 221 11390 ----
NM_001009569chr101117 --11148 --
NM_001009899chr354694 4268 1011 975 544 --14208 --
NM_001009955chr11501 --1526 --
NM_001009955chr11501 --1526 --
NM_001009959chr252501 2126 1969 1961 1018 11978 2566 479 --
NM_001009993chr294234 3976 3658 3188 3153 1764 938 860 109 ------
NM_001010846chr1124614 4272 4078 3796 3511 3048 3027 889 827 816 552 21 ----13105
NM_001010854chr142165 46 1544 ----
NM_001010861chr122126 1894 ----12362
NM_001010862chrX92963 2825 2516 2372 2144 1274 751 529 140 ----1872
NM_001010888chrX74544 4309 4101 3972 3878 3609 1064 13463 24490 264 --
NM_001010908chr102557 261 ----1750
NM_001010922chr1103957 3887 3868 3632 2684 1660 1628 1487 1413 409 --14047 --
NM_001010924chr102991 923 ------
NM_001010926chr12112 77 ------
NM_001010935chr1122 ------
NM_001010942chr1231192 215 23 ------
NM_001010971chr11800 ------
NM_001010983chr3142 ------
NM_001010986chrX2832 156 ------
NM_001011513chr423244 115 12535 23869 3761 --
NM_001011537chr342404 954 612 422 ------
NM_001011546chr202601 155 ------
NM_001011553chr72626 211 ------
NM_001011666chr765166 4758 4476 4348 956 487 14741 11261 --
NM_001011708chr241180 1173 1110 424 --21102 1075 --
NM_001011713chr141110 ------
NM_001011722chr12451 62 ------
NM_001011722chr12451 62 ------
NM_001012264chr142667 325 ------
NM_001012300chr122135 27 ------
NM_001012329chr171936 1912 1812 1574 1534 1481 350 1609 1342 11641
NM_001012333chr113317 97 59 ------
NM_001012334chr113317 97 59 ------
NM_001012393chr1184845 4733 4586 3157 2063 1754 1604 1338 33686 2024 1978 15003 14446
NM_001012420chr1562617 2570 2021 1056 568 453 1274 ----
NM_001012423chr1552617 2570 2021 568 453 1274 ----
NM_001012426chr683192 2440 2092 1361 1231 1073 465 305 22843 1298 63352 1327 1109 896 794 323 --
NM_001012427chr683192 2440 2092 1361 1231 1073 465 305 22843 1298 63352 1327 1109 896 794 323 --
NM_001012642chr1572162 2022 1797 1552 853 818 151 1739 ----
NM_001012753chr191898 ----4462 276 194 110
NM_001012755chrX33134 369 348 --14552 13378
NM_001012968chrX51052 813 565 527 517 1538 ----
NM_001012974chr63229 183 78 ------
NM_001012977chrX41157 1104 521 479 --179 --
NM_001012979chrX150 ------
NM_001012989chrX1470 1562 ----
NM_001013031chr101504 --22667 966 12147
NM_001013415chr4154 ------
NM_001013438chr31138 ------
NM_001013635chr1221147 1114 1906 --1961
NM_001013693chr1112471 2136 916 863 781 732 427 372 255 233 227 21953 315 ----
NM_001013693chr1112471 2136 916 863 781 732 427 372 255 233 227 21953 315 ----
NM_001013746chr72902 79 1677 --1345
NM_001013843chr152334 328 ------
NM_001014336chr12143 --1344 --
NM_001014435chr164541 507 412 246 ------
NM_001014443chr1----132 --
NM_001014445chr177869 768 744 720 323 143 57 ------
NM_001014797chr10107728 7495 6704 6019 2803 2795 2670 1427 1215 707 26512 6249 15868 --
NM_001014809chr42816 712 ------
NM_001015045chr46547 498 460 96 84 71 --42279 1927 1586 114 1583
NM_001015508chr82268 239 ------
NM_001015877chrX42626 2325 704 317 --11975 1167
NM_001015881chrX1929 --1513 --
NM_001015882chr91865 ------
NM_001015887chr311514 148 ----
NM_001015892chr51164 ------
NM_001017369chr421099 888 ------
NM_001017395chr352710 1287 1012 650 264 --23138 675 --
NM_001017424chr121204 450 --11211 --
NM_001017425chr121204 450 --11211 --
NM_001017923chr14146 ------
NM_001017926chr831664 1314 1269 2627 339 ----
NM_001017930chrX11438 --11018 --
NM_001017962chr103873 676 655 ------
NM_001017973chr51397 ------
NM_001017974chr51397 ------
NM_001017975chr11198 ------
NM_001018005chr152160 65 ------
NM_001018050chr22113064 2762 2662 2435 2400 2130 1364 1289 1280 855 169 23219 672 13087 --
NM_001018052chr22113064 2762 2662 2435 2400 2130 1364 1289 1280 855 169 23219 672 13087 --
NM_001018064chr931921 625 99 --1143 --
NM_001018074chr553052 2674 1312 928 833 --11370 13238
NM_001018075chr553052 2674 1312 928 833 --11370 13238
NM_001018076chr553052 2674 1312 928 833 --11370 13238
NM_001018077chr553052 2674 1312 928 833 --11370 13238
NM_001018091chr1532623 2211 97 ------
NM_001018108chr1541581 415 333 33 ------
NM_001018111chr742650 2548 1054 430 --11201 --
NM_001018676chr81174 ------
NM_001018677chr81174 ------
NM_001020658chr161536 1409 1351 1051 437 168 ------
NM_001020658chr161536 1409 1351 1051 437 168 ------
NM_001020825chr52527 149 ------
NM_001023587chr321049 147 --144 1919
NM_001024071chr14--1161 ----
NM_001024094chr553052 2674 1312 928 833 --11370 13238
NM_001024218chr141666 ------
NM_001024226chr12345 35 ------
NM_001024227chr12345 35 ------
NM_001024228chr12345 35 ------
NM_001024401chr16132849 2809 2771 2708 2251 2003 1985 1832 1769 959 584 399 370 --3968 773 619 --
NM_001024455chrX52239 1680 782 657 229 --1761 --
NM_001024463chr152751 730 --1398 1229
NM_001024649chr552989 2269 2110 976 779 --12471 --
NM_001024660chr311115 ------
NM_001024666chrX2646 195 ------
NM_001024668chr121791 --1721 1684
NM_001024807chr19----1341 --
NM_001024808chr1292420 2319 2291 2108 1029 730 535 491 432 --22489 800 --
NM_001024847chr321906 349 1682 11660 1946
NM_001024858chr14102948 2925 2552 1989 883 554 548 299 194 156 --12381 1530
NM_001024937chr172605 196 --143 1637
NM_001024948chr132318 625 326 12924 ----
NM_001024956chr1135611 2242 2190 24364 346 11740 --
NM_001025068chr3192 21593 1464 ----
NM_001025069chr3192 21593 1464 ----
NM_001025070chr5--142 ----
NM_001025071chr5--142 ----
NM_001025076chr1054945 4831 2440 2302 2017 44810 4487 3837 28 35225 4976 2007 --
NM_001025077chr1036303 6189 1209 46168 5845 5195 28 26583 6334 --
NM_001025079chr321117 736 1601 11048 --
NM_001025081chr1821248 1141 131 ----
NM_001025090chr1821248 1141 131 ----
NM_001025092chr1821248 1141 131 ----
NM_001025101chr1821248 1141 131 ----
NM_001025108chr224078 212 --21113 706 --
NM_001025205chr32316 111 ------
NM_001025233chr1242509 2143 939 456 --1310 --
NM_001025242chrX41208 441 380 141 ----180
NM_001025243chrX41208 441 380 141 ----180
NM_001025266chr3104396 4223 3794 3556 3543 1651 802 763 678 371 --21323 1050 --
NM_001025366chr671485 1479 1364 1354 682 602 132 ------
NM_001025366chr671485 1479 1364 1354 682 602 132 ------
NM_001025367chr671485 1479 1364 1354 682 602 132 ------
NM_001025367chr671485 1479 1364 1354 682 602 132 ------
NM_001025368chr671485 1479 1364 1354 682 602 132 ------
NM_001025368chr671485 1479 1364 1354 682 602 132 ------
NM_001025369chr671501 1495 1380 1370 698 618 148 ------
NM_001025369chr671501 1495 1380 1370 698 618 148 ------
NM_001025370chr671485 1479 1364 1354 682 602 132 ------
NM_001025370chr671485 1479 1364 1354 682 602 132 ------
NM_001025579chr1731126 242 119 --1817 --
NM_001025580chrX64112 3485 3478 3165 1088 318 ------
NM_001025595chr431584 1321 520 ------
NM_001025596chr111399 ------
NM_001025603chr131317 596 60 ------
NM_001025780chr911155 1109 ----
NM_001029835chr74309 295 146 54 --190 --
NM_001029858chr642085 947 940 657 ------
NM_001029859chr1172265 1822 1758 1662 550 374 173 11684 1873 --
NM_001029863chr632623 2036 2007 ------
NM_001029864chr2042129 1689 794 77 2400 276 22085 369 --
NM_001029875chr542406 2032 371 146 1783 --12014
NM_001029882chr1192 --1208 --
NM_001029882chr1192 --1208 --
NM_001029955chr442591 640 533 207 13431 1364 --
NM_001029998chr421349 367 11409 ----
NM_001030006chr172554 492 12522 --1632
NM_001030007chr16103859 3752 3598 3383 2819 1280 1218 582 524 182 11013 --12666
NM_001030055chr1424419 3763 11010 ----
NM_001031679chr1283224 3170 2643 2516 2389 2303 1242 152 ------
NM_001031685chr1----2382 338 --
NM_001031690chr762608 1947 1168 960 811 25 --1131 --
NM_001031695chr22125421 5092 4482 4378 4340 4041 3999 3563 1382 1367 1294 1228 2881 711 15073 --
NM_001031702chr34828 679 649 154 2686 36 ----
NM_001031710chr71340 ----1734
NM_001031716chr23980 874 250 ------
NM_001031732chr413190 --1656 13283
NM_001031740chr151295 1150 145 133 78 ------
NM_001031804chr1613461 --11143 --
NM_001032221chr981414 1349 1303 1132 668 300 158 104 1520 1736 11199
NM_001032279chr11----148 --
NM_001032280chr641336 1109 175 145 1254 ----
NM_001032283chr121234 ------
NM_001032284chr121234 ------
NM_001032288chr2061582 997 640 590 377 24 --2989 423 --
NM_001032289chrX3331 275 189 ------
NM_001032296chr1342722 2509 2465 854 --182 --
NM_001032730chr12682 578 ------
NM_001033025chr131161 527 514 ------
NM_001033044chr11407 ------
NM_001033056chr11407 ------
NM_001033059chr661748 1501 637 563 202 123 1380 ----
NM_001033081chr151911 692 453 293 268 --2683 189 --
NM_001033082chr151911 692 453 293 268 --2683 189 --
NM_001033087chr2072664 2592 2072 1119 1016 809 653 23264 2635 ----
NM_001033088chr151325 ------
NM_001033112chr5----184 --
NM_001033117chr394785 4599 3290 1935 1669 1456 1258 811 689 --54393 1864 1856 1687 1443 --
NM_001033551chr17114051 3819 3621 3490 3133 2977 2616 2554 1247 1104 415 11197 53710 3429 3189 1636 1432 --
NM_001033554chr17135 ------
NM_001033557chr21564 ----1466
NM_001033566chr171957 --1693 --
NM_001033568chr171957 --1693 --
NM_001033602chr1362627 2239 1757 135 91 41 ------
NM_001033723chr882404 2318 2202 2162 2066 1048 762 31 --1120 --
NM_001033756chr671419 1413 1298 1288 616 536 66 ------
NM_001033756chr671419 1413 1298 1288 616 536 66 ------
NM_001033859chr17138 1124 ----
NM_001034837chr52657 73 ----128
NM_001034838chr52657 73 ----128
NM_001034850chr5--11548 ----
NM_001034954chr1063038 3012 2452 740 349 260 ------
NM_001034955chr1063038 3012 2452 740 349 260 ------
NM_001034956chr1063038 3012 2452 740 349 260 ------
NM_001034957chr1063038 3012 2452 740 349 260 ------
NM_001035chr141275 1194 137 71 ------
NM_001035254chr982101 2002 1820 1713 957 894 660 31 22108 969 22114 332 --
NM_001035511chr142008 1434 1424 246 ------
NM_001035512chr142115 1541 1531 353 ------
NM_001035513chr142115 1541 1531 353 ------
NM_001035521chr22202 85 ------
NM_001035534chr961354 1253 967 452 444 69 1911 ----
NM_001037132chr711870 1841 169 --
NM_001037133chr711870 1841 169 --
NM_001037163chr7------195
NM_001037164chr741269 474 362 97 ----11534
NM_001037317chr122126 1894 ----12362
NM_001037324chr31642 1756 152 --
NM_001037332chr561976 1952 1619 596 376 168 ------
NM_001037333chr561976 1952 1619 596 376 168 ------
NM_001037334chr1842439 2198 2019 705 1480 12398 --
NM_001037494chr12192 ------
NM_001037495chr12192 ------
NM_001037533chr13656 220 87 ------
NM_001037582chr421547 1131 --21256 69 11434
NM_001037872chr2126 ------
NM_001037954chr1123120 1384 --22374 153 --
NM_001038493chr241357 541 301 24 2624 607 ----
NM_001038640chr151639 1341 ----
NM_001038707chr192222 1722 1575 1556 1445 827 779 447 261 1717 ----
NM_001038707chr192222 1722 1575 1556 1445 827 779 447 261 1717 ----
NM_001039091chrX----1392 --
NM_001039140chr202183 37 1150 ----
NM_001039141chr2282677 2228 2059 1095 1039 732 446 49 --12272 --
NM_001039199chr2084524 3836 1735 1634 1036 703 697 164 13217 ----
NM_001039350chr751723 1528 1437 1168 71 ------
NM_001039459chr74741 321 291 146 --1306 --
NM_001039465chr142471 412 --1213 --
NM_001039479chr1492371 2077 1910 1655 443 322 226 155 36 1414 21850 1497 --
NM_001039538chr222729 47 12594 ----
NM_001039574chr15985 933 899 875 783 --1311 --
NM_001039577chr1134488 4039 3925 3385 3340 3302 3120 3099 1800 1793 1269 371 77 23141 929 23957 3071 --
NM_001039580chr453526 954 920 850 302 13561 11635 --
NM_001039583chr221137 ------
NM_001039584chr221137 ------
NM_001039585chr143678 3444 1530 47 12724 ----
NM_001039590chrX23971 3227 --13124 --
NM_001039591chrX23971 3227 --13124 --
NM_001039618chr1165817 5315 3769 1943 537 426 --15149 --
NM_001039619chr142308 27 --1368 --
NM_001039670chr127679 672 593 238 200 96 31 1247 ----
NM_001039690chr1662016 1973 1789 737 588 533 --1960 --
NM_001039693chr234089 495 442 ------
NM_001039711chr11377 --1822 11127
NM_001039712chr11377 --1822 11127
NM_001039771chr142253 56 --1895 --
NM_001039802chr111189 ----1509
NM_001039840chrX65682 3887 1589 1542 952 770 25332 4605 ----
NM_001039877chr192178 145 --1560 --
NM_001039888chr1--1617 ----
NM_001039916chr1241038 390 81 43 --1191 --
NM_001039917chr1241038 390 81 43 --1191 --
NM_001039918chr1241038 390 81 43 --1191 --
NM_001039919chr1241038 390 81 43 --1191 --
NM_001039920chr1241038 390 81 43 --1191 --
NM_001039937chr1332752 2667 949 --13802 --
NM_001040001chr641664 1438 649 280 --12034 --
NM_001040056chr162691 27 --166 --
NM_001040057chr711251 ------
NM_001040092chr82394 313 ------
NM_001040102chr1041989 1798 318 123 1959 22391 2233 --
NM_001040103chr1041989 1798 318 123 1959 22391 2233 --
NM_001040107chr122250 155 ------
NM_001040108chr1472972 2240 1267 640 421 138 90 1930 12584 --
NM_001040110chr741668 1377 1235 558 --11472 --
NM_001040113chr161877 ------
NM_001040118chr111444 --2495 48 --
NM_001040134chr1941425 1329 917 462 --11411 --
NM_001040142chr221585 948 ------
NM_001040143chr221585 948 ------
NM_001040144chr1662016 1973 1789 737 588 533 --1960 --
NM_001040146chr1662016 1973 1789 737 588 533 --1960 --
NM_001040152chr754460 3525 1853 1448 694 11182 15018 --
NM_001040157chr4--2604 405 ----
NM_001040159chr4------1535
NM_001040172chr52651 382 ------
NM_001040173chr52651 382 ------
NM_001040202chr452251 1021 959 929 858 ------
NM_001040214chr631890 411 286 ------
NM_001040284chr1635332 4119 1525 ------
NM_001040402chr453123 2908 2866 971 155 22531 240 ----
NM_001040429chr1372733 2304 2293 2252 1372 488 375 ------
NM_001040439chr1651441 1120 539 484 222 21192 449 --1272
NM_001040446chr522064 132 1152 ----
NM_001040450chr1522636 2466 ----1542
NM_001040451chr53470 448 411 ----1164
NM_001040452chr53470 448 411 ----1164
NM_001040453chr1522636 2466 ----1542
NM_001040619chr141182 609 214 112 ----1485
NM_001040624chr842731 2058 342 132 22134 148 ----
NM_001040625chr842731 2058 342 132 22134 148 ----
NM_001040626chr842731 2058 342 132 22134 148 ----
NM_001040627chr842731 2058 342 132 22134 148 ----
NM_001040628chr842731 2058 342 132 22134 148 ----
NM_001040629chr842731 2058 342 132 22134 148 ----
NM_001040630chr842731 2058 342 132 22134 148 ----
NM_001040653chr382566 1654 1625 466 344 248 182 115 ------
NM_001040712chr963391 3207 2926 493 89 38 ------
NM_001040876chr4--1412 ----
NM_001042355chr16115330 5027 4823 4749 4571 3584 1612 1545 819 707 43 --11746 --
NM_001042388chr182746 256 ------
NM_001042412chr16115330 5027 4823 4749 4571 3584 1612 1545 819 707 43 --11746 --
NM_001042413chr974068 3806 3730 2533 1357 833 113 12999 ----
NM_001042425chr641336 1109 175 145 1254 ----
NM_001042427chr10----1248 --
NM_001042430chr141544 2491 159 ----
NM_001042472chr202230 39 ------
NM_001042481chr143657 151 113 ----22074 277
NM_001042492chr1772741 726 417 373 367 165 76 12686 ----
NM_001042494chr1531299 937 52 13350 ----
NM_001042495chr1531299 937 52 13350 ----
NM_001042496chr1531299 937 52 13350 ----
NM_001042497chr1531299 937 52 13350 ----
NM_001042506chrX2521 479 11115 179 --
NM_001042533chr323054 2333 ------
NM_001042537chrX12395 11966 ----
NM_001042539chr1631011 961 762 ----1152
NM_001042555chr1234275 1285 1036 1561 ----
NM_001042599chr286343 5793 5631 5507 5093 4834 2525 1741 --27058 2636 --
NM_001042601chr322169 999 1698 ----
NM_001042603chr1244657 1541 976 282 1116 ----
NM_001042604chr313514 11446 ----
NM_001042632chr2071805 1698 1003 853 583 532 463 22344 2125 ----
NM_001042633chr2071805 1698 1003 853 583 532 463 22344 2125 ----
NM_001042635chr141120 ------
NM_001042681chr142458 2344 559 238 12002 12193 --
NM_001042682chr142458 2344 559 238 12002 12193 --
NM_001042682chr142458 2344 559 238 12002 12193 --
NM_001042683chr621435 167 1411 --11167
NM_001042728chr124754 680 359 101 ------
NM_001042749chrX11814 ------
NM_001042750chrX11814 ------
NM_001042751chrX11814 ------
NM_001043318chr1493826 3710 3391 918 694 629 498 485 424 13401 1664 11531
NM_001043351chr11351 12013 ----
NM_001044305chr61302 ------
NM_001044385chr221613 843 --12581 1400
NM_001046chr542884 337 326 319 1405 125 --
NM_001065chr124546 424 50 24 1494 ----
NM_001071775chr133279 227 37 ------
NM_001077628chr13164 49 38 ------
NM_001079874chr131443 498 281 --12088 --
NM_001083620chr421654 129 ------
NM_001092chr1771886 1705 1673 561 550 431 220 11605 11834 --
NM_001095chr1291718 1606 1297 1258 1246 1197 621 473 364 11476 2703 160 --
NM_001100108chr1118301 6861 3159 3144 2886 2450 2273 1805 1400 577 499 36923 6534 337 17469 --
NM_001106chr3219125 8010 8000 7867 7668 7398 7310 7171 6899 6608 6328 3831 3789 3769 3141 2098 1125 841 823 493 486 49678 3661 3569 1948 ----
NM_001113490chrX32582 1345 1268 ------
NM_001116chr1652342 2031 1993 130 96 31244 934 257 12289 --
NM_001117chr1862402 2340 2116 1984 815 35 ------
NM_001121chr102295 230 1237 ----
NM_001124chr114560 197 150 106 ------
NM_001126chr11117 1235 ----
NM_001127chr222871 386 --129 --
NM_001128chr16103859 3752 3598 3383 2819 1280 1218 582 524 182 11013 --12666
NM_001131chr63913 800 337 ------
NM_001135chr153663 543 81 ------
NM_001140chr17279 73 ------
NM_001144chr1621343 1187 ------
NM_001147chr8190 ------
NM_001148chr431940 1497 790 ------
NM_001149chr1011360 --1924 --
NM_001160chr1252472 2379 2369 2055 93 ------
NM_001173chr1424419 3763 11010 ----
NM_001174chrX3418 307 27 ------
NM_001191chr2051429 1179 1105 1020 295 ------
NM_001198chr662094 2028 1809 855 842 91 --2308 102 --
NM_001200chr201970 1918 ----
NM_001201chr453748 3608 3535 1230 594 11538 ----
NM_001204chr257513 6863 5378 5365 1992 12121 46744 1843 1461 552 11038
NM_001206chr922443 455 --12810 --
NM_001218chr1562595 2390 2082 623 617 66 ------
NM_001219chr751887 1824 1811 1461 338 --12203 11619
NM_001220chr7156 ------
NM_001221chr41101 ------
NM_001222chr1041647 791 176 91 --31654 299 164 --
NM_001225chr11----129 --
NM_001235chr112636 96 ------
NM_001237chr4----2797 353 --
NM_001237chr4----2797 353 --
NM_001256chr1732148 909 756 1825 ----
NM_001259chr7115684 5617 4850 4706 4445 1628 1557 1309 892 110 75 1606 16230 15389
NM_001267chr17244 24 ------
NM_001268chr13129 ------
NM_001270chr51285 --1806 --
NM_001273chr121179 ------
NM_001277chr113816 797 689 1901 ----
NM_001278chr101859 1292 ----
NM_001282chr172554 492 12522 --1632
NM_001289chrX3598 509 267 ------
NM_001290chr4--1217 --1894
NM_001293chr111449 ----1498
NM_001294chr192394 85 ------
NM_001298chr231283 529 104 ------
NM_001304chr17--13713 12486 11509
NM_001310chr1242441 1128 700 468 ------
NM_001312chr142479 99 1375 ----
NM_001313chr42816 712 ------
NM_001326chr112477 405 ------
NM_001331chr1192646 1868 1791 1783 1108 621 497 146 132 1125 12506 --
NM_001343chr541478 1248 319 100 ------
NM_001351chr331761 1351 1157 --11125 --
NM_001352chr19----133 --
NM_001356chrX31534 953 187 ----1943
NM_001363chrX4616 548 321 38 ------
NM_001364chr1153570 3487 3371 3287 3040 1986 2390 337 --
NM_001365chr174760 556 320 51 --2251 79 --
NM_001380chr102928 54 1742 ----
NM_001386chr811993 2766 322 1849 --
NM_001387chr593095 2777 2439 2237 2152 1279 801 204 131 --12868 --
NM_001396chr213914 794 697 12647 1493 --
NM_001397chr1102306 2178 2169 2019 2002 1951 1636 879 751 105 1161 ----
NM_001406chr1751483 1304 361 192 140 --137 --
NM_001407chr371673 1569 1383 1334 554 418 127 ------
NM_001408chr141261 1239 1066 618 ------
NM_001412chrX53164 3069 3046 952 361 1342 --11251
NM_001417chr1241725 1489 1477 171 --11463 --
NM_001418chr111610 ------
NM_001418chr111610 ------
NM_001419chr1984111 4026 3726 3275 3218 3161 3018 623 11589 13518 24729 4383
NM_001420chr1952591 2577 2518 2439 384 --12509 --
NM_001421chrX31627 266 134 1200 1324 --
NM_001423chr123753 547 449 ------
NM_001433chr172900 228 1808 --1846
NM_001438chr13582 335 21 ------
NM_001439chr131161 527 514 ------
NM_001453chr631517 1208 380 ------
NM_001460chr153006 2999 1167 148 95 33298 3262 3165 ----
NM_001478chr122687 341 1663 2817 241 1610
NM_001483chr73963 742 210 ------
NM_001489chr9--1212 ----
NM_001497chr982466 1901 1787 1755 633 573 483 204 22579 2292 --11804
NM_001500chr6128 1314 ----
NM_001518chr741082 986 924 307 ------
NM_001521chr22202 85 ------
NM_001541chr111155 ------
NM_001542chr122514 48 ------
NM_001543chr5124785 4550 4406 4148 3956 3849 3621 1471 1206 1084 501 396 44229 4083 1169 894 32963 1945 1281 --
NM_001552chr177967 717 394 381 280 191 95 ------
NM_001554chr11123 ------
NM_001555chrX--147 ----
NM_001565chr41242 ------
NM_001569chrX41208 441 380 141 ----180
NM_001604chr111986 ------
NM_001614chr17----1112 --
NM_001614chr17----1112 --
NM_001615chr2177 ------
NM_001616chr222730 982 --1267 --
NM_001618chr13765 625 295 ------
NM_001620chr11152 ------
NM_001634chr661748 1501 637 563 202 123 1380 ----
NM_001635chr71425 ------
NM_001650chr1853013 2884 1076 1058 1006 148 ----
NM_001654chrX2333 54 --138 --
NM_001655chr1131878 1639 1374 --1270 --
NM_001658chr12345 35 ------
NM_001659chr12102460 2249 2137 1881 1068 357 341 138 105 69 --22416 379 --
NM_001660chr31264 ------
NM_001661chr172601 532 ------
NM_001663chr1431985 539 331 ------
NM_001664chr3----1219 125
NM_001665chr113422 388 35 1366 ----
NM_001668chr132265 2122 666 2867 411 ----
NM_001670chr223627 591 523 ------
NM_001677chr12723 231 ------
NM_001678chr1751607 1242 1204 463 266 ------
NM_001679chr33275 199 167 ------
NM_001682chr1252862 1168 531 365 317 ------
NM_001683chr322262 2216 133 1265 12162
NM_001684chr1134014 3596 3587 3564 3162 3114 3033 1456 1297 1128 1084 849 537 ------
NM_001693chr841057 1043 927 802 1205 ----
NM_001695chr831250 338 115 ------
NM_001699chr1931128 732 111 --1240 --
NM_001701chr931354 1012 621 ----11066
NM_001704chr61541 ------
NM_001706chr3--1827 ----
NM_001707chr7130 1635 2605 121 --
NM_001709chr1131992 1149 336 ------
NM_001717chr1521151 540 --1191 --
NM_001723chr62215 194 --1669 --
NM_001731chr121255 --1664 --
NM_001743chr2----1243 --
NM_001746chr552989 2269 2110 976 779 --12471 --
NM_001753chr72662 562 ------
NM_001754chr2153099 2976 223 100 44 12608 14245 --
NM_001755chr16----22098 623 --
NM_001759chr1254047 3332 3321 1823 604 1552 23371 1869 --
NM_001760chr63898 799 372 1339 ----
NM_001768chr23963 863 63 ------
NM_001773chr141204 987 513 141 ------
NM_001777chr321117 736 1601 11048 --
NM_001783chr19----192 1288
NM_001788chr72626 211 ------
NM_001789chr341743 1389 1122 212 11696 ----
NM_001791chr111189 ----1509
NM_001796chr161237 ------
NM_001806chr1932525 2402 171 ------
NM_001826chr12445 87 ------
NM_001829chr41615 --1339 --
NM_001833chr9159 ------
NM_001839chr1265 32 ------
NM_001851chr61143 ------
NM_001859chr953524 2888 2611 2570 1557 --13127 --
NM_001865chr6----146 --
NM_001874chr12104374 3914 3479 3281 2063 2043 1894 1614 1607 571 --21699 998 --
NM_001882chr52117 91 ------
NM_001884chr51217 ------
NM_001893chr17----1119 --
NM_001894chr221776 2393 185 ----
NM_001904chr32827 302 ------
NM_001908chr862281 1812 1738 1610 153 28 --1446 --
NM_001923chr113608 255 57 --1587 --
NM_001924chr1--1372 ----
NM_001927chr23690 294 229 247 35 2105 69 --
NM_001932chr17--1622 ----
NM_001933chr1431241 249 185 --1293 --
NM_001936chr751723 1528 1437 1168 71 ------
NM_001938chr13367 338 265 ------
NM_001949chr672561 1297 1174 1041 527 425 220 --1617 --
NM_001951chr81500 ------
NM_001955chr63751 135 47 ------
NM_001957chr422287 1973 1674 ----
NM_001962chr54450 429 226 220 ------
NM_001964chr52842 386 --1130 --
NM_001967chr31163 ------
NM_001970chr174590 555 233 176 --1416 --
NM_001977chr42148 94 ------
NM_001978chr87826 721 651 423 273 214 202 ----1790
NM_001981chr12875 316 --12188 --
NM_001982chr121938 --11050 --
NM_001987chr1243230 2952 682 648 21655 1159 1602 --
NM_001995chr41234 166 ----
NM_002006chr475087 4152 4013 1614 1501 1101 501 24099 3580 11486 --
NM_002010chr13------129
NM_002015chr1363327 2576 2305 1197 1035 543 --12401 --
NM_002017chr1111215 ------
NM_002023chr131344 1152 1067 --2393 177 --
NM_002025chrX118388 7703 6756 6240 6203 5799 3054 2852 2438 1558 1341 12889 --18619
NM_002027chr81174 ------
NM_002028chr144843 399 98 23 11184 21131 289 --
NM_002037chr6--1152 ----
NM_002040chr212297 61 ------
NM_002041chr15------1116
NM_002044chr15----1156 --
NM_002048chr91340 ------
NM_002049chrX1143 ------
NM_002054chr2173 ------
NM_002063chrX11005 1982 ----
NM_002065chr11407 ------
NM_002070chr35904 812 798 741 208 1925 ----
NM_002072chr92752 30 ------
NM_002074chr131365 1342 1087 --11643 --
NM_002076chr1273234 3193 2439 886 697 613 126 --22533 2169 --
NM_002077chr952148 1669 1516 1509 388 --22061 2034 --
NM_002081chr2111760 1656 1264 1229 1207 667 642 572 526 428 377 1204 1280 --
NM_002083chr143217 54 44 2226 73 ----
NM_002084chr52849 547 1795 1687 1730
NM_002086chr1762149 2032 2006 1903 529 324 11390 ----
NM_002092chr443801 1422 855 646 ------
NM_002094chr16171 ------
NM_002101chr22425 324 ------
NM_002114chr61455 ------
NM_002126chr1793853 3745 1632 1180 955 531 525 453 413 --2300 239 --
NM_002128chr1322193 179 ------
NM_002135chr123396 375 363 1179 1160 --
NM_002137chr7--12005 ----
NM_002140chr9183 ------
NM_002146chr1721338 58 ------
NM_002148chr21605 ------
NM_002156chr21372 ------
NM_002158chr242869 2477 2380 206 22880 2412 ----
NM_002161chr9----133 --
NM_002168chr153280 242 57 ------
NM_002181chr2275 21 1289 ----
NM_002187chr511096 1235 --2945 217
NM_002193chr241311 1283 619 402 ------
NM_002196chr2051019 1001 902 405 37 ------
NM_002196chr2051019 1001 902 405 37 ------
NM_002199chr41116 ------
NM_002204chr1741354 1095 348 194 ------
NM_002205chr122834 278 1402 ----
NM_002206chr12135 ------
NM_002211chr101726 ----1986
NM_002214chr765421 4333 2200 2187 1971 1887 --14631 --
NM_002221chr1112973 2865 2703 2697 2434 2244 1063 835 707 412 308 --12337 --
NM_002223chr1263714 3650 3081 647 582 29 ------
NM_002226chr142742 35 1806 ----
NM_002227chr1142 ----1460
NM_002230chr175877 429 338 165 75 ------
NM_002232chr12948 70 --1206 --
NM_002235chr1241545 1497 465 314 11202 ----
NM_002240chr211166 1226 --1418
NM_002246chr231218 211 82 ----1311
NM_002247chr1032103 1922 906 12145 ----
NM_002254chr242333 620 227 204 1829 ----
NM_002264chr374550 4444 4347 1590 1295 178 148 1984 156 2630 77
NM_002267chr132727 449 ------
NM_002268chr341620 1159 560 385 ------
NM_002270chr594250 4113 3953 1908 1503 1398 1012 571 221 --13941 --
NM_002271chr1321894 214 --1588 --
NM_002282chr12------1220
NM_002285chr224078 212 --21113 706 --
NM_002293chr152707 2701 1935 1787 1772 12669 1346 --
NM_002310chr595609 4865 4307 2188 2123 1879 714 228 43 45104 1923 1368 1253 --11093
NM_002313chr1085005 4865 3951 2045 1689 1625 1143 562 1362 24791 1898 --
NM_002315chr111105 ------
NM_002319chr73319 264 252 41089 932 236 88 11076 --
NM_002332chr122570 58 1224 2311 86 --
NM_002333chr1931102 308 100 --1821 --
NM_002334chr1151482 1401 1375 103 58 21721 1709 --1140
NM_002336chr1264763 3868 3722 3384 1421 878 --24942 631 1454
NM_002351chrX21692 119 ------
NM_002359chr17143938 3929 3857 3820 3814 3512 3261 3197 2801 2681 1428 1127 1078 515 --23889 717 13136
NM_002373chr1531223 1165 70 ------
NM_002374chr222729 47 12594 ----
NM_002375chr392191 2108 1701 1603 924 678 531 326 290 ----1849
NM_002382chr1431103 352 155 1411 1170 21048 80
NM_002384chr181208 --1901 --
NM_002385chr1821248 1141 131 ----
NM_002391chr113317 97 59 ------
NM_002398chr221380 1101 ------
NM_002399chr1511035 ------
NM_002401chr1772374 1773 1736 872 782 552 33 11798 ----
NM_002403chr16278 128 56 48 30 24 ------
NM_002429chr1231095 1038 629 --21347 295 --
NM_002430chr2262237 887 859 779 287 34 21828 1594 1990 1699
NM_002442chr1251550 1404 617 249 216 --21324 293 --
NM_002448chr4297 47 1678 ----
NM_002465chr12129 ------
NM_002466chr20----1107 --
NM_002479chr11115 1195 1480 --
NM_002480chr123999 350 129 ----1396
NM_002499chr152445 173 ------
NM_002500chr21211 --180 --
NM_002501chr19143935 3396 3125 1583 966 950 831 788 780 568 549 377 351 24 --31390 241 179 --
NM_002505chr641508 1245 189 101 ------
NM_002507chr1761941 1607 1402 764 670 160 ------
NM_002508chr131278 523 85 11633 ----
NM_002509chr202778 203 1788 1766 --
NM_002515chr14--11628 ----
NM_002516chr19199 ------
NM_002522chr17113812 3192 1474 1374 921 826 820 804 671 586 33 32894 710 152 22927 2884 --
NM_002524chr121030 379 ----1141
NM_002537chr15163 1999 ----
NM_002545chr1184845 4733 4586 3157 2063 1754 1604 1338 33686 2024 1978 15003 14446
NM_002547chrX73182 1669 1039 923 655 122 22 13218 11154 --
NM_002553chr7----1369 --
NM_002570chr152918 274 ------
NM_002576chr112832 83 --21048 37 --
NM_002577chr351485 1135 523 235 51 --12881 --
NM_002578chrX1142 ------
NM_002579chr1941425 1329 917 462 --11411 --
NM_002581chr924360 564 --21237 975 --
NM_002583chr121544 ------
NM_002586chr621413 443 136 ----
NM_002589chr4180 ------
NM_002592chr20136 ------
NM_002594chr203579 55 30 1707 12082 --
NM_002599chr113810 461 249 --2969 47 --
NM_002607chr7----142 --
NM_002608chr2241523 1271 442 392 --21325 1252 --
NM_002609chr52738 515 1103 3667 435 207 --
NM_002613chr16125208 4257 3671 2007 1690 1410 854 842 479 260 230 25 1562 43664 1917 1858 1154 11449
NM_002628chr31776 ------
NM_002633chr12452 171 ------
NM_002634chr172856 704 --169 --
NM_002645chr1132331 575 385 ------
NM_002648chr631197 448 21 ------
NM_002651chr14885 711 271 57 --1593 1674
NM_002653chr57929 904 821 790 765 684 196 ------
NM_002655chr865109 1961 1716 1190 705 607 --14766 --
NM_002657chr20163253 3238 3194 3056 2945 2689 2490 2473 1345 1230 742 634 444 282 187 48 22597 2531 11484 --
NM_002660chr2051169 398 254 200 96 ----11035
NM_002687chr1431205 1180 404 ------
NM_002698chr1962493 2339 1925 815 721 52 22799 396 11031 11185
NM_002705chr163689 78 42 --1574 --
NM_002706chr21129 ------
NM_002707chr24350 329 152 84 --145 --
NM_002709chr232582 1277 1003 ------
NM_002710chr123736 375 118 ------
NM_002714chr62969 937 ------
NM_002716chr1153382 3273 2545 2317 893 23197 2947 23531 1114 --
NM_002717chr81162 ------
NM_002718chr362082 1658 638 618 464 237 --21878 737 --
NM_002719chr1481928 1756 1557 1503 831 429 300 221 ------
NM_002721chr92376 38 ------
NM_002730chr19----2972 273 --
NM_002731chr122777 2504 ----1918
NM_002737chr1775762 5321 2660 2398 2125 1075 945 12071 143 --
NM_002738chr161759 1151 1239 --
NM_002745chr2273997 3599 2758 1332 1220 937 208 22848 1146 13481 --
NM_002746chr163522 204 186 ------
NM_002747chr1831413 177 79 11800 ----
NM_002753chr4--1637 1821 --
NM_002755chr15----1572 --
NM_002765chrX----1392 --
NM_002821chr65826 707 630 95 86 2813 300 ----
NM_002822chr1231807 663 478 ------
NM_002826chr12761 310 1360 ----
NM_002827chr2031715 1619 488 ------
NM_002829chr93925 346 268 ------
NM_002830chr21390 ------
NM_002833chr1551490 1177 1137 497 149 --136 11381
NM_002834chr1252968 1497 1238 1104 989 23391 1466 ----
NM_002836chr201178 --1367 --
NM_002838chr11483 ------
NM_002839chr963391 3207 2926 493 89 38 ------
NM_002840chr131335 516 223 21280 1192 3603 263 90 --
NM_002841chr31468 ------
NM_002842chr192185 44 ------
NM_002843chr1133211 2276 2212 ----11233
NM_002844chr621361 1021 ------
NM_002847chr731379 1331 1080 1113 1119 --
NM_002849chr121106 1896 ----
NM_002852chr31581 ------
NM_002859chr1251464 1252 1240 596 120 --1217 11175
NM_002865chr8--1266 ----
NM_002868chr12102273 2262 2232 1963 1948 1844 1824 1568 489 108 ------
NM_002869chr1121523 674 ------
NM_002871chr13769 749 93 ------
NM_002880chr35753 720 561 181 160 --2641 257 --
NM_002884chr1122 ------
NM_002886chr354974 3361 1683 1213 929 25141 1051 ----
NM_002890chr51246 ------
NM_002892chr1411124 11167 ----
NM_002893chrX------1275
NM_002898chr125672 608 472 184 109 ----1567
NM_002900chr101121 ------
NM_002903chr173311 278 22 ------
NM_002906chr1141602 438 381 152 12427 ----
NM_002911chr1931614 1336 1105 1517 1318 --
NM_002928chr161047 667 584 509 305 264 ------
NM_002930chr18130 ------
NM_002940chr4--1412 ----
NM_002941chr311290 1426 1206 --
NM_002942chr31325 --1941 --
NM_002945chr171847 1261 ----
NM_002953chr11164 ------
NM_002955chr641633 1258 175 79 ------
NM_002956chr122505 157 ------
NM_002958chr31720 ------
NM_002959chr174171 3643 3204 2963 650 518 110 33968 3686 3349 14113 1400
NM_002973chr121402 ------
NM_002997chr251383 1293 1275 312 78 ------
NM_002998chr82901 415 1431 ----
NM_003001chr142115 1541 1531 353 ------
NM_003003chr171258 ------
NM_003010chr1742216 1885 715 466 ------
NM_003011chr941426 1152 680 283 11327 --11383
NM_003016chr171625 11412 1747 --
NM_003026chr921197 1110 11006 1463 --
NM_003027chr152128 94 164 ----
NM_003028chr9153898 3810 3495 3471 3201 3002 2870 2495 2444 2437 1493 1062 846 696 282 13208 11541 41406 1340 1272 838
NM_003029chr121118 34 --11108 --
NM_003030chr341771 1381 108 57 ------
NM_003031chr161756 ------
NM_003034chr1267115 6277 4937 2575 479 104 --36940 6675 1831 --
NM_003036chr121157 256 1806 ----
NM_003045chr1374245 4210 3306 1022 921 361 190 --14301 --
NM_003047chr181323 1040 1020 516 424 248 100 81 ------
NM_003060chr571155 1017 891 233 173 112 80 ------
NM_003069chrX1114 ------
NM_003074chr31339 1186 ----
NM_003075chr12----164 --
NM_003076chr1271688 1676 1654 1478 448 363 51 11081 1582 --
NM_003077chr173767 179 28 ------
NM_003079chr171322 ----1223
NM_003088chr771006 904 461 363 318 257 229 ------
NM_003090chr15273 31 ------
NM_003096chr2134 ----1170
NM_003098chr203449 214 23 ------
NM_003099chr1595939 4727 2616 1234 1001 943 808 751 57 ----11043
NM_003108chr266451 5355 2773 2627 2551 1813 12763 15640 --
NM_003113chr22584 175 ------
NM_003128chr252221 1967 1959 1858 26 ------
NM_003131chr692247 521 459 427 392 368 344 248 188 11588 1143 1834
NM_003133chr11190 ------
NM_003136chr141348 ------
NM_003137chr652186 1934 731 92 49 ------
NM_003139chr113793 704 607 --147 --
NM_003144chr631600 1591 768 --21872 1835 --
NM_003145chr11171 1149 1116 --
NM_003146chr112124 33 ------
NM_003149chr331210 520 37 --1589 --
NM_003150chr1772172 2136 1915 1552 567 500 317 12166 11879 --
NM_003153chr1241006 986 108 35 --1314 --
NM_003155chr822793 1840 ------
NM_003157chr31265 ------
NM_003161chr1723071 831 ------
NM_003164chr113464 178 106 1366 1472 --
NM_003173chrX31237 957 71 --21111 1081 --
NM_003174chr101285 ------
NM_003178chr31660 12064 ----
NM_003179chrX21217 172 1179 ----
NM_003185chr206953 508 489 300 240 136 ------
NM_003187chr51164 ------
NM_003189chr192550 2400 1334 1135 740 729 692 553 147 22289 639 --1359
NM_003199chr1865522 4949 4895 1445 1436 1096 14779 ----
NM_003200chr1962099 1749 1606 299 199 41 11740 ----
NM_003202chr551734 1328 718 696 83 1126 ----
NM_003204chr172635 101 21584 229 11164 11438
NM_003216chr2263046 2957 2355 2074 2056 248 --12883 --
NM_003220chr641336 1109 175 145 1254 ----
NM_003221chr663954 1298 827 617 574 471 23187 2761 23074 594 --
NM_003234chr331694 956 455 ------
NM_003236chr243016 2773 2401 136 1149 11029 --
NM_003239chr1441077 817 773 709 ------
NM_003242chr321906 349 1682 11660 1946
NM_003253chr212611 216 ------
NM_003255chr1762489 2316 996 652 455 68 2826 199 12363 --
NM_003257chr1521079 383 ------
NM_003269chr621033 395 2530 422 --1119
NM_003272chr11196 ------
NM_003275chr911174 ------
NM_003281chr1175190 4266 3297 2122 1756 1605 1094 1027 916 893 875 804 625 417 404 314 137 12021 13480 25331 4678
NM_003286chr20180 ------
NM_003289chr9----131 --
NM_003290chr19----1223 --
NM_003292chr132102 1739 1531 --1527 --
NM_003298chr3105923 4979 4516 4458 3989 3771 2187 960 924 376 14892 25848 4500 15189
NM_003300chr14179 ------
NM_003305chr41138 ------
NM_003309chr631879 390 87 11588 ----
NM_003317chr141583 --1713 --
NM_003320chr1173567 2972 1317 818 748 97 72 33633 509 121 2840 529 24089 724
NM_003325chr221250 ------
NM_003334chrX1153 ------
NM_003337chr51125 11133 1485 --
NM_003339chr5163 ------
NM_003340chr411087 --1443 --
NM_003342chr1742427 2256 973 757 12988 ----
NM_003344chr751497 659 643 529 394 ------
NM_003347chr2282171 2140 2000 1916 716 665 596 215 22358 2107 ----
NM_003348chr121127 ----21292 560
NM_003349chr2061582 997 640 590 377 24 --2989 423 --
NM_003350chr81938 1741 ----
NM_003352chr22935 337 ------
NM_003360chr41242 1116 ----
NM_003367chr192372 178 ----167
NM_003371chr991485 1422 771 759 744 583 445 183 55 1345 ----
NM_003373chr1031749 608 332 11613 11282 --
NM_003376chr671485 1479 1364 1354 682 602 132 ------
NM_003376chr671485 1479 1364 1354 682 602 132 ------
NM_003390chr111239 ----1408
NM_003392chr353604 3140 2977 1606 1141 --11037 --
NM_003394chr12--1578 2175 63 --
NM_003400chr21118 ----1701
NM_003404chr2021848 1462 ------
NM_003406chr8--11432 11495 --
NM_003410chrX12381 ------
NM_003412chr352012 1172 1113 917 324 --11096 --
NM_003413chrX4811 433 263 176 ------
NM_003416chr8147 ------
NM_003418chr31821 ------
NM_003430chr192493 398 1327 ----
NM_003453chr131539 ------
NM_003455chr1121393 461 --2178 70 138
NM_003458chr3153573 3448 3371 3194 3058 2799 1234 875 584 567 510 477 444 279 87 --43930 3290 2935 310 --
NM_003462chr14675 440 279 245 --188 --
NM_003463chr642693 2667 2645 701 23303 1359 ----
NM_003466chr271614 1558 1532 693 545 474 196 --11715 11759
NM_003468chr241303 1107 642 222 ------
NM_003470chr1691719 1649 1558 1498 526 376 353 176 80 ------
NM_003472chr611485 ------
NM_003482chr1282642 2264 2203 1016 771 464 370 159 22098 215 12112 --
NM_003483chr1211901 ------
NM_003485chr144905 351 202 128 --1943 21215 44
NM_003489chr2142830 2156 1370 1073 ------
NM_003498chr1642159 1843 1125 246 1875 1369 12414
NM_003502chr163531 523 38 1441 ----
NM_003557chr111185 --166 --
NM_003558chr9--1507 ----
NM_003559chr17123657 3534 3389 3267 3085 2848 1442 1376 1273 1043 976 968 22566 1399 1840 1435
NM_003563chr1731297 1179 494 --1563 --
NM_003564chr12550 28 --1535 199
NM_003566chr1222377 2303 13007 --1897
NM_003574chr1853819 1785 1147 742 248 ------
NM_003575chr751435 1347 1081 622 246 31442 260 80 1337 --
NM_003576chr1342722 2509 2465 854 --182 --
NM_003581chr22676 415 --1425 --
NM_003583chr123393 241 52 12801 ----
NM_003586chr162458 444 ------
NM_003590chr262706 1592 1149 951 579 140 12461 --23797 3147
NM_003597chr242197 1826 1717 480 --1441 12096
NM_003607chr173947 3916 3802 1272 441 373 30 24220 750 --13451
NM_003613chr15--132 ----
NM_003615chr322478 180 ------
NM_003618chr2------1894
NM_003624chr1941362 1324 1276 400 --1426 --
NM_003626chr112984 496 1919 ----
NM_003627chr11----1417 --
NM_003628chr21193 ------
NM_003629chr173125 2875 2845 2281 1377 1199 1061 ------
NM_003632chr172209 51 --1669 --
NM_003633chr531973 1020 257 --12352 --
NM_003637chr161495 1439 1357 1348 603 146 --21164 28 11046
NM_003644chr17176052 5928 5858 5219 5201 4991 4793 4412 4183 4096 2466 2253 1950 1218 999 211 205 24956 1745 42053 2024 784 494 --
NM_003654chr111538 ------
NM_003655chr173276 235 225 --1711 --
NM_003663chr333056 2787 2497 ------
NM_003670chr31964 --11390 --
NM_003671chr9102921 2910 2690 2444 2434 1304 1080 1068 919 98 1347 22772 271 1212
NM_003672chr11109 ------
NM_003685chr19--1171 2378 126 --
NM_003704chr41216 --1255 --
NM_003711chr5199 --1214 --
NM_003713chr151109 423 217 154 64 1693 ----
NM_003716chr3136 ------
NM_003722chr321989 764 --181 1197
NM_003732chr5------1195
NM_003737chr112431 179 --1130 --
NM_003746chr12192 ------
NM_003749chr1362419 1917 912 548 454 304 ------
NM_003758chr1531390 1123 360 ------
NM_003758chr1531390 1123 360 ------
NM_003759chr443929 2925 1519 269 --43507 3230 597 41 --
NM_003763chr2032666 521 160 12456 ----
NM_003768chr121681 1164 ------
NM_003773chr3151 ------
NM_003787chr1821122 616 ------
NM_003791chr161147 ----141
NM_003795chr62215 198 1107 ----
NM_003800chr61238 --11873 --
NM_003806chr121270 --1218 --
NM_003816chr8184 ------
NM_003837chr9123 ------
NM_003861chr1462865 2850 2324 2234 2055 40 1536 ----
NM_003862chr52331 101 ------
NM_003872chr283036 2478 2443 2379 2268 686 604 475 ------
NM_003873chr1052445 819 743 563 384 12091 ----
NM_003877chr122643 304 ------
NM_003878chr8----1210 --
NM_003883chr5185 ------
NM_003888chr1531623 1578 393 --11441 175
NM_003893chr103449 207 179 ----1377
NM_003895chr2131893 1773 275 --1356 --
NM_003908chr201139 11268 ----
NM_003913chr633871 1635 431 23339 749 --1902
NM_003924chr4--1173 ----
NM_003932chr2221529 1322 1629 125 --
NM_003934chr91228 ------
NM_003938chr193853 297 58 ------
NM_003941chr722340 1693 --22303 2250 1672
NM_003947chr31129 11213 1883 --
NM_003948chr42205 145 --12518 --
NM_003949chr1781913 1597 1546 1439 1379 637 448 309 1483 ----
NM_003954chr1751440 1362 1053 500 190 --144 --
NM_003955chr1751505 1125 149 110 102 --21481 1136 --
NM_003961chr163185 138 76 165 ----
NM_003966chr597579 5862 5569 2702 2590 1531 1227 1195 887 16234 26969 6302 --
NM_003972chr102524 429 ------
NM_003975chr14323 221 206 103 ------
NM_003980chr621014 486 ------
NM_003983chr1643195 1410 272 100 ----13908
NM_003987chr1042144 876 590 584 1806 22018 1989 --
NM_003988chr1042221 953 667 661 1883 22095 2066 --
NM_003989chr1052080 873 812 526 520 1742 21954 1925 --
NM_003990chr1052080 873 812 526 520 1742 21954 1925 --
NM_003992chr151276 ------
NM_003994chr1213159 ------
NM_004006chrX32320 2078 48 ------
NM_004007chrX32320 2078 48 ------
NM_004009chrX32320 2078 48 ------
NM_004010chrX32320 2078 48 ------
NM_004011chrX32320 2078 48 ------
NM_004012chrX32320 2078 48 ------
NM_004013chrX32320 2078 48 ------
NM_004014chrX32320 2078 48 ------
NM_004015chrX32320 2078 48 ------
NM_004016chrX22234 1992 ------
NM_004017chrX32320 2078 48 ------
NM_004018chrX22234 1992 ------
NM_004020chrX32320 2078 48 ------
NM_004021chrX22234 1992 ------
NM_004022chrX22234 1992 ------
NM_004023chrX22234 1992 ------
NM_004024chr131091 518 112 ----1394
NM_004028chr1853013 2884 1076 1058 1006 148 ----
NM_004035chr1745053 1380 1248 552 ------
NM_004036chr26671 463 281 232 166 154 --1244 1130
NM_004050chr14112653 2468 2344 2254 2139 1808 1777 952 620 317 72 11859 ----
NM_004055chr1141481 662 618 293 1655 1230 --
NM_004059chr93334 160 23 ----1421
NM_004067chr731153 1085 580 ------
NM_004068chr32316 111 ------
NM_004082chr21108 --141 --
NM_004087chr341332 591 457 63 ------
NM_004089chrX1929 --1513 --
NM_004090chr1783215 3018 2586 2544 2262 705 417 144 12714 42671 1098 514 489 11259
NM_004093chr1342807 2050 672 490 ------
NM_004094chr1432047 628 160 ------
NM_004097chr22266 204 ------
NM_004098chr101805 11314 ----
NM_004099chr942040 1725 1633 54 --21643 23 --
NM_004100chr62464 385 12078 --1785
NM_004114chrX2332 73 ------
NM_004116chr21450 ------
NM_004124chr1432354 2277 2264 ------
NM_004132chr1021101 156 1872 ----
NM_004136chr152707 48 ------
NM_004139chr20--2322 108 ----
NM_004145chr192875 332 189 ----
NM_004162chr3----11123 --
NM_004171chr11128647 8009 6980 6826 6249 6091 6014 3192 2775 1679 1259 146 57744 6184 3863 1005 843 28502 3766 --
NM_004181chr41131 1325 ----
NM_004186chr34895 852 750 345 --140 --
NM_004187chrX21081 920 21260 593 ----
NM_004193chr102378 86 ------
NM_004199chr51397 ------
NM_004200chr11123264 2954 2864 2816 2529 2375 2247 2166 2062 1051 542 490 155 ----
NM_004202chrY1128 ------
NM_004205chr111367 --1475 --
NM_004206chr3134 ------
NM_004225chr821197 992 ------
NM_004227chr773119 2446 2067 1236 1210 945 719 --22651 2510 --
NM_004229chrX2586 344 11550 21709 1516 168
NM_004232chr182662 300 ------
NM_004238chr21102 ------
NM_004247chr172280 86 ------
NM_004248chr101267 --1138 --
NM_004249chr4180 ------
NM_004253chr91678 --1871 --
NM_004261chr1----1834 --
NM_004274chr1433058 944 188 ----11155
NM_004279chr721915 698 12177 12110 --
NM_004286chr22102470 2423 2365 1917 1815 841 759 474 373 219 2852 266 52839 2805 2115 689 97 --
NM_004288chr21927 ------
NM_004293chr932401 623 310 ------
NM_004295chr172470 175 11042 ----
NM_004302chr1272538 2252 2216 2154 760 461 118 32548 2229 604 2857 102 --
NM_004309chr174988 446 277 104 1963 2839 179 --
NM_004311chr1022990 1219 12087 32478 2244 2147 1812
NM_004316chr122440 23 --1465 --
NM_004321chr293526 3196 3152 2701 2485 2291 1396 1235 421 ------
NM_004329chr102355 307 ------
NM_004331chr842221 2119 1789 990 ----12707
NM_004337chr81329 ------
NM_004338chr1875132 4478 2506 2481 2354 2293 1809 1971 16305 22489 2221
NM_004349chr8--11316 ----
NM_004356chr111123 2472 441 ----
NM_004370chr631680 1564 591 ------
NM_004377chr223297 131 26 ------
NM_004379chr221299 651 ------
NM_004380chr1652586 2333 2317 2289 2208 11930 1723 --
NM_004385chr5147 ------
NM_004392chr132424 89 --12410 --
NM_004393chr382084 1826 1800 736 700 363 164 154 ------
NM_004395chr54627 524 293 124 --1301 --
NM_004396chr171278 ------
NM_004397chr1183751 3289 2924 1582 1388 1338 932 841 12766 ----
NM_004398chr113441 323 21 ------
NM_004399chr12135 1705 ----
NM_004405chr23317 284 144 ------
NM_004409chr194758 620 562 131 ------
NM_004420chr11102359 2189 2079 1604 1569 1526 967 831 189 182 --32197 2087 540 --
NM_004421chr14729 295 81 23 ------
NM_004423chr352662 2585 2075 2065 543 12291 11082 --
NM_004426chr1231678 461 302 --11381 --
NM_004427chr15997 824 404 284 112 1163 1398 --
NM_004430chr841696 1106 942 205 ------
NM_004431chr12330 196 --1284 --
NM_004432chr91254 11769 ----
NM_004433chr14668 579 356 214 ------
NM_004434chr1431891 1245 123 ------
NM_004436chr1----1142 --
NM_004437chr173531 2335 2279 1153 853 538 33 1735 2606 485 --
NM_004438chr242606 1103 507 97 12120 32137 1114 854 --
NM_004440chr61684 159 1271 --
NM_004443chr35732 586 538 520 263 ------
NM_004447chr12169 ------
NM_004450chr141276 1367 ----
NM_004451chr111155 --1673 --
NM_004454chr32506 107 ------
NM_004456chr71169 ------
NM_004458chrX21051 72 ------
NM_004459chr17--1434 ----
NM_004464chr421188 236 2914 885 ----
NM_004474chr13973 914 761 ------
NM_004475chr1791125 1105 872 805 485 459 408 343 41 --1943 --
NM_004481chr132148 1012 196 12481 22422 2158 --
NM_004482chr21926 ------
NM_004494chr141289 1169 955 115 1191 ----
NM_004499chr51172 ------
NM_004501chr133651 2674 843 21361 441 --12797
NM_004502chr173445 429 61 --1372 --
NM_004504chr232840 2325 512 --12013 --
NM_004514chr17122995 2879 2613 2532 2475 1956 1948 1901 967 512 269 90 22586 380 ----
NM_004529chr92571 274 ------
NM_004540chr21--1783 ----
NM_004554chr1441387 406 370 49 1175 ----
NM_004555chr164496 407 144 89 ----1212
NM_004575chr421472 1162 11039 ----
NM_004583chr173643 487 276 1505 ----
NM_004586chrX65371 3952 3882 1007 867 607 --34682 4016 948 --
NM_004588chr1183970 3203 1626 1052 952 833 626 221 ----12910
NM_004598chr563308 2768 815 570 401 112 --22579 2395 --
NM_004603chr781098 831 473 412 385 151 81 52 1311 ----
NM_004606chrX3355 266 129 --131 --
NM_004612chr954511 4292 3554 1659 1610 24751 621 ----
NM_004622chr231576 283 180 ------
NM_004626chr11193 1145 1726 --
NM_004630chr112938 212 ------
NM_004637chr3130 160 1225 --
NM_004641chr101117 --11148 --
NM_004651chrX2349 266 --143 --
NM_004655chr1731388 147 44 ------
NM_004656chr36935 786 496 482 282 122 2773 48 ----
NM_004660chrY31566 721 180 ----12148
NM_004663chr151213 ------
NM_004667chr151108 ------
NM_004675chr1125 ------
NM_004687chr1741563 760 500 181 ------
NM_004689chr142443 374 1111 ----
NM_004698chr11175 --152 --
NM_004703chr1732491 2424 1758 22548 2498 12079 --
NM_004704chr3127 ------
NM_004709chrX31797 1495 30 ------
NM_004711chr22113194 2993 2802 2756 2420 1279 1159 1103 870 509 371 1741 23354 2531 11021
NM_004716chr116799 740 694 670 133 55 ------
NM_004717chr731399 478 51 ------
NM_004723chr14910 417 234 126 1821 ----
NM_004726chrX85515 5164 5151 4907 4697 1443 732 539 22239 1058 15119 14470
NM_004730chr532111 1789 173 --1738 --
NM_004734chr1332203 131 103 --12920 23234 328
NM_004736chr141715 1623 851 126 ------
NM_004737chr22--2144 74 ----
NM_004739chr111150 ------
NM_004740chr172321 287 ----165
NM_004741chr10------21401 287
NM_004742chr321817 1674 ------
NM_004745chr896220 6203 5786 5039 5031 4951 1841 1647 108 --14289 --
NM_004747chr102328 61 ----11388
NM_004748chr1533771 3175 707 --13745 --
NM_004755chr14--1861 ----
NM_004758chr173357 246 95 ------
NM_004762chr1741761 1424 250 95 --1228 1354
NM_004768chr11107 1838 ----
NM_004770chr81246 ------
NM_004772chr531270 599 124 1252 ----
NM_004774chr17----22742 983 --
NM_004776chr20103273 3055 2579 2526 2214 2179 1030 997 884 269 2405 170 ----
NM_004781chr12388 243 ------
NM_004781chr12388 243 ------
NM_004788chr1162275 2181 2041 1890 1054 629 1713 --1473
NM_004789chr91450 ------
NM_004796chr1421976 1814 ------
NM_004798chr2063421 3099 926 688 302 43 22763 1110 13130 --
NM_004801chr2------11074
NM_004805chr21203 ------
NM_004815chr144606 4146 3884 524 14888 34130 1567 1461 11491
NM_004818chr121244 190 ----
NM_004822chr1763353 2700 1505 1495 1367 242 23481 1416 21385 948 --
NM_004840chrX52177 2161 714 577 411 3383 349 34 11707 --
NM_004856chr151399 ------
NM_004860chr17--161 ----
NM_004867chrX1163 ------
NM_004874chr8----1471 --
NM_004879chr113343 112 54 ------
NM_004884chr1541768 385 177 157 1447 ----
NM_004886chr19132 ------
NM_004887chr52999 115 --1969 --
NM_004891chr2------1233
NM_004898chr432413 2134 1956 ------
NM_004902chr203745 736 268 ------
NM_004904chr765166 4758 4476 4348 956 487 14741 11261 --
NM_004905chr1--1185 ----
NM_004906chr61504 ------
NM_004907chr192299 238 1188 ----
NM_004923chr113701 306 245 --1147 --
NM_004924chr191153 1850 1111 --
NM_004926chr143317 153 98 ------
NM_004936chr962930 2061 1030 609 474 198 11001 ----
NM_004943chr1961152 981 883 831 410 201 11211 3781 384 187 --
NM_004947chr331035 794 375 132 --11795
NM_004953chr31340 ------
NM_004955chr62584 152 1575 ----
NM_004956chr733906 3547 2976 ------
NM_004959chr941496 1451 1006 547 21470 1183 2598 296 --
NM_004962chr102228 46 --157 --
NM_004965chr212493 105 ------
NM_004968chr75641 494 482 249 135 ------
NM_004973chr661330 1208 1154 629 288 103 ------
NM_004975chr201108 --2368 240 1120
NM_004976chr11114825 4483 4369 4026 3449 2016 1825 1732 1371 659 384 13472 21577 587 14715
NM_004977chr191562 --2394 153 --
NM_004978chr191648 1596 1562 1538 1446 621 424 417 400 --144 1652
NM_004979chrX2359 30 31088 471 323 ----
NM_004985chr1233371 2761 1007 ------
NM_004992chrX198256 7656 7087 6994 6690 6413 5870 3231 3170 3138 2476 2009 1556 1489 1414 1377 1370 760 648 --46915 6442 2607 1796 13180
NM_004992chrX198256 7656 7087 6994 6690 6413 5870 3231 3170 3138 2476 2009 1556 1489 1414 1377 1370 760 648 --46915 6442 2607 1796 13180
NM_004993chr1421462 1378 1959 1330 --
NM_005004chr10127 ------
NM_005010chr711870 1841 169 --
NM_005011chr741668 1377 1235 558 --11472 --
NM_005017chr3126 --157 --
NM_005020chr71159 ------
NM_005023chr511423 ------
NM_005027chr1941153 1134 284 270 1104 ----
NM_005028chr1021774 706 ----1846
NM_005045chr73933 925 50 --1126 --
NM_005056chr1244901 1785 1220 526 1360 ----
NM_005057chr131541 583 380 1388 21903 1745 --
NM_005065chr1444831 4745 4300 799 --13572 --
NM_005076chr1183959 3418 3229 2964 2913 1241 1197 1078 976 750 713 690 500 476 381 341 260 137 13986 33024 2951 492 --
NM_005095chr111551 1822 3662 402 95 --
NM_005096chrX5414 320 196 141 106 ------
NM_005099chr12158 22 11021 1225 1396
NM_005103chr11------1289
NM_005105chr141655 803 691 56 ------
NM_005109chr34985 974 651 629 1605 ----
NM_005110chr53801 709 143 --1277 --
NM_005116chr2031546 701 215 --34605 1710 266 1202
NM_005117chr11185 --1710 --
NM_005119chr121178 1092 ------
NM_005121chr1742913 2472 1129 529 --13862 --
NM_005133chr11----148 --
NM_005134chr182746 256 ------
NM_005135chr1531299 937 52 13350 ----
NM_005144chr861184 1156 1032 928 880 480 --21013 319 --
NM_005151chr1842439 2198 2019 705 1480 12398 --
NM_005155chr62662 223 --1463 --
NM_005156chr964073 3792 3570 3367 1906 339 ----11425
NM_005157chr9131954 1525 753 746 661 620 565 457 224 188 160 145 121 --1319 --
NM_005159chr1511719 --1892 1772
NM_005161chr1182201 1926 1584 429 139 54 37 31 22033 1552 --1650
NM_005165chr172356 307 1102 125 --
NM_005166chr19----1341 --
NM_005168chr231151 622 583 1434 ----
NM_005171chr12--1843 ----
NM_005182chr164541 507 412 246 ------
NM_005184chr1991213 1142 475 452 427 393 327 307 223 1994 1277 --
NM_005186chr115559 516 475 130 102 ------
NM_005187chr1651631 1574 1528 1332 1305 --11486 --
NM_005188chr11157733 7315 7284 6745 6570 5955 5905 5658 5583 3054 2321 1234 928 682 114 27795 6248 57927 7532 5786 5548 2724 --
NM_005189chr1742392 676 598 249 2691 444 22205 2196 --
NM_005191chr341210 1060 196 111 ------
NM_005197chr1444567 4171 3793 805 11151 24080 616 11429
NM_005202chr161419 744 701 290 273 242 --32185 407 346 --
NM_005206chr1731096 951 900 --1893 --
NM_005207chr2253400 3126 2424 1463 643 1821 ----
NM_005219chr561373 722 419 344 232 147 11258 11278 --
NM_005220chr17----11449 1569
NM_005229chrX3441 422 52 1233 ----
NM_005230chr121248 --1478 --
NM_005233chr31725 ------
NM_005235chr286343 5793 5631 5507 5093 4834 2525 1741 --27058 2636 --
NM_005238chr1162904 1124 1047 999 625 249 1743 11191 --
NM_005241chr311239 ------
NM_005249chr14--1649 ----
NM_005252chr141188 ------
NM_005254chr152871 142 11122 ----
NM_005261chr82882 134 ------
NM_005264chr101747 --1766 --
NM_005274chr11142 ------
NM_005276chr1221747 1181 1607 11161 --
NM_005276chr1221747 1181 1607 11161 --
NM_005277chr42539 224 ------
NM_005279chr2148 ------
NM_005281chr13776 671 59 --1654 --
NM_005295chr71291 ------
NM_005311chr742779 2480 922 540 --1600 1940
NM_005324chr1722126 1722 --11300 1696
NM_005329chr1672211 2039 2016 1563 1536 897 171 ------
NM_005336chr282108 2020 1722 1611 903 604 449 400 2804 301 21998 1455 --
NM_005339chr423516 563 ------
NM_005342chrX22011 1927 192 11104 --
NM_005347chr9--11668 ----
NM_005359chr1886061 5297 5188 4829 4823 4103 3974 318 25466 24 56023 5958 1680 1166 299 --
NM_005370chr1951247 1134 1071 832 82 ------
NM_005373chr121420 1238 21669 129 ----
NM_005374chr1782247 2185 2077 1821 872 799 725 139 22030 1480 22156 840 12143
NM_005375chr6--11183 ----
NM_005381chr21114 --184 --
NM_005382chr81324 ------
NM_005386chr201573 ------
NM_005388chr931410 1298 521 ------
NM_005389chr6------1107
NM_005392chr961682 1351 1262 347 329 243 ----1286
NM_005397chr742650 2548 1054 430 --11201 --
NM_005399chr144182 4081 882 404 --24241 1097 --
NM_005400chr272454 2293 1934 517 504 450 195 ------
NM_005406chr181558 1538 ----
NM_005407chr1431382 505 82 ------
NM_005410chr51580 ------
NM_005415chr22498 483 --1745 --
NM_005417chr20111825 1666 1369 1338 1326 612 417 329 271 133 98 ----11798
NM_005418chr112639 627 1140 1569 --
NM_005426chr1----2382 338 --
NM_005433chr1821931 687 --22568 862 --
NM_005436chr1043130 2869 2579 1518 --13832 --
NM_005437chr1031364 1339 27 ------
NM_005442chr32431 103 ------
NM_005445chr101123 ------
NM_005458chr94573 384 205 191 --2531 460 --
NM_005461chr202106 28 1535 ----
NM_005465chr131710 80 74 1131 ----
NM_005475chr12103065 2702 2614 2333 2147 1023 981 529 171 35 ------
NM_005477chr1552518 2461 2303 1822 492 ----1755
NM_005477chr1552518 2461 2303 1822 492 ----1755
NM_005483chr192370 39 ------
NM_005487chr2251924 1495 1465 668 480 11360 --1814
NM_005493chr62307 65 ------
NM_005497chr1735940 1292 401 --14800 14888
NM_005502chr9--23072 218 12633 --
NM_005503chr1521064 920 1138 ----
NM_005507chr113324 201 51 ------
NM_005509chr52410 137 ------
NM_005512chr1151876 1841 1477 737 471 1338 --11435
NM_005517chr12349 314 ------
NM_005519chr101133 1419 ----
NM_005522chr711053 --1377 --
NM_005523chr741169 631 407 66 11556 --1986
NM_005537chr131929 ------
NM_005542chr71330 ------
NM_005544chr2----1970 --
NM_005550chr161658 137 1421 --
NM_005563chr1--1829 ----
NM_005565chr5266 31 ------
NM_005573chr51745 --169 --
NM_005581chr19289 62 --1123 --
NM_005584chr13147 ------
NM_005595chr12916 874 ------
NM_005596chr985025 4987 4912 1344 924 674 627 353 36052 4477 664 25336 933 --
NM_005598chr161405 1319 1193 680 529 117 --21461 321 189
NM_005607chr8--188 155 --
NM_005610chr11831 ------
NM_005614chr73820 765 415 ------
NM_005617chr5--142 ----
NM_005618chr62206 156 ------
NM_005619chr191106 --150 --
NM_005625chr81193 --182 --
NM_005626chr12377 180 ------
NM_005627chr6162 ------
NM_005632chr1641005 840 727 351 ------
NM_005634chrX----1216 --
NM_005637chr1831989 1872 152 --1696 --
NM_005639chr1231769 197 178 ------
NM_005647chrX72830 1334 836 776 691 598 69 1462 ----
NM_005650chr22--1916 ----
NM_005652chr161797 ------
NM_005663chr41367 ------
NM_005664chr152385 183 ------
NM_005665chr133986 1670 890 ----11807
NM_005668chr533036 1737 1332 ------
NM_005677chr351397 1041 1035 962 932 ------
NM_005688chr331088 917 78 --1887 --
NM_005715chr632505 2060 1965 11792 ----
NM_005717chr121130 116 ------
NM_005721chr21326 ------
NM_005722chr242213 1784 820 108 11873 ----
NM_005730chr1231110 843 681 23216 2919 --11127
NM_005734chr111281 ------
NM_005735chr23567 211 56 --1154 --
NM_005736chr101147 31321 1110 582 --1639
NM_005737chr262914 2697 2690 2513 710 331 ------
NM_005738chr741269 474 362 97 ----11534
NM_005740chr225813 611 591 339 69 2733 184 ----
NM_005746chr732781 222 125 11077 ----
NM_005748chr1243446 3358 2976 2227 23410 3144 ----
NM_005754chr52803 69 ------
NM_005759chr254250 4235 1916 1039 65 ------
NM_005766chr1331287 459 200 --21167 127 --
NM_005778chr32407 194 ------
NM_005786chr182884 157 ------
NM_005795chr233012 515 169 --12118 1125
NM_005808chr343193 2763 2321 315 2832 70 ----
NM_005811chr12276 55 ------
NM_005822chr641827 1768 635 350 1942 1450 --
NM_005828chr17114677 4277 4223 4082 3879 3117 1720 1600 1292 635 171 33511 1656 855 33527 1455 558 --
NM_005832chr321148 442 ------
NM_005840chrX127214 6888 6169 4697 2683 2654 2619 2394 1557 1294 477 232 11193 16294 --
NM_005842chr131511 ------
NM_005843chr231889 296 52 1624 --132
NM_005851chr113447 410 152 172 1279 --
NM_005852chr176816 397 368 207 166 21 --184 --
NM_005857chr131382 538 66 ----11188
NM_005859chr521443 442 --11352 --
NM_005864chr142602 124 ------
NM_005870chr13192 --1188 --
NM_005871chr101760 ------
NM_005876chr23698 642 621 ------
NM_005880chr1621642 1475 ------
NM_005881chr161304 ------
NM_005885chr5------1429
NM_005896chr22630 151 ------
NM_005898chr1153077 2777 2127 1998 230 --1378 --
NM_005899chr1721546 1008 --181 --
NM_005900chr431151 97 40 ------
NM_005901chr1898664 8315 7286 7205 6931 5964 5464 3407 2449 27272 760 --12304
NM_005902chr1594611 4579 4265 4250 4232 3563 1578 1439 834 --21423 454 14340
NM_005904chr182919 150 ------
NM_005907chr611218 ------
NM_005909chr533971 3549 3270 ------
NM_005910chr1763631 3515 3044 2577 404 88 --11504 --
NM_005911chr26527 461 430 99 76 61 --1481 155
NM_005916chr7130 ------
NM_005920chr183137 2839 2714 1002 895 370 266 64 1218 43826 3282 2511 385 --
NM_005922chr62178 92 ------
NM_005924chr7156 ------
NM_005927chr531166 1032 403 145 ----
NM_005933chr1162849 2452 2226 2006 654 375 --1135 11970
NM_005934chr19182391 2248 2155 2074 2055 1907 851 714 478 455 363 311 274 233 191 120 114 69 11743 12015 1822
NM_005938chrX21300 1076 --21286 79 --
NM_005941chr842671 891 692 219 1743 1554 --
NM_005943chr681484 1445 1356 1284 1254 638 533 396 21561 664 --1415
NM_005955chr1124973 4783 4618 4598 3949 3903 3799 3766 1698 884 757 678 --35201 3870 1485 14290
NM_005957chr1144152 4031 3623 3491 3266 1652 1319 1133 1025 855 836 695 625 47 --1323 13468
NM_005962chr1032121 1575 604 22143 723 ----
NM_005962chr1032121 1575 604 22143 723 ----
NM_005964chr174623 380 314 129 ------
NM_005966chr2174 ------
NM_005967chr124542 516 111 66 1215 ----
NM_005969chr1161098 981 948 358 323 308 1872 ----
NM_005977chr131795 ------
NM_005984chr225471 463 356 331 116 ------
NM_005986chr1342750 1765 1103 728 --12170 --
NM_005996chr1211002 --1100 --
NM_006011chr1543482 3363 3015 1140 13411 44089 3471 3098 2796 12648
NM_006015chr151045 911 361 264 72 1213 ----
NM_006016chr632053 2032 681 --1862 --
NM_006030chr351705 1221 707 324 130 ------
NM_006033chr1872221 481 425 372 214 191 111 --11498 --
NM_006034chr1192019 1957 1819 966 749 511 142 111 23 42303 1890 1582 633 3784 732 376 --
NM_006035chr1491194 1184 1167 1084 1006 998 845 297 74 ------
NM_006037chr264926 3236 3117 2973 148 101 24137 1306 --11475
NM_006039chr1761044 930 849 439 111 53 ------
NM_006043chr161764 124 1483 --
NM_006047chr2083190 3161 2373 1086 885 765 748 556 ----1464
NM_006051chr5----1100 --
NM_006054chr1121386 271 1393 --1473
NM_006064chrX1303 ------
NM_006070chr3----1366 --
NM_006077chr101792 --174 --
NM_006079chr61210 ------
NM_006085chr121121 290 ------
NM_006090chr11538 ------
NM_006091chr1561249 1187 1104 655 632 606 ----1416
NM_006094chr842345 1910 816 64 ------
NM_006095chr454500 4206 3842 3301 2847 --11783 --
NM_006099chr13810 751 322 ----1899
NM_006106chr1163020 2656 2627 2596 1177 916 ------
NM_006107chr171432 ------
NM_006108chr1121579 1472 1198 1784 11773
NM_006109chr142308 27 --1368 --
NM_006110chr162128 30 ------
NM_006113chr131443 498 281 --12088 --
NM_006121chr123146 91 27 ------
NM_006122chr1521101 231 1132 --11061
NM_006133chr1192272 2130 1780 933 926 604 370 290 48 21755 1521 ----
NM_006135chr121050 340 ------
NM_006141chr1652769 2704 2257 1022 735 ------
NM_006145chr192978 843 --1259 --
NM_006153chr31212 ------
NM_006154chr1531852 741 291 12278 ----
NM_006158chr81356 11620 ----
NM_006160chr1741036 207 151 133 1515 11383 --
NM_006162chr1851694 1233 1172 660 204 --1370 --
NM_006164chr21419 ------
NM_006167chr831516 479 42 1533 ----
NM_006176chr114720 319 232 191 --1635 --
NM_006180chr931921 625 99 --1143 --
NM_006185chr115494 227 179 86 60 1416 --1528
NM_006186chr21456 ------
NM_006187chr1272104 2010 1068 1031 915 505 174 12351 1701 22993 55
NM_006191chr121296 ------
NM_006195chr91250 ------
NM_006197chr821816 189 1865 ----
NM_006201chrX31119 1111 918 --11153 1212
NM_006203chr564838 4328 3830 3643 1947 1651 --14217 --
NM_006206chr462708 2344 2291 2250 990 949 ------
NM_006209chr82394 313 ------
NM_006212chr185168 5004 3540 1887 1284 912 69 55 1362 ----
NM_006224chr1792321 1951 1759 971 938 846 710 545 160 ------
NM_006226chr21178 ------
NM_006237chr134863 767 186 136 ------
NM_006238chr691969 1702 1519 1412 1403 443 334 302 167 2478 128 41605 538 193 86 --
NM_006241chr32898 367 ------
NM_006243chr12907 158 ----1771
NM_006245chr64859 701 61 42 ------
NM_006251chr512209 1324 ----
NM_006252chr166173 5638 5438 1820 1440 1091 --16657 26921 693
NM_006256chr1173 ------
NM_006258chr1021571 242 ------
NM_006265chr8------1593
NM_006267chr221538 609 ------
NM_006268chr1151126 396 322 252 166 2944 191 11103 --
NM_006270chr192176 51 180 135 --
NM_006275chr2032438 2031 1952 ------
NM_006277chr22239 70 ------
NM_006279chr12931 606 ------
NM_006289chr9----2346 64 --
NM_006292chr11131 ------
NM_006293chr154954 347 338 240 --1120 --
NM_006298chr652810 2639 2224 411 145 ------
NM_006301chr122519 446 ------
NM_006306chrX41961 1362 812 98 24709 523 ----
NM_006307chrX168 ------
NM_006310chr172935 279 ------
NM_006311chr17189 ------
NM_006317chr51287 ------
NM_006320chr4--132 ----
NM_006321chr352026 1975 1898 1856 486 12058 1379 11839
NM_006328chr112135 119 ------
NM_006329chr14--2659 276 ----
NM_006336chr991377 1358 1210 1116 986 613 543 368 262 ----1302
NM_006337chr122135 27 ------
NM_006347chr1127 ------
NM_006350chr51379 ------
NM_006352chr11327 ------
NM_006353chr641401 1095 309 22 ------
NM_006356chr17123 ------
NM_006357chr2172 ------
NM_006359chrX12395 11966 ----
NM_006367chr1128 1140 ----
NM_006369chr11308 1384 ----
NM_006373chr1781113 1104 1023 989 518 211 144 108 1921 ----
NM_006375chrX2263 179 --1441 --
NM_006379chr7--1200 ----
NM_006380chr1743296 3204 2671 1663 --13559 --
NM_006386chr2232309 1913 352 ------
NM_006389chr1151127 1058 892 252 97 ------
NM_006401chr91161 ------
NM_006403chr621581 631 --1589 --
NM_006416chr6159 1737 ----
NM_006422chr12160 149 ----
NM_006434chr1063038 3012 2452 740 349 260 ------
NM_006451chr51876 ------
NM_006454chr4102785 2606 2564 2543 2095 1043 926 840 589 244 32186 2119 759 156 --
NM_006455chr173966 917 826 ------
NM_006457chr423244 115 12535 23869 3761 --
NM_006459chr1061913 1905 1808 739 451 131 ----1478
NM_006465chr15112267 2186 2170 1680 1610 1507 694 505 479 390 347 32052 762 472 71707 865 850 840 830 820 810 1578
NM_006467chr531676 511 289 --11975 --
NM_006471chr18--175 1217 --
NM_006482chr123393 241 52 12801 ----
NM_006489chr14--11628 ----
NM_006494chr192812 230 --192 --
NM_006496chr111275 ------
NM_006517chrX121908 1899 1836 1817 1777 1746 1509 913 482 286 36 26 1545 ----
NM_006524chr72323 71 1336 --1420
NM_006526chr2011480 --11942 --
NM_006527chr41276 --1239 --
NM_006539chr163427 167 39 --1136 --
NM_006544chr1421725 1647 --35243 902 69 --
NM_006546chr17106196 5935 5359 4733 4211 2132 2003 1993 374 63 32352 2094 1020 34306 1374 276 14200
NM_006547chr751956 1725 1482 266 183 ------
NM_006548chr321515 156 --144 --
NM_006549chr1272938 2593 2501 2449 2305 2272 768 32651 2586 525 ----
NM_006557chr92532 23 11472 ----
NM_006558chr8144 ------
NM_006559chr131241 1133 1112 ------
NM_006560chr111399 ------
NM_006561chr1054945 4831 2440 2302 2017 44810 4487 3837 28 35225 4976 2007 --
NM_006562chr10----1233 --
NM_006565chr16------1928
NM_006587chr421208 53 ------
NM_006589chr12523 431 ----1543
NM_006595chr11--1159 ----
NM_006599chr1638050 5241 1240 --16324 --
NM_006601chr1221125 89 ----1356
NM_006602chr203201 80 63 ------
NM_006603chrX11814 ------
NM_006609chr21462 ------
NM_006614chr322848 1366 ------
NM_006618chr1----1428 11036
NM_006621chr151813 1779 1298 673 498 --1597 --
NM_006624chr1031372 552 111 ------
NM_006626chr922678 965 --1928 --
NM_006628chr1544477 3028 1349 1154 ------
NM_006629chr1832749 667 563 ----12014
NM_006650chr5103732 3712 3500 3455 3252 2585 1303 960 501 369 13132 1153 --
NM_006653chr62275 67 ------
NM_006654chr1234275 1285 1036 1561 ----
NM_006658chr711070 187 ----
NM_006660chr151126 ------
NM_006662chr161122 ------
NM_006682chr722778 180 ------
NM_006690chr20112343 2042 1810 928 854 783 485 425 106 75 47 22027 1843 1221 1396
NM_006717chr911055 --22358 1067 21359 688
NM_006720chr1085005 4865 3951 2045 1689 1625 1143 562 1362 24791 1898 --
NM_006722chr342887 2051 775 683 ------
NM_006724chr62178 92 ------
NM_006726chr411131 ------
NM_006727chr51341 ------
NM_006734chr621227 463 ------
NM_006735chr7164 ------
NM_006738chr15103907 3810 3745 3573 3547 1402 1372 1162 973 246 34405 2961 1433 24649 120 --
NM_006744chr10287 59 ----147
NM_006745chr421099 888 ------
NM_006749chr82458 107 --2401 122 --
NM_006750chr16147155 7043 6707 6229 2818 1721 1479 1150 672 533 399 108 90 26 37492 7209 506 37851 2744 1743 --
NM_006754chr73435 302 278 ------
NM_006764chr32194 37 --1448 --
NM_006766chr831002 840 297 11803 ----
NM_006769chr11149 132 ----
NM_006772chr671669 1420 1403 1231 694 501 222 ------
NM_006775chr631099 572 175 1551 1431 --
NM_006777chrX12331 --12419 --
NM_006783chr13------1733
NM_006788chr1851456 737 463 426 82 ------
NM_006805chr541330 116 102 43 --21444 1276 --
NM_006807chr1721091 265 --1356 --
NM_006814chr2022216 2079 --1179 --
NM_006816chr51219 ------
NM_006819chr111272 133 ----
NM_006822chr172195 131 ------
NM_006823chr811111 --11144 --
NM_006826chr22955 185 ------
NM_006833chr71139 ------
NM_006836chr122495 144 ------
NM_006838chr1241751 1533 1200 669 ------
NM_006841chr35620 484 180 139 42 --1774 --
NM_006852chr1732860 2560 2529 --22453 931 11894
NM_006854chr731823 677 544 ------
NM_006856chr121783 126 11102 --
NM_006861chr1281730 1411 693 665 633 344 198 161 11559 ----
NM_006870chr202601 155 ------
NM_006873chr263504 3142 2593 552 331 69 12293 ----
NM_006874chr42937 855 ------
NM_006875chrX1873 --1211 --
NM_006876chr111502 1548 ----
NM_006884chr341771 1381 108 57 ------
NM_006885chr1623948 234 11147 ----
NM_006888chr1453541 3373 2540 1168 547 --22444 2252 --
NM_006893chr1147 ------
NM_006897chr121631 ------
NM_006902chr143030 631 605 60 33154 3064 568 --12963
NM_006906chr114680 373 126 67 156 1771 --
NM_006908chr74571 435 265 239 --2255 107 --
NM_006910chr16180 ------
NM_006914chr91581 ------
NM_006918chr1135611 2242 2190 24364 346 11740 --
NM_006922chr22738 319 1872 ----
NM_006924chr1723182 869 13438 12803 11646
NM_006925chr142471 412 --1213 --
NM_006931chr1221679 445 11389 ----
NM_006939chr1421056 171 1897 ----
NM_006946chr114441 387 380 76 1540 2485 176 --
NM_006950chrX5803 368 211 176 51 ------
NM_006951chr101719 ------
NM_006981chr922827 2478 --12808 --
NM_006987chr1731225 961 498 2221 87 ----
NM_006990chr1102531 2419 1871 1789 1765 1637 1541 569 201 51 22433 375 21717 358 11707
NM_006997chr101297 ------
NM_006999chr541593 793 229 200 1438 ----
NM_007007chr1294381 4371 4305 3467 3034 1036 1005 628 175 --13235 14418
NM_007008chr2----1366 --
NM_007011chr15115794 4593 4238 4221 2347 2304 2249 1110 821 252 160 1765 22479 34 11804
NM_007013chr8128 ------
NM_007014chr1681706 1402 1186 511 283 167 109 43 --284 51 --
NM_007024chr31126 1235 ----
NM_007030chr5145064 4716 4667 4452 4283 3191 1789 1330 1144 1048 887 632 511 387 33206 905 246 ----
NM_007032chr2282677 2228 2059 1095 1039 732 446 49 --12272 --
NM_007038chr2145959 5304 1024 147 ----15203
NM_007042chr321052 93 1262 1402 --
NM_007043chr1232028 1776 1600 --11677 --
NM_007045chr6198 --1398 --
NM_007050chr2097143 6812 6615 5098 2821 1368 378 135 91 25232 1916 --15113
NM_007052chrX1115 ------
NM_007064chr311115 ------
NM_007067chr1721105 316 ----11323
NM_007073chr634208 3650 1444 --33626 3385 215 13132
NM_007084chr13185 ------
NM_007096chr9159 ------
NM_007118chr51611 ------
NM_007122chr14585 234 203 144 ------
NM_007124chr631833 635 48 ----11738
NM_007126chr9----1374 --
NM_007144chr1741043 350 95 64 --1948 --
NM_007145chr1911398 ------
NM_007146chr1722234 582 ----12213
NM_007153chr1974280 1748 1490 610 369 272 76 2360 117 13036 133
NM_007157chrX42310 370 214 121 ----22501 2180
NM_007159chr33640 424 30 ------
NM_007162chr63579 470 463 1230 2510 201 --
NM_007166chr1111036 ----2454 313
NM_007170chr13704 187 75 ------
NM_007174chr1241990 1553 621 286 ------
NM_007178chr12----169 --
NM_007181chr19--1139 ----
NM_007185chr15780 313 288 232 71 ------
NM_007191chr122660 46 ------
NM_007195chr1853230 1467 915 892 71 ------
NM_007197chr12----1308 2722 282
NM_007200chr15103907 3810 3745 3573 3547 1402 1372 1162 973 246 34405 2961 1433 24649 120 --
NM_007207chr1132 1659 ----
NM_007210chr1232033 1899 562 ------
NM_007212chr11875 ------
NM_007214chr61461 ------
NM_007216chr111254 ------
NM_007222chr831664 1314 1269 2627 339 ----
NM_007236chr1542092 372 363 338 --158 --
NM_007238chr20104768 4721 4597 4536 4271 3326 3320 3175 304 72 11170 --13053
NM_007241chr17--1147 ----
NM_007243chr66604 565 488 464 71 25 ------
NM_007245chr162748 139 ----1189
NM_007249chr1377512 7160 5891 5868 3179 2390 266 23263 2401 1558 --
NM_007270chr711490 --1282 --
NM_007271chr631269 1154 395 ------
NM_007275chr321108 352 ------
NM_007282chr32796 227 ------
NM_007286chr552094 2022 1965 629 125 32102 1383 177 21487 170 --
NM_007292chr1745053 1380 1248 552 ------
NM_007294chr1751034 494 307 97 71 ------
NM_007295chr1751034 494 307 97 71 ------
NM_007296chr1751034 494 307 97 71 ------
NM_007297chr1751034 494 307 97 71 ------
NM_007298chr1751034 494 307 97 71 ------
NM_007299chr1751034 494 307 97 71 ------
NM_007300chr1751034 494 307 97 71 ------
NM_007302chr1751034 494 307 97 71 ------
NM_007303chr1751034 494 307 97 71 ------
NM_007304chr1751034 494 307 97 71 ------
NM_007305chr1751034 494 307 97 71 ------
NM_007313chr9131954 1525 753 746 661 620 565 457 224 188 160 145 121 --1319 --
NM_007331chr431091 1038 887 12541 --1303
NM_007345chr1821623 821 ------
NM_007350chr1264392 3939 3804 3671 3598 3396 13246 34458 3657 1424 --
NM_007353chr792015 1944 1862 1152 901 690 669 524 162 --1735 --
NM_007358chr131828 142 62 ------
NM_007363chrX21088 944 ------
NM_007365chr13245 175 151 --2585 72 --
NM_007368chr1351244 1008 203 181 57 ------
NM_007372chr171896 1112 ----
NM_007375chr122038 1781 12248 --22542 524
NM_009588chr6----1207 --
NM_012081chr522478 190 --12327 --
NM_012082chr81683 ------
NM_012084chrX--1434 ----
NM_012089chr111396 --11028 --
NM_012090chr121131 968 ------
NM_012095chr1032927 2662 558 ------
NM_012096chr323213 1447 --2674 442 --
NM_012102chr142458 2344 559 238 12002 12193 --
NM_012104chr1163205 1389 1219 798 669 288 11335 1810 --
NM_012104chr1163205 1389 1219 798 669 288 11335 1810 --
NM_012110chr4168 ------
NM_012118chr41399 ------
NM_012120chr632523 2006 401 ------
NM_012121chr1771800 1712 1421 1375 1107 156 30 --1600 --
NM_012134chr141545 376 254 203 --11237 21729 1561
NM_012141chr1332752 2667 949 --13802 --
NM_012153chr1142226 1748 525 316 ------
NM_012154chr82588 151 --181 --
NM_012156chr2063406 3101 2598 2494 1381 1194 168 ----
NM_012158chr1331626 1528 1462 ------
NM_012180chr41668 ------
NM_012183chr11414 ------
NM_012193chr1185088 4946 4803 3783 3674 2174 1842 1623 25203 4779 11907 --
NM_012197chr941363 1280 1116 55 ------
NM_012199chr1104112 4076 4010 2920 1795 1540 780 465 365 247 13167 ----
NM_012200chr11192 ------
NM_012207chr10--1273 ----
NM_012214chr255917 4339 4228 2515 2316 26354 190 ----
NM_012216chrX132 ------
NM_012229chr1031077 514 41 ------
NM_012234chr311240 --12606 --
NM_012238chr1021629 1111 ------
NM_012244chr1451357 1286 688 505 342 --11474 --
NM_012247chr101749 --1647 --
NM_012249chr2--1130 1826 1357
NM_012250chr114450 142 119 93 ----143
NM_012252chr753781 3669 3528 1327 282 11704 23716 3472 --
NM_012257chr7--194 ----
NM_012259chr631458 1062 40 ------
NM_012264chr2251967 1690 1684 862 532 1188 41602 837 797 348 --
NM_012264chr2251967 1690 1684 862 532 1188 41602 837 797 348 --
NM_012282chrX4278 260 153 33 --1298 --
NM_012288chr6115331 4977 4244 3949 3725 2261 2136 1291 1117 478 425 41906 963 490 249 23875 3756 --
NM_012297chr442348 2029 900 97 ------
NM_012300chr541695 1577 662 186 ------
NM_012301chr71674 ------
NM_012304chr582571 2168 2098 1691 613 433 324 102 --1603 --
NM_012306chr12123209 3167 2810 2495 2366 981 894 675 654 433 353 26 --53406 3304 2933 1310 149 --
NM_012307chr181942 ----11003
NM_012308chr1172286 834 712 574 411 337 118 32458 888 297 1135 --
NM_012309chr11104952 3543 1761 1637 1132 1123 949 451 393 343 --14168 34683 4139 413
NM_012311chr102642 599 ------
NM_012316chr1114486 4182 4102 3666 3556 2050 1990 1908 1360 996 409 24151 807 162 14547
NM_012325chr20----11106 --
NM_012326chr22773 75 ------
NM_012330chr101166 ------
NM_012333chr131444 1389 1183 ------
NM_012337chr1131 ------
NM_012343chr531132 291 105 ------
NM_012347chr662800 2779 2017 1067 592 320 ------
NM_012382chr543674 3252 2745 1485 --24209 2791 --
NM_012398chr1952129 1928 644 253 130 1524 31906 1893 588 12613
NM_012399chr2231505 1374 483 --11798 11410
NM_012402chr1141291 925 364 99 ------
NM_012406chr1221200 307 ------
NM_012407chr221137 ------
NM_012419chr61266 ------
NM_012421chr1----1174 --
NM_012423chr192110 42 ------
NM_012425chr102245 27 ------
NM_012428chr152347 284 ------
NM_012430chr32287 103 --1172 --
NM_012434chr62643 68 --1407 --
NM_012446chr51141 --145 --
NM_012448chr1772143 2083 1880 943 908 843 684 --22550 539 12254
NM_012461chr144666 636 268 48 178 ----
NM_012465chr1062304 2272 1337 731 338 135 ------
NM_012470chr7--1122 1167 --
NM_012471chrX11436 159 ----
NM_012475chr1----132 --
NM_012477chr22174 48 ------
NM_012479chr732586 686 389 1339 ----
NM_012482chr12163 112 ------
NM_013227chr153663 543 81 ------
NM_013229chr1252472 2379 2369 2055 93 ------
NM_013233chr221277 967 --11148 --
NM_013252chr72668 475 12659 ----
NM_013255chr797430 6286 6041 6024 5541 1956 1892 890 180 --16335 --
NM_013261chr42937 625 13139 23658 1172 --
NM_013262chr641377 955 945 219 ------
NM_013279chr11102010 782 774 661 498 449 337 227 120 104 21732 1476 21599 731 --
NM_013281chr2021499 1298 ------
NM_013286chr3103672 3581 3542 2892 2577 2477 1523 1110 341 139 --22885 930 1724
NM_013305chr185762 363 290 188 132 ------
NM_013316chr71794 ------
NM_013325chr23513 484 351 ------
NM_013326chr18165 ------
NM_013336chr341869 1668 1633 731 ----161
NM_013341chr241180 1173 1110 424 --21102 1075 --
NM_013346chrX124 ------
NM_013353chr1164 --187 --
NM_013368chr191441 ------
NM_013372chr1543383 3082 441 341 ------
NM_013373chr222826 707 ----1820
NM_013374chr332561 2307 709 --12113 --
NM_013390chr941451 540 476 460 11517 ----
NM_013396chr2121507 60 ------
NM_013401chr115844 689 672 97 29 --1301 --
NM_013403chr192178 145 --1560 --
NM_013409chr5134 ------
NM_013411chr152316 2282 2022 1783 697 --1996 --
NM_013417chr9----133 --
NM_013423chrX2202 45 ------
NM_013427chrX2202 45 ------
NM_013433chr1961488 1459 532 381 180 139 ------
NM_013434chr211996 11578 21767 246 --
NM_013434chr211996 11578 21767 246 --
NM_013438chr931583 1287 535 ------
NM_013446chr731424 995 360 11032 1420 --
NM_013449chr1252365 819 769 500 134 ------
NM_013451chr101156 ------
NM_013943chr111306 12907 12607 1301
NM_013951chr271614 1558 1532 693 545 474 196 --11715 11759
NM_013960chr82568 147 ------
NM_013989chr1494979 4336 4157 4093 3556 1262 459 223 88 23591 555 ----
NM_013995chrX1103 --1880 --
NM_014000chr1031749 608 332 11613 11282 --
NM_014007chr941217 513 195 143 ------
NM_014011chr21479 ------
NM_014021chr121201 373 --32774 2327 1109 --
NM_014023chr1062211 2127 1179 1050 364 221 ----12234
NM_014030chr1741154 477 389 297 1111 21119 351 --
NM_014034chr611126 11231 ----
NM_014046chr61582 ------
NM_014066chr83306 96 90 ------
NM_014079chr36748 328 265 257 249 241 ------
NM_014106chr1532328 2150 411 ------
NM_014109chr81449 --11055 --
NM_014112chr895319 4031 3674 3464 1857 771 709 639 513 11167 ----
NM_014117chr16----22507 980 --
NM_014141chr734964 4570 1823 14627 24247 584 1364
NM_014153chr16--1182 ----
NM_014154chr331358 591 270 ------
NM_014155chr1196157 5756 5714 5646 5501 4867 4594 2207 422 ----14774
NM_014157chr1674025 3342 2931 2618 1255 836 827 13108 11456 --
NM_014169chr141235 --1198 --
NM_014181chr232766 2434 1031 1143 --12153
NM_014182chr122500 181 ------
NM_014191chr123832 757 739 ------
NM_014217chr121204 450 --11211 --
NM_014231chr12101810 1802 1793 1760 1597 1470 97 69 58 51 --11893 --
NM_014232chr1731376 397 272 1450 ----
NM_014232chr1731376 397 272 1450 ----
NM_014233chr1761790 1604 621 522 358 218 1494 1208 --
NM_014234chr6----1167 --
NM_014243chr431909 764 270 ------
NM_014246chr228859 788 737 708 696 411 248 71 ----11573
NM_014250chr2251924 1495 1465 668 480 11360 --1814
NM_014253chrX1535 --1444 --
NM_014264chr41102 ------
NM_014267chr112110 38 ------
NM_014271chrX2578 178 ------
NM_014275chr53780 162 36 1851 ----
NM_014286chr9143567 3467 2972 2687 2678 2549 2531 1282 1227 452 316 151 129 68 1719 2261 99 13459
NM_014289chrX31120 582 221 11424 11255 --
NM_014292chr2291602 1564 1401 1299 1287 602 321 257 37 1372 21609 88 --
NM_014294chr8--1215 11381 --
NM_014299chr1981510 1478 1409 1382 637 282 189 130 --31757 471 263 11580
NM_014309chr22125411 5082 4472 4368 4330 4031 3989 3553 1372 1357 1284 1218 2871 701 15063 --
NM_014317chr101217 ------
NM_014325chr1211448 1692 ----
NM_014330chr19175 ------
NM_014331chr425473 4846 17226 --1878
NM_014333chr1122065 39 ----12079
NM_014351chr222980 60 ------
NM_014368chr951860 1725 1472 1342 350 --2287 209 --
NM_014372chr11211 ------
NM_014376chr561976 1952 1619 596 376 168 ------
NM_014381chr1472972 2240 1267 640 421 138 90 1930 12584 --
NM_014393chr821647 1552 1335 ----
NM_014397chr961419 1241 574 398 216 139 ------
NM_014408chr1174 ------
NM_014417chr193755 380 121 ------
NM_014418chr142652 285 31738 1335 432 21865 1452 11970
NM_014423chr531261 1181 173 --13755 --
NM_014447chr431583 1320 520 ------
NM_014452chr63891 309 236 21195 974 ----
NM_014454chr61848 ------
NM_014455chr13429 413 405 ------
NM_014470chr12--1711 ----
NM_014472chr10182 ----157
NM_014480chr194591 324 268 156 ----1186
NM_014482chr2--1109 ----
NM_014488chr11194 ------
NM_014491chr72975 127 --2890 152 --
NM_014494chr1642064 691 492 281 ------
NM_014496chrX--1243 ----
NM_014507chr2241078 450 344 289 11206 ----
NM_014515chr12----11074 --
NM_014517chr32306 232 ------
NM_014554chr1251605 690 661 129 46 --193 --
NM_014569chr741308 1041 1035 140 11338 11506 11490
NM_014572chr1311119 165 ----
NM_014573chr1711833 ------
NM_014575chr3----1429 --
NM_014577chr221102 ------
NM_014584chr1431501 1409 1085 ------
NM_014591chr1021045 449 ----1225
NM_014592chr52657 73 ----128
NM_014603chr1781618 1540 1483 1332 1276 632 225 89 --21247 192 --
NM_014604chr173782 571 145 ----1619
NM_014612chr91296 11110 ----
NM_014614chr23517 463 76 ----1110
NM_014615chr1662310 779 679 601 556 260 --12712 --
NM_014620chr121190 ------
NM_014630chr15133899 3876 3819 3274 2504 1079 1039 801 568 511 485 392 201 1369 1416 --
NM_014632chr11159 ------
NM_014634chr22103451 3404 3287 3281 2904 2527 637 625 502 23 --22740 2550 --
NM_014636chr9113467 3280 1676 1237 883 868 610 586 471 258 74 13392 34232 3133 778 --
NM_014640chr21276 ------
NM_014646chr18102890 2486 2337 2093 2085 2055 2032 1105 613 146 --22829 93 2690 675
NM_014655chr171852 1487 814 701 578 439 106 --21660 289 --
NM_014659chr152751 730 --1398 1229
NM_014661chr10123110 2980 2752 2735 1250 1122 1097 957 624 500 425 73 --22619 821 --
NM_014665chr8113555 3525 3314 2907 2755 2330 2308 2292 998 695 659 23489 87 32525 2494 2284 --
NM_014666chr51264 ------
NM_014667chr322458 930 1193 11674 --
NM_014670chr22466 295 ------
NM_014676chr161536 1409 1351 1051 437 168 ------
NM_014677chr81371 1185 2496 309 --
NM_014682chr81790 ------
NM_014683chr1711548 ------
NM_014686chr195810 344 329 204 168 1240 ----
NM_014690chr762608 1947 1168 960 811 25 --1131 --
NM_014693chr31642 1756 152 --
NM_014699chr161314 ------
NM_014700chr1661486 1283 1232 427 383 297 --1615 --
NM_014701chr1542246 2198 1209 989 ----1587
NM_014707chr732271 1706 531 ------
NM_014709chr21106 ------
NM_014710chrX2888 337 ------
NM_014712chr162440 75 ------
NM_014717chr19255 38 ------
NM_014720chr1041778 1618 1170 402 ----1447
NM_014723chr20122419 2408 2384 2372 2322 2311 2295 2272 2077 1004 470 314 12669 1880 --
NM_014726chr1751387 1166 177 100 37 --21094 861 --
NM_014729chr831960 771 320 ------
NM_014730chr12144120 4098 3836 3597 3239 2054 1955 1733 1691 1402 1393 1128 565 209 1688 35028 234 203 1169
NM_014730chr12144120 4098 3836 3597 3239 2054 1955 1733 1691 1402 1393 1128 565 209 1688 35028 234 203 1169
NM_014731chr2071234 1116 700 495 392 340 160 21546 1319 11532 11326
NM_014733chr512178 --11460 --
NM_014735chrX52107 1801 1413 762 321 ----11976
NM_014738chr1781081 1016 702 421 280 211 200 164 11026 ----
NM_014739chr674085 3429 3064 1214 689 375 309 11512 12827 --
NM_014746chr264054 3193 2823 1092 614 50 12733 11698 24020 3825
NM_014747chr1225631 5140 4917 4210 4114 3951 3857 3626 3522 2103 2048 1474 1367 1254 1194 922 910 839 649 586 547 62 15055 33706 1521 900 --
NM_014751chr81120 ------
NM_014752chr1121326 187 --121 --
NM_014755chr232873 1666 1199 21221 167 13650 --
NM_014756chr111385 ----157
NM_014757chr552296 1880 1862 557 145 12326 --11666
NM_014758chr1171786 1643 1584 610 384 346 81 12043 1449 --
NM_014759chr891635 1543 1492 1089 1036 650 344 166 125 11555 ----
NM_014761chr1631138 809 146 ------
NM_014766chr783798 2932 2331 885 754 584 331 301 11305 1790 33354 2912 1373
NM_014767chr10163546 2709 2481 2368 2332 1407 1257 990 917 662 582 513 485 417 405 47 13088 23094 700 13190
NM_014770chr1231142 871 155 --11167 --
NM_014772chr1892900 2866 1334 1314 1203 263 257 89 44 --21193 604 --
NM_014774chr11863 11226 3265 92 84 --
NM_014779chr31304 --1343 --
NM_014784chr11711 3964 337 289 ----
NM_014790chr51399 ------
NM_014791chr91286 ------
NM_014797chr663122 2443 511 150 84 51 ------
NM_014800chr74741 321 291 146 --1306 --
NM_014803chr1042881 831 412 373 ------
NM_014807chr113656 324 240 --2713 100 --
NM_014810chr172554 1408 1382 1358 602 173 43 --13411 --
NM_014824chr11------1266
NM_014826chr173947 3916 3802 1272 441 373 30 24220 750 --13451
NM_014827chr111315 11673 11471 --
NM_014828chr1432337 2063 1623 ------
NM_014830chr12123152 2862 2445 1481 1403 1381 1313 1203 903 789 562 191 --22928 1001 1514
NM_014832chr1321615 1510 ------
NM_014838chr22102769 2546 2529 2424 2261 2234 1937 1789 944 127 ------
NM_014839chr111819 ------
NM_014840chr1262737 2608 2493 646 218 146 --12362 --
NM_014841chr621374 1174 ------
NM_014847chr11365 1505 ----
NM_014849chr191258 1091 967 816 472 368 342 299 241 --1521 198
NM_014850chr394785 4599 3290 1935 1669 1456 1258 811 689 --54393 1864 1856 1687 1443 --
NM_014860chr232471 874 784 --1614 --
NM_014864chr1113687 3652 3558 3258 2730 2713 1532 1502 876 365 213 --31494 1437 1161 --
NM_014868chr122664 115 ------
NM_014869chr351313 914 368 330 50 --1983 --
NM_014872chr942260 2034 1873 508 --11925 --
NM_014876chr2221794 81 11477 144 --
NM_014877chr1746774 5641 5561 1699 ----23090 2856
NM_014883chr46547 498 460 96 84 71 --42279 1927 1586 114 1583
NM_014884chr19147 ------
NM_014891chr751111 588 536 500 470 --1282 --
NM_014893chrY22165 733 ------
NM_014897chr1721978 922 --1538 --
NM_014898chr1931878 1665 164 ------
NM_014899chr512194 13029 12494 1773
NM_014901chr561991 1896 1418 691 416 43 ------
NM_014903chr122780 108 --1520 --
NM_014906chr1711448 --130 --
NM_014912chr1043137 1308 562 551 ------
NM_014917chr11831 ------
NM_014920chr61510 1822 11485 13001
NM_014921chr1972837 2309 2281 859 771 223 136 --22491 1227 --
NM_014923chr131266 ------
NM_014926chr32236 173 ------
NM_014931chr192633 39 197 ----
NM_014933chr41371 ----187
NM_014935chr1133492 3397 3291 3270 3025 2726 2447 1430 1119 873 318 217 71 11290 13009 --
NM_014943chr821066 215 ----1272
NM_014944chr131129 577 221 11390 ----
NM_014945chr541350 687 514 414 --11849 --
NM_014947chr132957 2556 723 ----12485
NM_014949chr13670 418 317 ------
NM_014956chr1161041 930 360 315 218 75 2788 672 1281 --
NM_014961chr441382 351 315 87 ------
NM_014969chr11252 ------
NM_014974chr1041783 1669 603 365 1232 11475 --
NM_014978chr1041365 1224 695 490 21315 644 ----
NM_014982chr1495118 4768 3910 3635 3580 3274 1018 912 159 ------
NM_014990chr14--1247 ----
NM_014991chr443021 2144 2093 913 ------
NM_014992chr14----144 --
NM_014994chr15102160 2149 2082 1986 1950 1460 790 752 555 321 1448 1133 1731
NM_014997chr732621 2179 1124 --12252 --
NM_014999chr12--155 ----
NM_015000chr1212320 ------
NM_015002chr1222177 193 11431 187 --
NM_015008chr352710 1287 1012 650 264 --23138 675 --
NM_015011chr1321124 74 ------
NM_015012chr111356 ------
NM_015015chr1951838 1641 742 657 86 --21749 261 --
NM_015020chr1631014 583 404 ------
NM_015023chr1121798 1777 1768 1742 1610 1295 687 635 629 556 362 212 --11176 --
NM_015024chr831288 942 907 --1982 --
NM_015025chr222545 1771 ----11809
NM_015026chr1244596 3009 584 469 1639 1863 --
NM_015032chr132643 88 ------
NM_015033chr94854 798 167 161 2594 318 2347 33 2529 240
NM_015035chr20136535 6429 6182 6075 4949 4716 4672 4628 4223 2446 2236 1772 1710 --1970 --
NM_015039chr153535 3343 449 436 256 --13413 --
NM_015042chr1563925 3687 3267 1341 846 815 12684 43969 3670 3320 349 --
NM_015044chr16113266 3256 3201 3073 2989 2854 1272 828 769 410 103 --1877 --
NM_015045chr1021423 81 ------
NM_015052chr71168 ------
NM_015054chr12134 ------
NM_015057chr13--142 ----
NM_015064chr1273143 3077 2893 2609 1431 1015 713 13102 32758 1035 361 12528
NM_015068chr733312 705 300 134 13870 --
NM_015070chr1321146 444 11487 1522 --
NM_015074chr154912 3225 1515 910 31 122 34596 1986 148 --
NM_015075chrX122004 1957 1852 1725 1593 1443 703 640 604 316 285 137 --21994 351 --
NM_015076chr653522 3045 1485 358 162 13068 ----
NM_015080chr112265 231 ------
NM_015082chr572392 2143 762 655 462 314 45 22154 343 ----
NM_015090chr1135729 5084 4740 4595 4553 4474 4438 3982 1395 1237 767 713 309 55694 5419 2290 1551 1488 12465 --
NM_015091chr141268 ------
NM_015092chr1634132 3666 732 13278 ----
NM_015093chr621604 722 --11170 11683
NM_015100chr121866 1775 ------
NM_015101chr182895 2886 2797 2615 2519 1883 1859 869 ------
NM_015102chr1296 77 ------
NM_015106chr31152 ------
NM_015107chrX71503 917 850 696 414 206 45 --11806 --
NM_015113chr1732050 1980 603 2383 253 2276 105 --
NM_015115chr453123 2908 2866 971 155 22531 240 ----
NM_015116chr13174 141 --11348
NM_015120chr2126 ------
NM_015125chr193511 466 104 ------
NM_015129chrX139 ------
NM_015130chr4----1539 --
NM_015132chr7--2768 540 11572 --
NM_015133chr1651441 1120 539 484 222 21192 449 --1272
NM_015138chr1542815 2091 501 235 ------
NM_015143chr41248 1148 ----
NM_015144chr1663376 2641 1279 1043 846 310 1929 --23658 1238
NM_015147chr241154 1067 280 78 ------
NM_015150chr33762 324 272 --1149 1253
NM_015155chr1062964 2479 2387 2325 2301 822 ------
NM_015156chr1452867 855 443 319 140 1725 ----
NM_015157chr1181193 1107 1072 1001 984 736 258 240 --21127 771 --
NM_015158chr92868 799 ------
NM_015161chr162310 99 1123 ----
NM_015172chr11507 ------
NM_015176chr11705 ------
NM_015178chr8112591 2490 2126 1939 1694 941 826 289 260 176 133 151 --1524
NM_015185chrX63019 2707 2659 2616 2311 597 1640 ----
NM_015191chr1152504 803 241 97 68 1636 1263 --
NM_015192chr2022886 350 ------
NM_015194chr1761826 1357 750 443 346 46 11594 ----
NM_015199chr342743 2231 2151 1146 --1616 --
NM_015200chr4----1176 --
NM_015205chr13124743 4468 4428 4135 4080 1923 1459 1331 1273 836 561 284 33426 1565 1213 24214 1971 --
NM_015206chr1533368 3026 548 1723 12608 13740
NM_015208chr1842749 2734 1117 911 13781 13358 --
NM_015213chr112260 52 ------
NM_015215chr122395 865 13141 ----
NM_015221chr1061499 1446 1411 1376 101 26 ------
NM_015225chr942900 2592 965 231 --22585 726 --
NM_015231chr113936 906 21 ------
NM_015233chr1362627 2239 1757 135 91 41 ------
NM_015236chr41112 ------
NM_015242chr111444 --2495 48 --
NM_015247chr16115330 5027 4823 4749 4571 3584 1612 1545 819 707 43 --11746 --
NM_015250chr92584 34 11914 ----
NM_015251chr1622041 1975 ------
NM_015254chr892931 2806 2440 2055 1953 1284 569 68 53 12502 ----
NM_015265chr222210 2051 2586 313 ----
NM_015267chr121596 ------
NM_015271chr453860 3008 1372 1304 559 --2957 573 --
NM_015272chr1611732 11645 ----
NM_015277chr18--11229 --2285 130
NM_015278chr632956 529 370 12217 --1992
NM_015284chr181882 1787 1533 517 474 362 259 185 21613 760 62024 1922 820 564 398 87 --
NM_015288chr5103304 3278 2594 2494 2474 2350 1150 1090 946 27 --13859 --
NM_015292chr123291 112 43 1521 1120 --
NM_015293chr6----2126 105 --
NM_015299chr14103696 3250 3242 2892 2834 2784 1578 709 454 213 13738 53427 2719 1318 917 60 1194
NM_015305chr1441445 741 463 237 1395 1416 --
NM_015308chr111834 ------
NM_015310chr8107819 7634 7107 7092 6895 6467 3041 2788 1261 775 --36586 6222 3187 --
NM_015313chr1163827 3470 1582 1282 1261 1177 --23539 579 --
NM_015315chr5113434 3423 2990 2922 2749 2269 2201 1181 570 435 347 11318 12778 --
NM_015316chr1431310 329 164 11176 ----
NM_015317chr262746 2385 1089 991 445 208 ------
NM_015319chr121152 --1312 164
NM_015321chr19184759 4721 4641 4085 4077 3730 3650 3467 3075 3040 1779 1748 1657 1409 1297 700 604 435 33760 3065 1854 33861 3599 3391 1427
NM_015326chr182524 2370 2278 2066 1186 653 303 193 --22479 164 --
NM_015327chr151181 974 537 367 52 --1256 --
NM_015328chr782693 2614 2460 2026 2020 504 416 49 ------
NM_015329chr1972590 2494 1809 921 272 151 122 ------
NM_015335chr1222220 119 --1385 --
NM_015336chr121730 --12649 --
NM_015338chr2051429 1374 1274 651 122 --31844 238 150 --
NM_015343chr17----156 --
NM_015344chr81588 --11764 --
NM_015345chr682425 1993 1002 726 547 366 287 108 12690 22220 645 --
NM_015346chr1471803 1628 1315 1307 623 148 67 ----11697
NM_015347chr1232932 1996 1958 22109 1983 ----
NM_015349chr652760 2322 2022 603 347 ----12160
NM_015355chr17----11531 --
NM_015361chr23943 313 43 ------
NM_015365chrX64112 3485 3478 3165 1088 318 ------
NM_015374chr2271445 1032 1013 964 572 531 431 11339 1512 --
NM_015378chr152432 2338 2163 930 621 --22321 1945 170
NM_015385chr1063038 3012 2452 740 349 260 ------
NM_015388chr6174 --128 --
NM_015393chr483612 3500 3242 2969 2396 434 238 107 ------
NM_015397chr931197 726 155 1384 ----
NM_015401chr126811 683 433 272 240 35 --1779 --
NM_015416chr121791 --1721 1684
NM_015417chr201139 2453 112 ----
NM_015443chr173539 462 379 ------
NM_015444chr32441 254 --1200 --
NM_015455chr543579 3119 447 25 11514 23891 643 13292
NM_015458chr8104458 1689 1521 1456 1105 1010 885 635 93 68 ------
NM_015460chr311793 ------
NM_015461chr182540 262 ------
NM_015466chr31216 ------
NM_015470chr251011 1001 220 161 55 ------
NM_015481chr1241119 1072 809 763 --1311 --
NM_015483chr72407 280 ------
NM_015488chr281504 1471 1293 1171 1127 520 403 378 21339 1235 11268 --
NM_015493chr1942030 1999 1582 894 --1135 --
NM_015497chr1521113 971 ------
NM_015508chr3----11241 --
NM_015509chr1231426 1324 397 ------
NM_015514chr142578 87 ------
NM_015516chr1131396 1033 295 --21049 445 --
NM_015520chr311888 ------
NM_015526chr1951474 1263 1205 1092 65 --3482 400 131 1521
NM_015530chr2------1604
NM_015531chr111126 ------
NM_015534chr11152 --2802 30 1382
NM_015535chr263347 3065 2807 995 664 157 13566 11201 --
NM_015542chr10----161 --
NM_015553chr683581 3536 3392 1711 1558 1263 313 104 15000 ----
NM_015554chr1542779 2764 1989 370 --1149 --
NM_015557chr1153467 2828 2777 2626 2457 1340 1170 1088 984 958 897 765 697 628 445 13042 12756 22853 510
NM_015564chr553338 2575 2316 984 392 --13602 --
NM_015565chr2132229 1434 442 ----11940
NM_015568chr2083679 3200 1664 1443 672 541 287 69 13000 63990 3874 3663 1466 1293 601 1142
NM_015569chr124566 252 --12950 --
NM_015570chr721759 656 --11829 --
NM_015571chr632305 2099 522 ------
NM_015575chr273130 3035 1241 852 746 577 146 1983 1521 --
NM_015576chr352651 2137 1157 610 76 11960 ----
NM_015577chr521712 411 ------
NM_015578chr1931481 752 41 --11775 --
NM_015604chr143685 535 212 ------
NM_015608chr10--141 ----
NM_015609chr132676 2091 788 12429 11050 --
NM_015626chr1711156 ------
NM_015635chr932101 1898 1426 ------
NM_015645chr113353 305 293 130 ----
NM_015646chr1231192 215 23 ------
NM_015652chr103456 178 94 ------
NM_015686chrX102417 2248 1989 1759 1559 488 397 360 354 321 11842 1822 --
NM_015691chrX32615 1908 1860 --22845 2330 --
NM_015695chr61767 --11674 1843
NM_015696chr11215 ------
NM_015713chr822694 790 1281 ----
NM_015716chr172605 196 --143 1637
NM_015726chr141712 538 196 77 11544 ----
NM_015831chr74930 890 768 590 ------
NM_015844chr181208 --1901 --
NM_015845chr181212 --1679 --
NM_015846chr181208 --1901 --
NM_015847chr181208 --1901 --
NM_015855chr111775 ----1586
NM_015872chr12369 105 --2728 127 1143
NM_015878chr821846 1674 ------
NM_015879chr1888372 8053 7565 5654 5206 2643 1184 338 37161 6459 3298 --3707 354 67
NM_015885chr11--1124 ----
NM_015886chr845200 4342 3665 671 1788 11360 --
NM_015888chr122065 1040 --12192 --
NM_015898chr1951683 880 760 376 235 12018 12479 --
NM_015902chr81901 ------
NM_015904chr24710 664 318 281 ------
NM_015906chr144565 4469 3272 1498 --14162 --
NM_015912chr841963 1683 1007 741 --11737 --
NM_015913chr11695 1138 ----
NM_015955chr22155 67 ------
NM_015963chr2----122 --
NM_015975chrX41697 1649 276 237 ------
NM_015980chr511171 11451 ----
NM_015981chr532460 2181 606 12142 ----
NM_015982chr172290 171 ------
NM_016006chr31175 ------
NM_016016chr17------1315
NM_016018chr822416 1139 1906 ----
NM_016021chr652994 2312 2256 665 311 23010 1128 11892 --
NM_016022chr12441 430 1292 ----
NM_016026chr141123 ------
NM_016032chrX51253 1103 998 959 244 --1317 --
NM_016037chr111111 ------
NM_016041chr171303 ------
NM_016057chr124993 966 491 316 2396 89 ----
NM_016059chr6125 ------
NM_016072chr1232256 1996 718 --12195 --
NM_016073chr153758 186 99 1241 ----
NM_016076chr152322 555 261 204 108 --1877 --
NM_016083chr643341 3153 2907 742 ------
NM_016089chr3101798 1426 1368 823 655 487 403 319 235 67 11555 11592 1283
NM_016090chr112796 45 ------
NM_016097chr182778 719 ------
NM_016100chr20179 ------
NM_016132chr1523245 2719 --1753 --
NM_016147chr115943 409 268 188 36 ------
NM_016156chr1142398 2248 716 57 --11869 --
NM_016162chr122669 212 --1223 --
NM_016172chr92141 106 ------
NM_016173chr3124268 4244 3818 3788 3646 3398 3277 3052 1727 1641 1618 827 23450 1604 2875 488 1422
NM_016205chr42186 22 ------
NM_016206chr397710 7194 7083 6452 3373 2902 1106 384 222 26851 507 12454 11394
NM_016211chr41371 ----187
NM_016220chr72902 79 1677 --1345
NM_016223chr113132 97 83 ------
NM_016233chr13926 865 146 ------
NM_016235chr1611411 --11160 --
NM_016250chr141776 1511 --137
NM_016252chr21638 1123 ----
NM_016257chr1103168 3061 2855 1019 981 574 498 478 463 197 --32542 138 125 --
NM_016258chr11590 ------
NM_016260chr256697 5216 1453 1411 743 15293 11972 --
NM_016271chr181736 ------
NM_016272chr2281760 1111 960 913 741 534 525 161 --22823 1951 --
NM_016275chr352706 2536 1925 1814 1696 ------
NM_016281chr121442 1104 ----
NM_016284chr163933 667 86 --1106 --
NM_016289chr222334 1974 ------
NM_016297chr253048 3033 999 654 532 ------
NM_016308chr132000 1613 288 ------
NM_016312chr121144 ------
NM_016315chr2----11451 11311
NM_016316chr2126 ------
NM_016319chr124657 567 317 247 --177 167
NM_016322chr943135 2571 376 251 12592 ----
NM_016329chr32122 87 ------
NM_016338chr521029 225 ------
NM_016339chr1771725 1644 1518 1397 1351 743 267 --21620 380 --
NM_016340chr51483 --11171 11087
NM_016357chr122967 58 ------
NM_016374chr12639 248 ------
NM_016374chr12639 248 ------
NM_016376chr1744333 3995 1542 1158 24270 2951 12903 1742
NM_016396chr1511188 21146 1037 --12858
NM_016399chr12--1577 --2728 645
NM_016403chr111607 ------
NM_016418chr22103759 3450 1322 1168 1133 1116 954 440 58 45 13247 13234 --
NM_016422chr1152772 2573 2546 2273 262 ----1917
NM_016424chr1721937 176 ------
NM_016427chr182153 123 ------
NM_016441chr21910 ----11670
NM_016448chr131897 1718 1500 ------
NM_016451chr11--1210 ----
NM_016453chr33484 452 65 --1670 --
NM_016463chr5126 ------
NM_016470chr201554 ------
NM_016472chr141451 ------
NM_016480chr5----184 --
NM_016484chrX1552 --122 --
NM_016486chr11160 ------
NM_016488chr1221923 287 ------
NM_016496chr191459 1327 ----
NM_016506chr112680 271 --1127 --
NM_016507chr173846 776 680 ----12067
NM_016513chr61510 1822 11485 13001
NM_016516chr21671 --2646 636 --
NM_016522chr11----11573 --
NM_016530chr1542968 1073 310 41 ----11435
NM_016531chr452972 2656 584 392 48 ----23950 3716
NM_016559chr3----1537 --
NM_016569chr1211002 --1100 --
NM_016578chr111550 ----146
NM_016588chr62858 343 ------
NM_016596chr126811 683 433 272 240 35 --1779 --
NM_016598chr331250 409 225 ------
NM_016603chr531642 219 172 ------
NM_016605chr5132577 2534 2192 2013 1946 1804 977 948 898 843 599 464 244 11734 ----
NM_016619chr4121 ------
NM_016621chr11144480 4332 4287 4253 4195 4140 4102 3494 3248 1770 1626 1558 1180 801 24369 2826 11836 --
NM_016626chr181429 ------
NM_016628chr101319 ------
NM_016645chr151325 ------
NM_016653chr221090 1074 ------
NM_016654chr152871 142 11122 ----
NM_016655chr15------1116
NM_016656chrX1303 ------
NM_016823chr172966 821 ------
NM_016824chr102295 230 1237 ----
NM_016830chr124172 164 155 122 ------
NM_016834chr1763631 3515 3044 2577 404 88 --11504 --
NM_016835chr1763631 3515 3044 2577 404 88 --11504 --
NM_016841chr1763631 3515 3044 2577 404 88 --11504 --
NM_016848chr9----1107 --
NM_016929chr674497 3970 3388 3257 1114 977 688 33365 3264 1498 ----
NM_016936chr1681791 1524 1488 596 259 228 179 85 11390 1795 --
NM_016938chr113427 379 98 ------
NM_016946chr182564 1383 1261 1103 1025 615 564 183 11354 11367 --
NM_016950chr4------1535
NM_016952chr11104060 4003 3664 3609 3318 3179 2866 2844 822 164 --24038 1171 --
NM_017409chr12--1232 --1276
NM_017413chrX72021 1808 963 634 566 350 137 12127 1852 1100
NM_017415chr573946 3568 3191 1163 816 634 125 --24080 3130 --
NM_017420chr1443205 2958 1512 193 ------
NM_017423chr441591 793 491 278 ------
NM_017426chr42645 181 ------
NM_017432chr191452 ------
NM_017447chr2123946 33 ----13639
NM_017450chr1751293 996 924 235 48 --182 --
NM_017455chr152347 284 ------
NM_017456chr1741761 1424 250 95 --1228 1354
NM_017459chr16278 128 56 48 30 24 ------
NM_017488chr21333 --11431 11460
NM_017514chrX7857 682 613 184 97 48 37 1722 ----
NM_017525chr111222 ----1187
NM_017546chr21876 ------
NM_017548chr331757 435 129 ----1320
NM_017551chr1032107 1773 1749 12671 ----
NM_017553chr1541219 945 913 48 --1395 --
NM_017563chr396223 5403 5148 4142 2436 894 355 263 211 15467 ----
NM_017575chr1761391 1385 1178 1035 579 339 31143 652 292 11587 --
NM_017582chr121742 124 ----11352
NM_017586chr9122034 1964 1914 1846 1720 1653 1366 742 607 562 507 244 11487 2412 130 --
NM_017590chr2272688 1818 406 247 227 136 29 2666 107 22384 601 1675
NM_017593chr42368 320 ------
NM_017594chr91572 ----1834
NM_017596chr1314546 4471 4371 4248 4215 4201 4152 3773 3659 3503 3490 3469 3351 3345 3296 3245 3212 3145 2862 2851 1852 1752 1650 1526 1488 1348 1306 921 724 704 508 13510 --33950 1042 254
NM_017602chrX3876 112 51 ------
NM_017610chr1541665 779 369 26 --11978 --
NM_017617chr951359 1178 1126 454 92 --143 --
NM_017622chr174520 513 196 74 1616 1500 --
NM_017623chr25613 560 193 187 122 1149 2292 228 --
NM_017626chr1051420 1356 415 190 161 ------
NM_017628chr444621 3846 1574 215 --11006 24061 3808
NM_017629chr1----11761 --
NM_017632chr41295 ------
NM_017633chr633684 2629 833 ----194
NM_017634chr811916 ------
NM_017637chr9139025 8747 8314 7870 6511 6371 6057 3156 3075 2596 1316 654 538 --26033 2868 133
NM_017643chr1743122 2127 1235 972 --12308 --
NM_017644chr334948 3431 171 1749 ----
NM_017657chr21181 ------
NM_017658chr1433130 2880 641 --1355 --
NM_017661chr151335 ------
NM_017664chr13136 ------
NM_017666chrX41560 560 231 138 2576 278 --1126
NM_017668chr163697 133 45 1733 1807 --
NM_017670chr11--2844 768 --2646 622
NM_017672chr152414 307 ------
NM_017680chr91980 ------
NM_017709chr174167 3461 3016 2924 877 309 112 2406 54 ----
NM_017715chr72565 494 ------
NM_017719chr332019 1889 1631 ------
NM_017728chr1772959 2117 1987 1196 1141 761 637 22584 188 1206 1782
NM_017730chr31118 ------
NM_017736chr1652576 2051 2037 182 150 --1741 --
NM_017737chr12520 357 11633 ----
NM_017739chr1----3583 522 59 --
NM_017744chr162453 2207 1674 926 557 242 --1777 --
NM_017747chr5127 ------
NM_017753chr91966 ------
NM_017754chr694884 4501 3216 3192 3173 926 851 274 265 --23435 956 13383
NM_017763chr173459 70 53 ------
NM_017772chr611134 134 11184 --
NM_017778chr831290 1229 1217 ----11277
NM_017780chr83809 798 52 ------
NM_017784chr321016 35 ------
NM_017797chr195987 961 714 231 25 ------
NM_017798chr2031256 1216 1066 ------
NM_017799chr1431712 1699 1525 11684 ----
NM_017801chr362243 997 938 558 72 60 ------
NM_017813chr821799 1340 --24221 1524 --
NM_017824chr1062019 1839 1788 1061 988 579 ------
NM_017845chr4124 ------
NM_017848chrX23518 349 ----11335
NM_017851chr1561109 511 383 368 296 228 1973 11084 --
NM_017857chr112662 194 ------
NM_017860chr1153 --1365 --
NM_017866chr8------1780
NM_017893chr1041307 953 466 412 1945 ----
NM_017902chr10125326 4830 4718 4660 3768 1839 1662 1534 1159 776 551 250 21670 405 24686 632 --
NM_017907chr112202 24 ------
NM_017911chr2261470 1378 1322 1287 937 310 1149 140 --
NM_017919chr9115523 5365 4789 4677 4419 3929 3921 2333 1679 431 198 --35169 4840 2264 --
NM_017921chr17122340 2228 2102 2034 2014 1824 1709 1624 1589 573 523 105 --2360 45 --
NM_017923chr42818 682 ----149
NM_017944chr1143054 2324 2077 918 ----12678
NM_017955chr144856 247 159 95 --11106 --
NM_017987chr102848 477 11683 183 --
NM_018014chr23286 143 133 ------
NM_018015chrX2990 113 ------
NM_018017chr1042482 2475 1084 558 ------
NM_018027chr1032769 2649 834 21319 213 1846 --
NM_018032chr162659 289 --143 --
NM_018036chr1443962 341 322 57 11642 13283 --
NM_018045chr192733 2708 2488 2407 2372 1897 884 789 118 22743 355 32643 2055 696 --
NM_018048chr1221833 1391 ------
NM_018053chr13734 714 226 1687 ----
NM_018054chr161142 --122 --
NM_018056chr11174 ------
NM_018061chr11650 --21715 103 --
NM_018063chr102399 161 ------
NM_018064chr61308 ------
NM_018070chr11501 --1526 --
NM_018071chr142192 84 2852 230 2567 318 1616
NM_018084chr252858 1307 532 150 73 ------
NM_018085chr1167454 7250 7042 7035 6994 6966 6951 6724 5515 3062 2525 2511 951 545 527 119 12460 1283 2857 62
NM_018086chr211636 ------
NM_018092chr1631320 1047 352 1633 ----
NM_018095chr112680 271 --1127 --
NM_018096chr177869 768 744 720 323 143 57 ------
NM_018110chr16--11241 21206 398 --
NM_018111chr19--131 ----
NM_018115chr41575 1748 1768 --
NM_018121chr1073172 3096 3071 2554 2066 688 52 ------
NM_018125chr12451 62 ------
NM_018131chr10----1738 --
NM_018133chr3--1430 ----
NM_018154chr195750 739 379 162 62 ------
NM_018156chr152432 2338 2163 930 621 --22321 1945 170
NM_018157chr1252890 2181 432 286 92 ------
NM_018164chr121201 ------
NM_018171chr123732 681 649 ------
NM_018172chr1121492 983 ----11054
NM_018178chr131801 612 420 12058 ----
NM_018181chr1821928 1483 ----11881
NM_018182chr1772016 1719 1683 1584 594 173 165 ----11957
NM_018193chr15----1200 --
NM_018198chr11276 2932 372 1965 --
NM_018199chr1421189 245 ------
NM_018205chr10122276 1956 1772 1660 812 728 686 577 538 514 276 266 12211 12151 --
NM_018206chr161635 ------
NM_018207chr151661 1523 338 204 55 ------
NM_018208chr161128 922 896 771 395 66 1890 ----
NM_018211chr121826 359 ------
NM_018222chr1151753 1382 1359 1178 108 ------
NM_018223chr123907 262 208 --11162 --
NM_018234chr252054 1927 1712 1610 845 12237 ----
NM_018237chr10------1187
NM_018239chr10122276 1956 1772 1660 812 728 686 577 538 514 276 266 12211 12151 --
NM_018240chr11206 1770 1109 --
NM_018244chr2031187 491 224 --1211 --
NM_018247chr6149 --11910 --
NM_018254chr141713 1557 1495 708 ------
NM_018256chr2195 ------
NM_018266chr311016 ----2837 356
NM_018287chr10--1168 ----
NM_018293chr32967 677 ------
NM_018299chr832819 917 37 1300 ----
NM_018307chr171957 --1693 --
NM_018312chr1121565 488 12094 ----
NM_018313chr312081 11069 11973 --
NM_018315chr4154 ------
NM_018325chr92619 450 1107 11315 --
NM_018330chr101247 ------
NM_018351chr1243936 3837 3825 1435 14007 --24198 3643
NM_018357chr151366 ------
NM_018358chr32259 112 ------
NM_018361chr841433 539 396 109 --11134 --
NM_018362chr1133780 3496 875 ------
NM_018364chr163654 3115 3066 2659 671 549 ------
NM_018375chr1421887 238 --21713 580 11354
NM_018381chr197899 814 667 635 599 323 257 ----1802
NM_018383chr242021 819 192 101 ------
NM_018387chr9169 ------
NM_018403chr373949 3282 2633 2611 818 621 468 23894 976 ----
NM_018416chr1262538 1776 1634 989 555 426 ------
NM_018419chr202377 85 ------
NM_018425chr1052173 1954 877 702 194 12456 21810 113 --
NM_018429chr51969 ------
NM_018431chr202632 115 ------
NM_018439chr1832365 2031 1782 ------
NM_018440chr867151 5728 5487 2593 875 131 23434 512 25618 576 --
NM_018441chr2122 140 ----
NM_018444chr812144 ------
NM_018446chr3142 ------
NM_018457chr122143 46 --192 --
NM_018462chr31310 ----174
NM_018469chr1751061 935 493 427 129 ------
NM_018482chr8--2174 55 ----
NM_018486chrX1432 ----1193
NM_018489chr13151 68 55 ------
NM_018509chr1741462 1378 282 33 ------
NM_018557chr221089 541 ----1507
NM_018566chr174427 3598 3540 3441 2051 1814 1089 ----1920
NM_018569chr431280 199 83 ------
NM_018590chr10157 ------
NM_018638chr1234968 2158 1938 12148 13542 --
NM_018640chr1242577 2085 1973 1965 ------
NM_018644chr1162256 637 578 412 352 47 --11712 12005
NM_018650chr11452 2848 120 ----
NM_018652chr151639 1341 ----
NM_018660chr882628 2374 1158 1078 931 866 527 34 11946 --177
NM_018667chr1652356 1993 1909 1869 1808 --2529 34 --
NM_018685chr711157 ------
NM_018686chr121326 --139 --
NM_018688chr87841 772 339 166 124 106 59 --1295 --
NM_018691chr541248 1163 1042 895 1150 ----
NM_018695chr51341 1398 ----
NM_018698chrX1169 ------
NM_018699chr42278 222 ------
NM_018700chr521605 154 ------
NM_018703chr16180 ------
NM_018710chr81217 --11109 --
NM_018712chr112417 376 ------
NM_018713chr11974 ------
NM_018715chr161858 1540 1497 871 809 198 --2891 597 --
NM_018717chr462730 1845 990 899 886 715 ------
NM_018718chr751718 927 734 567 489 1783 1545 --
NM_018841chr183347 1237 1160 1025 1016 976 739 388 --23467 1004 11327
NM_018844chr741996 602 350 199 ------
NM_018846chr71340 ----1734
NM_018890chr74571 435 265 239 --2255 107 --
NM_018896chr17149 ------
NM_018898chr512089 --1103 --
NM_018899chr512089 --1103 --
NM_018900chr512089 --1103 --
NM_018901chr512089 --1103 --
NM_018902chr512089 --1103 --
NM_018903chr512089 --1103 --
NM_018904chr512089 --1103 --
NM_018905chr512089 --1103 --
NM_018906chr512089 --1103 --
NM_018907chr512089 --1103 --
NM_018908chr512089 --1103 --
NM_018909chr512089 --1103 --
NM_018910chr512089 --1103 --
NM_018911chr512089 --1103 --
NM_018945chr631037 258 28 175 ----
NM_018948chr11394 ------
NM_018951chr731191 278 99 ------
NM_018952chr175565 225 143 113 85 ------
NM_018957chr222104 56 --171 129
NM_018963chr212157 80 ------
NM_018964chr2151039 735 724 258 81 ------
NM_018970chr721099 26 ------
NM_018977chrX3885 430 363 --1250 --
NM_018979chr1262013 1975 765 458 443 365 ----1158
NM_018993chr2041387 410 57 51 ----1466
NM_018994chr12531 394 ------
NM_018999chr1053618 1064 338 191 101 ------
NM_019000chr5--11548 ----
NM_019001chr313514 11446 ----
NM_019004chr711571 1455 1303 --
NM_019008chr22113698 3673 3581 3351 2975 2792 1040 933 403 214 40 --33436 3277 1092 12574
NM_019027chr42841 741 21742 237 1695 --
NM_019041chr641741 1712 350 199 ------
NM_019045chrX1839 ------
NM_019050chr431584 665 54 ------
NM_019055chr112525 431 ----1201
NM_019062chr1142 --133 --
NM_019063chr22776 550 ----21983 888
NM_019071chr71233 ------
NM_019074chr152787 651 2283 112 ----
NM_019088chr19181 ------
NM_019091chr21874 ------
NM_019096chr61188 ----1391
NM_019102chr71106 ------
NM_019102chr71106 ------
NM_019106chr2263269 2506 2431 1011 683 230 --12278 12328
NM_019116chr1683222 3044 2976 2875 2774 2339 2293 788 --33484 3321 1232 1720
NM_019555chr351645 1174 687 376 342 ------
NM_019556chrX21432 441 ------
NM_019557chr13763 652 60 1829 ----
NM_019593chr2053046 2834 2109 2080 2019 --22195 2124 --
NM_019595chr22239 70 ------
NM_019600chr151581 ------
NM_019605chr11296 --152 --
NM_019606chr73488 380 38 ------
NM_019610chr121357 242 ------
NM_019613chr17--143 ----
NM_019842chr6----175 --
NM_019845chr24754 335 308 163 ----1175
NM_019849chr192189 143 ------
NM_019859chr1021351 1100 ------
NM_019885chr2112305 2176 2056 1814 1129 714 662 633 603 524 119 --22356 931 --
NM_019891chr121166 52 ------
NM_019903chr102295 230 1237 ----
NM_020039chr1291718 1606 1297 1258 1246 1197 621 473 364 11476 2703 160 --
NM_020062chr204991 416 409 269 ------
NM_020063chr12189 70 --1182 --
NM_020066chr1----1386 --
NM_020116chr4--1526 ----
NM_020122chr285725 5294 5182 1093 1000 571 255 29 14532 35517 2290 1397 24540 2044
NM_020123chr10----1297 --
NM_020134chr251059 914 908 295 218 --3997 306 137 --
NM_020144chr711602 1475 ----
NM_020145chr93619 189 59 ------
NM_020148chr1842839 459 388 75 12459 ----
NM_020150chr1021982 1767 --196 --
NM_020151chr221486 40 ----1163
NM_020159chr41586 ------
NM_020177chr532998 2698 2501 23236 118 ----
NM_020178chr174861 455 408 131 ------
NM_020182chr2073460 3434 3357 2965 2839 894 114 43177 2638 2575 2305 12750 12469
NM_020193chr11----11024 --
NM_020198chr17143 ------
NM_020205chr113374 22501 562 ----
NM_020210chr156935 855 755 151 127 117 --1274 --
NM_020211chr1561201 1176 1028 979 598 37 ------
NM_020214chr15--153 ----
NM_020228chr1141758 297 79 64 1653 ----
NM_020231chr3--1678 125 --
NM_020235chr3149 ------
NM_020239chr192222 1722 1575 1556 1445 827 779 447 261 1717 ----
NM_020248chr171936 1912 1812 1574 1534 1481 350 1609 1342 11641
NM_020310chr1782541 2382 2248 1809 1109 862 598 354 22226 704 22263 2179 --
NM_020336chr2043048 2560 1524 283 12914 1482 13522
NM_020337chr462837 2437 1991 1094 731 171 ------
NM_020338chr1073292 2921 2503 1392 1303 838 485 188 2149 133 --
NM_020340chr641497 868 146 53 11657 ----
NM_020341chr2021772 550 --1251 --
NM_020342chr211775 ----21758 567
NM_020346chr1111556 ----1564
NM_020354chr102767 116 ----1867
NM_020357chr32575 411 ------
NM_020374chr122787 630 11374 ----
NM_020381chr621418 297 1406 11502 --
NM_020382chr1241397 1267 1062 462 161 ----
NM_020384chrX41611 510 316 216 --21696 1648 --
NM_020403chr1311796 11194 ----
NM_020416chr442584 2505 2003 763 1704 1794 --
NM_020423chr13383 228 184 ------
NM_020428chr1921099 96 --1801 --
NM_020429chr7102754 2634 2114 2015 812 427 330 323 258 92 12521 12816 --
NM_020433chr2061568 1470 1371 1310 1167 303 --1225 --
NM_020438chr94475 426 275 123 ------
NM_020440chr193026 2954 2125 2072 1187 742 710 689 135 --22081 106 --
NM_020443chr1146953 6916 5637 4879 4638 4574 4505 4488 2615 2519 1447 765 666 97 11635 25031 4980 1746
NM_020447chr15112595 2258 2230 1900 884 697 540 493 356 50 24 ----1129
NM_020452chr161677 1368 840 795 381 177 191 ----
NM_020463chr21545 ------
NM_020466chr624496 3771 ------
NM_020474chr181799 --1180 --
NM_020475chr851882 1753 1663 1548 991 1473 ----
NM_020476chr851882 1753 1663 1548 991 1473 ----
NM_020477chr851882 1753 1663 1548 991 1473 ----
NM_020478chr851945 1816 1726 1611 1549 1536 ----
NM_020480chr851882 1753 1663 1548 991 1473 ----
NM_020532chr2----1366 --
NM_020647chr83867 221 24 --178 --
NM_020651chr221740 270 ------
NM_020655chr1661250 1243 1171 919 906 324 --1119 --
NM_020689chr2031340 510 153 21657 119 ----
NM_020690chr5------1220
NM_020699chr1105138 5069 4252 3588 2148 1870 1860 1644 1216 380 --24628 313 14771
NM_020703chr11233 --1596 --
NM_020708chr20102197 1895 1588 1002 794 768 755 741 384 238 --2605 57 --
NM_020711chr252501 2126 1969 1961 1018 11978 2566 479 --
NM_020713chr20193084 2739 2576 2553 2437 2386 2282 2185 1184 894 815 785 766 674 565 351 164 84 47 --32417 985 833 22502 1024
NM_020717chrX134518 4036 3740 3734 3590 3464 3287 1817 1804 1433 785 654 400 1300 1116 11474
NM_020718chr16136635 5472 5251 4331 2438 2041 1979 1869 1801 1053 700 456 62 ------
NM_020724chr462630 2518 2081 1854 769 669 --12448 12232
NM_020727chr2132939 2576 1322 1644 ----
NM_020728chr752995 2915 2513 245 24 --139 --
NM_020734chr122926 459 1240 ----
NM_020739chr1533771 3175 707 --13745 --
NM_020742chrX22234 444 ----11029
NM_020748chr1731613 1551 365 ------
NM_020750chr641050 1016 153 75 1967 3458 308 293 1406
NM_020752chr101209 2982 498 ----
NM_020753chr175758 582 520 264 166 --1296 --
NM_020760chr231779 459 53 --21926 172 --
NM_020765chr12115 47 ------
NM_020766chrX94230 3533 3520 3216 2897 1738 1268 952 386 --13747 --
NM_020769chrX3744 376 271 3886 782 104 ----
NM_020771chr621403 1307 ------
NM_020772chr1766903 6576 5262 1264 927 525 23437 2866 ----
NM_020773chr492234 2060 1883 945 839 742 593 528 187 ------
NM_020777chr462171 2122 554 534 497 214 11874 31799 719 345 --
NM_020783chr1822391 459 ------
NM_020792chr322326 356 1319 ----
NM_020794chr131509 346 329 ------
NM_020795chr1751851 1828 1376 33 21 21875 644 11315 11613
NM_020796chr531022 767 135 12269 12306 --
NM_020801chr521784 1665 1631 ----
NM_020805chr18--2691 586 11278 --
NM_020806chr141666 ------
NM_020814chr21126 1409 ----
NM_020820chr2091504 1403 983 612 575 288 199 135 77 11261 11372 --
NM_020824chr10------1103
NM_020826chr11123603 3583 3546 2956 2854 2644 1303 1238 664 131 47 36 13335 1575 --
NM_020830chr243129 2652 2174 388 --1875 --
NM_020831chr224910 845 214 64 1222 1860 1159
NM_020832chr13561 196 188 1599 ----
NM_020839chr321577 64 11223 ----
NM_020843chr151402 ------
NM_020844chr8106973 6129 5476 5102 4797 2933 2835 2580 1279 1242 --12508 17563
NM_020845chr1282284 2241 1945 1825 1800 1698 938 171 11958 --12374
NM_020850chr16163040 2925 2737 2670 2619 2504 2465 2221 2171 1243 1097 1041 977 256 65 31 13198 12751 --
NM_020851chr1541766 1434 1420 1329 --21704 1691 --
NM_020856chr1931381 1155 460 --21238 387 --
NM_020859chr473324 1205 716 429 356 168 152 ------
NM_020865chr3------1122
NM_020868chr211519 1320 ----
NM_020888chr191861 1683 1457 693 658 522 304 138 122 1174 11851 --
NM_020895chr191269 ------
NM_020896chr113941 358 211 --140 1851
NM_020897chr131210 1190 23 1165 ----
NM_020899chr1742459 2360 749 329 --2424 272 --
NM_020914chr1742549 1684 885 863 11967 ----
NM_020918chr1063473 3141 2398 1080 174 142 ------
NM_020924chr91183 ------
NM_020927chr1641892 1453 374 284 --11874 --
NM_020935chr274668 3782 3478 1748 1059 551 333 11139 ----
NM_020940chr1032897 2323 96 ----12137
NM_020948chr121378 676 ------
NM_020951chr1922245 1660 ------
NM_020956chr19124626 3399 3274 3172 2904 1476 1351 1269 1009 266 37 31 33217 1111 141 34050 2988 1585 --
NM_020958chr142380 351 1319 ----
NM_020962chr1581548 878 709 692 553 392 363 322 --1110 --
NM_020963chr1138 ------
NM_020975chr1061888 1505 1305 458 222 71 ------
NM_020977chr431940 1497 790 ------
NM_020980chr151687 --1239 --
NM_020983chr1272218 2135 1656 1597 892 564 261 1165 1386 11550
NM_020987chr1011360 --1924 --
NM_020988chr1641261 916 526 107 ------
NM_020993chr1292420 2319 2291 2108 1029 730 535 491 432 --22489 800 --
NM_021003chr141719 ------
NM_021007chr221585 948 ------
NM_021013chr17171 ------
NM_021020chr893555 2849 2545 2461 791 443 213 189 54 12736 23024 2526 12259
NM_021033chr1362689 2382 1277 1157 831 758 1205 --1122
NM_021038chr321314 1304 ----13166
NM_021047chr194735 489 184 49 --161 --
NM_021061chr854011 3873 1257 569 380 11046 --163
NM_021072chr51310 ------
NM_021076chr222420 206 --2461 448 --
NM_021078chr174180 144 123 23 ----1193
NM_021079chr1792801 2498 2424 2123 1067 949 895 740 631 22850 2484 23047 2559 --
NM_021083chrX63445 3223 2280 678 143 77 ------
NM_021090chr22114210 4177 3813 1847 1840 1480 1474 1372 1275 1066 1016 34824 1607 217 ----
NM_021097chr21767 12180 11973 --
NM_021101chr332273 2143 570 12136 --1633
NM_021106chr92618 253 ------
NM_021109chrX150 ------
NM_021109chrX150 ------
NM_021120chrX83088 2271 2195 1259 1019 869 450 151 --32757 2575 1987 --
NM_021133chr1150 ------
NM_021136chr14----159 --
NM_021145chr72968 120 ------
NM_021148chr732520 1940 26 ------
NM_021158chr203549 207 101 --164 --
NM_021159chr431323 275 51 ------
NM_021165chr12742 665 ----173
NM_021173chr111353 127 133 --
NM_021174chr81284 1259 2661 64 --
NM_021183chrX41563 423 251 107 1175 ----
NM_021189chr14802 783 309 37 2426 216 31025 435 222 --
NM_021194chr11100 ------
NM_021198chr291480 1462 1446 1312 1249 938 932 450 253 1215 ----
NM_021202chr20112783 2631 2460 2403 2020 1178 946 869 543 499 306 11245 22296 314 --
NM_021213chr1731093 851 258 --1134 --
NM_021229chr1221198 325 --1431 --
NM_021237chr3--1133 ----
NM_021238chr1221781 1437 ------
NM_021239chr141139 --1451 --
NM_021240chr92195 92 ------
NM_021242chrX1657 1970 ----
NM_021249chr1431582 1556 37 ------
NM_021253chr62903 104 1478 1951 --
NM_021259chr1651004 949 467 401 81 ------
NM_021269chr19199 ------
NM_021619chr931041 412 76 ------
NM_021622chr1022062 949 2837 40 ----
NM_021627chr32419 158 ------
NM_021629chr344983 4715 611 188 ------
NM_021638chr4115012 4110 3587 3363 1769 1153 944 492 333 131 80 --33250 1926 1439 23066 833
NM_021639chr11600 --1348 --
NM_021643chr221691 1620 11627 ----
NM_021644chr10--1273 ----
NM_021647chr463648 1315 1152 792 293 87 ----21714 508
NM_021648chr652481 2193 2123 553 241 21702 197 ----
NM_021705chr641508 1245 189 101 ------
NM_021728chr14----1349 --
NM_021729chr11--1315 --1131
NM_021738chr101285 ------
NM_021783chrX22220 34 ----1764
NM_021813chr665094 4891 4841 2318 1902 490 24232 1463 ----
NM_021814chr62497 207 ------
NM_021905chr651743 1687 1475 613 556 1282 ----
NM_021911chr575372 5352 4393 3725 1898 1769 1165 ------
NM_021912chr1533172 3125 3019 ------
NM_021913chr1931128 732 111 --1240 --
NM_021914chr144774 714 223 115 ------
NM_021940chr61302 ------
NM_021943chr651870 1834 1672 316 54 --21861 1776 --
NM_021945chr663302 2920 1074 947 842 669 12494 12520 --
NM_021946chrX3573 341 47 --11179 1995
NM_021948chr11254 ------
NM_021954chr1353300 2527 623 447 427 13718 21487 392 --
NM_021961chr11117425 6975 6768 6443 5668 5291 4689 1968 614 384 323 --24569 2748 15645
NM_021962chr1771886 1705 1673 561 550 431 220 11605 11834 --
NM_021964chr386468 6452 5692 5569 4960 2588 1651 1643 ------
NM_021965chr93879 541 67 ------
NM_021967chr531254 1187 996 11266 ----
NM_021973chr41586 ------
NM_021977chr652579 2519 1536 755 650 --1254 --
NM_021988chr2061582 997 640 590 377 24 --1423 --
NM_021991chr174580 226 132 41 ------
NM_021998chrX1458 --1171 --
NM_022003chr1121204 397 --21134 105 --
NM_022037chr2--1211 ----
NM_022044chr22--190 ----
NM_022048chr1565257 4491 4026 2273 1302 29 14676 46021 5243 4221 1077 123
NM_022051chr11604 ------
NM_022060chr143980 918 520 ----1555
NM_022062chr1171501 1260 1222 665 607 353 112 161 ----
NM_022066chr173953 345 120 --2902 871 --
NM_022075chr13969 277 85 --1289 --
NM_022080chr2012780 --22622 1942 --
NM_022095chr201290 --144 --
NM_022107chr62524 392 168 123 1173
NM_022114chr1164509 4080 3726 3705 3503 3496 3487 3469 3391 3323 3142 3042 1785 1094 1024 822 34030 3201 864 ----
NM_022117chrX3377 212 61 ------
NM_022118chr132573 500 ------
NM_022123chr14--1197 ----
NM_022130chr531141 1064 181 1408 ----
NM_022138chr641409 308 286 216 ------
NM_022166chr16226126 5721 5101 4751 4481 4119 2101 1871 1468 1429 1410 1315 1160 744 677 666 644 622 573 567 258 100 --44295 1026 696 450 --
NM_022169chr1151185 453 346 338 29 --2192 58 --
NM_022173chr2--1211 ----
NM_022307chr75641 494 482 249 135 ------
NM_022336chr242093 843 690 24 12341 ----
NM_022337chr111503 ------
NM_022351chr823356 500 ------
NM_022367chr1171 --2630 217 --
NM_022368chrX----170 --
NM_022369chr153372 118 79 1380 ----
NM_022442chr2061582 997 640 590 377 24 --1423 --
NM_022458chr762859 2428 2248 2070 1946 641 32817 2784 2277 --1935
NM_022459chr1335622 4488 4204 ------
NM_022461chr32274 56 ------
NM_022462chr1972518 1448 1231 689 617 186 26 13698 23305 1137 22630 154
NM_022465chr12102487 2461 2234 1873 1175 1122 680 570 509 498 11032 22454 2140 2444 102
NM_022473chr1564140 3047 1646 1242 664 152 11094 24388 2952 --
NM_022474chr1432722 2351 2295 ------
NM_022477chr2021587 1460 ------
NM_022479chr731317 1233 978 ------
NM_022484chr711247 1122 ----
NM_022485chr3------149
NM_022488chr31159 ------
NM_022491chr1282331 1102 1088 1046 998 535 528 115 --12289 --
NM_022497chr372794 2663 2473 1440 806 792 743 --1929 --
NM_022552chr22914 226 ------
NM_022553chr63389 185 116 1138 ----
NM_022557chr171217 ------
NM_022572chr281504 1471 1293 1171 1127 520 403 378 21339 1235 11268 --
NM_022574chr722057 2039 --31925 862 698 --
NM_022640chr172215 185 ------
NM_022650chr51246 ------
NM_022658chr1231320 297 153 ------
NM_022659chr84408 172 162 74 ------
NM_022719chr2273462 3113 2360 1348 739 307 301 32867 2470 842 43876 3618 514 80 --
NM_022730chr22817 760 --1945 --
NM_022735chr131694 1553 387 --1217 --
NM_022737chr194479 142 88 63 ----1280
NM_022745chr132309 1856 155 12070 21088 41 --
NM_022748chr742255 545 143 45 22221 2046 1375 --
NM_022755chr941911 963 323 252 ------
NM_022756chr131366 110 40 ------
NM_022758chr643129 2106 1069 741 --12854 --
NM_022763chr362779 2701 2670 2503 2145 322 12787 183 --
NM_022768chr1185 ------
NM_022771chr121195 ------
NM_022780chr22595 382 ------
NM_022781chr922660 2654 --2708 94 1384
NM_022782chr12------199
NM_022817chr242198 858 424 329 --12129 12170
NM_022822chr117666 651 351 334 223 164 61 1860 ----
NM_022824chr531352 637 362 --1521 --
NM_022825chrX2276 76 ------
NM_022828chr521693 1222 ------
NM_022831chr131569 1494 64 --11317 --
NM_022833chr961354 1253 967 452 444 69 1911 ----
NM_022841chr1522628 1777 ------
NM_022842chr3102575 2485 2323 1235 1145 957 750 493 341 309 --12492 12461
NM_022843chr1311130 ------
NM_022844chr161877 ------
NM_022845chr16----22052 577 --
NM_022893chr231056 311 73 ------
NM_022894chr21338 --11572 1118
NM_022897chr54817 811 131 33 --1745 1382
NM_022898chr1474444 4357 3445 3253 3097 206 160 13215 ----
NM_022900chr71847 ------
NM_022918chr1121686 1394 ------
NM_022970chr1031051 966 305 ------
NM_022977chrX21051 72 ------
NM_022978chr531254 1187 996 11266 ----
NM_023000chr1411124 11167 ----
NM_023001chr1411124 11167 ----
NM_023009chr12267 91 ------
NM_023011chr132573 326 ------
NM_023018chr141625 1152 51 40 11179 1567 --
NM_023019chr21108 --141 --
NM_023035chr191255 ------
NM_023039chr5128 ------
NM_023067chr351109 1054 410 384 202 1918 ----
NM_023068chr2091563 1314 599 299 293 242 115 91 21 21129 1073 11376 --
NM_023074chr192972 948 ------
NM_023076chr1632258 207 176 --1119 --
NM_023079chr1741747 1406 509 494 ------
NM_023925chr12--176 ----
NM_023929chr83915 305 143 ------
NM_024007chr552800 2731 1275 913 335 11218 ----
NM_024015chr173801 120 86 --21070 987 --
NM_024016chr17191 1518 ----
NM_024017chr1741680 320 130 34 1170 125 1512
NM_024019chr41135 --167 --
NM_024040chr10162 --129 --
NM_024046chr3121232 1203 1197 1152 973 819 437 425 390 364 320 99 --1912 --
NM_024076chr1992179 2169 1892 1725 1585 946 892 722 262 12434 ----
NM_024082chrX3432 399 97 ------
NM_024085chr22839 697 1748 ----
NM_024090chr441483 1402 1205 530 ------
NM_024107chr175795 739 617 565 248 1526 --1710
NM_024117chr91139 --21072 91 --
NM_024293chr24729 336 322 258 ------
NM_024294chr643129 2106 1069 741 --12854 --
NM_024297chr17--168 ----
NM_024306chr167964 449 218 170 153 122 39 129 1331 --
NM_024312chr122391 208 --11235 --
NM_024320chr173797 789 197 --1271 --
NM_024345chr9105686 5640 5152 4915 4843 4753 3827 1301 1295 283 --11058 --
NM_024491chr32476 420 1106 ----
NM_024496chr14------1326
NM_024507chr162251 44 1335 ----
NM_024509chr192155 28 ------
NM_024512chr323157 993 21053 974 ----
NM_024524chr342728 703 681 210 ------
NM_024525chr1192 ------
NM_024528chrX2138 118 ------
NM_024529chr12782 329 --1193 --
NM_024541chr1021685 1335 136 --11557
NM_024551chr1272378 2042 1726 1026 916 718 670 11649 ----
NM_024551chr1272378 2042 1726 1026 916 718 670 11649 ----
NM_024554chr121592 204 21435 177 ----
NM_024556chr113444 323 46 ------
NM_024567chr81695 1159 ----
NM_024581chr6123 ------
NM_024586chr11212 ------
NM_024595chr1--1281 ----
NM_024599chr17379 65 31 1497 ----
NM_024607chr884210 4009 3357 3115 819 435 338 51 13348 --13008
NM_024612chr171407 ------
NM_024615chr5----137 --
NM_024617chr92867 667 --1837 --
NM_024624chr21535 ----1640
NM_024626chr111580 ------
NM_024628chr311098 ------
NM_024630chr62811 301 ------
NM_024639chr642489 2338 1175 565 22928 379 1330 --
NM_024643chr141516 2463 131 ----
NM_024652chr154808 453 400 358 1479 ----
NM_024659chr21250 ------
NM_024665chr334259 3908 345 ------
NM_024674chr142813 2592 1031 953 1766 ----
NM_024689chrX11511 11137 162 --
NM_024698chr1141224 542 515 443 --51145 988 872 451 104 --
NM_024700chr11101 ------
NM_024704chr202203 39 ------
NM_024713chr1521325 1192 ------
NM_024722chr172367 114 --159 --
NM_024735chr1671889 1875 1687 1565 1274 1177 775 --11231 --
NM_024740chr1174015 3759 3320 3309 3243 1059 239 ------
NM_024742chr16101585 1210 772 737 727 709 694 586 392 144 --1133 --
NM_024744chr222538 956 ------
NM_024755chr152334 328 ------
NM_024761chr954430 3311 1288 841 549 --44366 1496 1030 483 --
NM_024762chr193852 139 102 ------
NM_024770chr2106755 5763 5150 4737 4663 2378 2160 1838 1197 967 11209 25641 1365 --
NM_024779chr1231148 491 348 ------
NM_024785chr21257 1351 ----
NM_024792chr172915 283 ------
NM_024798chr1532494 2225 79 --22201 2012 --
NM_024811chr1111508 1450 3673 536 179 11539
NM_024824chr141602 1692 ----
NM_024825chr191294 ------
NM_024828chr91130 ------
NM_024831chr82520 216 ------
NM_024834chr1041999 1756 1307 769 ------
NM_024835chr17156 ------
NM_024837chr1541783 1577 1199 440 ----1686
NM_024854chr1211314 --11515 --
NM_024874chr151272 931 438 304 158 --154 --
NM_024884chr1474472 4188 4063 3891 3580 1587 1220 24199 1824 ----
NM_024887chr161781 1709 777 534 371 35 --1393 --
NM_024911chr12713 159 ------
NM_024915chr852834 2249 2198 1825 1086 12882 --136
NM_024921chrX21451 1327 ------
NM_024930chr522690 436 ------
NM_024939chr1641640 1279 1203 373 ----2283 116
NM_024946chr1631615 1200 518 --1498 --
NM_024948chr101692 ------
NM_024949chr484531 4296 3251 3114 1712 1279 1213 880 ----11052
NM_024953chr1221918 997 11926 1376 --
NM_024954chr103671 95 67 1238 ----
NM_024969chr22853 757 ------
NM_024989chr266839 6261 2992 2556 1418 506 38126 7685 1596 ----
NM_024991chr1063038 3012 2452 740 349 260 ------
NM_024993chr231422 1350 61 11615 ----
NM_025027chr19------2315 197
NM_025054chr813394 ----14032
NM_025073chr134511 4481 3479 13722 ----
NM_025083chr1572007 1881 1785 1615 1400 805 529 11863 1438 1295
NM_025106chr151865 746 717 404 289 11767 11794 --
NM_025133chr23975 870 25 ------
NM_025134chr1611709 --12390 --
NM_025137chr151124 ------
NM_025138chr132407 335 ------
NM_025146chr331983 1874 494 1478 12583 --
NM_025154chr72357 273 1244 --11230
NM_025158chr53470 448 411 ----1164
NM_025160chr143965 3900 3592 530 11181 ----
NM_025164chr1141879 1365 760 90 --11782 1455
NM_025179chr174317 4138 3782 3219 1918 1753 982 24558 3279 24651 4435 14537
NM_025181chr21750 ------
NM_025182chr91951 ----1112
NM_025184chrX1617 ------
NM_025187chr162522 253 11366 --1277
NM_025191chr131364 915 797 22791 472 1375 --
NM_025195chr841819 1752 644 70 ------
NM_025204chr226786 708 373 324 316 135 ------
NM_025208chr1142093 776 468 143 11676 ----
NM_025222chr382707 2580 1196 926 798 398 252 127 2437 298 ----
NM_025224chr2071767 769 687 654 551 449 152 12035 11855 11864
NM_025235chr1041539 814 729 628 1320 11700 --
NM_025236chr64600 304 209 41 1218 ----
NM_025237chr1751121 477 146 69 42 ------
NM_025248chr1773203 2887 2768 2132 770 376 140 ------
NM_025251chr891112 889 811 429 411 289 254 103 68 11136 ----
NM_030576chr1742568 2459 2015 841 --22311 1910 --
NM_030579chr1651123 801 741 183 81 ------
NM_030594chr15----1988 --
NM_030621chr1442834 2605 984 441 13267 1931 --
NM_030625chr1021628 799 ------
NM_030627chr531455 983 976 ------
NM_030629chr1631213 635 444 21568 491 11402 11345
NM_030634chr122334 854 172 ----
NM_030647chr754086 3974 2159 1792 1016 --34914 4554 4542 --
NM_030648chr495376 4778 4725 3380 1684 1659 1484 568 195 25457 4576 ----
NM_030650chr233872 3629 293 22857 22 ----
NM_030653chr12135 1705 ----
NM_030660chr1421462 1378 1959 1330 --
NM_030661chr741097 469 266 99 --11549 --
NM_030664chr1041899 978 203 145 ----11829
NM_030665chr173576 534 445 11132 ----
NM_030674chr1225539 4289 24351 1739 25244 3888 23798 890
NM_030753chr17------194
NM_030761chr142620 2277 2034 1087 1131 11031 22485 568
NM_030763chrX2897 100 ------
NM_030766chr121216 ------
NM_030767chr952729 2437 2192 2102 383 1965 32654 2636 1011 22718 2053
NM_030780chr851763 1286 400 177 50 ------
NM_030795chr81390 ------
NM_030797chr22266 190 ------
NM_030802chr175196 150 142 108 93 1330 ----
NM_030806chr1198988 8425 7988 7626 7500 7260 7156 7057 7034 6687 5737 3584 2856 2506 1052 529 473 423 327 12943 49216 7432 7419 838 13107
NM_030808chr1741040 417 156 33 --1731 --
NM_030816chr122447 782 --22730 418 --
NM_030881chr2232309 1913 352 ------
NM_030884chr392191 2108 1701 1603 924 678 531 326 290 ----1849
NM_030885chr322167 1968 ------
NM_030906chr112106 87 ------
NM_030911chr1321443 65 ------
NM_030912chr102245 82 --2772 284 --
NM_030913chr16665 525 517 499 493 182 1507 2110 45 --
NM_030914chr94311 170 103 68 --1613 --
NM_030915chr24942 892 834 227 --21474 208 --
NM_030918chr1134788 4395 4272 3977 3853 3430 1606 1338 942 820 739 254 87 1225 24057 3898 14514
NM_030920chr11818 --1694 --
NM_030922chr152809 749 186 ----
NM_030937chr171452 1003 349 304 266 84 63 1105 2921 35 --
NM_030938chr172748 267 ------
NM_030952chr14368 204 136 73 21110 37 ----
NM_030958chr82187 72 ------
NM_030964chr573640 3310 3129 2479 1350 1186 343 1413 23356 2996 11392
NM_030978chr91458 ------
NM_030981chr1151226 1076 977 782 472 1878 ----
NM_031243chr7--12005 ----
NM_031262chr9126 ------
NM_031263chr9183 ------
NM_031266chr51172 ------
NM_031268chr16125208 4257 3671 2007 1690 1410 854 842 479 260 230 25 1562 43664 1917 1858 1154 11449
NM_031286chr11328 ----159
NM_031309chr852373 855 691 624 336 135 2519 407 --
NM_031371chr12639 248 ------
NM_031371chr12639 248 ------
NM_031372chr421688 310 --11365 --
NM_031411chr512089 --1103 --
NM_031417chr1982693 512 506 270 230 43 31 21 62427 2257 2217 966 321 296 ----
NM_031419chr3153 1263 ----
NM_031431chr1321549 545 ------
NM_031433chr114500 382 38 23 ----1144
NM_031438chr51462 ------
NM_031439chr831508 137 38 11426 130 11439
NM_031442chrX42927 2365 665 491 --1473 1411
NM_031443chr74309 295 146 54 --190 --
NM_031444chr22101836 855 830 692 674 667 623 295 250 28 12118 21873 658 --
NM_031445chr263171 2687 2383 565 216 205 23339 2605 1609 --
NM_031453chr1052489 2182 1956 370 58 ------
NM_031461chr812297 21776 361 ----
NM_031477chr163325 277 85 ------
NM_031478chr163646 639 92 --1569 --
NM_031483chr2032261 2255 363 ------
NM_031492chr113404 385 202 ------
NM_031844chr133651 2674 843 21361 441 --12797
NM_031845chr222729 47 12594 ----
NM_031847chr222729 47 12594 ----
NM_031849chr512089 --1103 --
NM_031857chr512089 --1103 --
NM_031858chr1721546 1008 --181 --
NM_031860chr512089 --1103 --
NM_031862chr1721546 1008 --181 --
NM_031866chr102973 747 --1320 --
NM_031890chr2272674 2619 2247 2208 2140 550 519 12017 ----
NM_031891chr18----1135 --
NM_031892chrX2646 195 ------
NM_031935chr11138 1687 ----
NM_031936chr11181 ------
NM_031948chr16275 36 ------
NM_031954chr1272799 2772 2390 994 777 682 25 --12249 --
NM_032012chr995012 4685 4372 3560 3245 1022 624 79 71 ------
NM_032013chr2021587 1460 ------
NM_032017chr1112020 1922 1903 1763 1680 1378 1329 1307 447 340 79 --11753 11992
NM_032041chr842731 2058 342 132 22134 148 ----
NM_032042chr541051 991 776 292 1418 ----
NM_032051chr224668 475 468 223 ------
NM_032052chr2281170 967 910 296 250 244 217 176 --1935 --
NM_032102chr11--1414 ----
NM_032105chr1137401 5424 5100 3207 2408 2120 1850 1774 801 629 536 209 202 1104 26349 2110 --
NM_032108chr193952 945 174 ------
NM_032109chr581276 1158 355 343 265 133 112 61 ------
NM_032124chr182807 178 ------
NM_032144chr221380 526 ------
NM_032148chr123379 368 123 122 ----
NM_032156chr12--176 ----
NM_032160chr1823316 1420 --11323 --
NM_032174chr171311 1207 1138 1065 1000 478 143 1306 ----
NM_032181chr2190 ------
NM_032182chr1021213 125 ----1430
NM_032189chr13124545 4270 4230 3937 3882 1725 1261 1133 1075 638 363 86 33228 1367 1015 24016 1773 --
NM_032195chr212211 170 1124 ----
NM_032199chr1043121 2782 1389 1256 13295 ----
NM_032208chr231278 384 27 1280 13432 --
NM_032217chr41960 ------
NM_032221chr2032015 1780 394 ------
NM_032233chr141772 ------
NM_032239chr41506 --11178 --
NM_032242chr372825 2712 2649 2629 2307 350 131 43271 1172 750 301 --168
NM_032256chr121729 --1208 --
NM_032268chr1653069 2494 2250 737 488 32838 2795 1150 53232 2600 2475 1242 441 --
NM_032272chr81118 --1151 --
NM_032281chr1952591 2577 2518 2439 384 --12509 --
NM_032283chr1131771 1749 1654 1598 1382 1251 722 411 300 279 206 199 169 1379 11618 --
NM_032288chr342404 954 612 422 ------
NM_032294chr1731153 613 484 --11871 11169
NM_032320chr111501 ------
NM_032324chr13170 64 22 ------
NM_032325chr1151903 787 451 365 195 1817 ----
NM_032345chr123139 133 49 ------
NM_032353chr172425 123 --1442 --
NM_032369chr122250 155 ------
NM_032373chr1021523 547 --23592 659 15466
NM_032389chr111187 --2207 181 --
NM_032408chr74996 890 325 237 ------
NM_032410chr831271 287 194 ------
NM_032430chr193403 372 316 ------
NM_032431chr113339 240 117 --3291 220 46 --
NM_032434chr21536 11513 21521 219 --
NM_032435chr152363 1826 919 748 564 11918 1843 --
NM_032440chr1042688 2331 908 795 ------
NM_032442chr17--1147 ----
NM_032445chr1572291 2187 2170 2108 1731 830 768 ------
NM_032452chr1431264 1203 341 ------
NM_032457chr432813 646 543 13470 ----
NM_032458chrX42956 2655 1034 647 --12305 1497
NM_032466chr831632 1319 1200 ------
NM_032468chr831632 1319 1200 ------
NM_032482chr1982623 2566 2215 1799 1777 647 582 308 21875 1822 ----
NM_032486chr1632615 1734 36 32203 2034 1958 ----
NM_032505chr312715 ------
NM_032508chrX51423 1334 1311 524 55 1439 ----
NM_032509chr822235 2097 21835 571 --1833
NM_032538chr6162676 2641 2513 2162 1974 1858 1847 1836 1749 1096 1048 964 832 435 248 89 --32747 2411 1817 --
NM_032539chrX2547 197 ------
NM_032550chr102952 369 1473 ----
NM_032552chr981501 1411 1377 732 678 364 248 83 11310 ----
NM_032560chr142239 206 --1215 --
NM_032562chr101159 ----153
NM_032569chr1681637 1279 1247 677 554 545 309 223 1738 1427 --
NM_032575chr16121699 1604 1542 1512 1502 1492 1474 1429 825 457 396 358 2641 261 ----
NM_032581chr731663 610 105 1405 ----
NM_032582chr175752 696 683 664 119 --1202 --
NM_032595chr1771562 1391 1094 619 613 462 370 167 ----
NM_032622chr451487 1193 1068 1057 264 ------
NM_032632chr1421653 743 1760 11239 --
NM_032682chr373485 2873 2577 1168 881 404 341 ------
NM_032711chr17143938 3929 3857 3820 3814 3512 3261 3197 2801 2681 1428 1127 1078 515 --23889 717 13136
NM_032717chr44939 780 372 163 ----140
NM_032750chr34692 663 320 63 --2651 49 --
NM_032765chr51165 --1752 --
NM_032778chr323054 2333 ------
NM_032781chr114680 373 126 67 156 1771 --
NM_032786chr123499 193 57 --177 1442
NM_032788chr231102 471 305 1501 --2584 334
NM_032801chr1152272 1665 985 468 337 11954 ----
NM_032808chr154838 763 173 80 ----1161
NM_032810chr1031243 263 48 ------
NM_032812chr101105 ------
NM_032813chr1321082 330 ------
NM_032828chr1943013 1853 1668 125 1431 14709 --
NM_032833chr132005 605 184 ------
NM_032837chr1721401 23 ------
NM_032839chr31377 ------
NM_032867chr112651 603 1242 ----
NM_032869chr811440 ----11817
NM_032870chr61557 ------
NM_032873chr1153241 2960 702 651 636 --24480 1402 13636
NM_032892chr15----1108 --
NM_032900chr1073362 3350 2914 1200 959 211 191 --13685 --
NM_032906chr42356 218 ------
NM_032924chr76861 772 762 219 169 49 ------
NM_032932chr17146371 6347 5882 5709 5500 5106 5061 4808 4788 1923 1530 484 475 28 44956 3914 2432 564 46024 5549 4417 596 --
NM_032947chr531148 1017 405 182 ----
NM_032961chr411227 1167 1300 11354
NM_032968chrX43290 2811 2636 456 ------
NM_032969chrX43290 2811 2636 456 ------
NM_032973chrY33285 2635 456 ------
NM_032982chr792512 2499 2025 1951 1938 1847 437 216 65 12222 21960 197 --
NM_032983chr7103326 3313 2839 2765 2752 2661 1251 1030 879 353 13036 32774 2123 1011 --
NM_032998chr11377 --1822 11127
NM_032999chr741082 986 924 307 ------
NM_033000chr741082 986 924 307 ------
NM_033001chr741082 986 924 307 ------
NM_033016chr2241523 1271 442 392 --21325 1252 --
NM_033018chrX31119 1111 918 --11153 1212
NM_033020chr144565 4469 3272 1498 --14162 --
NM_033027chr33796 760 397 ------
NM_033036chr1151664 396 373 185 41 --193 --
NM_033044chr121131 968 ------
NM_033055chr11791 ------
NM_033071chr6----2126 105 --
NM_033089chr2051124 598 498 323 136 ------
NM_033118chr20--1854 ----
NM_033121chr122669 74 ------
NM_033127chr12505 53 ------
NM_033129chr2081936 1686 1618 1476 822 491 77 37 2751 262 --1769
NM_033132chr1341882 434 126 45 --12027 --
NM_033135chr1142093 776 468 143 11676 ----
NM_033136chr52350 122 1233 ----
NM_033137chr52350 122 1233 ----
NM_033143chr452894 1519 567 250 99 21245 1216 ----
NM_033158chr3151 ------
NM_033181chr643341 3153 2907 742 ------
NM_033201chr165749 477 429 274 211 1436 188 --
NM_033207chr1041989 1798 318 123 1959 22391 2233 --
NM_033215chrX2415 108 --1124 --
NM_033221chr962430 2142 2008 1865 1799 225 ----31033 361 109
NM_033224chr756165 5443 3171 2528 1968 --16581 15556
NM_033226chr163248 96 81 ------
NM_033238chr15142584 2411 2129 1954 1847 1823 1740 1075 727 472 443 361 308 297 3967 750 698 11931 1107
NM_033240chr1551383 1061 183 122 89 --31610 553 64