TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4724-5p
miRNA Sequence: AACUGAACCAGGAGUGAGCUUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX62897 2621 2168 1377 822 643 11184 --13047
NM_000108chr751796 1625 1601 1343 198 21874 186 ----
NM_000125chr664067 3888 3713 2950 1394 27 13643 --12876
NM_000168chr763195 2502 793 609 209 85 21180 291 --11209
NM_000176chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_000259chr1565615 5591 4633 2181 1435 981 ----1468
NM_000332chr6146469 6435 6402 6174 5984 5744 5181 4696 4687 2409 2381 2276 941 485 17183 ----
NM_000390chrX32875 897 561 22768 597 22880 2832 --
NM_000489chrX83249 2750 2430 2354 1169 724 699 248 1909 --12589
NM_000611chr1166996 6316 5881 5522 4536 830 11135 --12576
NM_000899chr1253429 3318 2956 1118 1072 22784 986 14181 --
NM_001001323chr1262444 2063 1287 1135 590 75 11144 ----
NM_001001419chr563915 3778 2089 1212 626 241 ----24244 560
NM_001001420chr563915 3778 2089 1212 626 241 ----24244 560
NM_001001664chr263894 3578 3052 2740 1235 599 --11369 --
NM_001002860chr1473294 3110 3079 1406 1272 660 538 1527 13742 --
NM_001003652chr1868516 5764 3323 2314 1242 364 27735 2597 1625 11116
NM_001003674chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_001003675chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_001003679chr152087 649 603 465 115 11789 11625 --
NM_001003712chr1243744 3162 1211 1178 22547 1406 21285 931 13453
NM_001004317chr673579 3439 2862 2817 1415 1331 1174 1830 13932 --
NM_001005404chr1764240 4006 3544 3297 1083 1058 24457 3479 11065 --
NM_001005473chr576634 5481 4239 4219 4046 1640 154 16294 ----
NM_001007466chr683281 3240 2037 1950 1769 1614 1206 321 ------
NM_001008239chr1853338 3187 2980 1446 342 13722 2812 772 --
NM_001009554chr453963 3893 3851 3781 946 24561 4139 21709 503 --
NM_001009554chr453963 3893 3851 3781 946 24561 4139 21709 503 --
NM_001009899chr366185 4679 4657 3984 565 123 32154 1508 864 ----
NM_001009960chr742816 2313 451 108 12488 12472 1385
NM_001014797chr1087992 7539 7391 6788 6125 5874 2919 1226 1619 ----
NM_001018065chr995917 5438 5026 4865 4660 3808 2177 1293 327 ------
NM_001018066chr995917 5438 5026 4865 4660 3808 2177 1293 327 ------
NM_001018074chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_001018075chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_001018076chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_001018077chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_001018090chr152987 363 22136 257 --12415
NM_001018091chr1521097 473 22246 367 --12525
NM_001018102chr152987 363 22136 257 --12415
NM_001024094chr593320 3240 3139 2872 2829 1533 798 543 203 ------
NM_001024647chr1286470 2645 1379 1370 1141 923 913 184 23053 1801 ----
NM_001024948chr142999 2524 774 362 43049 1251 1169 490 ----
NM_001024956chr1175736 5360 4267 3921 1446 841 230 --15714 --
NM_001025077chr1086568 5164 4617 2915 2480 2392 2211 664 --11113 --
NM_001025266chr354619 3351 3103 1150 1019 34380 3893 1760 24162 136 --
NM_001025580chrX73916 3296 2845 1684 867 639 457 11162 12897 --
NM_001030055chr1454458 4447 4373 4188 2986 23659 854 14252 24528 73
NM_001031732chr483634 2867 2683 2669 2648 1072 860 651 --13491 2628 406
NM_001034841chr1675378 5227 5006 4894 1470 526 137 14578 14955 11246
NM_001039199chr2054943 4898 4135 431 87 25019 3078 24692 919 --
NM_001039590chrX73418 3148 3082 3029 2873 1609 814 --13715 --
NM_001039591chrX73418 3148 3082 3029 2873 1609 814 --13715 --
NM_001039618chr11124525 4326 4300 4165 4074 3612 2062 1805 1264 903 798 139 55719 4811 4560 4011 806 ----
NM_001039840chrX55334 4768 4455 1230 1214 31729 1477 1338 ----
NM_001040284chr16105610 5506 5211 5147 4604 4313 3713 1534 342 102 25567 3807 --15050
NM_001040665chr744665 4074 3930 1599 34005 1811 736 172 --
NM_001040712chr983192 2649 2415 2353 998 778 502 364 1511 ----
NM_001042355chr1695217 5036 3962 3741 3640 1535 1093 971 337 ------
NM_001042412chr1695217 5036 3962 3741 3640 1535 1093 971 337 ------
NM_001042555chr1274507 1776 1764 1645 848 563 418 11671 1963 --
NM_001042599chr287407 6420 4809 3056 2947 2792 1878 973 17564 11328 --
NM_001046chr572719 2631 2008 480 184 178 42 42206 957 938 925 ----
NM_001106chr3128538 8196 8129 8112 7098 6536 5942 2657 2065 1903 1028 536 37593 2322 714 12170 --
NM_001121chr1051615 1306 701 644 433 ----1762
NM_001167chrX64626 4571 2604 2509 973 143 46473 5784 2216 2033 ----
NM_001173chr1454458 4447 4373 4188 2986 23659 854 14252 24528 73
NM_001186chr2152935 2553 2179 722 421 42652 652 603 112 11217 --
NM_001204chr257480 6220 3106 2838 2025 36777 5303 1422 21654 220 --
NM_001259chr7105909 5434 5309 4797 2330 1789 1722 1434 847 729 35882 5572 2008 11667 --
NM_001304chr1743683 2625 2342 653 1345 23168 1173 12585
NM_001310chr1232924 2525 1124 12554 --11956
NM_001412chrX43643 1347 1204 1197 ----12587
NM_001419chr19114715 4549 4452 3898 3886 3675 2964 1578 963 388 382 ------
NM_001438chr163618 2866 2859 2565 870 411 --187 --
NM_001527chr684704 4149 1665 1544 1300 1153 1133 387 24232 3078 ----
NM_001695chr861701 1499 1467 1064 969 828 43267 2821 725 392 --13805
NM_001858chr674657 3718 3426 3225 1489 889 583 --13473 --
NM_001938chr121828 544 21508 761 1461 1207
NM_002025chrX77402 7307 5770 5729 2983 2547 2316 28974 2681 ----
NM_002158chr223263 559 13306 23003 1371 12935
NM_002210chr263040 2346 957 841 315 176 23233 602 ----
NM_002214chr754965 4906 4764 1476 362 22273 1341 --15701
NM_002264chr343934 1989 632 443 --23536 1358 14663
NM_002270chr585325 3892 2201 1921 1590 870 296 45 15311 ----
NM_002310chr566433 6278 4499 757 562 23 --12542 11762
NM_002481chr1117788 7743 7640 6301 5504 4895 3166 1908 1902 1342 135 --12506 --
NM_002655chr854501 4371 3333 830 71 --23264 186 14007
NM_002745chr2274546 4392 1728 1681 279 252 183 33639 2769 966 ----
NM_002839chr983192 2649 2415 2353 998 778 502 364 1511 ----
NM_002886chr365184 4831 3981 3611 1521 925 11146 11188 15055
NM_003199chr1865244 5005 4917 4240 3573 671 --15467 12190
NM_003262chr365005 4194 1278 895 569 146 25231 4588 ----
NM_003413chrX11683 ----2564 513
NM_003574chr1874886 2195 1920 1294 869 316 185 34676 3641 1182 ----
NM_003583chr1241156 840 638 253 32456 1443 1376 13882 11131
NM_003774chr1253279 3176 2997 2951 2062 22516 1090 11358 --
NM_003913chr664220 3933 3178 1501 1325 751 32908 2725 523 ----
NM_003994chr1253429 3318 2956 1118 1072 22784 986 14181 --
NM_004171chr1178476 8102 7221 3429 2308 2292 960 27057 2121 1834 --
NM_004338chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_004500chr1441946 1690 1418 393 11755 --1357
NM_004622chr251871 1781 242 232 212 22168 641 ----
NM_004660chrY52184 2121 1475 764 247 12211 --12272
NM_004834chr262838 2243 2203 1160 999 241 --23017 1308 --
NM_004866chr584725 4508 3559 3536 482 273 260 192 23396 834 ----
NM_004992chrX128361 8276 6419 6239 5421 5409 3337 2305 2217 2001 1058 401 28456 131 26722 6507 --
NM_004992chrX128361 8276 6419 6239 5421 5409 3337 2305 2217 2001 1058 401 28456 131 26722 6507 --
NM_005121chr1773657 3514 3271 1042 1010 917 895 ----12663
NM_005156chr984965 4825 3621 3583 3409 1568 1286 320 34872 4080 45 15308 --
NM_005188chr11118236 7384 6586 5952 5881 2986 1611 1449 465 230 27 15028 32076 1587 1133 --
NM_005235chr287407 6420 4809 3056 2947 2792 1878 973 17564 11328 --
NM_005277chr441718 1364 394 156 1407 --1771
NM_005339chr473543 3282 2714 908 885 290 284 23431 2658 ----
NM_005504chr1265917 5663 4325 1551 912 280 --15104 --
NM_005596chr966184 5301 4646 4112 1092 631 35965 4292 1756 15716 1466
NM_005840chrX57066 5792 5213 318 207 --16224 11311
NM_005901chr1868516 5764 3323 2314 1242 364 27735 2597 1625 11116
NM_005903chr563915 3778 2089 1212 626 241 ----24244 560
NM_005906chr641568 1267 344 333 ----1378
NM_005909chr563996 3598 2682 1137 695 545 ----12981
NM_005941chr853203 2687 1122 241 216 13688 13465 --
NM_005999chr151282 539 406 348 116 21086 71 ----
NM_006016chr642261 1789 1441 370 2462 357 ----
NM_006095chr443914 3088 1281 391 13823 13449 2564 544
NM_006420chr20144 22855 699 --22165 632
NM_006482chr1241156 840 638 253 32456 1443 1376 13882 11131
NM_006599chr16168143 7975 6569 6560 6356 5424 5237 2985 2902 2655 2616 2372 1623 693 513 406 37156 5100 1822 ----
NM_006609chr242502 472 420 255 31893 295 275 1872 --
NM_006626chr932596 2551 2504 ----12409
NM_006654chr1274507 1776 1764 1645 848 563 418 11671 1963 --
NM_006750chr1698126 7211 6485 6467 3226 2799 1650 751 413 12126 ----
NM_006838chr12--31916 1220 759 11256 11438
NM_006873chr252312 1320 1199 144 134 1685 ----
NM_006918chr1175736 5360 4267 3921 1446 841 230 --15714 --
NM_006948chr2142226 2135 2100 983 3903 559 517 ----
NM_007038chr2164476 4458 3872 1731 609 104 11766 16103 11071
NM_007114chr333006 2979 2865 ----13129
NM_007187chr131863 1851 1222 1947
NM_007249chr13109010 8916 8688 8623 7101 3600 2871 2387 1272 435 --13028 --
NM_007347chr1542576 801 783 208 22407 948 --13207
NM_007373chr1041801 1509 1187 540 --11287 11193
NM_012137chr182901 2873 2507 1991 1115 471 318 287 ------
NM_012218chr1952182 1964 667 408 400 12714 12366 1268
NM_012234chr363030 2830 2454 2323 1258 1158 --33079 803 428 --
NM_012262chr154440 4322 3969 1622 723 11117 14565 1764
NM_012316chr184164 3958 3754 3675 2102 2013 731 365 33736 1236 632 ----
NM_013255chr7106946 6627 6299 6132 3201 2996 2676 2378 1118 781 25784 1491 ----
NM_014005chr572207 956 662 572 352 237 167 22040 364 ----
NM_014021chr173155 2974 1335 1302 1115 587 369 1203 1432 --
NM_014048chr1654037 3760 3252 3243 1772 34840 3630 267 1528 24582 180
NM_014112chr864675 3588 1128 959 725 523 14393 --13929
NM_014155chr1175806 5321 4809 2959 2030 2002 292 ------
NM_014331chr466833 6697 6218 1306 715 171 11992 ----
NM_014333chr1182638 2447 2157 1752 557 549 506 269 1276 ----
NM_014423chr545470 1683 1252 1073 24098 2059 --13583
NM_014445chr331886 1667 267 192 --12036
NM_014504chr761389 806 701 689 590 508 11761 11859 --
NM_014616chr331099 287 53 22313 363 --11349
NM_014637chr82249 107 1101 --186
NM_014701chr1542714 2148 1293 889 22651 2592 1528 12189
NM_014721chr6117148 7062 7001 6672 6360 5875 5413 2896 2407 1986 1055 22522 485 ----
NM_014730chr12104622 4165 4036 1789 1207 1152 733 673 599 199 14636 ----
NM_014730chr12104622 4165 4036 1789 1207 1152 733 673 599 199 14636 ----
NM_014739chr664129 3462 3328 1643 1309 1107 --12823 --
NM_014774chr183197 3154 2960 2534 2373 2014 1134 195 1784 ----
NM_014877chr1787306 6869 6630 6208 4772 3015 2262 2165 46930 6083 1924 849 11581 --
NM_014906chr1762684 1317 1207 926 343 309 --34041 3332 1120 --
NM_014982chr1444792 4187 4054 3569 15246 34943 2025 1043 --
NM_015026chr1233210 1435 362 22939 1849 --1148
NM_015049chr252684 2593 2022 252 217 23012 301 13081 --
NM_015138chr1532666 2620 849 22228 322 1536 11816
NM_015247chr1695217 5036 3962 3741 3640 1535 1093 971 337 ------
NM_015271chr474236 3421 3064 1734 1509 1357 583 ------
NM_015336chr1222138 2117 --2627 351 11679
NM_015365chrX73916 3296 2845 1684 867 639 457 11162 12897 --
NM_015458chr864498 3742 3335 3272 3260 72 33667 1352 1144 --11216
NM_015532chr152987 363 22136 257 --12415
NM_015888chr173232 2129 1108 1020 852 316 302 22866 356 ----
NM_016021chr642895 1017 558 538 --11139 1138
NM_016255chr652930 2913 803 453 418 22445 2170 12056 --
NM_016260chr266022 4987 2892 2810 514 377 32372 1260 586 ----
NM_016271chr1871695 1558 864 807 687 122 113 1757 ----
NM_016396chr1582570 2284 2149 998 935 659 573 532 ------
NM_016530chr1593787 3302 3049 1437 1382 1209 1007 999 868 --22593 949 --
NM_016824chr1051615 1306 701 644 433 ----1762
NM_017420chr1463568 3105 2641 2451 2370 277 23286 628 ----
NM_017447chr2173846 3474 3441 3266 1480 1303 731 14015 14120 --
NM_017628chr42761 387 55049 4719 3857 1691 802 13633 11944
NM_017637chr969044 8481 7942 6094 5906 3397 37163 2188 895 43677 2828 1776 1559 --
NM_017650chr765522 4779 4248 2301 820 380 35059 2359 1202 ----
NM_017658chr1443754 913 880 770 21447 782 --33845 981 832
NM_017736chr1663037 3024 2129 897 883 632 2927 652 22835 444 --
NM_017761chr13475 230 25 ----1389
NM_018036chr1464248 1439 1400 813 493 126 --13010 --
NM_018155chr373032 2546 2305 2187 2099 773 607 21356 178 ----
NM_018254chr13689 232 165 22299 1903 --11965
NM_018364chr133042 542 501 13002 --1400
NM_018429chr562116 1949 1808 1065 614 604 1877 ----
NM_018440chr8108388 8103 6976 6879 3179 3079 2789 2566 1358 105 35394 2223 803 1157 --
NM_018638chr12155590 5569 5088 3915 3888 3849 3676 1402 1081 1025 1012 985 940 780 543 24570 412 1431 --
NM_018947chr71563 1211 35016 1765 179 14700
NM_018948chr12441 139 21333 1008 --1474
NM_019094chr1283271 3034 2603 970 878 870 292 218 11413 ----
NM_019903chr1051615 1306 701 644 433 ----1762
NM_020141chr151955 1876 1592 387 90 ----1896
NM_020228chr1152511 2233 1630 467 112 1475 21729 969 --
NM_020245chr693187 3146 2016 1943 1856 1675 1520 1112 227 ------
NM_020718chr1676346 6226 5797 5622 4776 1999 1910 31670 1559 1155 24803 2435 --
NM_020766chrX104103 3619 3274 3195 2886 1721 1089 824 470 260 14609 1190 --
NM_020772chr17157885 7736 7652 6796 6213 6145 5540 5436 5311 5299 2547 1955 1839 1703 742 --28561 8235 --
NM_020774chr1875954 4818 2284 2128 1641 1481 805 15076 --15260
NM_020841chr1243744 3162 1211 1178 22547 1406 21285 931 13453
NM_020871chrX51949 1938 1651 747 554 32159 677 525 ----
NM_020921chr1453690 3530 2529 2462 2387 31288 1039 60 ----
NM_020948chr183666 3001 2923 2589 2574 2480 1403 268 22413 2380 ----
NM_021072chr552253 788 518 221 213 11693 12002 --
NM_021127chr1871417 1326 1260 604 545 465 435 11394 1394 --
NM_021190chr181087 1057 933 535 401 366 246 66 11346 ----
NM_021255chr14103630 3262 2863 2716 1655 1639 1606 1508 625 395 13761 --13747
NM_021647chr453963 3893 3851 3781 946 24561 4139 21709 503 --
NM_021813chr684948 4186 1149 1129 945 669 263 55 22067 910 ----
NM_021961chr1157135 2258 2210 1249 402 27200 6348 25385 1264 --
NM_022456chr1286470 2645 1379 1370 1141 923 913 184 23053 1801 ----
NM_022763chr352534 1028 760 553 444 12908 1889 1352
NM_022918chr1141578 347 105 94 ----11844
NM_024607chr884328 4245 3084 2994 2851 1293 615 176 13574 ----
NM_024665chr364583 4411 4174 3731 643 492 31705 1400 403 14497 --
NM_024920chr461299 415 396 390 296 195 ------
NM_024947chr369375 6422 6233 5922 1639 748 68230 7479 6350 2684 1566 449 13561 15857
NM_024989chr298128 7345 6318 6174 5932 5192 1950 1329 41 76920 5861 5606 3103 2356 1664 326 46387 2106 797 789 --
NM_025191chr153291 3241 2459 2444 564 33203 2482 342 13567 --
NM_030648chr474372 1532 1265 1038 346 336 22 1897 ----
NM_030762chr1231663 1249 580 1565 --11675
NM_030816chr133288 1401 90 1925 12853 1517
NM_030817chr1273672 3143 3058 2956 755 514 211 12536 23153 1484 --
NM_031314chr1441946 1690 1418 393 11755 --1357
NM_031427chr1475226 4890 4354 1853 338 246 161 35302 2304 2045 ----
NM_031483chr2083532 3359 3152 3099 1356 1016 660 494 13313 12311 --
NM_031490chr162424 216 1183 --1157
NM_032160chr1854171 3378 3191 3127 88 13789 2513 123 --
NM_032446chr573789 3620 3111 2831 623 178 106 ----13673
NM_032457chr443632 2447 396 153 --33687 1279 1088 --
NM_032859chr1331463 238 213 ----13783
NM_032968chrX53642 3540 497 424 404 33858 1496 699 33970 3363 784 11023
NM_032969chrX53642 3540 497 424 404 33858 1496 699 33970 3363 784 11023
NM_032973chrY53634 3536 497 424 404 33850 1496 699 33962 3358 784 11023
NM_033224chr777381 6172 5152 3145 2404 1162 546 66999 6773 6120 4929 2241 1509 ----
NM_033656chr2185559 5146 4724 4386 2153 2068 1324 1056 ------
NM_052832chr862908 2731 2214 2001 242 89 12823 22021 236 --
NM_052885chr1284860 4150 3945 3464 1774 762 295 24 33705 3278 3189 ----
NM_080743chr622405 1645 22126 1727 --1906
NM_130391chr983192 2649 2415 2353 998 778 502 364 1511 ----
NM_130392chr983192 2649 2415 2353 998 778 502 364 1511 ----
NM_130393chr983192 2649 2415 2353 998 778 502 364 1511 ----
NM_133370chr483634 2867 2683 2669 2648 1072 860 651 --13491 2628 406
NM_133445chr953810 3783 3557 2805 1235 --13491 1630
NM_138270chrX83249 2750 2430 2354 1169 724 699 248 1909 --12589
NM_138426chr742062 1578 834 516 22494 299 --1884
NM_138444chr1364515 3920 1854 1277 372 318 24092 3279 --1597
NM_138494chr742816 2313 451 108 12488 12472 1385
NM_138713chr16168143 7975 6569 6560 6356 5424 5237 2985 2902 2655 2616 2372 1623 693 513 406 37156 5100 1822 ----
NM_138714chr16168143 7975 6569 6560 6356 5424 5237 2985 2902 2655 2616 2372 1623 693 513 406 37156 5100 1822 ----
NM_139168chr551722 1638 714 708 567 21983 1632 ----
NM_139169chr1062081 880 556 389 364 299 12198 ----
NM_139283chr1232048 940 623 --1279 11704
NM_144571chr485749 5494 5461 5387 1741 1151 803 353 46462 6325 4543 2540 21886 521 --
NM_144578chr1465291 4019 2017 1665 1038 622 65374 4184 4054 3582 1550 597 11190 --
NM_144599chr1575231 5148 4832 4684 4259 3813 659 14410 ----
NM_145055chr1853338 3187 2980 1446 342 13722 2812 772 --
NM_145259chr265429 4966 4899 2729 1746 835 16718 ----
NM_145686chr262838 2243 2203 1160 999 241 --23017 1308 --
NM_145687chr262838 2243 2203 1160 999 241 --23017 1308 --
NM_152608chr172376 2261 1823 1028 985 895 658 1110 ----
NM_152624chr5137476 7392 6606 5632 5103 5095 4538 2761 2325 1213 793 541 211 46782 6147 5086 2384 15208 1219
NM_152630chrX31305 439 417 11264 --1481
NM_152756chr563641 3329 3077 1616 863 246 24070 2773 ----
NM_152999chr744665 4074 3930 1599 34005 1811 736 172 --
NM_153188chr585325 3892 2201 1921 1590 870 296 45 15311 ----
NM_153207chr1263157 2852 2540 348 189 71 1358 12900 --
NM_170710chr442944 2879 532 146 23020 3006 --1545
NM_173214chr16168143 7975 6569 6560 6356 5424 5237 2985 2902 2655 2616 2372 1623 693 513 406 37156 5100 1822 ----
NM_173468chr485122 4694 4656 1528 1503 1473 1432 1163 22089 1322 ----
NM_173531chr1983228 3010 2868 2804 2780 2755 2695 1433 ------
NM_173582chr1155691 2348 1584 1198 548 --12335 15589
NM_173670chr52299 245 --2911 701 1223
NM_173808chr164231 1301 875 602 395 305 23628 1599 ----
NM_173829chr565194 4262 1655 1057 713 495 25046 891 --15223
NM_173851chr831380 848 141 --13918 12992
NM_174916chr1552269 2205 2044 1746 1567 11561 1378 --
NM_175623chr1286470 2645 1379 1370 1141 923 913 184 23053 1801 ----
NM_175854chr1362767 2335 2003 986 830 135 ----1495
NM_178011chr1032702 620 403 ----13198
NM_181265chr442944 2879 532 146 23020 3006 --1545
NM_181358chr173620 3460 3255 3100 1582 572 263 24221 977 13381 --
NM_181481chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_181482chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_181483chr1886734 5928 5580 4953 4869 2435 2170 1680 36311 5381 998 35749 1164 86 --
NM_181504chr593532 3323 1551 1489 1395 842 588 446 35 1698 ----
NM_181521chr1685891 5716 4999 4791 1344 1270 757 94 22036 1627 11194 --
NM_181523chr593532 3323 1551 1489 1395 842 588 446 35 1698 ----
NM_181524chr593532 3323 1551 1489 1395 842 588 446 35 1698 ----
NM_181705chr564681 4198 1248 1178 737 410 ------
NM_181787chr833165 1518 784 33555 2521 1285 21228 1205 --
NM_182493chr1664474 3986 3800 2163 1882 370 34950 4081 1069 ----
NM_182515chr1965708 5547 5513 4468 2211 2161 35208 2587 2409 15527 --
NM_182620chr1772019 1969 1835 1829 1421 379 195 21654 388 ----
NM_182762chr754794 4428 1317 537 354 35746 2285 1408 14232 --
NM_194247chr273872 3659 1417 1207 822 789 187 1420 23767 403 --
NM_194291chr852422 1071 714 692 504 ----1191
NM_194314chr195585 5412 4464 4318 2003 1695 1410 335 233 ------
NM_194434chr1874886 2195 1920 1294 869 316 185 34676 3641 1182 ----
NM_198128chr1871695 1558 864 807 687 122 113 1757 ----
NM_198268chr173620 3460 3255 3100 1582 572 263 24221 977 13381 --
NM_198269chr173620 3460 3255 3100 1582 572 263 24221 977 13381 --
NM_198465chrX42877 2808 1053 88 1101 1453 --
NM_198468chr654570 3512 3387 3152 242 23788 2892 1873 --
NM_198581chr227250 318 46589 2075 1839 233 1353 17334
NM_199040chr1283271 3034 2603 970 878 870 292 218 11413 ----
NM_199437chr1152511 2233 1630 467 112 1475 21729 969 --
NM_199438chr1152511 2233 1630 467 112 1475 21729 969 --
NM_199439chr1152511 2233 1630 467 112 1475 21729 969 --
NM_201591chr441718 1364 394 156 1407 --1771
NM_201592chr441718 1364 394 156 1407 --1771
NM_203329chr1166996 6316 5881 5522 4536 830 11135 --12576
NM_203330chr1166996 6316 5881 5522 4536 830 11135 --12576
NM_203331chr1166996 6316 5881 5522 4536 830 11135 --12576
NM_203406chr542258 2008 1128 397 31116 873 644 --11049
NM_203458chr142570 2361 1273 977 13234 --12994
NM_206594chr163618 2866 2859 2565 870 411 --187 --
NM_206595chr163618 2866 2859 2565 870 411 --187 --
NM_206853chr642881 2770 1276 439 12543 2835 164 14086
NM_206854chr644142 4031 3265 1700 13804 33332 2096 1425 15347
NM_206855chr655107 4996 4230 3915 713 24769 770 34297 2390 196 16312
NM_206866chr2152935 2553 2179 722 421 42652 652 603 112 11217 --
NM_207303chr1064020 3729 3375 2812 2587 1124 ----22853 1419
NM_207647chr962493 2409 1978 1671 647 412 11864 --12254