TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4725-3p
miRNA Sequence: UGGGGAAGGCGUCAGUGUCGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr144900 694 143 130 ------
NM_000024chr53507 373 212 --1438 --
NM_000034chr161167 ------
NM_000037chr862514 1966 1915 1823 464 137 1431 12191 --
NM_000038chr521581 281 12084 11642 --
NM_000051chr111671 11201 22213 1224 13229
NM_000061chrX2163 32 ----139
NM_000068chr1931176 611 114 --11182 --
NM_000074chrX4778 676 640 358 --1658 --
NM_000075chr123216 187 45 --1230 --
NM_000080chr172926 149 123 193 1612
NM_000084chrX115857 5368 4442 2537 2099 1996 1900 1760 826 722 128 26674 4855 15830 12220
NM_000088chr1751288 1266 1146 1117 406 1372 147 --
NM_000090chr23810 161 55 ------
NM_000092chr2113958 3615 3596 3153 3115 3051 2917 2876 482 60 42 23123 884 --11488
NM_000093chr992274 2188 2113 1906 1633 968 950 541 413 --22129 105 --
NM_000104chr24613 535 98 82 ------
NM_000109chrX41924 1066 930 848 --1592 --
NM_000134chr41422 ------
NM_000138chr1532315 201 66 12292 --1378
NM_000141chr1031034 942 307 ----1185
NM_000142chr421579 512 ----1506
NM_000153chr1421673 1565 1231 142 --
NM_000163chr511885 32111 1942 139 ----
NM_000165chr62416 299 11487 ----
NM_000168chr7103238 3219 2429 2371 2329 2299 2240 2066 593 442 12105 12832 1973
NM_000176chr543456 3144 1196 1098 13388 --1634
NM_000188chr10141 1696 1485 --
NM_000192chr1231339 569 530 1365 1312 --
NM_000202chrX103297 3240 2635 2522 2488 2460 2439 1562 1156 232 --52673 2614 2450 2416 1479 --
NM_000208chr19101887 1875 1750 1395 1066 761 728 394 286 49 33178 2924 562 14536 --
NM_000216chrX73873 3823 3149 789 618 482 315 31435 801 212 ----
NM_000217chr1295227 5221 4966 3819 3593 3447 2062 1954 640 23662 3406 13354 44178 3790 2032 318
NM_000221chr2--2306 149 2227 61 1213
NM_000222chr431681 1589 295 ----21503 307
NM_000232chr442673 2393 2194 155 11155 ----
NM_000238chr7----1154 --
NM_000240chrX5839 748 669 627 324 --2845 428 --
NM_000248chr32355 39 --12395 --
NM_000258chr31244 ------
NM_000259chr1596370 4626 4017 4004 2474 2247 1938 1870 906 45744 5543 4913 536 35034 5023 4889 14161
NM_000264chr993360 3305 3132 2876 2332 2077 900 575 63 12145 --1245
NM_000267chr1793457 3291 2589 2392 2141 899 882 385 105 23444 768 53476 2936 1123 80 64 --
NM_000268chr22123683 2875 2365 2321 1382 1089 1015 918 816 511 436 254 23535 2964 53473 2606 980 128 37 1787
NM_000280chr11------1690
NM_000284chrX41713 1499 1284 282 11564 ----
NM_000286chr172307 89 ------
NM_000314chr10----1281 1915
NM_000319chr1231035 404 64 --2991 370 --
NM_000330chrX51798 1522 1508 735 611 1195 ----
NM_000332chr6105951 5916 5801 5554 5470 4885 2837 2304 661 289 16505 26168 5676 12871
NM_000334chr1762031 1943 1905 1808 674 562 ------
NM_000335chr352196 1780 1716 733 96 11829 31770 848 655 --
NM_000345chr42866 747 --1183 --
NM_000346chr1741919 1589 144 81 31337 1226 706 11965 --
NM_000362chr2293545 3405 2268 1419 1292 817 274 69 38 1646 83422 2883 1424 844 413 401 51 30 21217 373
NM_000365chr123139 112 27 1287 176 --
NM_000367chr642281 2180 1454 476 1818 ----
NM_000368chr973722 1905 1405 620 517 287 79 31038 805 268 94693 4367 4358 4240 1911 717 376 292 197 --
NM_000369chr1441935 1361 457 341 11400 ----
NM_000378chr11----1323 --
NM_000386chr172564 21 ------
NM_000391chr11101665 1461 1330 1182 1146 596 506 454 431 388 2345 216 31580 1112 526 --
NM_000393chr241934 1323 741 364 ------
NM_000394chr214417 112 104 82 --2433 92 --
NM_000399chr103170 149 89 --1331 --
NM_000411chr2152971 2529 2029 671 88 12862 ----
NM_000412chr31270 ------
NM_000430chr1723432 36 23619 788 13096 --
NM_000435chr195868 259 180 104 76 --1267 1253
NM_000439chr5122435 2272 2059 1829 1613 1561 735 724 417 221 135 44 1505 --1814
NM_000448chr1152496 2222 2138 389 44 22709 960 169 --
NM_000449chr181357 1103 1045 1017 941 238 114 78 1538 11059 --
NM_000451chrX21858 460 --31883 1770 315 --
NM_000452chr1331887 1685 261 21970 1771 11312 2805 586
NM_000461chr374278 3629 3582 1711 1295 1154 195 34362 4329 1429 22966 1094 1792
NM_000462chr1531805 1686 1286 ------
NM_000474chr7----1528 --
NM_000476chr941285 607 552 268 --1331 122
NM_000478chr13747 491 49 ----1174
NM_000488chr1128 ------
NM_000489chrX63065 3001 2478 1055 293 173 32918 2255 427 13046 --
NM_000500chr66481 432 379 372 154 40 --1119 --
NM_000503chr831717 1383 1328 11470 --1349
NM_000505chr5----123 --
NM_000516chr201231 --2122 116 --
NM_000530chr131092 848 357 1341 1268 --
NM_000533chrX51611 1381 749 334 256 --21832 761 --
NM_000538chr132258 215 ------
NM_000544chr6_cox_hap1133304 3261 3243 3124 2746 2444 917 556 492 481 372 208 28 175 1999 32476 1190 746
NM_000554chr1943315 545 412 162 --22879 65 13288
NM_000555chrX117545 6978 6106 5607 5581 5541 5019 1618 783 341 175 26669 3087 37653 5661 2700 25821 2779
NM_000557chr204419 190 51 23 ------
NM_000587chr53981 266 162 21105 451 1119 1104
NM_000598chr72248 206 --11508 --
NM_000599chr273466 3189 2855 1169 1120 1023 675 43879 1229 773 497 54051 3296 2995 608 23 33247 1680 1088
NM_000602chr711015 --11179 --
NM_000615chr1122900 289 --1894 --
NM_000618chr12156346 5786 5639 5598 5398 5284 4945 4699 4678 4221 2618 2330 803 348 130 22027 1280 ----
NM_000618chr12156346 5786 5639 5598 5398 5284 4945 4699 4678 4221 2618 2330 803 348 130 22027 1280 ----
NM_000620chr12132135 2040 2021 1988 1893 1877 1399 409 338 159 140 126 65 12079 1506 --
NM_000627chr21677 ------
NM_000633chr1855226 4824 2106 1263 376 ------
NM_000680chr8155 ------
NM_000681chr106914 904 398 273 242 115 --11176 11142
NM_000684chr103508 316 38 --21248 435 --
NM_000685chr34765 684 173 60 ------
NM_000685chr34765 684 173 60 ------
NM_000686chrX41207 520 361 96 --11356 --
NM_000719chr12146563 6276 6192 6062 5927 5780 5272 4765 4447 2647 2378 2174 1908 308 46431 5109 4337 2349 56322 5330 4420 2142 2136 32360 2035 791
NM_000721chr1102683 2526 2241 2116 1988 1891 1686 312 190 33 --62656 2330 1738 1675 525 300 --
NM_000723chr173503 308 256 --31288 493 367 2451 433
NM_000724chr1011452 1382 11384 --
NM_000726chr221061 1051 1316 ----
NM_000738chr115985 222 164 133 112 ------
NM_000756chr81434 ------
NM_000788chr461061 980 554 352 317 304 ----1333
NM_000791chr552143 971 953 376 33 1129 --1192
NM_000793chr1475032 4279 4203 3649 3339 1271 1075 13922 44537 3978 3367 1454 14631
NM_000794chr51127 ----1917
NM_000795chr116932 917 893 760 311 34 --2938 322 --
NM_000800chr561389 669 423 389 358 77 11346 ----
NM_000801chr2061009 994 799 782 199 186 --21066 192 --
NM_000806chr511546 11284 ----
NM_000809chr4178561 8550 8027 7654 7144 6854 6815 6339 5620 3224 3172 2842 2645 2587 2525 2229 1539 58650 3553 3348 3248 376 46830 5696 1181 580 38795 6068 3607
NM_000812chr43383 314 35 ------
NM_000813chr563810 2130 2080 1631 370 38 22115 2105 ----
NM_000814chr1553396 3253 3027 955 559 ----12723
NM_000817chr23985 294 42 21251 459 ----
NM_000818chr104476 400 75 31 ------
NM_000831chr145911 4614 973 908 --14423 1767
NM_000833chr1641386 1265 1123 1011 11337 ----
NM_000834chr1211054 1405 31299 316 217 --
NM_000837chr8----3527 366 86 --
NM_000838chr662007 1092 966 851 714 237 --1563 --
NM_000844chr331061 1055 93 --1113 1245
NM_000855chr11----1338 --
NM_000861chr362586 1731 1030 571 559 368 1599 ----
NM_000864chr11953 ----1962
NM_000868chrX32618 289 268 1842 12525 --
NM_000870chr581338 1161 998 631 558 239 152 110 1224 ----
NM_000872chr1021416 311 2557 489 1146 --
NM_000875chr15146003 5873 5841 4896 2606 2410 2220 1405 954 634 609 324 211 151 14616 66417 2156 1726 1398 846 317 --
NM_000876chr631231 449 173 ------
NM_000880chr83912 303 93 ------
NM_000883chr72618 121 1111 2626 485 --
NM_000883chr72618 121 1111 2626 485 --
NM_000891chr17103632 3335 3266 3256 2994 2967 2948 993 662 321 13601 ----
NM_000898chrX3779 678 165 2593 572 ----
NM_000899chr1273772 3506 1686 1543 1433 813 609 ------
NM_000903chr162289 54 --164 --
NM_000919chr5----158 --
NM_000924chr1251087 467 416 320 309 11354 11129 --
NM_000933chr2031650 1443 1384 ------
NM_000935chr321133 1021 11095 11068 --
NM_000944chr421656 678 12214 --11781
NM_000945chr231317 658 541 --21706 1387 144
NM_000949chr53778 731 625 3962 800 153 ----
NM_000956chr141284 ------
NM_000958chr53998 854 482 ------
NM_000963chr11760 ------
NM_000964chr1741375 1181 1173 461 1944 21337 128 --
NM_000965chr33955 383 256 131 ----
NM_000966chr122299 174 --3938 884 340 --
NM_000983chr131307 529 371 --1130 --
NM_000984chr17----1438 --
NM_001001132chr2131288 541 275 --21336 298 --
NM_001001323chr1222872 788 ------
NM_001001331chr352479 1835 1078 268 58 21861 253 21906 900 11912
NM_001001344chrX42183 2049 1589 730 1332 ----
NM_001001395chr1222662 2234 11889 12558 --
NM_001001396chr1143982 3909 3881 3680 3672 3664 3427 3262 3110 1783 1754 1458 614 602 22913 768 83827 3545 3319 3071 2979 1692 947 862 13736
NM_001001419chr554789 4303 1962 1625 386 11082 13501 --
NM_001001420chr554789 4303 1962 1625 386 11082 13501 --
NM_001001433chr2012028 32389 699 546 12555 22829 155
NM_001001481chr873420 3151 2782 2628 895 327 124 1724 ----
NM_001001484chr104844 625 297 147 1500 ----
NM_001001502chr51109 --190 --
NM_001001549chr752569 2206 2150 1793 603 --11908 --
NM_001001550chr752569 2206 2150 1793 603 --11908 --
NM_001001555chr752569 2206 2150 1793 603 --11908 --
NM_001001557chr832226 2179 171 --21587 1520 --
NM_001001684chr1732352 1793 225 1329 ----
NM_001001701chr462308 2268 2184 2135 1487 127 --1636 --
NM_001001787chr11184 ------
NM_001001890chr2163992 3062 2981 2854 2786 626 --54248 2944 2830 2800 1110 --
NM_001001938chr9123800 3571 3474 3349 3188 3118 3077 2714 2614 1598 1235 1090 11441 1316 11290
NM_001001995chrX41805 1588 680 549 ------
NM_001002026chr332066 1641 1511 1372 31717 931 338 --
NM_001002233chr862155 2001 1824 1725 1586 539 1868 ----
NM_001002243chr2------154
NM_001002252chr122297 228 --188 132
NM_001002269chr9------1164
NM_001002762chr1022509 938 32149 524 381 12260 12591
NM_001002838chrX51786 692 439 321 101 --179 --
NM_001002860chr1444020 1862 619 552 --11682 13367
NM_001002909chr1792119 2072 1591 1489 1388 433 371 334 55 --1345 --
NM_001003406chr2242648 2257 1303 1226 --53217 2935 2875 2855 2653 --
NM_001003652chr1888494 8303 7384 7199 6294 2710 726 454 58041 7499 6846 5975 3456 17402 27645 2228
NM_001003674chr1886558 4686 4618 2816 2514 1943 1146 448 --34707 4305 2313 11432
NM_001003675chr1886558 4686 4618 2816 2514 1943 1146 448 --34707 4305 2313 11432
NM_001003681chr222525 259 11389 31575 1570 1488 --
NM_001003694chr33588 566 43 ----1578
NM_001003698chr641746 1666 1364 1237 171 31671 1636 1492 --
NM_001003699chr641746 1666 1364 1237 171 31671 1636 1492 --
NM_001003760chr683232 2890 2600 1089 668 526 406 345 43311 2525 2516 1114 1674 --
NM_001003786chr17162 2666 27 1464 2616 585
NM_001003787chr17162 2666 27 1464 2616 585
NM_001003788chr17162 2666 27 1464 2616 585
NM_001003792chr321134 447 ----1420
NM_001003793chr321134 447 ----1420
NM_001003794chr3122479 2298 2062 2021 1911 1198 1028 1002 746 663 380 68 12150 32831 681 442 1542
NM_001003800chr9113557 3287 3135 1509 1221 1177 1140 1106 775 397 181 --11329 23293 576
NM_001003805chr14166 ------
NM_001003810chr41584 1620 1256 --
NM_001003891chr222112 83 --1247 --
NM_001003940chr1542980 2384 565 499 12541 73854 2761 2508 1429 1248 1175 1032 12400
NM_001003942chr1542980 2384 565 499 12541 73854 2761 2508 1429 1248 1175 1032 12400
NM_001003943chr1542984 2388 569 503 12545 73858 2765 2512 1433 1252 1179 1036 12404
NM_001004065chr933348 1382 424 33645 488 439 1557 12561
NM_001004317chr663741 1349 1027 624 569 25 --21639 909 --
NM_001004329chr121378 ------
NM_001004342chr1185814 5352 4387 4169 2225 2101 1873 1614 1432 1248 845 792 781 769 742 730 714 643 --95829 4505 1410 1314 833 816 747 701 682 --
NM_001004354chr94801 360 219 59 1920 3815 768 763 --
NM_001004356chr411266 --21547 1048 --
NM_001004358chr411266 --21547 1048 --
NM_001004419chr1254314 4253 3532 1331 271 24071 3585 24335 1533 14357
NM_001005217chr42454 64 ------
NM_001005242chr1241591 669 261 109 ------
NM_001005266chr152494 235 --1209 --
NM_001005267chr152494 235 --1209 --
NM_001005268chr152494 235 --1209 --
NM_001005269chr152494 235 --1209 --
NM_001005271chr1731166 353 303 1179 21044 275 31081 198 95
NM_001005273chr1731166 353 303 1179 21044 275 31081 198 95
NM_001005335chr19150 ------
NM_001005340chr72858 744 ------
NM_001005366chr121767 --1884 --
NM_001005375chrY--11183 --21399 479
NM_001005377chr19----157 --
NM_001005386chr22457 286 --1514 1206
NM_001005404chr17104261 3659 3504 3012 1585 1075 970 643 222 61 33375 1223 1146 11337 14267
NM_001005463chr1032088 731 714 ----32435 1048 865
NM_001005473chr5116496 5986 5842 5003 4922 4836 2301 2293 2285 1105 84 65699 5674 5196 4892 4335 198 35641 2307 1475 --
NM_001005502chr12104919 4422 4295 3442 3432 2045 1846 1160 1143 119 24560 969 21702 1236 12032
NM_001005505chr331632 1248 327 ----157
NM_001005609chrX113668 3463 3139 3026 2567 2449 2417 1422 777 603 175 32610 838 140 43848 3446 1405 37 --
NM_001005741chr11392 --1157 --
NM_001005742chr11392 --1157 --
NM_001005746chr221061 1051 1316 ----
NM_001005747chr221061 1051 1316 ----
NM_001005753chr252151 2064 1675 775 661 11862 --11707
NM_001005782chr22327 28 ------
NM_001005845chr851711 379 189 51 40 1203 ----
NM_001005849chr172561 134 ----1143
NM_001005920chr16----1724 11090
NM_001006115chr382637 2586 2126 1893 1815 1747 697 458 42463 918 627 417 42251 1127 408 32 1834
NM_001006600chr542001 1683 541 430 ------
NM_001006605chr121127 821 21179 909 1112 --
NM_001006605chr121127 821 21179 909 1112 --
NM_001006636chr2155 2887 821 ----
NM_001006665chr13546 189 59 --1167 2768 174
NM_001006933chrX----158 --
NM_001006946chr261459 1226 526 233 179 60 1280 --21393 614
NM_001007023chr1475032 4279 4203 3649 3339 1271 1075 13922 44537 3978 3367 1454 14631
NM_001007024chr1794237 4216 3913 3585 3387 3115 846 548 466 13042 1431 --
NM_001007025chr1794237 4216 3913 3585 3387 3115 846 548 466 13042 1431 --
NM_001007026chr12------1442
NM_001007067chr83343 241 84 ------
NM_001007068chr83343 241 84 ------
NM_001007069chr83343 241 84 ------
NM_001007070chr83343 241 84 ------
NM_001007097chr994075 4023 3974 3639 3556 3108 1830 322 265 14532 13158 11959
NM_001007102chr611465 11136 ----
NM_001007156chr1541581 749 228 168 31885 1725 739 3673 399 200 --
NM_001007246chr2111440 --11195 --
NM_001007277chr1161118 427 303 247 182 74 --1779 --
NM_001007553chr11445 11192 21115 146 --
NM_001007565chr3----1277 --
NM_001008220chr543820 2664 941 303 22518 707 3233 141 125 23787 594
NM_001008222chrX21334 500 2891 259 21168 301 --
NM_001008239chr18103715 2527 2355 1007 660 593 300 139 35 22 13234 2216 149 23298 47
NM_001008272chr31288 --192 --
NM_001008273chr31288 --192 --
NM_001008388chr41108 ------
NM_001008392chr3113576 3389 3377 2819 2639 2622 1160 947 799 386 302 --11346 --
NM_001008393chr472885 2801 2781 2647 2602 2403 562 1781 11813 --
NM_001008408chr7136204 5935 5796 5607 5591 5516 4041 4021 3926 992 679 468 440 34468 1109 130 14131 --
NM_001008410chr261935 1614 856 847 754 686 11783 3802 532 420 22082 435
NM_001008495chr841516 505 438 360 ------
NM_001008541chr1021774 389 --12257 --
NM_001008541chr1021774 389 --12257 --
NM_001008660chr111977 21443 447 ----
NM_001008701chr19102896 2754 2739 2493 2285 1197 1182 1020 521 504 1202 92866 2840 2829 2477 2026 1062 873 848 616 1891
NM_001008711chr831414 529 33 ------
NM_001008726chr1451729 1663 1618 1542 1528 --11651 --
NM_001008738chr562425 2358 2345 1908 1091 89 ------
NM_001008744chr1431248 240 120 11392 186 --
NM_001008925chr443272 2645 601 237 ----11150
NM_001008938chr113389 323 172 ------
NM_001009184chr8----3527 366 86 --
NM_001009554chr443972 3420 1583 433 3658 536 176 21759 1504 --
NM_001009554chr443972 3420 1583 433 3658 536 176 21759 1504 --
NM_001009571chr741570 1556 1489 1354 21599 1198 ----
NM_001009814chr13194 ------
NM_001009880chr2244000 1251 1216 910 23920 1306 64547 4313 3589 1806 888 192 --
NM_001009899chr3105838 5349 5200 4982 2436 2304 1975 1434 748 688 14069 35738 5022 4407 11982
NM_001009923chr201143 --1579 --
NM_001009955chr1------1161
NM_001009955chr1------1161
NM_001010852chr61145 ------
NM_001010853chr652529 917 614 509 475 ------
NM_001010861chr121717 152 1821 1714 --
NM_001010862chrX83132 3112 2684 2151 1100 534 198 71 12953 33106 2604 94 --
NM_001010888chrX43797 3284 3200 1581 --24104 1409 14495
NM_001010891chr536504 6438 5187 25056 2008 ----
NM_001010895chr921976 1359 2498 183 --152
NM_001010898chr173537 2426 1179 1002 852 691 293 --13714 53348 3217 2678 1170 776
NM_001010934chr731133 965 32 11158 ----
NM_001010942chr122177 110 ------
NM_001011513chr453871 2863 2738 1057 345 33949 3120 2705 --1935
NM_001011537chr3--1267 1541 --
NM_001011553chr73754 398 223 ------
NM_001011666chr7136359 5999 5956 5865 5589 4733 4514 2444 2357 2096 1263 680 661 24204 235 11576 2613 492
NM_001011708chr242020 1160 1077 794 ------
NM_001012264chr145957 734 669 192 83 1748 3765 606 239 --
NM_001012393chr1154575 1705 1395 1348 291 34339 4091 3914 54185 3212 2047 889 277 21724 40
NM_001012398chr162959 33 11101 ----
NM_001012415chr91616 188 2731 218 --
NM_001012642chr1552114 1409 752 505 155 --21750 161 134
NM_001012732chr431092 1051 147 ------
NM_001012751chr1041669 1584 710 507 ------
NM_001012755chrX105075 4671 4386 3567 2039 1289 1121 1040 502 445 44393 3230 1144 774 24571 46 11009
NM_001012756chr1922442 2302 22998 2665 ----
NM_001012968chrX41936 1759 348 327 22075 399 ----
NM_001012977chrX81173 1162 1148 986 484 176 167 153 --4524 286 204 199 --
NM_001012989chrX2268 56 --134 --
NM_001013031chr1071303 1068 865 667 480 465 248 11106 2817 697 --
NM_001013398chr72248 206 --11508 --
NM_001013399chr621127 421 ----11162
NM_001013415chr411425 11358 158 1314
NM_001013615chr13793 419 74 --11058 --
NM_001013620chr12108206 7928 7541 5909 2930 2360 1873 1734 1591 753 27604 807 22337 1020 --
NM_001013635chr1241181 1171 296 27 --21056 289 --
NM_001013690chr1251906 1636 1624 1580 934 12191 42370 2122 571 362 --
NM_001013693chr142774 2631 2279 259 --32240 430 236 --
NM_001013693chr142774 2631 2279 259 --32240 430 236 --
NM_001014434chr11644 1826 137 --
NM_001014435chr16142 --2510 87 --
NM_001014797chr10127739 7207 5831 5478 3150 3025 2941 2181 2100 1146 1049 983 --57604 7445 7237 2768 2343 25587 439
NM_001014839chr1--1842 31037 105 66 1823
NM_001014841chr1--1842 31037 105 66 1823
NM_001015045chr44784 571 531 288 12363 1358 2658 551
NM_001015053chr1741229 1118 271 213 1510 31234 568 519 21125 425
NM_001015508chr83699 628 101 --1709 --
NM_001015881chrX21192 57 --2902 457 --
NM_001015882chr91788 2738 112 1156 --
NM_001015887chr351553 1404 622 451 96 --11520 1203
NM_001017368chr1782337 2214 2092 2009 1001 780 285 163 21125 886 2853 308 --
NM_001017371chr2----11088 --
NM_001017395chr363076 3010 2815 2488 1433 811 127 --13142
NM_001017405chr43688 354 334 --166 --
NM_001017424chr151501 578 525 269 47 21858 1579 2531 279 --
NM_001017425chr151501 578 525 269 47 21858 1579 2531 279 --
NM_001017440chr7217959 7448 7395 7388 6551 6251 5758 3241 2818 2649 2576 2493 2156 2146 1866 1628 1614 1425 735 507 489 37647 7000 6019 61917 1737 1516 1062 512 71 37616 1095 851
NM_001017523chr1251324 162 45 37 26 11921 21801 1738 --
NM_001017916chr173812 759 182 21587 529 31702 602 175 --
NM_001017917chr173812 759 182 21587 529 31702 602 175 --
NM_001017923chr142622 30 11411 ----
NM_001017926chr831763 1729 1682 11410 ----
NM_001017970chr1462594 2273 1759 638 231 109 11038 ----
NM_001017981chr223571 245 40 ------
NM_001017992chr531336 108 34 1183 ----
NM_001017995chr564815 4231 1624 1482 1419 1271 21935 86 43132 3051 2953 1876 23378 558
NM_001017999chr142095 1888 377 368 --12275 --
NM_001017999chr142095 1888 377 368 --12275 --
NM_001018000chr142095 1888 377 368 --12275 --
NM_001018000chr142095 1888 377 368 --12275 --
NM_001018001chr142095 1888 377 368 --12275 --
NM_001018005chr15----121 --
NM_001018050chr2272738 2664 2565 2548 2353 1153 252 --23016 2135 --
NM_001018052chr2272738 2664 2565 2548 2353 1153 252 --23016 2135 --
NM_001018056chr9----195 --
NM_001018057chr1151386 451 119 107 94 2178 55 ----
NM_001018064chr92220 28 21783 844 2781 285 --
NM_001018065chr9145909 5853 5736 5328 5295 5079 5039 4897 3955 1728 1423 1374 417 170 45632 2261 845 373 44615 3960 1671 574 2865 623
NM_001018066chr9145909 5853 5736 5328 5295 5079 5039 4897 3955 1728 1423 1374 417 170 45632 2261 845 373 44615 3960 1671 574 2865 623
NM_001018072chr1251324 162 45 37 26 11921 21801 1738 --
NM_001018074chr543456 3144 1196 1098 13388 --1634
NM_001018075chr543456 3144 1196 1098 13388 --1634
NM_001018076chr543456 3144 1196 1098 13388 --1634
NM_001018077chr543456 3144 1196 1098 13388 --1634
NM_001018108chr1571564 727 654 216 154 116 77 62157 1902 866 701 589 511 52033 1821 905 735 159 2599 338
NM_001018111chr782839 1399 1273 1056 1012 586 188 149 22676 1486 21125 558 23530 3394
NM_001020658chr121364 23 --11413 1443
NM_001020658chr121364 23 --11413 1443
NM_001020818chr1991734 388 214 187 139 104 92 81 27 --31880 533 192 --
NM_001020819chr1991734 388 214 187 139 104 92 81 27 --31880 533 192 --
NM_001020820chr1991734 388 214 187 139 104 92 81 27 --31880 533 192 --
NM_001020821chr1991734 388 214 187 139 104 92 81 27 --31880 533 192 --
NM_001023567chr154933 878 735 574 ------
NM_001023587chr331180 849 46 1760 ----
NM_001024094chr543456 3144 1196 1098 13388 --1634
NM_001024218chr142649 86 ------
NM_001024401chr1642881 2677 2550 1039 12113 22813 1894 --
NM_001024455chrX82448 2342 2027 1900 949 833 764 322 22142 2064 22434 970 12458
NM_001024647chr12136676 6538 6500 6079 6058 5603 5589 5096 1955 1058 420 371 110 14678 15070 --
NM_001024649chr572481 2196 1978 1835 1046 913 542 22891 896 136 --
NM_001024666chrX----1541 1183
NM_001024668chr122793 175 ----1668
NM_001024680chr231467 1457 1411 ------
NM_001024808chr12142748 2635 2543 2360 2018 1903 1100 891 863 383 319 309 163 85 --22365 821 --
NM_001024809chr1741375 1181 1173 461 1944 21337 128 --
NM_001024847chr351662 689 611 597 94 11628 1909 1229
NM_001024934chr63558 205 126 ------
NM_001024935chr63558 205 126 ------
NM_001024936chr63558 205 126 ------
NM_001024937chr174565 511 201 63 1291 5695 609 517 247 81 1186
NM_001024947chr5--11005 --11119
NM_001024948chr132488 1272 707 22855 2392 ----
NM_001025068chr33689 659 142 183 --11555
NM_001025069chr33689 659 142 183 --11555
NM_001025076chr10115924 5189 4802 4338 4265 2442 2385 1530 1107 394 167 25494 4423 34979 2257 2213 12012
NM_001025077chr10167282 6547 6160 5696 5623 4992 4775 2888 2465 1752 1525 1388 1326 550 246 221 36852 5781 1401 46337 1161 1127 164 --
NM_001025079chr392921 2713 2555 2542 1512 901 779 661 631 --52656 2527 1137 1107 906 --
NM_001025081chr182477 453 --21032 248 --
NM_001025090chr182477 453 --21032 248 --
NM_001025092chr182477 453 --21032 248 --
NM_001025101chr182477 453 --21032 248 --
NM_001025105chr521021 58 11229 11379 --
NM_001025107chr191726 883 803 706 503 477 301 213 101 32712 2126 72 5857 686 461 453 340 --
NM_001025107chr191726 883 803 706 503 477 301 213 101 32712 2126 72 5857 686 461 453 340 --
NM_001025108chr251222 953 882 709 640 2518 120 2645 631 --
NM_001025201chr22547 527 ------
NM_001025205chr31291 --1114 --
NM_001025233chr1232087 1034 68 22758 145 1626 --
NM_001025252chr842882 2670 2270 378 ------
NM_001025253chr842882 2670 2270 378 ------
NM_001025266chr3144884 4686 4514 3967 3819 3655 3560 3360 1899 1686 1607 1537 395 156 21393 893 3501 495 490 34326 1957 1247
NM_001025579chr173819 477 293 --11176 --
NM_001025580chrX114119 3629 3027 1702 1388 396 379 360 345 333 48 33933 615 465 23258 384 --
NM_001025595chr421560 138 11637 ----
NM_001025596chr111126 ------
NM_001025603chr181357 1103 1045 1017 941 238 114 78 1538 11059 --
NM_001025616chr451911 1649 1634 1205 423 --1623 --
NM_001025777chr22514 380 ------
NM_001029858chr662996 2908 2118 1298 619 538 ----12949
NM_001029859chr1172270 1828 1805 1745 1574 313 136 1782 ----
NM_001029863chr642626 1157 1008 991 --1432 --
NM_001029875chr552658 1924 1170 1116 116 32807 1199 1185 ----
NM_001029883chr253094 3019 2335 873 757 21988 922 12701 --
NM_001029989chr151613 ------
NM_001029998chr441314 913 460 236 1577 1286 --
NM_001030006chr17102624 2617 2507 2293 2155 1980 774 647 600 178 --32347 780 641 1263
NM_001030007chr1693717 3087 2980 2714 2469 1185 830 545 294 32952 1286 444 53632 2835 2545 240 234 1258
NM_001030059chr101302 ------
NM_001030272chr112498 421 ------
NM_001030273chr112498 421 ------
NM_001030287chr13871 163 89 ------
NM_001031679chr1242359 1246 555 300 23481 2527 33359 3152 2727 12497
NM_001031690chr752775 2245 2101 2039 1224 42062 1988 436 416 32339 2252 820 32830 2258 2071
NM_001031695chr22145197 5146 5109 5075 4984 4003 3933 3915 3643 3592 1285 1243 949 596 54722 4504 4129 3284 1563 85202 4931 3907 3476 1872 827 621 609 --
NM_001031732chr463344 2891 2783 2768 2439 1178 42914 545 496 274 1659 --
NM_001031738chr22454 58 ----2206 118
NM_001031804chr1673641 3519 3463 2993 2766 1148 581 23661 294 44166 3265 637 447 --
NM_001032221chr941846 1650 1445 57 11206 1303 1595
NM_001032279chr112363 283 ------
NM_001032280chr641521 1176 603 94 --1455 --
NM_001032282chr831342 1183 507 ------
NM_001032288chr2031329 1234 1074 --3380 35 29 --
NM_001032289chrX2333 51 --172 --
NM_001032296chr1362845 2801 2724 914 839 707 11945 12175 1966
NM_001032363chr151876 1770 1556 477 366 154 11788 --
NM_001032363chr151876 1770 1556 477 366 154 11788 --
NM_001032380chr1011307 --1130 --
NM_001032393chrX4777 715 168 147 ------
NM_001033025chr161522 1256 1242 1222 1215 504 --21249 1231 157
NM_001033026chr192158 51 --191 1434
NM_001033045chr243489 2736 1787 700 14020 ----
NM_001033047chr432245 1860 65 11775 2430 76 --
NM_001033049chr2151519 920 559 325 250 --22302 933 11587
NM_001033059chr622003 91 2359 338 1651 --
NM_001033081chr11243 1722 2612 199 --
NM_001033082chr11243 1722 2612 199 --
NM_001033085chr2----1239 --
NM_001033087chr2062694 2501 2082 1253 1018 676 1138 ----
NM_001033117chr384557 3961 3886 3547 3496 3489 3458 82 34332 1594 260 84699 4282 4042 1612 1324 1319 317 291 --
NM_001033518chr782126 2020 922 785 630 570 539 339 11032 52317 2282 2002 1090 1085 --
NM_001033519chr782126 2020 922 785 630 570 539 339 11032 52317 2282 2002 1090 1085 --
NM_001033520chr782126 2020 922 785 630 570 539 339 11032 52317 2282 2002 1090 1085 --
NM_001033551chr1783713 3365 2876 1435 400 326 300 255 --23741 3192 13625
NM_001033561chr173898 823 796 --2807 297 1317
NM_001033576chr1762742 1743 822 775 208 68 32563 2298 1754 1162 --
NM_001033578chr832168 953 300 ------
NM_001033602chr1352358 1030 653 506 35 12163 ----
NM_001033659chr1711503 --11456 --
NM_001033723chr862630 2609 1993 1971 950 743 --32480 2466 767 --
NM_001033925chr1011745 11756 1447 --
NM_001034025chr122879 349 ----1916
NM_001034850chr531306 426 132 ------
NM_001034954chr1042454 2006 1290 1100 1778 1264 --
NM_001034955chr1042454 2006 1290 1100 1778 1264 --
NM_001034956chr1042454 2006 1290 1100 1778 1264 --
NM_001034957chr1042454 2006 1290 1100 1778 1264 --
NM_001035254chr992507 2393 1727 961 748 590 556 469 226 --3830 736 78 --
NM_001035260chr102339 213 ------
NM_001035511chr192135 2126 1758 1445 1405 791 713 220 80 22113 1864 22140 722 21887 1878
NM_001035512chr1112242 2233 1865 1552 1512 898 820 327 187 95 29 22220 1971 22247 829 21994 1985
NM_001035513chr1112242 2233 1865 1552 1512 898 820 327 187 95 29 22220 1971 22247 829 21994 1985
NM_001035521chr22794 667 1785 2738 88 --
NM_001035534chr93343 297 44 --21377 493 --
NM_001037131chr24441 404 371 108 ------
NM_001037132chr752226 2138 2033 1690 281 1231 ----
NM_001037133chr752226 2138 2033 1690 281 1231 ----
NM_001037164chr711785 --1201 --
NM_001037165chr7198926 8365 7528 7086 6558 5779 5615 5532 3015 2455 2062 1883 1823 1042 890 773 242 170 150 --26450 253 --
NM_001037317chr121717 152 1821 1714 --
NM_001037332chr572250 2196 768 558 490 334 258 2301 196 22172 520 --
NM_001037333chr572250 2196 768 558 490 334 258 2301 196 22172 520 --
NM_001037339chr14674 628 541 371 --21205 633 --
NM_001037340chr14674 628 541 371 --21205 633 --
NM_001037341chr14674 628 541 371 --21205 633 --
NM_001037341chr14674 628 541 371 --21205 633 --
NM_001037954chr1123396 2237 13006 --1127
NM_001038702chr522784 1883 12229 --22409 2183
NM_001038707chr152242 820 646 635 459 2748 120 1451 --
NM_001038707chr152242 820 646 635 459 2748 120 1451 --
NM_001039029chr1241858 363 330 317 ----1786
NM_001039199chr2053848 3786 3057 1009 846 1682 43204 3162 3153 1856 --
NM_001039350chr741129 684 500 64 1697 2174 81 --
NM_001039459chr761156 1140 324 226 200 126 --3882 464 329 --
NM_001039479chr1441835 809 472 447 11702 1628 1862
NM_001039538chr21748 ----33065 2795 819
NM_001039550chr23724 181 87 --156 --
NM_001039570chr22114437 4092 3827 3346 1308 1100 696 432 401 191 79 --44387 4155 3532 95 14116
NM_001039571chr22114437 4092 3827 3346 1308 1100 696 432 401 191 79 --44387 4155 3532 95 14116
NM_001039577chr194426 3985 2875 1334 1165 1147 830 737 676 23725 1759 13075 1779
NM_001039582chrX1295 --152 --
NM_001039590chrX53206 2942 2878 2516 1028 23454 3222 13836 --
NM_001039591chrX53206 2942 2878 2516 1028 23454 3222 13836 --
NM_001039618chr1165013 4632 2226 1217 307 235 15070 15852 --
NM_001039690chr1631584 151 85 11898 42166 2064 1516 256 1335
NM_001039711chr13827 783 204 1161 2896 194 --
NM_001039712chr13827 783 204 1161 2896 194 --
NM_001039771chr147990 976 953 436 337 323 192 --1886 --
NM_001039772chr112153 64 ------
NM_001039802chr141319 892 547 425 --1177 11312
NM_001039840chrX65923 4588 2341 960 889 127 --25947 1675 --
NM_001039877chr192288 246 --2761 150 1182
NM_001039916chr1231019 136 90 160 ----
NM_001039917chr1231019 136 90 160 ----
NM_001039918chr1231019 136 90 160 ----
NM_001039919chr1231019 136 90 160 ----
NM_001039920chr1231019 136 90 160 ----
NM_001039937chr1333196 287 245 23056 1143 ----
NM_001039960chr1261418 1314 1259 399 302 258 21568 1384 1251 --
NM_001040002chr173342 296 83 11017 31067 482 117 2207 89
NM_001040020chr721364 522 1227 11500 --
NM_001040108chr1473301 2244 2109 1000 464 423 170 11206 --1486
NM_001040135chr71783 --1210 --
NM_001040144chr1631584 151 85 11898 42166 2064 1516 256 1335
NM_001040146chr1631584 151 85 11898 42166 2064 1516 256 1335
NM_001040151chr11173927 3681 3661 3231 3145 3121 3025 2997 2930 2908 1641 1598 1453 967 648 485 312 73631 3444 3383 2990 855 559 395 54389 4261 3995 823 111 13935
NM_001040152chr741793 1438 1206 189 2772 458 1344 --
NM_001040153chr131366 --199 --
NM_001040159chr4--11379 --182
NM_001040172chr581338 1161 998 631 558 239 152 110 1224 ----
NM_001040173chr581338 1161 998 631 558 239 152 110 1224 ----
NM_001040181chr33979 961 731 2805 66 ----
NM_001040182chr33979 961 731 2805 66 ----
NM_001040183chr33979 961 731 2805 66 ----
NM_001040199chr33979 961 731 2805 66 ----
NM_001040200chr33979 961 731 2805 66 ----
NM_001040272chr952342 1867 837 405 101 1704 21454 285 1462
NM_001040273chr1052002 1889 649 557 358 --22057 2051 --
NM_001040284chr16105669 4493 4037 3693 1062 966 953 932 745 28 25023 132 --15179
NM_001040402chr432458 110 96 ------
NM_001040429chr1342529 2296 1202 159 11210 13509 --
NM_001040441chr175119 4027 4018 1597 1561 1278 52 --33957 1936 1622 --
NM_001040446chr542091 1853 832 814 1946 1686 --
NM_001040450chr1532345 2126 381 ------
NM_001040453chr1532345 2126 381 ------
NM_001040458chr571685 1505 618 478 272 240 110 --1610 1696
NM_001040619chr141321 1138 613 539 --1130 --
NM_001040624chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040625chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040626chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040627chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040628chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040629chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040630chr862339 2079 2069 2039 1913 44 31879 512 457 32345 1862 135 1539
NM_001040647chr73696 484 268 --1371 --
NM_001040648chr73696 484 268 --1371 --
NM_001040708chr831029 1017 378 ------
NM_001040709chr1102439 2134 1632 971 897 776 645 549 180 94 22350 2155 3819 427 79 1916
NM_001040712chr963224 3178 2525 1038 430 392 12739 ----
NM_001042353chr203474 376 370 --2549 407 --
NM_001042361chr102618 256 ------
NM_001042364chr102618 256 ------
NM_001042365chr102618 256 ------
NM_001042387chr102618 256 ------
NM_001042388chr183353 274 25 --1108 --
NM_001042393chr102618 256 ------
NM_001042396chr102618 256 ------
NM_001042397chr102618 256 ------
NM_001042404chr121588 1322 11608 1286 --
NM_001042413chr9103190 2756 2682 2572 1137 1101 850 556 521 285 12888 11001 11093
NM_001042424chr492506 2297 2289 746 650 634 480 287 270 2559 371 ----
NM_001042425chr641521 1176 603 94 --1455 --
NM_001042437chr25879 839 680 245 154 177 ----
NM_001042472chr202421 53 --1557 --
NM_001042476chr1662194 1998 1858 1847 1749 652 1324 1368 1441
NM_001042486chr2031217 468 248 --21527 415 --
NM_001042492chr1793457 3291 2589 2392 2141 899 882 385 105 23444 768 53476 2936 1123 80 64 --
NM_001042494chr1553497 2612 2405 1249 208 --33641 1004 901 --
NM_001042495chr1553497 2612 2405 1249 208 --33641 1004 901 --
NM_001042496chr1553497 2612 2405 1249 208 --33641 1004 901 --
NM_001042497chr1553497 2612 2405 1249 208 --33641 1004 901 --
NM_001042506chrX81183 1172 1107 986 484 176 167 153 --51158 524 286 204 199 --
NM_001042510chr841342 676 357 145 1452 11408 --
NM_001042511chr841342 676 357 145 1452 11408 --
NM_001042533chr3------1499
NM_001042537chrX42024 1659 833 582 --1489 --
NM_001042555chr12114167 4145 4132 3516 3198 3190 1856 1844 1235 1175 780 43540 3128 1280 1091 14773 23554 1214
NM_001042599chr2127616 7023 6737 6443 6327 5977 2806 1912 1581 1525 113 80 46790 5739 896 51 87621 7589 6187 5513 5474 5365 538 351 15768
NM_001042601chr333296 503 36 12324 1662 --
NM_001042603chr1255336 4193 3909 1784 458 34848 4699 4371 44769 1790 1547 145 --
NM_001042604chr374319 4145 3752 3465 3080 1721 33 --14328 13835
NM_001042632chr2031981 1927 936 --21904 122 11673
NM_001042633chr2031981 1927 936 --21904 122 11673
NM_001042669chr451911 1649 1634 1205 423 --1623 --
NM_001042681chr142398 2249 2084 2043 1924 1269 --
NM_001042682chr142398 2249 2084 2043 1924 1269 --
NM_001042682chr142398 2249 2084 2043 1924 1269 --
NM_001042683chr611151 11249 1718 --
NM_001042728chr122299 174 --3938 884 340 --
NM_001042729chr14543 469 401 229 ------
NM_001042747chr14543 469 401 229 ------
NM_001042749chrX2625 440 ------
NM_001042750chrX2625 440 ------
NM_001042751chrX2625 440 ------
NM_001042762chr72915 178 ------
NM_001043318chr14123537 3196 3166 2711 1272 1265 968 885 794 703 576 502 13772 21489 809 --
NM_001043351chr172152 1651 1500 776 416 177 120 --1142 --
NM_001044385chr243707 1204 777 609 33066 2963 838 11333 --
NM_001048183chr193772 3626 2890 2697 1134 619 250 86 47 22786 627 1320 153
NM_001049chr1442226 1598 603 453 1311 3952 631 271 --
NM_001068chr3159 ------
NM_001074chr4195 ------
NM_001080418chr11166 143 1579 1548
NM_001087chr22401 121 --1323 --
NM_001092chr1761890 841 490 421 364 349 --2846 476 --
NM_001095chr1241720 1491 368 118 21841 1521 11273 31726 708 468
NM_001096chr171842 --149 1307
NM_001100108chr1168329 7876 7764 6629 6443 5269 2426 2211 1423 1220 1207 1151 938 835 807 749 25842 3007 66755 2199 1563 1103 1097 706 --
NM_001106chr3179708 8436 8211 7992 7570 7561 7477 3643 3383 3302 2662 2397 2201 1014 729 479 332 37305 7146 1197 46273 2962 2249 497 1463
NM_001111chr191726 883 803 706 503 477 301 213 101 32712 2126 72 5857 686 461 453 340 --
NM_001113490chrX52479 2447 1176 654 55 1581 1770 --
NM_001116chr1672865 2602 2291 2128 1960 464 77 22193 378 42045 615 198 183 22167 2146
NM_001117chr1852005 1841 830 703 651 --1740 1548
NM_001119chr421360 336 11499 31260 1008 389 --
NM_001121chr1021364 629 1566 --1299
NM_001123chr102693 55 ------
NM_001128chr1693717 3087 2980 2714 2469 1185 830 545 294 32952 1286 444 53632 2835 2545 240 234 1258
NM_001130chr194888 638 627 180 --2335 200 --
NM_001135chr153727 637 282 1270 1758 --
NM_001140chr174223 214 198 99 --3240 228 208 --
NM_001146chr831951 1757 1575 ------
NM_001148chr441510 1502 320 225 11814 ----
NM_001156chr101507 ------
NM_001160chr1242667 876 679 439 1169 ----
NM_001167chrX64891 4562 1972 1787 1438 1338 14606 12536 14665
NM_001174chrX41966 1577 377 269 ------
NM_001178chr112498 421 ------
NM_001183chrX3599 231 94 --188 156
NM_001186chr2173217 2609 755 441 281 156 38 12759 2702 643 11142
NM_001189chr43895 780 333 ------
NM_001191chr204473 442 205 41 ----2947 382
NM_001198chr682304 2243 2225 2176 1901 750 310 122 1960 --12191
NM_001200chr2021085 800 31114 980 109 ----
NM_001201chr4133750 3623 3544 3188 2911 1273 1197 954 935 910 848 505 64 13145 23613 2728 --
NM_001202chr141111 ------
NM_001204chr2104800 4790 2773 2089 1845 1760 1324 1298 1182 557 21798 892 15370 27384 2206
NM_001206chr952865 2348 1192 306 148 1910 12199 --
NM_001217chr191100 ------
NM_001219chr74905 897 640 147 21898 26 11396 --
NM_001232chr13890 867 836 1132 1110 --
NM_001233chr742390 2221 2204 358 ------
NM_001237chr4----1356 --
NM_001237chr4----1356 --
NM_001256chr1732502 1034 746 32156 2111 800 ----
NM_001257chr162442 223 --1188 1563
NM_001259chr786358 5986 5140 4822 2203 1937 998 578 55483 4474 4187 1508 1061 1923 1145
NM_001268chr134253 68 39 32 ------
NM_001270chr531028 846 131 ------
NM_001271chr1542572 2293 2223 1093 52794 1279 739 684 308 11110 --
NM_001273chr123382 182 100 --170 147
NM_001274chr11164 --1124 --
NM_001275chr142403 271 --1277 --
NM_001282chr17102624 2617 2507 2293 2155 1980 774 647 600 178 --32347 780 641 1263
NM_001283chr74466 430 269 162 1198 2189 63 --
NM_001294chr19----189 --
NM_001304chr1762491 2362 2350 1533 1461 55 --21199 171 --
NM_001310chr1292671 2099 2058 1971 1239 1232 1062 535 349 12488 12340 --
NM_001315chr641874 896 785 106 --1386 --
NM_001331chr11142629 2231 2211 2020 1748 1738 1731 1033 940 299 227 215 172 151 --22188 502 1925
NM_001332chr541375 451 389 81 1572 ----
NM_001343chr551539 1210 643 618 594 1270 1540 --
NM_001346chr342753 990 464 119 1361 2670 568 11916
NM_001351chr31729 1441 --21373 380
NM_001364chr11164467 4370 3984 3872 3312 3297 3241 3233 3220 3193 3187 3170 1920 1826 1087 392 54487 3782 3760 2938 1550 23708 3340 24177 922
NM_001365chr171501 ------
NM_001386chr862014 872 841 740 350 74 --21602 1580 1210
NM_001387chr5103000 2924 2913 2898 2871 1235 1214 891 787 738 21099 142 1793 --
NM_001389chr21------1447
NM_001396chr2132712 1103 1036 ------
NM_001397chr122590 1793 --22258 1969 41846 1041 506 114
NM_001399chrX113668 3463 3139 3026 2567 2449 2417 1422 777 603 175 32610 838 140 43848 3446 1405 37 --
NM_001401chr91500 --1386 --
NM_001402chr651964 1663 1629 1307 429 ------
NM_001406chr1791649 1516 1477 1379 1241 1148 533 390 186 11129 21164 408 1442
NM_001407chr341679 1653 1481 384 --21506 421 1565
NM_001408chr161484 1382 1101 1094 393 210 1413 41496 1265 357 39 145
NM_001412chrX63195 3057 2956 1411 1189 416 13393 --13709
NM_001417chr1231774 1201 25 11962 21467 1303 11219
NM_001419chr1963842 3520 3032 1865 933 834 --33146 3099 1749 13616
NM_001421chrX31636 1373 554 1358 31683 1367 1360 --
NM_001422chr11191 1131 1211 --
NM_001423chr1242080 1902 1591 1566 ------
NM_001426chr2----2592 496 --
NM_001427chr73821 804 735 11541 6809 790 758 751 744 726 --
NM_001429chr22--2417 408 2906 237 --
NM_001431chr641218 883 442 164 --1810 --
NM_001438chr1153001 525 507 476 464 456 441 364 321 307 249 220 209 160 23 1196 3447 435 383 --
NM_001439chr161522 1256 1242 1222 1215 504 --21249 1231 157
NM_001448chrX31546 1441 502 ------
NM_001451chr16180 --1976 1191
NM_001461chr12215 140 ------
NM_001463chr24813 174 167 36 ------
NM_001482chr154725 374 328 69 ------
NM_001493chrX4687 208 184 47 --2230 76 1738
NM_001495chr851043 1033 893 286 156 2937 118 2922 906 1403
NM_001497chr922215 140 11976 --11114
NM_001518chr71926 --1357 --
NM_001521chr22794 667 1785 2738 88 --
NM_001527chr654728 4141 3438 3299 3004 34746 1849 203 ----
NM_001533chr19150 ------
NM_001543chr561947 1922 679 636 448 266 13423 74827 4723 4218 3578 1874 1603 707 14443
NM_001546chr611242 --11248 --
NM_001554chr11437 ------
NM_001560chrX82550 2128 1971 1746 871 854 307 50 22419 58 11708 --
NM_001584chr111495 11105 11021 --
NM_001604chr11------1690
NM_001609chr1064112 3672 3659 3466 3398 1778 ------
NM_001616chr233129 833 823 32978 2537 1124 ----
NM_001619chr1141023 234 107 64 1404 2974 269 --
NM_001634chr622003 91 2359 338 1651 --
NM_001650chr1863470 1522 1085 682 553 352 11359 1615 12699
NM_001655chr1111530 179 31888 1882 1540 --
NM_001659chr12112668 2626 2561 2222 2094 2082 1996 1685 912 745 400 22265 2046 52539 2209 2017 362 80 1891
NM_001660chr34646 512 236 200 ------
NM_001663chr145897 867 834 551 178 1766 1542 --
NM_001665chr114546 152 120 108 ----1433
NM_001668chr161973 1520 595 257 148 92 --42268 133 107 102 --
NM_001674chr13871 163 89 ------
NM_001677chr11822 ----122
NM_001678chr17101411 1404 1232 1206 727 661 636 580 496 148 --61731 1700 1328 1193 559 204 21628 193
NM_001682chr1222586 502 ------
NM_001683chr352479 1835 1078 268 58 21861 253 21906 900 11912
NM_001684chr1143699 3626 3598 3397 3389 3381 3144 2979 2827 1500 1471 1175 331 319 22630 485 83544 3262 3036 2788 2696 1409 664 579 13453
NM_001690chr342223 726 213 141 31653 316 38 21695 543 --
NM_001693chr821045 442 ----11141
NM_001695chr863583 2732 1095 282 132 118 --14222 --
NM_001701chr941356 1294 247 56 11510 11281 --
NM_001704chr61153 ------
NM_001706chr3139 --1232 --
NM_001709chr1112351 --1859 --
NM_001711chrX41077 712 435 223 ----1675
NM_001718chr631311 959 276 ------
NM_001720chr161727 869 796 646 143 36 11665 2875 637 --
NM_001731chr123920 746 275 ------
NM_001743chr22137 89 --1152 --
NM_001746chr572481 2196 1978 1835 1046 913 542 22891 896 136 --
NM_001753chr741519 1407 664 564 1468 ----
NM_001754chr2163992 3062 2981 2854 2786 626 --54248 2944 2830 2800 1110 --
NM_001759chr1284287 3701 3548 1951 1338 1158 1063 1044 23524 1186 43999 3575 1416 1262 14510
NM_001760chr63916 729 112 ----1244
NM_001768chr251188 1058 475 449 45 --3332 90 68 --
NM_001773chr141428 1321 1099 104 --41229 1184 84 61 1479
NM_001777chr392921 2713 2555 2542 1512 901 779 661 631 --52656 2527 1137 1107 906 --
NM_001782chr92245 59 182 ----
NM_001783chr194385 119 105 81 --169 2254 155
NM_001788chr73754 398 223 ------
NM_001789chr311596 --138 --
NM_001791chr141319 892 547 425 --1177 11312
NM_001798chr124786 734 295 242 --1235 --
NM_001810chr204661 606 546 220 --1126 1773
NM_001822chr22547 527 ------
NM_001823chr14138 ------
NM_001826chr12409 53 ------
NM_001830chrX63508 3156 2909 1365 1100 979 ------
NM_001839chr12662 89 --1168 --
NM_001842chr9----1198 --
NM_001858chr614990 54156 3191 1096 833 195 ----
NM_001862chr2----182 --
NM_001874chr12104919 4422 4295 3442 3432 2045 1846 1160 1143 119 24560 969 21702 1236 12032
NM_001891chr42343 24 ------
NM_001892chr521021 58 11229 11379 --
NM_001895chr2071003 779 451 382 363 276 226 1297 11020 1427
NM_001903chr53727 671 664 1919 ----
NM_001915chr173812 759 182 21587 529 31702 602 175 --
NM_001918chr1106484 5939 3676 3479 3209 3130 2761 1083 768 193 47015 6645 3174 1146 35969 5614 1006 15675
NM_001921chr431092 1051 147 ------
NM_001923chr113471 199 135 --1103 --
NM_001933chr143986 540 461 1319 21015 57 --
NM_001935chr231002 922 306 ------
NM_001936chr741129 684 500 64 1697 2174 81 --
NM_001938chr12360 44 --11549 --
NM_001940chr12------1442
NM_001945chr521048 255 --21100 276 --
NM_001946chr121998 21104 774 ----
NM_001949chr663045 1203 1145 731 400 85 22098 2091 4428 317 310 97 --
NM_001951chr81555 ----1131
NM_001954chr65618 590 217 208 183 --3524 176 94 --
NM_001956chr12476 92 --1447 --
NM_001962chr52452 235 ------
NM_001964chr52206 95 1923 1186 1193
NM_001969chr1453498 2542 1083 963 49 1525 --11312
NM_001975chr124783 753 227 217 1546 3793 246 120 --
NM_001977chr451431 1403 375 161 46 1710 ----
NM_001978chr83994 912 57 2869 113 1174 --
NM_001981chr141500 505 410 44 --11737 --
NM_001982chr122201 79 3368 260 110 2316 70 2247 208
NM_001987chr1273493 2935 1602 1591 1314 501 136 1277 34157 1698 631 --
NM_001995chr44523 439 222 141 1977 151 31167 582 287
NM_001999chr531334 1250 116 ------
NM_002006chr4105436 4959 4154 1945 1752 814 728 664 556 197 35487 5189 1129 21845 1504 --
NM_002009chr1552294 1059 870 84 70 ----11807
NM_002010chr13----1188 --
NM_002013chr141201 ------
NM_002015chr1342189 2104 1321 1178 12837 12325 --
NM_002017chr1111412 --21238 172 --
NM_002023chr151300 506 447 289 134 --11476 --
NM_002024chrX2881 683 --11787 --
NM_002025chrX168753 8437 8047 7557 7441 6994 6972 6813 6587 6067 5691 3536 2520 1150 1051 644 37390 2263 654 38785 8350 7566 23406 1078
NM_002026chr211033 1131 21023 1015 1158
NM_002037chr61318 ------
NM_002040chr2152747 2145 1027 849 394 12270 ----
NM_002045chr33346 94 70 ----1128
NM_002048chr92160 121 --21067 184 --
NM_002054chr21411 ------
NM_002060chr12487 170 --1198 --
NM_002062chr661589 1070 549 508 323 211 --31575 1155 148 --
NM_002063chrX2969 232 ------
NM_002068chr193678 215 154 --1505 --
NM_002072chr93785 360 223 1408 2373 34 --
NM_002074chr131662 1619 1155 ----11518
NM_002076chr1283161 2705 1153 1117 785 722 305 224 --21096 160 --
NM_002077chr921915 845 --2510 153 21795 1533
NM_002084chr53579 537 104 ------
NM_002086chr1762066 2058 1852 1790 1667 613 11837 32035 498 249 12047
NM_002092chr443931 3753 1267 422 --24808 3759 --
NM_002107chr1163 ------
NM_002111chr483222 3198 2445 2430 552 540 534 283 1905 43559 3514 3264 3139 22787 1470
NM_002114chr6169 ------
NM_002126chr1733591 987 547 31082 865 792 1993 --
NM_002131chr67949 847 432 407 397 216 42 ----193
NM_002135chr124403 378 365 123 ------
NM_002138chr41584 1620 1256 --
NM_002139chrX3257 132 120 --2613 607 --
NM_002141chr7151 171 157 --
NM_002146chr1741366 500 412 116 1439 2150 145 1513
NM_002147chr173944 921 155 --1306 --
NM_002148chr2----1609 --
NM_002158chr233695 2872 433 22501 2419 --1740
NM_002161chr9------138
NM_002165chr201298 ------
NM_002167chr11144 ------
NM_002182chr342686 1917 339 265 22033 489 1731 1164
NM_002192chr72618 450 ------
NM_002193chr2--11865 --1566
NM_002196chr202738 145 ------
NM_002196chr202738 145 ------
NM_002199chr41165 ------
NM_002203chr543951 2834 2631 2594 --1928 --
NM_002204chr1751372 1336 1000 360 236 ------
NM_002207chr31202 ----188
NM_002210chr222802 978 11407 1160 --
NM_002220chr151365 ----1250
NM_002221chr182961 2870 2662 2631 1161 709 58 42 12525 22249 2231 22668 1096
NM_002223chr1243859 3223 2751 649 ------
NM_002226chr143760 745 341 1352 1687 --
NM_002227chr11385 --2189 47 --
NM_002230chr1751014 825 744 401 44 1324 1987 2893 139
NM_002232chr151252 992 381 214 139 11270 ----
NM_002234chr122172 135 ------
NM_002240chr21249 25 --131 --
NM_002241chr1143145 2095 2088 2031 969 941 933 816 650 606 403 190 42 27 11070 22267 1018 1199
NM_002247chr1052239 1572 908 663 90 152 181 --
NM_002250chr19----134 --
NM_002252chr21461 --137 --
NM_002253chr4176 --2997 206 --
NM_002254chr242242 882 648 470 --1408 --
NM_002264chr3144799 4570 4465 4209 4135 3334 1440 1160 1019 763 712 567 352 92 1903 11259 --
NM_002265chr172856 306 ------
NM_002267chr1342154 2071 262 254 ----127
NM_002268chr31755 --11623 1764
NM_002270chr5115461 5097 4601 4254 4210 4039 3885 3729 2175 1852 573 23442 493 11409 --
NM_002271chr133781 574 56 1538 ----
NM_002274chr172311 254 ------
NM_002283chr124762 519 288 25 ------
NM_002285chr251222 953 882 709 640 2518 120 2645 631 --
NM_002293chr152618 2411 2079 1733 498 --22162 248 --
NM_002309chr2283050 3010 3002 2875 2287 2001 1966 1125 12923 82596 2244 2055 1131 849 728 716 231 --
NM_002310chr5126118 5819 5793 5612 2404 1941 1881 1816 1360 1045 971 503 35446 4679 4014 35419 2257 1841 --
NM_002319chr7----5747 328 309 39 33 --
NM_002332chr121634 1182 2619 90 --
NM_002334chr1151988 798 768 406 340 1287 51605 1514 687 316 39 --
NM_002336chr1244820 2036 1690 1499 34467 1233 864 14962 --
NM_002349chr231596 622 161 ------
NM_002353chr1284 76 --1127 --
NM_002355chr1231110 146 120 2911 879 2569 167 131
NM_002356chr652609 2358 863 175 40 --22826 256 --
NM_002359chr17113826 3514 3469 2951 2913 1602 1253 1130 384 117 84 --73892 3046 2833 2827 2760 1615 125 1109
NM_002373chr1531272 1225 479 1490 11322 122
NM_002374chr21748 ----33065 2795 819
NM_002375chr372242 2140 1827 1606 1514 63 43 --5539 293 226 183 75 --
NM_002382chr1471059 1040 942 228 215 177 117 --11309 1184
NM_002383chr165891 726 367 328 179 297 79 1351 1812
NM_002384chr18------1213
NM_002385chr182477 453 --21032 248 --
NM_002387chr5124618 4568 4497 3589 3427 3131 1266 873 751 689 422 415 25027 1347 1211 --
NM_002390chr1711876 --1206 --
NM_002397chr521940 780 ------
NM_002398chr211086 ------
NM_002402chr72982 342 --2426 21 --
NM_002406chr54833 299 169 93 --2414 355 --
NM_002430chr2262058 1934 1748 706 351 294 1655 61739 1728 994 729 62 39 12114
NM_002442chr1221725 436 11127 21568 453 11331
NM_002444chrX61740 1436 1360 642 288 229 --21665 178 2467 271
NM_002451chr9103555 3369 3332 3296 3263 3240 2838 2729 1198 325 --1276 --
NM_002457chr111129 ------
NM_002473chr223994 150 59 --1182 --
NM_002479chr12307 233 ----1148
NM_002481chr1227452 7229 7103 6977 6571 6557 6454 5925 5579 5482 5135 4970 2388 1957 1923 1536 997 981 712 688 629 304 66498 5357 5343 1656 1506 652 57564 6145 5197 4888 917 1719
NM_002486chr92270 183 2707 504 1758 --
NM_002499chr1532046 915 692 21996 457 42314 1636 216 176 --
NM_002500chr2------1425
NM_002501chr1994053 3928 3197 2553 901 455 182 80 32 --73872 3208 1214 869 619 572 354 14130
NM_002505chr651510 1271 568 395 353 21313 1029 ----
NM_002507chr1761744 1600 1475 1395 672 205 --21285 287 1796
NM_002508chr161953 1680 1270 178 143 26 41581 547 305 156 21619 361 --
NM_002515chr141440 1608 21741 1639 --
NM_002516chr191266 --2233 55 --
NM_002519chr1141231 1103 973 161 11304 ----
NM_002520chr5----1104 --
NM_002522chr1772732 1497 1340 879 835 205 78 191 --12527
NM_002524chr11957 --173 2848 134
NM_002542chr3159 253 30 2212 42 --
NM_002545chr1154575 1705 1395 1348 291 34339 4091 3914 54185 3212 2047 889 277 21724 40
NM_002547chrX93979 2899 1643 761 742 657 350 116 42 11292 1341 1359
NM_002553chr7----1398 --
NM_002556chr11121985 1968 1840 1784 1623 1526 1455 1339 863 730 433 301 31951 673 99 11773 2822 758
NM_002570chr1531115 875 825 11167 2368 60 --
NM_002572chr11175 ----139
NM_002576chr1131186 1122 225 --2104 89 --
NM_002577chr383725 3505 2948 2574 1526 1516 808 780 --73125 1627 1540 1493 905 897 794 13715
NM_002581chr944728 3766 1230 808 25570 3685 --22154 435
NM_002582chr165859 708 627 287 177 ------
NM_002585chr11136 --1262 --
NM_002586chr641645 1103 304 235 11300 21164 395 21291 402
NM_002588chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_002594chr2041640 1620 1593 1538 --1309 122
NM_002595chr122411 216 1720 ----
NM_002599chr1151056 912 324 141 112 --2364 22 1288
NM_002600chr14674 628 541 371 --21205 633 --
NM_002605chr152467 318 11203 ----
NM_002607chr751011 889 244 129 45 ------
NM_002608chr2251579 1538 1517 1493 94 11244 41510 340 264 143 11360
NM_002609chr541917 581 248 84 1268 11713 --
NM_002610chr232363 2284 392 ------
NM_002613chr1675380 4670 3353 1414 1291 1259 1156 44396 4131 3258 1684 22118 1943 --
NM_002616chr17----2115 49 --
NM_002622chr52296 162 --5632 622 219 83 26 --
NM_002628chr33449 441 386 --11143 --
NM_002633chr11471 --1401 --
NM_002634chr173859 191 71 --1719 --
NM_002636chr63428 389 44 --167 --
NM_002646chr152155 2148 1497 855 788 31809 1378 500 21740 185 1800
NM_002648chr65980 972 929 241 73 ----1513
NM_002649chr71280 21141 401 2625 145 --
NM_002651chr12837 348 2635 560 3868 320 213 1652
NM_002655chr864488 4406 3914 1734 1619 1233 11492 11153 --
NM_002657chr20173645 3580 3394 3232 3164 3041 2650 2509 2465 1546 1367 1338 979 801 777 529 314 1951 53655 3184 2865 1146 289 12477
NM_002670chr321540 1331 11244 21461 436 --
NM_002687chr143496 332 71 --11208 --
NM_002697chr1----197 --
NM_002698chr1972349 2314 2221 1141 1130 796 325 11934 42605 2296 2277 1014 --
NM_002699chr181507 1254 1092 1068 1045 537 497 385 21142 417 41373 1366 1079 529 --
NM_002709chr263591 3208 2393 1031 878 507 1445 13201 --
NM_002710chr121122 ------
NM_002713chr13282 252 88 --1885 --
NM_002714chr66939 776 298 192 91 57 2447 100 --1974
NM_002715chr51915 ------
NM_002716chr11103501 3449 3399 3295 3113 2494 2279 2235 721 194 33461 3347 1433 13509 --
NM_002717chr83464 104 33 1189 ----
NM_002718chr342693 2323 1864 817 1105 32570 893 214 --
NM_002719chr1472350 2279 1682 617 316 180 71 12122 11759 --
NM_002725chr1113635 3244 1309 1297 1127 1112 513 462 299 251 99 1910 24264 1760 --
NM_002726chr6----1170 292 53
NM_002730chr1961249 948 924 907 460 235 --51358 1266 975 247 241 --
NM_002731chr152620 655 277 255 237 --1660 12962
NM_002734chr1742213 238 114 29 176 11526 21538 657
NM_002745chr2254072 1691 319 197 60 34110 4012 507 14459 21324 390
NM_002747chr1851504 667 646 232 82 --31510 564 509 --
NM_002753chr4------1301
NM_002764chrX7888 804 750 681 627 213 54 ------
NM_002790chr1125 ------
NM_002819chr1961166 1107 1021 520 352 327 --1547 --
NM_002821chr63557 236 154 1568 2308 251 2549 166
NM_002827chr2021372 728 1420 1158 --
NM_002829chr9126 1877 --2275 33
NM_002833chr1551203 629 413 324 38 --31427 367 153 --
NM_002839chr963224 3178 2525 1038 430 392 12739 ----
NM_002840chr131217 667 296 --31379 519 372 --
NM_002843chr1153268 2544 2107 745 255 1760 32424 739 702 21118 643
NM_002845chr183471 248 88 ------
NM_002847chr751504 1346 1334 1092 1000 ------
NM_002848chr1211234 --21313 945 --
NM_002849chr12182 ------
NM_002850chr1941143 794 242 236 11216 11057 --
NM_002855chr1183599 2259 1477 1409 1358 1033 898 190 23006 655 53064 2559 828 571 256 23122 211
NM_002859chr1241320 1254 1158 411 11820 1666 41715 1339 336 33
NM_002866chr191452 --4231 49 31 22 141
NM_002868chr12132264 2244 2062 1988 1981 1927 1818 912 773 744 413 329 311 12314 52409 2235 2171 2105 371 22162 1994
NM_002869chr1162068 1781 1762 1484 857 98 1417 11770 21707 454
NM_002871chr141366 289 231 165 --2642 279 21372 1264
NM_002886chr3145174 4913 4824 4668 4594 3549 1872 1864 1348 1253 1131 1092 269 243 11120 14600 --
NM_002895chr202911 837 ------
NM_002906chr1151631 1519 441 384 373 12046 ----
NM_002907chr12----1424 --
NM_002911chr1951452 1401 599 506 321 11595 11306 --
NM_002912chr62792 305 1203 ----
NM_002918chr191764 --2781 304 --
NM_002924chr14589 504 235 205 ------
NM_002945chr175856 722 590 131 59 ------
NM_002953chr13546 189 59 --1167 2768 174
NM_002955chr641746 1666 1364 1237 171 31671 1636 1492 --
NM_002959chr1134241 4173 4126 3996 3332 3326 3061 2859 1433 1110 963 678 614 2503 91 13491 24150 897
NM_002970chrX158 ------
NM_002971chr351020 742 365 179 74 ------
NM_002994chr42657 143 2153 35 11516 --
NM_002996chr1641387 778 628 269 31878 186 161 11239 --
NM_002997chr261459 1226 526 233 179 60 1280 --21393 614
NM_003001chr1112242 2233 1865 1552 1512 898 820 327 187 95 29 22220 1971 22247 829 21994 1985
NM_003009chr191315 --1102 1267
NM_003010chr1752376 1959 1847 934 703 11810 11818 --
NM_003011chr94380 242 97 29 147 1586 --
NM_003012chr8102982 2970 2713 1217 1203 1139 1114 1067 628 612 22782 2410 1160 --
NM_003016chr1741849 1687 1577 276 --21857 772 --
NM_003017chr621234 234 --11376 --
NM_003026chr93952 915 426 1384 1466 11081
NM_003028chr963768 2711 2605 2513 2503 2373 2408 365 32637 2358 987 --
NM_003029chr141131 1019 253 45 158 --1279
NM_003030chr331406 1343 114 11821 176 --
NM_003034chr12107983 7031 6264 5268 5087 2579 2085 1032 720 519 47278 6705 6551 6021 1634 1727
NM_003043chr374203 3850 3750 2870 2802 909 33 21182 1024 13057 --
NM_003045chr13124981 4198 3695 3156 1542 1532 609 423 336 278 260 183 34671 4525 3062 2555 364 13283
NM_003047chr1184 --41245 1093 1062 274 --
NM_003051chr121949 1698 --11547 --
NM_003060chr531201 1034 876 --2400 190 1510
NM_003068chr83317 205 85 1408 ----
NM_003070chr91857 --2745 43 --
NM_003071chr341949 1904 1436 1381 11625 ----
NM_003074chr331918 1871 107 3858 642 73 11391 21885 735
NM_003076chr1281695 1524 1432 1405 1159 609 475 188 --51681 1416 1038 480 203 21324 401
NM_003079chr174982 391 370 324 ------
NM_003081chr2051146 977 195 150 21 1438 ----
NM_003085chr51109 --190 --
NM_003106chr32938 835 ------
NM_003107chr661057 926 673 662 453 210 11863 ----
NM_003108chr2147029 6368 6301 6071 5580 5102 4409 2858 2660 1820 1763 1060 854 280 26553 335 21876 1039 --
NM_003111chr2----11088 --
NM_003112chr742759 1045 276 216 32363 1154 651 ----
NM_003128chr232823 1948 29 2274 101 22874 1134 --
NM_003131chr662107 1969 1767 648 254 209 --62206 2113 1961 822 667 653 1508
NM_003137chr662022 735 485 274 96 69 --275 53 22002 907
NM_003139chr114715 678 239 53 1805 2616 36 --
NM_003144chr641397 588 351 326 ------
NM_003146chr11278 35 --1262 --
NM_003149chr351538 1212 1103 496 305 11398 1531 --
NM_003150chr1752183 2044 1850 941 310 ----11925
NM_003152chr1731173 303 22 ------
NM_003155chr882529 2448 2418 2326 2118 2094 556 274 --32424 2077 259 --
NM_003156chr1151218 1157 1019 278 72 1996 41146 400 64 41 --
NM_003161chr1783462 2880 2194 1199 1143 636 250 237 22396 1159 ----
NM_003164chr113546 377 113 1419 1438 --
NM_003165chr941945 1749 1544 156 11305 1402 1694
NM_003170chr172573 197 --1550 --
NM_003173chrX31377 1241 1226 1479 1188 11049
NM_003174chr101203 ------
NM_003178chr342156 1872 1592 1479 21802 598 1448 --
NM_003179chrX31444 415 68 --41361 1208 1201 247 21385 1125
NM_003181chr61130 --1166 --
NM_003184chr831052 231 23 ------
NM_003185chr2041232 1107 464 242 --3526 474 469 --
NM_003188chr61833 ------
NM_003189chr1103215 2843 2568 2154 924 694 674 334 275 121 12297 32835 257 250 --
NM_003199chr1851848 893 715 306 49 24516 924 2809 89 --
NM_003200chr1932023 1610 893 --22035 918 --
NM_003202chr51569 11200 --163
NM_003204chr1731333 243 120 ----11457
NM_003216chr22113214 2499 1296 942 920 850 776 657 506 468 414 --23138 2085 12114
NM_003217chr1281654 1301 763 616 384 210 200 133 --2251 35 4622 390 326 22
NM_003220chr641521 1176 603 94 --1455 --
NM_003221chr6123637 3621 3459 3428 3372 3195 2894 2775 1484 1344 1048 304 33764 3384 1214 53346 2862 2847 2646 311 1527
NM_003223chr16------1554
NM_003224chr202236 147 --1951 1860
NM_003234chr362432 2346 681 458 276 230 31687 1555 483 1693 1438
NM_003236chr252868 2787 1326 1295 107 22592 1226 21300 1019 --
NM_003242chr351662 689 611 597 94 11628 1909 1229
NM_003243chr121194 119 ----1256
NM_003244chr182342 125 --1287 --
NM_003246chr151107 --2663 97 --
NM_003250chr171322 1391 2144 50 1150
NM_003253chr2141535 1311 563 42 11291 1469 --
NM_003255chr1742053 1827 1014 81 12106 42369 1649 281 149 1840
NM_003257chr151350 ------
NM_003262chr363703 3677 3462 3257 1579 274 15039 43771 3670 3656 3614 --
NM_003269chr631008 498 358 ------
NM_003274chr2122025 30 11200 --11817
NM_003275chr91535 --11483 --
NM_003286chr2011140 31110 1098 786 1438 --
NM_003290chr19161 --1188 --
NM_003298chr3205818 5090 4946 4918 4793 4502 4146 3946 3814 2237 1406 1310 1209 1056 1046 869 796 735 179 127 14608 36014 5262 5197 --
NM_003300chr141330 ------
NM_003304chr331482 1407 1026 ------
NM_003309chr641750 1646 708 507 ----1187
NM_003314chr53451 292 177 ------
NM_003320chr1174131 3535 2769 1599 1522 1404 234 23331 682 23570 1328 43648 2756 2745 831
NM_003336chrX1129 --1929 --
NM_003339chr521497 1198 --21406 112 --
NM_003342chr1763124 2717 2691 852 484 395 1827 32541 2536 965 --
NM_003345chr162496 197 ------
NM_003348chr1241395 1210 592 268 --3406 54 34 11419
NM_003349chr2031329 1234 1074 --3380 35 29 --
NM_003352chr22327 28 ------
NM_003359chr42206 188 21378 939 ----
NM_003369chr1132617 530 118 --32582 685 583 --
NM_003370chr191216 --7738 590 576 231 162 63 29 --
NM_003373chr1051494 735 496 471 368 51810 1441 1416 635 340 2501 354 1613
NM_003381chr62803 39 --1688 --
NM_003383chr9----195 --
NM_003385chr22924 796 --1274 --
NM_003387chr272799 2106 1854 1810 929 372 296 22770 198 42421 949 942 86 --
NM_003390chr112803 242 --2731 311 --
NM_003392chr364056 3417 3390 3156 1048 626 23315 104 21311 1021 1518
NM_003404chr2021443 702 --21363 593 --
NM_003405chr22262 28 ------
NM_003406chr831621 1594 1483 21812 140 21746 1736 --
NM_003407chr191578 --1563 --
NM_003411chrY21349 367 --1583 --
NM_003412chr322712 2675 --11116 --
NM_003413chrX--1456 2255 249 --
NM_003418chr31241 ------
NM_003420chr32799 260 1650 183 1733
NM_003439chr732768 598 29 21399 771 ----
NM_003458chr3113841 3783 3734 3052 2803 1288 1015 952 407 369 264 --43819 3812 1304 722 13198
NM_003463chr643132 2634 985 896 33232 2654 920 1259 --
NM_003466chr232489 2346 888 1553 32304 852 438 12014
NM_003468chr232954 1567 1126 --21397 497 1175
NM_003470chr1651617 1164 540 355 156 --41732 1724 531 503 --
NM_003474chr1022238 958 21651 469 21986 1640 --
NM_003478chr1153121 2373 1321 348 183 ------
NM_003482chr1252626 2473 921 539 529 1990 32489 1118 53 31997 927 202
NM_003483chr1232776 795 99 --11053 --
NM_003485chr1431270 280 268 --51242 1097 897 889 82 1876
NM_003487chr172178 74 --1200 --
NM_003489chr2123444 2191 21174 1118 ----
NM_003490chr222786 65 1234 ----
NM_003532chr6140 ------
NM_003557chr141299 633 170 154 1397 2359 179 1186
NM_003559chr17133436 3192 2903 2501 1482 1355 1201 995 927 642 442 279 246 13495 42746 2735 608 598 13835
NM_003564chr14575 561 234 194 --3538 428 239 1200
NM_003566chr1231260 488 361 22692 212 ----
NM_003574chr1844123 3922 1213 474 --25133 1978 --
NM_003575chr741368 1199 1035 974 21557 1465 11340 --
NM_003576chr1362845 2801 2724 914 839 707 11945 12175 1966
NM_003583chr12113025 2399 1340 1237 853 806 794 774 671 545 402 ------
NM_003590chr253702 2724 2708 633 228 41502 656 446 344 ----
NM_003593chr171550 --1697 1527
NM_003607chr163850 1423 1148 940 733 204 22785 1291 31374 395 72 --
NM_003615chr31475 12570 --13701
NM_003617chr1114640 4544 4523 3636 3618 3515 1479 1146 212 84 43 21628 65 54558 4552 3108 554 197 24246 673
NM_003620chr172774 717 1926 ----
NM_003629chr142488 1101 1091 816 --1439 23473 1047
NM_003633chr521868 329 --31595 1024 636 --
NM_003634chr225905 872 793 428 240 1293 3197 34 28 --
NM_003635chr101189 1160 --143
NM_003636chr161869 1816 580 541 294 39 --1526 --
NM_003637chr13490 417 347 21535 430 3393 360 234 --
NM_003642chr2----1239 --
NM_003644chr17156361 5715 5594 5084 4815 4481 4171 2459 2169 2146 1349 1192 810 787 599 54492 4037 2478 1379 513 136155 6022 5672 4348 4292 4189 4176 2182 2122 1256 751 738 355 11485
NM_003655chr173575 485 162 --3587 541 239 --
NM_003656chr3----166 --
NM_003659chr2----1316 --
NM_003660chr195675 532 257 61 43 --2638 632 --
NM_003663chr322201 273 --1582 --
NM_003664chr5----1182 1360
NM_003670chr371392 1092 999 945 438 48 32 1302 138 --
NM_003671chr983495 2993 2923 2709 2674 2272 948 851 23157 2931 42754 2299 1071 924 --
NM_003672chr12678 33 11738 ----
NM_003680chr11569 --1254 2680 503
NM_003685chr193949 800 380 --1806 --
NM_003711chr5185 ------
NM_003714chr592968 2682 2457 2368 2275 2195 1002 269 29 ----11098
NM_003716chr331031 952 717 ------
NM_003735chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_003736chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_003740chr631725 711 136 21271 191 143 --
NM_003743chr231612 870 517 11602 1580 --
NM_003749chr1332016 1595 835 --1189 --
NM_003750chr101816 ------
NM_003758chr1531321 605 68 --21277 1126 --
NM_003758chr1531321 605 68 --21277 1126 --
NM_003759chr453072 1103 817 582 279 11486 23146 2842 12850
NM_003763chr2012028 32389 699 546 12555 22829 155
NM_003766chr171171 --1244 --
NM_003768chr141545 593 300 195 1246 41574 1560 310 55 --
NM_003774chr1273311 2357 2339 1268 784 738 716 22803 2691 ----
NM_003779chr1156 --1338 --
NM_003787chr181626 168 1619 --
NM_003790chr11221 ------
NM_003794chr31719 1368 ----
NM_003795chr6----1488 --
NM_003797chr111172 ------
NM_003800chr662364 2211 2052 1532 920 778 1183 11845 11810
NM_003816chr811325 1399 ----
NM_003819chr12250 69 1295 ----
NM_003822chr153145 2537 2025 495 423 --11974 11172
NM_003827chr193546 492 32 --2464 84 2577 93
NM_003829chr91161 ------
NM_003831chr1831123 417 126 ------
NM_003840chr862133 2068 1872 1671 1511 47 --131 22057 1687
NM_003842chr832283 1913 504 --133 11528
NM_003850chr13----1244 --
NM_003861chr1492900 2876 2345 2166 2142 2115 911 858 367 1379 32853 2031 1052 --
NM_003864chr41167 ------
NM_003870chr1511813 21627 77 22048 2007 --
NM_003872chr262677 2223 1023 874 478 425 12367 21194 835 --
NM_003873chr1011834 ------
NM_003885chr1762649 2345 1991 1912 1905 766 --12655 1116
NM_003887chr22802 338 22059 232 1907 --
NM_003888chr1571334 1303 1263 1237 381 365 340 ------
NM_003895chr2121579 184 1775 ----
NM_003896chr25879 839 680 245 154 177 ----
NM_003901chr1082720 2701 2685 1894 1824 1712 469 169 41943 1840 891 422 22333 159 --
NM_003913chr694213 4051 4031 3742 3533 3207 2691 2666 626 33927 2919 97 14172 11639
NM_003916chrX41360 1282 956 948 ------
NM_003924chr4----1231 1202
NM_003927chr181321 1368 2777 34 --
NM_003930chr71159 21833 1715 11953 --
NM_003931chr63558 205 126 ------
NM_003932chr2231934 1800 98 --11366 --
NM_003939chr10123714 3318 2695 2678 1382 1053 889 650 634 555 404 117 21196 314 63991 3822 3428 3146 1498 1393 23281 904
NM_003947chr341082 239 206 101 1417 1305 --
NM_003951chrX2285 59 ------
NM_003953chr172634 2613 2566 2514 2345 1036 874 --12465 12365
NM_003954chr172278 46 1941 11221 11197
NM_003955chr172369 277 1289 2297 226 --
NM_003958chr673892 3535 3103 3070 2637 743 511 21498 877 1516 13562
NM_003966chr5217690 7300 7267 7073 6162 5541 5324 4791 3068 2747 2739 2715 2692 2677 2565 2336 2092 1947 1229 889 497 31937 1859 43 16019 12056
NM_003968chr3----1151 --
NM_003971chr172248 58 1420 ----
NM_003981chr152268 34 ------
NM_003983chr16104396 4250 4144 4046 3689 3179 1604 1301 1041 495 --64327 4299 2716 1240 474 455 11619
NM_003994chr1273772 3506 1686 1543 1433 813 609 ------
NM_003998chr42580 156 ------
NM_004006chrX41924 1066 930 848 --1592 --
NM_004007chrX41924 1066 930 848 --1592 --
NM_004009chrX41924 1066 930 848 --1592 --
NM_004010chrX41924 1066 930 848 --1592 --
NM_004011chrX41924 1066 930 848 --1592 --
NM_004012chrX41924 1066 930 848 --1592 --
NM_004013chrX41924 1066 930 848 --1592 --
NM_004014chrX41924 1066 930 848 --1592 --
NM_004015chrX41924 1066 930 848 --1592 --
NM_004016chrX41838 980 844 762 --1506 --
NM_004017chrX41924 1066 930 848 --1592 --
NM_004018chrX41838 980 844 762 --1506 --
NM_004019chrX1331 ----1166
NM_004020chrX41924 1066 930 848 --1592 --
NM_004021chrX41838 980 844 762 --1506 --
NM_004022chrX41838 980 844 762 --1506 --
NM_004023chrX41838 980 844 762 --1506 --
NM_004024chr141230 1047 522 448 --1130 --
NM_004028chr1863470 1522 1085 682 553 352 11359 1615 12699
NM_004034chr101507 ------
NM_004035chr1775185 4981 4647 3748 3615 413 249 --13937 --
NM_004036chr22646 77 ------
NM_004037chr15867 657 354 344 101 --1615 1291
NM_004063chr84748 254 240 112 1922 ----
NM_004068chr31291 --1114 --
NM_004071chr21272 ------
NM_004077chr1231232 1100 373 --21108 197 1181
NM_004080chr71440 ----1290
NM_004081chrY--11183 --21399 479
NM_004082chr22232 112 ------
NM_004083chr12------151
NM_004085chrX2515 302 ------
NM_004087chr351544 1398 1347 1335 66 2618 575 ----
NM_004089chrX21192 57 --2902 457 --
NM_004093chr1352983 2569 2359 1310 415 ----131
NM_004094chr142436 49 ------
NM_004097chr2----2718 207 2746 364
NM_004098chr1031180 932 518 --1975 --
NM_004100chr622572 379 1362 12541 --
NM_004102chr11589 --180 1494
NM_004103chr83742 721 699 --2731 117 --
NM_004111chr111232 ------
NM_004112chr173339 260 28 --21335 440 --
NM_004113chr321720 151 11827 41589 46 40 24 --
NM_004114chrX2986 928 ------
NM_004115chr131138 ------
NM_004117chr641406 822 410 145 --2871 59 11629
NM_004124chr1442846 2724 2462 630 22187 234 13044 --
NM_004134chr5163 ----1586
NM_004136chr1553024 814 615 485 333 ------
NM_004157chr32893 335 ------
NM_004161chr26990 460 405 279 260 169 ------
NM_004162chr351125 1039 809 467 40 1327 ----
NM_004171chr11229249 9032 8241 7815 6861 6787 6585 6452 6425 6320 6026 3523 3440 3325 3174 2805 2491 2468 2047 1704 1180 299 49333 9098 419 331 47772 6514 1168 292 --
NM_004187chrX41329 1288 435 361 11341 41007 464 451 214 --
NM_004193chr103194 47 35 1364 1403 --
NM_004200chr11103230 2293 2226 1198 1093 1036 992 921 831 245 22587 1028 1790 52341 2067 1209 1185 1056
NM_004202chrY----1174 --
NM_004205chr111182 --231 24 --
NM_004210chr106769 586 572 112 87 37 --42127 1351 392 314 194
NM_004225chr821328 299 ------
NM_004229chrX31838 1614 1563 11488 ----
NM_004231chr72265 101 --2209 30 --
NM_004232chr1831514 849 276 ------
NM_004236chr151424 ------
NM_004254chr11----3283 261 22 --
NM_004255chr15------122
NM_004263chr221635 1485 11413 31610 1519 242 1504
NM_004272chr5--11755 1589 --
NM_004274chr1441221 389 259 159 23049 178 2337 143 --
NM_004277chr611623 1553 ----
NM_004279chr732112 1939 1740 21989 738 --1541
NM_004290chr551158 1033 878 397 107 142 --1303
NM_004293chr943460 3002 1512 27 12677 ----
NM_004296chr1493430 3398 3030 2671 1604 1183 896 841 625 12470 33225 2887 2688 --
NM_004301chr32267 28 ------
NM_004302chr1242462 2284 2120 750 --32307 764 476 --
NM_004304chr22286 23 ------
NM_004308chr1181893 1465 1449 1180 559 298 203 30 1324 157 1637
NM_004311chr10112975 2939 2788 2755 2728 2525 2321 1257 425 340 224 1850 42733 2551 2257 2137 1899
NM_004319chr1112928 2726 2561 2457 2308 2063 2008 848 650 559 293 2460 179 52540 2524 2438 2423 707 1865
NM_004326chr131035 977 802 --51144 1012 846 835 356 1998
NM_004338chr1886558 4686 4618 2816 2514 1943 1146 448 --34707 4305 2313 11432
NM_004339chr2181761 1592 740 635 337 270 196 32 1449 ----
NM_004342chr722290 1635 ----11703
NM_004364chr1941181 1123 923 381 --31199 215 164 --
NM_004370chr631773 821 650 1678 21829 803 --
NM_004371chr14961 231 190 41 --2623 84 --
NM_004379chr211281 --1198 --
NM_004385chr5265 55 ------
NM_004391chr381899 1887 1806 1703 1694 1446 602 327 22092 1826 21421 806 12037
NM_004392chr1362256 1644 583 556 347 105 21897 171 ----
NM_004395chr52540 227 --2697 275 1149
NM_004397chr1154016 3223 2810 938 535 33900 411 369 42999 1355 601 400 --
NM_004405chr23404 380 75 1817 2320 287 --
NM_004411chr72752 174 ------
NM_004414chr211361 --21177 491 1625
NM_004416chr1241084 886 739 695 --2689 24 --
NM_004419chr103893 714 699 2996 843 ----
NM_004423chr3152716 2526 2453 2442 2241 2140 2008 1695 1016 915 784 378 248 219 55 --12348 --
NM_004426chr1241617 1408 664 539 1342 31574 1317 1286 --
NM_004427chr151038 813 782 495 406 21158 426 4459 411 290 255 --
NM_004430chr852186 1066 1044 380 30 11001 71756 977 961 955 811 208 137 1624
NM_004431chr12532 112 --3333 322 203 --
NM_004432chr932196 2163 393 --11840 --
NM_004436chr12145 82 --139 --
NM_004437chr173471 2663 2297 2271 1112 1047 633 --22411 37 --
NM_004438chr21857 32959 2066 1064 13204 --
NM_004441chr341273 465 415 100 --1451 1390
NM_004443chr32257 161 ----1147
NM_004446chr1166 ------
NM_004447chr122732 455 ------
NM_004451chr11------1538
NM_004454chr331725 1547 665 1573 12239 --
NM_004456chr71171 ------
NM_004457chr231083 199 118 199 ----
NM_004458chrX52082 1690 1654 380 218 11819 ----
NM_004459chr1731969 1526 1512 ----11547
NM_004463chrX----178 --
NM_004468chr11542 ----129
NM_004474chr12688 287 11034 2694 391 2958 408
NM_004475chr1751129 960 839 479 155 --2277 189 --
NM_004481chr172455 2411 2160 1817 529 257 89 2678 640 21731 818 1236
NM_004484chrX1265 --152 --
NM_004491chr19113795 3337 3004 1347 1281 667 655 446 428 272 125 1924 33445 1573 1372 12915
NM_004494chr121184 814 1136 2343 241 2973 100
NM_004496chr1441101 408 289 281 --3318 311 152 --
NM_004497chr19----2684 608 --
NM_004500chr1462028 1905 1479 185 136 119 21293 631 --1369
NM_004501chr153588 3545 3510 3303 2652 136 41551 1256 1251 847 --
NM_004504chr222888 2136 12761 --22829 2007
NM_004505chr17--12030 --11389
NM_004514chr171516 12627 12086 --
NM_004519chr81191 --1163 --
NM_004525chr21112 ----11317
NM_004527chr173342 296 83 11017 31067 482 117 2207 89
NM_004529chr92551 234 ----11416
NM_004530chr1611197 1753 41054 327 219 30 --
NM_004535chr2021437 96 ----11727
NM_004537chr1221152 1087 --156 --
NM_004566chr1062459 2211 2138 969 853 790 ----1940
NM_004573chr156777 665 231 218 69 48 ------
NM_004575chr42582 34 ------
NM_004583chr173491 286 251 1134 1259 --
NM_004586chrX105137 4433 3662 2171 2144 1948 1874 1241 160 151 24455 3379 24515 671 --
NM_004588chr1193811 3673 3608 2800 2733 2643 1631 404 92 23059 737 23246 3095 1837
NM_004598chr592921 2500 1050 869 555 485 421 266 52 --1634 22679 101
NM_004600chr131376 229 71 ------
NM_004602chr2051300 480 372 338 282 ------
NM_004603chr741115 939 303 138 --1344 --
NM_004606chrX1308 142 264 34 --
NM_004612chr941697 829 149 112 54552 4343 4202 3935 1470 --1217
NM_004620chr113564 149 51 ------
NM_004626chr113551 543 479 ------
NM_004630chr1161046 1033 958 946 893 350 --11056 --
NM_004634chr33588 566 43 ----1578
NM_004637chr351240 1155 1000 888 72 11164 21285 443 --
NM_004639chr6------125
NM_004645chr173744 277 242 1549 ----
NM_004654chrY2478 23 --2995 406 --
NM_004655chr173991 392 302 --11207 --
NM_004656chr31939 2957 84 3248 76 63 --
NM_004667chr151223 ------
NM_004673chr131589 1492 993 1572 ----
NM_004674chr83608 175 85 ------
NM_004684chr4128 ------
NM_004686chr84725 636 439 309 --1351 --
NM_004697chr91869 157 1794 --
NM_004709chrX51148 432 232 220 106 ------
NM_004716chr113784 742 330 --2802 714 140
NM_004717chr731384 433 373 ------
NM_004719chr1242724 2532 421 188 12453 1193 --
NM_004723chr11239 ----1860
NM_004725chr1041418 1268 1075 477 ------
NM_004726chrX75168 4629 4490 4170 4092 1666 567 24259 1361 11227 11680
NM_004731chr1211280 1137 --11427
NM_004736chr152130 1893 456 83 54 --11419 --
NM_004739chr112536 478 --3669 542 72 --
NM_004742chr341566 1320 621 43 1264 --21259 458
NM_004744chr433590 317 189 12932 ----
NM_004745chr8126177 6091 5172 4869 4429 4297 2020 1780 1480 588 487 278 56674 4283 1946 1680 641 76922 6600 6137 4906 4625 42 23 --
NM_004753chr11278 ------
NM_004755chr1441021 869 90 44 11243 ----
NM_004758chr1721063 1038 --3845 756 417 1165
NM_004760chr71770 1269 1710 --
NM_004762chr1711857 --3519 231 54 --
NM_004774chr1743130 2487 1027 985 12324 22851 340 --
NM_004779chr54888 880 511 491 2531 225 --2218 75
NM_004794chrX151 ------
NM_004796chr1422451 329 12007 1334 --
NM_004798chr20123533 3181 3008 2578 2552 1325 982 928 690 680 288 105 23217 822 3317 308 293 --
NM_004801chr241444 1162 418 79 1222 ----
NM_004805chr241412 1223 228 59 ------
NM_004808chr1032843 2285 1070 1589 ----
NM_004815chr184852 4376 4360 4060 3990 3888 1569 857 23693 3510 24430 283 --
NM_004821chr53626 613 558 --1656 --
NM_004822chr1793911 3831 3710 3703 2786 1497 1335 551 528 --33730 1602 304 33072 1254 105
NM_004824chr62394 69 2488 385 ----
NM_004831chr194778 752 719 328 --2762 170 --
NM_004834chr292866 2807 2734 2702 2688 1346 306 159 152 ----22893 2531
NM_004835chr34765 684 173 60 ------
NM_004835chr34765 684 173 60 ------
NM_004841chr16877 802 742 716 322 192 --11153 --
NM_004845chrX63937 3204 2921 2884 770 367 2878 280 33910 1632 845 --
NM_004849chr641680 1338 507 193 ------
NM_004850chr23521 152 145 11133 ----
NM_004856chr15----1160 1394
NM_004857chr1473583 3452 3391 1917 1224 1013 911 1544 ----
NM_004859chr1742600 2406 529 63 21942 611 2768 254 --
NM_004860chr17------2235 30
NM_004863chr14113923 3735 3628 3324 1872 1247 716 651 449 332 189 ----15021
NM_004866chr544755 3471 1478 152 44008 411 236 49 ----
NM_004871chr1794237 4216 3913 3585 3387 3115 846 548 466 13042 1431 --
NM_004872chr11301 ------
NM_004874chr81119 ------
NM_004879chr116996 332 305 181 125 60 --1657 --
NM_004884chr1521651 574 --41577 1572 623 227 1661
NM_004887chr521002 296 1936 1886 --
NM_004890chr171242 ----1264
NM_004896chr102254 128 ------
NM_004897chr101265 --1933 --
NM_004898chr442744 1949 649 628 22549 2168 12275 --
NM_004899chr21151 --1461 --
NM_004904chr7136359 5999 5956 5865 5589 4733 4514 2444 2357 2096 1263 680 661 24204 235 11576 2613 492
NM_004922chr104662 418 257 206 ----1793
NM_004926chr1451747 1459 681 559 546 190 3517 130 71 --
NM_004930chr1----3275 93 81 --
NM_004932chr521226 90 ------
NM_004934chr5137 ------
NM_004936chr922608 2042 21916 53 ----
NM_004938chr93996 845 99 1449 172 --
NM_004947chr372597 2581 2082 1819 871 427 254 12097 42589 847 280 208 12002
NM_004952chr1----4701 670 304 163 1724
NM_004955chr63436 119 58 1618 ----
NM_004956chr743462 3148 2889 441 ----13570
NM_004973chr6----21600 1334 --
NM_004976chr11114840 4762 3882 3645 3173 1845 1473 1311 845 567 55 14155 53309 1737 1504 1357 911 14316
NM_004978chr161482 1116 502 476 386 366 2410 224 21283 180 --
NM_004979chrX41119 830 388 53 --41056 1009 811 188 --
NM_004981chr22----1154 --
NM_004985chr123555 464 176 ------
NM_004992chrX247887 7797 7660 7405 7048 6807 6008 5925 5775 5719 5699 5319 3373 3088 3069 2291 2235 1816 1305 1290 1203 953 945 92 27784 1538 157461 6978 6786 6354 6172 3005 2815 2621 1800 1510 1274 1268 1221 342 63 46537 3099 3082 2570
NM_004992chrX247887 7797 7660 7405 7048 6807 6008 5925 5775 5719 5699 5319 3373 3088 3069 2291 2235 1816 1305 1290 1203 953 945 92 27784 1538 157461 6978 6786 6354 6172 3005 2815 2621 1800 1510 1274 1268 1221 342 63 46537 3099 3082 2570
NM_004993chr144992 504 459 36 31361 1347 594 ----
NM_004998chr151943 --1954 2137 107
NM_004999chr653653 3222 1383 1243 533 44438 3174 1334 1301 13695 --
NM_005010chr752226 2138 2033 1690 281 1231 ----
NM_005020chr73531 235 71 2600 557 2162 80 --
NM_005028chr1032251 1903 825 1183 ----
NM_005030chr161269 ------
NM_005032chrX1398 1285 1722 1190
NM_005045chr71129 ----1155
NM_005056chr1265580 4437 4153 2028 702 194 35092 4943 4615 45013 2034 1791 389 --
NM_005063chr10123762 3244 3086 2681 1420 1390 1198 1130 953 671 384 201 13632 2993 267 --
NM_005065chr1495117 4882 4873 4539 4081 2028 1901 1643 971 25239 1451 22034 1857 --
NM_005077chr91365 ------
NM_005078chr1541472 1154 502 292 --31172 1146 329 --
NM_005079chr842882 2670 2270 378 ------
NM_005080chr222274 231 2946 656 4831 742 353 279 --
NM_005086chr1261718 1290 610 495 419 338 --1408 --
NM_005088chrX1329 1183 --1813
NM_005095chr172239 2212 1834 873 806 664 246 22049 897 ----
NM_005096chrX81012 894 881 439 416 143 135 120 11105 11084 21021 451
NM_005105chr161911 1764 1532 758 684 177 ------
NM_005110chr52641 527 ----2671 250
NM_005112chr42858 765 --1775 --
NM_005116chr2083239 2899 1471 1337 966 684 341 317 13444 11004 24193 3846
NM_005119chr11403 --11207 --
NM_005121chr1743258 2993 439 82 --32389 1522 1338 --
NM_005122chr1------123
NM_005126chr312209 ------
NM_005128chr21------1514
NM_005133chr112363 283 ------
NM_005134chr183353 274 25 --1108 --
NM_005135chr1553497 2612 2405 1249 208 --33641 1004 901 --
NM_005146chr113720 218 69 --1223 --
NM_005147chr1641109 867 453 416 21025 993 ----
NM_005153chr163750 106 66 ------
NM_005156chr9104957 4558 4103 3795 3512 3349 1929 198 167 21 44732 4576 3703 281 ----
NM_005157chr951887 1747 1583 1482 717 1604 21331 201 1417
NM_005159chr1542135 2007 1905 600 --178 --
NM_005168chr21585 11523 --11377
NM_005180chr1031218 543 363 ------
NM_005182chr16142 --2510 87 --
NM_005184chr1961411 1280 349 214 174 50 --51348 1159 1148 1097 183 11122
NM_005186chr112477 104 --2562 510 --
NM_005187chr1641290 523 372 343 ------
NM_005190chr621127 421 ----11162
NM_005197chr1455277 4947 4547 4531 1468 46159 5493 3788 2440 34379 3821 306 --
NM_005202chr14894 480 349 147 11960 2888 200 21805 1617
NM_005203chr10----1165 --
NM_005206chr17175 1983 --1904
NM_005219chr561749 1395 1121 624 584 91 --2491 365 --
NM_005220chr1751451 1289 962 448 267 --31129 133 114 --
NM_005229chrX4989 930 880 200 1358 --11232
NM_005233chr342185 970 587 171 12004 ----
NM_005234chr191107 --1314 --
NM_005235chr2127616 7023 6737 6443 6327 5977 2806 1912 1581 1525 113 80 46790 5739 896 51 87621 7589 6187 5513 5474 5365 538 351 15768
NM_005238chr1162865 2658 2572 2348 1396 251 22963 2807 12891 12871
NM_005240chr14709 575 560 192 --2804 548 --
NM_005244chr20--1481 --157
NM_005248chr14543 469 401 229 ------
NM_005252chr141311 ----187
NM_005256chr11------154
NM_005257chr1811268 1144 11176 --
NM_005259chr23298 48 28 ------
NM_005263chr12324 106 --2962 373 --
NM_005266chr141512 667 507 213 --1549 11294
NM_005271chr10--1299 --123
NM_005275chr6----126 1120
NM_005276chr1261749 1435 1183 705 624 111 1255 2633 587 --
NM_005276chr1261749 1435 1183 705 624 111 1255 2633 587 --
NM_005277chr441601 663 321 99 1171 ----
NM_005281chr13977 753 73 --2657 303 --
NM_005311chr752569 2206 2150 1793 603 --11908 --
NM_005312chr952659 2580 1949 533 171 12194 52142 1864 964 541 183 --
NM_005324chr1722039 239 11746 --11900
NM_005329chr1641717 1663 883 384 22243 2069 ----
NM_005333chrX2769 211 2923 67 --1795
NM_005334chrX41655 1497 411 240 --2483 456 3593 489 33
NM_005335chr32369 300 136 2375 118 --
NM_005336chr272152 2001 1878 432 405 341 121 --31737 1459 115 21800 411
NM_005339chr494351 4307 4142 4067 1614 1518 1165 603 244 11681 11032 --
NM_005342chrX72852 2653 2179 2121 2044 863 266 ------
NM_005347chr9----11651 --
NM_005349chr4------1489
NM_005359chr18156357 6025 5826 5347 5235 4614 4553 4482 4369 2385 2185 1951 1445 745 184 16346 24306 4290 11469
NM_005374chr1792370 2262 2104 2095 1918 1788 1773 674 387 2702 692 32362 2082 659 --
NM_005378chr21759 ------
NM_005380chr131301 515 261 1494 1859 --
NM_005381chr2----121 --
NM_005385chr342504 2141 1070 897 22712 2423 ----
NM_005392chr92489 115 11819 11184 --
NM_005397chr782839 1399 1273 1056 1012 586 188 149 22676 1486 21125 558 23530 3394
NM_005398chr1061457 951 481 266 259 42 --1271 --
NM_005399chr184010 3453 2798 2766 1316 1084 578 560 31429 1210 868 --11586
NM_005400chr262803 2650 2361 960 419 144 --2480 96 --
NM_005402chr741866 1744 1544 1372 --1333 --
NM_005407chr1421532 1257 --71580 1506 1285 316 293 274 203 --
NM_005409chr41198 ------
NM_005413chr2190 --5362 95 82 53 33 --
NM_005417chr2041429 649 420 27 --21751 138 1370
NM_005429chr41124 ------
NM_005430chr125849 822 812 655 406 --3949 387 150 --
NM_005433chr1822193 2167 2322 161 ----
NM_005435chr71110 --1571 --
NM_005436chr1063795 2523 1637 323 244 73 --22507 863 1658
NM_005437chr1051342 1277 1127 419 219 --1118 1391
NM_005438chr11--1249 159 1117
NM_005439chr122508 73 --1171 2498 391
NM_005443chr44496 476 465 105 ------
NM_005445chr101267 ------
NM_005453chr63475 222 107 --1227 --
NM_005455chr11382 1623 --11511
NM_005458chr942232 1670 533 248 21706 951 --21802 465
NM_005461chr201285 --11477 --
NM_005465chr121634 356 --1795 --
NM_005474chr1741229 1118 271 213 1510 31234 568 519 21125 425
NM_005475chr1272754 2409 2199 780 432 205 83 12032 12995 --
NM_005476chr921009 28 --1167 --
NM_005479chr1061207 1185 1013 619 303 54 --1360 --
NM_005487chr222525 259 11389 31575 1570 1488 --
NM_005493chr61135 ------
NM_005494chr71664 ------
NM_005501chr1751185 1149 813 173 49 ------
NM_005502chr962495 2249 2140 641 455 51 12180 ----
NM_005504chr1295691 4369 4285 1682 1663 1067 618 549 488 56592 5806 4348 604 269 ----
NM_005505chr122687 278 --3381 334 79 --
NM_005507chr115451 440 333 203 76 --1174 --
NM_005509chr52430 399 ------
NM_005512chr1181996 1555 1521 1300 1293 1258 746 168 ----1818
NM_005515chr7----3622 186 58 --
NM_005517chr161325 1068 556 459 361 276 --3355 250 227 --
NM_005522chr751371 347 313 109 88 11027 ----
NM_005523chr731095 595 484 ------
NM_005524chr31326 --152 --
NM_005537chr132847 783 ------
NM_005542chr72638 276 --1196 --
NM_005544chr2------1121
NM_005546chr562241 2222 2118 1817 1753 550 --1247 --
NM_005563chr14837 83 38 25 ------
NM_005565chr51134 ------
NM_005573chr52602 71 1254 ----
NM_005578chr394832 4824 4786 3872 3741 3414 1919 888 486 33485 1736 462 44805 4795 4779 4763 --
NM_005581chr192390 130 --4135 106 99 92 --
NM_005584chr134574 232 111 39 ------
NM_005595chr12303 286 ------
NM_005596chr994942 2464 2281 2202 2189 1442 994 273 89 24961 850 ----
NM_005599chr131310 526 336 11038 11045 --
NM_005602chr34838 228 166 90 --31145 853 157 --
NM_005604chr682173 1966 774 744 582 410 123 80 --164 --
NM_005605chr81213 1224 1296 --
NM_005607chr82882 867 ------
NM_005610chr1146 ------
NM_005611chr1631283 921 535 2830 206 ----
NM_005613chr152134 2065 1599 1481 305 21843 395 ----
NM_005625chr83343 241 84 ------
NM_005626chr11182 --1151 --
NM_005627chr62213 176 --1943 --
NM_005638chrX31654 506 121 1689 ----
NM_005644chr11366 --2359 352 --
NM_005647chrX53356 2908 2264 672 639 2435 77 21144 764 12612
NM_005650chr221170 ------
NM_005652chr1661163 1023 981 921 815 191 21120 1016 21168 1109 --
NM_005655chr821183 507 ------
NM_005656chr2131463 306 292 --164 --
NM_005665chr133861 1831 1474 ------
NM_005669chr572232 1965 959 830 389 42 23 22064 1758 ----
NM_005678chr152997 944 --2807 129 --
NM_005682chr1611271 ------
NM_005686chr161547 1450 1425 1135 1079 175 11308 130 --
NM_005689chr21128 --121 --
NM_005697chr153218 183 60 ------
NM_005707chr155439 317 139 118 41 ------
NM_005722chr22457 286 --1514 1206
NM_005725chr142356 2065 1873 641 1885 1670 --
NM_005730chr12113670 3498 3287 3203 2959 2594 1181 1152 1135 730 326 21358 425 33458 2950 1085 3685 508 47
NM_005731chr23356 272 109 --1265 --
NM_005737chr262896 2809 2372 1987 1795 384 22719 467 11833 --
NM_005738chr711785 --1201 --
NM_005746chr732697 2524 426 ------
NM_005748chr1253380 3116 2913 2321 1236 ------
NM_005756chrX31289 1031 982 ------
NM_005759chr273800 3635 3288 1271 533 357 47 21800 142 13025 14170
NM_005766chr1391223 1149 1032 1014 546 418 353 117 37 --1283 --
NM_005779chr562605 1265 848 732 433 27 ------
NM_005786chr182888 90 ------
NM_005789chr17102065 1947 1915 1896 1539 1420 519 464 435 302 22167 1804 21518 1511 2442 210
NM_005808chr3113576 3389 3377 2819 2639 2622 1160 947 799 386 302 --11346 --
NM_005813chr252019 1998 1909 992 304 --1998 --
NM_005814chr161092 540 527 90 57 49 --3936 284 71 1132
NM_005819chr183230 3193 3066 2622 2481 1035 130 28 21092 469 43437 1274 811 391 --
NM_005822chr641845 1694 119 53 1685 ----
NM_005828chr17154587 4279 3967 3779 3669 3529 2027 1968 1784 1679 1101 578 445 338 241 24031 261 64750 4152 3756 3730 584 249 24593 3883
NM_005832chr321065 256 2992 108 ----
NM_005840chrX146877 6561 5094 4761 4699 2447 2098 1829 1712 915 584 493 480 33 11438 51096 590 575 530 463 --
NM_005851chr112282 104 --3318 293 62 --
NM_005852chr1731166 353 303 1179 21044 275 31081 198 95
NM_005857chr111438 --1572 --
NM_005864chr142281 226 --2161 111 --
NM_005871chr1041021 882 280 207 ------
NM_005880chr1631645 1232 37 ----11591
NM_005882chr43688 354 334 --166 --
NM_005883chr1922855 1058 12219 1296 22945 2422
NM_005885chr541263 1073 167 58 21565 77 130 --
NM_005895chr1273745 2978 2965 2820 1298 1068 654 24039 1356 21088 402 --
NM_005896chr21649 --1810 --
NM_005898chr1142885 1294 1065 92 2419 253 ----
NM_005901chr1888494 8303 7384 7199 6294 2710 726 454 58041 7499 6846 5975 3456 17402 27645 2228
NM_005903chr554789 4303 1962 1625 386 11082 13501 --
NM_005904chr182144 73 --1980 --
NM_005909chr564035 3905 3527 3464 2925 1292 23409 2832 13323 --
NM_005910chr1783572 3000 2878 1531 1415 1250 1125 209 23794 285 63687 3221 1508 908 867 316 13549
NM_005911chr221031 83 2547 22 2484 343 --
NM_005920chr183707 3491 3318 3224 2904 2513 1138 102 23604 3157 93055 2717 2435 2421 2375 1268 1163 979 68 23597 837
NM_005922chr6----1142 --
NM_005924chr72982 837 ------
NM_005927chr531169 1003 175 --2923 469 --
NM_005928chr15361 35 28 --1510 1157
NM_005933chr11132834 2796 2759 2478 2352 2245 1945 1854 1081 845 729 709 224 32914 506 343 52764 2421 1951 734 697 2759 381
NM_005934chr1982577 2078 1969 1833 1825 1788 739 145 --1944 --
NM_005935chr495277 5185 4350 3925 3698 1528 882 693 235 23721 816 --11770
NM_005937chr17123961 3844 3648 3599 3528 3415 3338 3129 2626 1113 675 464 23861 1293 52586 2578 1107 1045 202 11460
NM_005938chrX----41290 1089 1083 276 11263
NM_005941chr864192 3590 2945 860 827 254 13547 ----
NM_005943chr661713 1397 1152 1123 211 60 3109 36 28 21243 1144 --
NM_005955chr1135086 4680 4563 4344 3985 3655 3393 1934 1488 1378 1196 759 421 22038 1592 13873 22180 908
NM_005962chr1021774 389 --12257 --
NM_005962chr1021774 389 --12257 --
NM_005964chr1731391 999 101 --21053 1046 --
NM_005966chr242404 2316 1655 952 ------
NM_005967chr121272 --4558 457 115 104 --
NM_005985chr204567 205 104 86 --122 155
NM_005996chr1241536 1234 1107 103 11359 ----
NM_005997chr12128 31 --169 --
NM_006007chr954149 4135 3733 2958 2793 1101 1520 11767
NM_006011chr15103927 3858 3826 3702 3430 3314 3185 1354 1316 1209 --84049 3679 3590 3324 3040 3019 2835 2829 23196 2966
NM_006015chr111245 --1127 1356
NM_006030chr331632 1248 327 ----157
NM_006032chr141188 ------
NM_006034chr113466 264 144 --32375 418 66 --
NM_006035chr141408 1392 11077 21132 315
NM_006036chr221961 1576 1978 1428 1131
NM_006037chr274843 3767 3246 3126 3091 1918 1828 11599 169 13003
NM_006038chr2051825 1455 1371 686 517 --1706 1563
NM_006040chr1631393 1245 532 --2567 453 --
NM_006047chr2042744 2530 2517 919 21318 635 ----
NM_006048chr141212 435 421 186 --1499 --
NM_006054chr1141012 487 451 140 11368 21421 151 --
NM_006055chr26968 424 408 224 155 81 ----12450
NM_006064chrX1111 ------
NM_006067chr163934 773 35 ------
NM_006068chr4------1282
NM_006070chr3----1277 --
NM_006080chr71170 12805 ----
NM_006091chr1531627 1396 366 31553 1409 672 5565 495 252 226 65 21752 636
NM_006095chr4104030 3958 3005 2841 1786 1775 1580 914 635 474 11180 ----
NM_006106chr1183473 2505 1244 1003 995 559 420 154 13274 12632 --
NM_006108chr1141704 880 730 218 22307 408 ----
NM_006129chr81531 1385 --1187
NM_006133chr1152359 1934 964 753 674 --2975 873 --
NM_006135chr111252 --1493 21096 1045
NM_006136chr7--21175 370 --1470
NM_006141chr1622450 1088 ------
NM_006143chr12194 ------
NM_006148chr1772955 2597 2574 2443 2267 2207 2070 1417 32650 780 197 --
NM_006156chr14----1217 --
NM_006158chr841581 571 171 37 ------
NM_006160chr1761442 626 394 327 228 209 --21576 191 1257
NM_006166chr1232590 2551 129 ------
NM_006167chr84942 854 842 202 12173 1947 146
NM_006177chr143899 747 689 1847 11014 --
NM_006178chr1741496 1477 232 160 ----11398
NM_006180chr92220 28 21783 844 2781 285 --
NM_006185chr113658 181 88 ----2555 479
NM_006190chr221095 903 ------
NM_006191chr124766 714 203 48 1140 --186
NM_006195chr92990 21 --21399 516 --
NM_006197chr831581 216 138 21767 248 ----
NM_006201chrX2852 438 --21098 81 --
NM_006202chr1941389 348 156 26 11245 41649 798 377 163 11833
NM_006203chr595396 5118 3919 2120 1970 1618 1271 908 505 ----13793
NM_006206chr442472 2323 1038 713 1916 1449 --
NM_006224chr1772376 2323 2138 1915 499 431 308 --21617 872 --
NM_006226chr21439 ------
NM_006237chr1392146 2114 855 737 697 547 141 130 65 ------
NM_006238chr692032 1973 1862 1821 1684 1353 265 230 198 1415 41421 293 288 181 --
NM_006241chr352421 2176 832 821 786 22393 621 ----
NM_006243chr14763 728 425 362 1662 2896 737 --
NM_006245chr61861 1974 2344 177 --
NM_006246chr142519 209 ------
NM_006251chr583349 3195 3171 2419 1035 746 613 599 --23185 1166 --
NM_006252chr1137497 7461 6545 6428 6310 6253 5441 5344 2460 1540 1478 663 385 12562 26176 2642 --
NM_006254chr3----1159 --
NM_006256chr152774 2395 2380 1810 648 ------
NM_006265chr831388 468 444 ------
NM_006267chr281840 1697 1614 1244 601 579 520 349 ------
NM_006268chr112868 353 11029 41106 982 86 77 --
NM_006275chr2032376 2274 41 --12485 --
NM_006277chr2------1181
NM_006279chr1----1936 1302
NM_006282chr2084730 4714 4685 3409 3391 3140 1519 1375 1403 44639 3426 1538 317 --
NM_006283chr8104891 4607 4416 3244 1496 1368 554 258 242 46 34060 1286 1076 24372 3568 2363 323
NM_006288chr1151140 1092 1031 267 61 11110 1950 --
NM_006292chr11149 ------
NM_006293chr151175 --1866 1756
NM_006300chr1952283 1810 1657 1511 217 --1285 --
NM_006301chr122507 237 ------
NM_006306chrX75923 5915 4727 4580 4363 1464 738 24418 910 43949 1529 266 83 14612
NM_006310chr1721277 1153 --21164 972 --
NM_006313chr1231223 593 35 ------
NM_006315chr463631 1506 1446 812 420 324 33701 3371 576 21001 857 24220 1351
NM_006317chr5----1606 --
NM_006320chr43947 308 288 ------
NM_006321chr371860 1648 1619 877 501 234 164 11525 --11632
NM_006328chr113627 232 96 ----2583 139
NM_006330chr821027 616 166 ----
NM_006334chr9------1316
NM_006335chr11329 ------
NM_006336chr971424 1386 1335 1240 1151 402 273 --11233 --
NM_006341chr11205 ------
NM_006343chr22483 93 ------
NM_006345chr43490 327 72 1517 ----
NM_006352chr141947 1557 387 335 ------
NM_006354chr3162 --4329 270 264 139 --
NM_006357chr2146 ------
NM_006358chr225945 451 412 74 50 --1363 --
NM_006359chrX42024 1659 833 582 --1489 --
NM_006367chr15963 824 699 110 82 --1784 --
NM_006369chr1----3360 311 135 --
NM_006373chr1761241 1115 1084 355 254 165 --1270 1984
NM_006375chrX41744 1481 464 389 --21579 220 --
NM_006377chr951165 1142 1101 1056 975 ------
NM_006380chr1753546 2744 1632 1411 33 23282 1696 ----
NM_006386chr2292268 1778 1674 791 612 545 127 75 62 --42232 1980 638 287 --
NM_006387chr19156 --2461 423 --
NM_006389chr114518 500 381 212 2548 238 51061 896 409 400 42 1541
NM_006390chr1241504 1487 1376 667 11341 1156 --
NM_006393chr1033980 3221 117 34273 749 581 1870 --
NM_006401chr91163 ------
NM_006405chr14172 ------
NM_006407chr321112 557 ------
NM_006409chr71229 ------
NM_006411chr65903 348 335 121 94 --2875 43 --
NM_006416chr61532 ------
NM_006421chr8----1257 --
NM_006422chr12----122 --
NM_006434chr1042454 2006 1290 1100 1778 1264 --
NM_006449chr251953 1943 1702 1546 1528 22041 468 11734 11485
NM_006454chr441034 868 554 65 12601 11986 22076 1079
NM_006457chr453871 2863 2738 1057 345 33949 3120 2705 --1935
NM_006459chr1021647 756 3634 515 24 11534 --
NM_006464chr2114054 2942 2916 1666 1611 1605 1551 1166 769 293 261 34494 2992 964 33770 1759 1621 11744
NM_006465chr1561978 1941 1698 482 377 356 1282 52142 2003 802 423 270 1778
NM_006469chr1--11408 1334 --
NM_006472chr151118 828 503 128 56 ------
NM_006482chr12113025 2399 1340 1237 853 806 794 774 671 545 402 ------
NM_006488chr2--2306 149 2227 61 1213
NM_006489chr141440 1608 21741 1639 --
NM_006496chr13566 489 330 ------
NM_006497chr172563 282 1523 2658 653 1569
NM_006500chr11163 --127 --
NM_006509chr191380 ----2275 103
NM_006510chr621019 165 1860 1350 --
NM_006516chr131432 533 523 1128 ----
NM_006517chrX82072 1970 1497 611 599 518 216 181 --3626 582 41 131
NM_006520chrX21731 59 --1460 --
NM_006521chrX2944 76 11224 11104 3511 194 32
NM_006532chr1931943 1772 191 22069 828 1575 --
NM_006534chr2063208 3079 2806 1283 561 197 12392 12128 11178
NM_006538chr254077 3493 3472 2619 311 1731 --21017 537
NM_006544chr1466121 5391 5245 2134 2014 210 25688 434 ----
NM_006546chr17176069 5948 5939 5794 5685 5119 4664 4643 4557 4379 4153 2658 2644 2440 2149 1682 1549 46226 5780 2186 749 96621 6518 6276 5958 5217 4389 4350 4214 423 1768
NM_006547chr721743 328 22076 1872 1276 --
NM_006555chr71620 --11962 11724
NM_006557chr931768 1103 603 --1488 --
NM_006559chr1----1137 --
NM_006560chr111126 ------
NM_006561chr10115924 5189 4802 4338 4265 2442 2385 1530 1107 394 167 25494 4423 34979 2257 2213 12012
NM_006565chr165438 362 340 71 32 1830 ----
NM_006566chr184468 390 358 337 ------
NM_006572chr1742617 606 323 309 --12189 --
NM_006577chr21342 --1954 --
NM_006578chr1541549 1387 1263 556 --1420 --
NM_006593chr24668 626 314 281 1746 1753 167
NM_006595chr1121888 434 --41912 1906 1353 440 --
NM_006599chr16127563 7546 7403 7389 7290 7184 5867 1702 1392 1080 843 392 45143 2562 2506 1044 55730 5153 2577 1759 1153 17417
NM_006601chr122980 46 1236 ----
NM_006603chrX2625 440 ------
NM_006609chr262157 2087 1929 340 199 57 1987 ----
NM_006614chr363674 2678 2421 1306 1295 362 12258 ----
NM_006618chr121153 528 11485 ----
NM_006621chr171698 1665 1597 1344 480 334 92 1211 1601 --
NM_006624chr1021600 95 21389 578 2856 851 --
NM_006626chr982150 1891 1791 1699 1046 985 791 254 11682 ----
NM_006628chr1543983 3540 1175 46 24247 3957 --14222
NM_006640chr1731777 1376 1369 31831 115 98 ----
NM_006646chr1372185 1996 1239 1186 746 647 262 22552 2482 ----
NM_006650chr543820 2664 941 303 22518 707 3233 141 125 23787 594
NM_006651chr42959 555 --11299 --
NM_006653chr6----1136 --
NM_006654chr12114167 4145 4132 3516 3198 3190 1856 1844 1235 1175 780 43540 3128 1280 1091 14773 23554 1214
NM_006662chr163324 134 28 1273 1125 --
NM_006670chr61141 ------
NM_006690chr2042198 1994 1972 539 --22284 1986 153
NM_006694chr12361 282 1118 1271 1261
NM_006698chr2051255 562 434 391 22 ------
NM_006699chr162724 2359 2140 398 321 128 2578 456 11971 --
NM_006700chr122780 575 --1741 --
NM_006706chr52621 297 ------
NM_006708chr62258 129 1388 21085 305 1994
NM_006717chr963298 2286 2276 1142 305 77 23066 1164 ----
NM_006721chr102693 55 ------
NM_006722chr32355 39 --12395 --
NM_006724chr6----1142 --
NM_006726chr421135 915 1327 1826 --
NM_006727chr51158 ------
NM_006729chrX104987 4814 4436 3435 1342 1164 1053 1042 925 660 24337 2199 14897 --
NM_006732chr1951797 1544 1374 661 501 --1818 --
NM_006734chr621231 346 139 ----
NM_006735chr71359 --1114 --
NM_006736chr271734 1435 1191 607 509 129 101 --31510 616 527 --
NM_006742chr1651780 1279 615 589 421 31792 810 339 31495 1318 439 11412
NM_006744chr102172 90 ------
NM_006750chr16157520 7328 7304 5469 4948 3174 3163 3065 2066 819 680 605 462 430 110 26737 5570 38000 1805 371 23101 1751
NM_006751chr22748 333 2827 172 ----
NM_006754chr731128 889 160 ------
NM_006756chr82964 147 11173 ----
NM_006761chr17----3726 706 700 --
NM_006763chr181935 1742 1626 1603 1435 1300 861 647 11488 11587 --
NM_006766chr862652 1932 1796 444 370 163 --22625 604 1658
NM_006772chr681646 1617 1546 1446 1309 321 205 25 11701 51578 1407 1207 675 561 --
NM_006777chrX32836 2690 2436 --22873 354 --
NM_006788chr185829 739 546 474 112 1713 1129 --
NM_006793chr10127 ------
NM_006795chr1171573 1449 1371 1114 563 462 112 --41408 1384 1119 522 1468
NM_006802chr1169 1981 2398 373 2290 46
NM_006805chr541447 666 160 47 --21076 105 --
NM_006814chr2072440 2251 2091 877 512 271 42 1401 42133 971 832 33 --
NM_006823chr82533 313 1183 1867 --
NM_006826chr23408 187 28 --11105 11252
NM_006827chr1473197 2846 2590 2237 967 924 309 --43036 2869 2262 347 --
NM_006838chr1251712 684 398 218 190 ------
NM_006851chr1242803 2750 2406 381 ----1407
NM_006852chr1762680 2480 2466 2455 2225 691 22866 139 52566 2363 1143 724 590 --
NM_006854chr732028 1530 757 --11558 --
NM_006856chr1261048 1034 420 370 362 265 ----1766
NM_006861chr1251502 1387 1312 736 69 --3570 545 151 1203
NM_006873chr273063 2999 2928 2787 443 364 244 ------
NM_006874chr4----11216 --
NM_006875chrX3755 261 187 --2884 214 --
NM_006884chr331406 1343 114 11821 176 --
NM_006885chr1693509 3441 3111 2819 2758 1512 1364 1098 1041 1157 11104 --
NM_006888chr1453129 3032 2561 997 26 23299 2714 ----
NM_006896chr731138 830 231 ------
NM_006898chr2--1821 2226 100 --
NM_006906chr112773 169 --1100 --
NM_006908chr721101 1067 ------
NM_006915chrX41816 1652 722 495 2992 351 --141
NM_006922chr222598 765 ------
NM_006924chr1744028 3755 2964 161 11338 33765 990 699 12808
NM_006930chr521869 1849 --11781 1643
NM_006931chr1251663 1407 824 353 290 --11580 1430
NM_006937chr172561 134 ----1143
NM_006940chr1241249 636 552 485 --21599 1404 1565
NM_006950chrX5688 618 360 316 43 3298 134 112 --1731
NM_006955chr1032731 2358 814 --1547 --
NM_006965chr182937 379 21169 99 11151 1269
NM_006981chr962788 2153 519 501 457 98 1906 1741 --
NM_006987chr1741227 1180 1053 173 1322 31307 1126 29 --
NM_006988chr212790 782 ------
NM_006990chr162081 1794 244 238 183 36 11966 71877 1780 1622 450 331 162 128 --
NM_006999chr541394 397 243 231 --1596 --
NM_007005chr921073 152 --131 --
NM_007007chr1244728 4137 3884 3249 11102 24332 2950 --
NM_007011chr15185847 5492 5076 5039 4999 4961 4921 4882 4529 2679 2109 1998 1559 1439 1397 491 357 164 55361 4744 580 305 208 44580 4538 2656 1889 --
NM_007013chr831009 412 187 ------
NM_007026chr173468 103 80 --1474 --
NM_007036chr5------1825
NM_007038chr2174869 4289 3844 2237 2186 504 400 56055 4200 3831 2331 1282 ----
NM_007039chr1431829 1722 1679 11622 32053 1554 82 --
NM_007040chr196909 421 390 278 267 160 1724 4990 889 165 44 --
NM_007042chr362542 2314 1943 782 461 287 12298 --1446
NM_007050chr20188048 6617 6329 5749 5346 5132 5046 3113 2375 2023 1730 1617 1527 1451 1346 1161 744 216 23137 542 21505 385 45605 3232 2825 620
NM_007054chr563633 3195 2746 1042 640 85 13028 23606 3517 --
NM_007067chr1741280 1208 1055 416 1605 --11535
NM_007068chr223427 415 349 1100 ----
NM_007073chr683790 3774 3629 3417 3277 2952 1128 927 23369 354 13784 13270
NM_007078chr10--21976 495 --1304
NM_007084chr1321234 358 --1414 --
NM_007107chr332310 811 432 ------
NM_007111chr132875 159 ------
NM_007124chr631767 1729 765 --1220 --
NM_007125chrY1364 ------
NM_007129chr132854 373 ----1319
NM_007144chr17199 21129 372 188 --
NM_007145chr1911149 2953 539 ----
NM_007146chr1732788 2637 1097 2560 142 32668 2187 379 --
NM_007158chr11445 11192 21115 146 --
NM_007159chr31686 --187 --
NM_007166chr111977 21443 447 ----
NM_007170chr11189 --3785 341 86 2916 275
NM_007174chr1261715 1680 924 828 780 418 1950 2694 629 1787
NM_007175chr872446 2301 738 506 356 91 72 ------
NM_007185chr14808 681 220 53 11100 1198 1435
NM_007189chr731379 560 247 --1584 --
NM_007191chr121157 ------
NM_007192chr1431113 281 274 --135 --
NM_007195chr1873271 3196 2949 2570 2346 1271 899 12995 1918 23133 821
NM_007202chr172647 56 --3772 611 604 --
NM_007203chr933348 1382 424 33645 488 439 1557 12561
NM_007204chr11130 ------
NM_007207chr13793 604 275 ------
NM_007212chr14626 417 212 153 2832 258 --1910
NM_007214chr621246 1099 ------
NM_007217chr3130 ------
NM_007220chrX114878 4630 4206 3990 3843 3772 3506 3317 3179 1334 557 34588 4566 3729 34815 3687 1658 14213
NM_007222chr831763 1729 1682 11410 ----
NM_007224chr123505 137 67 --1636 --
NM_007236chr1552393 1580 657 429 93 --3437 375 99 1256
NM_007238chr2084837 4758 4613 4119 4106 1343 317 74 14327 --24086 3659
NM_007245chr162769 366 1622 1131 1843
NM_007246chr4------188
NM_007249chr13219289 8983 8083 7516 7409 7270 6979 6670 6211 5821 5751 2793 2672 2596 2504 2079 1354 1323 1289 1028 850 88972 8947 8017 7966 7550 6960 6022 2822 37881 6805 5757 16629
NM_007270chr731437 1190 504 --11122 --
NM_007275chr31437 --1452 --
NM_007276chr72261 218 2781 696 ----
NM_007283chr3122479 2298 2062 2021 1911 1198 1028 1002 746 663 380 68 12150 32831 681 442 1542
NM_007286chr562115 816 721 618 287 213 31942 1394 749 --21318 235
NM_007292chr1775185 4981 4647 3748 3615 413 249 --13937 --
NM_007308chr4----1183 --
NM_007313chr951887 1747 1583 1482 717 1604 21331 201 1417
NM_007320chr192288 237 ------
NM_007345chr1832134 1678 249 ------
NM_007349chr72110 80 ------
NM_007350chr1253552 3257 3190 1616 1446 24087 3418 11732 --
NM_007357chr13568 423 153 ------
NM_007358chr131683 1655 729 11821 ----
NM_007373chr1041778 1218 681 380 11156 ----
NM_007375chr132362 1881 290 ------
NM_009585chr34765 684 173 60 ------
NM_009585chr34765 684 173 60 ------
NM_012069chrX42566 2549 402 130 11928 2624 230 --
NM_012074chr1451078 954 821 129 108 1815 ----
NM_012081chr51694 1290 1161 --
NM_012083chr1041090 852 835 240 1542 ----
NM_012095chr1062718 2440 2182 1085 1065 448 --12672 22289 2197
NM_012102chr142398 2249 2084 2043 1924 1269 --
NM_012104chr11113163 2688 2462 2416 1427 1380 1221 1161 999 432 32 23368 321 43082 1444 1034 1021 13226
NM_012104chr11113163 2688 2462 2416 1427 1380 1221 1161 999 432 32 23368 321 43082 1444 1034 1021 13226
NM_012110chr4244 27 ------
NM_012120chr622876 949 ------
NM_012134chr141591 1264 181 174 1655 --21585 1231
NM_012137chr172160 2054 1930 1909 653 555 539 22744 2379 ----
NM_012141chr1333196 287 245 23056 1143 ----
NM_012156chr20113347 3065 3045 2836 2824 2508 2488 2434 2377 2329 81 1581 51272 741 734 657 356 1464
NM_012158chr1311508 ------
NM_012160chr61196 ------
NM_012161chr411032 --11179 --
NM_012164chr976676 6285 5283 4730 2860 2312 806 36510 4571 449 45692 5395 2041 1145 --
NM_012180chr41535 ------
NM_012183chr11239 --1141 --
NM_012193chr11145286 4899 4420 4370 4032 3574 3455 3352 1877 1865 1816 1531 674 332 14730 35151 4633 684 --
NM_012199chr1184520 4340 4052 3954 3636 2951 2929 2922 2899 1870 1306 1152 1084 1075 1055 750 636 42 23131 1648 64079 2956 1528 1440 783 670 33831 3600 940
NM_012210chr951226 1130 1004 390 182 2967 353 251 46 --
NM_012215chr1041334 729 375 226 21666 1299 ----
NM_012219chr343035 2890 2675 277 22395 568 32514 1144 388 1187
NM_012232chr1772051 2033 2027 1914 1805 1443 31 --41893 1886 322 50 21623 1457
NM_012234chr342727 1386 1183 1065 ------
NM_012238chr1031706 1352 697 11474 ----
NM_012244chr1461647 1632 1477 1368 574 510 --61657 1505 1317 497 345 34 11165
NM_012247chr102649 50 ------
NM_012250chr1131155 1107 50 ------
NM_012252chr774501 3475 3349 2120 1870 1518 397 43746 1005 731 462 13719 --
NM_012255chr201168 ------
NM_012262chr164878 4293 4251 3180 2061 2004 43369 1940 1287 776 13711 --
NM_012279chr581875 1801 1752 1569 1361 517 325 51 1279 51594 1585 743 498 270 --
NM_012281chr721762 800 ------
NM_012287chr363789 1552 1340 1247 552 343 21692 766 1443 --
NM_012288chr6205441 5067 4969 4790 4744 4521 4189 4152 4089 3758 3491 2040 2018 2008 1863 768 356 225 156 87 24683 866 74670 3934 2228 2030 1256 1241 173 11829
NM_012294chr743792 1434 1425 76 33055 2928 193 --13891
NM_012296chr1163427 2962 2678 2640 293 54 11472 53376 2489 397 159 85 23433 850
NM_012297chr422083 1836 1167 --11680
NM_012298chr31218 ----1156
NM_012300chr562074 1813 1660 922 589 478 --2248 213 --
NM_012301chr761771 1548 1413 609 316 215 ------
NM_012302chr121012 303 ------
NM_012304chr572474 2362 2333 1758 996 922 239 22093 147 2898 328 11697
NM_012306chr12123558 3539 3421 3331 3065 2403 2379 2294 1036 547 373 53 23520 3057 23544 3126 1841
NM_012307chr184810 682 175 78 11020 ----
NM_012308chr1152493 1990 1923 803 584 1643 2139 41 1873
NM_012309chr1174194 3370 1500 1168 907 497 401 54088 3210 1984 600 446 23800 1399 --
NM_012310chrX4620 446 247 85 1201 ----
NM_012316chr1145408 4493 3793 1676 1315 981 975 943 902 820 605 402 376 244 --93879 3688 3559 1922 1642 1283 1101 381 155 --
NM_012326chr23763 271 79 --137 --
NM_012327chr1851092 328 276 240 41 11584 ----
NM_012328chr731323 1232 199 ----145
NM_012329chr1731057 1044 359 ----1393
NM_012334chr532883 1582 439 --1359 13426
NM_012384chr2082373 2277 2220 2031 786 555 513 218 --11784 --
NM_012395chr732354 2292 310 23122 2811 22334 1165 --
NM_012398chr1952920 2783 2541 1135 786 1848 12371 1737
NM_012412chr72826 222 --128 --
NM_012414chr1------1525
NM_012416chr92819 97 1135 1247 1125
NM_012423chr191306 126 146 --
NM_012448chr1772159 2057 1570 1021 731 240 85 --32553 2042 542 --
NM_012461chr143586 478 251 --151 --
NM_012463chr121599 ----1152
NM_012464chr442230 1030 900 516 ----12363
NM_012478chr175711 694 408 189 100 1930 3834 678 296 --
NM_012479chr731750 790 108 22707 61 11929 --
NM_013227chr153727 637 282 1270 1758 --
NM_013229chr1242667 876 679 439 1169 ----
NM_013230chrY1586 1485 --137
NM_013231chr1483863 3433 3301 3236 1532 1446 1199 1027 --1701 13439
NM_013243chr1531125 437 165 1233 ----
NM_013245chr165723 574 288 217 119 --2648 225 --
NM_013246chr112703 120 ----1717
NM_013253chr1151386 451 119 107 94 2178 55 ----
NM_013255chr7178664 7824 7570 6967 6924 6528 6259 5834 5483 3513 2146 1877 1755 1572 431 230 154 22076 2064 27545 2120 28658 6874
NM_013257chr832168 953 300 ------
NM_013259chr31288 --192 --
NM_013261chr432773 1352 100 12923 --166
NM_013269chr1254241 4180 3459 1258 198 23998 3512 24262 1460 14284
NM_013275chr162611 196 1325 ----
NM_013277chr123243 171 24 2931 107 1176 --
NM_013279chr11102300 2197 2053 1620 1601 815 517 360 276 229 11845 22219 611 11698
NM_013281chr2031198 980 581 ------
NM_013293chr73611 93 38 176 ----
NM_013313chr2283228 3068 2546 2475 964 882 290 232 --43512 3412 2525 21 --
NM_013316chr73133 85 54 --1799 --
NM_013336chr341686 538 443 302 1342 --1601
NM_013341chr242020 1160 1077 794 ------
NM_013354chr82358 318 --1100 --
NM_013357chr83746 203 87 ----1870
NM_013368chr191201 --1466 131
NM_013372chr1542920 2806 1037 469 33180 2281 1082 ----
NM_013374chr312217 1850 12033 1804
NM_013377chr121605 ------
NM_013382chr1472143 2117 2099 873 727 664 40 --32059 1769 1630 11605
NM_013390chr921387 257 1251 11162 --
NM_013396chr213318 271 62 ------
NM_013400chr72992 968 1849 ----
NM_013403chr192288 246 --2761 150 1182
NM_013411chr161847 1812 1716 1092 779 601 22482 1988 1606 11751
NM_013417chr9------138
NM_013423chrX2928 109 ------
NM_013427chrX2928 109 ------
NM_013433chr1961867 1775 1469 1332 1284 476 --51947 1930 1877 1347 142 --
NM_013434chr22695 249 1399 31741 1722 587 --
NM_013434chr22695 249 1399 31741 1722 587 --
NM_013438chr9----21605 1297 --
NM_013444chrX6987 779 343 278 252 186 --41000 216 211 172 --
NM_013446chr73998 185 147 21445 496 1164 --
NM_013448chr142648 639 ------
NM_013449chr12122993 2930 2112 2005 1990 844 811 710 657 626 540 175 42263 1132 1103 558 82718 2375 2133 644 533 337 323 182 1834
NM_013450chr221047 349 --1355 --
NM_013951chr232489 2346 888 1553 32304 852 438 12014
NM_013952chr232566 2423 965 1630 32381 929 515 12091
NM_013953chr232566 2423 965 1630 32381 929 515 12091
NM_013958chr8----1145 --
NM_013959chr8----1145 --
NM_013960chr83609 518 193 ------
NM_013961chr8----1145 --
NM_013962chr8----1145 --
NM_013989chr1475032 4279 4203 3649 3339 1271 1075 13922 44537 3978 3367 1454 14631
NM_013992chr232566 2423 965 1630 32381 929 515 12091
NM_013993chr65618 590 217 208 183 --3524 176 94 --
NM_013994chr65618 590 217 208 183 --3524 176 94 --
NM_013995chrX22532 356 ------
NM_013999chr173379 333 120 11054 31104 519 154 2244 126
NM_014000chr1051494 735 496 471 368 51810 1441 1416 635 340 2501 354 1613
NM_014001chr1751463 1321 1299 1291 314 1383 21358 458 --
NM_014005chr562931 2409 1965 1211 824 635 22459 656 1395 --
NM_014007chr92989 836 1175 --1791
NM_014010chr94556 507 152 61 ------
NM_014011chr21481 ------
NM_014016chr3176 ------
NM_014021chr123031 281 22956 2222 31319 139 130 11207
NM_014030chr171830 --21140 859 1748
NM_014034chr641551 979 406 58 --1260 21132 972
NM_014038chr7----1127 --
NM_014043chr31251 ------
NM_014057chr951523 1113 581 502 365 21321 436 ----
NM_014059chr131272 ----1346
NM_014106chr1542039 1920 937 675 12130 ----
NM_014109chr84473 412 358 141 ------
NM_014110chr13282 252 88 --1885 --
NM_014112chr844738 4378 529 130 34816 4765 4328 ----
NM_014117chr1692363 2321 2264 2241 1972 1943 844 764 748 --32270 1783 95 --
NM_014141chr775053 3928 3452 1352 1240 432 209 24715 3635 13502 --
NM_014145chr201143 --1579 --
NM_014149chr72675 201 1697 1595 --
NM_014155chr11146877 6608 6380 5974 5717 5675 5630 2782 2283 1353 1073 989 403 143 25511 2118 ----
NM_014157chr16113321 2997 2797 1383 1343 1287 1249 1219 972 277 89 1794 31272 627 545 23179 1436
NM_014166chr13--1837 2821 810 --
NM_014169chr143211 50 21 ------
NM_014181chr251912 1159 857 826 779 1691 ----
NM_014182chr122291 72 182 1726 1130
NM_014183chr201261 ------
NM_014186chr1182245 2117 1462 757 729 602 575 509 12129 12163 --
NM_014188chr13269 60 37 --1303 --
NM_014189chr421360 336 11499 31260 1008 389 --
NM_014190chr441712 1158 688 105 11851 31612 1360 741 --
NM_014191chr12168 ------
NM_014211chr561541 1487 1449 1419 1304 223 21530 691 ----
NM_014212chr124947 839 615 89 1826 1388 --
NM_014216chr1431607 491 480 --1443 --
NM_014217chr151501 578 525 269 47 21858 1579 2531 279 --
NM_014231chr1282028 1953 1613 1583 1546 472 267 132 21605 640 11486 2119 85
NM_014232chr1710653 626 498 399 349 293 274 251 241 61 --61635 1494 383 361 284 279 --
NM_014232chr1710653 626 498 399 349 293 274 251 241 61 --61635 1494 383 361 284 279 --
NM_014233chr1772174 1893 1781 1724 1361 417 74 --11527 --
NM_014234chr6----1173 --
NM_014238chr1741707 1371 1078 281 --138 --
NM_014248chr22----156 --
NM_014250chr222525 259 11389 31575 1570 1488 --
NM_014252chr13----1127 --
NM_014253chrX41662 1571 553 538 --1633 --
NM_014267chr111239 1786 ----
NM_014268chr1861444 1337 1274 1140 564 289 ----1306
NM_014270chr19171 ------
NM_014282chr93919 493 109 21227 191 --1165
NM_014283chr141369 355 324 203 ------
NM_014284chr1--1842 31037 105 66 1823
NM_014289chrX1447 1142 21182 123 11259
NM_014293chr2293999 3471 3447 1356 1108 577 495 132 68 12749 3569 421 98 53408 3164 1386 1049 660
NM_014294chr821362 1129 11231 ----
NM_014299chr196737 650 593 579 265 52 2714 123 1433 --
NM_014309chr22145187 5136 5099 5065 4974 3993 3923 3905 3633 3582 1275 1233 939 586 44712 4494 4119 1553 85192 4921 3897 3466 1862 817 611 599 --
NM_014316chr1662194 1998 1858 1847 1749 652 1324 1368 1441
NM_014319chr1231642 655 70 1445 ----
NM_014323chr223414 392 161 ----1148
NM_014331chr4117536 6459 6377 6198 5855 5160 4926 3005 2503 2347 2098 46062 5845 5390 2234 1503 --
NM_014332chrX2327 155 1316 ----
NM_014333chr1162661 1021 579 358 335 238 --1442 11005
NM_014342chr1131480 1384 1264 --11323 --
NM_014344chr112839 362 --1700 --
NM_014345chr65935 907 274 172 165 --1178 1954
NM_014368chr951793 1344 399 371 352 1270 21613 163 --
NM_014374chr72992 968 1849 ----
NM_014376chr572250 2196 768 558 490 334 258 2301 196 22172 520 --
NM_014381chr1473301 2244 2109 1000 464 423 170 11206 --1486
NM_014388chr1136031 5884 5427 4694 4389 4187 4121 3846 3706 2318 1487 1476 367 15805 44989 3865 3741 3685 25863 4804
NM_014393chr832308 731 370 --11714 2948 221
NM_014397chr941422 1321 329 62 21438 122 ----
NM_014399chr71172 ------
NM_014400chr196457 344 71 61 38 23 2446 124 ----
NM_014410chr182345 324 ------
NM_014418chr1441889 1306 387 117 1294 ----
NM_014421chr452139 1755 1704 1392 310 ------
NM_014423chr564687 2106 2035 1134 1002 115 135 ----
NM_014431chr103429 120 112 11598 1360 --
NM_014437chr1153 --2597 60 --
NM_014445chr351938 1820 1582 119 31 ------
NM_014447chr421559 138 11636 ----
NM_014452chr62894 178 2383 299 ----
NM_014456chr101515 ------
NM_014458chr121103 32 11181 41280 1273 881 255 --
NM_014460chr2231738 1701 584 --1477 --
NM_014469chr11----1296 --
NM_014470chr122639 593 --139 --
NM_014478chr73696 484 268 --1371 --
NM_014494chr1641849 711 390 314 2958 135 22073 2052 11912
NM_014496chrX1252 ------
NM_014504chr741903 1514 770 251 --1277 --
NM_014515chr1211049 --132 --
NM_014517chr331630 1266 1232 11800 ----
NM_014521chr241666 1644 1470 1389 21743 1693 ----
NM_014554chr1262250 1448 1430 694 564 163 --32294 1675 552 12018
NM_014562chr21269 ----1102
NM_014570chr223211 184 39 ------
NM_014573chr1731835 1337 284 --11563 --
NM_014586chr21134552 4503 4148 4061 3908 3611 3564 3398 3284 1528 446 273 238 21207 619 2281 243 11686
NM_014587chr161431 --11253 11190
NM_014591chr105920 428 374 235 75 31080 893 289 1348 11284
NM_014604chr172636 147 --2157 152 --
NM_014606chr461114 401 394 384 374 27 2333 38 21031 465 21260 1121
NM_014607chr231952 827 444 22065 620 1514 --
NM_014612chr9199 11381 --11222
NM_014614chr241321 588 406 164 1184 ----
NM_014615chr1673655 3248 2919 2737 589 526 445 33094 2813 2507 33162 2276 264 --
NM_014616chr333518 625 42 --11063 --
NM_014620chr12----1127 --
NM_014630chr15122908 2684 2676 1217 1041 1019 927 899 751 555 542 422 --33201 3072 983 43856 3435 3278 974
NM_014634chr2232661 1107 49 22729 440 53515 2415 643 119 32 13581
NM_014636chr963495 1727 1352 886 877 649 24142 3114 43137 1365 1358 836 21101 845
NM_014646chr1853018 2945 2036 487 148 --22999 2491 197
NM_014647chr1621571 195 11447 1713 12157
NM_014653chr1272063 1502 685 662 541 459 211 11734 11575 11495
NM_014660chr71953 --1366 --
NM_014661chr1073936 1550 1537 824 551 502 113 11398 23752 297 13297
NM_014663chr11143 --11057 --
NM_014667chr352350 2314 1895 748 251 --11678 --
NM_014671chr741613 145 134 44 1579 --1510
NM_014674chr373843 3668 3463 3256 3164 2923 2655 11504 43507 3183 3176 641 --
NM_014676chr121364 23 --11413 1443
NM_014677chr821057 1011 --11034 --
NM_014679chr112989 72 11145 1436 --
NM_014682chr81896 22272 143 1539 --
NM_014683chr1732194 1656 696 --21895 209 --
NM_014686chr1932250 1852 658 ----1695
NM_014690chr752775 2245 2101 2039 1224 42062 1988 436 416 32339 2252 820 32830 2258 2071
NM_014702chr663274 3240 1099 523 162 119 22726 2567 13106 22955 2464
NM_014705chr721903 765 ------
NM_014707chr732289 2260 475 --1480 --
NM_014709chr21195 ------
NM_014711chr1631959 159 36 11503 1429 --
NM_014720chr102734 374 ------
NM_014721chr697068 6942 6312 5763 5337 5186 4707 776 60 42176 1941 1284 539 1882 27493 7228
NM_014723chr2082963 2946 2924 2660 2622 2079 711 62 --42795 2707 698 74 --
NM_014726chr1751008 979 493 187 31 --1155 --
NM_014729chr8123 186 1217 --
NM_014730chr12195189 4867 4672 4446 4327 4061 3948 3878 3678 3647 3421 3378 1903 1443 1022 759 551 276 236 45051 4223 2047 1512 94769 3744 3733 3540 3429 1475 1312 894 813 --
NM_014730chr12195189 4867 4672 4446 4327 4061 3948 3878 3678 3647 3421 3378 1903 1443 1022 759 551 276 236 45051 4223 2047 1512 94769 3744 3733 3540 3429 1475 1312 894 813 --
NM_014731chr2021224 143 --11354 21803 86
NM_014733chr551478 805 799 635 587 ------
NM_014735chrX61665 1507 1449 514 439 280 ----1767
NM_014739chr672881 2731 1636 1538 1142 1095 332 --24011 337 --
NM_014742chr2021470 257 31647 706 400 31186 575 567 --
NM_014743chr462877 2460 2305 1114 610 100 33059 422 195 --12011
NM_014747chr1135757 5674 5555 5471 5383 5120 4930 4417 1585 1326 1234 1024 590 25287 3726 54438 4117 3959 3690 1227 34888 4005 3735
NM_014751chr84778 767 761 243 1397 ----
NM_014752chr1141942 1809 445 28 ------
NM_014754chr83825 709 354 1160 1790 --
NM_014755chr2103829 3249 3212 3046 1544 1526 1451 1436 1282 1105 2212 68 44123 2876 1299 1287 --
NM_014756chr113389 323 172 ------
NM_014757chr562362 1801 1761 1620 914 702 21722 620 2950 749 21646 1637
NM_014761chr166988 747 283 176 151 70 ----11059
NM_014764chr124514 465 355 55 ------
NM_014765chr132076 539 479 1174 2719 544 --
NM_014766chr783476 3399 3194 2736 627 595 196 39 --31266 1255 398 --
NM_014767chr1063332 2732 2247 1350 1260 317 22621 1374 43555 1332 1285 489 22651 1401
NM_014770chr121124 11024 --11103
NM_014771chr163814 690 287 1349 1886 --
NM_014772chr18123600 3535 3434 3129 3011 2841 2552 2404 2211 1456 1278 925 --22733 2217 1274
NM_014774chr192797 2559 2144 2080 1278 952 839 727 280 ----1867
NM_014776chr1292960 2936 2865 2383 1244 1058 949 577 418 --22643 2623 --
NM_014779chr34815 345 156 70 ------
NM_014786chr111419 1379 2886 191 --
NM_014795chr241345 481 471 25 1504 ----
NM_014798chr1751782 1691 736 653 583 21745 402 31509 1402 1279 --
NM_014800chr761156 1140 324 226 200 126 --3882 464 329 --
NM_014803chr1062576 2562 2299 2097 1040 354 1299 ----
NM_014807chr114658 591 343 68 2265 45 --1717
NM_014810chr163156 2815 2649 2637 2584 1286 --22608 888 --
NM_014812chr121588 1322 11608 1286 --
NM_014819chr531928 1552 775 ------
NM_014820chr32599 204 --11904 --
NM_014822chr41120 ------
NM_014824chr111212 ----11531
NM_014826chr163850 1423 1148 940 733 204 22785 1291 31374 395 72 --
NM_014827chr11253 ----11476
NM_014830chr1252622 2615 2401 1573 734 23843 3543 53669 3431 3406 2878 2653 1305
NM_014832chr1331379 604 348 1450 ----
NM_014836chr1011307 --1130 --
NM_014838chr2242701 2468 2428 2238 --1167 1625
NM_014839chr192318 2013 1980 1829 1787 1601 924 602 316 1386 1881 11823
NM_014840chr1242729 1261 837 418 21148 1092 12297 --
NM_014841chr62402 127 ------
NM_014849chr13355 336 58 21174 233 4889 308 279 63 1346
NM_014850chr384557 3961 3886 3547 3496 3489 3458 82 34332 1594 260 84699 4282 4042 1612 1324 1319 317 291 --
NM_014859chr1731339 991 107 11266 ----
NM_014868chr123231 187 56 ----127
NM_014871chr12172 ------
NM_014872chr922171 223 2946 734 11932 --
NM_014873chr163751 3265 1726 1456 1307 679 11841 1474 11610
NM_014875chr13941 751 741 ------
NM_014876chr2282123 1726 1602 1527 690 379 297 115 1765 --193
NM_014877chr1797368 7193 7056 6778 6009 2580 2445 1440 96 12051 1902 22557 910
NM_014883chr44784 571 531 288 12363 1358 2658 551
NM_014887chr132717 643 ------
NM_014888chr721364 522 1227 11500 --
NM_014897chr1763099 3079 3070 2568 2160 2080 126 21101 338 --
NM_014901chr521589 1405 22028 567 11889 --
NM_014902chr2031217 468 248 --21527 415 --
NM_014903chr1252394 2072 376 365 325 --12112 --
NM_014904chr1063302 3156 2820 1457 640 115 21449 328 1753 --
NM_014906chr1753369 1016 1002 295 257 11503 --13375
NM_014909chr14113901 3655 3377 3359 3195 3141 2900 2675 2477 2416 373 1465 23942 3166 12570
NM_014912chr1022881 2728 --12604 --
NM_014914chr24441 404 371 108 ------
NM_014918chr1531299 529 511 ------
NM_014920chr643484 2541 1341 29 33242 956 641 32533 2418 52 --
NM_014921chr19102896 2754 2739 2493 2285 1197 1182 1020 521 504 1202 92866 2840 2829 2477 2026 1062 873 848 616 1891
NM_014923chr1311901 12301 1240 11716
NM_014924chr143983 839 308 33142 2240 1100 2615 49 --
NM_014925chr126809 777 681 365 239 207 ----1765
NM_014926chr331151 743 117 ------
NM_014932chr321376 678 --1710 --
NM_014933chr4------1383
NM_014935chr183293 2437 1502 1432 1348 1165 860 359 12372 23822 3464 --
NM_014936chr652795 2129 921 717 460 --1301 --
NM_014939chr1821567 610 ------
NM_014945chr541889 1862 330 298 22009 1226 41285 1237 697 692 --
NM_014950chr1431776 603 111 ------
NM_014952chr156831 712 583 471 276 245 22028 1984 31374 550 448 --
NM_014962chr201873 22544 952 --1276
NM_014969chr14820 456 427 411 ------
NM_014974chr1051549 1434 1307 150 52 ----1710
NM_014977chr141157 1219 --1470
NM_014978chr1031322 1293 234 1413 1379 --
NM_014982chr1483751 3592 2127 1783 1374 1135 894 34 24324 807 22141 665 --
NM_014988chr452065 1762 979 858 93 12165 --12186
NM_014989chr631355 1293 395 --1563 --
NM_014990chr1441357 436 276 150 1375 ----
NM_014991chr462375 2292 2248 254 54 46 ------
NM_014992chr141681 1354 1291 --
NM_014994chr1572324 2039 660 630 198 178 135 2767 518 3837 784 467 11956
NM_014996chr331048 209 146 1186 --1846
NM_014997chr762892 2581 1108 251 208 190 ----1180
NM_015000chr1243088 2261 2122 1142 12411 12221 --
NM_015001chr14936 907 268 35 --2927 166 --
NM_015002chr124795 673 660 342 22163 1704 --1170
NM_015008chr363076 3010 2815 2488 1433 811 127 --13142
NM_015020chr1693597 3556 3523 3505 3351 3299 1251 789 211 32798 2387 1191 43702 1388 1219 1132 --
NM_015023chr151715 1673 1454 1432 115 --61555 1522 1424 1214 1149 1127 2679 93
NM_015024chr821334 1123 1106 11376 2976 149
NM_015025chr242031 1757 1006 888 12199 ----
NM_015026chr1294742 4586 4565 4478 4443 3527 1218 1072 955 --24541 4469 11486
NM_015027chr1631765 1502 631 21785 230 --11241
NM_015032chr1331947 978 897 12589 1518 --
NM_015033chr972676 1062 940 899 811 309 35 --22694 504 --
NM_015039chr163571 3515 3139 901 438 194 41010 165 107 81 34112 1523 589 --
NM_015042chr15164279 4252 3681 3660 3637 3608 3432 3214 2878 2828 2708 1503 1489 1117 961 851 2833 342 64296 3718 3642 3443 857 608 64263 2806 1435 1083 881 199
NM_015044chr1683146 2864 2625 2554 2492 2066 805 773 --12675 --
NM_015045chr1031506 1435 553 ------
NM_015049chr263093 2764 2741 2552 1123 496 22953 2052 ----
NM_015051chr973377 2886 2808 1341 1122 971 143 1981 12851 --
NM_015052chr75507 491 195 70 51 --21213 76 --
NM_015053chr152238 1773 599 114 77 --2313 26 --
NM_015060chr71193 ------
NM_015063chr1941344 1270 216 86 --5500 389 194 187 129 --
NM_015064chr1293256 2334 1444 1320 1050 989 922 821 165 33112 2719 1087 12729 11039
NM_015068chr751476 1244 645 290 58 ------
NM_015069chr161243 ------
NM_015071chr5115203 5166 4964 4321 4152 2087 995 901 790 654 621 34788 2168 1071 32315 2292 2286 --
NM_015072chr141480 --1395 --
NM_015074chr194288 3797 3714 3418 3152 1742 1669 560 356 33678 3387 158 21911 120 --
NM_015075chrX42245 1901 1760 99 11599 21571 359 --
NM_015076chr654474 3811 2842 957 239 32961 1078 202 2910 215 --
NM_015079chr1573031 2774 2433 2177 789 120 31 1244 12310 1237
NM_015080chr1131013 392 117 1374 1175 --
NM_015082chr522397 511 11873 32092 679 483 1789
NM_015086chr1231048 88 79 11459 21588 556 169
NM_015087chr1322233 470 32307 2054 80 22671 2252 --
NM_015092chr16114584 4469 4360 4006 3910 3817 3621 3543 1840 990 677 1650 --13196
NM_015093chr62321 23 --1525 --
NM_015097chr332293 1866 293 1111 11474 --
NM_015100chr171714 1565 1349 1337 624 609 362 1738 5804 749 630 614 155 11721
NM_015107chrX62448 2372 1883 1516 579 172 31592 1496 465 --3210 178 49
NM_015115chr432458 110 96 ------
NM_015125chr192503 449 1375 1156 1524
NM_015132chr731755 1574 153 1301 ----
NM_015138chr1582583 2412 1011 939 812 475 66 58 ----2823 794
NM_015141chr33994 972 573 1227 ----
NM_015143chr41326 ----11277
NM_015144chr1653787 3263 3256 1077 822 1381 1659 12515
NM_015155chr103975 668 155 1853 12330 --
NM_015156chr1463516 2625 641 323 194 175 33430 3155 578 33632 858 635 12995
NM_015161chr1661461 1340 1042 514 285 108 1500 1582 --
NM_015170chr821729 616 ----1567
NM_015171chr161352 --1110 --
NM_015172chr131287 1187 599 ------
NM_015173chr431596 1366 105 --11587 1220
NM_015176chr121472 1165 11311 1165 --
NM_015185chrX82740 2470 2372 2322 2203 557 528 514 32633 2452 846 22387 317 --
NM_015191chr1122656 828 12026 21048 168 --
NM_015194chr1771816 1479 1359 1328 627 618 145 21691 1556 31669 1350 174 --
NM_015199chr382577 2312 2289 2172 2088 1985 1958 1831 ------
NM_015200chr451770 709 593 234 154 --21992 243 --
NM_015202chr1641707 1533 1366 1051 21391 1155 ----
NM_015206chr15103615 3050 2653 2610 1220 1072 617 504 433 320 --12615 --
NM_015208chr1841504 1363 781 506 33719 2895 943 ----
NM_015209chr142095 1888 377 368 --12275 --
NM_015215chr133211 2126 335 --1308 --
NM_015216chr531292 442 61 11247 11088 1484
NM_015225chr972985 2650 2338 842 563 438 189 13104 ----
NM_015226chr1673453 3138 1368 1170 1074 695 590 1828 22778 328 21176 874
NM_015229chr173885 865 340 --1108 --
NM_015233chr1352358 1030 653 506 35 12163 ----
NM_015235chr103839 780 107 --11877 11988
NM_015236chr42979 201 --2984 229 --
NM_015245chr652296 2064 1115 611 580 --42575 2260 2039 1753 12131
NM_015250chr951859 1589 1437 386 377 1159 3254 62 56 11595
NM_015252chr23163 153 49 1607 1324 --
NM_015254chr8133198 3176 2982 2933 2866 2785 2765 2753 2072 1090 722 496 405 --12492 1100
NM_015260chr1911552 ----11096
NM_015263chr151361 ------
NM_015264chr2244000 1251 1216 910 23920 1306 64547 4313 3589 1806 888 192 --
NM_015265chr252497 2140 2119 2066 666 ------
NM_015270chr1241658 1640 394 243 12247 52222 1672 1541 933 351 1514
NM_015271chr484350 2922 2859 1680 1008 872 861 121 ------
NM_015272chr1661929 1853 1681 245 193 186 1226 1516 --
NM_015277chr1811147 ----1193
NM_015278chr632205 1362 72 23254 2358 ----
NM_015282chr262581 2557 2038 1231 1020 930 --42687 2487 410 64 --
NM_015284chr182085 2074 1906 1623 1572 1345 597 413 11762 32103 2091 1675 12029
NM_015288chr573662 3391 3000 2805 1076 852 173 --22836 2598 21319 1154
NM_015291chr162578 1143 509 277 213 143 1232 --23028 412
NM_015296chr133402 184 43 ------
NM_015299chr14103780 3729 3554 3366 3286 1480 1360 986 370 221 --13816 33794 3447 3294
NM_015305chr1491980 1749 1615 1552 387 268 209 132 28 2157 140 21288 119 --
NM_015310chr8106870 6719 6190 3233 2798 1711 1516 1233 984 274 47960 7791 6990 3003 57224 2732 2492 2112 1716 --
NM_015313chr11104076 3635 3343 3188 3122 3087 1286 710 602 217 23433 2946 21624 684 43543 3474 3328 3244
NM_015315chr5103390 2939 2783 2434 2242 2183 996 963 746 548 13152 42169 2108 862 201 --
NM_015317chr252518 2371 2339 2128 1113 ------
NM_015320chr24386 357 174 37 --290 64 11018
NM_015326chr182784 2374 2071 1817 1015 741 184 65 --22708 202 22483 2300
NM_015327chr141245 1214 868 258 --1481 1376
NM_015328chr7112561 2321 2286 1189 876 866 778 671 637 366 317 31023 283 56 22685 421 194
NM_015335chr1242158 1847 195 137 --140 11916
NM_015336chr1222445 914 ------
NM_015338chr2041559 1351 752 689 1344 21853 125 --
NM_015339chr2031009 192 78 --1300 --
NM_015344chr841766 679 131 36 ----11928
NM_015346chr1491734 1610 1568 1429 1224 527 150 99 78 --2606 391 1342
NM_015349chr642705 2130 2115 1952 --22072 547 22260 651
NM_015359chr862839 2707 2586 2170 526 489 ----1827
NM_015365chrX114119 3629 3027 1702 1388 396 379 360 345 333 48 33933 615 465 23258 384 --
NM_015374chr222235 206 --2211 65 1476
NM_015375chr184875 4121 3665 3532 3400 1546 1410 139 33514 1590 577 144 23834 1691
NM_015378chr143018 2990 2673 2314 --11813 22766 2712
NM_015382chr141288 ------
NM_015385chr1042454 2006 1290 1100 1778 1264 --
NM_015387chr231502 720 713 21564 684 21926 460 --
NM_015388chr61263 --2268 34 --
NM_015393chr472888 2560 2380 1226 1128 674 139 --2280 167 --
NM_015396chr331278 1080 1055 1191 ----
NM_015397chr9101561 1514 1495 1402 1349 1278 738 687 292 194 --1779 --
NM_015401chr1251023 781 692 437 255 1293 ----
NM_015404chr93525 485 57 --1564 --
NM_015416chr122793 175 ----1668
NM_015426chr3----1582 --
NM_015429chr31388 --11060 --
NM_015435chr8--11343 --11027
NM_015436chr443091 2464 420 56 ----1969
NM_015443chr1731029 1016 570 --1215 --
NM_015444chr32657 106 --2259 56 --
NM_015455chr531530 1166 922 11080 ----
NM_015457chr112352 68 1708 2229 73 --
NM_015458chr875265 5135 4351 3826 3752 1862 1821 11223 --11516
NM_015460chr32584 291 11325 12083 --
NM_015464chr71330 1258 ----
NM_015465chr52660 486 ------
NM_015475chr22983 744 ----1407
NM_015481chr1211084 --51012 813 315 225 112 --
NM_015488chr251634 1374 1346 525 75 11430 31507 407 349 1303
NM_015493chr1932147 2099 77 --1148 --
NM_015509chr1261354 1280 1149 1138 438 92 --21540 1155 2444 136
NM_015514chr143534 428 148 ----1231
NM_015527chr164695 598 522 250 1128 2738 41 --
NM_015534chr13885 215 127 ----197
NM_015541chr3----1577 --
NM_015542chr1031043 961 250 ------
NM_015549chr142513 460 1205 2237 65 --
NM_015550chr7103299 2847 2835 2727 2244 1138 820 770 642 38 21414 152 22635 2275 12716
NM_015560chr332632 2493 770 --12304 --
NM_015564chr563404 3322 3251 2545 1156 548 ------
NM_015565chr2121628 119 ------
NM_015569chr194705 4668 4501 4327 3685 2952 1930 1918 492 1402 24598 619 --
NM_015571chr632611 2344 1027 21927 357 ----
NM_015575chr242773 2697 2379 397 1805 22995 2260 --
NM_015576chr312716 ----12261
NM_015577chr51551 --31322 151 125 --
NM_015578chr1942090 2008 1371 461 11769 12095 --
NM_015605chr102618 256 ------
NM_015609chr182504 2317 2171 1922 1903 1085 481 197 1895 32448 867 189 --
NM_015610chr782126 2020 922 785 630 570 539 339 11032 52317 2282 2002 1090 1085 --
NM_015627chr181620 1376 1178 679 452 422 403 379 --21382 693 1522
NM_015630chr2----11132 --
NM_015635chr941609 344 336 191 --1878 --
NM_015638chr204669 558 236 86 --2579 472 --
NM_015645chr112313 298 ------
NM_015646chr122177 110 ------
NM_015651chr941955 1912 1734 531 177 31793 1745 303 12014
NM_015652chr101182 --1485 --
NM_015670chr17396 80 59 --1108 --
NM_015680chr23608 573 548 --1592 --
NM_015686chrX21922 443 --42382 2090 1764 402 --
NM_015689chr7----127 --
NM_015695chr65761 618 491 177 132 --51825 1801 1724 739 99 1538
NM_015711chr192696 269 --4685 653 149 23 --
NM_015716chr174565 511 201 63 1291 5695 609 517 247 81 1186
NM_015719chr192244 179 --3738 524 149 --
NM_015726chr171849 1394 1362 645 573 454 64 11704 21869 1689 --
NM_015833chr2151519 920 559 325 250 --22302 933 11587
NM_015834chr211130 --1913 1198
NM_015840chr191726 883 803 706 503 477 301 213 101 32712 2126 72 5857 686 461 453 340 --
NM_015841chr191726 883 803 706 503 477 301 213 101 32712 2126 72 5857 686 461 453 340 --
NM_015844chr18------1213
NM_015846chr18------1213
NM_015847chr18------1213
NM_015850chr882264 1843 1798 1732 351 340 135 98 12445 ----
NM_015872chr161770 1387 1184 1160 1107 451 --51775 1708 1454 1335 131 11726
NM_015874chr4------1489
NM_015879chr18158183 7970 7631 7425 7031 5217 3305 3080 3058 2717 2466 1924 1488 1221 1215 36236 6218 3115 38270 2810 503 28278 2343
NM_015881chr1151386 451 119 107 94 2178 55 ----
NM_015886chr875192 5159 5050 4534 3600 939 117 14788 --15171
NM_015889chr222112 83 --1247 --
NM_015892chr1052147 1676 611 438 429 --22472 2196 --
NM_015897chr19124 ------
NM_015898chr19102484 2250 2167 2147 1573 940 762 440 214 193 11002 42493 2255 1658 253 1550
NM_015904chr22693 251 ----2286 242
NM_015906chr174270 3644 1867 1471 1156 883 761 ----1747
NM_015912chr822028 1749 22531 1855 21940 943 22098 719
NM_015913chr15566 545 520 510 221 --3659 589 214 --
NM_015948chr6162 ------
NM_015955chr22159 131 ------
NM_015960chr10189 ------
NM_015980chr521465 1192 --11473 11328
NM_015981chr5112916 2520 2372 2200 2035 1223 1210 870 637 101 76 12105 52500 1191 585 551 465 1247
NM_015982chr172425 345 ----1100
NM_015984chr11385 ----2222 163
NM_015987chr122117 81 1277 154 --
NM_015995chr15135379 5241 5215 4755 3974 3447 1712 1266 1242 1144 496 293 56 --64046 1498 1493 1349 1276 815 --
NM_015999chr13186 173 35 ------
NM_016002chr1151 ------
NM_016003chr782126 2020 922 785 630 570 539 339 11032 52317 2282 2002 1090 1085 --
NM_016018chr852858 2811 2031 765 465 11764 --12676
NM_016019chr73882 335 36 --1386 --
NM_016021chr631904 463 299 --32166 2075 1895 --
NM_016032chrX21334 500 2891 259 21168 301 --
NM_016037chr13885 867 321 ----11117
NM_016039chr14123 ------
NM_016041chr17----1312 --
NM_016057chr1231151 373 170 31195 1058 76 21122 1103 --
NM_016059chr61358 1723 1185 --
NM_016061chr231449 1107 554 21547 29 ----
NM_016063chr63776 645 570 193 1767 --
NM_016071chr7296 70 ----134
NM_016072chr1222325 2182 ------
NM_016076chr173017 2791 2443 2260 2228 829 585 ------
NM_016079chr252151 2064 1675 775 661 11862 --11707
NM_016081chr4----11468 --
NM_016083chr633671 2792 1218 1188 ----
NM_016096chr841342 676 357 145 1452 11408 --
NM_016107chr5--1238 1276 11051
NM_016131chr21759 --41976 948 794 743 --
NM_016132chr1531268 1250 350 23336 307 1880 --
NM_016147chr1151082 872 453 359 322 --2241 235 1209
NM_016151chr161318 174 1365 1108
NM_016152chr33955 383 256 131 ----
NM_016156chr1162250 2217 2170 1970 1768 1742 21587 464 12269 --
NM_016169chr1082792 2331 1289 730 595 499 473 416 21159 1003 43264 3014 2638 2477 --
NM_016192chr2------1252
NM_016194chr1541549 1387 1263 556 --1420 --
NM_016201chr382304 2002 1502 836 723 653 586 230 32175 1441 502 22161 105 --
NM_016206chr3148558 8418 8109 8052 7492 7246 7180 6925 6464 5673 2354 2176 1594 785 22235 212 37277 7268 3359 --
NM_016211chr4------1383
NM_016223chr11----158 --
NM_016224chr672077 1511 1347 754 288 76 40 --12111 11790
NM_016227chr141369 355 324 203 ------
NM_016231chr172572 43 ------
NM_016233chr14875 285 207 151 --1419 --
NM_016234chr10189 1739 --2288 197
NM_016240chr841535 1491 1333 520 21088 649 11520 --
NM_016248chr1353294 1084 756 624 486 23249 554 34000 1286 1247 --
NM_016252chr21945 ------
NM_016255chr672908 2293 971 917 595 560 429 23215 1091 ----
NM_016257chr163256 3063 2411 1404 1390 1023 --22333 142 1440
NM_016258chr11795 ------
NM_016260chr2137587 6309 6064 5971 5935 5676 5072 4668 2553 2461 2353 1493 1144 24714 83 36589 5559 565 --
NM_016269chr45947 732 481 344 321 --1765 --
NM_016272chr22112563 2425 1907 1860 1824 1814 1792 714 527 310 109 --42433 884 771 362 22459 793
NM_016279chr5177 ------
NM_016281chr121893 183 3984 881 185 --
NM_016284chr162795 90 ----1100
NM_016287chr192063 2047 1651 1618 1605 821 665 233 106 --11803 --
NM_016298chr322517 43 12036 12679 --
NM_016308chr111769 --1368 --
NM_016320chr1121093 57 1836 --1362
NM_016322chr972934 2894 2802 2356 579 383 241 ------
NM_016333chr161195 --1140 166
NM_016338chr53983 971 854 2864 191 ----
NM_016340chr53822 166 127 ------
NM_016353chr852004 1835 844 501 69 ----21915 272
NM_016376chr1753374 3203 370 323 105 23006 2688 24221 3262 13067
NM_016396chr1552884 2517 2488 2062 2049 22984 959 --12172
NM_016406chr1----2359 94 --
NM_016410chr93558 101 69 ------
NM_016418chr22133743 2935 2425 2381 2334 1442 1149 1075 978 876 571 496 314 23595 3024 53533 2666 1040 188 97 1847
NM_016422chr1142387 693 674 164 22821 109 --1731
NM_016436chr204928 536 419 231 1814 1784 12017
NM_016453chr3----2249 23 --
NM_016456chr12599 130 --4137 105 88 81 --
NM_016472chr141480 ----1940
NM_016486chr1------1186
NM_016507chr1773065 2340 2270 754 552 195 35 22197 598 1684 --
NM_016513chr643484 2541 1341 29 33242 956 641 32533 2418 52 --
NM_016522chr1131540 1285 1078 31474 1332 241 ----
NM_016525chr93781 712 261 --1796 1606
NM_016530chr1552498 1505 719 53 45 --1314 21025 747
NM_016531chr453628 1588 1118 1077 754 2339 328 ----
NM_016544chr293771 3557 3517 2852 2844 1159 1151 602 87 --43800 1168 718 51 11133
NM_016545chr13881 337 69 --1627 1302
NM_016557chr31944 --151 --
NM_016559chr321447 276 21398 1292 --11466
NM_016569chr1241536 1234 1107 103 11359 ----
NM_016574chr116932 917 893 760 311 34 --2938 322 --
NM_016577chr3114032 3285 2734 1595 1354 703 596 401 70 55 24 13990 54380 4368 972 709 437 --
NM_016587chr72261 218 2781 696 ----
NM_016592chr2041322 1242 442 24 --31213 1207 335 --
NM_016596chr1251023 781 692 437 255 1293 ----
NM_016604chr561070 973 833 339 298 286 2914 502 ----
NM_016605chr572171 1919 1898 1862 932 233 141 22765 2061 11877 --
NM_016607chrX31482 660 484 156 ----
NM_016621chr11113837 3767 3603 3479 2879 1688 1641 1533 1293 718 456 13979 64292 3153 3138 3128 723 656 14324
NM_016623chr82126 116 --1132 --
NM_016626chr18182 11170 ----
NM_016641chr1621490 1382 --11548 --
NM_016656chrX1111 ------
NM_016819chr31366 2360 126 2519 349 --
NM_016824chr1021364 629 1566 --1299
NM_016834chr1783572 3000 2878 1531 1415 1250 1125 209 23794 285 63687 3221 1508 908 867 316 13549
NM_016835chr1783572 3000 2878 1531 1415 1250 1125 209 23794 285 63687 3221 1508 908 867 316 13549
NM_016841chr1783572 3000 2878 1531 1415 1250 1125 209 23794 285 63687 3221 1508 908 867 316 13549
NM_016929chr6104320 3356 3273 1844 1615 1363 1064 979 954 337 34547 3344 1074 23993 1455 --
NM_016936chr1662067 1798 1762 1490 573 139 11499 11803 --
NM_016940chr211446 157 ----
NM_016946chr192934 2789 2578 1385 1312 1268 527 401 194 1241 2949 290 --
NM_016950chr4--11379 --182
NM_016952chr1174040 2999 2903 2808 2729 740 543 14021 23576 209 1199
NM_016953chr2105938 5867 5375 4430 4161 1636 860 714 590 422 36025 1655 232 --13795
NM_017409chr124784 588 86 27 1313 138 --
NM_017410chr1231063 924 465 1504 11109 1422
NM_017412chr81430 --11402 --
NM_017413chrX92043 1821 1010 682 646 352 229 141 72 --52165 2048 1814 969 157 2358 287
NM_017415chr583135 1809 1730 1329 703 676 667 189 34564 4525 953 21285 1227 --
NM_017420chr1422787 2469 23016 80 12461 --
NM_017425chr11177 ------
NM_017437chr1442340 2318 2097 612 22186 552 12374 --
NM_017447chr211584 23146 217 23982 3833 --
NM_017450chr1741444 1069 986 72 --2499 51 --
NM_017452chr2051300 480 372 338 282 ------
NM_017453chr2051300 480 372 338 282 ------
NM_017454chr2051300 480 372 338 282 ------
NM_017456chr1711857 --3519 231 54 --
NM_017482chr221614 621 --121 --
NM_017488chr231557 1293 298 --31305 392 387 --
NM_017491chr42858 765 --1775 --
NM_017519chr621285 1276 ----1312
NM_017550chr1941009 860 843 76 1826 --189
NM_017551chr1032559 1835 964 32202 1998 834 ----
NM_017553chr1531286 1155 23 ------
NM_017554chr331548 463 86 32094 1389 34 2427 154 --
NM_017580chr1042358 1961 907 545 --22041 1496 --
NM_017582chr12640 95 --21504 22 --
NM_017590chr2262437 2260 2106 1782 1637 390 --52681 1645 540 231 149 --
NM_017596chr1124203 4084 3436 1791 1563 1141 840 743 726 122 54 47 --84242 1491 1298 1285 985 127 64 40 --
NM_017602chrX1124 --2140 84 --
NM_017610chr1541990 1866 747 47 ------
NM_017617chr9130 --1458 136
NM_017628chr473613 3267 3244 2099 1385 497 153 24819 452 --35144 4320 2115
NM_017629chr141763 1296 1259 759 11521 ----
NM_017633chr663172 3046 1430 281 217 203 ------
NM_017635chr112476 286 170 ----
NM_017637chr9129210 8706 8462 8186 7716 7507 7108 7096 6298 6193 6087 3016 77402 6850 3543 2449 2158 1655 1575 46606 6288 5747 211 26182 372
NM_017640chr64594 95 82 25 --2576 233 --
NM_017643chr1752753 1896 1184 1160 849 ------
NM_017644chr374836 4018 3507 1102 1047 174 135 --14584 14891
NM_017645chr972968 2323 2213 2101 2085 2012 188 23015 1949 ----
NM_017649chr1031001 467 143 --1497 --
NM_017650chr7105897 4746 4090 3866 1408 1135 929 857 261 56 25073 1013 24465 863 --
NM_017657chr2------154
NM_017658chr1433947 564 261 13060 1362 --
NM_017664chr132667 40 ------
NM_017666chrX72051 1764 1407 813 686 606 525 1221 ----
NM_017668chr16----3700 99 48 --
NM_017672chr15166 1444 --1867
NM_017679chr17196 --3559 548 465 2170 115
NM_017700chr43499 179 133 --1419 --
NM_017709chr1154207 3530 3369 2878 2819 1627 1586 1579 1314 1092 966 907 552 455 254 22970 869 --11098
NM_017712chr19175731 5716 5710 5396 5218 4882 2332 2114 1517 1344 671 625 562 349 216 206 155 11745 56207 6138 5402 1705 149 24203 1566
NM_017714chr201938 --1259 --
NM_017715chr74706 690 274 245 --2482 185 1663
NM_017719chr342500 821 125 33 --1694 1192
NM_017737chr11502 11564 1348 1617
NM_017739chr13524 205 157 --163 --
NM_017740chr1611345 1369 --11181
NM_017742chr181404 11372 21866 440 --
NM_017754chr6114737 3272 3233 1312 1149 1138 642 436 351 297 152 14393 33968 1028 719 64668 4475 1465 1165 921 865
NM_017758chr172497 212 21475 491 4958 952 545 431 1964
NM_017762chr1562389 1800 1783 1724 790 50 --1967 --
NM_017772chr681793 1611 1605 1593 1341 1118 461 442 --21212 436 --
NM_017776chrX21145 618 ------
NM_017784chr321152 24 1905 ----
NM_017787chr1032677 2317 151 21999 244 42455 647 191 134 1821
NM_017789chr21698 --1217 --
NM_017791chr1461690 1187 1161 598 321 144 --1312 --
NM_017798chr2011238 --11188 --
NM_017799chr14------11830
NM_017801chr342204 1029 950 897 ------
NM_017810chr163762 616 271 2558 33 ----
NM_017811chr972499 2145 1166 968 798 747 564 --43080 2778 2715 2707 13162
NM_017813chr8125724 5412 5255 5068 4728 4654 3626 2046 2028 1122 735 149 22138 1433 --15350
NM_017816chr4146 ------
NM_017848chrX104476 4162 3861 3804 3671 1812 1767 1268 1244 146 33759 1132 107 24177 153 14455
NM_017849chr293099 2871 2652 2224 2086 979 468 320 285 --82045 2030 948 936 538 215 80 24 2130 119
NM_017893chr1021241 355 11483 31028 538 115 --
NM_017902chr10174473 4413 4401 4154 4000 3980 3829 2002 1979 1827 1573 1207 823 808 634 369 226 45644 4193 2228 1004 14551 25451 4062
NM_017906chr62103 77 ------
NM_017910chr22323 273 ------
NM_017915chr121394 --1300 --
NM_017919chr984929 4183 3923 3901 1822 854 582 262 11090 35022 4846 616 11145
NM_017921chr17101838 1773 1679 798 483 362 169 157 79 48 --31712 1692 730 --
NM_017922chr141111 ------
NM_017934chr6180 ------
NM_017938chrX1553 21344 447 1412 --
NM_017944chr1132995 627 23 1886 13023 --
NM_017954chr741570 1556 1489 1354 21599 1198 ----
NM_017955chr141858 ----11167
NM_017987chr1032123 712 545 --1485 2794 172
NM_017988chr123732 247 205 --1801 --
NM_017994chr772874 2857 2831 2729 2534 1972 992 1524 ----
NM_017998chr941375 894 884 335 ------
NM_018003chr1512105 ----12418
NM_018008chr32158 22 --2260 27 --
NM_018010chr331622 1567 432 21096 1045 11123 --
NM_018013chr6143026 3018 2735 2610 2176 2111 2033 1877 1087 805 784 337 230 133 --22703 253 --
NM_018026chr1191349 1267 1073 530 350 329 305 218 209 21317 512 71092 1022 1006 225 165 100 25 --
NM_018027chr1072290 2244 1055 867 244 228 35 --32044 1281 366 12252
NM_018028chr1921234 275 2990 537 41026 912 523 73 2893 282
NM_018037chr11262 --2480 267 --
NM_018043chr1151351 1270 1047 521 76 --1173 --
NM_018045chr142715 2374 2336 30 2451 76 22631 2455 --
NM_018048chr1232058 1810 808 21693 775 ----
NM_018061chr141374 1186 129 61 1571 ----
NM_018062chr21417 --1406 --
NM_018067chr11227 --1424 --
NM_018070chr1------1161
NM_018071chr142338 117 --5765 602 195 108 36 1274
NM_018079chr24582 499 191 138 ------
NM_018084chr233277 990 680 22286 690 12329 --
NM_018085chr1167866 7413 7121 6877 6732 6533 5933 5373 1493 959 693 552 530 248 214 88 26431 5998 35584 820 627 --
NM_018086chr251813 1746 1629 1364 82 1513 ----
NM_018103chr1143 ------
NM_018110chr164938 930 530 522 1487 --1300
NM_018111chr19183 ------
NM_018115chr42770 524 1762 ----
NM_018121chr1043126 2004 1221 448 --12212 --
NM_018133chr351992 1948 1731 576 450 ------
NM_018150chr1--1103 2904 612 1813
NM_018156chr143018 2990 2673 2314 --11813 22766 2712
NM_018157chr1233168 2497 621 33274 2505 684 23039 349 --
NM_018159chrX2409 127 --1150 11383
NM_018178chr172037 801 558 256 190 28 21 1330 --1154
NM_018181chr1821590 136 21389 691 1514 1638
NM_018182chr1761927 1826 698 536 319 312 42207 2175 544 452 41772 1686 797 421 --
NM_018184chr352000 1852 762 92 62 11555 ----
NM_018198chr141497 1403 967 476 2594 242 21269 981 --
NM_018200chr1571939 1819 1789 1035 716 454 198 12339 21944 563 22182 723
NM_018206chr16268 29 2522 112 1483 --
NM_018208chr151130 956 878 437 263 1134 ----
NM_018211chr111835 1116 22153 408 11842
NM_018214chr63369 117 66 11301 137 --
NM_018225chr984675 4132 3655 3606 3408 1541 1523 955 24817 1872 45357 5352 5346 933 11847
NM_018227chr443083 2708 1245 1231 12514 ----
NM_018234chr261935 1614 856 847 754 686 11783 3802 532 420 22082 435
NM_018240chr15861 697 322 97 63 --3703 210 115 --
NM_018243chr453367 1565 1365 1098 355 53303 3266 1454 1185 466 1962 1116
NM_018244chr2061148 1051 896 843 477 152 1312 ----
NM_018247chr632002 742 670 ----1154
NM_018250chr8----124 --
NM_018287chr103912 361 334 ------
NM_018293chr332857 2192 86 12341 ----
NM_018299chr873420 3151 2782 2628 895 327 124 1724 ----
NM_018312chr111452 --11627 21910 1868
NM_018313chr332469 1989 1887 ----12039
NM_018315chr411425 11358 158 1314
NM_018319chr1431248 240 120 11392 186 --
NM_018320chr112862 343 --2950 414 --
NM_018325chr921652 79 ----11387
NM_018327chr2041888 644 435 84 11639 --194
NM_018351chr12104434 4323 4177 4153 4113 3791 3681 3468 2868 834 23588 3372 14523 24076 3981
NM_018362chr1143274 2504 860 121 1390 ----
NM_018364chr132629 821 784 --43241 3070 2820 330 --
NM_018371chr841027 642 387 39 1551 ----
NM_018375chr1441834 1262 1177 754 ----181
NM_018381chr192776 325 ----2714 680
NM_018387chr91129 ------
NM_018388chrX21274 32 --11253 --
NM_018400chr11173927 3681 3661 3231 3145 3121 3025 2997 2930 2908 1641 1598 1453 967 648 485 312 73631 3444 3383 2990 855 559 395 54389 4261 3995 823 111 13935
NM_018403chr343712 1572 1552 911 1531 21057 400 --
NM_018409chr442931 2397 2184 947 12341 23093 724 --
NM_018416chr12112290 2031 1998 1987 1947 1663 951 567 198 191 176 32011 1867 965 21034 86 --
NM_018419chr20----137 --
NM_018423chr1241201 337 125 57 ----182
NM_018424chr941842 598 496 428 31791 451 403 ----
NM_018433chr21218 ------
NM_018439chr1852577 2176 1853 1050 947 21897 1777 ----
NM_018440chr8148456 8204 7154 6894 5657 5535 5470 2452 1830 1561 768 442 405 145 48222 7685 5964 964 27132 398 15608
NM_018452chr6_random41479 1071 243 91 1196 --13728
NM_018462chr33349 90 84 1604 ----
NM_018471chr24572 393 160 71 ------
NM_018482chr822338 2065 ----11734
NM_018489chr131499 502 373 ----1220
NM_018509chr173687 387 178 --31517 1451 672 --
NM_018534chr2178 --2545 118 --
NM_018553chr1751843 1564 1252 1212 367 1412 21698 593 1228
NM_018566chr153443 3279 2053 1287 791 --21952 994 14333
NM_018571chr22602 44 --1474 --
NM_018584chr121164 1146 11226 31157 1152 835 --
NM_018593chr63684 511 61 ------
NM_018638chr1235367 3463 2253 44068 2213 1003 23 ----
NM_018640chr1222662 2234 11889 12558 --
NM_018644chr1152084 1395 1370 723 539 11671 1736 --
NM_018650chr1----1358 --
NM_018660chr8102448 2064 1919 787 619 551 530 359 210 158 43011 1903 1029 294 32238 2009 869 --
NM_018683chr2071674 1631 1521 417 328 261 170 --2204 176 1304
NM_018684chrX71286 1231 1108 1058 955 400 231 1459 ----
NM_018695chr542001 1683 541 430 ------
NM_018710chr811002 --1882 --
NM_018713chr13976 198 191 1438 ----
NM_018715chr172033 1754 1737 568 352 208 190 21457 866 2521 320 --
NM_018717chr41912 --32095 945 729 --
NM_018718chr721517 154 32119 1685 64 61963 1928 1801 441 134 38 --
NM_018840chr20--1346 1337 --
NM_018841chr173470 3123 3085 2453 1306 1042 32 33423 3360 1567 21518 1028 11084
NM_018847chr921563 1441 --152 --
NM_018890chr721101 1067 ------
NM_018898chr572375 2287 2058 285 261 136 74 ------
NM_018899chr572375 2287 2058 285 261 136 74 ------
NM_018900chr572375 2287 2058 285 261 136 74 ------
NM_018901chr572375 2287 2058 285 261 136 74 ------
NM_018902chr572375 2287 2058 285 261 136 74 ------
NM_018903chr572375 2287 2058 285 261 136 74 ------
NM_018904chr572375 2287 2058 285 261 136 74 ------
NM_018905chr572375 2287 2058 285 261 136 74 ------
NM_018906chr572375 2287 2058 285 261 136 74 ------
NM_018907chr572375 2287 2058 285 261 136 74 ------
NM_018908chr572375 2287 2058 285 261 136 74 ------
NM_018909chr572375 2287 2058 285 261 136 74 ------
NM_018910chr572375 2287 2058 285 261 136 74 ------
NM_018911chr572375 2287 2058 285 261 136 74 ------
NM_018912chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018913chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018914chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018915chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018916chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018917chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018918chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018919chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018920chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018921chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018922chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018923chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018924chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018925chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018926chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018927chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018928chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018929chr541719 1681 646 384 11365 71667 1395 718 503 390 176 58 --
NM_018944chr213550 525 229 --140 --
NM_018945chr663454 3386 3290 3119 1368 1039 22664 1177 1136 --
NM_018952chr172264 228 ------
NM_018953chr124824 579 73 60 --2606 267 --
NM_018957chr221304 ------
NM_018963chr212270 145 31208 530 397 ----
NM_018970chr7144 22996 640 12735 --
NM_018976chr123776 117 98 ------
NM_018977chrX----1435 1767
NM_018979chr1231744 639 251 1880 11983 --
NM_018992chr1671669 1278 1187 669 628 548 43 11329 ----
NM_018999chr1074739 4419 3175 1880 1848 706 242 44841 3098 1346 1337 13214 --
NM_019000chr531306 426 132 ------
NM_019001chr374319 4145 3752 3465 3080 1721 33 --14328 13835
NM_019004chr74487 381 213 141 21803 1727 ----
NM_019008chr22113805 3729 3293 2978 2963 2794 1405 1291 387 187 49 --22777 1189 22845 2666
NM_019022chr1852744 2471 2280 1164 395 ----11092
NM_019027chr431906 1795 875 1727 ----
NM_019035chr421962 1403 ------
NM_019042chr731128 986 49 ------
NM_019053chr101980 --11009 --
NM_019063chr262334 1711 1484 1470 904 765 ------
NM_019064chr172802 694 ----1612
NM_019072chr533312 1598 374 23093 838 ----
NM_019074chr152791 51 ------
NM_019083chr131476 1255 351 1455 ----
NM_019084chr1011667 1673 --12147
NM_019087chr53646 259 112 11465 1245 --
NM_019091chr22878 87 --125 --
NM_019096chr64904 857 761 420 1832 2985 909 1808
NM_019098chr841656 297 280 205 --11574 --
NM_019106chr22153201 3183 2992 2596 2247 2235 1380 1267 1246 1234 817 748 529 388 290 43372 1373 1317 428 3764 755 80 13031
NM_019107chr192370 31 ------
NM_019114chr932418 968 953 1894 42437 2429 2230 1857 --
NM_019116chr1663298 3159 2817 1364 631 202 12548 22598 541 21061 564
NM_019117chrX63132 2782 2314 1396 822 480 22878 2725 ----
NM_019555chr3--1222 1347 1371
NM_019557chr1--1165 --164
NM_019558chr21303 ------
NM_019590chr1021377 1196 1960 ----
NM_019592chr93328 121 74 2890 564 1243 --
NM_019593chr2043078 2836 2712 99 13115 12090 --
NM_019595chr2------1181
NM_019597chrX4777 715 168 147 ------
NM_019600chr15----1632 --
NM_019606chr73359 223 87 --1480 --
NM_019845chr21154 1714 --1314
NM_019849chr191193 ------
NM_019859chr1021447 342 2588 520 1177 --
NM_019885chr222491 692 --42179 934 338 206 1529
NM_019895chr33979 961 731 2805 66 ----
NM_019903chr1021364 629 1566 --1299
NM_020039chr1241720 1491 368 118 21841 1521 11273 31726 708 468
NM_020062chr20--2853 697 2880 38 --
NM_020063chr1------136
NM_020066chr13860 364 343 1901 ----
NM_020116chr431703 1193 84 ------
NM_020120chr22514 380 ------
NM_020122chr275299 5035 4202 1439 1420 1002 230 25788 4509 35269 2006 1587 24386 476
NM_020123chr105635 456 396 259 179 2540 193 ----
NM_020127chr151754 1554 1486 684 92 1727 11804 --
NM_020134chr241140 1127 876 205 2949 461 51062 1019 926 919 310 --
NM_020141chr132431 2252 206 --12162 --
NM_020144chr761592 669 363 178 162 125 12127 ----
NM_020148chr1863120 3009 2330 632 304 280 --22543 344 --
NM_020150chr1052161 1919 1858 830 36 21612 681 --2174 64
NM_020151chr261560 1419 1133 663 326 312 2599 387 31489 1299 1152 --
NM_020166chr3139 ------
NM_020168chr15----2911 473 11331
NM_020177chr592376 2370 2166 1312 1276 1269 528 399 385 2312 164 ----
NM_020178chr172841 86 --1100 --
NM_020179chr113460 419 130 ------
NM_020180chr18----31356 1186 975 --
NM_020182chr20113488 3170 3001 2779 2758 1406 1322 1249 1007 874 664 23454 853 41449 1429 1412 781 1965
NM_020184chr232050 1981 903 21747 1548 32030 1959 463 --
NM_020193chr111318 ------
NM_020198chr1731532 1021 999 11326 ----
NM_020199chr531219 946 362 ------
NM_020204chr11644 1826 137 --
NM_020205chr183483 3331 2486 1352 1099 1075 648 212 42590 2558 809 733 43427 1371 1359 523 --
NM_020211chr15--11250 21020 346 149
NM_020239chr152242 820 646 635 459 2748 120 1451 --
NM_020240chr522784 1883 12229 --22409 2183
NM_020245chr694873 4821 4696 2001 1382 1232 1089 1041 383 21803 1713 11390 11015
NM_020309chr196843 829 348 231 219 153 11032 1930 --
NM_020310chr1752476 2182 695 433 409 --52499 789 783 335 282 --
NM_020336chr2093552 3196 2830 2666 2648 2587 2547 1452 623 43514 1343 1016 600 12686 12933
NM_020337chr482894 2851 2263 1194 970 671 275 173 22572 657 1938 --
NM_020338chr1052907 2304 1020 413 322 13183 42646 2445 1395 1072 --
NM_020340chr62684 149 41629 626 281 80 ----
NM_020341chr201553 ------
NM_020348chr1072809 2396 1768 1091 525 390 162 --41697 1014 120 81 12247
NM_020354chr103844 170 59 --2316 154 --
NM_020360chr173582 259 88 --2587 514 --
NM_020374chr1251568 818 603 528 235 ------
NM_020379chr12315 146 ------
NM_020381chr631958 637 116 ----11398
NM_020382chr1241411 608 470 276 1360 51462 1259 545 383 36 --
NM_020384chrX71698 1473 1426 1233 705 479 284 1229 1489 11671
NM_020390chr374259 3202 1965 1222 1024 912 904 13356 14608 --
NM_020416chr482509 1936 930 912 834 659 311 173 --2879 423 --
NM_020420chrY--11183 --21399 479
NM_020426chr17175 --1106 --
NM_020429chr762942 2818 2380 2257 2235 605 ----11120
NM_020432chr71884 1342 11733 --
NM_020440chr173139 2944 1258 992 630 282 196 1237 12863 --
NM_020443chr1176918 6538 6160 5840 5445 5229 5142 4252 2770 2706 1861 1257 1111 884 856 456 179 56615 5661 4442 4230 919 36543 1121 281 11485
NM_020445chr71783 --1210 --
NM_020457chr163446 423 162 1515 1234 --
NM_020463chr231317 262 171 ------
NM_020465chr1631373 533 70 --21707 434 --
NM_020466chr625039 4133 44291 3748 1455 750 24155 3194 --
NM_020474chr184256 182 150 102 ------
NM_020475chr862451 1903 1852 1760 401 74 1368 12128 --
NM_020476chr862451 1903 1852 1760 401 74 1368 12128 --
NM_020477chr862451 1903 1852 1760 401 74 1368 12128 --
NM_020478chr862514 1966 1915 1823 464 137 1431 12191 --
NM_020480chr862451 1903 1852 1760 401 74 1368 12128 --
NM_020526chr121592 238 11272 11652 --
NM_020530chr224697 400 267 101 1223 2394 357 --
NM_020630chr10----2587 31 --
NM_020638chr1281387 1316 1294 566 309 260 126 55 ----3444 225 202
NM_020640chr31278 --21629 775 --
NM_020642chr111557 ------
NM_020647chr841604 869 809 192 ------
NM_020651chr241559 1252 1239 272 ------
NM_020665chrX------123
NM_020673chr20137280 7260 6456 6444 6390 6344 6069 5142 1682 1676 1370 1338 1294 23117 152 66537 5602 2402 1818 1102 110 --
NM_020679chr172429 96 1156 2190 120 2134 23
NM_020689chr2051748 1507 1211 549 208 --1513 11166
NM_020693chr111369 --1386 1192
NM_020697chr81208 ----1984
NM_020699chr1194854 4499 4111 4035 3438 3392 3363 3356 3273 1887 1872 1803 1539 1317 945 447 231 62 49 44983 4914 3346 1670 25141 411 11751
NM_020706chr21138 --1144 --
NM_020708chr2092440 896 776 758 720 588 479 366 358 ------
NM_020713chr2021958 701 194 42867 367 169 152 1345
NM_020732chr621285 1276 ----1312
NM_020734chr1243208 2964 938 561 12944 ----
NM_020742chrX62118 1800 1676 944 810 21 11865 ----
NM_020747chr51921 ------
NM_020748chr1711586 ------
NM_020750chr641340 1286 1164 99 --4487 297 52 25 --
NM_020752chr1062930 2834 2706 2509 2085 238 22341 1887 1214 11978
NM_020755chr6194 11613 --1108
NM_020760chr231334 1236 97 ------
NM_020766chrX84562 3406 3207 2834 1457 1081 1002 521 22994 1097 ----
NM_020769chrX3932 922 168 ------
NM_020771chr62357 161 --11054 --
NM_020772chr17148535 8451 8362 8201 7456 6907 5981 5773 5377 2855 2575 2285 648 480 57946 7037 5396 3454 2646 16724 --
NM_020774chr18105882 4593 3986 2292 1981 1891 1861 1447 1284 999 14755 15117 --
NM_020778chr1574289 1783 1757 1694 853 666 75 --44412 643 507 469 33987 1025 846
NM_020791chr171554 ------
NM_020792chr331906 1885 101 32684 2260 1710 3741 576 92 --
NM_020794chr121370 281 ------
NM_020795chr17131743 1259 1252 823 813 729 588 410 275 227 188 142 89 2791 316 31790 1318 422 1164
NM_020796chr552824 2760 2474 1998 225 12776 1235 12544
NM_020801chr532635 2323 987 ------
NM_020804chr692530 2078 1829 1809 1618 1064 949 769 382 --61962 1648 432 427 410 74 1488
NM_020805chr1821765 205 ------
NM_020806chr142649 86 ------
NM_020807chr1631529 1468 375 --21559 337 1251
NM_020808chr1----1806 --
NM_020809chr1111995 --21800 505 --
NM_020810chr1463405 3308 3205 2239 737 179 --33480 3099 3076 --
NM_020819chr62816 310 ------
NM_020820chr2021579 1142 --11419 181
NM_020825chr16163690 3575 2772 2601 2543 2501 2484 1482 1419 1377 1332 1220 1042 885 836 791 --21425 1185 1147
NM_020826chr1132254 1003 577 177 ----
NM_020830chr252714 1096 622 342 215 --3716 711 494 1248
NM_020839chr331535 1425 1128 --2298 43 11543
NM_020844chr8107208 6855 6484 6454 5242 4903 4825 3058 2437 48 77282 6359 6059 5657 5612 5036 4997 --16150
NM_020845chr1262286 2060 2027 842 791 275 ------
NM_020850chr1683113 2927 2450 2047 1066 887 315 145 --32766 913 132 12755
NM_020856chr1921317 1306 ----11403
NM_020858chr1532132 1513 369 1707 ----
NM_020859chr483433 3260 2893 2632 2566 918 358 171 23902 1622 22584 1401 1744
NM_020860chr42399 118 ------
NM_020861chr61366 31161 1106 84 5348 127 119 61 52 --
NM_020871chrX22037 766 --1993 --
NM_020872chr321301 618 21579 375 ----
NM_020888chr182006 1796 1730 1450 1314 660 591 202 --31736 1524 1495 --
NM_020897chr151291 1192 469 426 318 --11024 --
NM_020898chr122536 524 1121 2776 281 --
NM_020899chr1792376 1699 942 915 618 564 438 427 203 1172 22366 217 4723 586 537 266
NM_020918chr1073145 3091 2920 2603 813 438 168 12727 1145 --
NM_020919chr23482 299 67 ----21100 912
NM_020920chr14----1384 --
NM_020922chrX51786 692 439 321 101 --179 --
NM_020927chr1692272 2196 1765 1725 1550 956 741 708 224 2901 396 11899 --
NM_020935chr284584 4361 4326 3712 3471 3221 221 65 1926 14348 --
NM_020944chr92208 57 2248 198 2116 66 --
NM_020947chr1672391 2087 1961 1698 565 545 42 1225 177 --
NM_020948chr153365 2708 617 329 251 23257 1133 22977 2713 --
NM_020951chr1982345 2307 1739 564 526 501 387 206 12364 --12023
NM_020956chr1984628 3401 3001 1294 697 682 529 419 1305 41403 1136 103 83 24445 689
NM_020959chr19121 ------
NM_020962chr1592437 2333 881 832 803 733 646 456 121 --3759 713 638 11642
NM_020964chr1874664 3869 1558 1143 934 785 434 11182 11370 --
NM_020967chr2031249 398 286 ------
NM_020974chr112229 66 1534 --2546 181
NM_020977chr441510 1502 320 225 11814 ----
NM_020981chr22787 123 ------
NM_020983chr1241658 1640 394 243 12247 52222 1672 1541 933 351 1514
NM_020993chr12142748 2635 2543 2360 2018 1903 1100 891 863 383 319 309 163 85 --22365 821 --
NM_021003chr141755 ------
NM_021019chr12155 --182 1144
NM_021020chr8133229 3014 2843 2713 2698 2304 1032 952 850 479 386 366 155 --42853 2614 1069 161 33106 2530 232
NM_021032chr321720 151 11827 41589 46 40 24 --
NM_021033chr1332910 983 358 13350 ----
NM_021035chr2051290 1227 1138 970 534 ------
NM_021038chr313403 1120 ----
NM_021072chr51236 ------
NM_021076chr221528 ------
NM_021079chr1731102 663 484 42706 1261 1176 426 12889 23071 2805
NM_021083chrX63663 3595 3210 1431 1366 130 22984 948 22941 2899 --
NM_021090chr22134750 4528 4217 3456 3238 1940 1516 1494 1078 1071 796 771 168 31244 504 437 41597 1500 995 234 1919
NM_021096chr2242648 2257 1303 1226 --53217 2935 2875 2855 2653 --
NM_021097chr263042 2942 2573 1157 846 462 ----12058
NM_021101chr351736 1015 872 789 241 3984 960 200 ----
NM_021105chr32737 241 --1531 --
NM_021111chr92951 233 1267 ----
NM_021115chr22----1151 --
NM_021116chr7198860 7698 7306 7286 6108 5829 5535 3405 3343 3236 2414 2373 2069 1947 1521 1471 1004 887 297 2828 780 68524 7628 7549 1959 1526 268 15484
NM_021120chrX32954 1222 423 12381 155 22800 256
NM_021132chr1031233 319 144 --11257 --
NM_021136chr141306 --2286 94 --
NM_021144chr92434 116 --1124 --
NM_021149chr164441 392 237 158 --1166 --
NM_021155chr19152511 2320 2266 2251 2234 1978 1165 1110 765 675 506 437 253 145 37 11129 41921 1171 1052 93 22405 2106
NM_021156chr202976 107 --153 --
NM_021159chr451639 1559 563 488 41 --21437 1326 11144
NM_021160chr61156 ----1188
NM_021167chr731771 987 229 11047 ----
NM_021174chr83693 308 275 --2664 615 --
NM_021177chr63290 257 224 --121 --
NM_021183chrX32040 1757 490 12219 --12263
NM_021189chr161006 984 787 758 235 225 --31036 978 889 --
NM_021191chr1272542 2132 2084 1870 725 171 138 ------
NM_021192chr24383 129 105 51 --1388 --
NM_021198chr231464 1448 344 --21173 423 1437
NM_021201chr1131304 520 67 1180 ----
NM_021202chr2063073 2625 2187 583 443 267 42587 469 376 149 32864 840 130 --
NM_021205chr152793 2442 2006 995 650 --11133 --
NM_021215chr2072290 2191 2074 732 547 239 147 12308 32328 558 388 2748 463
NM_021224chr91358 ------
NM_021235chr19----148 --
NM_021245chr10132 ----1175
NM_021249chr14139 21432 207 --11364
NM_021253chr631345 1151 61 --1201 --
NM_021255chr1453927 2989 2926 2850 2669 12536 11027 --
NM_021260chr1441428 1118 564 536 --3490 442 135 1396
NM_021625chr12126 ------
NM_021627chr3--2951 285 1770 --
NM_021629chr375057 4337 4212 4170 3685 3573 795 125 11120 1893
NM_021633chr141331 1238 277 74 --11339 --
NM_021635chr651498 1438 1368 1301 28 ----1679
NM_021637chrX----1443 1174
NM_021639chr1----1177 --
NM_021647chr443972 3420 1583 433 3658 536 176 21759 1504 --
NM_021648chr641923 989 982 555 --42724 1729 339 187 --
NM_021705chr651510 1271 568 395 353 21313 1029 ----
NM_021724chr17159 --1194 --
NM_021728chr141982 ------
NM_021738chr101203 ------
NM_021809chr2042278 989 508 64 22350 206 12056 1276
NM_021813chr685408 5376 4111 1659 1536 1391 561 165 1687 35414 1752 1096 24334 1548
NM_021814chr6------11321
NM_021905chr682011 1799 1652 1517 1460 1414 644 472 21942 1442 42067 1873 1836 50 --
NM_021911chr563810 2130 2080 1631 370 38 22115 2105 ----
NM_021912chr1553396 3253 3027 955 559 ----12723
NM_021914chr143225 105 98 22002 48 ----
NM_021923chr411266 --21547 1048 --
NM_021935chr33652 235 117 ----1110
NM_021943chr672201 2014 1973 1864 1626 1514 1372 ------
NM_021945chr6123190 2805 2764 1300 1271 1089 1076 792 631 549 272 146 11149 23390 2643 --
NM_021946chrX51081 1041 589 414 31 --41302 1047 69 51 --
NM_021947chr171469 ----11336
NM_021949chrX52478 2344 1884 1025 252 1627 ----
NM_021950chr1142216 1964 1936 148 21494 327 12111 --
NM_021959chr66854 838 629 255 216 198 1182 2639 82 167
NM_021960chr142613 2347 487 90 12772 --1506
NM_021961chr11186992 6465 6373 6301 6280 6106 5362 2923 2770 2750 2612 2573 2290 2120 1596 1548 1477 277 24794 2557 36471 6048 1753 --
NM_021962chr1761890 841 490 421 364 349 --2846 476 --
NM_021964chr335361 1884 705 12527 15367 16625
NM_021966chr141735 ----1115
NM_021970chr41512 1623 ----
NM_021976chr681030 808 786 778 354 328 249 26 --31047 894 287 1681
NM_021977chr683290 2771 2726 2500 1545 787 279 257 12621 12863 --
NM_021980chr1021048 53 ------
NM_021988chr2031329 1234 1074 --3380 35 29 --
NM_021991chr174717 528 268 104 127 1690 1596
NM_022003chr1131016 815 166 --2863 109 1346
NM_022048chr15136002 5964 4842 4133 4060 2006 1733 1572 1008 526 326 274 233 52352 1690 1623 1176 692 66365 1442 588 532 492 335 46127 5055 4529 2216
NM_022049chr131179 494 371 --171 --
NM_022051chr11608 ------
NM_022058chr242105 1509 1428 377 21719 23 ----
NM_022060chr1431112 858 504 41222 1010 375 86 3877 422 341 --
NM_022062chr1131588 1336 167 --31889 1514 207 1122
NM_022067chr143931 607 37 --1665 --
NM_022068chr182657 636 ------
NM_022075chr13971 690 236 --2684 677 --
NM_022080chr2052765 2688 2641 2309 1717 21861 265 --1846
NM_022107chr63594 453 26 --2402 146 --
NM_022114chr194751 3868 3855 3393 3229 1460 1386 1201 970 --23506 975 23515 1327
NM_022116chr72915 178 ------
NM_022130chr53550 233 25 21435 346 1184 193
NM_022140chr542269 2144 659 248 12208 11550 --
NM_022143chr7----11354 11239
NM_022166chr16125534 5111 5045 2365 2103 1439 1413 1373 1114 716 594 433 35514 1707 1697 85603 5167 5059 4929 4741 2398 816 278 1650
NM_022169chr1171476 1419 1397 1362 538 299 216 --31077 524 242 11232
NM_022170chr771498 1480 596 428 417 298 262 1279 --1239
NM_022340chr363390 2483 1336 1280 555 434 11117 33074 2571 2346 --
NM_022351chr843287 3274 3247 1208 ------
NM_022373chr72814 134 ------
NM_022442chr2031329 1234 1074 --3380 35 29 --
NM_022454chr8154 1219 1292 --
NM_022455chr5----2252 78 1116
NM_022456chr12136676 6538 6500 6079 6058 5603 5589 5096 1955 1058 420 371 110 14678 15070 --
NM_022459chr1366317 4401 4254 4103 1834 612 35960 1907 87 22475 530 --
NM_022462chr19173293 3145 3074 3007 2953 2858 2548 2378 1511 1480 1401 1003 989 842 718 644 245 33193 3064 1195 71382 877 862 856 850 523 29 13398
NM_022465chr12142942 2913 2711 2143 1950 1883 1023 986 979 708 687 654 343 228 31903 622 78 22824 160 12258
NM_022469chr153065 632 365 130 110 --1400 1700
NM_022473chr1594254 3972 3097 1236 1200 1060 951 827 233 34169 462 278 31717 1101 80 13556
NM_022475chr42669 253 ------
NM_022476chr162959 33 11101 ----
NM_022484chr721249 1139 ------
NM_022491chr12113037 2992 2663 2632 2471 2291 1384 1105 537 269 71 --31118 793 450 --
NM_022497chr363822 2499 1451 1413 841 226 22973 854 1377 12911
NM_022552chr211039 --4991 271 261 256 --
NM_022553chr62109 99 1214 1227 --
NM_022572chr251634 1374 1346 525 75 11430 31507 407 349 1303
NM_022574chr772211 2096 2060 2032 1832 1444 289 --62186 2151 2017 1843 1740 1485 --
NM_022644chr172189 109 ------
NM_022652chr121998 21104 774 ----
NM_022658chr122376 301 --1178 --
NM_022716chr162318 2306 2080 536 454 195 22943 1026 ----
NM_022726chr631748 1083 268 21588 231 ----
NM_022730chr24962 737 199 72 --1261 1189
NM_022731chr1------1262
NM_022733chr151183 1086 978 159 54 11044 3990 985 314 --
NM_022745chr162912 2834 2800 2055 1945 431 1999 12465 --
NM_022749chr851213 1114 951 546 204 --11414 --
NM_022750chr72582 63 --2656 498 --
NM_022751chr181101 ------
NM_022753chr122782 2283 22116 1062 --11982
NM_022754chr531296 228 91 11859 1621 --
NM_022755chr952643 890 826 512 173 --32327 874 444 2729 284
NM_022756chr131341 519 276 --148 --
NM_022758chr6113132 3086 2856 2338 2206 2168 1025 901 615 397 75 12215 52278 2178 1048 718 405 12448
NM_022771chr122860 198 1217 ----
NM_022776chr331556 94 39 11303 ----
NM_022778chr11539 11422 1920 2524 321
NM_022781chr992665 2304 1260 1242 1125 739 713 607 260 139 1680 --
NM_022810chrX2285 59 ------
NM_022822chr112790 565 --1141 1231
NM_022825chrX2285 278 ------
NM_022833chr93343 297 44 --21377 493 --
NM_022836chr141603 1471 453 148 21400 432 1445 --
NM_022840chr1841466 1060 462 54 2957 43 ----
NM_022841chr1541847 1757 962 437 12668 ----
NM_022893chr212652 ----165
NM_022894chr221754 208 1534 ----
NM_022898chr14134020 3855 3618 3607 3541 3506 3164 2968 1619 1445 1286 1050 530 11124 23530 3426 --
NM_022910chr1631373 533 70 --21707 434 --
NM_022912chr272939 2831 2765 2285 976 229 105 --1678 --
NM_022918chr111810 --1197 --
NM_022965chr421579 512 ----1506
NM_022970chr1031034 942 307 ----1185
NM_022977chrX52082 1690 1654 380 218 11819 ----
NM_023009chr16627 226 188 168 140 93 --1279 --
NM_023019chr22232 112 ------
NM_023034chr82543 219 --1549 --
NM_023037chr133327 108 76 --1413 --
NM_023071chr1241040 385 347 159 ----1207
NM_023076chr163854 179 122 1234 ----
NM_023079chr1781641 1628 1285 1162 655 511 500 485 2672 528 41268 516 56 25 --
NM_023105chr882264 1843 1798 1732 351 340 135 98 12445 ----
NM_023106chr882264 1843 1798 1732 351 340 135 98 12445 ----
NM_023110chr882264 1843 1798 1732 351 340 135 98 12445 ----
NM_023111chr882264 1843 1798 1732 351 340 135 98 12445 ----
NM_023112chr1492985 2805 2739 2288 2136 2086 1990 1920 592 12726 31066 941 933 12962
NM_023923chr193772 3626 2890 2697 1134 619 250 86 47 22786 627 1320 153
NM_023929chr831950 675 668 22588 2120 1660 --
NM_023930chr115810 734 246 212 158 --2843 829 1740
NM_023932chr6------132
NM_024007chr553183 2850 2515 2061 713 11046 --12820
NM_024015chr1721113 404 --1804 --
NM_024016chr174784 594 584 524 --1214 --
NM_024017chr1781468 1448 1230 1211 1059 353 187 160 --11507 140
NM_024019chr44995 146 92 44 --178 --
NM_024029chr191114 --1260 --
NM_024034chr204982 879 710 57 --1410 --
NM_024038chr192219 125 --2255 86 --
NM_024046chr33874 352 67 --31236 333 327 --
NM_024050chr191632 --1437 1502
NM_024052chr1762445 2434 2179 1929 649 271 --2314 209 --
NM_024085chr22739 97 ----1420
NM_024094chr82233 121 ------
NM_024104chr192108 56 2282 167 133 --
NM_024107chr175332 307 231 162 37 --1537 --
NM_024293chr24750 262 67 43 ------
NM_024294chr6113132 3086 2856 2338 2206 2168 1025 901 615 397 75 12215 52278 2178 1048 718 405 12448
NM_024295chr871871 1526 521 349 277 264 44 1401 32043 1465 270 --
NM_024306chr1631009 237 50 --1863 --
NM_024328chr142567 153 --3682 177 132 --
NM_024345chr9115844 5575 5166 4747 4466 4281 1849 1532 1214 299 222 24355 4245 35001 1000 324 1305
NM_024408chr183394 3047 1498 1208 1144 1027 698 593 --22738 580 --
NM_024416chr951523 1113 581 502 365 21321 436 ----
NM_024423chr1864155 3079 1560 1451 1147 917 23814 1626 12850 --
NM_024424chr11----1323 --
NM_024425chr11----1323 --
NM_024426chr11----1323 --
NM_024430chr1851807 1404 1223 621 449 41797 1716 1604 1293 --1237
NM_024511chr483065 3035 2997 2197 813 752 741 421 11190 ----
NM_024512chr321135 757 --11066 --
NM_024519chr161321 --135 --
NM_024524chr332494 2218 146 33043 2712 542 --12653
NM_024529chr111175 1239 ----
NM_024541chr1061848 1451 1263 661 643 437 ----11490
NM_024551chr1232446 1716 951 12560 22454 362 --
NM_024551chr1232446 1716 951 12560 22454 362 --
NM_024567chr82654 61 --1228 --
NM_024569chr172711 2690 2643 2591 2422 1113 951 --12542 12442
NM_024572chr2----145 --
NM_024581chr6181 ------
NM_024582chr41207 ----1341
NM_024586chr13488 180 70 --2254 174 --
NM_024590chr4--21328 1272 11242 --
NM_024594chr551637 1627 1417 1409 1349 --41483 545 246 183 --
NM_024602chr13871 359 224 1689 3800 628 77 1697
NM_024615chr5----140 --
NM_024616chr321353 961 --11447 --
NM_024626chr131582 1551 588 --11310 11137
NM_024631chr11256 44 ------
NM_024638chr332387 1585 912 1175 --1900
NM_024639chr622799 333 --11969 --
NM_024641chr632957 2248 813 22104 2044 1550 12641
NM_024645chr831374 526 237 2534 350 ----
NM_024646chr164000 2527 1174 887 437 208 1757 ----
NM_024657chrX3670 662 23 ------
NM_024659chr2155 2887 821 ----
NM_024665chr384666 4296 3837 3372 1312 1062 396 353 --13845 --
NM_024674chr143161 3059 2339 2193 1651 53221 3215 3210 3205 146 13167
NM_024689chrX31827 1388 243 11632 2712 65 1354
NM_024698chr1121242 1059 1241 --1464
NM_024700chr12968 132 2995 741 ----
NM_024704chr205716 407 330 263 41 1252 ----
NM_024719chr13285 51 ------
NM_024721chr82744 88 2487 138 ----
NM_024740chr1154111 3032 2938 2806 284 42885 1599 1306 379 --1438
NM_024744chr231758 878 171 --1602 12397
NM_024749chr132141 678 43 32177 2036 534 1522 --
NM_024761chr9175036 4725 4549 4357 4284 3990 3586 3459 2124 1710 1290 1190 1175 811 485 408 42 41752 820 622 151 24272 3875 14434
NM_024769chr115819 790 721 58 30 ------
NM_024770chr275064 4917 4869 4258 561 507 399 26672 4345 ----
NM_024785chr251336 1320 504 315 200 --199 --
NM_024798chr1572548 2402 2014 1911 714 566 548 ------
NM_024811chr1171807 1618 1583 675 529 370 331 --2598 98 --
NM_024816chr16----146 --
NM_024828chr931375 1316 1141 ------
NM_024830chr541962 1397 297 260 11558 --11533
NM_024834chr1041818 1655 1640 1467 2555 527 ----
NM_024835chr17158 ------
NM_024850chr52318 86 ----1287
NM_024875chr1071714 1213 321 301 284 240 183 --3155 145 61 2474 272
NM_024881chr1982694 1516 1046 766 720 472 301 242 33804 3267 319 43330 745 728 41 --
NM_024887chr181802 1419 1319 688 355 110 89 62 11347 11442 --
NM_024889chr10141227 1212 1161 1101 730 701 686 671 657 643 616 601 586 96 11637 11176 71199 1184 1148 1133 1117 717 632
NM_024896chr991958 1879 1868 1667 825 693 664 446 59 ----1831
NM_024909chr651580 1414 1223 1102 444 1478 71571 1473 1438 1404 1393 524 490 --
NM_024921chrX21494 1464 ----1712
NM_024927chr17----126 --
NM_024930chr552799 2721 2226 1774 44 ----1624
NM_024947chr3168966 8954 8156 7908 6674 6606 6291 3096 2838 2802 2343 2083 1320 1296 631 360 17993 16881 --
NM_024949chr424125 456 11468 24318 374 --
NM_024953chr1262765 2719 2036 1956 278 57 12532 --1107
NM_024989chr287899 7617 7307 7295 7280 6147 1535 770 37542 6197 6180 26533 6528 11552
NM_024991chr1042454 2006 1290 1100 1778 1264 --
NM_024997chr1631129 908 322 ------
NM_025027chr191963 11162 1109 --
NM_025054chr832739 1628 1192 ------
NM_025074chr462512 2232 1054 885 411 390 13091 ----
NM_025080chr1161065 984 967 895 858 739 ------
NM_025082chr16----123 --
NM_025083chr1531913 1828 628 --61820 1499 1434 532 442 422 21885 184
NM_025090chr1741210 1125 959 567 11312 11252 21390 1008
NM_025099chr173988 136 33 ------
NM_025115chr82126 40 ------
NM_025133chr22998 757 ------
NM_025134chr1621965 1923 21683 557 21929 1812 --
NM_025146chr361888 825 581 131 103 67 ------
NM_025151chr862155 2001 1824 1725 1586 539 1868 ----
NM_025160chr172838 1564 1456 878 480 305 233 33128 759 471 11291 13301
NM_025164chr1132141 1483 358 2241 130 11403 11714
NM_025179chr1124418 4218 4189 3732 3649 3547 3315 1478 1429 1417 479 471 34385 3976 922 24692 1874 34211 1758 1321
NM_025184chrX2827 39 ------
NM_025187chr1621320 1225 --1526 --
NM_025195chr861852 1201 607 468 216 145 --2666 647 --
NM_025208chr1152432 2160 1772 1716 890 --22184 1904 --
NM_025222chr342933 2824 1905 129 --2979 929 21988 1935
NM_025227chr201309 --3235 215 203 --
NM_025236chr63672 255 228 2566 71 2631 264 1748
NM_025248chr17103266 3208 2745 467 388 370 319 266 67 56 22961 1101 43187 586 379 336 --
NM_025251chr841046 452 433 404 --2851 398 --
NM_025263chr65746 677 525 393 244 2438 343 2272 141 1740
NM_030576chr1762535 1770 879 231 169 162 1319 1174 --
NM_030594chr1531107 472 100 2276 261 11017 --
NM_030621chr1463340 2866 2826 1678 1394 515 21603 237 --1411
NM_030623chr241420 1367 1208 590 --31079 620 34 11426
NM_030627chr541279 886 437 272 --13173 23215 72
NM_030629chr161404 --31858 1719 1433 --
NM_030631chr143781 311 22 ------
NM_030634chr161990 942 883 575 528 326 --2915 473 12089
NM_030637chr14------1229
NM_030645chr181416 1188 1053 468 341 322 95 65 --3302 189 122 2984 112
NM_030647chr7146187 5253 5076 4968 4753 4544 4456 4402 1990 1981 1638 1435 846 755 26044 4701 54761 4558 4255 711 29 --
NM_030648chr455199 4517 4330 1710 917 --44803 4268 3903 1688 24312 3573
NM_030660chr144992 504 459 36 31361 1347 594 ----
NM_030661chr791623 1583 1368 500 242 152 144 102 93 --41632 1553 1296 125 1285
NM_030664chr104844 625 297 147 1500 ----
NM_030665chr1711196 --2980 360 --
NM_030667chr1211234 --21313 945 --
NM_030668chr1211234 --21313 945 --
NM_030669chr1211234 --21313 945 --
NM_030670chr1252266 1767 1743 277 142 --22345 1977 --
NM_030671chr1252266 1767 1743 277 142 --22345 1977 --
NM_030674chr12105196 4552 4033 3878 1711 1486 1297 1242 762 301 55603 4252 3613 1157 248 34687 1590 1247 11304
NM_030755chr1411160 2418 310 ----
NM_030758chr2271218 452 399 139 123 112 90 --11118 --
NM_030761chr142313 1696 953 808 ----11862
NM_030766chr122999 311 ----11020
NM_030767chr972731 2035 1909 1077 499 206 161 31903 1069 107 62658 2382 1926 1833 668 589 21877 1016
NM_030774chr1111237 11264 121 --
NM_030791chr1411416 11744 ----
NM_030796chr762156 2069 1947 717 154 113 --51731 857 582 493 45 --
NM_030797chr2------1224
NM_030799chr522168 1726 --11829 --
NM_030802chr172754 651 --198 1200
NM_030806chr1188428 8349 7879 7744 7099 6748 6523 6311 3457 3010 2091 2063 1459 1250 1062 480 380 257 38633 2548 1636 79172 8071 7435 7385 7188 784 434 28570 728
NM_030808chr173733 391 207 --11090 --
NM_030809chr1262462 2215 1671 948 551 46 1616 ----
NM_030816chr152924 2735 883 831 734 12746 --12284
NM_030881chr2292268 1778 1674 791 612 545 127 75 62 --42232 1980 638 287 --
NM_030884chr372242 2140 1827 1606 1514 63 43 --5539 293 226 183 75 --
NM_030885chr351796 1434 505 224 50 --31626 493 188 --
NM_030912chr105877 843 591 307 297 --4357 319 93 37 1110
NM_030914chr93856 781 256 --2929 109 --
NM_030915chr282406 1871 1804 1476 946 828 796 773 163 31931 1702 951 --
NM_030918chr1205016 5009 4972 4904 4795 4611 4375 4111 4088 4024 3982 3805 3433 3365 1702 1695 823 741 507 492 35240 4425 3612 74275 4101 2125 1724 842 837 98 13449
NM_030920chr121764 1471 22061 229 1793 --
NM_030923chr21477 --1226 --
NM_030927chr1031612 1453 1324 ------
NM_030937chr121390 949 --139 --
NM_030948chr6------185
NM_030952chr12851 398 --2908 76 1388
NM_030958chr81199 --1191 --
NM_030964chr5103562 3261 3064 3030 2552 2407 1155 1058 635 345 1178 51503 694 501 390 360 1508
NM_030981chr1151136 994 897 360 259 --1816 141
NM_031216chr1831507 788 79 11637 11680 187
NM_031268chr1675380 4670 3353 1414 1291 1259 1156 44396 4131 3258 1684 22118 1943 --
NM_031283chr25801 670 603 338 297 --1365 2807 649
NM_031289chr124944 917 650 54 ------
NM_031305chr451911 1649 1634 1205 423 --1623 --
NM_031309chr851874 1469 678 399 246 --22219 343 1390
NM_031314chr1462028 1905 1479 185 136 119 21293 631 --1369
NM_031369chr41584 1620 1256 --
NM_031370chr41584 1620 1256 --
NM_031372chr431664 1420 271 --2517 472 1430
NM_031407chrX2