TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4725-5p
miRNA Sequence: AGACCCUGCAGCCUUCCCACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001002838chrX1537 --11274 11589
NM_001008392chr332330 1379 120 --13265 21107 633
NM_001009899chr356413 2311 2164 1518 1318 12367 15029 14166
NM_001014797chr10118195 7278 7185 7178 6884 6191 5194 3161 2871 1034 880 23239 2144 --17623
NM_001024649chr5--1766 --21985 1053
NM_001040284chr1632194 1516 353 ----23839 262
NM_001106chr388069 6299 3333 2730 2223 2090 792 661 18505 22316 2195 --
NM_001746chr5--1766 --21985 1053
NM_003298chr354340 1869 1392 537 404 11836 23935 3909 --
NM_004726chrX53769 1715 1394 1379 1371 --14871 --
NM_005808chr332330 1379 120 --13265 21107 633
NM_006252chr155941 5755 2833 1290 931 --16673 --
NM_006544chr1426092 4223 15010 --13775
NM_013231chr1423063 410 --1269 13883
NM_014877chr1797685 7587 7238 7020 6093 5654 5630 5606 2278 25729 2271 ----
NM_015092chr1664121 3993 3240 3233 1455 423 13857 --1217
NM_015338chr2021615 680 ----31394 523 466
NM_020922chrX1537 --11274 11589
NM_021116chr778919 8713 3132 1857 1788 1433 121 26612 2763 46986 2281 1426 1192 1363
NM_025160chr123698 1484 1656 --14056
NM_033225chr812424 --2714 171 12166
NM_052906chr22114653 4079 3877 1609 1536 1316 831 435 356 347 63 1383 14570 1559
NM_152734chr655311 5206 2196 1884 904 35187 3494 847 13518 25283 4289