TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4726-3p
miRNA Sequence: ACCCAGGUUCCCUCUGGCCGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1282429 2393 2241 2218 1831 1717 537 225 --175 --
NM_000044chrX197 --1411 --
NM_000046chr552689 2166 2125 1146 100 31065 731 255 191 --
NM_000068chr192393 36 11545 ----
NM_000081chr11204 --11152 --
NM_000084chrX95722 5047 4911 4435 2049 1728 1377 1368 1277 24427 1155 15054 --
NM_000089chr71736 ------
NM_000092chr274526 3925 3896 3830 3054 3018 344 ----11097
NM_000104chr233000 2405 2267 1201 ----
NM_000115chr1322719 1051 ----12473
NM_000125chr6123458 2857 1634 1561 1365 1309 1204 1009 892 565 451 354 23540 1196 22796 2756 --
NM_000138chr1532408 1960 1007 1763 ----
NM_000168chr722323 2129 ------
NM_000176chr543409 3055 2788 168 ----11577
NM_000208chr1954556 4000 3742 1467 206 23371 1181 34423 4376 1607 --
NM_000210chr221812 426 ------
NM_000214chr2021685 1117 --11703 --
NM_000216chrX42855 1617 719 164 11629 ----
NM_000217chr1254678 4586 4207 646 118 24689 4638 ----
NM_000240chrX12167 ------
NM_000248chr322722 2456 ------
NM_000259chr1564946 4597 3910 1292 1131 910 24441 4099 13988 11249
NM_000262chr2251669 1585 1214 1148 712 --1537 21561 453
NM_000264chr9----1236 13026
NM_000268chr2283745 3610 3595 2724 1434 1245 1092 453 43103 2486 2286 348 12550 11508
NM_000271chr181194 ----1174
NM_000272chr221283 1102 ----21390 1358
NM_000304chr17--1928 ----
NM_000317chr111340 ------
NM_000321chr1321607 1434 ------
NM_000329chr1------1848
NM_000332chr655329 2247 2163 2069 502 --16744 --
NM_000362chr2273362 3168 2772 2333 1397 1335 120 --12235 1230
NM_000368chr984171 3761 3744 3282 1650 1399 661 171 ------
NM_000376chr1272691 2385 2243 935 687 103 26 ----12426
NM_000387chr31135 1627 ----
NM_000399chr10--1475 ----
NM_000411chr2142734 2312 794 49 22790 186 1444 12277
NM_000429chr1091810 1661 1573 1476 1354 404 73 43 22 --21650 1628 --
NM_000430chr1732449 1300 1186 12563 1234 12292
NM_000435chr19127 1238 ----
NM_000439chr552173 2077 717 647 552 ----2839 344
NM_000448chr1132271 1293 50 22613 2263 ----
NM_000449chr13494 192 156 11271 ----
NM_000461chr364291 3253 1755 1680 1610 539 ------
NM_000476chr991361 1272 956 555 511 494 424 348 233 --11251 --
NM_000480chr1121202 214 ----1223
NM_000486chr1262092 2033 1008 674 368 193 12789 ----
NM_000489chrX23295 3011 ------
NM_000493chr61723 ------
NM_000555chrX67688 7571 5071 2278 2090 181 15715 ----
NM_000557chr203410 111 26 1429 1159 --
NM_000572chr12865 699 2963 75 166 1785
NM_000598chr721530 575 ------
NM_000610chr1192768 2625 2207 1943 1051 740 432 375 254 2522 384 12426 --
NM_000615chr1162335 2115 1969 922 631 379 ------
NM_000617chr1252302 2020 1801 1795 1714 1728 ----
NM_000618chr1285383 5081 4814 4466 4182 1372 1244 982 ------
NM_000618chr1285383 5081 4814 4466 4182 1372 1244 982 ------
NM_000635chr1951023 415 220 63 46 157 ----
NM_000719chr1265429 4565 4176 518 146 90 14923 24145 1310 --
NM_000723chr1751590 1050 577 565 137 --11233 11455
NM_000726chr2178 --1439 --
NM_000738chr117968 882 806 410 136 123 106 1709 ----
NM_000800chr54400 244 238 57 1644 ----
NM_000813chr52828 73 15488 ----
NM_000814chr1543770 3467 2651 776 --13897 --
NM_000816chr52650 130 ------
NM_000826chr432017 1669 815 ------
NM_000827chr53985 904 25 --12461 --
NM_000831chr1216075 6027 5955 5900 5785 5773 4959 4727 4348 4168 3867 2051 2005 1584 1353 561 528 501 183 95 30 24702 1650 21702 956 14245
NM_000834chr12193 ----11113
NM_000864chr12881 90 ------
NM_000865chr6192 ------
NM_000872chr10--177 ----
NM_000875chr15126671 6515 6104 5629 5455 4925 4410 2181 1780 1527 914 888 26688 2256 16485 --
NM_000882chr31338 ------
NM_000883chr73698 505 494 1217 --1665
NM_000883chr73698 505 494 1217 --1665
NM_000891chr1763544 3020 1259 1206 1062 640 --12920 --
NM_000902chr342788 2346 2312 707 ------
NM_000903chr1611150 --145 --
NM_000950chrX43508 3045 2296 360 ------
NM_000963chr1------12410
NM_000964chr1781161 951 351 278 259 208 175 131 ------
NM_000983chr131638 1486 451 ----150
NM_001001323chr1212274 12319 ----
NM_001001344chrX42435 2347 1928 1735 ------
NM_001001389chr1192768 2625 2207 1943 1051 740 432 375 254 2522 384 12426 --
NM_001001390chr1192768 2625 2207 1943 1051 740 432 375 254 2522 384 12426 --
NM_001001391chr1192768 2625 2207 1943 1051 740 432 375 254 2522 384 12426 --
NM_001001392chr1192814 2671 2253 1989 1097 786 478 421 300 2568 430 12472 --
NM_001001395chr1232366 1787 262 ------
NM_001001419chr564208 3953 3878 1549 1383 908 ----11501
NM_001001420chr564208 3953 3878 1549 1383 908 ----11501
NM_001001433chr2052701 2449 2415 2325 421 22657 257 12491 --
NM_001001436chr161877 1185 ----
NM_001001520chr191123 ------
NM_001001549chr762687 2620 1854 1051 866 286 --2910 100 --
NM_001001550chr762687 2620 1854 1051 866 286 --2910 100 --
NM_001001555chr762687 2620 1854 1051 866 286 --2910 100 --
NM_001001557chr851787 1393 226 131 69 11452 ----
NM_001001665chr252652 2409 2246 2194 832 32362 1330 142 22816 392 22770 2738
NM_001001668chr19190 ----13619
NM_001001701chr442272 1987 1761 1465 --1626 --
NM_001001852chr224631 372 230 173 ----154
NM_001001890chr2153113 3066 1704 121 103 14178 ----
NM_001001938chr984048 3835 3421 2872 2687 571 529 31 23193 73 33527 2774 2707 --
NM_001002032chr172545 78 --1225 --
NM_001002033chr172645 178 --1325 --
NM_001002811chr171458 1353 983 605 566 373 48 1135 ----
NM_001002812chr171458 1353 983 605 566 373 48 1135 ----
NM_001002812chr171458 1353 983 605 566 373 48 1135 ----
NM_001002814chr893170 2926 2859 2817 2637 2512 1303 1265 760 13118 32779 2743 548 22986 1217
NM_001002860chr1422876 913 23229 1040 34215 1089 1007 --
NM_001002909chr173554 421 59 --11817 --
NM_001003406chr22153152 3092 3010 2736 2672 2501 2011 1211 1171 1163 986 948 742 356 154 22164 383 11323 198
NM_001003652chr1856891 5712 5418 3036 575 47371 5613 5512 836 ----
NM_001003681chr222689 320 1246 1300 --
NM_001003682chr121171 1156 1450 1549 1490
NM_001003698chr631640 577 442 ------
NM_001003699chr631640 577 442 ------
NM_001003796chr225862 781 667 325 125 --1697 --
NM_001003800chr983738 2527 2370 1496 1405 1276 785 487 12990 32847 1063 830 --
NM_001003940chr15143729 3722 3370 3156 2963 2945 2934 2873 2675 2619 2518 723 713 197 53745 3621 2783 779 341 ----
NM_001003942chr15143729 3722 3370 3156 2963 2945 2934 2873 2675 2619 2518 723 713 197 53745 3621 2783 779 341 ----
NM_001003943chr15143733 3726 3374 3160 2967 2949 2938 2877 2679 2623 2522 727 717 201 53749 3625 2787 783 345 ----
NM_001004065chr983887 3448 3380 3070 2808 2525 882 341 33108 2852 38 11365 13016
NM_001004304chr1263041 2687 2562 2435 2407 227 12185 32160 1007 786 12817
NM_001004317chr644442 4403 3431 1201 1691 13350 198
NM_001004329chr1221478 53 ------
NM_001004419chr1264222 3795 1806 1498 1000 851 ------
NM_001005266chr152759 214 ------
NM_001005267chr152759 214 ------
NM_001005268chr152759 214 ------
NM_001005269chr152759 214 ------
NM_001005271chr175867 819 403 237 104 1920 ----
NM_001005273chr175867 819 403 237 104 1920 ----
NM_001005367chr191309 1111 ----
NM_001005386chr252420 1867 892 704 145 11729 ----
NM_001005404chr1774150 3334 1208 736 647 637 88 --1687 --
NM_001005463chr1022448 1882 11851 ----
NM_001005474chr32560 21 1437 --1221
NM_001005502chr12125066 4425 3668 3454 1947 1812 1539 1370 1088 984 658 36 ----44945 3758 1491 1210
NM_001005505chr371667 1650 1459 1268 602 489 401 1154 ----
NM_001005609chrX153711 3559 3400 3382 3002 1490 1482 1471 1133 1104 993 780 420 377 40 1901 32939 921 724 21515 878
NM_001005746chr2178 --1439 --
NM_001005747chr2178 --1439 --
NM_001005920chr1641039 1006 802 390 --1204 --
NM_001006115chr3132572 2400 2360 2254 2058 1072 1022 966 619 450 435 374 150 52615 2563 2003 1903 1118 --12187
NM_001006623chr242296 1824 376 205 ------
NM_001006946chr271828 1364 690 433 388 251 193 ------
NM_001007099chr12249 163 ------
NM_001007100chr12249 163 ------
NM_001007102chr631411 444 265 ------
NM_001007156chr1521497 752 --11603 11628
NM_001007226chr1741145 515 350 233 --1166 --
NM_001007227chr1741145 515 350 233 --1166 --
NM_001007228chr1741145 515 350 233 --1166 --
NM_001007229chr1741145 515 350 233 --1166 --
NM_001007230chr1741145 515 350 233 --1166 --
NM_001007246chr2131663 1648 1631 ------
NM_001007565chr31327 ------
NM_001007794chr1--1595 ----
NM_001008220chr5133840 3715 3601 3207 2780 2707 2696 2667 2608 798 731 606 443 43161 2895 1048 1039 1526 --
NM_001008222chrX51226 454 346 326 240 ------
NM_001008239chr1853564 2803 1516 747 268 ------
NM_001008392chr363443 3126 3033 2781 2183 524 22767 81 ----
NM_001008410chr292268 2158 2137 1866 814 774 602 589 560 2781 133 1541 --
NM_001008701chr1992683 1232 1046 834 820 693 369 288 53 --2790 165 --
NM_001008703chr6121 ------
NM_001008704chr6121 ------
NM_001008726chr1441495 1139 687 306 ------
NM_001008738chr532763 2153 2141 ------
NM_001008925chr433344 3117 209 ------
NM_001009552chr8144 1469 ----
NM_001009554chr454625 3052 1254 1056 912 11768 ----
NM_001009554chr454625 3052 1254 1056 912 11768 ----
NM_001009555chr431415 1385 267 ------
NM_001009899chr364844 4795 2523 2133 2065 1486 13954 15594 --
NM_001009993chr2103709 3280 3236 3168 3156 2852 1560 1334 636 221 43095 1200 887 588 --14013
NM_001010846chr194057 3988 1540 660 651 555 410 229 24 ------
NM_001010853chr632591 1149 297 ------
NM_001010867chr1276446 6411 6319 6132 6119 5960 5931 5910 5376 5229 4760 4619 4224 2575 2334 2104 1935 1739 1199 1114 998 934 512 396 361 156 46 34303 880 298 --21780 128
NM_001010908chr101564 ----1537
NM_001010984chr122573 1702 1550 ----
NM_001011645chrX197 --1411 --
NM_001011663chr101161 1363 ----
NM_001011666chr742153 1487 1182 91 1213 16291 --
NM_001011718chr208888 826 362 308 249 237 183 138 --1673 --
NM_001011722chr13494 488 101 1455 1122 --
NM_001011722chr13494 488 101 1455 1122 --
NM_001012329chr1102255 2244 2176 2130 2109 1751 736 719 325 63 21560 523 11611 --
NM_001012393chr1133894 1151 85 41854 1821 1262 539 13596 --
NM_001012418chr642934 1643 948 109 --13108 1927
NM_001012642chr1592138 2026 2017 1865 1588 801 620 536 50 --11939 --
NM_001012751chr1031207 528 274 ------
NM_001012755chrX54738 4004 3501 1341 784 23353 352 ----
NM_001012761chr522480 1790 21800 130 12096 --
NM_001013398chr721530 575 ------
NM_001013399chr6134 ------
NM_001013415chr41130 --11040 --
NM_001013438chr31729 ------
NM_001013439chr31575 ------
NM_001013622chr491105 869 794 483 421 360 174 113 51 2988 943 ----
NM_001013635chr123807 402 99 ------
NM_001013690chr1242257 2199 1829 1550 12145 ----
NM_001014434chr12679 162 ------
NM_001014442chr13156 ------
NM_001014797chr1066178 2960 2691 2369 1081 670 27514 6869 --24968 896
NM_001015887chr331341 1269 147 1220 ----
NM_001017368chr1732773 55 45 2786 691 1295 --
NM_001017371chr21122 ------
NM_001017395chr372889 2861 2749 2687 1235 403 286 22400 243 --13382
NM_001017396chr231915 1497 787 ------
NM_001017415chr12549 278 1220 ----
NM_001017416chr12549 278 1220 ----
NM_001017440chr7105957 4991 2801 2528 2101 2079 1836 1649 987 674 37454 6375 3181 --17781
NM_001017535chr1272691 2385 2243 935 687 103 26 ----12426
NM_001017923chr1421454 80 ------
NM_001017924chr1061401 1283 1184 450 416 33 ------
NM_001017969chr91188 ------
NM_001018008chr153565 470 430 --123 --
NM_001018054chr1----11046 --
NM_001018057chr111412 1202 ----
NM_001018065chr945061 2252 701 538 ------
NM_001018066chr945061 2252 701 538 ------
NM_001018067chr155301 4932 4221 3775 1983 13490 ----
NM_001018068chr155301 4932 4221 3775 1983 13490 ----
NM_001018069chr155301 4932 4221 3775 1983 13490 ----
NM_001018074chr543409 3055 2788 168 ----11577
NM_001018075chr543409 3055 2788 168 ----11577
NM_001018076chr543409 3055 2788 168 ----11577
NM_001018077chr543409 3055 2788 168 ----11577
NM_001018108chr1572304 1907 1710 816 286 183 48 --32078 764 304 --
NM_001020818chr1941328 1161 487 373 21746 546 ----
NM_001020819chr1941328 1161 487 373 21746 546 ----
NM_001020820chr1941328 1161 487 373 21746 546 ----
NM_001020821chr1941328 1161 487 373 21746 546 ----
NM_001020825chr53884 530 263 ------
NM_001023567chr1531770 1723 757 11624 ----
NM_001024094chr543409 3055 2788 168 ----11577
NM_001024218chr141595 ------
NM_001024226chr131042 837 304 ------
NM_001024227chr131042 837 304 ------
NM_001024228chr131042 837 304 ------
NM_001024455chrX82534 2427 2411 1709 787 754 579 281 11072 --1202
NM_001024463chr156741 466 369 244 74 41 ------
NM_001024593chr104840 321 254 23 ------
NM_001024649chr5174 --1740 1760
NM_001024680chr251810 1760 1644 695 621 ----11730
NM_001024808chr1252703 741 600 224 90 ------
NM_001024809chr1781161 951 351 278 259 208 175 131 ------
NM_001024858chr14122928 2642 2534 2227 2062 1996 734 571 557 449 265 172 1608 22916 1914 --
NM_001024956chr1154056 1808 1798 1708 779 21910 1348 --1706
NM_001025076chr1045937 5094 4968 1458 35645 2306 235 ----
NM_001025077chr1077295 6452 6326 2816 1229 494 426 27003 1593 1193 --
NM_001025079chr331218 609 504 --1958 --
NM_001025105chr541154 464 159 122 ------
NM_001025108chr274161 3817 3432 3004 2950 2809 1197 ------
NM_001025233chr1231765 1017 427 ------
NM_001025252chr832853 2538 332 1182 ----
NM_001025253chr832853 2538 332 1182 ----
NM_001025366chr61586 1324 ----
NM_001025366chr61586 1324 ----
NM_001025367chr61586 1324 ----
NM_001025367chr61586 1324 ----
NM_001025368chr61586 1324 ----
NM_001025368chr61586 1324 ----
NM_001025369chr61602 1340 ----
NM_001025369chr61602 1340 ----
NM_001025370chr61586 1324 ----
NM_001025370chr61586 1324 ----
NM_001025389chr1121202 214 ----1223
NM_001025390chr1121202 214 ----1223
NM_001025579chr1741133 365 163 37 --11065 --
NM_001025603chr13494 192 156 11271 ----
NM_001025616chr431848 1677 92 ------
NM_001029989chr151969 1747 ----
NM_001030007chr1673508 2645 2477 1612 1080 483 297 153 ----
NM_001030055chr1443614 3448 3363 840 24617 510 ----
NM_001030059chr102353 35 ------
NM_001031679chr1252663 2392 2315 1378 1192 ----11058
NM_001031684chr251461 1087 443 392 121 ----11313
NM_001031690chr753077 2807 2013 1015 274 42874 2443 733 199 2259 212 1778
NM_001031692chr72332 212 ------
NM_001031695chr2284560 4373 4017 1979 1469 1034 418 52 --14784 --
NM_001031702chr31283 1813 2659 23 --
NM_001031711chr571552 418 280 229 96 84 34 --1451 --
NM_001031717chr34957 361 243 87 1704 ----
NM_001031740chr141666 474 285 52 1610 --11586
NM_001031804chr1673819 3456 3000 2937 1461 1263 805 ------
NM_001032221chr92362 342 ----1536
NM_001032279chr111366 --1428 --
NM_001032280chr631553 1236 148 ------
NM_001032283chr12129 ------
NM_001032284chr12129 ------
NM_001032363chr181840 1773 1586 1571 1544 702 518 134 --1511 --
NM_001032363chr181840 1773 1586 1571 1544 702 518 134 --1511 --
NM_001033026chr191470 196 ----
NM_001033045chr243999 3311 435 76 11421 11470 1555
NM_001033057chr31511 ------
NM_001033059chr621607 761 11446 ----
NM_001033081chr171806 1433 687 495 445 420 271 31916 1310 638 ----
NM_001033082chr171806 1433 687 495 445 420 271 31916 1310 638 ----
NM_001033087chr2053138 2967 737 515 37 --1667 --
NM_001033117chr344293 3970 3395 456 44441 3634 584 120 ----
NM_001033506chr11149 ------
NM_001033518chr752662 2157 2093 714 528 42733 2608 1766 589 ----
NM_001033519chr752662 2157 2093 714 528 42733 2608 1766 589 ----
NM_001033520chr752662 2157 2093 714 528 42733 2608 1766 589 ----
NM_001033551chr17233528 3482 3442 3386 3252 3225 3215 3100 2983 2664 2628 1441 1341 1266 1006 917 868 817 681 653 489 420 385 23564 2818 33606 3464 2604 --
NM_001033564chr651507 486 381 69 61 ----11594
NM_001033723chr842411 2098 2053 543 12470 1841 --
NM_001033756chr61520 1258 ----
NM_001033756chr61520 1258 ----
NM_001034837chr5--1102 ----
NM_001034838chr5--1102 ----
NM_001034841chr16105150 4530 4480 4310 4108 3502 1826 1773 1253 210 --13603 --
NM_001034845chr41178 11338 165 --
NM_001034850chr531583 1410 442 ----1521
NM_001035235chr52203 63 --1135 --
NM_001037131chr22426 166 ----136
NM_001037174chr211409 ------
NM_001037339chr13552 451 111 ------
NM_001037340chr13552 451 111 ------
NM_001037341chr13552 451 111 ------
NM_001037341chr13552 451 111 ------
NM_001037631chr2------1280
NM_001037954chr11123082 2749 2471 1314 1089 722 638 335 217 175 166 35 --11178 --
NM_001038707chr14366 336 303 150 ------
NM_001038707chr14366 336 303 150 ------
NM_001039140chr202491 99 1338 ----
NM_001039350chr721738 1336 1158 ----
NM_001039457chr12285 273 157 ----
NM_001039479chr1462192 2082 1760 1590 847 49 11739 12262 --
NM_001039538chr233383 2813 541 ------
NM_001039550chr25763 264 206 185 122 1302 ----
NM_001039573chr171464 ------
NM_001039574chr141046 965 786 756 --1169 1402
NM_001039580chr443311 1233 990 982 ------
NM_001039583chr224561 535 422 109 2191 55 1153 --
NM_001039584chr224561 535 422 109 2191 55 1153 --
NM_001039585chr163793 3081 1587 700 574 84 --23059 1364 --
NM_001039590chrX21079 861 ------
NM_001039591chrX21079 861 ------
NM_001039618chr1135892 4193 288 --15651 --
NM_001039690chr16132340 2068 2038 1684 928 781 769 726 701 612 541 355 343 42171 579 494 89 12024 --
NM_001039711chr13849 186 67 1931 ----
NM_001039712chr13849 186 67 1931 ----
NM_001039840chrX75770 5714 5624 4798 4631 2161 2083 ----15148
NM_001039916chr121118 ------
NM_001039917chr121118 ------
NM_001039918chr121118 ------
NM_001039919chr121118 ------
NM_001039920chr121118 ------
NM_001040102chr1082394 2022 1963 1780 524 399 69 30 11917 ----
NM_001040103chr1082394 2022 1963 1780 524 399 69 30 11917 ----
NM_001040144chr16132340 2068 2038 1684 928 781 769 726 701 612 541 355 343 42171 579 494 89 12024 --
NM_001040146chr16132340 2068 2038 1684 928 781 769 726 701 612 541 355 343 42171 579 494 89 12024 --
NM_001040152chr781987 1459 1043 983 925 891 634 606 --14443 1293
NM_001040159chr4--1330 1401 --
NM_001040167chr721003 28 1859 ----
NM_001040214chr6------12186
NM_001040273chr10101994 1833 1441 834 772 540 498 467 384 347 11814 ----
NM_001040280chr63392 255 136 2451 325 21526 1291 1600
NM_001040284chr1655816 5038 5009 4716 897 175 ----
NM_001040409chr22859 833 ------
NM_001040446chr521741 1098 11693 21935 127 1553
NM_001042361chr101204 1427 ----
NM_001042364chr101204 1427 ----
NM_001042365chr101204 1427 ----
NM_001042371chr1672103 1871 1407 1366 547 248 241 11468 ----
NM_001042387chr101204 1427 ----
NM_001042388chr18--1795 --179
NM_001042393chr101204 1427 ----
NM_001042396chr101204 1427 ----
NM_001042397chr101204 1427 ----
NM_001042403chr121794 ------
NM_001042404chr121314 601 ------
NM_001042413chr974010 3771 3604 1283 1263 750 515 11188 ----
NM_001042425chr631553 1236 148 ------
NM_001042440chr561644 600 567 479 107 24 --11770 --
NM_001042441chr561644 600 567 479 107 24 --11770 --
NM_001042442chr561644 600 567 479 107 24 --11770 --
NM_001042443chr561644 600 567 479 107 24 --11770 --
NM_001042444chr561644 600 567 479 107 24 --11770 --
NM_001042445chr561644 600 567 479 107 24 --11770 --
NM_001042446chr561644 600 567 479 107 24 --11770 --
NM_001042486chr2041492 1005 515 391 ------
NM_001042494chr1522597 1295 ------
NM_001042495chr1522597 1295 ------
NM_001042496chr1522597 1295 ------
NM_001042497chr1522597 1295 ------
NM_001042510chr82629 151 ------
NM_001042511chr82629 151 ------
NM_001042537chrX22338 2014 1412 ----
NM_001042555chr1221867 1598 ----12926
NM_001042599chr276390 5834 4996 4874 3107 1491 1059 27723 2987 ----
NM_001042601chr353114 3064 634 393 237 --1896 --
NM_001042603chr12135139 4929 4033 3506 3448 3390 3332 3244 1470 1090 761 474 86 15028 ----
NM_001042604chr314171 1918 ----
NM_001042669chr431848 1677 92 ------
NM_001042724chr191698 1676 ----
NM_001043318chr1473171 2906 2696 2583 1365 1257 488 43628 1493 1070 633 ----
NM_001044385chr231516 1296 642 13286 12790 --
NM_001048183chr1113692 3515 2749 2495 2378 1423 1254 957 878 814 663 1114 --11375
NM_001049chr1452113 1862 1797 613 247 --12129 --
NM_001050chr1731302 264 98 --1569 11420
NM_001065chr123431 409 119 ------
NM_001083620chr432015 1668 814 ------
NM_001092chr1782271 2153 1905 1882 1736 769 564 52 11845 ----
NM_001099678chr365399 5279 4823 4233 3906 392 24991 123 16239 --
NM_001100108chr186731 6702 6487 6140 5665 5126 2934 304 35950 5295 1364 1369 --
NM_001106chr3237995 7929 7086 6449 3837 3736 3624 3436 3290 3005 2807 2717 2666 2207 2177 2143 1931 1843 1687 1676 1082 873 866 23648 2080 37393 3899 1813 11976
NM_001128chr1673508 2645 2477 1612 1080 483 297 153 ----
NM_001144chr162559 264 1939 ----
NM_001146chr832122 1724 160 --1193 --
NM_001148chr431687 68 59 11801 --1419
NM_001151chr4------1109
NM_001167chrX96719 6101 5430 5265 5234 4474 4272 1943 324 25382 2468 --26217 4192
NM_001173chr1443614 3448 3363 840 24617 510 ----
NM_001174chrX3940 801 327 1286 1319 --
NM_001177chr1262461 2239 2154 1973 1674 1662 ------
NM_001186chr2142147 1184 858 737 ----12888
NM_001198chr621662 44 1623 1658 --
NM_001203chr41228 --1158 --
NM_001204chr236684 5079 428 --16108 --
NM_001222chr1031811 1643 302 ----21553 573
NM_001237chr42832 322 --1441 --
NM_001237chr42832 322 --1441 --
NM_001241chr2----11798 --
NM_001241chr2----11798 --
NM_001256chr1721912 1136 12528 --12823
NM_001259chr764712 4104 1573 1318 244 102 ------
NM_001265chr136774 747 706 286 215 121 ------
NM_001271chr1542852 940 424 258 1567 13078 --
NM_001293chr11153 1487 ----
NM_001298chr231335 501 83 ------
NM_001300chr101450 ------
NM_001304chr1723274 786 21099 61 12652 --
NM_001331chr1162701 1842 1087 774 694 562 --125 --
NM_001332chr521235 187 ------
NM_001346chr321983 623 ----1777
NM_001356chrX----1408 --
NM_001357chr11264 ------
NM_001364chr1183494 2954 1873 1697 1681 1638 1457 72 ----1631
NM_001387chr583200 2974 2841 2642 1258 1202 747 402 42317 2241 2218 2156 ----
NM_001396chr2132185 2079 797 --1507 --
NM_001399chrX153711 3559 3400 3382 3002 1490 1482 1471 1133 1104 993 780 420 377 40 1901 32939 921 724 21515 878
NM_001406chr1751674 673 510 250 43 ------
NM_001407chr371646 1281 1252 522 387 280 133 21485 1470 ----
NM_001408chr151592 1247 448 233 142 1431 ----
NM_001412chrX33160 3128 2391 --1612 --
NM_001416chr173512 355 45 ------
NM_001417chr122347 340 --1779 11908
NM_001420chr1973121 2890 2676 2571 430 364 164 --12873 --
NM_001421chrX71529 1427 1238 618 332 246 140 ------
NM_001431chr6----1901 --
NM_001432chr43557 280 43 13889 --12426
NM_001438chr112383 12615 12784 11335
NM_001440chr882585 2498 1983 627 610 194 185 82 32667 1113 705 ----
NM_001448chrX21297 527 11431 ----
NM_001458chr73522 466 131 1219 ----
NM_001460chr13622 143 21 ------
NM_001489chr9143 ------
NM_001491chr652391 2133 924 463 126 12738 1202 --
NM_001493chrX2542 522 1144 ----
NM_001497chr992585 2351 2339 1882 1829 1792 1710 636 180 12431 12306 11069
NM_001498chr631308 512 115 --1955 1388
NM_001527chr664817 4346 4301 4211 3190 340 ------
NM_001543chr5133965 3852 3056 1666 1493 1230 1178 984 649 588 554 421 253 34658 1841 713 24488 3893 --
NM_001552chr1741029 882 210 194 1398 ----
NM_001560chrX31004 768 511 32385 2265 2149 12560 2720 72
NM_001610chr111100 ----1617
NM_001634chr621607 761 11446 ----
NM_001635chr7--1125 ----
NM_001658chr131042 837 304 ------
NM_001660chr31254 1206 --1100
NM_001661chr172615 51 ------
NM_001663chr1422719 154 ------
NM_001665chr111537 1206 ----
NM_001668chr142257 2202 1768 877 12212 ----
NM_001677chr11755 1235 ----
NM_001679chr32823 509 ------
NM_001682chr1211988 12033 ----
NM_001693chr811254 --21122 199 --
NM_001704chr6182 ----162
NM_001707chr7----1150 --
NM_001709chr1112043 ------
NM_001723chr61238 ------
NM_001730chr134462 407 197 35 ------
NM_001730chr134462 407 197 35 ------
NM_001731chr122119 74 ------
NM_001746chr5174 --1740 1760
NM_001748chr1185 1891 ----
NM_001750chr561644 600 567 479 107 24 --11770 --
NM_001754chr2153113 3066 1704 121 103 14178 ----
NM_001759chr1264609 3213 1101 1077 680 44 34051 4042 2080 ----
NM_001773chr131251 1063 508 ----1241
NM_001777chr331218 609 504 --1958 --
NM_001781chr12--1130 ----
NM_001789chr331486 1220 1125 1119 --1397
NM_001792chr181460 ------
NM_001797chr161246 ------
NM_001798chr1221017 73 1148 ----
NM_001806chr191188 32473 1997 132 --1267
NM_001874chr12125066 4425 3668 3454 1947 1812 1539 1370 1088 984 658 36 ----44945 3758 1491 1210
NM_001892chr541154 464 159 122 ------
NM_001893chr171360 ------
NM_001903chr51735 ------
NM_001904chr3183 ------
NM_001918chr1238686 8577 8132 7763 7194 7059 6993 3115 3096 2881 2609 2445 2065 1876 1621 1569 1430 1155 978 549 402 383 197 --11759 31796 501 469
NM_001936chr721738 1336 1158 ----
NM_001939chrX82597 2344 895 803 519 291 149 132 23421 1274 12617 --
NM_001941chr1853110 3029 2692 1156 711 11214 ----
NM_001946chr121366 ----1859
NM_001949chr652205 2114 1139 1044 375 1213 ----
NM_001954chr62691 294 --2743 552 --
NM_001964chr51436 ------
NM_001968chr41344 ------
NM_001969chr1463580 2626 1579 652 538 424 23319 3227 13436 11179
NM_001981chr122407 673 ------
NM_001991chr1762173 866 698 505 489 438 41563 1523 1370 771 ----
NM_001995chr431420 1359 1137 11155 ----
NM_002009chr15--11822 11102 --
NM_002013chr14150 ------
NM_002015chr1373080 3041 2718 2434 2336 2139 162 11201 ----
NM_002024chrX11673 11551 ----
NM_002025chrX139043 8887 8732 8675 8663 7882 7602 7318 6829 6175 6111 2119 1069 --37656 1494 770 --
NM_002048chr92175 145 190 ----
NM_002061chr131953 1788 1478 11740 --21905 1398
NM_002062chr641242 536 316 25 21474 192 1484 11079
NM_002069chr7------1117
NM_002074chr151581 1575 1213 428 50 ------
NM_002076chr1262757 2690 1301 282 111 98 ------
NM_002077chr931609 335 75 ------
NM_002086chr1772102 2088 2012 1975 1906 880 111 --1630 2833 801
NM_002126chr1733688 3099 1601 ------
NM_002130chr53619 449 142 --184 1163
NM_002136chr121459 ------
NM_002139chrX--1583 ----
NM_002140chr91906 ------
NM_002141chr73589 278 90 ------
NM_002198chr57589 309 264 185 169 147 46 2578 223 ----
NM_002205chr127872 819 806 651 633 310 77 ------
NM_002210chr253396 1415 1067 613 502 13135 ----
NM_002214chr744825 3493 879 426 --14773 --
NM_002235chr1261219 571 534 387 148 127 11675 11584 --
NM_002241chr152813 2433 2257 2059 927 12650 12549 --
NM_002246chr241244 945 238 194 21196 1147 128 11164
NM_002247chr102529 233 2912 669 ----
NM_002249chr12474 402 ----1211
NM_002254chr251785 1481 572 243 135 2446 41 ----
NM_002264chr364422 4196 4063 4054 509 162 11872 13378 --
NM_002267chr131563 ------
NM_002268chr311904 ------
NM_002270chr535153 4466 215 14409 ----
NM_002271chr13--22267 1522 ----
NM_002285chr274161 3817 3432 3004 2950 2809 1197 ------
NM_002293chr132736 913 740 12097 11767 --
NM_002298chr133576 568 97 ------
NM_002309chr22153037 2460 2454 2271 2121 2081 1203 1052 853 684 624 608 580 159 139 5916 739 654 523 236 32769 2626 564 12395
NM_002334chr1131812 256 217 --21880 582 1521
NM_002336chr1254784 1806 757 602 67 --1356 --
NM_002355chr1251168 1137 546 510 469 ------
NM_002359chr17114243 3630 3362 3339 2763 2613 1537 1495 1454 1172 537 13404 11310 --
NM_002373chr151539 1405 31034 437 134 11007
NM_002374chr233383 2813 541 ------
NM_002375chr372016 1807 1687 1571 553 357 257 11497 ----
NM_002382chr1421007 269 ------
NM_002387chr541954 217 157 127 2744 565 14400 --
NM_002390chr1772070 1982 1452 352 313 193 27 31529 1266 405 22018 1772 --
NM_002397chr521518 1398 --1643 --
NM_002399chr1511144 ------
NM_002403chr12131 67 137 2262 43 --
NM_002406chr54998 838 364 21 ------
NM_002427chr11----11105 --
NM_002430chr2251972 1796 1643 957 835 1634 11611 --
NM_002444chrX51847 1813 1514 1470 181 ------
NM_002473chr223553 528 505 195 ----
NM_002481chr197015 6895 6714 5693 5666 2301 1740 266 253 12558 16599 17764
NM_002499chr1552092 1538 971 529 188 --11773 --
NM_002501chr19114002 3913 3704 3490 2990 1511 783 678 503 434 381 31463 1152 854 12621 11356
NM_002507chr1751937 1808 1728 123 103 1733 31709 1701 443 --
NM_002508chr1164 ------
NM_002509chr202801 615 1232 ----
NM_002514chr831045 990 191 ------
NM_002516chr19--1112 ----
NM_002519chr112376 184 ------
NM_002522chr1773427 2849 2641 1513 1207 1046 141 33196 772 654 ----
NM_002524chr12256 201 ------
NM_002526chr621630 77 ------
NM_002545chr1133894 1151 85 41854 1821 1262 539 13596 --
NM_002547chrX53723 2669 1578 1356 1045 1145 ----
NM_002569chr152152 42 180 --11337
NM_002572chr111395 1297 ----
NM_002581chr934865 1940 1666 31301 825 462 ----
NM_002591chr201491 ------
NM_002595chr1221722 92 ------
NM_002599chr1151034 1000 958 144 93 11008 ----
NM_002600chr13552 451 111 ------
NM_002601chr21333 ------
NM_002605chr152208 194 ----1445
NM_002609chr581909 1675 1297 741 682 599 161 68 21717 358 ----
NM_002613chr16164977 4778 4285 4080 3642 3367 2142 2093 1834 1789 1709 1406 1396 756 569 326 11664 11176 --
NM_002628chr34924 841 370 179 ----11164
NM_002629chr101609 --1282 --
NM_002633chr11491 1175 ----
NM_002645chr1122238 119 ------
NM_002648chr641307 1212 886 526 --1994 --
NM_002655chr81369 11357 24457 200 --
NM_002657chr2082948 2699 1490 1096 726 463 278 145 13399 12660 --
NM_002670chr321596 1152 ------
NM_002687chr1411024 ------
NM_002698chr1992864 2737 2677 2516 843 818 128 117 59 1354 11041 --
NM_002710chr121741 ------
NM_002714chr661050 942 862 201 149 141 --1787 --
NM_002716chr1153132 2370 1337 861 338 --1278 11289
NM_002731chr12780 477 ------
NM_002737chr1795897 5875 5649 5545 5011 4077 1671 1148 660 35790 2028 806 34235 2420 1743 14810
NM_002745chr2254218 2957 1794 892 582 --12885 --
NM_002751chr2291186 951 939 461 363 223 207 69 43 ------
NM_002752chr5--169 ----
NM_002755chr151223 ------
NM_002815chr17158 ----1195
NM_002834chr1222867 1029 11398 11525 11613
NM_002843chr1143274 3214 3125 2433 22504 2446 --13112
NM_002849chr122863 36 ------
NM_002859chr1281736 1497 1446 1324 689 566 303 192 ------
NM_002868chr1262285 2216 2142 492 221 214 12149 ----
NM_002869chr1111818 1770 ----
NM_002874chr922112 99 170 2563 79 11743
NM_002886chr375122 4118 4076 3247 1686 804 336 24853 123 14948 11812
NM_002892chr1421083 419 ------
NM_002955chr631640 577 442 ------
NM_002957chr9163533 3471 3085 2962 2950 2844 2673 1361 1331 1235 1199 1082 1023 307 101 49 23663 2896 --11279
NM_002973chr122393 173 --1201 --
NM_002979chr12249 163 ------
NM_002994chr41497 --11238 --
NM_002997chr271828 1364 690 433 388 251 193 ------
NM_003010chr1741965 1536 906 329 ------
NM_003011chr921242 1199 157 11405 --
NM_003028chr963783 3429 2451 777 180 44 42518 2472 2405 904 --11091
NM_003034chr12108117 6222 6084 5971 3203 2808 2797 2355 2284 1207 37741 6283 2452 ----
NM_003045chr13154306 4270 4055 3934 3798 3637 3594 3196 1893 1567 1332 1130 987 772 214 2382 350 ----
NM_003060chr521250 301 11300 --1907
NM_003074chr362122 1457 868 804 674 84 11764 ----
NM_003076chr1241465 586 549 92 ------
NM_003088chr781072 1009 961 907 826 805 366 225 1233 1928 --
NM_003108chr266155 5516 2872 2607 2575 1948 34791 2465 56 ----
NM_003111chr21122 ------
NM_003130chr721200 872 11123 1423 --
NM_003131chr672125 1759 917 863 825 623 573 42211 2041 1847 258 ----
NM_003137chr611419 --1891 --
NM_003144chr622201 1784 ------
NM_003150chr1742091 1887 1572 851 --21991 158 --
NM_003156chr1151268 301 159 128 44 11251 11284 --
NM_003161chr17----21209 714 --
NM_003164chr11--149 --196
NM_003178chr332097 1898 299 1467 ----
NM_003179chrX41262 1246 970 496 --130 11033
NM_003185chr201956 ------
NM_003189chr172741 2477 2410 653 565 312 160 11226 1345 --
NM_003199chr1833899 3459 1592 11047 ----
NM_003200chr19122114 1962 1914 1788 1723 1633 1477 962 910 459 308 194 42211 2047 1908 1662 1956 --
NM_003204chr1741496 74 68 62 ----21712 1324
NM_003214chr671356 910 549 484 349 70 60 21070 414 ----
NM_003215chr431480 1116 83 --21127 426 --
NM_003216chr22133079 2939 2767 2351 2183 2128 1076 1054 834 599 356 316 53 33142 1213 588 22891 2679 --
NM_003217chr121203 11768 ----
NM_003220chr631553 1236 148 ------
NM_003221chr673502 3285 2955 2727 1687 1653 1348 1551 11042 --
NM_003236chr2103030 2683 2582 2473 2454 2234 2196 179 113 88 2890 768 11338 --
NM_003239chr145943 820 761 713 100 ------
NM_003253chr211131 ------
NM_003255chr1761623 890 572 363 250 235 ------
NM_003269chr621230 305 1254 ----
NM_003274chr2152733 1989 1894 592 109 1571 ----
NM_003275chr91219 11143 ----
NM_003281chr1195196 5044 4341 4304 4276 4262 3711 3406 2136 2083 1760 1116 1098 1076 1064 888 857 739 550 33484 1462 447 63330 2187 1816 1569 439 243 14332
NM_003292chr11657 --1581 --
NM_003298chr3104996 4957 4475 4464 3992 2441 1702 1172 1152 745 45900 4271 3775 2241 1789 15025
NM_003314chr5133 ------
NM_003320chr11104423 3813 3736 1557 1297 1199 623 503 269 36 41632 1064 926 813 --12994
NM_003325chr224540 266 176 154 ------
NM_003338chr101247 --11437 --
NM_003339chr51162 ----11294
NM_003340chr41308 ------
NM_003342chr1742150 2083 925 867 ----12302
NM_003344chr711120 --2691 446 --
NM_003345chr161369 --2438 108 --
NM_003356chr1141041 1019 431 344 1807 1900 --
NM_003368chr12549 278 1220 ----
NM_003370chr193248 135 81 ------
NM_003371chr951502 1360 1345 789 289 51944 1438 775 680 39 22058 229 --
NM_003374chr51224 191 ----
NM_003376chr61586 1324 ----
NM_003376chr61586 1324 ----
NM_003380chr101292 ------
NM_003392chr363262 3109 1596 1511 1235 879 1483 ----
NM_003400chr21876 ------
NM_003404chr2041841 1790 1315 450 ------
NM_003406chr821538 1523 11241 ----
NM_003427chr64686 475 467 118 ------
NM_003452chr92834 206 ------
NM_003458chr3133715 3560 3306 3120 3084 1308 1111 588 513 392 206 118 77 12633 21326 847 --
NM_003463chr642837 2784 1168 197 --12445 --
NM_003466chr252516 2459 775 591 461 32364 785 52 1334 11947
NM_003468chr243164 761 355 123 24142 3537 ----
NM_003474chr1031969 1862 583 1827 1616 1574
NM_003478chr1132978 2571 50 ------
NM_003482chr1242199 932 460 178 12207 --1323
NM_003487chr17192 ------
NM_003489chr2142197 1302 1043 966 ------
NM_003502chr164649 526 233 209 ------
NM_003559chr17133701 3224 2921 2872 2581 2509 1276 1263 1137 1065 1046 771 314 ------
NM_003563chr1741145 515 350 233 --1166 --
NM_003566chr121647 --3701 558 184 --
NM_003574chr1864376 4364 4106 2311 2024 440 13737 ----
NM_003583chr1243649 3476 3222 1300 11053 1468 --
NM_003590chr211513 ------
NM_003597chr262162 2111 1531 563 533 307 ----1172
NM_003598chr191171 ------
NM_003607chr144112 1202 1087 834 13063 1778 --
NM_003618chr21402 ------
NM_003626chr11--1859 ----
NM_003629chr183121 2829 2797 2766 2690 2562 2453 1316 22571 521 23008 2245 12506
NM_003644chr1795731 5245 4796 3974 2622 1237 616 538 99 55719 4692 2538 2039 526 11810 11307
NM_003656chr3145 ------
NM_003659chr221215 321 1387 ----
NM_003663chr341352 1248 1071 361 ------
NM_003666chr11666 ----2618 586
NM_003679chr153101 2965 2593 2293 743 --1718 13176
NM_003684chr1136 --2927 810 1304
NM_003685chr19----1154 --
NM_003722chr31165 11805 ----
NM_003749chr132924 418 ------
NM_003758chr151174 1996 ----
NM_003758chr151174 1996 ----
NM_003759chr413095 12623 ----
NM_003762chr111486 ----137
NM_003763chr2052701 2449 2415 2325 421 22657 257 12491 --
NM_003766chr172503 454 ------
NM_003774chr1243206 2080 1070 541 ------
NM_003793chr113290 284 26 ------
NM_003794chr31393 ------
NM_003796chr191631 ------
NM_003800chr641573 743 551 358 1783 ----
NM_003822chr162956 2873 2695 2590 2523 2014 ------
NM_003858chr142588 240 1145 ----
NM_003885chr1772325 1844 861 770 353 161 131 ------
NM_003901chr1062648 2150 989 787 642 88 154 --11091
NM_003913chr633386 3022 335 ------
NM_003927chr183993 781 737 ------
NM_003932chr2231828 616 568 --1548 --
NM_003949chr1771818 1674 1481 1336 517 193 48 3603 453 433 11324 --
NM_003951chrX----1324 --
NM_003955chr1761267 1148 647 563 178 113 1428 ----
NM_003958chr653541 2903 2831 2798 2465 23604 3154 ----
NM_003983chr16113659 3561 1701 1518 1179 1095 917 787 477 289 28 --1176 --
NM_004047chr12285 273 157 ----
NM_004050chr1471812 1009 825 793 518 509 299 22336 915 12149 --
NM_004052chr10285 23 ------
NM_004065chrX3318 236 37 ------
NM_004067chr741496 1356 1128 214 ------
NM_004074chr111164 ------
NM_004075chr121201 ------
NM_004079chr141098 929 396 230 --12282 32526 317 180
NM_004099chr941516 1329 745 530 --1325 12019
NM_004133chr842228 2002 1774 444 ------
NM_004156chr8144 1469 ----
NM_004161chr211086 11408 ----
NM_004169chr173286 231 29 2602 199 ----
NM_004171chr11128032 6950 6640 6344 6305 6214 3546 2669 2287 2099 988 848 28263 1507 --1375
NM_004187chrX4960 923 191 86 ------
NM_004200chr1172573 2333 2174 592 524 442 363 22379 214 12661 --
NM_004202chrY2548 81 ------
NM_004210chr1091629 1572 1356 1314 723 642 521 430 396 11993 12139 --
NM_004227chr763073 2484 2406 2390 1976 1239 1180 22129 803 12248
NM_004228chr194178 71 64 47 ------
NM_004229chrX22039 605 1473 ----
NM_004232chr1842929 935 551 173 ------
NM_004233chr63392 255 136 2451 325 21526 1291 1600
NM_004242chr6--143 ----
NM_004255chr152143 65 ------
NM_004261chr11661 ------
NM_004263chr2101676 1262 564 410 355 291 169 158 129 80 ------
NM_004274chr1452058 1058 442 89 52 ------
NM_004281chr10----1123 --
NM_004286chr2272418 1896 1818 939 877 832 703 22650 547 2596 260 --
NM_004293chr913445 2105 32 13617 --
NM_004295chr1741061 252 201 67 1547 1529 --
NM_004302chr1252581 1871 982 587 300 32485 489 335 12064 --
NM_004319chr131272 893 815 1480 2634 61 1779
NM_004321chr2123357 2898 2844 2645 2475 2346 2200 857 733 626 591 566 42783 2431 1069 912 13191 13008
NM_004326chr11879 1956 1245 --
NM_004329chr102310 94 ------
NM_004331chr831770 1043 556 --11058 --
NM_004354chr42801 147 ------
NM_004364chr1981216 1154 965 788 240 178 136 27 ------
NM_004370chr631391 747 359 --1870 --
NM_004380chr1662657 2531 2441 2094 1966 189 ------
NM_004392chr1342602 1811 1002 447 ------
NM_004393chr352009 777 657 140 43 ----1932
NM_004395chr53707 138 101 1508 ----
NM_004397chr1173993 3846 3839 2721 1014 766 265 ----22611 1227
NM_004418chr24427 404 180 74 ----1445
NM_004423chr352011 1951 1789 972 801 22070 270 ----
NM_004426chr1261841 1234 579 456 199 63 ------
NM_004430chr811986 ------
NM_004433chr16672 443 347 327 263 217 31383 162 63 ----
NM_004436chr13469 258 177 ------
NM_004438chr272584 2075 949 765 589 562 210 ------
NM_004442chr141667 676 497 384 51455 544 373 314 223 11207 --
NM_004449chr21--1157 ----
NM_004454chr31121 2615 251 ----
NM_004455chr131053 933 303 185 ----
NM_004463chrX1143 ------
NM_004468chr12229 116 2394 76 1185 --
NM_004485chr1114304 4283 4117 3571 3558 3545 3196 2994 1452 879 644 13730 34368 4320 3532 --
NM_004487chr3141 11233 ----
NM_004494chr161245 1101 372 185 167 50 2439 312 ----
NM_004501chr163453 3435 3343 667 609 322 11406 12960 --
NM_004503chr124814 564 324 271 ------
NM_004505chr1721641 66 1709 --1260
NM_004514chr1732343 1125 461 --12946 --
NM_004516chr193872 440 198 ------
NM_004521chr101145 1100 ----
NM_004540chr21--196 ----
NM_004560chr92717 233 ------
NM_004566chr1082580 1993 1745 928 889 762 523 247 1293 1769 22496 498
NM_004577chr71499 ------
NM_004586chrX74339 2153 1737 1570 582 565 528 13553 --35332 1689 922
NM_004588chr11123873 3469 1375 970 859 654 519 442 385 362 262 224 1209 1121 --
NM_004598chr543259 1295 776 549 ------
NM_004612chr964722 4662 4649 4539 3208 50 12955 1746 11427
NM_004615chrX1313 --1642 --
NM_004626chr114707 233 150 74 1286 ----
NM_004630chr1141212 1134 883 207 1174 ----
NM_004631chr1----11046 --
NM_004637chr31245 1471 ----
NM_004642chr122657 131 ------
NM_004646chr195948 360 196 116 72 ----1447
NM_004655chr1721354 429 ------
NM_004656chr381198 492 485 473 338 291 278 215 1126 ----
NM_004660chrY2926 405 --1539 1642
NM_004713chr141642 ------
NM_004716chr112285 87 1674 ----
NM_004717chr731268 1027 209 --11577 --
NM_004723chr121081 63 2192 131 1147 --
NM_004725chr1031166 1067 524 1562 ----
NM_004726chrX55172 4614 1920 1008 697 25284 1105 13736 --
NM_004739chr111221 ------
NM_004742chr331754 1472 374 ------
NM_004745chr865789 4811 2503 1473 242 231 24965 4380 ----
NM_004762chr1781768 1716 1682 1599 630 618 582 564 --21803 538 --
NM_004788chr1142722 2353 2317 2139 ------
NM_004798chr2083473 3446 3354 2896 2883 2290 175 151 1193 13576 12242
NM_004808chr1083159 2994 2811 2671 2239 2165 1134 966 1887 ----
NM_004815chr184643 4565 4558 3665 1811 1122 938 871 ------
NM_004821chr53167 89 25 ------
NM_004822chr17192704 2521 2515 1566 1500 1474 1311 1301 1226 1122 937 705 602 578 564 353 307 195 87 12865 23293 1111 --
NM_004827chr43779 698 246 1678 ----
NM_004834chr232720 1330 58 1616 ----
NM_004840chrX22157 188 ------
NM_004845chrX54031 3606 3594 1670 69 21575 149 11129 --
NM_004850chr221762 1506 --1176 21682 385
NM_004859chr1742749 2719 2623 149 --22910 239 --
NM_004860chr173511 396 129 ------
NM_004862chr1621203 73 11226 11089 --
NM_004863chr14104355 4214 1876 1770 1688 1603 1170 982 409 397 25237 4166 21178 357 --
NM_004866chr574895 4523 4354 3178 3077 1637 1258 ----24306 4274
NM_004884chr1571717 479 271 255 230 134 98 11676 21728 1553 --
NM_004897chr102770 149 ------
NM_004904chr742153 1487 1182 91 1213 16291 --
NM_004921chr152022 1741 971 530 158 --11912 --
NM_004922chr106919 865 719 644 150 113 ----1975
NM_004936chr953053 2819 2755 332 194 11224 1406 --
NM_004956chr764525 3968 844 727 432 415 1282 ----
NM_004973chr61554 11682 --1523
NM_004976chr11164520 4283 4029 4019 3948 3827 3255 3223 1796 1728 1684 1630 791 392 184 109 45064 4746 3234 1512 1451 --
NM_004978chr171709 1628 1449 1419 1135 1106 403 162 1107 11065
NM_004979chrX81101 1064 928 871 833 452 317 93 1964 ----
NM_004985chr1234256 1738 262 --13010 --
NM_004992chrX188171 8035 7010 6942 6731 6472 6051 6024 5934 5862 5807 5389 3198 2835 1448 1428 1099 820 26549 5881 38205 2825 1784 --
NM_004992chrX188171 8035 7010 6942 6731 6472 6051 6024 5934 5862 5807 5389 3198 2835 1448 1428 1099 820 26549 5881 38205 2825 1784 --
NM_004994chr202178 56 ------
NM_004995chr1431348 1182 425 1572 --11386
NM_005008chr225862 781 667 325 125 --1697 --
NM_005027chr194890 410 391 37 --1440 1810
NM_005032chrX21071 772 1347 ----
NM_005044chrX64322 3610 1047 996 643 49 21198 882 11252 --
NM_005045chr71107 ------
NM_005056chr12135383 5173 4277 3750 3692 3634 3576 3488 1714 1334 1005 718 330 15272 ----
NM_005065chr1433583 3535 1628 --25263 4774 --
NM_005067chr31145 ----1176
NM_005078chr1551746 1251 729 357 178 134 --1608
NM_005079chr832853 2538 332 1182 ----
NM_005087chr31575 ------
NM_005088chrX2757 202 ------
NM_005095chr121568 810 ------
NM_005096chrX31181 302 289 --1864 --
NM_005114chr41496 1637 ----
NM_005116chr2094357 3696 3672 3314 2914 1658 1586 578 24 13167 ----
NM_005121chr1713251 --1146 --
NM_005126chr331545 506 430 2694 607 ----
NM_005133chr111366 --1428 --
NM_005134chr18--1795 --179
NM_005135chr1522597 1295 ------
NM_005137chr22102188 2084 958 884 855 815 606 360 96 66 32226 402 31 1680 --
NM_005148chr174450 150 96 40 ------
NM_005155chr61154 1632 ----
NM_005160chr22105498 5047 4680 4294 2696 2397 1901 803 481 140 2896 554 1541 --
NM_005161chr1162126 1929 1526 1458 1421 24 ----21696 659
NM_005180chr1011354 ------
NM_005184chr1941302 1271 1109 293 21384 1236 ----
NM_005188chr11107745 6923 6763 6458 5695 5653 5540 2836 2398 348 37960 7411 5390 36269 2493 278 17102
NM_005190chr6134 ------
NM_005197chr1446054 4754 4269 2078 35695 4085 3960 ----
NM_005214chr2------1243
NM_005219chr561616 1430 1233 613 177 95 31770 1581 588 11646 --
NM_005229chrX31131 425 32 21168 133 11174 --
NM_005235chr276390 5834 4996 4874 3107 1491 1059 27723 2987 ----
NM_005238chr1162985 2778 2641 1365 1071 1032 1427 ----
NM_005241chr31277 ------
NM_005256chr11----1604 1904
NM_005271chr1031227 1064 269 1378 1931 --
NM_005302chr71419 ------
NM_005311chr762687 2620 1854 1051 866 286 --2910 100 --
NM_005312chr992568 2385 2343 2168 2104 1928 986 864 442 11052 1751 --
NM_005324chr1731985 1828 486 ------
NM_005349chr4--196 ----
NM_005359chr18106487 6276 6029 5239 5153 4025 2237 1694 1638 1120 24779 4462 12425 16017
NM_005368chr222505 463 1210 2426 32 --
NM_005375chr61734 ----153
NM_005385chr342000 1819 520 42 ------
NM_005386chr203302 125 22 --1278 --
NM_005387chr111527 ------
NM_005392chr941709 1509 716 620 1724 ----
NM_005400chr272413 1920 1154 925 903 280 177 ------
NM_005402chr761753 703 639 624 543 269 --21321 1225 --
NM_005413chr2------1419
NM_005417chr2081934 1924 1906 1434 1275 1253 562 42 11373 11774 --
NM_005435chr71562 1218 ----
NM_005437chr1041181 993 511 91 ------
NM_005443chr41384 ------
NM_005455chr141287 1172 183 62 ------
NM_005458chr92472 173 2708 388 ----
NM_005465chr121466 1349 11480 ----
NM_005475chr1242931 2862 1106 197 ----12228
NM_005487chr222689 320 1246 1300 --
NM_005497chr17155722 5556 5380 5330 5214 4921 4852 4776 4475 4310 3884 1462 873 826 250 ----15636
NM_005502chr91710 ------
NM_005504chr1286499 5980 5947 5549 4869 4353 4005 200 11937 ----
NM_005506chr432299 2269 48 11023 ----
NM_005517chr131455 1052 452 ------
NM_005522chr731374 179 42 --1126 --
NM_005523chr741447 1438 514 427 1153 --11462
NM_005526chr84239 142 88 61 ------
NM_005530chr1561508 1390 1140 1128 229 123 1488 --1957
NM_005537chr1321039 833 ------
NM_005540chr131536 357 98 ----11369
NM_005563chr12789 265 ------
NM_005578chr374861 4748 3436 3177 513 366 315 14113 ----
NM_005596chr942315 2296 2133 2066 36194 5887 5749 12209 --
NM_005598chr171542 661 532 302 201 120 36 ------
NM_005599chr131515 423 288 ------
NM_005603chr182460 144 ----2655 412
NM_005609chr11152 1261 ----
NM_005610chr1------1680
NM_005614chr72989 726 1877 ----
NM_005639chr122575 128 ------
NM_005643chr62656 211 ------
NM_005647chrX3993 623 591 2413 255 12570 12964
NM_005665chr123881 653 34170 3848 815 14123 1627
NM_005668chr543268 1774 949 815 1383 ----
NM_005722chr252420 1867 892 704 145 11729 ----
NM_005730chr1272653 1461 1284 1184 1056 846 817 33068 633 544 ----
NM_005734chr11----1114 --
NM_005737chr25772 684 605 510 492 1649 ----
NM_005739chr1562146 1702 1497 706 481 314 ------
NM_005742chr21255 141 ----
NM_005746chr732241 2203 249 ------
NM_005748chr1242751 2338 1240 496 ------
NM_005754chr511220 ------
NM_005759chr234592 1476 68 1350 --1319
NM_005761chr12126 ----150
NM_005779chr533328 3042 237 12373 1931 --
NM_005785chr1241626 1426 238 151 11694 11455 --
NM_005802chr91547 --1250 --
NM_005808chr363443 3126 3033 2781 2183 524 22767 81 ----
NM_005819chr183048 2977 1390 1371 1076 1024 653 453 ------
NM_005822chr652397 868 599 435 93 ------
NM_005828chr17164462 4073 3922 3807 3532 3517 3457 3209 1650 1485 1458 1179 1048 752 730 594 --13792 23161 3129
NM_005840chrX117679 7491 7260 6405 6301 6218 5458 2716 2657 2409 1221 ------
NM_005841chr42783 201 ------
NM_005842chr131220 ------
NM_005850chr1184 ------
NM_005852chr175867 819 403 237 104 1920 ----
NM_005859chr511065 ------
NM_005877chr2242143 759 719 331 11677 21641 1604 --
NM_005895chr1253830 3502 2726 2659 373 24150 4075 12950 --
NM_005898chr112587 171 --13011 --
NM_005899chr1721289 1055 ------
NM_005901chr1856891 5712 5418 3036 575 47371 5613 5512 836 ----
NM_005903chr564208 3953 3878 1549 1383 908 ----11501
NM_005906chr62679 128 166 ----
NM_005910chr17133911 3610 3519 3427 3246 3093 2822 2771 2744 1522 1061 456 364 33064 1097 1036 --1989
NM_005911chr231340 1258 1114 ------
NM_005920chr1133717 3710 3698 3579 3420 2992 2976 2914 2861 2635 982 971 583 33477 3017 697 11060 --
NM_005923chr6163 ------
NM_005933chr1142235 1047 287 228 --22892 1172 --
NM_005934chr1982321 2295 2170 1640 912 277 237 194 2315 42 ----
NM_005937chr17104077 3672 3353 2790 1141 949 625 398 191 70 --13880 13874
NM_005938chrX41361 964 952 484 21186 422 21251 173 --
NM_005955chr195567 4048 3773 2135 2001 816 663 638 283 23409 27 ----
NM_005977chr131936 ------
NM_005986chr1321110 578 --1216 --
NM_005994chr171172 2160 64 --1214
NM_006007chr953938 3785 3157 1066 555 --11043 13214
NM_006011chr1543734 3110 3049 911 2897 413 22942 1446 --
NM_006015chr111090 1134 ----
NM_006016chr611694 --11883 --
NM_006030chr371667 1650 1459 1268 602 489 401 1154 ----
NM_006032chr141192 ------
NM_006034chr11102361 2203 1604 507 460 269 208 181 155 35 2842 790 11985 --
NM_006035chr1421189 1065 --21213 361 --
NM_006038chr2051854 1724 849 424 385 21537 344 ----
NM_006040chr163446 386 221 --1208 --
NM_006048chr13924 898 323 ------
NM_006051chr52216 35 ------
NM_006070chr31327 ------
NM_006079chr62258 119 ------
NM_006089chrX11812 ------
NM_006090chr1--1595 ----
NM_006095chr433807 866 253 ------
NM_006106chr1152568 2243 2112 1181 1087 1835 ----
NM_006108chr112513 283 1773 22393 1757 --
NM_006133chr11182284 2110 2081 2069 2052 1677 1574 990 929 842 719 635 561 484 461 250 199 60 31957 1692 937 11629 --
NM_006141chr161223 22773 400 1260 --
NM_006145chr1911016 ------
NM_006158chr811790 --11695 --
NM_006166chr1242286 2123 1941 627 ----12238
NM_006191chr121869 1190 ----
NM_006195chr93426 318 133 ------
NM_006203chr545510 5300 5262 2135 14866 1331 --
NM_006206chr432664 99 34 ------
NM_006212chr195205 4743 3349 1011 858 802 623 298 268 21727 794 33995 3775 1733 13314
NM_006224chr1752029 2023 1700 773 407 1435 11663 --
NM_006242chr205658 283 188 85 24 ------
NM_006246chr1411219 11033 ----
NM_006256chr122768 924 ------
NM_006257chr104421 285 88 71 2823 46 1334 --
NM_006267chr21392 ------
NM_006268chr112283 116 --1877 --
NM_006277chr22293 75 ------
NM_006282chr2074458 4016 3326 2895 1358 1022 701 ----11620
NM_006306chrX114027 3720 3688 2239 1258 1155 1096 1040 875 815 299 --11227 --
NM_006309chr3136 --122 --
NM_006328chr11----1656 --
NM_006352chr1--1628 ----
NM_006359chrX22338 2014 1412 ----
NM_006380chr1753887 3598 3317 1438 752 --11405 --
NM_006386chr2221946 1847 12298 1767 11994
NM_006393chr1074084 3195 1603 1153 226 164 88 34141 3258 280 ----
NM_006403chr621387 445 ----1462
NM_006430chr21108 1418 ----
NM_006449chr221761 289 ------
NM_006454chr492995 2741 2594 1882 796 786 771 745 141 --2721 528 12877
NM_006459chr1041727 1539 742 134 ----1441
NM_006464chr254248 1482 388 357 191 11171 1763 11304
NM_006469chr121247 1026 --11377 --
NM_006480chr51462 ------
NM_006482chr1243649 3476 3222 1300 11053 1468 --
NM_006492chr12335 251 ------
NM_006496chr121932 243 ------
NM_006517chrX21577 289 1241 21895 694 1231
NM_006521chrX5924 901 487 269 115 31069 384 24 ----
NM_006532chr193593 460 301 11699 --129
NM_006544chr1455453 5031 4389 1090 672 11212 --15403
NM_006546chr1795430 5295 5260 5038 4163 2367 1895 1160 1116 16389 35249 432 105 --
NM_006547chr722014 827 ------
NM_006549chr1262778 2638 1932 1193 661 46 --12526 --
NM_006561chr1045937 5094 4968 1458 35645 2306 235 ----
NM_006565chr16136 ----1396
NM_006575chr141992 ------
NM_006591chr1141593 592 178 30 1646 ----
NM_006599chr1678155 7593 6455 5928 1877 1330 674 ----16229
NM_006621chr131751 579 280 ----11961
NM_006636chr22859 833 ------
NM_006646chr1351003 883 749 355 147 1841 ----
NM_006650chr5133840 3715 3601 3207 2780 2707 2696 2667 2608 798 731 606 443 43161 2895 1048 1039 1526 --
NM_006654chr1221867 1598 ----12926
NM_006690chr2042293 532 230 29 41814 1691 1582 1531 ----
NM_006696chr5162 --1113 --
NM_006699chr151080 748 658 224 91 ------
NM_006700chr121807 ------
NM_006706chr52746 284 ------
NM_006708chr63945 877 374 ------
NM_006717chr952368 1278 931 755 680 11072 1768 --
NM_006722chr322722 2456 ------
NM_006734chr621169 362 --21528 1096 --
NM_006736chr281773 1523 1515 1274 1216 1195 677 365 11312 --21496 164
NM_006738chr1554279 1506 1121 519 125 13551 13099 --
NM_006751chr21413 ------
NM_006756chr8126 --1114 --
NM_006764chr33467 385 344 ----1163
NM_006766chr832605 909 189 --12255 --
NM_006769chr11265 --1211 --
NM_006771chr175986 955 408 242 79 ------
NM_006775chr632459 2345 2088 ------
NM_006788chr1851993 1392 862 773 534 22084 431 ----
NM_006805chr571606 1320 450 421 269 150 119 123 1368 --
NM_006811chr2011004 ----1698
NM_006815chr1211236 --1503 --
NM_006826chr241270 1179 285 72 ------
NM_006827chr1472642 2575 2352 2137 367 303 66 11226 ----
NM_006852chr1721858 186 1995 ----
NM_006854chr721778 592 ------
NM_006861chr1261853 1749 1658 617 243 237 41706 1604 1549 603 --11341
NM_006868chr1832339 359 85 1189 23061 2184 --
NM_006874chr43946 899 300 ------
NM_006885chr1623085 667 1279 13333 --
NM_006888chr1443510 3406 2687 751 12360 ----
NM_006889chr361546 1408 1346 452 265 62 ------
NM_006899chr201136 ------
NM_006918chr1154056 1808 1798 1708 779 21910 1348 --1706
NM_006922chr222370 2031 ------
NM_006924chr1722969 1706 --1321 --
NM_006931chr1231950 1497 297 ----11870
NM_006943chr20123177 3146 3131 2699 2672 2073 1215 1192 952 554 462 400 2992 636 11027 --
NM_006981chr942027 2016 1986 353 ------
NM_007005chr91218 11039 ----
NM_007006chr1622861 400 ------
NM_007011chr15136173 5635 5469 5142 4477 2288 1534 1502 1004 907 685 272 95 41101 675 470 168 34798 1644 924 --
NM_007017chr53737 731 315 --1802 --
NM_007030chr5135124 4719 4698 4321 1808 1759 1690 1649 1333 1191 569 549 524 1787 11161 --
NM_007033chr152103 1937 1919 1771 567 ------
NM_007034chr11811 ------
NM_007038chr2145286 4495 1131 236 ----1216
NM_007039chr142531 218 ----1196
NM_007050chr20156453 6353 5597 5371 5025 4999 2324 2152 1469 1247 1104 797 785 626 448 35321 1636 1043 ----
NM_007052chrX162 ------
NM_007054chr572944 2932 2731 2629 1421 1255 51 ----21373 1341
NM_007067chr1741287 1247 373 212 1967 ----
NM_007073chr683609 3553 3475 3459 3402 3361 3076 1543 11133 ----
NM_007107chr311743 --1313 11668
NM_007114chr322470 1338 12791 ----
NM_007124chr631991 1456 693 ------
NM_007137chrX74970 3785 3749 3721 3706 1435 801 --13852 --
NM_007144chr174988 310 107 60 11283 1872 --
NM_007153chr1933090 1778 740 23208 1752 24476 2999 13176
NM_007170chr13373 135 28 ------
NM_007174chr1231694 886 214 1958 1755 --
NM_007176chr1421484 588 ----11173
NM_007189chr761356 1214 1116 575 368 85 21307 1085 --139
NM_007200chr1554279 1506 1121 519 125 13551 13099 --
NM_007203chr983887 3448 3380 3070 2808 2525 882 341 33108 2852 38 11365 13016
NM_007212chr12691 278 1654 ----
NM_007232chr205843 778 169 61 54 1644 1344 --
NM_007236chr1551876 1798 1565 556 517 1617 11633 --
NM_007245chr16----1822 --
NM_007246chr42703 234 ------
NM_007249chr1378792 7420 6897 6607 3381 2463 2169 1212 ----
NM_007266chr22625 187 ------
NM_007287chr342788 2346 2312 707 ------
NM_007288chr342788 2346 2312 707 ------
NM_007289chr342788 2346 2312 707 ------
NM_007345chr1821701 67 --1633 --
NM_007350chr1254281 3832 3085 1429 79 13277 23343 1391 13201
NM_007353chr792905 2887 2452 2305 1948 982 208 124 64 ------
NM_007358chr111884 ------
NM_007359chr1771767 1738 1319 1209 1176 599 406 1328 ----
NM_007361chr14246 26 ------
NM_007363chrX2823 257 1906 ----
NM_007375chr12892 863 ------
NM_012069chrX42139 1004 610 563 32463 794 628 ----
NM_012081chr523313 741 ------
NM_012083chr101326 199 --1267
NM_012092chr241796 1695 1338 138 11242 ----
NM_012095chr1053251 3085 2229 603 267 ------
NM_012096chr322984 1209 1589 --12741
NM_012097chr211409 ------
NM_012099chr1961253 1026 778 281 228 120 1127 152 --
NM_012111chr141137 ------
NM_012154chr82870 172 ------
NM_012156chr20103053 2987 2653 2554 2519 2333 1304 1096 1088 586 11336 ----
NM_012166chr941375 1146 530 31 --11064 2562 544
NM_012175chr112875 131 ------
NM_012193chr11105197 4953 4376 4216 4017 3435 1593 1317 1249 1179 --35243 4405 3514 --
NM_012199chr1104084 3792 3529 3362 3317 3290 2945 2857 1382 243 11837 23311 3153 --
NM_012214chr2104585 4317 4026 2485 2282 2243 2154 1721 1512 139 ----11432
NM_012218chr19112908 2744 2051 1894 1012 934 800 720 553 475 239 21158 613 ----
NM_012219chr3123082 3016 2917 2855 2552 2284 947 534 490 478 112 37 ----1670
NM_012232chr1762174 1972 1683 839 403 307 1628 --11498
NM_012234chr333040 2822 152 ----1588
NM_012248chr161567 --1223 --
NM_012249chr223530 1291 ----12685
NM_012252chr732046 1636 311 --14152 --
NM_012281chr7--11859 ----
NM_012282chrX3852 330 54 1303 ----
NM_012287chr353833 3533 3161 1325 33 ------
NM_012296chr1183212 2996 2927 2920 2583 1451 1229 792 43516 1200 1023 164 13439 13542
NM_012297chr41213 ------
NM_012300chr532508 1698 349 22182 2087 1894 --
NM_012301chr741819 1535 337 162 1124 ----
NM_012302chr11451 ------
NM_012308chr1132562 1939 377 --22395 1861 --
NM_012309chr1184738 3752 3169 1344 1181 803 506 201 11055 ----
NM_012316chr1165491 5366 5178 4866 4699 4610 4521 4423 4301 3889 3619 2241 1765 1663 1437 439 22179 658 --24785 1345
NM_012325chr2031611 665 230 21061 484 ----
NM_012329chr1731711 1566 245 ----153
NM_012347chr652713 2615 2520 1888 237 1718 ----
NM_012384chr2082452 2245 926 852 586 438 325 188 31759 235 26 --1463
NM_012398chr1992551 2378 2146 1138 1125 880 559 531 424 11822 ----
NM_012399chr2221695 370 ----1600
NM_012402chr1181392 1126 1077 928 381 174 108 21 ------
NM_012405chr163665 3215 3083 2789 1210 26 151 23411 278 --
NM_012407chr224561 535 422 109 2191 55 1153 --
NM_012478chr173746 242 75 1254 ----
NM_013230chrY11429 1570 ----
NM_013231chr1453270 3119 2931 2735 1369 ------
NM_013238chr1321241 595 ------
NM_013240chr2154103 3721 1430 1355 274 13231 1860 --
NM_013253chr111412 1202 ----
NM_013255chr768040 6992 5571 3034 2532 1248 37348 6857 5821 16478 16054
NM_013261chr422811 615 --1804 --
NM_013262chr6125 21167 223 11130 --
NM_013269chr1264149 3722 1733 1425 927 778 ------
NM_013275chr163623 525 132 ------
NM_013279chr11102024 1831 1780 1690 942 711 667 547 520 222 2862 617 1461 --
NM_013286chr343709 3226 1216 104 ----13482
NM_013323chr172936 128 1264 ----
NM_013354chr81530 ------
NM_013372chr1552878 2683 1315 346 82 1611 ----
NM_013374chr332927 2084 858 ------
NM_013381chr121582 ------
NM_013382chr14102263 2062 1933 1665 1501 845 782 621 231 25 32148 510 140 11583 --
NM_013390chr961741 641 550 469 454 428 11234 ----
NM_013399chr1681710 1624 1273 1254 640 522 505 492 31453 1390 358 2669 93 --
NM_013433chr1951767 1675 1435 1410 260 2695 665 1294 --
NM_013436chr21175 ------
NM_013443chr941235 1120 400 160 21008 365 11035 --
NM_013446chr71925 11212 ----
NM_013951chr252516 2459 775 591 461 32364 785 52 1334 11947
NM_013952chr252593 2536 852 668 538 32441 862 129 1411 12024
NM_013953chr252593 2536 852 668 538 32441 862 129 1411 12024
NM_013992chr252593 2536 852 668 538 32441 862 129 1411 12024
NM_013993chr62691 294 --2743 552 --
NM_013994chr62691 294 --2743 552 --
NM_014021chr123399 217 22778 2210 1658 --
NM_014023chr1082200 1975 1946 1920 1166 957 548 225 ------
NM_014028chr632632 2162 59 12721 12329 12248
NM_014038chr72434 83 ------
NM_014060chrX----123 --
NM_014071chr20128 ------
NM_014106chr1532543 727 387 ------
NM_014117chr1622582 478 ------
NM_014155chr11127098 6995 6966 6778 6180 5340 2867 1857 1405 1338 1025 148 --11841 11718
NM_014157chr16103939 3435 1427 1411 1392 975 397 176 140 99 23772 1461 13150 21468 287
NM_014159chr32662 122 ------
NM_014181chr242485 2332 1046 84 ------
NM_014191chr122848 224 ------
NM_014216chr1481630 1489 1437 1051 661 612 535 383 ------
NM_014231chr1281831 1778 1705 649 525 503 456 398 11999 --1355
NM_014232chr1721122 551 ------
NM_014232chr1721122 551 ------
NM_014233chr1771697 873 555 436 399 266 211 1682 ----
NM_014238chr1761426 1193 1082 1064 689 261 11145 ----
NM_014240chr383554 3487 3420 2943 2699 831 753 75 22681 313 13928 13879
NM_014250chr222689 320 1246 1300 --
NM_014268chr181249 ------
NM_014275chr56858 591 137 128 115 54 --1292 1715
NM_014292chr2251404 1214 656 355 29 21303 1243 11816 --
NM_014299chr19111824 1455 1434 879 819 700 286 276 245 208 133 21633 410 ----
NM_014309chr2284550 4363 4007 1969 1459 1024 408 42 --14774 --
NM_014323chr222852 221 1361 137 --
NM_014325chr1221705 625 21519 54 ----
NM_014333chr112262 254 1137 ----
NM_014342chr1121331 429 1116 --11511
NM_014344chr112581 346 1188 131 --
NM_014345chr641069 692 429 92 ------
NM_014396chr741611 638 456 410 ----1552
NM_014397chr94582 554 298 79 ------
NM_014423chr544809 3865 2173 2123 21266 431 13940 --
NM_014445chr311512 ------
NM_014454chr62851 356 ------
NM_014456chr1031763 1324 609 ----21637 1605
NM_014470chr122313 46 ------
NM_014494chr1612310 1870 ----
NM_014515chr122126 41 ------
NM_014517chr31418 183 ----
NM_014547chr152250 82 ------
NM_014547chr152250 82 ------
NM_014554chr1242284 2214 1947 1452 ------
NM_014577chr222663 172 1670 ----
NM_014586chr21114513 3274 3202 3135 1898 1666 1403 1109 747 318 291 13617 ----
NM_014588chr202719 232 ------
NM_014591chr105545 488 135 110 31 --21040 929 1913
NM_014592chr5--1102 ----
NM_014613chr561916 1009 986 780 635 445 12468 1801 --
NM_014614chr231262 475 336 ------
NM_014615chr1643506 2806 2748 1165 ------
NM_014616chr353370 3349 2755 2647 845 ------
NM_014633chr111387 ------
NM_014634chr22102877 2535 2488 2341 1235 1187 1166 610 402 364 ------
NM_014636chr9124127 3830 3757 2851 1505 1436 794 742 264 232 77 57 140 ----
NM_014647chr1622084 1784 11897 ----
NM_014649chr19150 --175 --
NM_014659chr156741 466 369 244 74 41 ------
NM_014660chr71209 ------
NM_014661chr10123847 3735 3698 3268 1324 1213 608 454 388 168 156 58 22624 531 13055 --
NM_014665chr873300 2750 538 393 354 285 135 12316 12239 --
NM_014674chr353619 3607 3122 2644 512 23814 3529 1445 --
NM_014677chr81503 ----11237
NM_014680chr171138 ----1505
NM_014682chr82876 729 ------
NM_014683chr1732039 1676 262 ------
NM_014686chr1951693 643 333 177 139 1680 1634 --
NM_014690chr753077 2807 2013 1015 274 42874 2443 733 199 2259 212 1778
NM_014700chr1631596 1307 1286 ------
NM_014703chr331226 953 844 ------
NM_014705chr731953 1345 376 1530 ----
NM_014711chr1631571 454 111 1725 ----
NM_014720chr1011598 ------
NM_014730chr12165196 5148 4975 4934 4201 3794 3458 2057 1978 1964 1750 1737 1595 792 558 181 54436 3562 3390 3338 458 11830 --
NM_014730chr12165196 5148 4975 4934 4201 3794 3458 2057 1978 1964 1750 1737 1595 792 558 181 54436 3562 3390 3338 458 11830 --
NM_014731chr2081537 1229 1187 612 505 462 353 196 1712 11632 --
NM_014736chr151994 1772 ----
NM_014737chr20113381 2820 2737 2641 1604 1402 1197 1093 938 930 140 11312 21395 24 --
NM_014739chr623243 865 12746 --12849
NM_014747chr1275060 4993 4984 4960 4874 4852 4783 4701 4654 4632 4560 4470 4322 4312 4232 3864 3694 1870 1684 1535 1524 1160 853 652 394 383 225 55302 5098 4738 1129 553 21700 1662 --
NM_014751chr831970 830 568 ------
NM_014752chr1131360 145 55 1248 ----
NM_014755chr253848 3114 1442 1408 461 ------
NM_014757chr591990 1948 1883 1817 1557 231 148 141 100 ------
NM_014762chr162598 2393 2150 1621 680 252 2782 559 1835 --
NM_014765chr141899 602 411 73 11866 ----
NM_014767chr1093199 2900 2380 2293 1132 1033 995 957 884 22986 2357 43598 3230 982 114 --
NM_014770chr1241170 1133 414 253 --2932 472 --
NM_014772chr1893527 3341 2882 2241 2199 1395 1323 997 390 22904 1208 ----
NM_014774chr151300 1212 1080 764 545 ----1747
NM_014783chr1521118 324 ------
NM_014810chr153523 2787 2261 161 46 23443 1364 ----
NM_014812chr121314 601 ------
NM_014820chr321920 568 ------
NM_014822chr41504 1495 ----
NM_014826chr144112 1202 1087 834 13063 1778 --
NM_014827chr11161 11369 ----
NM_014828chr1452496 2168 742 253 191 --21707 1674 --
NM_014829chr51142 ----11940
NM_014830chr1252730 2441 1267 921 706 22723 1385 --13531
NM_014840chr1261314 1105 1039 637 389 130 1650 2375 60 --
NM_014850chr344293 3970 3395 456 44441 3634 584 120 ----
NM_014864chr144322 4110 4047 2856 24055 3026 ----
NM_014872chr952216 2061 1879 1856 227 21838 190 ----
NM_014873chr134765 3781 3316 14229 --13639
NM_014876chr2271993 1917 1880 1549 728 391 187 --11953 --
NM_014877chr1776830 6600 6587 6195 5684 5509 895 --27682 1113 --
NM_014891chr791592 1540 1491 1324 1126 561 465 418 128 1300 135 21410 450
NM_014902chr2041492 1005 515 391 ------
NM_014903chr1222343 1536 ------
NM_014904chr1033449 1585 992 ------
NM_014906chr1754134 2566 1393 463 385 ------
NM_014914chr22426 166 ----136
NM_014921chr1992683 1232 1046 834 820 693 369 288 53 --2790 165 --
NM_014923chr1321617 654 ------
NM_014924chr1472857 1953 1192 1070 863 811 313 ------
NM_014932chr321731 1263 ------
NM_014934chr1343783 1561 1199 1013 23075 1275 13068 1556
NM_014935chr1123485 3425 3157 2898 2838 2795 2712 1367 1122 1070 1049 249 33119 2703 1022 33262 3170 992 11231
NM_014939chr1811180 ------
NM_014945chr541961 738 732 519 ----21560 203
NM_014947chr182648 2576 2288 2067 1205 1118 1070 671 ------
NM_014952chr15101741 1615 1552 1366 1332 1279 249 159 128 80 31663 1581 460 --1753
NM_014953chr1353931 3170 1474 953 185 ------
NM_014962chr2042584 2554 1143 45 1541 1257 --
NM_014977chr14--2357 190 ----
NM_014982chr1434937 4459 3917 1931 ----
NM_014989chr621638 1412 ------
NM_014994chr1592086 1946 1670 1579 1456 551 526 392 247 --1737 1309
NM_015001chr11373 ----1656
NM_015008chr372889 2861 2749 2687 1235 403 286 22400 243 --13382
NM_015011chr1311101 ------
NM_015020chr1643511 3330 640 196 --11070 --
NM_015023chr171781 1737 1613 1193 1165 183 54 ------
NM_015025chr221787 730 ------
NM_015033chr952893 1047 713 610 312 12608 12501 1602
NM_015035chr20166540 6457 6432 6206 5520 5263 5047 4543 2085 2063 1952 1830 1651 1536 1258 450 139 --1121
NM_015037chr10180 1207 ----
NM_015042chr1563896 3168 1612 1461 971 650 64005 3934 3906 3247 1028 509 13196 --
NM_015044chr16112802 2693 2533 2496 2397 822 765 698 477 466 124 1234 2639 497 --
NM_015049chr253028 2081 2008 1273 510 1638 --13248
NM_015050chr631309 1075 120 2215 202 162 --
NM_015051chr932541 2218 1126 --11168 32169 726 447
NM_015053chr1102331 1866 1733 1485 556 425 367 330 265 34 1258 11643 --
NM_015061chr9270 37 --1710 --
NM_015063chr1961228 950 449 363 327 272 1112 11114 --
NM_015064chr1273648 3488 2851 1310 745 627 174 33600 976 196 ----
NM_015068chr751592 1485 1178 839 311 --23295 1083 11462
NM_015071chr576470 5635 4011 1958 1445 1426 1153 ------
NM_015074chr1114095 3929 1977 1765 1685 1442 1325 1160 518 487 318 43231 1884 1245 737 11111 24047 4015
NM_015075chrX82174 1855 1523 1464 880 495 248 102 11706 ----
NM_015076chr634158 3317 1584 --1987 --
NM_015077chr17143767 3700 3380 2971 1822 1184 729 722 493 435 409 206 181 86 --21026 101 24200 1000
NM_015082chr551996 1629 946 565 23 --1284 --
NM_015086chr1241553 1422 394 45 21339 430 ----
NM_015090chr186129 2369 2331 2004 1764 904 553 255 45585 5520 4557 4282 25321 5079 --
NM_015092chr1654145 4021 3567 1768 1219 --13492 --
NM_015093chr621231 226 ------
NM_015094chr22144260 3791 3258 3171 3140 3134 3027 2931 1408 963 691 573 301 96 --13402 --
NM_015101chr132092 2085 617 22655 891 22599 2041 --
NM_015102chr12133 116 ------
NM_015107chrX51621 1566 958 790 64 1127 ----
NM_015113chr1751798 1538 1496 606 321 61992 1758 1559 915 449 313 ----
NM_015125chr191238 --1476 --
NM_015132chr731439 417 65 ------
NM_015137chr811805 1453 ----
NM_015138chr1572128 2075 1809 1798 359 240 229 --11961 --
NM_015143chr431366 463 163 ------
NM_015144chr1633116 1137 419 2540 481 ----
NM_015156chr1442963 1075 827 25 1273 ----
NM_015161chr1631467 333 72 ------
NM_015176chr111420 ------
NM_015186chr92378 27 ------
NM_015194chr1771842 1801 1563 446 334 241 49 21538 634 1812 --
NM_015197chr14113465 3018 2954 2905 2826 2714 2315 1275 1261 611 443 11059 22508 897 --
NM_015200chr441024 315 294 68 ------
NM_015208chr1834059 1309 434 34011 3514 2720 12685 --
NM_015226chr1643470 2357 2112 273 12437 ----
NM_015239chr9----1123 --
NM_015245chr682713 2336 1964 989 805 670 317 141 12046 1438 --
NM_015250chr942040 829 672 22 11292 ----
NM_015254chr8172665 2603 2434 2169 1956 1130 968 896 692 572 512 318 292 277 236 154 29 11946 --1988
NM_015260chr1961539 1306 1246 531 443 218 1640 11431 --
NM_015270chr12112226 2138 2079 1931 1915 1907 1534 1492 567 504 362 21442 409 1228 --
NM_015271chr432864 2764 621 ------
NM_015272chr1621613 495 11888 1132 --
NM_015277chr1851856 1198 1176 433 166 ------
NM_015278chr642801 956 497 116 1692 ----
NM_015282chr252521 984 891 735 335 1848 ----
NM_015284chr181813 776 527 419 265 255 168 92 --21959 458 --
NM_015288chr553282 3259 3191 1407 1284 1686 23723 1550 --
NM_015292chr124745 306 216 208 ----1680
NM_015299chr14123691 3672 3598 3542 3517 3314 2994 2755 1523 1196 575 525 22838 430 13886 --
NM_015305chr1481678 1399 774 667 536 468 406 164 31390 675 241 ----
NM_015310chr847204 6607 5300 3348 36292 2996 2792 ----
NM_015313chr1164769 4707 3902 3712 1774 1134 24548 3910 --1127
NM_015315chr5133245 3207 3091 3068 2852 2843 2714 1302 1009 492 322 176 105 1586 1524 12793
NM_015317chr232853 2468 2142 ------
NM_015326chr142281 636 291 81 --11935 --
NM_015327chr131285 450 428 11276 --11032
NM_015332chr7113539 3484 3451 3329 3202 2998 2967 2565 2428 1206 655 2921 496 11411 --
NM_015335chr1222018 207 12415 --1449
NM_015338chr2051903 1383 1354 195 160 11435 --11419
NM_015344chr821980 108 ------
NM_015345chr692265 2109 1819 1077 870 786 743 428 111 1124 1485 --
NM_015347chr121184 ------
NM_015349chr642731 2076 1892 343 ------
NM_015355chr171380 ------
NM_015356chr8----282 28 --
NM_015374chr2241271 1000 414 387 3437 338 244 --136
NM_015375chr1124936 4867 4686 4370 4204 3432 3330 1988 945 778 627 130 21538 447 13134 33096 1908 897
NM_015378chr172902 2721 2341 2138 1205 1190 938 1650 12854 --
NM_015386chr16293 22 --2364 354 --
NM_015401chr125933 791 414 173 82 3747 678 39 ----
NM_015436chr433163 2936 28 ------
NM_015455chr51291 13870 --13036
NM_015457chr114989 804 767 162 1437 11041 --
NM_015461chr181737 --1258 --
NM_015470chr231249 1181 223 21015 797 --1336
NM_015508chr331172 1064 337 ------
NM_015528chr171178 ------
NM_015534chr11323 ------
NM_015535chr283812 2667 2637 1472 1215 968 506 430 ------
NM_015541chr341059 918 144 76 --11052 --
NM_015554chr151460 1522 --12118
NM_015568chr2084227 3950 3434 2976 2945 2764 1076 31 23209 263 33775 1711 406 --
NM_015575chr293367 2777 2501 1365 1297 1179 977 965 227 32264 1042 757 ----
NM_015576chr332336 684 136 ------
NM_015578chr1911531 ------
NM_015605chr101204 1427 ----
NM_015609chr1102839 2789 2562 2165 1164 958 807 772 315 49 1606 32713 762 324 --
NM_015610chr752662 2157 2093 714 528 42733 2608 1766 589 ----
NM_015627chr161537 1472 1334 1169 407 80 11523 ----
NM_015640chr155301 4932 4221 3775 1983 13490 ----
NM_015651chr972043 2027 2004 1918 757 362 122 11977 22020 792 12083
NM_015652chr102239 227 ------
NM_015675chr192437 427 ----1485
NM_015686chrX51961 1857 1623 972 826 11587 --21543 522
NM_015695chr63339 316 276 11794 ----
NM_015713chr813070 ----13048
NM_015726chr141487 1397 347 52 21612 532 ----
NM_015872chr161612 1365 665 392 281 93 1359 11666 --
NM_015874chr4--196 ----
NM_015879chr18107846 6706 6509 6493 6358 6344 3244 3187 1710 617 37569 6080 978 12078 --
NM_015881chr111412 1202 ----
NM_015885chr111657 ------
NM_015888chr163018 3011 2506 2274 1332 1000 ------
NM_015904chr22773 258 ------
NM_015906chr143992 3625 1395 339 ------
NM_015912chr81228 ----21840 286
NM_015916chr10140 --1143 --
NM_015976chr12236 116 ------
NM_015995chr15145046 4972 4870 4549 4346 3462 2171 1715 1404 1385 1289 1079 631 541 22123 1685 1862 --
NM_016003chr752662 2157 2093 714 528 42733 2608 1766 589 ----
NM_016009chr164305 3443 1918 1526 1306 521 12999 13610 --
NM_016018chr842742 585 535 393 ------
NM_016019chr7--1303 ----
NM_016025chr162796 97 --21325 642 --
NM_016032chrX51226 454 346 326 240 ------
NM_016057chr1221090 390 2817 201 1867 --
NM_016061chr211179 --2380 306 --
NM_016072chr1232081 1714 1531 1708 ----
NM_016076chr152520 2385 574 232 170 ------
NM_016078chr171803 ------
NM_016083chr653952 3592 3073 2514 994 ------
NM_016089chr352106 2081 1963 1784 393 ------
NM_016096chr82629 151 ------
NM_016106chr14133 ------
NM_016120chrX21111 979 ------
NM_016131chr211984 12274 ----
NM_016132chr1532683 2500 1046 ------
NM_016162chr121673 --2578 50 1771
NM_016166chr15149 ------
NM_016169chr10123184 3054 2571 2365 2142 2087 2064 1012 965 859 742 647 23202 2903 --1912
NM_016185chr172645 178 --1325 --
NM_016205chr441176 514 446 424 ------
NM_016206chr398075 7759 7746 7233 2745 2415 2062 1230 800 38892 2689 1948 12620 11074
NM_016224chr652067 1400 657 586 490 1890 149 11876
NM_016231chr1711141 157 1514 --
NM_016246chr19----121 --
NM_016250chr144738 706 692 618 ----160
NM_016255chr653202 2587 2268 432 69 ----23004 2616
NM_016260chr241637 1201 388 229 1837 15449 --
NM_016272chr2252598 2197 2100 1844 902 11914 ----
NM_016277chr621599 1425 ----11319
NM_016289chr242326 1813 661 393 ------
NM_016315chr221844 1244 ------
NM_016339chr1751672 531 287 44 37 ------
NM_016357chr121114 11037 ----
NM_016374chr121201 137 1219 ----
NM_016374chr121201 137 1219 ----
NM_016422chr1121033 697 22242 1197 --13161
NM_016427chr181107 --132 --
NM_016436chr2032236 2058 38 1225 1125 22354 2322
NM_016441chr232327 1820 365 ------
NM_016448chr121792 170 ------
NM_016485chr652201 1684 759 751 100 ------
NM_016507chr172723 527 12153 --1910
NM_016522chr1111202 11559 ----
NM_016526chr11112415 1973 1945 1903 1710 1599 1581 848 780 579 225 1538 ----
NM_016530chr1532945 723 634 ------
NM_016531chr44759 548 239 43 ------
NM_016575chr1265104 4773 3443 3356 1543 805 1282 14134 15093
NM_016577chr372988 1640 1377 1001 912 508 499 24194 3510 23453 1543 --
NM_016596chr125933 791 414 173 82 3747 678 39 ----
NM_016598chr331397 1357 377 ----11023
NM_016603chr541593 1568 124 70 ------
NM_016621chr1194266 4143 3971 3795 3774 3597 3463 1735 350 --23046 1237 --
NM_016626chr182392 277 --1717 --
NM_016651chr142820 783 ------
NM_016734chr961997 1947 1287 574 518 159 3782 723 349 41834 1535 1465 1353 21646 1418
NM_016821chr33343 194 39 188 172 --
NM_016834chr17133911 3610 3519 3427 3246 3093 2822 2771 2744 1522 1061 456 364 33064 1097 1036 --1989
NM_016835chr17133911 3610 3519 3427 3246 3093 2822 2771 2744 1522 1061 456 364 33064 1097 1036 --1989
NM_016841chr17133911 3610 3519 3427 3246 3093 2822 2771 2744 1522 1061 456 364 33064 1097 1036 --1989
NM_016929chr653516 1575 1406 841 651 13248 31275 508 250 --
NM_016936chr1642050 1634 216 36 --130 --
NM_016937chrX1307 1107 ----
NM_016938chr113441 382 326 --1161 --
NM_016946chr1103586 3197 2250 1298 867 505 393 350 272 215 --21430 1279 12963
NM_016950chr4--1330 1401 --
NM_017412chr81168 --11375 --
NM_017415chr544428 3890 3409 136 41576 781 515 96 ----
NM_017423chr432203 410 115 ------
NM_017432chr193364 148 96 1295 ----
NM_017440chr121141 ------
NM_017447chr2133660 1427 750 14381 ----
NM_017449chr141667 676 497 384 51455 544 373 314 223 11207 --
NM_017450chr1731084 927 99 21209 1141 1955 --
NM_017456chr1781768 1716 1682 1599 630 618 582 564 --21803 538 --
NM_017457chr194178 71 64 47 ------
NM_017459chr12131 67 137 2262 43 --
NM_017522chr1----11046 --
NM_017548chr321460 749 --21716 481 --
NM_017551chr1062231 1719 968 562 554 319 ------
NM_017554chr31199 2692 431 ----
NM_017563chr395946 5370 5113 4023 3949 1755 1645 459 88 ------
NM_017582chr141697 691 621 602 21436 1315 --21423 522
NM_017590chr2272267 892 526 427 353 271 32 22247 1018 22253 219 12425
NM_017592chr1971811 1075 870 802 551 276 71 --21876 560 11763
NM_017594chr942743 1270 557 478 21314 240 ----
NM_017596chr1194206 4022 3982 3958 3801 3787 3645 3472 3392 1506 1310 1144 943 775 673 622 315 261 143 43717 3695 3188 3130 ----
NM_017602chrX2807 602 ------
NM_017612chr121226 --1204 --
NM_017634chr841927 1286 456 271 ------
NM_017635chr11--11453 --126
NM_017637chr998729 7930 7866 7840 7829 7356 6101 1462 1096 17075 48621 8605 8552 88 18803
NM_017643chr1722817 2454 ------
NM_017650chr7115049 4891 4871 4273 4061 2086 2019 1363 936 704 308 ------
NM_017666chrX41904 1392 592 31 ----11433
NM_017693chr1321370 237 ------
NM_017709chr1104199 4039 3915 3743 3572 3533 3072 2693 1532 618 --13064 1413
NM_017736chr1613101 --138 --
NM_017741chr432321 2155 425 ----22273 2241
NM_017742chr1811266 --11691 --
NM_017745chrX1262 ------
NM_017752chrX3819 685 422 --1730 --
NM_017763chr174906 451 369 59 2838 80 --11133
NM_017772chr621569 181 21479 227 11222 --
NM_017786chr81190 --1491 --
NM_017787chr1042836 1111 108 30 ----12090
NM_017789chr23659 552 174 1107 ----
NM_017790chr9150 ------
NM_017811chr931107 765 71 12509 ----
NM_017824chr101978 1776 22129 258 --
NM_017848chrX43698 1820 1688 1302 33167 285 167 ----
NM_017849chr272607 2570 2366 1066 1013 971 444 13027 ----
NM_017873chr982586 2489 2258 2114 1238 833 573 398 --12901 198
NM_017902chr10135745 4894 4223 4201 3794 3615 2160 1952 1936 1785 1085 907 381 31514 1416 703 1481 --
NM_017913chr9157 1338 ----
NM_017919chr985715 4170 2198 2151 1048 968 775 201 13684 15661 --
NM_017933chr211061 ------
NM_017938chrX2845 391 ------
NM_017944chr1122929 27 12736 --11902
NM_017952chr244447 3926 1752 894 14325 ----
NM_017983chr171147 ----1452
NM_017988chr121706 ------
NM_018003chr1542083 1788 456 79 ----11739
NM_018010chr321599 252 11368 ----
NM_018028chr192293 38 ----1942
NM_018045chr192852 2810 2774 2668 2504 887 485 381 254 22248 2230 ----
NM_018050chr121221 --1289 1262
NM_018061chr131599 1452 1172 ------
NM_018084chr233188 2752 2429 ------
NM_018098chr3192 ------
NM_018103chr11281 ------
NM_018121chr1043064 2324 849 353 ------
NM_018125chr13494 488 101 1455 1122 --
NM_018128chr1741233 1224 1138 440 11066 --11342
NM_018155chr32472 168 ------
NM_018156chr172902 2721 2341 2138 1205 1190 938 1650 12854 --
NM_018182chr1712167 --11890 --
NM_018184chr31335 --11582 --
NM_018191chr1341354 350 320 37 --1449 1128
NM_018195chr1122139 195 --1315 --
NM_018198chr161431 1389 1085 1038 518 224 150 --1998
NM_018206chr161188 ------
NM_018207chr151641 1526 615 494 77 21302 32 21691 1546 --
NM_018208chr161122 1033 962 788 774 444 3368 324 157 ----
NM_018211chr121675 704 ------
NM_018234chr292268 2158 2137 1866 814 774 602 589 560 2781 133 1541 --
NM_018241chr4150 175 ----
NM_018244chr202983 129 ------
NM_018247chr632606 716 81 ------
NM_018287chr101416 ------
NM_018313chr332567 338 274 --12149 --
NM_018315chr41130 --11040 --
NM_018362chr1143794 3642 2851 2816 ------
NM_018364chr143901 2563 924 476 --1997 --
NM_018373chr14126285 6233 5574 5197 4066 2454 1537 1413 1365 1014 806 211 1403 36102 4308 445 11489
NM_018374chr754945 3941 3924 1134 888 14700 ----
NM_018388chrX------11013
NM_018409chr432745 2415 110 ------
NM_018416chr122510 49 32581 2183 1046 ----
NM_018425chr1072419 2002 1904 1871 1854 1617 53 31740 988 244 ----
NM_018433chr21504 ------
NM_018440chr8117796 6625 6394 6225 5981 5597 2020 1614 1288 611 22 13403 22797 604 16346
NM_018444chr841942 1688 656 297 --11456 --
NM_018445chr151208 ------
NM_018447chr3135 ------
NM_018449chr92200 42 ----1533
NM_018462chr31577 2811 292 1161 --
NM_018489chr1172 --21671 103 133
NM_018490chr1121731 106 ----182
NM_018534chr24597 549 396 167 ------
NM_018566chr155022 1919 1614 1546 56 ------
NM_018584chr14486 364 196 137 ------
NM_018638chr1224013 1550 22182 2162 14118 --
NM_018640chr1232366 1787 262 ------
NM_018667chr1692225 1774 1022 780 512 167 141 90 56 11781 1806 --
NM_018711chr123654 119 46 11475 ----
NM_018717chr482890 2642 1810 1099 993 880 513 315 1719 ----
NM_018836chr13948 827 28 ------
NM_018841chr163643 3409 3336 1310 1261 220 1823 1268 --
NM_018898chr5--2734 391 ----
NM_018899chr5--2734 391 ----
NM_018900chr5--2734 391 ----
NM_018901chr5--2734 391 ----
NM_018902chr5--2734 391 ----
NM_018903chr5--2734 391 ----
NM_018904chr5--2734 391 ----
NM_018905chr5--2734 391 ----
NM_018906chr5--2734 391 ----
NM_018907chr5--2734 391 ----
NM_018908chr5--2734 391 ----
NM_018909chr5--2734 391 ----
NM_018910chr5--2734 391 ----
NM_018911chr5--2734 391 ----
NM_018945chr633027 655 112 12406 --12979
NM_018959chr193506 102 76 1525 ----
NM_018963chr211178 ----1576
NM_018970chr742907 2867 2495 553 1750 ----
NM_018976chr1232440 962 324 12175 12767 --
NM_018977chrX3888 789 319 --1869 1407
NM_018999chr1024532 670 ------
NM_019000chr531583 1410 442 ----1521
NM_019001chr314171 1918 ----
NM_019004chr721574 711 ------
NM_019022chr1822627 311 --12787 --
NM_019027chr41878 ----12359
NM_019041chr642286 2128 969 865 ------
NM_019058chr101617 --1725 1589
NM_019064chr172833 310 1246 ----
NM_019066chr151126 ------
NM_019083chr131220 464 273 ------
NM_019084chr1021949 736 2769 170 2599 340 --
NM_019096chr651002 451 258 240 165 ------
NM_019106chr2233213 2162 510 1533 2956 335 --
NM_019114chr932412 2314 21 ------
NM_019116chr1693503 3448 3201 3186 2398 888 873 707 639 ------
NM_019117chrX42853 1283 965 411 12248 ----
NM_019555chr32542 501 ------
NM_019593chr202174 48 12118 ----
NM_019595chr22293 75 ------
NM_019596chr2152851 1900 1818 723 683 1175 --1628
NM_019610chr152072 1510 1455 1363 302 1592 22149 1859 --
NM_019613chr17184 1885 1326 11075
NM_019850chr22119 113 176 ----
NM_019857chrX3696 636 429 21648 1511 1527 --
NM_019859chr10--21006 108 ----
NM_019860chr1011041 21054 156 ----
NM_019885chr292550 2196 2182 791 665 613 513 463 399 22021 245 ----
NM_019891chr11522 ----11191
NM_020116chr41118 ------
NM_020117chr5--1920 --1952
NM_020122chr285589 5045 5024 4949 4784 4392 4017 72 12027 1586 13696
NM_020123chr101365 11216 1513 --
NM_020133chr6126079 5307 4141 2474 2406 2293 2000 1843 1248 828 463 36 12468 ----
NM_020137chrX3453 339 61 1108 ----
NM_020144chr71523 11982 ----
NM_020159chr421732 45 ------
NM_020168chr151847 1886 11266 11035
NM_020179chr111358 1170 ----
NM_020194chr21613 ------
NM_020198chr172181 108 ------
NM_020204chr12679 162 ------
NM_020205chr152522 536 361 284 118 23013 885 ----
NM_020208chr362889 2672 2137 1022 853 804 2564 162 12924 32852 2728 2355
NM_020231chr31120 --1500 --
NM_020235chr31291 ------
NM_020239chr14366 336 303 150 ------
NM_020246chr73292 151 145 1109 ----
NM_020248chr1102255 2244 2176 2130 2109 1751 736 719 325 63 21560 523 11611 --
NM_020310chr17132787 2443 2416 2244 2186 1033 978 865 805 771 591 479 194 22274 1857 ----
NM_020338chr10102669 2396 2369 1442 1416 1282 955 792 704 241 22520 564 --175
NM_020341chr201210 1774 ----
NM_020342chr21716 ------
NM_020346chr111603 ------
NM_020348chr1052577 2443 2363 1772 635 2312 266 11838 --
NM_020362chr16685 645 607 253 238 147 ------
NM_020383chr101264 ------
NM_020438chr981016 986 962 527 513 212 197 36 --1291 --
NM_020440chr131084 574 128 ------
NM_020443chr1116965 6785 5674 5283 2032 1429 940 499 322 313 273 34607 2710 2393 56949 6176 5625 1629 415 11795
NM_020456chr132912 72 ----12326
NM_020474chr181686 ------
NM_020526chr181780 1724 1685 681 648 584 253 153 1179 11632 --
NM_020640chr33624 498 205 11469 ----
NM_020647chr821698 160 3609 226 197 ----
NM_020651chr2------1170
NM_020672chr15567 480 168 51 23 ------
NM_020673chr2097521 7436 6628 5127 2951 2204 1234 1136 624 15303 ----
NM_020689chr2041150 1113 618 187 ------
NM_020699chr1125040 5026 4991 4471 4370 3669 1970 1945 1430 845 719 297 12088 14379 --
NM_020708chr2031899 326 224 --11988 11557
NM_020713chr20142852 2748 2440 2189 2181 1242 952 897 788 710 579 438 412 275 --21001 198 --
NM_020717chrX104937 4886 4594 1820 1783 1592 1307 1096 469 180 --14250 --
NM_020718chr1655901 5055 4977 2391 1240 34755 1657 757 ----
NM_020734chr1233025 2273 2150 ------
NM_020742chrX32650 2034 1887 ------
NM_020750chr671301 1046 576 540 511 251 115 ------
NM_020752chr10--1709 ----
NM_020766chrX44546 3437 3380 752 ------
NM_020769chrX3754 393 152 ------
NM_020772chr17107539 7306 7284 6350 2372 2326 1530 832 735 620 --28316 368 --
NM_020774chr1844781 1923 1905 1461 --1869 15041
NM_020783chr181520 186 ----
NM_020791chr171185 --188 --
NM_020792chr331894 889 746 ----12819
NM_020795chr1772018 1798 1548 1542 1485 715 73 1519 21847 198 --
NM_020804chr682474 2266 2049 2043 1880 389 205 182 1549 --12089
NM_020806chr141595 ------
NM_020808chr12356 300 ------
NM_020809chr1111594 ----193
NM_020813chr1982034 1987 1151 871 551 469 445 220 21168 919 --2701 304
NM_020814chr271252 1212 513 435 261 129 116 ------
NM_020830chr21504 ------
NM_020845chr12102425 1939 1784 1014 982 925 918 724 672 70 21758 101 ----
NM_020850chr16123213 2910 2740 2715 2373 2362 2093 1154 962 794 520 124 --12662 --
NM_020854chr18--11358 1985 --
NM_020858chr1511559 --11795 --
NM_020871chrX1362 --11700 --
NM_020886chr113970 903 465 21082 84 ----
NM_020888chr131865 786 157 1507 11330 11698
NM_020899chr1752213 1980 847 471 275 32380 182 89 1120 1509
NM_020918chr1053597 2815 2707 725 419 12662 1208 --
NM_020920chr14128 ------
NM_020925chr121174 464 ----137
NM_020933chr192654 351 ----1118
NM_020946chr9111771 1565 1523 1503 1438 1320 643 528 511 487 177 1202 1626 1617
NM_020948chr123172 2953 --1632 --
NM_020956chr19144784 4355 4145 3792 3200 1217 1027 659 642 633 504 423 360 291 ------
NM_020962chr1562192 2118 1552 810 606 497 ----1597
NM_020964chr18104316 3977 3921 3873 3461 3114 1637 1423 730 212 21148 690 23819 268 --
NM_020974chr111168 ----1518
NM_020977chr431687 68 59 11801 --1419
NM_020981chr23831 631 523 1312 ----
NM_020983chr12112226 2138 2079 1931 1915 1907 1534 1492 567 504 362 21442 409 1228 --
NM_020993chr1252703 741 600 224 90 ------
NM_021003chr141680 ------
NM_021012chr17123041 2867 2530 2522 2193 2106 1205 1057 611 423 242 101 2950 630 1383 --
NM_021020chr8173394 3287 3215 3194 3148 3137 2858 2814 2617 2155 1282 1194 1098 794 679 34 27 1112 11022 12988
NM_021033chr1332442 2353 947 ------
NM_021038chr313310 ------
NM_021088chr231915 1497 787 ------
NM_021090chr22145014 4950 4326 3975 3242 1805 1564 1381 1180 896 890 775 742 520 11087 2877 65 --
NM_021096chr22153152 3092 3010 2736 2672 2501 2011 1211 1171 1163 986 948 742 356 154 22164 383 11323 198
NM_021097chr232907 2140 683 1961 1515 --
NM_021116chr7258697 8109 7811 7291 6743 6578 6497 6326 6184 5865 3383 3279 3240 3128 2849 2791 2073 1745 1682 1310 818 607 548 488 23 38420 3347 532 12801 --
NM_021129chr102325 50 ------
NM_021132chr101235 1169 ----
NM_021133chr131699 583 72 ------
NM_021140chrX2969 314 ------
NM_021155chr1952975 2743 2666 864 305 169 ----
NM_021159chr431643 602 293 1439 ----
NM_021163chr723440 1375 11270 ----
NM_021192chr2186 ------
NM_021215chr2052216 950 637 396 200 1914 --11820
NM_021222chr121052 109 --11432 --
NM_021224chr9168 ------
NM_021242chrX1300 1227 --1381
NM_021252chr101370 1474 ----
NM_021255chr1443135 936 834 284 --1544 --
NM_021259chr167982 967 876 266 252 246 72 1735 ----
NM_021572chr621078 267 179 ----
NM_021619chr931306 268 39 3836 505 250 ----
NM_021627chr331061 866 792 --1166 --
NM_021629chr354698 3275 3086 746 38 ------
NM_021637chrX2210 98 ------
NM_021638chr493382 1515 1428 1241 1085 930 880 814 378 14004 13165 --
NM_021639chr12743 351 ------
NM_021643chr221336 86 1250 2520 271 11252
NM_021647chr454625 3052 1254 1056 912 11768 ----
NM_021649chr51683 --11852 --
NM_021729chr111303 --164 --
NM_021809chr2072414 2392 2023 656 318 309 46 21899 290 11845 --
NM_021813chr665008 4756 2224 1844 1762 1421 25126 4670 ----
NM_021905chr662264 920 296 142 124 55 ------
NM_021911chr52828 73 15488 ----
NM_021912chr1543770 3467 2651 776 --13897 --
NM_021914chr1421969 23 ------
NM_021945chr683095 2427 1416 1079 375 311 45 35 22437 335 22719 1392 --
NM_021946chrX51292 1246 1227 1204 1196 21107 1087 1337 --
NM_021949chrX52730 2642 2223 2030 1864 ------
NM_021954chr13103436 3034 2609 1248 1235 430 405 364 306 285 ------
NM_021956chr611061 ------
NM_021960chr122409 2262 ----1985
NM_021961chr1176997 6918 5903 5878 5435 2911 2458 12280 ----
NM_021962chr1782271 2153 1905 1882 1736 769 564 52 11845 ----
NM_021964chr336421 4750 1077 35269 4946 2258 12562 --
NM_021965chr931239 888 408 11197 --11106
NM_021998chrX1473 ----154
NM_022003chr11--31138 840 508 --1515
NM_022048chr1562491 1683 568 511 259 32 --21228 473 11845
NM_022060chr1471373 1276 1263 1246 1003 914 345 ------
NM_022062chr1181834 1526 1506 1497 1473 773 737 278 --11659 --
NM_022085chr621323 1008 11188 ----
NM_022091chr622505 665 ------
NM_022114chr183326 3317 3243 1525 1111 1053 778 617 21311 600 ----
NM_022130chr511041 ------
NM_022143chr7--21062 223 ----
NM_022152chr26970 926 911 176 79 32 ------
NM_022153chr10153535 3473 3328 3315 3115 3107 2885 1433 1377 1329 1209 702 505 119 40 43604 884 777 342 32310 1027 602 13051
NM_022166chr16125540 5337 4939 4388 4347 4339 2369 1856 805 702 454 91 ----14661
NM_022169chr1161322 1300 990 565 387 165 2333 174 187 --
NM_022171chr371441 1168 1162 1028 990 630 280 --1217 1582
NM_022371chr12268 225 155 ----
NM_022405chr362889 2672 2137 1022 853 804 2564 162 12924 32852 2728 2355
NM_022444chr72489 425 ------
NM_022459chr1336188 1661 169 15047 ----
NM_022462chr19153372 3139 2612 2472 1310 1244 974 665 638 555 490 376 277 262 190 1217 23354 179 --
NM_022465chr1252221 2058 1171 769 547 1534 12107 --
NM_022469chr142320 963 613 102 11093 ----
NM_022473chr1564154 1525 1365 1141 955 145 21651 238 1769 --
NM_022477chr2031185 1160 136 21637 1592 ----
NM_022491chr1253563 2615 2392 613 487 --23481 848 13066
NM_022497chr393468 2723 2645 2516 1216 1050 476 381 250 ------
NM_022552chr211276 ----11027
NM_022566chr152472 179 ------
NM_022648chr2104192 3417 1740 1334 1256 1214 897 805 235 224 22968 351 23727 1459 13954
NM_022652chr121366 ----1859
NM_022659chr82150 123 1204 ----
NM_022716chr113038 22687 207 ----
NM_022719chr22133193 2905 1324 950 941 751 664 576 550 487 315 265 97 ------
NM_022726chr6192 ------
NM_022735chr121395 220 11761 ----
NM_022745chr132980 2172 570 1954 12277 --
NM_022753chr142463 2426 1956 1885 ------
NM_022755chr942431 2238 1614 845 1256 ----
NM_022758chr663138 3100 2911 2623 2302 2251 1914 --12724
NM_022781chr942854 2612 808 562 ------
NM_022810chrX----1324 --
NM_022824chr52603 338 --1616 --
NM_022831chr111224 1199 ----
NM_022836chr1--21230 576 ----
NM_022843chr131398 ----1298
NM_022893chr223068 1166 ------
NM_022894chr21320 ------
NM_022898chr1434553 4279 905 23488 839 ----
NM_022913chr5----1218 --
NM_023000chr1421083 419 ------
NM_023001chr1421083 419 ------
NM_023009chr15715 557 182 75 69 --1461 --
NM_023012chr121701 ----1498
NM_023035chr191200 1812 ----
NM_023076chr1672514 2499 2168 2043 1088 1040 288 22288 2200 --11157
NM_023079chr1751544 1244 441 407 394 --1204 --
NM_023923chr1113692 3515 2749 2495 2378 1423 1254 957 878 814 663 1114 --11375
NM_023929chr832243 2186 2086 ------
NM_024007chr522596 676 ----11228
NM_024016chr171223 ------
NM_024019chr41365 1284 ----
NM_024034chr202810 95 1365 ----
NM_024052chr172652 39 ------
NM_024076chr1962133 1689 1634 795 746 540 --21915 632 1153
NM_024086chr1793447 2863 2699 1525 1314 832 601 566 338 ----22817 524
NM_024104chr1941023 1011 751 400 ------
NM_024294chr663138 3100 2911 2623 2302 2251 1914 --12724
NM_024306chr162467 203 ------
NM_024345chr976107 5796 5127 1097 853 508 155 ------
NM_024509chr191172 ------
NM_024511chr453075 2490 2246 2182 851 --12813 13467
NM_024522chr1111435 1373 1294 452 417 176 170 164 152 138 37 ------
NM_024525chr12494 212 ------
NM_024539chrX2433 389 ------
NM_024541chr1081830 1640 1399 1321 1267 646 447 153 31692 1632 1303 ----
NM_024548chr311635 ----11511
NM_024551chr1232111 2075 1593 21968 253 --11573
NM_024551chr1232111 2075 1593 21968 253 --11573
NM_024554chr14658 546 154 94 21343 115 11240 1397
NM_024556chr112396 177 ------
NM_024594chr531499 1431 149 2753 629 ----
NM_024595chr141229 894 412 253 21149 863 --1924
NM_024631chr11----1161 --
NM_024639chr61440 22783 915 1572 12749
NM_024674chr172684 2178 637 591 303 218 121 13226 ----
NM_024740chr1153891 3411 3279 392 136 23699 2766 33567 1571 127 --
NM_024742chr16111918 1872 1506 1417 1333 1283 1273 1248 414 341 229 21708 732 --11463
NM_024744chr211685 ----11055
NM_024770chr276447 5648 4699 4112 2168 1368 731 --16650 --
NM_024780chr1641071 905 369 189 --1220 11023
NM_024785chr251432 1194 508 103 61 183 11452 --
NM_024792chr1731064 431 79 2470 287 ----
NM_024798chr1572157 1183 1172 952 831 153 90 12407 ----
NM_024811chr1151470 1434 1251 775 737 11588 ----
NM_024824chr1441626 1500 1125 96 ------
NM_024841chr1131980 875 283 1534 ----
NM_024852chr12688 512 ------
NM_024855chr203613 136 43 --1191 --
NM_024874chr121216 423 1137 11293 --
NM_024884chr1494193 3204 2954 2823 1080 798 629 416 295 --1718 --
NM_024887chr131791 1578 1463 21879 175 --1543
NM_024899chr181103 1513 ----
NM_024909chr61110 21535 572 1580 1159
NM_024928chr10--1141 ----
NM_024947chr3118208 7458 6962 6652 3809 2915 2179 737 703 563 75 17921 18467 --
NM_024949chr443048 555 350 235 34032 3153 697 14018 --
NM_024953chr1262645 1111 589 556 506 76 1451 1209 11986
NM_024963chr7315520 5497 5364 5269 5099 4846 4590 4352 3955 3807 3742 2390 2259 2228 1808 1709 1565 1503 1458 1299 1170 1004 784 596 334 314 279 273 209 134 126 53602 2355 2308 763 58 35745 4555 1860 45395 4798 1122 550
NM_024969chr24735 578 105 68 ------
NM_024989chr248191 7085 2335 1454 11116 ----
NM_025040chr1931548 1514 733 ------
NM_025061chr1951075 774 211 172 141 --1158 --
NM_025073chr154152 3952 892 604 549 1248 ----
NM_025077chr1--1226 ----
NM_025090chr176939 385 334 305 200 136 ------
NM_025138chr131410 --1391 --
NM_025146chr322693 1966 ------
NM_025160chr123814 3225 164 12877 --
NM_025179chr1134243 4013 4007 3834 3639 3034 1861 1254 1033 1021 975 667 127 125 11304 24119 3403
NM_025182chr951039 961 839 315 215 ------
NM_025187chr1661243 1168 858 556 449 98 --1335 --
NM_025191chr143475 2636 2535 156 ------
NM_025222chr352506 803 761 545 416 ----12426
NM_025230chr1491719 1543 1407 721 522 492 287 209 125 1613 1253 11663
NM_025236chr61160 184 1539 1694
NM_025248chr1782882 1979 1266 1247 733 714 630 427 1835 --22043 1042
NM_025250chr793031 2793 2571 2487 2375 2274 1865 1169 186 21093 984 173 --
NM_030576chr17102657 2618 2548 2292 2180 2124 1914 1714 987 39 2573 277 ----
NM_030621chr1412907 ------
NM_030627chr533876 1653 819 12769 ----
NM_030629chr163649 132 83 2578 448 ----
NM_030634chr131702 1674 293 12028 ----
NM_030640chr123932 819 642 ------
NM_030645chr151123 1079 898 354 82 21173 126 11163 --
NM_030647chr763977 1474 1346 190 85 61 14271 54381 2126 1966 1835 899 --
NM_030648chr495493 5204 5070 4680 4489 4444 1663 43 30 --13862 --
NM_030650chr274261 3795 3534 1554 904 842 397 11484 14072 13506
NM_030665chr1741239 454 448 349 ------
NM_030759chr103276 218 117 ----1154
NM_030766chr121278 11012 1804 1355
NM_030786chr151461 767 754 677 112 --21913 1846 1336
NM_030806chr1159179 8871 8534 7952 7603 7458 7263 7236 6357 6276 6244 3188 2686 1421 820 28523 2206 37226 3313 2274 29021 1655
NM_030808chr1731047 279 77 --1979 --
NM_030810chr621323 1008 11188 ----
NM_030881chr2221946 1847 12298 1767 11994
NM_030884chr372016 1807 1687 1571 553 357 257 11497 ----
NM_030914chr97974 944 895 755 303 64 21 ------
NM_030918chr1145180 5163 4701 4634 4554 4502 4379 4284 4005 3827 3636 3346 1981 1914 24197 472 21102 484 --
NM_030920chr141689 1610 528 35 ----1835
NM_030925chr1361969 1557 1524 1474 278 129 21822 86 ----
NM_030938chr17--21152 873 1887 --
NM_030958chr81374 ------
NM_030962chr111434 --21368 318 --
NM_030963chr6----1192 --
NM_030964chr582983 2690 2380 1494 795 544 41 33 22970 433 22859 1028 22899 589
NM_030965chr11694 --1553 --
NM_030978chr91422 ------
NM_030981chr1171112 1099 901 833 475 124 91 --11179 1461
NM_031157chr121459 ------
NM_031262chr91849 ------
NM_031263chr91906 ------
NM_031268chr16164977 4778 4285 4080 3642 3367 2142 2093 1834 1789 1709 1406 1396 756 569 326 11664 11176 --
NM_031305chr431848 1677 92 ------
NM_031371chr121201 137 1219 ----
NM_031371chr121201 137 1219 ----
NM_031411chr5--2734 391 ----
NM_031412chr1231180 277 33 --2454 40 --
NM_031417chr1952794 2718 2521 623 430 --1668 --
NM_031419chr32560 21 1437 --1221
NM_031442chrX41291 1280 707 618 1601 23108 2010 --
NM_031445chr273378 3174 2796 2439 1325 839 421 ------
NM_031453chr1022108 331 --1151 --
NM_031459chr141427 1235 1179 228 31099 211 191 11550 --
NM_031461chr812013 1614 ----
NM_031468chr7105957 4991 2801 2528 2101 2079 1836 1649 987 674 37454 6375 3181 --17781
NM_031483chr2063184 2999 2783 1420 827 450 22354 778 --1315
NM_031844chr163453 3435 3343 667 609 322 11406 12960 --
NM_031845chr233383 2813 541 ------
NM_031847chr233383 2813 541 ------
NM_031849chr5--2734 391 ----
NM_031857chr5--2734 391 ----
NM_031858chr1721289 1055 ------
NM_031860chr5--2734 391 ----
NM_031862chr1721289 1055 ------
NM_031866chr102335 187 ----1372
NM_031886chr1932122 1709 153 2998 366 12634 22074 973
NM_031890chr2292988 2801 2498 2211 2203 2197 764 595 148 1637 21015 542 --
NM_031891chr18----1156 --
NM_031911chr432763 1982 896 --144 --
NM_031936chr12189 140 --1224 1596
NM_032012chr965131 4848 3350 1683 683 150 1604 ----
NM_032013chr2031185 1160 136 21637 1592 ----
NM_032028chr52578 143 ------
NM_032047chr341870 488 432 47 ------
NM_032050chr222852 221 1361 137 --
NM_032052chr2231237 942 231 --2422 240 --
NM_032102chr111682 --141 --
NM_032121chrX41737 1033 867 339 ----11119
NM_032124chr1831119 1090 959 ------
NM_032144chr211674 1622 ----
NM_032147chr121794 ------
NM_032153chr332518 1021 185 11054 11001 --
NM_032154chr101161 1363 ----
NM_032182chr1011198 11045 21272 78 --
NM_032195chr212151 104 ------
NM_032199chr1033371 3199 1492 11198 1344 --
NM_032221chr2021328 272 ------
NM_032228chr1132947 2431 1395 ----12600
NM_032229chr1311139 1779 ----
NM_032239chr421205 994 1453 11326 --
NM_032242chr3112886 2842 2769 2636 2089 1100 1056 711 538 376 278 22880 767 21111 1008 12624
NM_032268chr1693111 2591 2460 2284 2185 1998 1983 1165 78 32637 949 96 ----
NM_032281chr1973121 2890 2676 2571 430 364 164 --12873 --
NM_032283chr1101752 1509 1338 1310 1225 1155 696 671 357 202 21775 1719 ----
NM_032289chr541598 775 186 82 ----21250 533
NM_032291chr111282 ----1108
NM_032294chr1781683 1677 1552 738 465 413 321 200 21183 621 1595 --
NM_032307chr92727 231 ----1316
NM_032312chr21308 ----1186
NM_032316chr3162417 2336 2313 2251 2129 1915 1852 1600 1559 940 784 629 389 210 123 51 ----2862 417
NM_032320chr111527 ------
NM_032325chr1151749 1553 1417 360 55 ------
NM_032329chr2123909 3803 3672 3267 3251 3183 3064 2700 1639 1525 1251 325 1739 ----
NM_032364chr122851 265 ------
NM_032373chr1055877 5194 4643 4144 1342 14321 ----
NM_032434chr231132 1088 325 1507 11591 --
NM_032435chr132336 2238 211 --12039 --
NM_032438chr631411 444 265 ------
NM_032440chr1022327 1883 ------
NM_032457chr443739 3612 2577 425 ------
NM_032501chr2051460 1383 1280 1237 994 2325 26 ----
NM_032517chr101112 ------
NM_032536chr93589 555 467 1192 ----
NM_032538chr682606 1977 1862 1738 837 759 354 345 22166 548 ----
NM_032547chr42932 60 ------
NM_032560chr1411055 ------
NM_032569chr163549 506 346 21264 77 ----
NM_032631chr191123 ------
NM_032632chr1451904 1858 1382 625 290 ------
NM_032638chr351104 1079 443 374 366 ------
NM_032682chr342964 2637 1338 1200 ----1257
NM_032711chr17114243 3630 3362 3339 2763 2613 1537 1495 1454 1172 537 13404 11310 --
NM_032737chr19102514 2332 2294 1992 1740 1055 791 578 443 293 12152 1709 --
NM_032784chr63945 701 301 ------
NM_032786chr122495 468 1503 ----
NM_032800chr162524 2242 2177 2032 1779 1691 ----22502 2422
NM_032808chr155886 768 728 722 54 --2317 206 --
NM_032828chr19134763 3879 3273 1943 1931 1792 1485 1419 1286 880 553 425 224 --1215 13831
NM_032832chr6123 11443 ----
NM_032833chr131685 583 118 ------
NM_032837chr1722068 776 11442 ----
NM_032838chr19--1135 --1473
NM_032859chr13--1181 1535 --
NM_032871chr1171544 1323 608 511 498 477 140 141 11766 --
NM_032873chr1151736 1669 798 407 290 ----12775
NM_032876chr145880 724 363 118 101 ----12074
NM_032885chr192309 138 ------
NM_032900chr1073702 3625 2762 2559 1530 1377 638 12970 13011 --
NM_032905chr1011189 ------
NM_032932chr17195936 5615 5141 4970 4573 3990 3949 2302 2249 2159 2039 1963 1841 1711 984 969 939 540 354 2418 40 45966 5809 1461 1453 --
NM_032947chr5--11177 170 --
NM_032951chr75228 123 80 54 38 1524 ----
NM_032953chr75228 123 80 54 38 1524 ----
NM_032998chr13849 186 67 1931 ----
NM_033020chr143992 3625 1395 339 ------
NM_033055chr121078 445 ------
NM_033129chr2031674 793 480 --1568 --
NM_033132chr1311874 ------
NM_033133chr1792795 2788 1340 1101 972 857 597 483 235 33167 2376 1061 --13309
NM_033136chr561157 581 425 419 238 197 ------
NM_033137chr561157 581 425 419 238 197 ------
NM_033141chr1462217 1658 1585 870 589 483 --1805 12169
NM_033181chr653952 3592 3073 2514 994 ------
NM_033207chr1082394 2022 1963 1780 524 399 69 30 11917 ----
NM_033211chr521543 819 --1180 --
NM_033224chr757073 5328 5162 675 410 15127 1402 25248 573
NM_033226chr163202 190 180 ------
NM_033274chr552942 2934 1441 692 382 23456 1184 22408 974 --
NM_033285chr834460 1702 1292 --13955 --
NM_033290chrX63700 3132 2853 2777 283 30 ----11456
NM_033300chr1----11046 --
NM_033315chr1761705 1568 1436 1352 778 377 1212 11955 --
NM_033316chr31139 --123 --
NM_033326chr1142501 2025 1659 708 ------
NM_033334chr9143 ------
NM_033360chr1234377 1859 383 --13131 --
NM_033375chr1731471 1439 1195 31377 1268 1222 1560 --
NM_033386chr224357 171 130 50 31114 1077 974 ----
NM_033401chr162434 140 ------
NM_033425chr11123082 2749 2471 1314 1089 722 638 335 217 175 166 35 --11178 --
NM_033426chr1462105 1840 710 524 174 149 1892 1541 --
NM_033429chr1572659 1219 1097 825 273 42 29 22858 997 12104 183
NM_033430chr422550 322 ------
NM_033437chr422550 322 ------
NM_033449chr551482 1448 832 495 270 1400 11396 11584
NM_033480chr652713 2615 2520 1888 237 1718 ----
NM_033481chr652713 2615 2520 1888 237 1718 ----
NM_033503chr15143729 3722 3370 3156 2963 2945 2934 2873 2675 2619 2518 723 713 197 53745 3621 2783 779 341 ----
NM_033505chr2116206 6016 5574 5541 4925 4505 2695 1916 1327 1094 117 26405 5969 15019 25218 152
NM_033512chr862996 2479 760 686 511 272 11053 ----
NM_033542chr2021653 52 21508 385 135 --
NM_033551chr5133245 3207 3091 3068 2852 2843 2714 1302 1009 492 322 176 105 1586 1524 12793
NM_033631chr193822 3277 2963 2811 2669 1494 1407 722 603 1836 ----
NM_033632chr41130 --11040 --
NM_033644chr532508 1698 349 22182 2087 1894 --
NM_033645chr532508 1698 349 22182 2087 1894 --
NM_044472chr12552 280 ------
NM_052818chr1341906 1834 1732 1671 --11870 --
NM_052827chr1221017 73 1148 ----
NM_052828chr641615 617 594 359 31220 1053 252 134 --
NM_052840chr1531416 1032 138 ----11129
NM_052845chr1282861 2039 1280 1231 1066 835 223 73 1943 22969 2124 12181
NM_052860chr54980 664 625 80 ------
NM_052877chr1145 ------
NM_052896chr142534 1856 1692 886 21839 752 ----
NM_052897chr122645 238 3818 605 61 ----
NM_052898chr841707 1561 1342 270 ----11600
NM_052906chr22274868 4834 4679 4543 4413 4343 3752 3676 3513 3323 3187 3143 2027 1863 1682 1588 1491 1477 1424 1390 1199 1181 1034 786 691 360 351 53739 3687 3422 3391 906 23605 3345 1707
NM_052907chr1263161 2944 2926 1681 626 250 1600 ----
NM_052911chr182822 764 ------
NM_052918chr1052714 2534 1363 1310 1120 --12739 --
NM_052925chr19----184 --
NM_052927chr522034 1448 ------
NM_052934chr1102100 1951 1647 1623 828 660 477 119 70 39 ----21673 48
NM_052937chr842722 1882 1873 936 ------
NM_052954chr2142172 827 185 46 ------
NM_052978chr141173 ------
NM_053016chr996844 6334 6219 6192 6162 5050 2231 2011 28 --15225 36764 5877 3196
NM_053023chr1131288 583 504 12779 ----
NM_053024chr331246 1163 501 ----11486
NM_053025chr331115 398 370 --1306 --
NM_053026chr331115 398 370 --1306 --
NM_053027chr331115 398 370 --1306 --
NM_053028chr331115 398 370 --1306 --
NM_053031chr331115 398 370 --1306 --
NM_053032chr331115 398 370 --1306 --
NM_053279chr892719 2710 2261 2225 1150 677 407 175 44 2774 115 2558 270 --
NM_053281chrX1286 ------
NM_054013chr56858 591 137 128 115 54 --1292 1715
NM_057161chr63459 196 96 ------
NM_057178chr1732773 55 45 2786 691 1295 --
NM_058170chr1------11164
NM_058172chr411124 ------
NM_058241chr2----11698 --
NM_058241chr2----11698 --
NM_080391chr1275 61 --1588 --
NM_080392chr12124 110 --1637 --
NM_080476chr202203 98 ------
NM_080491chr1183212 2996 2927 2920 2583 1451 1229 792 43516 1200 1023 164 13439 13542
NM_080544chr381320 1210 1195 1189 1166 1128 286 216 ------
NM_080546chr932143 2121 922 ----11775
NM_080552chr20--197 ----
NM_080607chr205835 806 410 230 209 --1417 --
NM_080625chr2031051 1038 446 139 1984 --
NM_080645chr631391 747 359 --1870 --
NM_080661chr115985 943 337 316 129 1292 ----
NM_080664chr1421460 123 ------
NM_080666chr1441495 1139 687 306 ------
NM_080676chr2053138 2967 737 515 37 --1667 --
NM_080679chr68859 669 663 634 220 171 111 46 --1199 --
NM_080680chr68859 669 663 634 220 171 111 46 --1199 --
NM_080681chr68859 669 663 634 220 171 111 46 --1199 --
NM_080732chr195490 420 206 121 57 --1343 --
NM_080737chrX4937 545 526 410 1426 --11456
NM_080738chr151852 1668 1637 1293 219 --11688 --
NM_080743chr642050 1873 1017 926 12521 1460 --
NM_080744chr75663 513 454 162 153 2119 36 1481 --
NM_080759chr1342602 1811 1002 447 ------
NM_080760chr1342602 1811 1002 447 ------
NM_080764chr2262601 2289 1139 959 216 194 ------
NM_080792chr20112317 2133 2125 1901 1792 1778 691 671 278 219 180 21667 119 --21878 259
NM_080867chr1435077 648 590 14489 ----
NM_080881chr53707 138 101 1508 ----
NM_130386chr18------1176
NM_130434chr151482 --1951 --
NM_130436chr2132185 2079 797 --1507 --
NM_130438chr2132762 2656 159 --11084 --
NM_130797chr721738 1336 1158 ----
NM_130830chr3133323 3244 2976 1383 1246 1063 881 874 700 602 258 235 79 13717 11273 21110 51
NM_130846chr122863 36 ------
NM_133170chr20156453 6353 5597 5371 5025 4999 2324 2152 1469 1247 1104 797 785 626 448 35321 1636 1043 ----
NM_133172chr52216 35 ------
NM_133173chr52216 35 ------
NM_133174chr52216 35 ------
NM_133264chr1773595 3171 2622 2561 1438 915 295 23100 747 ----
NM_133328chr193664 653 331 157 ----
NM_133329chr251590 1573 1526 1385 1156 ------
NM_133334chr4126011 5703 5209 4945 4923 4895 4303 4165 4029 1710 970 744 15018 ----
NM_133372chr532763 2153 2141 ------
NM_133433chr51570 ----1116
NM_133444chr1981761 1512 1462 1319 599 464 440 61 --11590 --
NM_133445chr953149 2987 2537 881 745 --13275 --
NM_133457chr761357 1347 1278 1164 1092 250 11365 --11226
NM_133468chr732223 1947 34 1498 12344 --
NM_133476chr121118 ------
NM_133647chr1522597 1295 ------
NM_134325chr171635 1486 1182 1158 565 363 195 --1484 11208
NM_134447chr191631 ------
NM_138270chrX23295 3011 ------
NM_138288chr1441676 1383 411 33 ------
NM_138300chr161621 1459 1212 1106 1064 173 2490 134 ----
NM_138335chr4----2671 175 --
NM_138370chr2--1314 2641 512 199
NM_138373chr1941328 1161 487 373 21746 546 ----
NM_138385chr461197 924 555 451 365 158 ----11248
NM_138396chr124928 710 336 185 ------
NM_138409chr661330 1144 1044 929 551 521 ------
NM_138413chr1031050 983 436 ------
NM_138426chr721598 541 ------
NM_138434chr741280 295 155 101 21119 386 ----
NM_138444chr13104541 4230 1647 1422 1184 989 884 568 479 189 ----24644 3152
NM_138453chr51220 1149 ----
NM_138468chr295859 5783 5152 5097 4742 3972 2439 2273 574 ----13893
NM_138473chr1243546 3210 1385 775 13642 11962 --
NM_138479chr151807 1632 1622 772 286 11770 --11560
NM_138493chr6140 ------
NM_138576chr1434553 4279 905 23488 839 ----
NM_138638chr1421969 23 ------
NM_138713chr1678155 7593 6455 5928 1877 1330 674 ----16229
NM_138714chr1678155 7593 6455 5928 1877 1330 674 ----16229
NM_138717chr61154 1632 ----
NM_138730chr6--168 ----
NM_138731chr1441602 1126 40 23 ----11665
NM_138771chr711167 ------
NM_138795chr161575 642 594 545 272 126 --21318 490 1446
NM_138799chr242083 1917 1593 341 ----22035 2003
NM_138927chr2111078 --1713 --
NM_138959chr1136821 6248 4949 4835 4805 4798 4780 4747 1311 987 968 725 698 36060 950 295 25789 4535 --
NM_138967chr1552357 2323 1794 1780 877 42223 2180 1931 475 1831 --
NM_138994chr162434 140 ------
NM_139057chr1561802 1108 840 702 478 137 ------
NM_139062chr171442 ------
NM_139068chr5--1200 ----
NM_139069chr5--1200 ----
NM_139070chr5--169 ----
NM_139071chr1241465 586 549 92 ------
NM_139131chr111527 ------
NM_139135chr111090 1134 ----
NM_139136chr122230 163 1981 ----
NM_139168chr521878 1584 ------
NM_139215chr17192 ------
NM_139242chr1571413 1328 1277 943 392 377 75 ------
NM_139276chr1742091 1887 1572 851 --21991 158 --
NM_139283chr1242574 2358 2092 562 ------
NM_139316chr7--1125 ----
NM_139321chr2064265 3710 3130 2851 2675 1292 23404 331 --33288 1600 1159
NM_139323chr2041841 1790 1315 450 ------
NM_144571chr456346 6190 5886 5739 1296 --35590 4924 2604 --
NM_144578chr1495314 5073 4960 4883 4839 3909 3796 487 156 --13719 --
NM_144579chr2152841 2734 2633 2594 2510 2492 2190 2059 1916 886 833 509 437 231 114 32776 2140 124 ----
NM_144582chr2132621 2609 2516 2328 2105 1946 1787 1040 999 583 360 152 53 1833 11601 --
NM_144586chr25949 904 873 103 86 ------
NM_144588chr1031450 1026 239 61273 1184 468 376 264 40 ----
NM_144599chr1554218 3597 947 263 212 14696 --11273
NM_144609chr1731209 473 223 ------
NM_144628chr2073049 2780 2447 2362 1060 321 204 31136 494 461 1197 --
NM_144649chr86828 652 374 279 76 49 ------
NM_144703chr2041120 847 445 161 --1794 --
NM_144767chr1554279 1506 1121 519 125 13551 13099 --
NM_144973chr1264935 3373 1955 1873 1093 177 13324 ----
NM_145008chr113176 108 98 2755 556 ----
NM_145011chr1021715 533 ------
NM_145013chr1162338 2325 2138 854 795 158 --1999 --
NM_145025chr651193 1046 828 304 155 ------
NM_145049chr51120 ------
NM_145055chr1853564 2803 1516 747 268 ------
NM_145056chr193598 256 233 1540 ----
NM_145071chr31183 1402 172 --
NM_145112chr1421007 269 ------
NM_145113chr1431279 541 84 ------
NM_145117chr1132846 2402 1116 --22083 155 --
NM_145166chr3122706 2681 2673 2638 1911 1098 868 810 412 347 99 36 42781 2308 2211 2174 22371 577 --
NM_145185chr1981811 1723 1622 688 518 488 289 66 ----198
NM_145203chr131158 ----1771
NM_145206chr1033271 2703 1078 12123 ----
NM_145239chr1631120 70 53 --1841 --
NM_145254chr161107 ------
NM_145284chrX32008 941 195 ----11791
NM_145341chr1031763 1324 609 ----21637 1605
NM_145349chr1792043 1577 898 579 381 334 315 211 131 ------
NM_145649chr652391 2133 924 463 126 12738 1202 --
NM_145655chr652391 2133 924 463 126 12738 1202 --
NM_145686chr232720 1330 58 1616 ----
NM_145687chr232720 1330 58 1616 ----
NM_145690chr821538 1523 11241 ----
NM_145714chr16----1287 --
NM_145735chr1332290 2068 553 11141 ----
NM_145753chr31344 ------
NM_145808chr722310 2062 ------
NM_145861chr151852 1668 1637 1293 219 --11688 --
NM_145912chr22194660 4249 3666 3624 3592 3422 3215 3064 2947 2898 1640 1633 1147 820 677 614 556 203 34 54421 3895 3880 3257 1878 --13016
NM_145913chr122800 668 --1743 --
NM_147147chr683609 3553 3475 3459 3402 3361 3076 1543 11133 ----
NM_147150chr983887 3448 3380 3070 2808 2525 882 341 33108 2852 38 11365 13016
NM_147156chr102343 137 1369 ----
NM_148414chr16----1370 --
NM_148415chr16----1310 --
NM_148416chr16----1287 --
NM_148571chr1731384 293 241 31637 1453 322 12071 --
NM_148918chr173286 231 29 2602 199 ----
NM_152222chr1171544 1323 608 511 498 477 140 141 11766 --
NM_152237chr2241223 1169 294 131 31620 238 102 21342 1191 11306
NM_152238chr12236 116 ------
NM_152244chr172936 128 1264 ----
NM_152253chr22123622 3574 3156 3109 2770 2721 1402 1348 1240 361 288 27 13097 23755 3130 --
NM_152263chr1125846 5650 5258 4778 4262 3859 3735 2226 1668 1214 255 97 21539 1433 13871 24182 1166
NM_152265chr121262 1145 ------
NM_152271chr8140 ----1911
NM_152277chr522038 307 ------
NM_152280chr111076 12760 ----
NM_152284chr81778 ----1353
NM_152287chr1682513 2500 2485 2366 2200 1895 436 36 32422 378 165 ----
NM_152305chr31120 11604 1500 --
NM_152342chr164485 385 377 194 ------
NM_152344chr1731322 1220 1036 --11101 --
NM_152352chr1832809 2352 915 ----12566
NM_152388chr231516 1296 642 13286 12790 --
NM_152424chrX114739 4672 3759 3160 3148 3118 1876 1319 777 621 545 11734 ----
NM_152437chr1242233 1934 936 830 1250 ----
NM_152440chr12----11020 --
NM_152442chr1221106 551 ------
NM_152470chr1873410 3258 2654 2602 1368 1200 218 33972 3117 998 ----
NM_152482chr1991547 1199 1152 1138 706 531 483 62 24 31584 1110 318 21702 1633 --
NM_152529chr243999 3311 435 76 11421 11470 1555
NM_152538chr331341 1269 147 1220 ----
NM_152546chr551457 1290 1130 259 130 ----11409
NM_152556chr72860 94 ------
NM_152594chr1531963 100 58 12162 --1423
NM_152609chr1------1468
NM_152622chr513490 ----13519
NM_152624chr557466 1799 1715 1459 628 25492 1254 24847 2304 --
NM_152629chr974010 3771 3604 1283 1263 750 515 11188 ----
NM_152678chr331784 1030 863 12179 --32519 981 949
NM_152699chr383437 3415 2976 2446 2390 2345 1452 436 ------
NM_152722chr1141631 602 595 244 --2667 610 --
NM_152733chr6126303 6238 6149 6090 5476 4883 4312 2533 1283 1159 390 28 55168 2000 1683 1236 798 45728 4905 4421 672 --
NM_152734chr6115178 4946 4719 3884 1743 889 869 726 225 217 93 ------
NM_152756chr523888 3858 --12636 --
NM_152774chr7------12344
NM_152787chrX53643 2732 2647 2483 412 ------
NM_152793chr764494 3913 3192 3151 109 70 --44032 3691 1322 607 --
NM_152835chr132351 2063 669 ------
NM_152860chr1261487 1322 1258 530 150 144 11351 ----
NM_152924chr15136173 5635 5469 5142 4477 2288 1534 1502 1004 907 685 272 95 41101 675 470 168 34798 1644 924 --
NM_153020chr611261 ------
NM_153050chr22145014 4950 4326 3975 3242 1805 1564 1381 1180 896 890 775 742 520 11087 2877 65 --
NM_153051chr22145014 4950 4326 3975 3242 1805 1564 1381 1180 896 890 775 742 520 11087 2877 65 --
NM_153188chr535153 4466 215 14409 ----
NM_153234chr542827 2438 547 275 ------
NM_153261chr161143 11055 --11170
NM_153273chr3132572 2400 2360 2254 2058 1072 1022 966 619 450 435 374 150 52615 2563 2003 1903 1118 --12187
NM_153321chr17--1928 ----
NM_153322chr17--1928 ----
NM_153335chr1741246 101 81 51 2988 486 ----
NM_153350chr1651303 1187 538 359 338 11289 145 --
NM_153365chr471105 966 372 318 247 161 38 1213 --12288
NM_153367chr10113721 3555 3490 1587 1125 917 857 783 296 242 221 23918 1015 1600 --
NM_153371chr1332113 2043 557 ------
NM_153450chr11--2679 69 --2145 76
NM_153456chr13106110 6050 5627 5479 5065 2081 1672 1586 497 100 --11707 --
NM_153487chr6134213 3859 3736 3551 3074 1714 1182 1175 985 886 870 729 423 63528 3386 3246 1148 671 490 --14573
NM_153607chr522755 2150 --12710 --
NM_153616chr1511559 --11795 --
NM_153617chr1511559 --11795 --
NM_153618chr1511559 --11795 --
NM_153619chr1512797 --13033 --
NM_153620chr741765 570 433 211 --2517 63 --
NM_153693chr124814 564 324 271 ------
NM_153695chr9166 ------
NM_153702chr4------1254
NM_153705chr1131813 1729 249 12662 1595 11681
NM_153712chr243582 2440 2347 1369 13660 --13311
NM_153748chr122230 163 1981 ----
NM_153759chr211276 ----11027
NM_153810chr1054574 3124 1697 385 146 11935 1202 15018
NM_153832chr11134 184 ----
NM_170607chr1761527 1030 636 534 387 124 21378 264 ----
NM_170662chr3--1132 ----
NM_170674chr1511144 ------
NM_170675chr151820 ------
NM_170676chr151820 ------
NM_170677chr1511144 ------
NM_170711chr193682 278 252 1701 ----
NM_170719chr131410 --1391 --
NM_170731chr1112043 ------
NM_170732chr1112043 ------
NM_170733chr1112043 ------
NM_170734chr1112043 ------
NM_170735chr1112043 ------
NM_170768chr1151526 1420 636 123 38 ------
NM_170769chr61160 184 1539 1694
NM_170774chr20113381 2820 2737 2641 1604 1402 1197 1093 938 930 140 11312 21395 24 --
NM_170782chr12474 402 ----1211
NM_171998chrX41016 789 759 287 --1930 --
NM_172020chr791777 1768 1701 1530 707 492 385 150 46 ------
NM_172037chr81167 ------
NM_172069chr222161 80 12252 ----
NM_172070chr221972 192 ------
NM_172071chr157181 6981 4737 2836 1685 36526 6166 1722 ----
NM_172169chr1031811 1643 302 ----21553 573
NM_172170chr1031811 1643 302 ----21553 573
NM_172171chr1031811 1643 302 ----21553 573
NM_172173chr1031811 1643 302 ----21553 573
NM_172206chr1781683 1677 1552 738 465 413 321 200 21183 621 1595 --
NM_172216chr1262778 2638 1932 1193 661 46 --12526 --
NM_172315chr1511144 ------
NM_172316chr1511144 ------
NM_172344chr251590 1573 1526 1385 1156 ------
NM_172373chr1321025 1016 --11095 --
NM_173054chr71107 ------
NM_173060chr561644 600 567 479 107 24 --11770 --
NM_173061chr561644 600 567 479 107 24 --11770 --
NM_173063chr561644 600 567 479 107 24 --11770 --
NM_173156chr142175 2057 1615 267 11444 ----
NM_173163chr163436 214 185 ------
NM_173165chr164317 155 95 66 ------
NM_173172chr21255 ------
NM_173191chr105545 488 135 110 31 --21040 929 1913
NM_173192chr105545 488 135 110 31 --21040 929 1913
NM_173193chr105545 488 135 110 31 --21040 929 1913
NM_173194chr105545 488 135 110 31 --21040 929 1913
NM_173195chr105545 488 135 110 31 --21040 929 1913
NM_173198chr942027 2016 1986 353 ------
NM_173200chr942027 2016 1986 353 ------
NM_173214chr1678155 7593 6455 5928 1877 1330 674 ----16229
NM_173354chr2161755 719 569 310 232 71 --1841 --
NM_173359chr311526 ----11378
NM_173454chr152208 194 ----1445
NM_173468chr453960 2256 1764 240 85 --15611 14484
NM_173470chrX12314 ------
NM_173473chr1052143 2012 1696 357 128 --11794 --
NM_173495chrX3917 886 169 22507 273 ----
NM_173496chr1032925 2226 445 ------
NM_173500chr151929 --11090 --
NM_173510chr2232921 2834 331 ------
NM_173519chr831716 1491 563 ------
NM_173552chr31337 ------
NM_173576chr102729 438 ------
NM_173582chr1175819 5348 4047 1704 1489 1323 104 --14457 --
NM_173595chr12165148 4606 4590 4228 4161 4153 3918 3703 1801 741 560 491 339 269 173 133 34511 3884 186 24682 640 --
NM_173602chr1233749 3228 2877 13052 11199 --
NM_173609chr152759 214 ------
NM_173642chr1148852 8119 6670 6537 6470 6464 6263 5953 3230 2938 2494 2310 886 72 38676 8097 1196 26298 117 23307 2858
NM_173670chr511042 ------
NM_173672chr642557 1683 902 615 ----2535 402
NM_173683chr831484 1332 1142 --21796 1342 --
NM_173822chr231464 1433 270 ------
NM_173829chr575331 5121 3835 3762 2450 1495 776 14875 ----
NM_173832chr8113418 3282 2647 2447 2320 2302 1395 806 720 485 125 1513 12331 23655 732
NM_173833chr871430 1360 1327 1209 1180 666 58 1201 11442 --
NM_173847chr17--163 ----
NM_173854chr162287 1920 1540 804 780 647 --21622 309 --
NM_174856chr201136 ------
NM_174911chr872486 1435 1345 391 286 119 99 --1310 1111
NM_174916chr1521496 286 --11662 1475
NM_174934chr11103154 2891 2825 2726 1148 1100 1043 899 822 699 33510 3482 831 3785 477 285 12239
NM_174936chr181205 1028 789 192 175 146 99 28 ------
NM_175061chr711764 --1335 --
NM_175575chr1721061 1031 1100 11086 --
NM_175607chr31496 ------
NM_175612chr31496 ------
NM_175624chr1286949 6758 6707 5483 4904 3076 1321 1158 12282 26405 2405 35403 2994 2355
NM_175625chr1286949 6758 6707 5483 4904 3076 1321 1158 12282 26405 2405 35403 2994 2355
NM_175629chr211276 ----11027
NM_175630chr26612 353 244 204 86 48 --1583 --
NM_175709chr22103062 2768 2698 2550 2382 1950 650 621 372 45 2315 216 2753 522 22910 2311
NM_175736chr12157632 6501 5710 5683 5341 4973 2962 2597 2544 2275 1837 1409 1211 1016 64 42658 2377 2003 428 1946 --
NM_175748chr143547 484 463 ------
NM_175767chr5----11516 11860
NM_175854chr1332213 1784 1692 12017 ----
NM_175856chr51334 ------
NM_175859chrX3696 636 429 21648 1511 1527 --
NM_175862chr361546 1408 1346 452 265 62 ------
NM_175866chr1148 ------
NM_175884chr7--143 ----
NM_176871chr8133302 3254 3046 3002 2819 2766 2650 2112 2031 804 633 500 334 32664 255 93 ----
NM_177422chr12688 512 ------
NM_177424chr132033 1878 1710 --1616 --
NM_177438chr1412907 ------
NM_177553chr11----1604 1904
NM_177952chr141680 ------
NM_177972chr11104423 3813 3736 1557 1297 1199 623 503 269 36 41632 1064 926 813 --12994
NM_177977chr1771818 1674 1481 1336 517 193 48 3603 453 433 11324 --
NM_177985chr211409 ------
NM_177990chr201210 1774 ----
NM_177996chr20103053 2987 2653 2554 2519 2333 1304 1096 1088 586 11336 ----
NM_177999chr993149 3052 2821 2677 2390 1396 1136 961 360 --13464 1661
NM_178014chr64912 232 144 122 1208 ----
NM_178037chr1273648 3488 2851 1310 745 627 174 33600 976 196 ----
NM_178038chr1273648 3488 2851 1310 745 627 174 33600 976 196 ----
NM_178126chr1721575 127 12151 11843 --
NM_178151chrX67688 7571 5071 2278 2090 181 15715 ----
NM_178152chrX67688 7571 5071 2278 2090 181 15715 ----
NM_178153chrX67688 7571 5071 2278 2090 181 15715 ----
NM_178313chr231482 596 46 ------
NM_178424chr53474 468 52 --1539 --
NM_178427chr142257 2202 1768 877 12212 ----
NM_178470chrX197 ------
NM_178496chr331464 477 324 ----1468
NM_178500chr171149 1118 ----
NM_178508chr6121 ------
NM_178557chr491744 1674 1384 1324 1210 1081 697 612 239 ------
NM_178562chr72956 820 ------
NM_178565chr841137 1107 227 186 11725 ----
NM_178582chr2061443 1089 526 422 149 115 ----11395
NM_178812chr8------1219
NM_178818chr1672248 2225 2063 1659 1583 829 675 --1120 1717
NM_178841chr167953 946 739 281 200 65 31 --1258 --
NM_181050chr164649 526 233 209 ------
NM_181077chr1531768 1721 757 11622 ----
NM_181332chrX32650 2034 1887 ------
NM_181351chr1162335 2115 1969 922 631 379 ------
NM_181357chr1491719 1543 1407 721 522 492 287 209 125 1613 1253 11663
NM_181358chr183412 3395 3328 3270 3245 3205 253 156 ------
NM_181443chr2042584 2554 1143 45 1541 1257 --
NM_181504chr541224 1040 451 441 ------
NM_181523chr541224 1040 451 441 ------
NM_181524chr541224 1040 451 441 ------
NM_181655chr172745 39 ------
NM_181689chr203302 125 22 --1278 --
NM_181701chr971888 1742 874 860 809 736 111 1945 1749 11900
NM_181712chr131982 1641 1279 22022 1334 --21956 1561
NM_181807chr11------1370
NM_181833chr2283745 3610 3595 2724 1434 1245 1092 453 43103 2486 2286 348 12550 11508
NM_181838chr51162 ----11294
NM_181886chr41308 ------
NM_181887chr41308 ------
NM_181888chr41308 ------
NM_181889chr41308 ------
NM_181890chr41308 ------
NM_181891chr41308 ------
NM_181892chr41355 ------
NM_181893chr41308 ------
NM_182485chr443235 2849 1368 975 ------
NM_182488chr131332 ------
NM_182498chr193278 268 256 ------
NM_182507chr1262119 1814 1767 1490 853 490 2765 501 ----
NM_182509chr1451661 1295 1116 221 171 11356 ----
NM_182511chr1831209 958 199 ----1540
NM_182515chr19106720 6541 5572 4798 4430 4253 4095 1039 434 96 --1997 148
NM_182526chr14142963 2861 2806 2584 2288 2269 2236 1988 1069 866 639 605 392 24 12883 ----
NM_182527chr22121676 1516 663 549 514 501 473 348 180 167 124 95 1288 1391 --
NM_182562chr155793 660 642 98 44 2875 82 32240 408 22 --
NM_182580chr162486 2474 2321 2193 2138 1640 22066 1017 ----
NM_182646chr443235 2849 1368 975 ------
NM_182697chr711120 --2691 446 --
NM_182706chr8----282 28 --
NM_182757chr673315 3131 2828 2804 2736 2669 171 ----1842
NM_182830chr1422066 277 --22284 697 --
NM_182835chr14133 ------
NM_182898chr742153 1487 1182 91 1213 16291 --
NM_182899chr742153 1487 1182 91 1213 16291 --
NM_182907chr621662 44 1623 1658 --
NM_182915chr292268 2158 2137 1866 814 774 602 589 560 2781 133 1541 --
NM_182918chr21--1157 ----
NM_182920chr331340 1288 984 1563 ----
NM_182925chr581525 1496 1062 655 590 561 346 89 21488 382 131 --
NM_182935chr351748 890 546 182 87 1879 1464 --
NM_182948chr12780 477 ------
NM_182964chr1132846 2402 1116 --22083 155 --
NM_182970chr20274251 4242 4142 3937 3755 3527 3444 3363 3284 3229 3193 3181 3131 2822 2770 2639 1652 1483 1463 1360 1184 1152 679 241 225 147 36 33922 3587 1268 --160
NM_182972chr131111 948 306 --12291 --
NM_183004chr1463580 2626 1579 652 538 424 23319 3227 13436 11179
NM_183006chr2041492 1005 515 391 ------
NM_183043chr131936 ------
NM_183044chr131936 ------
NM_183078chr653447 2809 2737 2704 2371 23510 3060 ----
NM_183227chr621599 1425 ----11319
NM_183243chr73698 505 494 1217 --1665
NM_183243chr73698 505 494 1217 --1665
NM_183353chrX21111 979 ------
NM_194071chr764840 4485 1987 1778 1121 675 41429 852 517 147 24988 3717 --
NM_194248chr25968 732 319 280 192 ------
NM_194259chr161369 --2438 108 --
NM_194260chr161369 --2438 108 --
NM_194261chr161369 --2438 108 --
NM_194272chr152281 243 ----11030
NM_194278chr1473171 2906 2696 2583 1365 1257 488 43628 1493 1070 633 ----
NM_194282chr443002 2851 690 250 13010 ----
NM_194285chr1122791 438 --1102 12911
NM_194286chr12126052 5525 5429 2355 2344 2056 1387 1186 1041 610 221 204 36103 1842 1223 ----
NM_194314chr144175 1166 927 714 1945 11805 --
NM_194318chr1332469 972 375 2502 198 ----
NM_194322chr25968 732 319 280 192 ------
NM_194328chr942854 2612 808 562 ------
NM_194329chr942854 2612 808 562 ------
NM_194330chr942854 2612 808 562 ------
NM_194332chr942854 2612 808 562 ------
NM_194358chr1241626 1426 238 151 11694 11455 --
NM_194359chr1241626 1426 238 151 11694 11455 --
NM_194434chr1864376 4364 4106 2311 2024 440 13737 ----
NM_194463chrX2433 389 ------
NM_197939chr174901 825 341 21 3834 227 202 1326 1779
NM_197941chr532246 2079 408 12335 1833 12670
NM_197977chr92834 206 ------
NM_198066chr1472832 2574 2506 2413 2217 1215 544 ----12672
NM_198077chr11230 ------
NM_198081chr612459 --1424 22338 757
NM_198086chr145880 724 363 118 101 ----12074
NM_198148chr105794 685 208 114 54 2922 30 --21089 265
NM_198158chr322722 2456 ------
NM_198159chr322722 2456 ------
NM_198177chr322722 2456 ------
NM_198178chr322722 2456 ------
NM_198204chr1761527 1030 636 534 387 124 21378 264 ----
NM_198205chr1761527 1030 636 534 387 124 21378 264 ----
NM_198217chr1321039 833 ------
NM_198218chr1321039 833 ------
NM_198219chr1321039 833 ------
NM_198261chr121701 ----1498
NM_198262chr121701 ----1498
NM_198268chr183412 3395 3328 3270 3245 3205 253 156 ------
NM_198269chr183412 3395 3328 3270 3245 3205 253 156 ------
NM_198273chr53257 197 44 ------
NM_198279chrX11206 ------
NM_198291chr2081934 1924 1906 1434 1275 1253 562 42 11373 11774 --
NM_198320chr12125066 4425 3668 3454 1947 1812 1539 1370 1088 984 658 36 ----44945 3758 1491 1210
NM_198390chr163649 132 83 2578 448 ----
NM_198395chr511220 ------
NM_198404chr132308 180 ------
NM_198440chr2292325 2176 2038 1889 1002 788 572 479 366 --1258 12410
NM_198468chr62579 432 11352 11019 --
NM_198490chr3203472 3329 3051 2724 2611 2602 2556 2509 2472 2362 1382 1318 1085 979 565 466 418 398 146 90 --23336 2882 12382
NM_198560chr3163566 3446 3004 2941 2863 2706 2680 1511 1444 1438 746 375 294 265 170 159 33272 541 200 23189 2393 --
NM_198581chr287436 6703 6325 5903 5759 5556 5431 1047 ------
NM_198595chr493382 1515 1428 1241 1085 930 880 814 378 14004 13165 --
NM_198597chr106919 865 719 644 150 113 ----1975
NM_198679chr992568 2385 2343 2168 2104 1928 986 864 442 11052 1751 --
NM_198793chr331214 605 500 --1954 --
NM_198794chr141992 ------
NM_198834chr1721605 691 1160 ----
NM_198836chr1721605 691 1160 ----
NM_198837chr1721605 691 1160 ----
NM_198838chr1721605 691 1160 ----
NM_198839chr1721605 691 1160 ----
NM_198859chr363440 3344 1546 1330 1144 890 14981 ----
NM_198896chr1111818 1770 ----
NM_198900chr12157632 6501 5710 5683 5341 4973 2962 2597 2544 2275 1837 1409 1211 1016 64 42658 2377 2003 428 1946 --
NM_198901chr721200 872 11123 1423 --
NM_198903chr52650 130 ------
NM_198904chr531772 650 130 ------
NM_198935chr20--2853 792 --12251
NM_198968chr1343783 1561 1199 1013 23075 1275 13068 1556
NM_198993chr1791706 1513 1206 417 384 326 313 176 43 31316 468 208 1624 --
NM_199129chr2041170 389 115 22 21254 951 ----
NM_199131chr1073496 3352 3069 3057 2305 221 84 41270 1225 492 37 33531 2878 615 --
NM_199229chr221713 1524 21582 1126 11723 11079
NM_199245chr12112237 2184 2111 931 909 862 804 317 253 123 66 22405 368 --1761
NM_199262chr1771987 1855 1636 534 265 174 74 31746 1688 415 21777 1694 --
NM_199320chr442581 2000 855 847 1821 1961 --
NM_199320chr442581 2000 855 847 1821 1961 --
NM_199324chr412950 ------
NM_199327chr42783 201 ------
NM_199421chr1435077 648 590 14489 ----
NM_199454chr183326 3317 3243 1525 1111 1053 778 617 21311 600 ----
NM_199461chr1053490 2326 1259 866 784 --13560 13589
NM_199462chr1124936 4867 4686 4370 4204 3432 3330 1988 945 778 627 130 21538 447 13134 33096 1908 897
NM_199487chr202983 129 ------
NM_201267chr24597 549 396 167 ------
NM_201280chr621335 1168 1583 ----
NM_201432chr1795731 5245 4796 3974 2622 1237 616 538 99 55719 4692 2538 2039 526 11810 11307
NM_201433chr1795731 5245 4796 3974 2622 1237 616 538 99 55719 4692 2538 2039 526 11810 11307
NM_201437chr8126 --1114 --
NM_201520chr1771814 1600 1461 733 434 362 145 11768 11729 --
NM_201535chr144738 706 692 618 ----160
NM_201536chr144738 706 692 618 ----160
NM_201537chr144738 706 692 618 ----160
NM_201538chr144738 706 692 618 ----160
NM_201539chr144738 706 692 618 ----160
NM_201540chr144738 706 692 618 ----160
NM_201541chr144738 706 692 618 ----160
NM_201567chr331486 1220 1125 1119 --1397
NM_201568chr142175 2057 1615 267 11444 ----
NM_201569chr142175 2057 1615 267 11444 ----
NM_201599chrX31181 302 289 --1864 --
NM_201627chr51293 ------
NM_201999chr43946 899 300 ------
NM_203283chr4--196 ----
NM_203284chr4--196 ----
NM_203327chr2094357 3696 3672 3314 2914 1658 1586 578 24 13167 ----
NM_203341chr11734 ------
NM_203349chr1521960 1573 ------
NM_203350chr121182 78 ------
NM_203364chr1111238 ----1867
NM_203377chr222505 463 1210 2426 32 --
NM_203378chr222505 463 1210 2426 32 --
NM_203390chr81157 11558 ----
NM_203399chr12789 265 ------
NM_203401chr12789 265 ------
NM_203413chr175889 862 720 377 344 1407 2190 156 --
NM_203446chr2112724 ------
NM_203504chr41213 ------
NM_203505chr41213 ------
NM_203506chr1772102 2088 2012 1975 1906 880 111 --1630 2833 801
NM_205768chr1--1628 ----
NM_205842chr21175 ------
NM_205848chr142807 2351 2046 43 12372 ----
NM_205860chr162956 2873 2695 2590 2523 2014 ------
NM_205861chr131791 1578 1463 21879 175 --1543
NM_206594chr112383 12615 12784 11335
NM_206595chr112383 12615 12784 11335
NM_206853chr634034 3393 2939 --1507 --
NM_206854chr645295 4654 4200 1017 --11768 --
NM_206855chr646260 5619 5165 1982 ------
NM_206866chr2142147 1184 858 737 ----12888
NM_206909chr847204 6607 5300 3348 36292 2996 2792 ----
NM_206914chr125532 224 155 128 89 ------
NM_206933chr132406 273 61 11745 12327 --
NM_207012chr1053251 3085 2229 603 267 ------
NM_207042chr13469 258 177 ------
NM_207043chr112202 1347 1714 11912
NM_207044chr112202 1347 1714 11912
NM_207045chr13469 258 177 ------
NM_207046chr13469 258 177 ------
NM_207047chr112202 1347 1714 11912
NM_207292chr313310 ------
NM_207293chr313310 ------
NM_207294chr313310 ------
NM_207295chr313310 ------
NM_207296chr313310 ------
NM_207297chr313335 ------
NM_207337chr12--1388 ----
NM_207362chr21187 --1131 --
NM_207371chr1021499 1329 ------
NM_207372chr1022369 2231 21622 789 1730 --
NM_207380chr15143581 3570 3128 3005 1200 1128 1112 756 569 531 429 391 356 254 11365 33402 1102 283 --
NM_207390chr195869 802 728 362 46 1405 2684 293 --
NM_207406chr415207 26001 5528 1319 --
NM_207411chr873478 3268 3126 2909 2744 2273 1141 1545 ----
NM_207442chr142343 243 154 --1665
NM_207481chr22197 183 --11076 --
NM_207645chr1111299 ----1862
NM_207660chr1441626 1500 1125 96 ------
NM_207661chr1441626 1500 1125 96 ------
NM_207662chr1441626 1500 1125 96 ------
NM_212551chr13831 215 159 ------
NM_212558chr952618 1605 479 458 109 ------
NM_213606chr1032026 700 452 ----1521