TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4726-5p
miRNA Sequence: AGGGCCAGAGGAGCCUGGAGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--21068 38 ----
NM_000020chr1242092 1630 1592 1534 --51834 1712 1567 228 195 11575
NM_000037chr811788 --11656 --
NM_000038chr51174 ------
NM_000053chr132211 180 ----1682
NM_000068chr1931442 474 262 --1396 --
NM_000084chrX96181 5937 5878 5804 5747 5292 5023 4308 2467 66577 6068 4664 2617 2075 1647 16301 12191
NM_000088chr1721142 489 1284 124 --
NM_000090chr21640 ------
NM_000092chr244528 4370 3898 256 ------
NM_000093chr952137 1946 1638 742 624 ------
NM_000125chr6103703 3622 3317 2652 1367 1239 1126 693 433 397 11299 ----
NM_000129chr641470 1284 603 37 --21358 354 --
NM_000138chr151278 11662 12517 1742
NM_000141chr101264 --11049 --
NM_000163chr521710 667 ------
NM_000165chr61399 ------
NM_000168chr712826 ----13209
NM_000176chr533262 2984 2790 ----13413
NM_000196chr16------2446 113
NM_000208chr1974563 4434 3902 3347 1529 1147 612 1714 ----
NM_000214chr2031538 290 133 ------
NM_000217chr1253801 1877 1859 796 261 11121 1621 --
NM_000232chr442580 2536 2491 2187 11293 ----
NM_000237chr821696 616 1529 11658 --
NM_000238chr71249 130 ----
NM_000248chr312724 12995 ----
NM_000259chr1545004 4262 4147 1133 11057 ----
NM_000264chr911120 11165 22053 769 --
NM_000266chrX3965 924 261 ------
NM_000272chr211285 11209 ----
NM_000274chr103484 54 26 ------
NM_000278chr1052219 2156 2091 1560 1529 --41726 1547 851 757 --
NM_000280chr111797 ------
NM_000285chr19174 --139 --
NM_000289chr122390 142 ------
NM_000314chr1023135 632 ------
NM_000319chr1221149 480 ------
NM_000321chr1321436 301 ------
NM_000330chrX42108 2052 905 411 --11591 1889
NM_000332chr687045 6048 5327 5199 4608 2879 801 30 14680 16641 16413
NM_000334chr1772099 1834 824 706 623 299 137 31569 427 22 4711 408 354 113 12136
NM_000335chr392100 2038 1969 1604 801 482 221 184 100 --2819 705 --
NM_000337chr595882 1972 1891 1626 1589 1342 804 525 63 ----1599
NM_000353chr162935 84 ------
NM_000368chr944205 1686 1218 401 --24008 926 --
NM_000378chr11--1907 ----
NM_000393chr221697 1434 --1150 --
NM_000401chr1121059 725 ------
NM_000408chr222710 592 ------
NM_000429chr1091737 1679 1658 1575 1394 1263 1231 75 24 11814 21255 1184 --
NM_000430chr1733187 2667 383 12376 ----
NM_000448chr1112273 ------
NM_000450chr111520 --192 --
NM_000451chrX51795 1470 592 400 304 ------
NM_000458chr171873 ------
NM_000461chr323937 1855 11819 23334 1206 21600 306
NM_000474chr7----1487 --
NM_000476chr941222 1063 451 235 --3497 351 70 21365 585
NM_000478chr11231 1583 1197 --
NM_000480chr1141459 1117 414 317 1367 ----
NM_000482chr11----122 --
NM_000484chr211750 ------
NM_000489chrX21077 104 --13014 --
NM_000503chr811808 ------
NM_000533chrX2471 408 --2703 104 --
NM_000555chrX117816 7216 6585 5148 5134 5125 5073 4975 3104 702 555 12530 35807 5755 3142 --
NM_000575chr21880 1776 ----
NM_000599chr283739 3502 3138 3090 3063 2934 2868 1844 --53976 3528 3402 3084 424 --
NM_000609chr1032434 958 692 13013 1361 --
NM_000611chr11126943 6525 6201 6035 5265 4757 2372 2047 1899 1790 1529 137 14480 96473 6332 5415 5402 4408 2506 2320 2179 336 --
NM_000612chr1183613 3401 2805 2790 2678 2620 659 544 --43576 2795 2699 690 --
NM_000615chr1122164 1142 --32368 2338 2008 --
NM_000618chr1276380 5497 4655 1521 940 528 200 ------
NM_000618chr1276380 5497 4655 1521 940 528 200 ------
NM_000621chr1331342 1171 434 ------
NM_000633chr1895161 5049 3415 1995 1357 456 448 388 335 34224 1863 1364 41042 1013 844 566 13481
NM_000635chr1961518 1382 582 314 204 48 --1360 --
NM_000641chr1911225 11240 1286 --
NM_000684chr102422 269 11311 ----
NM_000721chr151979 1052 905 869 629 --1394 21077 349
NM_000724chr1031949 462 205 11873 ----
NM_000725chr123963 152 45 ------
NM_000726chr2----11098 --
NM_000738chr112936 108 1370 1971 2886 792
NM_000767chr1941225 1190 433 70 11460 11249 --
NM_000793chr1464751 4648 4418 1460 1067 404 34521 3608 1103 13282 --
NM_000801chr204987 961 921 716 ------
NM_000806chr521983 1877 ------
NM_000813chr542006 1163 830 584 1140 --1128
NM_000814chr1553925 3733 3668 3599 825 ------
NM_000815chr11452 --1429 --
NM_000817chr211004 ------
NM_000818chr102194 186 ------
NM_000826chr41585 1870 ----
NM_000827chr542431 1675 906 840 22152 582 ----
NM_000831chr1116069 5757 4368 4357 4176 4098 1830 1152 1011 997 544 --34151 3883 1310 35606 4161 3936
NM_000834chr1221162 493 ------
NM_000836chr193344 183 112 ------
NM_000837chr81196 --145 --
NM_000842chr111212 ------
NM_000859chr541206 1138 527 143 ------
NM_000865chr61201 ------
NM_000868chrX----1783 --
NM_000875chr15146439 6120 6106 6048 5996 5541 5123 4771 4743 4665 2359 1923 1903 425 24835 2100 24423 4413 22149 2031
NM_000876chr631350 1081 541 1208 ----
NM_000883chr72562 539 187 ----
NM_000883chr72562 539 187 ----
NM_000891chr1721011 89 --11262 --
NM_000899chr1241632 934 417 341 ------
NM_000901chr4----12294 --
NM_000909chr4122 ------
NM_000912chr843273 2239 1137 322 --22721 2322 --
NM_000920chr113364 269 26 ------
NM_000926chr1178690 7955 7838 7806 6675 5822 3217 1772 17997 --
NM_000933chr201180 ------
NM_000941chr7193 --3349 248 58 --
NM_000944chr411775 ----11616
NM_000960chr193647 239 99 --3512 258 160 --
NM_000961chr2093808 3426 1577 1337 1011 975 414 383 90 11194 ----
NM_000964chr1731163 1026 354 --51297 1187 954 873 255 --
NM_000965chr32920 350 --11209 --
NM_000966chr122985 357 1785 ----
NM_000977chr161359 ------
NM_001001132chr2111112 ------
NM_001001323chr1233029 2160 563 ------
NM_001001331chr332429 464 170 --1273 --
NM_001001342chr1031400 1154 117 --21412 1112 --
NM_001001394chr22684 60 ------
NM_001001523chr141041 147 107 36 --11083 145
NM_001001557chr861789 612 524 228 71 25 --1704 --
NM_001001661chr72260 112 162 ----
NM_001001664chr2--1589 ----
NM_001001668chr1933326 3198 981 23841 575 13985 --
NM_001001890chr2133896 3464 1416 ----12672
NM_001001933chr11154 ------
NM_001002031chr12145 1101 ----
NM_001002033chr171580 ------
NM_001002252chr121105 --161 1213
NM_001002257chr233521 3257 1323 --12466 --
NM_001002295chr101455 1870 11040 --
NM_001002762chr1032844 2810 78 1348 1267 --
NM_001002838chrX21264 746 1653 ----
NM_001002860chr1423125 755 ------
NM_001002909chr1732103 423 381 1707 ----
NM_001002914chr1721259 442 1180 2452 447 --
NM_001003406chr22123258 2841 2738 2682 2604 2499 2160 2049 950 587 391 185 1176 32504 961 789 13252
NM_001003652chr1888582 8011 3177 3044 2789 2175 1543 71 ------
NM_001003676chr115906 635 413 359 294 --1649 1278
NM_001003681chr2241621 638 92 86 --11494 --
NM_001003694chr31104 ------
NM_001003712chr1243839 2746 1018 47 ----12563
NM_001003792chr3--11168 ----
NM_001003793chr3--11168 ----
NM_001003794chr352586 1907 710 447 437 23024 1107 ----
NM_001003800chr94799 787 711 619 --1342 --
NM_001003895chrY--176 ----
NM_001003937chr261450 536 512 412 325 192 --1331 --
NM_001003940chr15103427 3338 3148 2621 2464 741 716 693 603 530 12530 43368 2948 2937 2501 --
NM_001003942chr15103427 3338 3148 2621 2464 741 716 693 603 530 12530 43368 2948 2937 2501 --
NM_001003943chr15103431 3342 3152 2625 2468 745 720 697 607 534 12534 43372 2952 2941 2505 --
NM_001004023chr11191 ------
NM_001004065chr922889 1400 ------
NM_001004105chr5127 ------
NM_001004127chr132247 208 ------
NM_001004128chr13476 217 52 ------
NM_001004196chr32949 37 11121 ----
NM_001004304chr1283037 2711 2090 1109 307 158 75 66 32052 799 731 1966 2480 457
NM_001004317chr644143 3107 1401 1381 --11452 13529
NM_001004342chr1156018 5884 5268 4519 4251 4205 3811 2433 2292 2041 1742 1145 975 517 433 --24803 379 --
NM_001004360chr221226 337 ------
NM_001004419chr1222802 1500 --11809 --
NM_001004439chr1551054 884 488 110 76 ------
NM_001005209chr23731 161 83 --3524 516 121 --
NM_001005271chr1711107 --1406 --
NM_001005273chr1711107 --1406 --
NM_001005290chr12449 104 --1419 170
NM_001005291chr17148 --1111 --
NM_001005336chr92541 152 1387 ----
NM_001005375chrY----11376 --
NM_001005377chr19128 ------
NM_001005404chr1752875 1210 608 339 218 21291 912 ----
NM_001005415chr191463 ------
NM_001005416chr191463 ------
NM_001005463chr1022287 312 ------
NM_001005473chr555889 5040 4286 2445 1330 ------
NM_001005474chr331023 424 23 ------
NM_001005505chr341652 1241 142 123 11412 ----
NM_001005609chrX53709 3402 3384 1272 578 ----23503 1137
NM_001005612chrX2296 25 ------
NM_001005743chr1421279 411 ------
NM_001005744chr1421279 411 ------
NM_001005745chr1421279 411 ------
NM_001005746chr2----11098 --
NM_001005747chr2----11098 --
NM_001005782chr22700 335 ------
NM_001005785chrY----11376 --
NM_001005786chrY----11376 --
NM_001005845chr8129 ------
NM_001005861chr32964 238 ------
NM_001005909chr3195 ------
NM_001006115chr362684 1729 961 897 780 221 ----1787
NM_001006610chr16125 ------
NM_001006617chr911048 ----1115
NM_001006619chr911048 ----1115
NM_001006620chr911048 ----1115
NM_001006621chr911048 ----1115
NM_001006623chr232298 373 207 --1429 --
NM_001006634chr16----2561 140 --
NM_001006636chr22292 120 ------
NM_001006657chr2--11168 ----
NM_001006665chr13801 610 577 ------
NM_001006684chrX----132 --
NM_001006933chrX----149 --
NM_001006946chr261735 1564 1367 779 353 128 --21895 83 --
NM_001007023chr1464751 4648 4418 1460 1067 404 34521 3608 1103 13282 --
NM_001007024chr1763923 3276 1317 1006 735 49 14004 ----
NM_001007025chr1763923 3276 1317 1006 735 49 14004 ----
NM_001007027chr11170 ------
NM_001007097chr913117 33314 3280 3211 21863 1011 --
NM_001007098chr11307 ------
NM_001007102chr61446 ------
NM_001007226chr1731113 230 134 --1274 --
NM_001007227chr1731113 230 134 --1274 --
NM_001007228chr1731113 230 134 --1274 --
NM_001007229chr1731113 230 134 --1274 --
NM_001007230chr1731113 230 134 --1274 --
NM_001007237chr162469 2222 1839 1092 905 28 ------
NM_001007246chr2111474 11675 ----
NM_001007277chr111934 ------
NM_001007466chr644466 4336 3804 70 14285 1973 --
NM_001007553chr141040 1021 1004 341 ------
NM_001007559chr1831913 1831 1822 ------
NM_001007565chr3144 ------
NM_001008220chr5103603 2991 2782 1017 945 619 441 392 129 109 12808 53711 2710 634 506 446 --
NM_001008222chrX61241 1142 505 429 336 265 ----1371
NM_001008495chr81914 1230 ----
NM_001008529chr1721267 254 ------
NM_001008541chr1032119 1458 403 11950 ----
NM_001008541chr1032119 1458 403 11950 ----
NM_001008660chr1121384 1055 ------
NM_001008701chr1952881 2280 2150 2045 630 132 22379 1044 --
NM_001008738chr522667 2015 22238 369 ----
NM_001008895chr1321457 132 --1540 --
NM_001008938chr11173 ------
NM_001009184chr81196 --145 --
NM_001009185chr5--1686 ----
NM_001009552chr8146 ------
NM_001009555chr411732 ------
NM_001009566chr131022 228 185 --1314 --
NM_001009881chr1127 ------
NM_001009882chr1127 ------
NM_001009899chr385253 4714 2188 2179 2135 1488 1234 431 32044 1624 415 11358 --
NM_001009909chr1143793 2678 2593 2584 43951 2450 1578 417 ----
NM_001009993chr274219 3773 3706 3353 3238 3170 3145 23987 3889 13656 --
NM_001010852chr61151 ------
NM_001010867chr1196365 5953 5466 5363 4966 2184 2019 1741 1628 1542 1449 1418 936 803 386 320 279 219 57 14379 22337 159 16656
NM_001010891chr586782 6434 6416 5788 5664 4982 4511 2713 1930 15631 1910
NM_001010926chr12542 141 --1131 --
NM_001010927chr61196 ------
NM_001010983chr31326 ------
NM_001010986chrX42018 1975 945 222 11953 ----
NM_001011513chr473925 3242 1574 1227 1095 615 114 21153 539 ----
NM_001011538chr44923 858 388 68 1776 ----
NM_001011546chr201209 ------
NM_001011553chr71902 ------
NM_001011554chr202827 738 1141 ----
NM_001011666chr755165 2353 1553 1489 120 1586 122 --
NM_001011708chr211092 12542 ----
NM_001012264chr14--1711 ----
NM_001012329chr162378 2205 2119 1572 327 58 ----11590
NM_001012398chr16------150
NM_001012446chr9------2387 114
NM_001012614chr4192 --1113 --
NM_001012642chr1542155 658 403 202 --32020 1757 1591 --
NM_001012644chr20122 --140 --
NM_001012732chr441261 297 277 229 --11019 1440
NM_001012751chr1021811 402 ------
NM_001012753chr1921142 1128 --11079 --
NM_001012755chrX21395 1343 1628 --11027
NM_001012756chr1973141 2713 2675 2630 2548 2539 1132 12406 ----
NM_001012968chrX----2535 525 --
NM_001012977chrX21068 1004 146 1423 --
NM_001012989chrX1245 ------
NM_001013031chr1032489 1166 340 --2924 919 --
NM_001013399chr61916 ------
NM_001013437chr182343 61 ------
NM_001013438chr32626 407 ------
NM_001013439chr31253 ------
NM_001013620chr1266002 5964 3038 2984 266 111 12894 ----
NM_001013622chr4111126 1107 939 895 450 389 327 265 203 142 80 --1756 11135
NM_001013635chr122980 836 ------
NM_001013690chr1241814 1015 604 550 --52358 1930 542 525 452 11874
NM_001013693chr172352 2146 1128 1073 910 730 341 --12362 --
NM_001013693chr172352 2146 1128 1073 910 730 341 --12362 --
NM_001013843chr151693 --1348 --
NM_001014435chr162545 505 ------
NM_001014445chr174825 714 239 134 ------
NM_001014797chr1047352 2801 2774 858 ----27878 7066
NM_001014809chr44923 809 687 649 --2821 314 --
NM_001014812chr15----1149 --
NM_001014831chr193717 698 514 ------
NM_001014832chr193717 698 514 ------
NM_001014834chr193717 698 514 ------
NM_001014835chr193717 698 514 ------
NM_001014839chr12877 130 --4789 431 314 85 --
NM_001014841chr12877 130 --4789 431 314 85 --
NM_001015045chr42679 173 --22340 95 --
NM_001015053chr1731505 1209 612 ------
NM_001015881chrX173 ------
NM_001015887chr341343 1271 495 149 --11281 --
NM_001017368chr1751006 848 550 439 68 --12161 --
NM_001017371chr211222 ------
NM_001017395chr393625 3397 2886 2877 1368 1054 708 544 526 --13023 --
NM_001017406chr1--136 ----
NM_001017440chr7107521 7470 7083 6558 5313 5217 2939 2775 2289 503 27281 3102 11174 16266
NM_001017923chr141255 ------
NM_001017926chr811425 --1624 --
NM_001017930chrX2465 224 ------
NM_001017973chr5----131 --
NM_001017974chr5----131 --
NM_001017979chr4133 ------
NM_001017995chr584011 3479 3371 1853 1332 1091 279 44 --135 --
NM_001018050chr2293474 3379 3240 3174 3063 2899 2537 859 566 1952 ----
NM_001018052chr2293474 3379 3240 3174 3063 2899 2537 859 566 1952 ----
NM_001018054chr111353 1579 --11152
NM_001018057chr111127 ------
NM_001018064chr91325 --1818 12109
NM_001018065chr985756 5649 5565 4764 2341 1491 1440 107 11315 ----
NM_001018066chr985756 5649 5565 4764 2341 1491 1440 107 11315 ----
NM_001018067chr144606 3683 946 903 23475 688 13996 --
NM_001018068chr144606 3683 946 903 23475 688 13996 --
NM_001018069chr144606 3683 946 903 23475 688 13996 --
NM_001018074chr533262 2984 2790 ----13413
NM_001018075chr533262 2984 2790 ----13413
NM_001018076chr533262 2984 2790 ----13413
NM_001018077chr533262 2984 2790 ----13413
NM_001018091chr1532075 950 95 ------
NM_001018108chr1521549 626 21397 546 11748 --
NM_001020658chr11415 ----148
NM_001020658chr11415 ----148
NM_001020825chr52459 265 ----1888
NM_001023587chr31145 ------
NM_001024071chr141993 --1125 --
NM_001024094chr533262 2984 2790 ----13413
NM_001024226chr111060 --1307 --
NM_001024227chr111060 --1307 --
NM_001024228chr111060 --1307 --
NM_001024401chr1642847 2276 1836 757 22740 215 32572 397 145 --
NM_001024455chrX21059 305 --12238 --
NM_001024463chr1531010 331 221 ------
NM_001024649chr532368 777 59 12882 ----
NM_001024680chr211646 11570 ----
NM_001024809chr1731163 1026 354 --51297 1187 954 873 255 --
NM_001024845chr14843 302 106 24 ------
NM_001024847chr31619 ----12140
NM_001024858chr1432599 736 65 1539 42924 2645 2225 208 12231
NM_001024937chr171731 ------
NM_001024948chr133531 3133 618 ------
NM_001024959chr36767 654 567 210 201 25 --2794 354 --
NM_001024960chr36767 654 567 210 201 25 --2794 354 --
NM_001025076chr1046224 5551 5133 2241 1574 15052 --
NM_001025077chr1047582 6909 6491 1284 21932 501 16410 --
NM_001025079chr332644 598 79 --1325 --
NM_001025081chr181376 ------
NM_001025090chr181376 ------
NM_001025092chr181376 ------
NM_001025101chr181376 ------
NM_001025107chr132140 2094 195 --11947 12105
NM_001025107chr132140 2094 195 --11947 12105
NM_001025108chr252969 2937 2787 1487 34 149 23007 2748 --
NM_001025232chr12143 ------
NM_001025233chr1262661 1924 1909 710 454 253 12685 ----
NM_001025366chr6----11501 --
NM_001025366chr6----11501 --
NM_001025367chr6----11501 --
NM_001025367chr6----11501 --
NM_001025368chr6----11501 --
NM_001025368chr6----11501 --
NM_001025369chr6----11517 --
NM_001025369chr6----11517 --
NM_001025370chr6----11501 --
NM_001025370chr6----11501 --
NM_001025389chr1141459 1117 414 317 1367 ----
NM_001025390chr1141459 1117 414 317 1367 ----
NM_001025579chr172280 33 ------
NM_001025580chrX13163 --13348 --
NM_001025595chr421478 328 ------
NM_001025616chr431587 86 31 ------
NM_001025780chr931159 1126 1073 ----11205
NM_001029858chr643361 1087 938 40 ------
NM_001029861chr192218 125 1934 2205 106 146
NM_001029863chr6--12289 ----
NM_001029871chr2061788 1572 1490 684 662 629 --31697 706 27 --
NM_001029875chr511891 11178 --12519
NM_001029882chr12499 45 ------
NM_001029882chr12499 45 ------
NM_001030006chr1752496 2370 623 564 283 12356 ----
NM_001030007chr1673583 3416 2479 1082 643 322 204 ------
NM_001030055chr1433932 1007 390 1718 ----
NM_001031623chr6133 ------
NM_001031680chr141886 241 153 131 1389 22035 1633 --
NM_001031684chr241399 1322 1188 394 ------
NM_001031690chr763074 2893 2275 800 461 454 --12439 --
NM_001031695chr2285380 4376 2026 1613 1606 1471 500 54 ------
NM_001031696chr191110 --1242 1251
NM_001031710chr71190 1314 ----
NM_001031716chr211007 ------
NM_001031717chr33132 71 62 ------
NM_001031723chr4----1155 --
NM_001031732chr431400 1294 1280 12417 12234 13483
NM_001031738chr2----123 --
NM_001031740chr131500 1359 54 31732 1426 339 ----
NM_001031801chr22129 ----1133
NM_001031804chr1653965 3442 826 138 129 --13459 1269
NM_001031812chr522195 1854 ------
NM_001032279chr11182 ------
NM_001032280chr611257 ------
NM_001032290chr12481 136 --1451 1102
NM_001032291chr12481 136 --1451 1102
NM_001032296chr1362678 2629 2446 2355 890 500 ----12526
NM_001032380chr1011976 ------
NM_001032999chr20134906 3618 3346 3256 2022 1931 1766 1609 1566 1054 814 682 483 21946 1432 24080 1782 --
NM_001033026chr193440 219 36 1559 ----
NM_001033044chr12627 534 ------
NM_001033047chr42973 850 12640 2496 153 --
NM_001033056chr12627 534 ------
NM_001033057chr3------2671 254
NM_001033059chr62756 393 ------
NM_001033081chr131548 1480 657 --11429 --
NM_001033082chr131548 1480 657 --11429 --
NM_001033087chr2042662 1081 808 365 --31023 330 33 --
NM_001033112chr51205 ------
NM_001033117chr3104671 4579 4447 3972 3383 1430 687 158 60 30 23407 41 196 14143
NM_001033507chr161887 1691 1565 1484 1345 69 --11384 --
NM_001033551chr17123558 3530 2956 2895 2567 1215 1109 1051 915 861 491 69 23302 281 74050 3098 3040 1269 1083 920 820 42632 1253 639 389
NM_001033557chr2123 --11179 --
NM_001033561chr171594 --127 --
NM_001033602chr1362631 2593 2297 2238 1889 1749 --21756 90 --
NM_001033667chr11215 --1572 1472
NM_001033677chr121285 ------
NM_001033714chr12--127 ----
NM_001033756chr6----11435 --
NM_001033756chr6----11435 --
NM_001033925chr10--1635 11591 --
NM_001034025chr123672 194 133 ------
NM_001034837chr5--2696 175 ----
NM_001034838chr5--2696 175 ----
NM_001034845chr41235 ------
NM_001034954chr1052209 1013 964 863 747 ------
NM_001034955chr1052209 1013 964 863 747 ------
NM_001034956chr1052209 1013 964 863 747 ------
NM_001034957chr1052209 1013 964 863 747 ------
NM_001035254chr972054 2033 1789 1042 762 427 337 --32081 1032 719 1194
NM_001035511chr12327 211 ------
NM_001035512chr131403 434 318 ------
NM_001035513chr131403 434 318 ------
NM_001035521chr22615 52 2571 246 ----
NM_001037132chr721869 621 ----1888
NM_001037133chr721869 621 ----1888
NM_001037164chr7145 1465 ----
NM_001037324chr31752 ------
NM_001037339chr111152 --1114 --
NM_001037340chr111152 --1114 --
NM_001037341chr111152 --1114 --
NM_001037341chr111152 --1114 --
NM_001037582chr41409 --1419 --
NM_001037639chr3----134 --
NM_001037872chr21652 ------
NM_001037954chr1142174 390 48 37 12675 ----
NM_001038493chr21404 --2374 36 --
NM_001038640chr153721 398 96 ------
NM_001038702chr532779 1702 1028 --2959 923 --
NM_001038707chr142158 1634 416 178 --11721 1849
NM_001038707chr142158 1634 416 178 --11721 1849
NM_001039350chr741740 1727 1117 31 ------
NM_001039459chr7--1423 ----
NM_001039479chr1462223 1985 786 410 274 26 1514 12284 --
NM_001039538chr222721 212 ------
NM_001039547chr3117464 6336 5834 5640 2906 2826 2817 2141 1864 775 597 47390 5493 5250 2071 27006 1841 --
NM_001039550chr22699 568 --1201 --
NM_001039569chr252979 2614 2577 2525 1222 22904 1282 ----
NM_001039570chr22144134 3955 3933 3831 3486 3451 3440 3271 2972 1441 1303 1175 850 497 52833 1709 1367 1218 774 23750 2956 23687 2893
NM_001039571chr22144134 3955 3933 3831 3486 3451 3440 3271 2972 1441 1303 1175 850 497 52833 1709 1367 1218 774 23750 2956 23687 2893
NM_001039574chr13897 879 823 ----1760
NM_001039583chr222187 105 --1206 --
NM_001039584chr222187 105 --1206 --
NM_001039590chrX43693 1108 212 75 ------
NM_001039591chrX43693 1108 212 75 ------
NM_001039618chr1154363 1398 1167 562 456 --15084 --
NM_001039690chr1692040 1912 783 763 724 609 586 523 349 --1931 --
NM_001039709chr20134906 3618 3346 3256 2022 1931 1766 1609 1566 1054 814 682 483 21946 1432 24080 1782 --
NM_001039711chr12845 364 ------
NM_001039712chr12845 364 ------
NM_001039771chr141813 11087 1103 --
NM_001039840chrX35716 4572 4205 11268 --15365
NM_001039877chr193235 36 24 --1105 --
NM_001039916chr121106 --1389 --
NM_001039917chr121106 --1389 --
NM_001039918chr121106 --1389 --
NM_001039919chr121106 --1389 --
NM_001039920chr121106 --1389 --
NM_001039937chr1321198 723 11164 ----
NM_001040057chr71601 11025 ----
NM_001040110chr711189 11289 --1708
NM_001040118chr11123 ------
NM_001040142chr222412 162 ------
NM_001040143chr222412 162 ------
NM_001040144chr1692040 1912 783 763 724 609 586 523 349 --1931 --
NM_001040146chr1692040 1912 783 763 724 609 586 523 349 --1931 --
NM_001040151chr1173492 1408 1202 1158 703 376 29 23430 514 12774 --
NM_001040152chr732010 367 208 ------
NM_001040153chr132685 67 ------
NM_001040202chr421734 928 --11019 --
NM_001040214chr62365 61 1777 ----
NM_001040272chr932318 1464 33 ------
NM_001040280chr61257 --1349 --
NM_001040284chr1664714 4383 1552 1058 1007 847 14862 ----
NM_001040402chr432504 894 149 ------
NM_001040427chr16155 --168 --
NM_001040439chr1651439 1273 1006 319 250 --3325 138 21 11147
NM_001040440chr5--1210 ----
NM_001040446chr542262 1100 149 89 ------
NM_001040451chr51468 ------
NM_001040452chr51468 ------
NM_001040455chr1171133 1024 838 500 294 237 150 --11143 11171
NM_001040624chr822706 2394 1608 12296 --
NM_001040625chr822706 2394 1608 12296 --
NM_001040626chr822706 2394 1608 12296 --
NM_001040627chr822706 2394 1608 12296 --
NM_001040628chr822706 2394 1608 12296 --
NM_001040629chr822706 2394 1608 12296 --
NM_001040630chr822706 2394 1608 12296 --
NM_001040709chr11112 --2555 435 --
NM_001040712chr912510 ------
NM_001040715chr1641149 1039 798 478 1938 2824 389 --
NM_001040716chr113364 269 26 ------
NM_001042353chr202385 55 ----1494
NM_001042368chr9123 160 1178 --
NM_001042371chr1662105 1770 1543 1511 1383 1334 22029 1559 32014 1574 1339 21741 1678
NM_001042388chr181676 ------
NM_001042403chr121263 --11032 --
NM_001042404chr111891 ------
NM_001042406chr61414 ------
NM_001042413chr943268 2696 1382 289 --1753 --
NM_001042422chr17------185
NM_001042423chr17------185
NM_001042425chr611257 ------
NM_001042472chr201228 --1590 1518
NM_001042473chr1011375 --11510 --
NM_001042486chr2031474 1276 257 --1992 --
NM_001042498chrX1838 --197 --
NM_001042506chrX21078 1004 146 1423 --
NM_001042510chr8--12042 1632 --
NM_001042511chr8--12042 1632 --
NM_001042539chr1621010 965 --11120 --
NM_001042550chr9--1194 ----
NM_001042552chr13933 584 317 1442 ----
NM_001042555chr121436 ------
NM_001042599chr277717 7344 6721 5271 2341 2335 2256 11004 ----
NM_001042601chr32712 695 --1786 --
NM_001042603chr1254931 4030 3246 140 113 --11494 --
NM_001042604chr32504 324 14293 ----
NM_001042632chr2042091 1937 404 395 --21897 298 21042 371
NM_001042633chr2042091 1937 404 395 --21897 298 21042 371
NM_001042663chr161297 1241 1202 1047 965 370 11068 21124 310 --
NM_001042664chr161297 1241 1202 1047 965 370 11068 21124 310 --
NM_001042665chr161297 1241 1202 1047 965 370 11068 21124 310 --
NM_001042669chr431587 86 31 ------
NM_001042681chr142424 2025 745 24 --11616 11745
NM_001042682chr142424 2025 745 24 --11616 11745
NM_001042682chr142424 2025 745 24 --11616 11745
NM_001042728chr122985 357 1785 ----
NM_001043318chr1432908 2826 178 32852 2675 119 11260 1480
NM_001043351chr131608 1599 1453 --12105 --
NM_001044305chr631578 1370 1299 ------
NM_001044385chr253929 3423 2585 1518 461 ------
NM_001044722chr522195 1854 ------
NM_001044723chr522195 1854 ------
NM_001050chr1731304 100 72 ------
NM_001068chr3185 ------
NM_001071775chr1311961 ------
NM_001079874chr12322 110 ------
NM_001080418chr1----1253 --
NM_001083620chr41584 1869 ----
NM_001092chr1721732 429 --11885 --
NM_001094chr172869 89 ------
NM_001095chr1241941 1780 1487 409 --21212 782 --
NM_001099678chr324825 833 35253 4749 4073 12250 12048
NM_001106chr3167636 6943 6638 6615 6171 3787 3658 3418 2813 2719 2690 2294 2105 1945 1178 868 39490 9164 2928 23622 840 --
NM_001111chr132140 2094 195 --11947 12105
NM_001113490chrX33570 1260 932 --23475 2310 --
NM_001117chr1822115 1005 ------
NM_001121chr10----11505 --
NM_001122679chr5--21068 38 ----
NM_001128chr1673583 3416 2479 1082 643 322 204 ------
NM_001146chr81214 ------
NM_001148chr441938 1689 827 426 ----1256
NM_001149chr1011187 ------
NM_001160chr1272378 1099 1085 864 820 775 398 ------
NM_001173chr1433932 1007 390 1718 ----
NM_001174chrX2455 162 ------
NM_001177chr1232059 1927 1777 ----12292
NM_001186chr2142357 2217 673 381 1624 22605 740 --
NM_001191chr2081362 1275 1141 1092 1028 588 423 210 --21376 144 11350
NM_001198chr622338 2035 ------
NM_001200chr202915 836 ------
NM_001204chr237082 4911 1990 14838 ----
NM_001206chr922836 434 ------
NM_001212chr17145 ------
NM_001222chr1061720 1408 625 477 387 62 1357 1397 --
NM_001241chr231861 1506 378 ------
NM_001241chr231861 1506 378 ------
NM_001253chr61257 ------
NM_001256chr1732591 2486 2176 12096 1200 --
NM_001259chr776068 5495 5439 1680 1261 1047 623 --11576 --
NM_001267chr17----136 --
NM_001271chr1542687 2583 769 130 --22850 237 --
NM_001280chr191173 ------
NM_001282chr1752496 2370 623 564 283 12356 ----
NM_001304chr1713519 12762 ----
NM_001310chr1242728 2268 1201 85 ----11892
NM_001313chr44923 809 687 649 --2821 314 --
NM_001319chr192202 109 --1365 1149
NM_001328chr4192 --1113 --
NM_001331chr1141084 1059 919 771 --21845 314 --
NM_001343chr5148 ------
NM_001351chr3----11350 --
NM_001356chrX--1356 ----
NM_001357chr11277 ------
NM_001358chr42457 100 ------
NM_001364chr1164715 3883 3641 2961 1875 1185 --23679 3082 --
NM_001365chr17184 ------
NM_001379chr191117 ------
NM_001382chr11----172 --
NM_001386chr821540 986 1700 11614 --
NM_001390chr1853087 2842 2677 1159 647 ------
NM_001396chr213834 741 695 ----12731
NM_001397chr162586 2326 1640 915 158 93 32435 1083 259 22152 1808 11997
NM_001399chrX53709 3402 3384 1272 578 ----23503 1137
NM_001406chr1731565 1410 202 11404 1671 1677
NM_001408chr131465 1243 1064 ------
NM_001412chrX13162 --22394 366 --
NM_001418chr111660 ------
NM_001418chr111660 ------
NM_001419chr1963913 3210 3170 2998 879 546 11273 ----
NM_001420chr1923123 886 --11182 --
NM_001421chrX41619 1349 348 197 --1335 --
NM_001430chr241439 1420 1397 155 ----11354
NM_001438chr11961 --11175 --
NM_001451chr1611336 --1833 --
NM_001453chr611515 ------
NM_001454chr17----1630 --
NM_001460chr153457 3223 3004 189 166 12284 13312 1453
NM_001482chr152353 286 --129 --
NM_001489chr91209 ------
NM_001494chr102738 227 ------
NM_001495chr841190 1160 472 374 ----1214
NM_001497chr91183 1657 62576 2514 2354 1832 1007 80 --
NM_001498chr62250 41 ------
NM_001521chr22615 52 2571 246 ----
NM_001530chr14197 144 ----
NM_001541chr111134 ------
NM_001542chr162469 2222 1839 1092 905 28 ------
NM_001552chr1731081 1041 952 ------
NM_001584chr111475 ------
NM_001604chr111797 ------
NM_001610chr112528 220 2756 157 ----
NM_001614chr171501 ------
NM_001614chr171501 ------
NM_001616chr22771 296 ------
NM_001618chr1279 34 ------
NM_001619chr113879 820 114 1351 2730 720 2853 126
NM_001620chr111574 --1131 --
NM_001634chr62756 393 ------
NM_001642chr111428 ----1973
NM_001650chr1822737 1010 ------
NM_001655chr1151787 1372 565 512 251 ------
NM_001658chr111060 --1307 --
NM_001659chr1242430 2405 1732 267 --12002 --
NM_001660chr3------1533
NM_001663chr1421769 1755 ------
NM_001664chr3----2899 78 1185
NM_001668chr141829 1482 1403 141 ------
NM_001677chr11362 --1300 --
NM_001678chr1761460 1365 1303 1185 630 467 --21267 542 --
NM_001682chr1232743 1874 277 ------
NM_001683chr332429 464 170 --1273 --
NM_001690chr331913 914 832 22044 690 12420 --
NM_001694chr161436 --1309 --
NM_001699chr193625 616 528 11333 ----
NM_001701chr911428 --11352 --
NM_001707chr72569 60 --129 --
NM_001709chr1152696 2469 876 648 521 ------
NM_001714chr121557 ------
NM_001723chr61240 ------
NM_001743chr2----1469 --
NM_001746chr532368 777 59 12882 ----
NM_001753chr711207 ----11785
NM_001754chr2133896 3464 1416 ----12672
NM_001755chr1622269 739 ------
NM_001759chr1264841 3585 3463 874 675 46 ------
NM_001777chr332644 598 79 --1325 --
NM_001781chr12180 ------
NM_001788chr71902 ------
NM_001792chr1811015 ------
NM_001795chr1621548 993 --2642 307 --
NM_001797chr16122 ------
NM_001802chr162809 231 --1225 --
NM_001806chr1912903 --22540 1885 --
NM_001810chr202591 233 --2572 132 --
NM_001829chr4--1813 1352 --
NM_001839chr11624 ------
NM_001842chr9----1189 --
NM_001858chr644843 1626 788 367 1895 ----
NM_001862chr2175 ------
NM_001878chr1141 --1334 --
NM_001895chr201860 ------
NM_001901chr61918 ------
NM_001904chr31349 1860 ----
NM_001907chr161236 ----184
NM_001918chr1129292 8596 7114 7105 7061 6671 6635 3650 2447 2067 1704 385 55928 3059 2373 1628 309 48135 7197 877 405 13259
NM_001920chr121741 ------
NM_001921chr441261 297 277 229 --11019 1440
NM_001923chr11187 ------
NM_001933chr143856 448 114 ------
NM_001936chr741740 1727 1117 31 ------
NM_001939chrX103701 3688 2490 1523 1096 1057 1040 805 348 293 --21423 98 --
NM_001945chr521350 1070 --11054 --
NM_001949chr652812 2207 1976 369 251 11066 1378 --
NM_001954chr6--1337 1251 --
NM_001956chr14423 401 246 110 ------
NM_001957chr41378 12304 ----
NM_001968chr4--1890 --1267
NM_001969chr1463582 3203 2722 2650 2623 320 --1349 --
NM_001970chr173391 217 194 --4397 85 79 74 --
NM_001973chr12387 370 ------
NM_001981chr11874 --12079 --
NM_001995chr42466 63 ------
NM_002009chr15------11045
NM_002010chr132463 455 ------
NM_002013chr143224 188 52 1272 ----
NM_002015chr1343055 2464 2436 1257 1399 ----
NM_002024chrX2885 159 1461 ----
NM_002025chrX57884 3052 2148 2121 1765 11168 48735 6957 6239 6073 18679
NM_002035chr1833215 2866 1289 23141 79 ----
NM_002037chr62409 149 ------
NM_002040chr213635 364 278 ------
NM_002051chr101455 1870 11040 --
NM_002063chrX21159 356 ------
NM_002065chr12627 534 ------
NM_002069chr71194 ------
NM_002071chr183460 447 139 --1543 --
NM_002077chr91201 --21811 1557 --
NM_002078chr3142 ----1176
NM_002079chr101445 ------
NM_002086chr1731711 1411 113 1647 11804 --
NM_002093chr3169 ------
NM_002103chr194885 833 808 108 --2727 210 --
NM_002112chr151215 ------
NM_002126chr1742986 2791 2573 23 ------
NM_002130chr52270 211 --1609 --
NM_002131chr62403 120 --3530 438 223 --
NM_002137chr71621 ------
NM_002139chrX2673 555 ------
NM_002141chr71213 --1234 --
NM_002145chr17145 ------
NM_002146chr171120 --1157 --
NM_002147chr173746 669 162 --156 --
NM_002148chr21675 ------
NM_002149chr24730 616 596 492 --1200 --
NM_002156chr21115 ------
NM_002167chr13348 340 193 ------
NM_002181chr21564 --2106 74 --
NM_002193chr241666 1288 1282 1174 --2547 380 --
NM_002196chr201378 ------
NM_002196chr201378 ------
NM_002198chr53661 332 284 --2337 211 --
NM_002201chr151101 ------
NM_002203chr51261 --12907 1267
NM_002206chr12158 --123 --
NM_002214chr735469 4679 902 ------
NM_002224chr64736 571 561 103 192 ----
NM_002226chr142656 372 1624 ----
NM_002229chr19----1302 --
NM_002230chr17----2211 159 --
NM_002241chr162859 2810 2070 929 136 32 1686 ----
NM_002247chr1011550 ------
NM_002248chr193549 208 36 1540 1217 --
NM_002253chr421051 312 ------
NM_002254chr211684 12171 --163
NM_002264chr364944 4198 3147 1454 969 307 13911 --11302
NM_002265chr171342 --1426 --
NM_002267chr1311742 11799 ----
NM_002268chr3--21598 120 --1493
NM_002270chr555070 5054 4386 1830 1502 ----1887
NM_002271chr1322252 695 ------
NM_002285chr252969 2937 2787 1487 34 149 23007 2748 --
NM_002309chr2293033 2633 2462 2278 1959 1205 1164 291 141 --32429 1137 972 --
NM_002315chr11295 61 ------
NM_002359chr1774171 3787 3341 3159 2991 1606 1297 --64246 3620 3530 1621 1533 1379 13192
NM_002372chr5194 ------
NM_002373chr151970 ------
NM_002374chr222721 212 ------
NM_002375chr342071 1573 1493 217 32259 2094 505 21612 632 --
NM_002376chr14----1157 --
NM_002380chr81365 ------
NM_002382chr1421113 396 --1404 --
NM_002383chr162833 788 --1943 --
NM_002384chr182297 135 --2730 686 1238
NM_002385chr181376 ------
NM_002387chr564115 1956 1877 1868 308 167 23451 1764 ----
NM_002398chr2--181 ----
NM_002399chr15180 ------
NM_002401chr1731929 851 542 --31874 1795 927 22105 867
NM_002402chr7193 ----1374
NM_002403chr11341 --129 --
NM_002429chr121259 ------
NM_002430chr2222154 1017 ------
NM_002442chr1221233 601 --1188 1300
NM_002448chr41675 ------
NM_002449chr51242 ------
NM_002480chr1211282 ------
NM_002481chr1137849 7428 6897 6605 6103 5387 5208 2997 2136 1985 1691 779 667 22062 341 26284 3159 --
NM_002493chr91216 ------
NM_002499chr1552409 1974 1894 181 128 --1152 --
NM_002501chr1943915 3431 1522 1513 13513 21570 437 --
NM_002505chr611158 1143 11244 --
NM_002507chr1751852 1527 1442 469 182 --21691 1491 --
NM_002508chr12368 90 168 ----
NM_002515chr1441443 1424 766 646 1654 ----
NM_002520chr5171 ------
NM_002522chr1763333 1285 1209 1048 983 398 --32655 2513 707 --
NM_002526chr621632 79 ------
NM_002537chr154992 891 766 340 ------
NM_002547chrX53704 2650 831 653 26 12806 ----
NM_002553chr7298 76 ----1129
NM_002556chr1142016 1522 859 291 ------
NM_002569chr156993 611 563 556 379 154 --21179 1003 1405
NM_002570chr154909 278 220 166 ------
NM_002572chr111345 --1158 --
NM_002576chr1121144 988 1917 ----
NM_002581chr944665 1984 1974 92 ----15227
NM_002586chr6----11085 --
NM_002589chr4184 ------
NM_002594chr2012006 ------
NM_002599chr1141183 1052 918 55 --1961 --
NM_002600chr111152 --1114 --
NM_002601chr22362 173 ------
NM_002605chr152196 81 ------
NM_002609chr55595 497 490 326 168 11734 3586 71 66 --
NM_002613chr16195257 5110 5100 4979 4287 4082 3991 2005 1874 1630 1394 1310 1251 622 600 571 451 427 60 --33645 1525 393 24531 825
NM_002628chr3--1374 ----
NM_002634chr171739 --1835 --
NM_002636chr61181 ------
NM_002641chrX31865 1596 343 ------
NM_002645chr1122527 1214 ------
NM_002646chr152075 1995 1640 1595 880 --2861 136 --
NM_002651chr11226 ----1617
NM_002655chr874030 3290 1978 1058 703 577 352 25259 898 --1373
NM_002657chr2073451 3375 2927 2697 466 280 34 --23413 405 --
NM_002660chr2011147 --1253 --
NM_002687chr1421038 854 ------
NM_002698chr1952513 2452 725 343 130 11919 41022 331 183 57 --
NM_002705chr161169 --141 --
NM_002706chr2----1462 --
NM_002709chr211068 ------
NM_002710chr12182 1965 ----
NM_002711chr71711 ------
NM_002714chr61713 ------
NM_002716chr1143213 3056 2562 2544 --22555 864 --
NM_002717chr8----1476 --
NM_002731chr112920 ------
NM_002736chr732179 2152 1485 1518 1511 --
NM_002745chr2224423 398 1653 179 11786
NM_002750chr10177 ------
NM_002752chr51490 ------
NM_002753chr4--2680 553 ----
NM_002773chr162453 68 --154 --
NM_002775chr103452 380 136 ------
NM_002779chr103513 374 54 ------
NM_002815chr17------1187
NM_002819chr1931447 593 432 ------
NM_002821chr6125 --2297 150 --
NM_002823chr21616 ------
NM_002824chr12----190 --
NM_002826chr13780 714 356 --1269 1103
NM_002832chr141304 1101 222 198 124 1536 --
NM_002833chr1541285 1271 1175 29 ------
NM_002837chr1294500 4400 4255 4179 3612 3338 3256 3247 3203 ------
NM_002839chr912510 ------
NM_002843chr1133423 2211 1131 --12127 --
NM_002844chr621080 504 11071 ----
NM_002845chr181120 ------
NM_002850chr191939 --136 --
NM_002851chr71618 ------
NM_002852chr31147 ------
NM_002854chr222129 22 ------
NM_002858chr121270 346 ------
NM_002867chr14737 648 173 38 1663 ----
NM_002868chr1282335 2204 1962 1656 932 840 717 599 --42008 921 196 113 11634
NM_002869chr112741 47 ------
NM_002883chr224708 254 103 27 --2734 682 1227
NM_002885chr13955 874 294 1156 2996 804 --
NM_002886chr333702 221 109 --1136 --
NM_002895chr201748 1254 --1780
NM_002897chr21692 ------
NM_002906chr11--1206 ----
NM_002918chr193883 389 274 ------
NM_002953chr13801 610 577 ------
NM_002956chr1221399 277 ------
NM_002958chr32964 238 ------
NM_002959chr184143 3202 3151 2816 983 491 203 67 14010 13274 --
NM_002968chr16160 ------
NM_002971chr321131 105 ------
NM_002972chr22------1276
NM_002994chr421215 311 ------
NM_002996chr1641849 427 254 212 --51760 1640 1446 1441 89 21697 1601
NM_002997chr261735 1564 1367 779 353 128 --21895 83 --
NM_002998chr821931 792 ------
NM_002999chr2061840 1576 395 373 229 22 ------
NM_003001chr131403 434 318 ------
NM_003010chr1731627 942 208 ----11969
NM_003016chr1741334 801 600 319 ------
NM_003026chr9--1108 ----
NM_003028chr9103763 3740 3243 2933 2743 2453 1211 1049 346 91 53530 3111 1414 1348 1280 22493 2443 --
NM_003030chr31215 1325 ----
NM_003031chr16125 ------
NM_003034chr1237016 432 393 --26569 6007 --
NM_003036chr11183 --1254 --
NM_003039chr13402 209 29 --1244 --
NM_003043chr393605 3571 3354 3230 2994 1500 1016 808 676 --33408 3178 1487 14019
NM_003045chr1394367 3486 3457 3367 949 811 240 216 194 --73640 3199 1552 1041 1021 858 662 --
NM_003047chr141078 528 380 98 --21048 1000 1370
NM_003071chr31216 --11441 --
NM_003072chr19----1176 --
NM_003074chr361964 1820 1737 1693 1459 230 --1748 --
NM_003076chr1261493 1482 1127 592 446 245 ------
NM_003077chr173694 610 169 ------
NM_003079chr171194 1158 ----
NM_003081chr201227 ------
NM_003091chr201186 1250 ----
NM_003098chr202212 49 ------
NM_003101chr131022 408 358 ----11451
NM_003108chr245663 2656 2427 1922 --12578 --
NM_003110chr173242 193 183 --1418 --
NM_003111chr211222 ------
NM_003112chr742175 1060 506 74 ------
NM_003130chr721030 874 --11198 --
NM_003131chr652121 2036 1605 852 278 129 1464 --
NM_003136chr141352 ------
NM_003137chr621645 208 ------
NM_003139chr113797 664 133 ------
NM_003140chrY1112 ------
NM_003144chr611759 1885 ----
NM_003150chr1762277 2093 2073 1822 1666 678 22147 608 11575 --
NM_003155chr83915 587 465 ------
NM_003156chr1151291 1059 872 864 196 --188 1118
NM_003161chr1732237 1244 688 11062 ----
NM_003173chrX11136 1288 --1933
NM_003178chr332095 1413 644 --11463 --
NM_003179chrX61351 1344 1264 1045 1017 261 --1406 11189
NM_003183chr23593 163 116 1813 ----
NM_003185chr2021101 238 ------
NM_003189chr1123117 2554 2540 2479 2267 2067 1139 980 421 411 309 167 12074 ----
NM_003199chr1843901 3813 3582 1498 ------
NM_003200chr19102315 2127 1903 1794 1725 1618 1581 1455 461 297 --32098 219 53 1205
NM_003204chr174691 650 460 168 ----1174
NM_003216chr22103252 2820 2723 2697 2029 1281 1250 1052 666 163 ------
NM_003220chr611257 ------
NM_003224chr207975 935 868 601 326 66 55 --2804 33 1213
NM_003236chr262968 2772 2736 2236 115 24 12505 1744 --
NM_003239chr141945 --1175 --
NM_003242chr31619 ----12140
NM_003246chr153758 744 650 ------
NM_003247chr6273 47 ------
NM_003253chr211583 --11743 --
NM_003255chr1732165 1625 454 12026 --163
NM_003257chr152910 382 ----1389
NM_003269chr61527 ------
NM_003274chr216971 707 411 147 111 102 --3333 254 81 --
NM_003275chr921059 319 11436 ----
NM_003286chr20--1928 ----
NM_003295chr13148 ------
NM_003317chr142557 117 ------
NM_003319chr21689 ------
NM_003320chr1173744 3630 3494 1453 1422 625 117 1378 63565 2783 1465 1291 506 157 1138
NM_003325chr222509 22 ------
NM_003336chrX2397 28 1449 1402 --
NM_003339chr52646 553 ------
NM_003342chr1743084 2152 745 126 --12872 --
NM_003344chr721122 528 ------
NM_003352chr22700 335 ------
NM_003370chr192225 181 --1583 --
NM_003374chr52604 230 ------
NM_003375chr10146 ------
NM_003376chr6----11501 --
NM_003376chr6----11501 --
NM_003387chr241157 506 396 238 ----11091
NM_003389chr9--3479 388 351 ----
NM_003390chr1111025 ------
NM_003392chr321605 1071 13781 ----
NM_003394chr12197 ------
NM_003400chr22793 117 ------
NM_003403chr141253 ------
NM_003404chr2021317 644 ------
NM_003406chr8--11338 11565 --
NM_003410chrX42290 1957 565 36 ------
NM_003411chrY21325 33 ------
NM_003412chr312243 --11170 --
NM_003418chr3173 ------
NM_003427chr62605 469 ------
NM_003432chr51490 ------
NM_003439chr763542 3001 2631 2333 418 360 23557 2256 --11023
NM_003458chr363424 2927 2745 2640 394 241 2960 133 23057 542 13037
NM_003459chr21569 ------
NM_003470chr1641584 1531 343 46 --11718 1306
NM_003472chr611482 ------
NM_003473chr102679 280 ------
NM_003474chr102592 585 ------
NM_003478chr111489 11340 ----
NM_003482chr1232598 2169 1101 --2900 463 --
NM_003483chr1222439 2404 12346 ----
NM_003485chr1451266 1012 241 181 23 --1273 --
NM_003487chr17183 ------
NM_003488chr174961 806 797 225 ------
NM_003557chr121380 271 ------
NM_003563chr1731113 230 134 --1274 --
NM_003564chr1----1228 --
NM_003574chr1845328 4103 2026 1350 192 25315 4109 14998
NM_003576chr1362678 2629 2446 2355 890 500 ----12526
NM_003582chr11191 ------
NM_003583chr1233478 2860 2686 --13225 --
NM_003589chr1321457 132 --1540 --
NM_003590chr213781 ------
NM_003598chr19------123
NM_003603chr422017 355 --1194 --
NM_003607chr164110 3631 3443 1369 758 419 1432 --13797
NM_003612chr15----2521 79 --
NM_003613chr152236 172 ------
NM_003618chr221187 986 ------
NM_003620chr17----1148 --
NM_003624chr192923 359 --21281 1040 --
NM_003629chr193491 3084 2831 2697 2655 2519 2251 1392 399 11207 12769 --
NM_003632chr173705 238 85 --199 --
NM_003633chr52499 490 ------
NM_003635chr104419 386 342 89 1472 194 --
NM_003644chr17106390 5758 2624 2252 1554 1291 1047 589 540 291 44435 2085 1986 1333 65927 5248 4953 4792 947 365 --
NM_003653chr17147 ------
NM_003655chr17----1121 --
NM_003660chr19182 --1646 --
NM_003663chr323195 2785 13001 ----
NM_003671chr952900 2883 2655 982 291 --1344 --
NM_003673chr173298 82 56 ------
NM_003677chr1252324 1402 646 637 30 1674 ----
NM_003679chr123128 2408 --1854 --
NM_003685chr191633 ------
NM_003688chrX191 ------
NM_003692chr91124 ------
NM_003701chr134795 315 309 108 ------
NM_003704chr41627 ------
NM_003705chr21779 ------
NM_003709chr21300 ------
NM_003711chr5----132 --
NM_003713chr12308 152 ------
NM_003722chr352378 2263 2101 1708 186 ------
NM_003732chr5----197 --
NM_003737chr11199 ------
NM_003740chr63269 210 36 --185 11296
NM_003741chr31280 ------
NM_003744chr1421279 411 ------
NM_003749chr133981 430 301 1568 ----
NM_003766chr172456 210 ------
NM_003768chr141569 1475 1394 162 --2599 114 --
NM_003773chr3----134 --
NM_003774chr1212279 11131 ----
NM_003779chr11333 --1451 1458
NM_003787chr18186 ------
NM_003800chr612083 ------
NM_003829chr9----169 --
NM_003860chr111309 ------
NM_003872chr252936 2603 2556 1869 1049 ------
NM_003873chr103730 674 383 1846 ----
NM_003883chr5175 --1449 --
NM_003885chr1752031 1846 686 556 347 125 1399 1357
NM_003888chr1511079 11195 ----
NM_003902chr11552 ------
NM_003904chr111130 1228 ----
NM_003907chr31323 --148 --
NM_003908chr2011283 ------
NM_003916chrX11053 ------
NM_003924chr421069 235 1385 ----
NM_003927chr18179 --21001 996 --
NM_003929chr141602 1443 708 617 21526 632 --1208
NM_003947chr321087 445 1293 --11250
NM_003948chr42981 204 --1688 --
NM_003949chr1751891 1816 1676 1531 1357 11846 151 --
NM_003953chr142603 2381 472 381 --11902 --
NM_003972chr1011204 --1136 --
NM_003974chr8160 124 1111 --
NM_003975chr11299 198 --1227
NM_003976chr12281 45 --2446 422 --
NM_003981chr153684 187 109 ------
NM_003982chr14251 43 ----1116
NM_003983chr1623351 1650 1791 --21437 462
NM_003987chr1052219 2156 2091 1560 1529 --41726 1547 851 757 --
NM_003988chr1052296 2233 2168 1637 1606 --41803 1624 928 834 --
NM_003989chr1052155 2092 2027 1496 1465 --41662 1483 787 693 --
NM_003990chr1052155 2092 2027 1496 1465 --41662 1483 787 693 --
NM_003994chr1241632 934 417 341 ------
NM_004028chr1822737 1010 ------
NM_004035chr17115057 4999 4519 4510 3713 3359 3313 3275 1797 451 353 24375 1721 ----
NM_004037chr12766 246 1216 2802 331 --
NM_004050chr1412349 --1737 11110
NM_004055chr1152038 1479 1460 1413 462 --32057 2032 22 --
NM_004059chr93390 343 21 ----1382
NM_004062chr16133 --141 --
NM_004069chr193281 272 175 ------
NM_004077chr124468 278 232 170 --1310 --
NM_004081chrY----11376 --
NM_004085chrX194 ------
NM_004086chr141225 ------
NM_004087chr331324 436 232 --11515 --
NM_004089chrX173 ------
NM_004093chr1322710 747 12207 ----
NM_004094chr142223 53 ------
NM_004096chr1031871 380 62 ------
NM_004097chr26201 180 124 94 83 49 ------
NM_004098chr102999 803 ------
NM_004099chr952080 1533 1431 656 357 --11747 --
NM_004100chr622503 2074 --179 --
NM_004112chr1731659 652 237 ----11107
NM_004124chr1422352 1060 13391 ----
NM_004132chr1031211 1136 918 --11034 --
NM_004134chr51471 ------
NM_004156chr8146 ------
NM_004171chr1188750 6642 3706 2608 2191 2101 1289 990 16404 ----
NM_004176chr17148 --1111 --
NM_004186chr33893 634 196 --1950 --
NM_004199chr5----131 --
NM_004200chr114541 444 433 337 --11220 --
NM_004202chrY3641 474 190 ------
NM_004207chr17------185
NM_004209chr164945 814 792 421 --2273 202 2887 849
NM_004225chr811015 ------
NM_004227chr742670 2568 2055 853 3967 230 137 22038 1945 12394
NM_004232chr181701 1419 ----
NM_004233chr61257 --1349 --
NM_004247chr17184 ------
NM_004253chr9--1882 ----
NM_004261chr1--1297 ----
NM_004263chr261540 1534 1508 1337 566 357 --1280 --
NM_004272chr51248 ------
NM_004274chr1431176 72 54 22844 2426 2541 96 --
NM_004276chr121285 ------
NM_004279chr71311 1897 ----
NM_004295chr1731375 912 59 1961 1180 --
NM_004296chr1483947 3808 2951 2600 2585 2579 1221 812 --13298 --
NM_004301chr3----1152 --
NM_004302chr1242678 2536 2332 422 --22251 123 1894
NM_004309chr173892 704 324 --3939 140 127 1146
NM_004311chr1032847 2716 893 --12868 --
NM_004321chr2113585 3422 3151 2647 2507 2477 2332 2236 1354 1208 1183 13404 33242 3170 815 --
NM_004323chr92532 108 22161 463 ----
NM_004326chr13968 930 351 ------
NM_004330chr15--184 --1782
NM_004331chr821643 200 11856 --12413
NM_004337chr822081 75 ------
NM_004343chr19157 1520 ----
NM_004350chr141886 241 153 131 1389 22035 1633 --
NM_004354chr4------1151
NM_004364chr1931276 1259 790 --31253 968 139 --
NM_004379chr221601 46 11525 ----
NM_004380chr1641869 1692 911 191 ------
NM_004384chr522195 1854 ------
NM_004393chr332160 882 79 1820 3361 278 162 22151 706
NM_004394chr521302 31 ------
NM_004395chr56679 316 223 140 128 60 --1501 2550 281
NM_004396chr171276 ------
NM_004397chr1163626 3156 3133 2723 1163 930 12861 ----
NM_004408chr92465 76 ------
NM_004414chr2131274 376 72 ------
NM_004417chr5----1100 --
NM_004420chr1172230 2120 2010 1799 934 905 180 1801 1949 --
NM_004427chr131002 250 160 --1898 128
NM_004429chrX41280 1022 964 218 --21247 306 1480
NM_004430chr822810 778 --21093 107 --
NM_004431chr1158 --1158 --
NM_004432chr9--1945 1701 --
NM_004436chr11113 --170 --
NM_004438chr232610 2045 843 1528 ----
NM_004440chr611257 --156 --
NM_004441chr321146 96 2889 872 ----
NM_004443chr31730 1105 2693 91 --
NM_004449chr2121270 1047 21360 496 ----
NM_004451chr111629 ------
NM_004459chr172669 157 ------
NM_004468chr1154 1597 ----
NM_004472chr51179 ------
NM_004475chr1791154 1085 964 927 767 474 407 342 147 --11104 --
NM_004481chr142682 2251 1792 755 --22466 2078 --
NM_004491chr19134016 3505 3106 2831 1632 1424 1377 1285 862 250 211 109 61 13574 43715 2788 560 362 11669
NM_004494chr131191 77 70 --31233 1104 188 --
NM_004496chr14--11021 ----
NM_004497chr193703 521 289 1206 --1622
NM_004500chr14----11519 --
NM_004501chr163455 2707 2519 1307 758 438 13360 12690 --
NM_004504chr232958 2645 675 ------
NM_004505chr17--11554 ----
NM_004514chr172814 694 --22537 140 --
NM_004516chr1941093 1012 862 201 --1956 --
NM_004521chr101259 --1148 --
NM_004529chr91476 --1958 --
NM_004530chr164475 461 399 164 1349 ----
NM_004537chr12140 ------
NM_004575chr411499 ------
NM_004578chr11837 ------
NM_004583chr17----2635 502 --
NM_004586chrX24050 1572 11496 13667 --
NM_004588chr1183969 3361 3283 972 668 647 439 359 11143 --1607
NM_004602chr2031402 1229 1018 ----1383
NM_004603chr75769 472 434 70 56 ----1102
NM_004612chr934699 3011 289 --13407 --
NM_004615chrX1620 1317 1363 --
NM_004622chr221888 1821 1973 123 --
NM_004630chr112936 326 --1465 --
NM_004631chr111353 1579 --11152
NM_004634chr31104 ------
NM_004635chr361163 1045 413 308 267 70 --41149 1004 396 28 1187
NM_004639chr6191 ------
NM_004642chr121134 ------
NM_004646chr192362 54 ------
NM_004654chrY174 --1219 --
NM_004656chr331099 785 45 --1281 --
NM_004660chrY1939 2409 354 ----
NM_004661chr541198 816 282 252 11234 ----
NM_004666chr6171 ------
NM_004667chr151147 ------
NM_004680chrY--176 ----
NM_004687chr1721950 215 41978 1350 603 88 --1566
NM_004689chr141441 ------
NM_004690chr61681 ------
NM_004694chr171254 ------
NM_004714chr192324 254 ------
NM_004722chr71228 --183 --
NM_004725chr101483 1981 ----
NM_004726chrX44966 2080 1055 699 ------
NM_004734chr1312935 12365 12215 --
NM_004736chr122182 483 11997 ----
NM_004737chr221880 1129 ----
NM_004740chr17140 ------
NM_004742chr3--1158 ----
NM_004745chr8105484 5185 5070 4942 4813 4678 1633 1475 245 229 26288 2415 25012 2506 1235
NM_004747chr1021124 34 ------
NM_004748chr153865 818 238 ------
NM_004757chr42610 448 192 ----
NM_004758chr171382 1224 1863 --
NM_004759chr151965 1799 1412 788 507 --21528 448 2623 216
NM_004772chr511377 ------
NM_004776chr2092941 2089 1177 1139 846 401 356 345 230 --21028 667 --
NM_004779chr5--1277 ----
NM_004781chr141662 1624 1165 707 11396 11694 --
NM_004781chr141662 1624 1165 707 11396 11694 --
NM_004788chr111200 ------
NM_004796chr1421895 300 --1834 --
NM_004798chr2053503 3337 2898 1144 124 ------
NM_004800chr13--1102 ----
NM_004801chr221546 547 ------
NM_004805chr21304 1537 ----
NM_004807chr23790 633 493 --31693 829 290 32004 861 627
NM_004808chr1082996 2488 2459 2376 2332 2294 2241 803 22919 729 12309 --
NM_004822chr1793582 3575 3203 1248 1118 988 566 89 69 --42699 1569 1486 1309 31529 1163 803
NM_004824chr611064 ------
NM_004827chr421601 248 ----1783
NM_004834chr232706 2525 681 --129 --
NM_004836chr22249 242 ------
NM_004839chr15----2543 185 --
NM_004840chrX62159 1539 718 426 405 273 11527 ----
NM_004842chr611782 1230 ----
NM_004845chrX83861 3608 3591 3439 3176 3167 1208 319 1571 11321 13787
NM_004849chr631621 1184 168 1290 ----
NM_004850chr231662 1508 1263 178 ----
NM_004856chr152514 403 ------
NM_004863chr1495299 5015 4747 3334 1605 973 633 312 56 34673 1573 1529 3412 387 381 14238
NM_004871chr1763923 3276 1317 1006 735 49 14004 ----
NM_004879chr111812 ------
NM_004884chr153499 444 94 --21720 706 --
NM_004898chr412016 147 ----
NM_004901chr81221 ------
NM_004904chr755165 2353 1553 1489 120 1586 122 --
NM_004922chr102915 721 ------
NM_004924chr193962 229 178 ------
NM_004925chr9----139 --
NM_004926chr1421756 218 ------
NM_004935chr71184 ----139
NM_004936chr91998 --2730 197 --
NM_004943chr1951129 1070 979 287 194 1378 31203 882 162 --
NM_004952chr13903 229 66 --2763 290 --
NM_004959chr911138 --21180 81 --
NM_004962chr10--1245 1233 --
NM_004965chr21130 ------
NM_004969chr10175 ------
NM_004973chr611584 ------
NM_004975chr202374 195 ------
NM_004976chr1164172 2074 1405 1328 1283 407 15188 65025 2044 1731 1428 1073 395 11659
NM_004978chr171560 1542 1486 472 434 215 149 --1391 11423
NM_004979chrX2856 400 1150 3455 277 249 --
NM_004985chr1211159 ------
NM_004992chrX126594 5936 5904 5864 5662 5528 5256 2655 2231 1641 1039 539 52861 1661 742 722 564 88163 7085 6054 2838 1451 818 699 574 11906
NM_004992chrX126594 5936 5904 5864 5662 5528 5256 2655 2231 1641 1039 539 52861 1661 742 722 564 88163 7085 6054 2838 1451 818 699 574 11906
NM_004993chr141955 1390 ----
NM_004995chr1451302 1184 1069 487 140 --1145 --
NM_004998chr151638 ----1678
NM_004999chr623918 954 13844 ----
NM_005010chr721869 621 ----1888
NM_005011chr711189 11289 --1708
NM_005016chr12--1247 ----
NM_005020chr72463 156 ------
NM_005023chr5--1553 ----
NM_005025chr31186 ------
NM_005053chr191168 1421 1479 --
NM_005056chr1255175 4274 3490 384 357 --11738 --
NM_005057chr121386 48 11857 ----
NM_005060chr141041 147 107 36 --11083 145
NM_005067chr34736 348 191 147 ------
NM_005072chr16240 22 --1114 1417
NM_005078chr152685 283 11342 ----
NM_005087chr31253 ------
NM_005093chr20134906 3618 3346 3256 2022 1931 1766 1609 1566 1054 814 682 483 21946 1432 24080 1782 --
NM_005096chrX3221 200 157 --11184 --
NM_005099chr141121 1067 985 976 --1157 --
NM_005103chr111279 ------
NM_005104chr61540 --1136 --
NM_005105chr121524 542 1887 ----
NM_005109chr312145 3331 267 70 1889 --
NM_005114chr42714 622 ------
NM_005116chr20103674 1583 848 784 690 580 560 337 236 22 --32917 729 700 21704 493
NM_005119chr12830 187 ------
NM_005121chr1712812 13679 ----
NM_005124chr61272 ------
NM_005133chr11182 ------
NM_005134chr181676 ------
NM_005153chr16184 ------
NM_005155chr62156 55 1566 ----
NM_005156chr923425 3375 --24550 3568 14375
NM_005160chr2275919 5785 5500 5440 5049 2641 2575 12485 11116 15024
NM_005176chr12145 1101 ----
NM_005182chr162545 505 ------
NM_005184chr191325 1587 21305 1076 --
NM_005187chr1691910 1903 1878 1871 1846 1839 1814 1807 1775 --31573 96 82 --
NM_005188chr11127638 7088 7004 6904 5705 5427 5218 5062 3311 2330 1050 816 11266 27686 1843 --
NM_005190chr61916 ------
NM_005197chr1445846 5483 4054 803 12287 ----
NM_005202chr141558 1503 748 118 --4357 278 187 30 --
NM_005203chr102325 22 ------
NM_005206chr1711273 11199 ----
NM_005207chr2273546 2753 2393 1409 1214 785 484 ----1870
NM_005219chr541352 1323 500 236 21439 641 2418 138 --
NM_005220chr172970 545 1306 ----
NM_005224chr191713 ------
NM_005225chr2051209 923 491 155 75 ------
NM_005229chrX2500 382 ----11153
NM_005233chr322550 478 ------
NM_005235chr277717 7344 6721 5271 2341 2335 2256 11004 ----
NM_005238chr1132780 2643 272 ------
NM_005239chr2141908 1609 295 133 11861 ----
NM_005241chr3150 ------
NM_005243chr22195 ------
NM_005254chr15------11339
NM_005256chr11139 ------
NM_005266chr131304 528 108 --1302 --
NM_005273chr71293 ------
NM_005276chr12--11087 11462 --
NM_005276chr12--11087 11462 --
NM_005279chr21123 ------
NM_005281chr12963 878 --1176 --
NM_005312chr972394 2387 1771 1085 959 449 123 --32346 2171 1014 --
NM_005324chr1711830 ------
NM_005326chr16155 --168 --
NM_005329chr1632022 1887 162 1118 ----
NM_005336chr232208 181 151 1440 1298 1270
NM_005347chr941550 1430 353 207 ------
NM_005359chr1896436 5905 5659 5149 4298 2329 2291 2282 2239 1209 24835 2374 --
NM_005374chr1751748 496 399 149 109 42192 892 849 25 22027 1580 --
NM_005376chr1------11088
NM_005386chr201739 ------
NM_005388chr931438 533 84 ------
NM_005398chr103915 130 23 1930 ----
NM_005399chr11402 --1881 --
NM_005400chr272897 2495 2480 2314 1922 733 551 ------
NM_005402chr721650 237 ------
NM_005407chr142491 182 1567 21262 547 --
NM_005424chr1234 26 ------
NM_005436chr1053812 2589 486 328 248 2626 309 1739 --
NM_005438chr11----2206 77 --
NM_005445chr10191 ------
NM_005456chr113700 564 59 --2714 594 1136
NM_005458chr95927 789 438 374 88 --1117 --
NM_005461chr2021689 351 --1532 --
NM_005474chr1731505 1209 612 ------
NM_005475chr1262562 2463 1167 1013 725 199 12657 22145 1297 --
NM_005477chr1532475 2209 809 1708 12008 22414 2226
NM_005477chr1532475 2209 809 1708 12008 22414 2226
NM_005487chr2241621 638 92 86 --11494 --
NM_005497chr17135558 5467 5216 4908 4854 4827 4312 4223 2464 1832 828 460 90 34790 4238 119 ----
NM_005502chr943068 1096 976 215 ------
NM_005503chr154919 901 861 450 11029 1119 --
NM_005505chr122736 36 1291 1349 --
NM_005507chr111457 --2322 199 --
NM_005512chr111104 11702 11511 11714
NM_005522chr71138 ------
NM_005523chr741548 1525 1440 993 ------
NM_005529chr13972 334 194 --11001 --
NM_005530chr1531503 1299 1290 --1126 --
NM_005537chr132835 389 ------
NM_005540chr111356 41388 1205 1125 642 ----
NM_005544chr21296 ------
NM_005550chr163574 482 168 --2567 44 --
NM_005552chr141159 123 ----
NM_005573chr51134 ------
NM_005576chr151245 ------
NM_005581chr191311 --2412 347 --
NM_005595chr11318 ------
NM_005596chr9--15381 ----
NM_005599chr11160 1100 ----
NM_005603chr18--2520 221 ----
NM_005604chr632345 669 57 --12048 --
NM_005614chr71728 ------
NM_005631chr721040 405 ----1149
NM_005637chr1831913 1831 1822 ------
NM_005647chrX63254 2795 2606 1181 1139 135 --11340 --
NM_005659chr22--1425 ----
NM_005660chrX124 156 130 --
NM_005662chr82363 68 ------
NM_005663chr4123 --193 --
NM_005668chr554337 3061 951 907 817 ------
NM_005670chr62434 371 1206 ----
NM_005686chr151125 517 471 374 190 --21024 23 --
NM_005690chr121127 ------
NM_005692chr7------167
NM_005698chr11101 --124 --
NM_005707chr153975 886 159 3901 287 26 ----
NM_005711chr511006 ------
NM_005718chr36767 654 567 210 201 25 --2794 354 --
NM_005720chr71247 ------
NM_005724chr15176 ------
NM_005736chr104283 277 198 146 11311 2381 227 --
NM_005737chr232734 2092 1983 --22202 682 --
NM_005738chr7145 1465 ----
NM_005746chr742250 2191 773 524 ------
NM_005748chr1212134 12688 ----
NM_005749chr171220 ------
NM_005759chr264594 3764 3755 3338 1915 1478 1423 ----
NM_005776chr14--125 ----
NM_005778chr31192 2305 46 1478 --
NM_005779chr513278 12491 --1762
NM_005785chr1231643 501 487 ------
NM_005786chr181977 --2104 67 --
NM_005789chr17193 ----140
NM_005795chr221900 571 ------
NM_005797chr11--11618 ----
NM_005807chr1--1245 ----
NM_005814chr141322 945 501 225 --51176 507 250 161 62 --
NM_005822chr642053 669 437 378 ------
NM_005826chr1145 ------
NM_005828chr1774086 3918 3304 3290 1828 325 153 --2733 617 --
NM_005840chrX137681 7293 7155 6407 5396 5197 5156 5007 4672 2802 2707 1621 1506 11112 17354 --
NM_005850chr11176 ------
NM_005851chr111151 --169 --
NM_005852chr1711107 --1406 --
NM_005853chr16150 ------
NM_005859chr511305 ------
NM_005868chr71234 --12524 --
NM_005876chr22689 127 --1696 1660
NM_005877chr222755 747 --21871 717 --
NM_005884chr193717 698 514 ------
NM_005892chr17----1363 --
NM_005896chr2----3744 663 658 --
NM_005897chr121113 155 1958 ----
NM_005898chr113589 557 44 ------
NM_005901chr1888582 8011 3177 3044 2789 2175 1543 71 ------
NM_005905chr131342 ------
NM_005909chr521150 739 11095 12798 --
NM_005910chr1753621 3560 3158 972 162 --43728 1525 860 403 13921
NM_005911chr221321 1281 ------
NM_005916chr7----147 --
NM_005920chr193136 2863 2770 2712 1225 1145 907 668 255 --1586 --
NM_005933chr1132451 2214 373 ------
NM_005935chr454471 4457 3546 3271 1274 --31929 1809 213 14903
NM_005937chr1743744 3161 3111 940 --43119 671 194 53 --
NM_005938chrX4515 439 346 125 ----11365
NM_005941chr814159 --1150 --
NM_005943chr63532 474 394 1467 41483 1403 1388 188 --
NM_005944chr32949 37 11121 ----
NM_005955chr195228 4554 3765 2137 2055 2003 1889 1448 1321 11916 23771 666 25160 642
NM_005962chr1032119 1458 403 11950 ----
NM_005962chr1032119 1458 403 11950 ----
NM_005964chr1721412 422 ------
NM_005984chr223451 403 127 --2462 336 2373 208
NM_006007chr923940 3787 11754 1685 13740
NM_006011chr1563945 3793 3113 1688 692 345 130 23145 2949 --
NM_006015chr11909 ------
NM_006016chr621679 337 ------
NM_006022chr13126 ------
NM_006030chr341652 1241 142 123 11412 ----
NM_006033chr1832212 2135 139 --1360 --
NM_006035chr1431005 499 43 11152 1923 --
NM_006036chr21480 ------
NM_006037chr294658 3533 3326 3313 3152 1833 1030 634 517 --24144 822 --
NM_006038chr2061658 1575 646 557 506 138 ----11858
NM_006039chr1711043 2941 96 3814 253 68 --
NM_006043chr161762 --198 --
NM_006047chr201946 ------
NM_006048chr11967 --1505 --
NM_006058chr5123 --1529 --
NM_006062chr2--1209 41185 891 246 160 1504
NM_006070chr3144 ------
NM_006091chr1511102 11322 ----
NM_006094chr82711 480 --1824 --
NM_006095chr444450 3840 868 711 ----192
NM_006096chr82379 48 11387 11568 --
NM_006099chr13750 138 99 ----1769
NM_006106chr112451 203 ------
NM_006113chr12322 110 ------
NM_006133chr1191835 1540 757 746 505 473 446 364 47 31581 547 427 82113 1923 1779 1675 1646 1555 988 202 --
NM_006141chr1662799 2722 1817 1092 1010 234 1723 --1905
NM_006145chr192355 295 1772 ----
NM_006148chr1752865 2438 1821 840 285 --22908 1961 --
NM_006153chr31209 ------
NM_006156chr141182 --1263 --
NM_006160chr171169 11373 ----
NM_006164chr21324 ------
NM_006167chr841848 1674 457 239 1657 ----
NM_006170chr12--127 ----
NM_006178chr1731285 420 384 159 ----
NM_006180chr91325 --1818 12109
NM_006185chr11124 --4164 157 152 58 1193
NM_006186chr22353 224 ------
NM_006190chr22882 170 ------
NM_006191chr122849 184 ------
NM_006195chr91320 ------
NM_006196chr2169 1237 ----
NM_006201chrX2184 164 ------
NM_006203chr513455 14791 --14334
NM_006206chr432587 2433 2131 ------
NM_006216chr21642 ------
NM_006224chr1742070 1922 795 708 --12319 --
NM_006237chr133882 862 826 --1887 --
NM_006243chr11866 ------
NM_006245chr63809 168 84 --160 --
NM_006247chr192321 181 ------
NM_006251chr522208 707 ----11042
NM_006252chr135732 4951 1102 14875 11090 11839
NM_006256chr132770 1850 176 ------
NM_006258chr1021343 228 ------
NM_006266chr9123 160 1178 --
NM_006268chr1121113 376 1236 2941 181 --
NM_006272chr213618 476 466 --1228 --
NM_006275chr20178 12232 ----
NM_006279chr11231 ------
NM_006282chr2064552 3328 1360 1341 722 625 ------
NM_006283chr834470 4361 778 1447 24296 3920 --
NM_006285chr92273 37 --1278 --
NM_006292chr111158 ------
NM_006293chr15258 33 1414 ----
NM_006301chr12--1569 ----
NM_006302chr2169 --146 --
NM_006306chrX55102 5094 5036 3875 3658 --42205 840 207 97 --
NM_006321chr352031 1974 792 747 517 1709 2575 212 --
NM_006322chr131219 ------
NM_006324chr161220 ------
NM_006328chr11----1215 187
NM_006336chr92398 278 --11327 --
NM_006352chr121760 440 ------
NM_006354chr32133 87 ----135
NM_006375chrX11574 ------
NM_006379chr732327 1489 197 ------
NM_006380chr1733799 3600 2675 23510 2985 --2223 112
NM_006382chr171245 ------
NM_006383chr153229 132 68 1210 ----
NM_006386chr2232329 2048 1807 ------
NM_006387chr193456 391 60 ------
NM_006389chr1121193 90 --11056 --
NM_006411chr63823 371 185 ------
NM_006415chr9379 67 23 ------
NM_006421chr81198 ------
NM_006434chr1052209 1013 964 863 747 ------
NM_006454chr482932 2784 2263 2227 877 756 248 24 ------
NM_006457chr473925 3242 1574 1227 1095 615 114 21153 539 ----
NM_006458chr11268 23 ------
NM_006459chr1031923 1807 596 141 ----
NM_006460chr1721743 129 11764 ----
NM_006475chr131264 ------
NM_006482chr1233478 2860 2686 --13225 --
NM_006483chr192324 254 ------
NM_006484chr192324 254 ------
NM_006489chr1441443 1424 766 646 1654 ----
NM_006492chr1--1339 ----
NM_006493chr1361447 1412 1315 615 586 194 ------
NM_006500chr1141192 996 387 169 --1328 --
NM_006504chr1042549 2269 1913 688 1780 --1856
NM_006510chr62850 345 1337 ----
NM_006517chrX32044 1716 1568 --21765 255 --
NM_006519chr6122 ------
NM_006520chrX21575 1247 ------
NM_006527chr4159 ------
NM_006532chr193545 536 247 1630 2553 147 --
NM_006538chr284082 4009 3408 3016 3003 1405 1161 995 1784 ----
NM_006539chr162426 84 ------
NM_006540chr81409 --21093 136 --
NM_006546chr1785391 5257 5234 5210 5144 5094 2001 997 1200 36244 5894 2131 16568
NM_006547chr721803 721 ------
NM_006548chr321513 436 11254 ----
NM_006549chr1262552 2489 2402 2389 453 211 --52641 2558 1935 1930 522 11948
NM_006555chr771838 1559 1517 1442 1371 262 115 ------
NM_006559chr12172 126 ------
NM_006561chr1046224 5551 5133 2241 1574 15052 --
NM_006566chr183369 363 322 ------
NM_006575chr141433 ------
NM_006587chr4151 ------
NM_006589chr12422 87 ------
NM_006599chr1676877 6801 6257 2878 941 916 489 ------
NM_006601chr121908 ------
NM_006608chr1131 ------
NM_006609chr232393 2334 1829 ------
NM_006621chr121753 180 ----11268
NM_006622chr51132 ------
NM_006624chr1011924 ------
NM_006625chr12732 97 1377 ----
NM_006625chr12732 97 1377 ----
NM_006625chr12732 97 1377 ----
NM_006626chr912073 ------
NM_006628chr1564392 3943 3647 3638 967 517 13504 --11491
NM_006634chr23184 52 42 --1159 --
NM_006640chr1741838 1697 1471 661 --1280 --
NM_006650chr5103603 2991 2782 1017 945 619 441 392 129 109 12808 53711 2710 634 506 446 --
NM_006654chr121436 ------
NM_006677chr33226 214 178 ----134
NM_006690chr2082079 1894 1672 1462 453 355 79 36 2642 148 31999 1977 430 --
NM_006698chr203307 249 130 --11261 --
NM_006699chr122602 370 ------
NM_006706chr51657 ------
NM_006708chr61872 11149 ----
NM_006713chr51261 ------
NM_006717chr921272 1156 1908 ----
NM_006722chr312724 12995 ----
NM_006726chr421104 194 ------
NM_006729chrX54198 4105 2214 1981 1493 ------
NM_006734chr611324 ------
NM_006736chr231709 1578 590 1369 11211 --
NM_006738chr15104582 4103 3928 1430 1059 922 826 494 275 43 13516 41534 1135 972 245 --
NM_006742chr1671926 1769 1543 686 545 381 42 1101 61856 1290 620 306 241 125 --
NM_006749chr83882 826 94 ------
NM_006750chr16116438 5896 5824 5733 2198 2160 1939 1144 1137 595 183 25748 295 11149 12244
NM_006761chr17----1215 --
NM_006763chr131530 849 199 --1458 --
NM_006764chr3276 42 ------
NM_006771chr173743 81 27 1232 1932 --
NM_006772chr61452 --21551 703 --
NM_006775chr622436 351 ------
NM_006777chrX62912 2805 2797 2424 780 624 ------
NM_006788chr1852094 1325 770 623 520 --21991 1960 1552
NM_006791chr15--1503 ----
NM_006801chr192647 283 --1631 --
NM_006805chr51423 ------
NM_006807chr171892 ------
NM_006809chr202783 136 ------
NM_006813chr63766 742 629 ------
NM_006815chr121894 ------
NM_006823chr821346 1280 --1327 1405
NM_006827chr1442688 2644 2354 1314 ----170
NM_006828chr61179 ------
NM_006833chr72278 132 ------
NM_006851chr1222469 948 ------
NM_006852chr171702 ------
NM_006856chr123859 804 274 ------
NM_006861chr1251721 1660 670 619 335 --11785 --
NM_006870chr201209 ------
NM_006874chr41813 --1819 --
NM_006875chrX1230 --124 --
NM_006884chr31215 1325 ----
NM_006885chr16--1956 ----
NM_006888chr1452295 545 528 304 186 ------
NM_006898chr21591 ------
NM_006901chr151106 ------
NM_006906chr11----1140 --
NM_006922chr222025 393 ------
NM_006924chr1723435 741 ------
NM_006930chr51576 11824 ----
NM_006931chr1231786 1372 256 11721 12055 --
NM_006939chr1411148 ------
NM_006940chr1241567 1351 1255 1181 ------
NM_006941chr222896 827 ----1149
NM_006950chrX3855 801 770 --1175 --
NM_006981chr932029 1014 439 1767 1152 --
NM_006991chr31871 1155 ----
NM_006999chr541948 1417 792 762 ----11612
NM_007007chr1233526 3094 279 ------
NM_007010chr1731923 647 233 ------
NM_007011chr1586363 5471 5301 4592 4245 2427 2312 2290 25396 2457 34480 4226 938 24207 2204
NM_007013chr81291 ------
NM_007030chr5125126 5063 4520 4450 4401 1810 1732 1577 1382 1001 439 328 24676 983 --14481
NM_007047chr682394 2090 1904 1603 756 635 255 22 1736 ----
NM_007050chr2097795 7636 6414 2309 1912 1858 1090 653 134 26629 6238 32819 2786 290 --
NM_007054chr563853 2946 2858 2849 1257 1166 11181 22935 2632 --
NM_007067chr1721165 375 --1143 --
NM_007073chr683593 2965 1589 1580 1545 1523 1510 817 ------
NM_007078chr1072941 2616 2008 1233 971 844 692 12540 --1663
NM_007084chr132546 353 ------
NM_007112chr1147 ------
NM_007122chr11510 1436 ----
NM_007124chr631458 565 98 1107 ----
NM_007125chrY1373 ------
NM_007126chr9----132 --
NM_007137chrX74599 4262 1986 1659 1437 821 803 25079 4295 --15368
NM_007146chr1722916 2756 12199 12115 --
NM_007158chr141040 1021 1004 341 ------
NM_007159chr3--1278 ----
NM_007162chr61134 --2461 396 --
NM_007166chr1121384 1055 ------
NM_007170chr12863 58 ------
NM_007173chr112713 166 ------
NM_007174chr124842 681 620 563 11903 11697 1115
NM_007185chr12238 130 --3734 203 64 --
NM_007191chr12----1107 --
NM_007200chr15104582 4103 3928 1430 1059 922 826 494 275 43 13516 41534 1135 972 245 --
NM_007203chr922889 1400 ------
NM_007207chr11665 ------
NM_007216chr111390 ------
NM_007218chr81184 ------
NM_007219chr202920 845 1876 1888 --
NM_007221chr11377 155 2327 68 --
NM_007222chr811425 --1624 --
NM_007235chr12187 ------
NM_007236chr1541895 1678 831 739 22225 1544 1801 --
NM_007245chr161296 --1115 --
NM_007247chr171828 ------
NM_007249chr1338583 2737 731 --16895 --
NM_007275chr321149 318 1125 ----
NM_007282chr31978 ------
NM_007283chr352586 1907 710 447 437 23024 1107 ----
NM_007286chr541999 1900 1372 258 --42099 558 484 81 --
NM_007292chr17115057 4999 4519 4510 3713 3359 3313 3275 1797 451 353 24375 1721 ----
NM_007294chr174364 155 112 60 1855 ----
NM_007295chr174364 155 112 60 1855 ----
NM_007296chr174364 155 112 60 1855 ----
NM_007297chr174364 155 112 60 1855 ----
NM_007298chr174364 155 112 60 1855 ----
NM_007299chr174364 155 112 60 1855 ----
NM_007300chr174364 155 112 60 1855 ----
NM_007302chr174364 155 112 60 1855 ----
NM_007303chr174364 155 112 60 1855 ----
NM_007304chr174364 155 112 60 1855 ----
NM_007305chr174364 155 112 60 1855 ----
NM_007327chr92167 159 --2975 820 --
NM_007349chr7257 49 ------
NM_007358chr131968 1578 76 ------
NM_007373chr1011173 ------
NM_007375chr132650 2622 1750 ------
NM_012062chr121127 ------
NM_012063chr121127 ------
NM_012081chr5--23245 730 1188 --
NM_012084chrX2431 410 ------
NM_012095chr1063087 2666 2251 1326 557 338 ------
NM_012098chr941310 1070 62 53 ------
NM_012102chr142424 2025 745 24 --11616 11745
NM_012104chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_012104chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_012127chr9----126 --
NM_012134chr12556 92 11863 11668 --
NM_012141chr1321198 723 11164 ----
NM_012156chr2042655 2541 1374 1306 11110 33245 2292 775 43003 2157 1073 33
NM_012158chr1311460 ------
NM_012164chr975496 2881 2501 2457 2419 2410 626 12276 1859 --
NM_012193chr1195189 5078 4138 4129 3410 3286 1997 1315 1181 13996 34219 3688 1550 --
NM_012197chr9162 ------
NM_012199chr184148 4007 3644 3319 2989 2947 1769 1384 11555 33513 1051 246 13752
NM_012207chr10144 ------
NM_012214chr254319 2284 1708 1674 1347 32330 2009 1273 16337 --
NM_012215chr1031839 1804 1289 ------
NM_012216chrX----130 --
NM_012224chr41447 ------
NM_012234chr323570 154 11038 ----
NM_012247chr10--1926 ----
NM_012250chr1131078 1051 136 ------
NM_012257chr71390 ------
NM_012259chr61571 ------
NM_012261chr201503 ------
NM_012262chr165163 4006 3730 3641 208 161 ----14933
NM_012264chr2241479 808 530 400 1209 21689 1549 1726
NM_012264chr2241479 808 530 400 1209 21689 1549 1726
NM_012268chr191110 --1242 1251
NM_012281chr731869 219 40 1925 ----
NM_012284chr12------1116
NM_012285chr171119 --1110 --
NM_012288chr674964 1737 1448 1111 716 487 268 14580 44649 1234 1067 960 14546
NM_012290chr211262 ------
NM_012294chr712600 13408 --11388
NM_012297chr42789 423 ------
NM_012300chr542510 2098 351 51 ------
NM_012301chr7--1569 ----
NM_012304chr542166 1953 1690 635 --22483 134 --
NM_012306chr1273161 3007 2824 1126 653 554 398 --53500 3296 2310 1237 1058 13132
NM_012307chr18------1912
NM_012308chr1121670 363 22350 1029 11716 --
NM_012309chr1174026 1747 805 636 629 458 289 11010 --1183
NM_012316chr1134612 4565 4519 4406 4141 4100 2243 2029 1427 1391 1307 1079 970 14940 --11972
NM_012324chr222746 26 ------
NM_012325chr2021613 1555 ------
NM_012329chr171247 ----11160
NM_012333chr111686 --1648 --
NM_012334chr551689 1680 1636 1235 127 11358 2915 64 24089 55
NM_012347chr632413 1938 559 --12618 --
NM_012384chr2031502 808 41 2671 644 22201 91 --
NM_012392chr12567 47 --1531 --
NM_012399chr2211254 ------
NM_012402chr1161217 1128 282 211 123 104 11143 1491 --
NM_012405chr182859 1212 1184 853 738 716 545 72 12676 12359 --
NM_012407chr222187 105 --1206 --
NM_012410chr164350 150 107 91 --1383 --
NM_012412chr72854 770 ------
NM_012414chr11165 ------
NM_012421chr1----132 --
NM_012425chr1022569 279 12201 125 --
NM_012433chr21106 ------
NM_012437chr11474 ------
NM_012448chr173941 823 350 ----11987
NM_012454chr61196 ------
NM_012479chr732039 782 336 ------
NM_013229chr1272378 1099 1085 864 820 775 398 ------
NM_013230chrY----11432 --
NM_013231chr1442933 2907 1334 445 --1706 --
NM_013233chr21965 ------
NM_013240chr2144101 3665 2663 1028 14009 13131 12522
NM_013246chr112314 289 --1115 --
NM_013253chr111127 ------
NM_013254chr121615 ------
NM_013262chr611147 ------
NM_013267chr122450 47 ------
NM_013269chr1211427 --11736 --
NM_013275chr161134 --1243 1165
NM_013277chr123758 689 210 ------
NM_013279chr1152008 944 628 336 176 1596 21816 119 --
NM_013281chr2021303 448 ------
NM_013304chr16148 ------
NM_013309chr1522174 2029 12098 ----
NM_013323chr1731214 1127 414 --1463 --
NM_013334chr3121 --160 --
NM_013336chr371757 1616 1298 749 649 617 502 11588 ----
NM_013341chr211092 12542 ----
NM_013354chr821402 211 1117 ----
NM_013357chr8197 ------
NM_013368chr192112 49 ------
NM_013372chr1532880 1288 836 12262 ----
NM_013381chr1212157 ------
NM_013382chr1431850 1492 878 11870 2848 624 --
NM_013403chr193235 36 24 --1105 --
NM_013434chr261945 1859 1842 1460 446 213 --31669 1639 1525 11729
NM_013434chr261945 1859 1842 1460 446 213 --31669 1639 1525 11729
NM_013444chrX151 ------
NM_013446chr73410 359 27 ------
NM_013447chr1932550 1513 571 31528 913 241 ----
NM_013448chr142499 114 ------
NM_013449chr1232921 2861 2765 ------
NM_013450chr211128 ------
NM_013958chr81165 ------
NM_013959chr81165 ------
NM_013960chr81577 ------
NM_013961chr81165 ------
NM_013962chr81165 ------
NM_013986chr22195 ------
NM_013989chr1464751 4648 4418 1460 1067 404 34521 3608 1103 13282 --
NM_013993chr6--1337 1251 --
NM_013994chr6--1337 1251 --
NM_013995chrX2835 70 11974 --12518
NM_014001chr1741474 1106 253 180 1499 170 1516
NM_014011chr21508 ------
NM_014021chr1--13403 ----
NM_014023chr1022948 959 ------
NM_014028chr632784 2634 2553 ------
NM_014030chr1751071 1043 903 787 45 --1941 --
NM_014042chr114257 225 98 21 ------
NM_014057chr9----1371 --
NM_014106chr1542870 2326 773 729 ------
NM_014112chr82538 395 --11607 --
NM_014155chr1177100 6977 1806 1500 1463 1027 670 16065 27437 6584 --
NM_014166chr131112 ------
NM_014182chr121628 1485 ----
NM_014212chr12----1125 --
NM_014216chr141500 1195 21653 1170 21441 1055
NM_014231chr1251868 1800 1469 458 400 ------
NM_014232chr1721058 554 --31177 544 395 --
NM_014232chr1721058 554 --31177 544 395 --
NM_014233chr171521 --21609 104 1270
NM_014240chr363422 3412 2974 1291 1265 70 23688 3660 11375 --
NM_014243chr4------1146
NM_014245chr35917 908 685 221 128 ----11001
NM_014250chr2241621 638 92 86 --11494 --
NM_014255chr12125 ------
NM_014267chr111653 ------
NM_014275chr52848 620 --2594 153 --
NM_014279chr92308 269 ------
NM_014284chr12877 130 --4789 431 314 85 --
NM_014286chr973412 2774 2709 2554 2411 800 520 11292 32589 2269 1280 12444
NM_014288chr11220 ------
NM_014289chrX21051 404 ------
NM_014292chr2281601 1543 1472 1464 1395 1367 658 120 --1607 --
NM_014294chr821009 366 ------
NM_014299chr1951987 1515 726 247 210 --11387 --
NM_014309chr2285370 4366 2016 1603 1596 1461 490 44 ------
NM_014314chr92479 368 ------
NM_014315chr14--1136 ----
NM_014319chr121569 ------
NM_014323chr222921 379 ------
NM_014325chr1241645 1452 627 74 --1606 --
NM_014331chr446567 6329 5181 2342 16810 27223 5795 --
NM_014333chr1111136 --138 --
NM_014345chr62793 260 ----1310
NM_014360chr14----1610 --
NM_014361chr11--1512 1363 --
NM_014368chr91382 --21775 158 --
NM_014372chr1----1573 --
NM_014399chr72952 265 1805 ----
NM_014400chr191390 --144 199
NM_014405chr1752244 696 655 605 146 1564 32196 298 124 --
NM_014415chr31153 ------
NM_014417chr192212 71 1852 ----
NM_014423chr554885 4290 3828 1854 171 --11307 --
NM_014447chr421477 328 ------
NM_014452chr61986 ------
NM_014454chr6----1889 --
NM_014462chr8269 25 ------
NM_014469chr112715 600 ------
NM_014470chr121513 --1301 --
NM_014488chr11186 ------
NM_014491chr71308 ------
NM_014494chr161890 --12042 --
NM_014498chr31330 ------
NM_014507chr2241115 892 793 202 --21191 1083 1192
NM_014515chr122972 854 194 ----
NM_014554chr12------12218
NM_014567chr16----2327 59 --
NM_014574chr141229 ------
NM_014575chr31142 ------
NM_014592chr5--2696 175 ----
NM_014601chr1961095 1057 1048 467 33 22 --11283 --
NM_014604chr172287 79 --5554 169 143 138 124 --
NM_014613chr532648 811 261 1739 ----
NM_014614chr221397 74 ------
NM_014615chr161987 ------
NM_014636chr953533 2866 1110 796 142 13597 1824 --
NM_014646chr1852485 978 492 461 34 --62789 2113 2092 612 126 66 --
NM_014647chr1621494 563 ------
NM_014659chr1531010 331 221 ------
NM_014661chr10103452 2709 2472 1373 1326 1053 991 783 576 433 11390 63850 3482 2596 1202 623 171 --
NM_014665chr832660 2334 347 12602 22753 295 --
NM_014667chr312391 1406 11619 --
NM_014671chr71618 ------
NM_014674chr342887 1399 1228 514 ----12648
NM_014676chr11415 ----148
NM_014677chr8------1251
NM_014680chr172532 140 ----145
NM_014686chr1932013 548 179 --1237 1918
NM_014690chr763074 2893 2275 800 461 454 --12439 --
NM_014693chr31752 ------
NM_014694chr92641 204 ----1107
NM_014702chr633501 3250 528 ------
NM_014705chr71418 ------
NM_014707chr71514 1750 ----
NM_014709chr21486 ------
NM_014717chr192347 53 ------
NM_014720chr1021629 33 ------
NM_014723chr2052407 2075 496 333 295 --12242 22414 2278
NM_014726chr17123 --1182 1161
NM_014729chr81864 ----1489
NM_014730chr12125185 5154 4977 4936 3959 2100 1960 1876 1759 1494 1067 589 23554 3351 54318 1480 982 225 184 23760 796
NM_014730chr12125185 5154 4977 4936 3959 2100 1960 1876 1759 1494 1067 589 23554 3351 54318 1480 982 225 184 23760 796
NM_014731chr2051543 1511 1315 538 369 11164 1615 --
NM_014739chr634055 3775 1509 22578 666 ----
NM_014742chr2021479 412 --21250 1245 --
NM_014747chr1104799 4634 4314 3866 1631 921 764 641 533 371 14360 64230 1873 1163 392 386 53 15064
NM_014748chr21132 --1313 1373
NM_014751chr811482 ------
NM_014755chr233811 1664 1355 ------
NM_014756chr11173 ------
NM_014757chr531819 927 98 --31861 203 144 --
NM_014759chr851626 1053 564 164 78 31535 1486 183 21552 1025 --
NM_014762chr172596 2375 2221 1799 1623 350 150 1853 ----
NM_014764chr121300 ------
NM_014765chr152386 2160 1916 1902 1810 --12402 --
NM_014766chr753728 884 752 488 110 --1589 --
NM_014770chr1211220 --1409 11137
NM_014771chr162788 83 --1299 1396
NM_014772chr1883467 3079 2356 2239 935 740 256 88 --52613 1319 1006 1000 262 --
NM_014774chr153022 2943 2813 2589 2345 1691 22889 906 --
NM_014779chr32302 116 ------
NM_014781chr81154 ------
NM_014784chr11947 --154 --
NM_014795chr2--1987 ----
NM_014798chr1741262 754 589 512 21585 48 31873 1661 190 1283
NM_014800chr7--1423 ----
NM_014806chr92420 23 ------
NM_014807chr111673 --1295 --
NM_014810chr143525 3048 861 396 12998 ----
NM_014812chr111891 ------
NM_014819chr531956 735 569 ------
NM_014824chr112141 56 --1497 --
NM_014826chr164110 3631 3443 1369 758 419 1432 --13797
NM_014827chr111261 ------
NM_014830chr1293174 2522 2443 945 923 854 841 773 72 12514 23412 1396 --
NM_014832chr131563 ----176
NM_014836chr1011976 ------
NM_014839chr131862 613 567 ------
NM_014840chr1293280 2401 2135 1120 1107 639 443 132 89 1534 22735 2115 --
NM_014850chr3104671 4579 4447 3972 3383 1430 687 158 60 30 23407 41 196 14143
NM_014873chr134751 3000 1405 --11415 13967
NM_014876chr2272216 1737 1518 820 782 730 62 --11474 --
NM_014877chr1767144 6108 5946 5572 1592 897 12414 ----
NM_014883chr42679 173 --22340 95 --
NM_014892chr61238 --1449 --
NM_014893chrY1424 1874 ----
NM_014897chr1732675 2666 475 12532 ----
NM_014901chr531900 1417 350 2808 90 31467 1423 530 11865
NM_014902chr2031474 1276 257 --1992 --
NM_014903chr121451 ------
NM_014906chr1731413 1395 387 1117 1218 --
NM_014912chr1023298 2877 ------
NM_014920chr61965 1491 --13822
NM_014921chr1952881 2280 2150 2045 630 132 22379 1044 --
NM_014923chr1311619 1658 ----
NM_014924chr14102653 2114 2076 2067 1194 902 896 684 527 173 11118 1356 --
NM_014932chr331706 1694 483 ------
NM_014934chr1323360 3227 11505 22905 1202 --
NM_014935chr1113793 3678 3436 3141 1420 1273 664 643 327 245 22 --73160 3061 2793 2725 2391 106 93 12453
NM_014938chr12102505 2361 1990 1814 823 797 683 459 318 291 --21669 301 --
NM_014944chr131022 228 185 --1314 --
NM_014945chr531871 401 345 --1717 --
NM_014946chr243047 2195 1238 272 ------
NM_014947chr132560 1072 764 12524 --11209
NM_014949chr14994 807 723 311 ------
NM_014952chr153708 579 530 2654 224 1114 --
NM_014962chr2032556 1152 506 --11146 --
NM_014964chr1741985 732 583 351 --21682 198 1332
NM_014974chr1031667 1539 1249 11586 ----
NM_014982chr1415230 ------
NM_014989chr611282 ------
NM_014990chr141905 --192 1157
NM_014991chr423073 775 --12092 --
NM_014992chr14--1280 ----
NM_014997chr742780 2152 1096 1023 --12018 --
NM_014999chr122560 290 11232 ----
NM_015000chr1213072 --1187 --
NM_015001chr11894 ------
NM_015008chr393625 3397 2886 2877 1368 1054 708 544 526 --13023 --
NM_015017chr11425 ----1518
NM_015018chr61165 1192 ----
NM_015023chr161168 654 620 418 170 37 --2634 292 --
NM_015024chr82483 86 151 197 --
NM_015027chr161416 11912 ----
NM_015032chr13----1700 --
NM_015033chr973073 2530 1297 1169 711 536 227 ------
NM_015035chr2096043 5127 4295 2249 1699 1675 1168 1150 30 15280 24580 1212 24933 1027
NM_015037chr101225 ------
NM_015039chr143529 3341 1662 32 13170 21648 428 --
NM_015042chr15144236 3929 3810 3798 3723 3155 1615 1223 929 901 685 311 267 51 --23842 3686 --
NM_015049chr2176 ------
NM_015057chr131264 ------
NM_015059chr15103536 3422 3038 2869 2828 1458 1233 333 165 38 1632 43564 3542 3339 2434 1533
NM_015061chr92648 624 ------
NM_015063chr193365 145 76 ------
NM_015068chr71862 --11488 --
NM_015069chr161127 ------
NM_015073chr1951701 1414 241 145 49 --11602 --
NM_015074chr174714 4631 3931 3173 1767 1162 817 33855 1088 224 1521 --
NM_015075chrX72143 1549 1466 1436 1384 864 246 1466 ----
NM_015076chr643519 3131 2949 2896 22806 829 ----
NM_015080chr111103 ------
NM_015082chr53963 401 130 11633 32386 2041 761 --
NM_015086chr1221424 1058 --156 --
NM_015090chr13899 651 313 --32183 603 258 --
NM_015092chr1621601 202 11527 ----
NM_015093chr61508 ------
NM_015094chr2284513 3116 3060 2894 1327 390 348 120 22907 1283 63308 3075 1605 821 304 129 14368
NM_015100chr131964 1660 796 ----1218
NM_015101chr132258 816 619 2324 23 ----
NM_015102chr12161 118 ------
NM_015107chrX21623 743 1612 1916 --
NM_015113chr1711502 --21585 1541 --
NM_015115chr432504 894 149 ------
NM_015129chrX11729 ------
NM_015132chr742001 1777 1726 765 ------
NM_015133chr1651439 1273 1006 319 250 --3325 138 21 11147
NM_015137chr832146 2104 795 ------
NM_015138chr1522522 303 1408 ----
NM_015149chr141902 709 628 367 ------
NM_015153chr61624 ------
NM_015155chr1073189 815 489 470 449 396 318 --12887 --
NM_015156chr1443471 2835 440 384 --11078 --
NM_015158chr92797 194 ------
NM_015161chr1621104 1097 ------
NM_015170chr832326 579 257 ------
NM_015180chr142809 65 ------
NM_015184chr32557 214 ------
NM_015185chrX32615 2226 2057 ------
NM_015192chr2032610 2283 791 ------
NM_015193chr831147 951 501 --1592 21241 104
NM_015194chr1731565 1438 748 --121 --
NM_015199chr31918 ------
NM_015205chr13104432 4163 1913 1811 1467 749 456 345 302 208 1505 23938 247 1388
NM_015206chr1533879 2686 824 --12773 --
NM_015215chr132939 1953 962 ------
NM_015233chr1362631 2593 2297 2238 1889 1749 --21756 90 --
NM_015236chr41294 ------
NM_015238chr52731 644 ------
NM_015242chr11123 ------
NM_015245chr651068 811 474 143 135 1321 21011 772 --
NM_015250chr93429 258 24 173 ----
NM_015252chr21618 1800 ----
NM_015254chr871259 1246 954 853 588 360 92 --52475 2218 872 539 487 1454
NM_015256chr5--1686 ----
NM_015265chr211660 --12056 11631
NM_015268chr31544 ------
NM_015269chr1127 ------
NM_015271chr411370 1671 ----
NM_015272chr1611790 --11771 --
NM_015277chr1831716 1178 113 --1169 --
NM_015282chr262860 2427 2208 614 554 136 ------
NM_015284chr151880 1603 782 766 593 ------
NM_015288chr5103326 3317 3308 2790 2456 2428 1207 1041 889 286 --137 1187
NM_015292chr122308 235 ------
NM_015296chr131138 1431 ----
NM_015299chr14103719 3684 3544 3317 3125 1443 1235 534 379 302 13177 33735 3694 2891 --
NM_015310chr822975 29 37743 2926 1917 35843 5494 3343 12600
NM_015313chr1124709 640 --173 --
NM_015315chr543247 1293 1091 1022 12695 1378 --
NM_015317chr212855 --12751 1378
NM_015319chr12----177 --
NM_015321chr19164687 4593 4487 4428 4162 4098 4082 3364 3129 1962 1844 1681 1508 1145 818 377 --64757 4640 4386 3810 1466 276 --
NM_015326chr152703 2674 2452 2333 546 ------
NM_015328chr762519 2400 2276 1141 1049 414 1179 ----
NM_015335chr121420 --1270 129
NM_015338chr2021772 174 --11386 11907
NM_015343chr171296 ------
NM_015346chr1441498 1351 1331 32 --1105 --
NM_015349chr62579 345 --11100 11896
NM_015358chr211964 ------
NM_015359chr82457 304 21812 1146 12676 --
NM_015365chrX13163 --13348 --
NM_015375chr174497 3363 3332 780 395 273 58 33495 1276 706 24870 1799 11705
NM_015382chr142667 259 ------
NM_015385chr1052209 1013 964 863 747 ------
NM_015386chr16189 ----126
NM_015388chr6121 ------
NM_015393chr442949 2790 536 153 13334 --1988
NM_015397chr92303 236 --11218 --
NM_015401chr123416 283 276 --3432 358 318 --
NM_015404chr9----2492 45 --
NM_015435chr811150 ------
NM_015443chr1751107 469 461 450 377 --3992 261 256 --
NM_015447chr91252 ------
NM_015460chr31251 ----1791
NM_015464chr7------1354
NM_015470chr221079 999 --11212 --
NM_015472chr3--1403 ----
NM_015472chr3--1403 ----
NM_015475chr21961 ----1829
NM_015477chr15--1331 ----
NM_015481chr1211006 ----1998
NM_015483chr7--1769 ----
NM_015485chr11320 ------
NM_015492chr15--1139 11043 --
NM_015493chr1951784 1728 1448 1438 201 12051 --186
NM_015497chr151931 ------
NM_015503chr162590 471 --2182 164 --
NM_015508chr311015 11083 ----
NM_015520chr311830 ----1952
NM_015527chr162285 30 ----165
NM_015530chr21725 ------
NM_015531chr11----1124 --
NM_015534chr11167 ------
NM_015535chr273814 2639 2595 2557 1127 1089 508 21554 832 ----
NM_015541chr321164 913 ------
NM_015545chr71737 --1287 --
NM_015548chr61125 ------
NM_015554chr1532621 1832 330 ------
NM_015555chr6133 ------
NM_015557chr163572 3511 2832 797 645 564 --43352 3062 1377 983 22233 969
NM_015559chr181363 ------
NM_015564chr512783 ------
NM_015565chr21------11657
NM_015567chr131445 ------
NM_015568chr2063900 3602 956 233 149 73 34244 3362 3124 13953 --
NM_015575chr293478 3354 3129 2488 1200 1193 753 463 21 12863 31182 980 145 --
NM_015578chr19150 ------
NM_015589chr14130 --1122 --
NM_015609chr162805 2107 2048 1819 1143 317 --12089 --
NM_015630chr21809 ------
NM_015640chr144606 3683 946 903 23475 688 13996 --
NM_015642chr31238 --1293 --
NM_015652chr101622 ------
NM_015670chr171459 ------
NM_015680chr23622 196 188 ------
NM_015686chrX62050 1859 1838 967 487 358 --21916 1674 12121
NM_015695chr61594 1835 1342 --
NM_015716chr171731 ------
NM_015719chr19----2787 237 1185
NM_015726chr151507 1169 485 377 244 --11189 --
NM_015840chr132140 2094 195 --11947 12105
NM_015841chr132140 2094 195 --11947 12105
NM_015844chr182297 135 --2730 686 1238
NM_015846chr182297 135 --2730 686 1238
NM_015847chr182297 135 --2730 686 1238
NM_015850chr852298 1896 1693 593 144 11946 11927 --
NM_015855chr112564 87 ------
NM_015872chr141699 1115 652 643 --11398 --
NM_015878chr82689 53 11804 ----
NM_015879chr18156607 6347 5833 5549 5499 3246 2749 2712 2311 1446 1398 1338 1095 742 373 --47172 5687 2641 1713 --
NM_015881chr111127 ------
NM_015885chr111109 ------
NM_015888chr123026 288 ------
NM_015892chr101406 --41720 816 333 290 --
NM_015898chr193737 656 598 --21930 244 --
NM_015904chr21564 ------
NM_015905chr71454 ------
NM_015906chr144051 3341 1863 1398 24285 3285 1868 --
NM_015912chr851949 1742 1709 1023 320 --22232 2033 --
NM_015932chr131563 ------
NM_015955chr2----184 --
NM_015960chr10194 ------
NM_015963chr2136 ------
NM_015976chr11238 ------
NM_015981chr582881 2651 2335 2307 2258 2139 2011 605 --21960 273 11950
NM_015984chr1--196 ----
NM_015995chr15134910 4872 4188 3965 3768 3524 2072 1938 884 744 610 543 401 21478 1429 95428 5003 4761 4552 2064 1841 524 485 52 --
NM_015999chr1----1465 --
NM_016009chr154723 3445 1914 1698 1120 13370 1133 --
NM_016018chr842019 691 395 106 ------
NM_016022chr12914 781 ------
NM_016032chrX61241 1142 505 429 336 265 ----1371
NM_016037chr14939 465 442 418 1284 ----
NM_016059chr6138 ----1381
NM_016061chr221603 500 1570 ----
NM_016062chr16----144 --
NM_016070chr17148 ------
NM_016075chr1363163 2783 2209 2042 1144 977 1155 ----
NM_016076chr122387 106 --1532 --
NM_016096chr8--12042 1632 --
NM_016120chrX1320 ------
NM_016131chr22749 706 11710 ----
NM_016132chr1542753 2633 2361 206 ------
NM_016141chr31606 ------
NM_016147chr1121120 974 1404 1115 --
NM_016152chr32920 350 --11209 --
NM_016185chr171580 ------
NM_016201chr32894 460 --3787 754 140 --
NM_016213chr15----166 --
NM_016219chr91488 1106 2451 122 --
NM_016221chr512300 ------
NM_016231chr1711684 1261 ----
NM_016235chr1621280 55 ------
NM_016240chr851230 637 525 498 96 --11075 --
NM_016248chr1322579 481 13913 ----
NM_016256chr164423 387 166 57 --1237 --
NM_016257chr151246 363 234 71 28 12781 32854 462 76 1115
NM_016260chr246899 1849 1192 231 12590 ----
NM_016264chr191197 ------
NM_016271chr181742 ------
NM_016272chr2241788 740 698 601 1327 1461 --
NM_016279chr5164 ------
NM_016281chr122223 212 ------
NM_016284chr162911 203 ------
NM_016287chr1----11857 1649
NM_016289chr242328 1834 1815 1586 --12333 --
NM_016290chr5173 ------
NM_016291chr3195 ------
NM_016300chr3278 44 ------
NM_016308chr122088 1505 ------
NM_016315chr211796 ------
NM_016316chr21652 ------
NM_016319chr122655 90 --1566 --
NM_016338chr5--11239 ----
NM_016340chr531094 904 528 ------
NM_016376chr1783705 1296 1197 1162 1106 618 434 418 14339 ----
NM_016377chr611782 1230 ----
NM_016410chr91449 ------
NM_016418chr22103326 3123 3041 2580 1496 961 902 650 156 43 --13244 23659 987
NM_016423chr14------1299
NM_016427chr18----1152 --
NM_016431chr222746 26 ------
NM_016433chr121501 1425 198 --
NM_016441chr221485 351 1391 ----
NM_016453chr32510 63 ------
NM_016467chr21549 --1132 --
NM_016480chr51205 ------
NM_016490chr2135 ------
NM_016496chr191463 ------
NM_016507chr171525 1360 ----
NM_016513chr61965 1491 --13822
NM_016522chr1131321 1296 376 ------
NM_016525chr92756 705 --1218 1331
NM_016529chr131125 ------
NM_016530chr1523811 941 1167 ----
NM_016531chr441529 1410 461 115 --146 --
NM_016559chr331439 1215 993 ------
NM_016575chr12124952 4607 4171 3991 3375 3337 3328 1501 1463 1027 985 694 --25075 1546 --
NM_016578chr111229 ------
NM_016596chr123416 283 276 --3432 358 318 --
NM_016603chr51609 ------
NM_016604chr51247 11126 ----
NM_016605chr562478 2191 1758 987 368 176 --31871 1731 791 --
NM_016609chr14------135
NM_016619chr41236 ------
NM_016621chr1153864 3204 1824 1792 1759 23950 3643 24157 800 --
NM_016639chr16----2450 199 1434
NM_016654chr15------11339
NM_016823chr1711143 11069 ----
NM_016824chr10----11505 --
NM_016829chr33518 314 289 --1259 --
NM_016830chr122230 162 ------
NM_016834chr1753621 3560 3158 972 162 --43728 1525 860 403 13921
NM_016835chr1753621 3560 3158 972 162 --43728 1525 860 403 13921
NM_016836chr21692 ------
NM_016839chr21692 ------
NM_016841chr1753621 3560 3158 972 162 --43728 1525 860 403 13921
NM_016848chr9--199 ----
NM_016929chr664325 3678 3256 3218 669 497 22983 1579 1183 1655
NM_016946chr193310 2833 2490 2341 2305 2252 1444 352 213 23176 717 21301 64 --
NM_016952chr1134002 798 495 1507 22850 723 --
NM_017413chrX31754 504 176 --32255 449 234 --
NM_017420chr1422896 1002 ------
NM_017423chr41489 ------
NM_017437chr141331 --12204 12287
NM_017447chr2153762 1525 1423 752 87 1196 ----
NM_017452chr2031402 1229 1018 ----1383
NM_017453chr2031402 1229 1018 ----1383
NM_017454chr2031402 1229 1018 ----1383
NM_017459chr11341 --129 --
NM_017482chr251536 1333 1217 973 113 ------
NM_017519chr621290 58 ------
NM_017522chr111353 1579 --11152
NM_017544chrX----1863 --
NM_017563chr395381 4806 4708 3951 1878 899 891 853 131 25707 83 ----
NM_017582chr141746 1494 623 465 --1694 --
NM_017590chr2272536 1955 1661 972 927 512 273 22043 743 22265 400 --
NM_017594chr9--2482 461 1560 --
NM_017596chr174176 4024 3799 3724 3094 721 690 23167 908 54214 1461 1129 973 946 1147
NM_017602chrX1146 --1661 --
NM_017610chr15----1121 --
NM_017622chr173454 237 30 --2519 141 --
NM_017623chr252696 805 519 496 121 ----1658
NM_017629chr111887 ------
NM_017633chr613714 ----12993
NM_017635chr111534 --1353 1515
NM_017637chr9138731 7137 6510 6103 6039 3497 3154 2703 2594 1948 1064 941 648 145 37869 7783 6056 --
NM_017644chr354078 1281 746 718 229 ------
NM_017649chr1021280 472 --1895 --
NM_017650chr724073 949 24948 4342 15238 --
NM_017651chr621365 188 ------
NM_017658chr1423711 1102 166 ----
NM_017666chrX3645 573 229 11371 ----
NM_017668chr163695 682 208 --1221 --
NM_017670chr112195 88 ------
NM_017679chr172438 27 --2616 72 --
NM_017681chrX1847 ------
NM_017704chr111671 1960 ----
NM_017712chr19135990 5835 5142 4667 2464 1977 1924 1677 1165 843 752 494 399 25083 767 35110 1301 463 15863
NM_017730chr32254 212 1598 ----
NM_017737chr122240 1842 ------
NM_017739chr1152 --1408 --
NM_017742chr181188 ------
NM_017744chr142168 619 307 253 ------
NM_017747chr51366 ------
NM_017748chr172871 727 ------
NM_017749chr112674 96 ------
NM_017753chr911014 ------
NM_017754chr674073 3862 3252 1901 882 474 272 1702 13877 --
NM_017755chr54240 98 59 49 ------
NM_017758chr173970 940 179 ----134
NM_017787chr1092890 2823 2673 2581 1086 829 814 660 446 12162 22051 1114 --
NM_017789chr21661 1183 ----
NM_017790chr91140 1438 ----
NM_017799chr1411681 2794 135 ----
NM_017811chr942239 964 80 73 ------
NM_017813chr843655 2155 1978 1592 ------
NM_017824chr1022726 1980 1982 ----
NM_017831chr18104264 4180 3522 3077 3005 2958 1909 1871 632 622 13537 ----
NM_017848chrX63370 3218 653 551 438 206 14490 11686 --
NM_017849chr292793 2572 2528 2490 2481 2024 1278 1011 851 --21069 941 --
NM_017851chr1551089 923 846 821 366 2963 138 1970 --
NM_017857chr113675 642 456 --1636 --
NM_017873chr982717 2708 2584 1240 894 806 592 365 12772 1550 --
NM_017893chr103428 411 145 ------
NM_017895chr20169 ------
NM_017896chr2061138 894 848 738 289 156 1513 11016 --
NM_017902chr10115219 4610 4426 3975 2148 1938 1533 1211 1143 1108 977 1131 44334 3618 2058 1667 --
NM_017907chr113341 206 64 --1192 --
NM_017921chr1771483 921 522 414 389 125 21 --42233 2227 2204 1642 --
NM_017929chr2251202 983 516 394 174 ------
NM_017938chrX2491 118 11833 ----
NM_017944chr1122563 82 ------
NM_017945chr33877 523 280 ------
NM_017964chr23744 666 657 ------
NM_017974chr261266 1137 1122 839 832 187 --11143 1407
NM_017993chr13148 190 ----
NM_017994chr742030 861 745 309 1187 ----
NM_018014chr211323 --1285 11135
NM_018018chr1221334 467 11868 ----
NM_018027chr1022002 209 11229 --1861
NM_018028chr191251 --21114 296 1100
NM_018045chr182357 1232 1208 993 487 383 352 256 2661 180 ----
NM_018046chr521393 692 ------
NM_018053chr14726 631 340 106 --2672 667 --
NM_018054chr16----2561 140 --
NM_018064chr61227 ------
NM_018067chr12169 101 ------
NM_018072chr11159 ------
NM_018084chr212431 12502 ----
NM_018085chr1148098 7458 6529 6188 5519 5079 3218 2814 2552 2427 1933 1259 124 117 26869 6114 26632 69 --
NM_018086chr2----11784 --
NM_018096chr174825 714 239 134 ------
NM_018107chr144831 768 176 71 ------
NM_018110chr1661335 898 887 480 170 56 ----11341
NM_018113chr121205 ----1406
NM_018116chr13547 501 425 ------
NM_018121chr1032815 2030 687 --1800 --
NM_018133chr31885 ------
NM_018155chr321253 170 --1394 --
NM_018157chr1252474 1276 1067 846 368 --12760 --
NM_018159chrX11627 ------
NM_018171chr121815 ------
NM_018178chr132055 1343 37 --11799 --
NM_018181chr1821481 771 ------
NM_018184chr321495 327 ------
NM_018195chr1142018 1755 1644 509 ------
NM_018197chr201256 1166 ----
NM_018200chr151460 12032 ----
NM_018201chr961883 1727 1619 841 380 345 --2875 58 1813
NM_018208chr11120 --41135 887 791 442 11142
NM_018222chr1111205 ------
NM_018243chr433542 656 579 12586 13128 11250
NM_018244chr206888 849 490 454 93 35 2374 72 1132 --
NM_018245chr101345 --1157 --
NM_018247chr623013 2734 11994 ----
NM_018254chr132197 1711 1548 ------
NM_018293chr341101 326 175 95 ----1985
NM_018302chr41700 1945 12327 --
NM_018327chr201653 ------
NM_018330chr101310 11352 ----
NM_018334chr71200 ------
NM_018340chr16114792 4764 4741 4690 4042 4011 3973 1620 939 771 668 --13988 --
NM_018354chr20123 ------
NM_018364chr163925 3652 3535 1145 547 71 1695 ----
NM_018368chr61222 ------
NM_018371chr821131 1124 ------
NM_018375chr1411721 125 ----
NM_018388chrX153 11158 ----
NM_018400chr1173492 1408 1202 1158 703 376 29 23430 514 12774 --
NM_018403chr353891 3882 3465 3148 2679 11330 ----
NM_018424chr931827 412 68 ------
NM_018437chr9--128 ----
NM_018440chr858151 6627 6227 2022 502 37677 6151 2680 15984 15571
NM_018446chr31326 ------
NM_018449chr93638 603 148 ------
NM_018452chr6_random31551 513 49 12968 13787 --
NM_018462chr31142 ------
NM_018469chr1731373 1366 61 --186 --
NM_018482chr82935 308 11940 ----
NM_018488chr172601 64 1618 ----
NM_018489chr11450 ------
NM_018566chr143538 3439 3130 814 ------
NM_018569chr421279 226 ------
NM_018602chr15287 23 ------
NM_018622chr3----134 --
NM_018644chr1162189 1832 576 411 73 44 --2421 351 --
NM_018652chr152721 398 ------
NM_018660chr842914 1156 504 471 12768 21012 33 --
NM_018674chr2--1533 1475 1547
NM_018682chr7--1456 ----
NM_018683chr2021702 1078 ------
NM_018684chrX31206 1054 1023 ------
NM_018689chr155558 524 455 387 218 22320 957 32588 1979 1654 21814 1035
NM_018699chr43288 276 107 ------
NM_018704chr111453 1188 ----
NM_018711chr1231026 1017 25 ------
NM_018715chr152157 2011 1905 785 602 --11558 --
NM_018718chr721742 738 ------
NM_018834chr51841 ------
NM_018837chr201102 ------
NM_018840chr20--1421 ----
NM_018841chr113334 33491 2823 339 13515 --
NM_018846chr71190 1314 ----
NM_018847chr911217 ------
NM_018898chr51219 11680 ----
NM_018899chr51219 11680 ----
NM_018900chr51219 11680 ----
NM_018901chr51219 11680 ----
NM_018902chr51219 11680 ----
NM_018903chr51219 11680 ----
NM_018904chr51219 11680 ----
NM_018905chr51219 11680 ----
NM_018906chr51219 11680 ----
NM_018907chr51219 11680 ----
NM_018908chr51219 11680 ----
NM_018909chr51219 11680 ----
NM_018910chr51219 11680 ----
NM_018911chr51219 11680 ----
NM_018945chr623399 2863 23673 2789 ----
NM_018948chr11493 --1984 --
NM_018951chr71326 --2417 46 --
NM_018959chr191488 1513 ----
NM_018963chr2121021 246 11007 ----
NM_018970chr722909 897 164 ----
NM_018994chr11392 --1554 --
NM_018999chr1064543 4330 3047 1197 876 682 13746 ----
NM_019001chr32504 324 14293 ----
NM_019004chr712375 ------
NM_019036chr61414 ------
NM_019041chr621926 197 ------
NM_019042chr72892 843 --154 --
NM_019045chrX2369 361 ------
NM_019046chr101615 --1215 --
NM_019057chr5------2272 242
NM_019063chr21869 ----1401
NM_019066chr152285 39 ------
NM_019074chr154867 398 362 280 --1650 1836
NM_019083chr11123 ------
NM_019084chr1021605 245 1254 ----
NM_019096chr63752 272 60 1248 --1685
NM_019106chr2222111 258 --23407 697 --
NM_019114chr932390 2004 146 ------
NM_019116chr1653374 2772 2300 1274 1160 1859 --22791 22
NM_019555chr311805 21750 123 ----
NM_019557chr11351 ------
NM_019592chr92600 30 ------
NM_019593chr2032078 1988 176 ------
NM_019605chr11620 ------
NM_019606chr72561 198 ------
NM_019610chr131888 682 564 ------
NM_019613chr173929 284 244 --1935 --
NM_019843chr221145 ------
NM_019854chr122730 707 ------
NM_019884chr19191 --1434 --
NM_019885chr272953 2341 2309 1103 895 661 105 11031 32055 1128 196 12131
NM_019903chr10----11505 --
NM_020039chr1241941 1780 1487 409 --21212 782 --
NM_020116chr4--1126 ----
NM_020117chr51746 1761 ----
NM_020134chr26791 377 369 331 299 231 --1913 --
NM_020137chrX2455 341 1385 ----
NM_020141chr1--11712 ----
NM_020142chr12------1452
NM_020144chr731898 1428 133 ------
NM_020145chr93470 207 171 ----134
NM_020151chr23632 607 413 ------
NM_020152chr212638 53 ------
NM_020155chr11122 ------
NM_020178chr172827 129 11004 1866 --
NM_020180chr1811259 --1445 --
NM_020182chr2052682 1154 762 161 113 ------
NM_020205chr133125 2520 120 22451 60 ----
NM_020209chr19--168 ----
NM_020239chr142158 1634 416 178 --11721 1849
NM_020240chr532779 1702 1028 --2959 923 --
NM_020248chr162378 2205 2119 1572 327 58 ----11590
NM_020309chr19----159 --
NM_020310chr1772540 2373 1988 1852 1035 873 555 32367 483 394 22247 1713 --
NM_020337chr44966 944 681 454 ------
NM_020338chr1043526 2622 1478 1418 11503 22457 1390 1419
NM_020342chr252470 2213 1773 1688 993 ------
NM_020344chr9140 ------
NM_020346chr111241 ------
NM_020357chr311056 --1397 --
NM_020362chr11687 ----1151
NM_020364chrY----11376 --
NM_020372chr14------135
NM_020381chr62691 340 ------
NM_020382chr1231484 440 202 --11356 --
NM_020383chr101294 ------
NM_020384chrX51497 508 411 400 133 ------
NM_020390chr323726 1133 --11684 --
NM_020405chr1794019 2902 2807 1609 1358 1051 960 864 128 33537 3231 975 3954 680 83 --
NM_020410chr192158 35 ------
NM_020418chr31461 ----1189
NM_020420chrY----11376 --
NM_020423chr12175 102 ------
NM_020429chr752448 2326 1112 963 176 12705 12156 --
NM_020440chr132953 1308 708 ------
NM_020443chr1106454 6334 5938 4393 2613 2539 2348 2107 1278 501 11079 31333 239 95 14387
NM_020456chr1322283 1843 11700 --176
NM_020463chr21416 ------
NM_020467chr121368 --135 --
NM_020473chrX31865 1596 343 ------
NM_020475chr811725 --11593 --
NM_020476chr811725 --11593 --
NM_020477chr811725 --11593 --
NM_020478chr811788 --11656 --
NM_020480chr811725 --11593 --
NM_020630chr103541 476 62 --1546 --
NM_020631chr161297 1241 1202 1047 965 370 11068 21124 310 --
NM_020640chr322288 79 12024 ----
NM_020644chr112970 689 ------
NM_020647chr822029 701 189 ----
NM_020649chr17191 --1103 --
NM_020651chr2197 ------
NM_020673chr20137434 7408 7368 6253 6179 5933 5898 5728 5627 5249 1449 1236 43 15872 ----
NM_020689chr201296 1146 21145 308 --
NM_020690chr5----1122 --
NM_020692chr14259 52 --1187 --
NM_020697chr81229 1332 ----
NM_020699chr135136 4473 1876 --31859 1814 1569 14310
NM_020703chr12128 85 ------
NM_020713chr20112737 2183 1267 1183 1128 582 569 371 326 320 163 --63107 2406 955 950 462 23 22600 2480
NM_020717chrX104771 3061 1767 1305 1094 858 693 658 448 158 14697 23522 1099 11311
NM_020718chr1644223 2589 1973 1242 15301 ----
NM_020728chr762695 2604 2243 1078 311 161 12619 ----
NM_020732chr621290 58 ------
NM_020734chr1222936 319 ----13215
NM_020738chr2--1180 ----
NM_020739chr153865 818 238 ------
NM_020742chrX1442 1938 11890 --
NM_020748chr1741970 1474 1430 293 --21612 1407 --
NM_020752chr102904 704 ------
NM_020764chr1621063 169 1987 1915 --
NM_020765chr1140 ------
NM_020766chrX44094 3440 3357 39 23432 3243 ----
NM_020769chrX1710 1284 ----
NM_020772chr1758144 7632 6419 5922 1561 17288 11405 --
NM_020773chr451832 1784 926 907 134 1272 ----
NM_020774chr1874611 1945 1925 1604 1546 1463 758 ------
NM_020779chr2--11168 ----
NM_020794chr11219 ------
NM_020795chr1751800 1704 491 362 82 --142 --
NM_020796chr542738 1218 972 908 --11851 1986
NM_020801chr521858 1788 ------
NM_020803chr421831 1800 12194 ----
NM_020807chr1621400 1180 1225 21572 1553 --
NM_020808chr12952 296 1706 ----
NM_020809chr1131673 1604 239 ------
NM_020810chr1423106 470 1478 11345 --
NM_020820chr2071456 998 504 363 197 189 163 192 2286 75 --
NM_020824chr101688 ------
NM_020826chr1172389 1414 1319 1061 656 558 129 ------
NM_020836chr142327 22 ------
NM_020839chr321272 51 11165 ----
NM_020841chr1243839 2746 1018 47 ----12563
NM_020845chr1252398 1726 1669 726 362 --42337 985 263 73 --
NM_020850chr1683095 3089 2912 2717 1283 1189 831 25 2798 508 42365 127 41 30 --
NM_020858chr151218 ------
NM_020859chr443464 2781 1514 354 ------
NM_020861chr611167 ------
NM_020868chr221226 337 ------
NM_020886chr1131016 972 37 --21040 468 --
NM_020896chr112275 26 1417 4861 722 227 196 --
NM_020899chr1741732 747 647 230 2840 463 174 --
NM_020917chr1942875 2409 636 605 13704 ----
NM_020920chr141337 --2309 58 --
NM_020922chrX21264 746 1653 ----
NM_020925chr111176 ------
NM_020927chr1631878 461 424 --1615 --
NM_020935chr244250 3025 1821 1130 14208 --14368
NM_020949chr32203 86 ------
NM_020956chr1954142 3511 1268 829 265 --33413 1220 662 2508 247
NM_020962chr1562257 1005 657 552 465 320 1291 1558 --
NM_020964chr1844366 3608 1222 105 33946 3121 725 13911 --
NM_020967chr2021019 806 1851 2475 44 --
NM_020971chr191750 ------
NM_020977chr441938 1689 827 426 ----1256
NM_020981chr22633 174 ------
NM_020987chr1011187 ------
NM_021007chr222412 162 ------
NM_021020chr8123488 3327 3196 2872 2544 1196 926 525 484 287 226 151 12648 33140 2817 2346 --
NM_021033chr1322355 670 ------
NM_021044chr122140 54 ------
NM_021047chr194567 530 486 448 ------
NM_021061chr851649 1640 851 842 798 24160 704 1866 1935
NM_021064chr61443 41797 727 343 217 ----
NM_021069chr422017 355 --1194 --
NM_021072chr532115 1642 564 1131 ----
NM_021079chr1773200 3056 2876 1283 759 572 208 176 32847 2536 1059 13062
NM_021090chr2284514 3709 3496 1217 1160 1153 1129 823 33201 1585 1264 21479 899 --
NM_021096chr22123258 2841 2738 2682 2604 2499 2160 2049 950 587 391 185 1176 32504 961 789 13252
NM_021109chrX------1296
NM_021109chrX------1296
NM_021120chrX--12108 ----
NM_021132chr1021249 978 ------
NM_021140chrX2389 100 ------
NM_021155chr192982 783 21201 639 11081 2868 173
NM_021156chr202368 59 ------
NM_021174chr83648 622 501 ----1655
NM_021183chrX1171 ------
NM_021190chr12921 467 11152 ----
NM_021194chr11109 ------
NM_021198chr241444 1429 1220 325 ------
NM_021202chr2022943 958 12080 51137 326 273 250 207 1369
NM_021215chr2012045 ------
NM_021224chr9164 ------
NM_021228chr19159 ------
NM_021238chr1241779 643 289 280 1147 ----
NM_021239chr1421353 137 11164 ----
NM_021245chr10----143 --
NM_021248chr202553 254 --2623 595 --
NM_021249chr1421467 1399 21604 220 ----
NM_021253chr61961 --21088 908 --
NM_021255chr1432638 1328 517 22939 458 ----
NM_021259chr1661002 963 750 466 354 241 1116 3879 455 314 176
NM_021260chr1431084 484 333 --2531 435 --
NM_021267chr1941148 962 253 70 --41017 502 324 220 --
NM_021269chr19----2193 109 --
NM_021569chr92167 159 --2975 820 --
NM_021575chr193281 272 175 ------
NM_021627chr311064 --1901 --
NM_021639chr11319 ------
NM_021643chr251860 1496 613 418 88 ------
NM_021644chr10144 ------
NM_021705chr611158 1143 11244 --
NM_021724chr17----1244 --
NM_021785chrX1134 ------
NM_021813chr695487 4229 3845 1840 1774 1758 1406 1387 1247 2327 255 24890 1424 --
NM_021814chr6------1102
NM_021905chr621498 32 --1119 --
NM_021911chr542006 1163 830 584 1140 --1128
NM_021912chr1553925 3733 3668 3599 825 ------
NM_021913chr193625 616 528 11333 ----
NM_021914chr142947 364 11615 ----
NM_021940chr631578 1370 1299 ------
NM_021943chr671780 1408 766 541 516 493 187 --31945 1839 851 --
NM_021946chrX1350 --41241 1230 954 308 --
NM_021947chr1731349 1239 934 ------
NM_021956chr611031 ------
NM_021959chr64883 669 304 243 --139 --
NM_021961chr1156920 5156 2905 1814 830 24730 2987 32010 1838 123 12592
NM_021962chr1721732 429 --11885 --
NM_021964chr336450 5943 4046 --26481 1642 --
NM_021967chr521285 995 --11253 --
NM_021971chr3121 --160 --
NM_022047chr62230 51 --162 --
NM_022048chr1565883 5528 4673 4431 2493 184 12417 21406 564 --
NM_022060chr1441282 953 368 332 11084 11266 11362
NM_022085chr63480 418 340 11327 11101 --
NM_022107chr6137 ------
NM_022123chr14----1609 --
NM_022130chr51272 ------
NM_022131chr321323 1030 --11513 126
NM_022133chr811754 ------
NM_022138chr631297 1139 181 ------
NM_022140chr571956 1839 1784 1584 1483 919 356 ------
NM_022143chr7------11436
NM_022154chr411352 ------
NM_022166chr1665407 5128 4884 2355 1837 123 22111 209 24749 4302 14563
NM_022169chr1171358 1295 1161 558 379 142 127 ------
NM_022170chr721368 108 --1623 1391
NM_022172chr113364 269 26 ------
NM_022336chr252338 2091 2024 841 804 --1358 --
NM_022343chr931244 857 75 ------
NM_022346chr441195 875 455 141 ------
NM_022356chr11416 ------
NM_022362chr102308 91 ------
NM_022368chrX125 ------
NM_022373chr71325 1340 1664 --
NM_022444chr721695 72 ------
NM_022459chr1335218 2528 99 12506 ----
NM_022461chr3154 ------
NM_022462chr1973747 2868 2830 2554 1096 687 225 13632 33757 1330 232 --
NM_022465chr1223066 111 --1772 --
NM_022469chr173150 2761 2692 2680 965 893 474 12357 2460 371 --
NM_022473chr1554139 1367 1143 565 55 23119 1291 ----
NM_022474chr1422383 2035 12644 ----
NM_022476chr16------150
NM_022477chr2021307 1298 11164 185 --
NM_022495chr141215 ------
NM_022497chr383026 2552 1521 425 364 354 336 211 3977 662 74 3781 772 253 --
NM_022553chr61182 ----1512
NM_022557chr171184 ------
NM_022574chr761474 761 720 703 690 610 --31724 1599 475 --
NM_022644chr171179 --1455 --
NM_022648chr253866 3433 1297 887 443 11000 33259 2935 1838 --
NM_022658chr12----1327 11332
NM_022659chr81153 ------
NM_022719chr2293195 3112 3045 2892 1270 952 753 666 225 --2744 738 --
NM_022733chr111173 ------
NM_022735chr12506 435 ------
NM_022742chr72131 60 ------
NM_022744chr163950 411 58 --11017 --
NM_022749chr841068 390 379 313 1500 1299 --
NM_022755chr962231 1804 1797 991 937 775 --11871 --
NM_022756chr121122 310 ------
NM_022758chr632942 2875 1304 11017 1110 --
NM_022763chr322699 1124 --12143 --
NM_022766chr2272629 2494 2198 824 547 311 300 21782 902 22089 256 --
NM_022768chr1--1320 ----
NM_022781chr922651 753 ------
NM_022824chr52682 190 ------
NM_022826chr2--11209 1897 --
NM_022829chr202827 738 1141 ----
NM_022832chr42291 128 193 ----
NM_022845chr1622223 693 ------
NM_022875chr5----177 --
NM_022877chr5----177 --
NM_022893chr233093 3070 2886 ------
NM_022898chr1453566 3409 1038 984 847 22939 1454 ----
NM_022913chr5--1226 ----
NM_022917chr94898 853 476 119 1203 11233 --
NM_022918chr1111858 ------
NM_022970chr101264 --11049 --
NM_022978chr521285 995 --11253 --
NM_023009chr12213 85 --1266 --
NM_023039chr5146 ------
NM_023067chr321203 381 --1248 11086
NM_023076chr16102672 2558 2546 2190 1085 1042 957 784 335 166 1972 22420 41 --
NM_023079chr1721745 1314 11204 ----
NM_023105chr852298 1896 1693 593 144 11946 11927 --
NM_023106chr852298 1896 1693 593 144 11946 11927 --
NM_023110chr852298 1896 1693 593 144 11946 11927 --
NM_023111chr852298 1896 1693 593 144 11946 11927 --
NM_023927chr541169 475 431 93 11138 ----
NM_023931chr1641509 1471 1416 1112 --21551 1195 --
NM_023932chr6162 --123 --
NM_024007chr51821 --32967 2799 2560 --
NM_024016chr172580 568 --196 --
NM_024029chr191271 ------
NM_024038chr19127 --1241 --
NM_024052chr1742087 812 489 381 --1172 --
NM_024055chr51649 ------
NM_024076chr1952344 959 899 797 744 --22233 2168 --
NM_024085chr22964 136 2245 29 3844 269 102 --
NM_024086chr1793760 3408 3287 2701 1527 1144 603 408 54 12627 33268 2439 285 1276
NM_024090chr431732 1336 1214 ------
NM_024107chr174863 744 272 64 --1738 --
NM_024117chr911048 ----1115
NM_024293chr24548 525 113 47 --1335 --
NM_024294chr632942 2875 1304 11017 1110 --
NM_024295chr82832 80 11272 ----
NM_024306chr167954 754 744 483 441 217 96 --2936 44 --
NM_024309chr41151 --136 --
NM_024312chr121101 ------
NM_024328chr142225 169 ----1520
NM_024329chr131367 1229 163 --2317 218 --
NM_024345chr952348 2162 855 510 265 11556 --15800
NM_024408chr143294 2953 1323 879 ----1554
NM_024416chr9----1371 --
NM_024424chr11--1907 ----
NM_024425chr11--1907 ----
NM_024426chr11--1907 ----
NM_024503chr1129 ------
NM_024511chr453383 2293 1139 818 520 23310 385 ----
NM_024519chr161236 --185 --
NM_024524chr321251 713 ------
NM_024536chr22420 98 --2141 129 1122
NM_024545chr22478 295 ------
NM_024551chr1262430 2376 295 242 140 70 ------
NM_024551chr1262430 2376 295 242 140 70 ------
NM_024554chr141486 1132 1069 156 1457 11091 --
NM_024556chr111368 ------
NM_024563chr541819 1350 725 80 ------
NM_024569chr142680 2458 549 458 --11979 --
NM_024595chr121063 422 1987 ----
NM_024612chr17--1118 1282 1826
NM_024617chr91886 ------
NM_024631chr111678 ------
NM_024635chr91214 ------
NM_024659chr22292 120 ------
NM_024665chr31625 ------
NM_024674chr152519 2297 1013 934 301 12445 ----
NM_024704chr203457 245 202 ------
NM_024721chr811979 ------
NM_024742chr1671646 1523 1477 1401 753 227 185 --41921 1584 1286 143 11927
NM_024755chr151693 --1348 --
NM_024757chr931117 949 243 ------
NM_024770chr256449 6037 1202 804 656 25459 2642 ----
NM_024779chr1221429 1146 --11393 1382
NM_024798chr1572325 2018 1792 672 663 156 87 22706 266 12560 --
NM_024811chr1121677 279 ------
NM_024834chr101538 ------
NM_024866chr2283004 2944 2604 567 536 378 367 163 --11348 1394
NM_024873chr42792 128 ------
NM_024874chr141098 1087 912 101 1526 11271 --
NM_024881chr19123396 3246 3186 3148 3139 3094 2435 1139 969 576 459 286 11065 33163 2339 145 1998
NM_024884chr1441835 1136 1127 1082 1992 24519 4181 14069
NM_024887chr151859 532 421 238 150 --1738 --
NM_024899chr182507 105 ------
NM_024911chr12711 108 ------
NM_024920chr411058 --1155 --
NM_024933chr23592 76 43 ------
NM_024939chr164549 297 246 102 1305 21278 1030 --
NM_024941chr5--11367 ----
NM_024943chr41673 1599 ----
NM_024944chr2131277 1202 904 ------
NM_024946chr1641737 615 313 169 ------
NM_024949chr453902 3827 1973 879 830 14354 ----
NM_024953chr1241998 1923 1735 509 --1413 --
NM_024979chr1351388 650 473 367 119 --1276 --
NM_024989chr297682 6850 6837 6676 2745 2390 2337 1571 1562 --16309 --
NM_024991chr1052209 1013 964 863 747 ------
NM_025049chr15241 34 169 ----
NM_025054chr853226 2922 1281 720 158 --22828 192 --
NM_025057chr141525 ------
NM_025074chr452790 1997 1195 544 260 12168 ----
NM_025079chr1------1179
NM_025083chr1531677 1624 1340 --21854 1482 11744
NM_025134chr162813 577 ------
NM_025138chr132406 86 ------
NM_025141chr151510 ------
NM_025146chr32783 274 ------
NM_025147chr2--1923 ----
NM_025158chr51468 ------
NM_025160chr134116 3011 1734 13092 ----
NM_025179chr184554 3870 3832 3697 1976 1130 894 747 13592 34496 3781 3198 --
NM_025187chr1661376 1241 496 396 198 100 2513 173 ----
NM_025191chr132537 2149 1309 ------
NM_025208chr1122267 1580 12322 ----
NM_025219chr2072162 2096 1655 1589 727 455 43 22015 336 21595 111 1470
NM_025222chr322045 125 12267 ----
NM_025230chr1471545 695 688 585 405 262 224 11333 1430 1725
NM_025235chr10159 --21538 774 --
NM_025236chr62162 27 --2215 40 --
NM_025244chr21203 ------
NM_025248chr1761991 1981 1256 1249 784 292 --82885 2767 2732 1306 1200 727 536 282 --
NM_025251chr851148 493 347 262 164 --4421 363 213 136 --
NM_030576chr1742660 1859 756 386 12484 32464 2290 2183 --
NM_030583chr81365 ------
NM_030594chr153231 96 25 ------
NM_030621chr1424021 2971 ------
NM_030627chr521655 821 --13183 --
NM_030629chr161105 ------
NM_030630chr173515 123 50 --3742 621 296 2286 175
NM_030637chr14--127 ----
NM_030645chr1123 ------
NM_030647chr755773 5044 4900 2510 2486 ------
NM_030648chr444976 4491 2097 1658 --12159 1702
NM_030650chr213883 24022 3488 23044 2847 --
NM_030660chr141955 1390 ----
NM_030661chr731656 1390 364 --1265 --
NM_030665chr17----11242 1115
NM_030674chr1243709 1564 794 582 1622 ----
NM_030755chr1422184 825 22856 2509 ----
NM_030758chr2221377 1094 --2347 295 145
NM_030761chr172530 2519 2507 2100 1926 1895 247 141 11791 --
NM_030762chr1221976 1442 --1279 --
NM_030786chr151796 1647 1467 179 149 11775 ----
NM_030796chr722171 2025 --151 --
NM_030802chr171354 ------
NM_030803chr261266 1137 1122 839 832 187 --11143 1407
NM_030806chr1108969 8600 8462 8201 3390 2836 2755 2684 1896 1743 12579 36317 3258 2283 38343 7325 6361
NM_030808chr171194 ------
NM_030810chr63480 418 340 11327 11101 --
NM_030881chr2232329 2048 1807 ------
NM_030884chr342071 1573 1493 217 32259 2094 505 21612 632 --
NM_030885chr322126 1453 22208 2095 ----
NM_030915chr241962 1601 696 501 --32191 2057 941 --
NM_030918chr185165 4258 3867 2041 1983 1667 497 53 14327 24270 2056 34558 3350 1742
NM_030927chr1051166 1130 1029 1014 504 --21171 353 11316
NM_030938chr17--1881 1265 --
NM_030940chr931481 1057 21 ------
NM_030953chr521166 639 11103 21011 193 --
NM_030954chr81741 1667 ----
NM_030962chr112525 188 ------
NM_030964chr573071 2927 2785 2758 2663 996 410 --11497 --
NM_030965chr1--1635 ----
NM_030981chr1121224 410 ----2837 146
NM_031205chr121285 ------
NM_031208chr16199 1114 --1749
NM_031216chr1822148 1866 11659 ----
NM_031243chr71621 ------
NM_031268chr16195257 5110 5100 4979 4287 4082 3991 2005 1874 1630 1394 1310 1251 622 600 571 451 427 60 --33645 1525 393 24531 825
NM_031272chr17----132 --
NM_031305chr431587 86 31 ------
NM_031314chr14----11519 --
NM_031372chr431448 1257 394 1375 ----
NM_031411chr51219 11680 ----
NM_031417chr19--11870 2228 105 12753
NM_031419chr331023 424 23 ------
NM_031424chr202385 55 ----1494
NM_031426chr972601 2572 2390 2029 2019 655 477 --1385 --
NM_031439chr8--2735 144 11341 1359
NM_031442chrX12178 --11294 --
NM_031444chr2292115 1910 1900 1841 1578 1569 930 627 219 21942 554 12180 177
NM_031445chr273336 2856 2602 2493 2099 841 321 ----186
NM_031453chr1022334 2110 ----11871
NM_031459chr141429 501 361 337 --1366 --
NM_031461chr831548 621 358 --11705 --
NM_031468chr7107521 7470 7083 6558 5313 5217 2939 2775 2289 503 27281 3102 11174 16266
NM_031476chr16122358 2302 2264 2255 2035 1125 921 825 772 656 533 140 1745 12547 --
NM_031477chr164264 62 42 27 --1284 --
NM_031483chr2043595 2785 1143 95 32524 1424 753 12260 --
NM_031844chr163455 2707 2519 1307 758 438 13360 12690 --
NM_031845chr222721 212 ------
NM_031847chr222721 212 ------
NM_031849chr51219 11680 ----
NM_031857chr51219 11680 ----
NM_031860chr51219 11680 ----
NM_031890chr2272500 2332 2104 1864 1164 941 518 12094 22337 879 --
NM_031989chr12--1247 ----
NM_031990chr1931447 593 432 ------
NM_031991chr1931447 593 432 ------
NM_031992chr721368 108 --1623 1391
NM_032012chr984371 3928 3658 3416 1414 1163 282 70 11434 1132 13313
NM_032013chr2021307 1298 11164 185 --
NM_032028chr52294 169 ------
NM_032041chr822706 2394 1608 12296 --
NM_032042chr522573 198 --1277 --
NM_032050chr222921 379 ------
NM_032052chr2221306 75 1256 ----
NM_032102chr1152796 2533 2029 629 338 ------
NM_032105chr1137982 7561 7030 6738 6236 5520 5341 3130 2269 2118 1824 912 800 22195 474 16417 --
NM_032109chr541391 1293 1177 329 --2353 312 --
NM_032121chrX42815 2614 1035 854 11094 ----
NM_032128chr42399 325 ------
NM_032132chr11154 --1403 --
NM_032139chr191106 1925 ----
NM_032144chr21593 ------
NM_032145chr6--11921 ----
NM_032146chr31170 ------
NM_032147chr121263 --11032 --
NM_032153chr322520 1069 --12276 --
NM_032182chr1011445 ------
NM_032189chr13104234 3965 2004 1715 1613 1269 551 258 147 104 1307 23740 49 1190
NM_032192chr171142 ------
NM_032193chr1171800 1770 1666 1300 687 603 178 11494 41965 737 369 359 --
NM_032195chr211209 ------
NM_032199chr1053373 3265 1233 197 71 13671 ----
NM_032207chr1921049 966 --2793 519 --
NM_032211chr101187 2345 216 ----
NM_032231chr15----125 --
NM_032242chr383051 2949 2175 2123 1240 1098 298 259 13078 52942 2889 2634 1088 984 12846
NM_032281chr1923123 886 --11182 --
NM_032283chr181794 1770 1596 1499 1334 1139 545 423 --2699 31 --
NM_032289chr511408 --31601 778 218 --
NM_032294chr1771679 1569 1358 1304 1200 319 248 ----1417
NM_032295chr7--2442 144 ----
NM_032298chr191446 --1126 --
NM_032325chr1171646 1608 1599 1555 1473 1419 193 21634 671 248 41 --
NM_032345chr121106 ------
NM_032352chr141987 ------
NM_032353chr172495 429 ------
NM_032357chr21723 ------
NM_032364chr122367 329 ----1269
NM_032373chr1032309 2027 899 45370 3905 1770 350 ----
NM_032376chr171669 ----173
NM_032389chr113906 828 136 --21163 386 --
NM_032408chr72979 280 ------
NM_032412chr51244 ------
NM_032420chr52628 105 160 1151 1572
NM_032429chr103581 165 87 ------
NM_032438chr61446 ------
NM_032440chr1032946 212 197 --12330 --
NM_032445chr1542093 895 866 772 --196 1533
NM_032446chr511081 --1769 --
NM_032449chr162567 1919 1835 467 451 366 22491 2218 ----
NM_032452chr1451364 486 471 86 26 ------
NM_032457chr41427 --13250 --
NM_032482chr1962611 2401 1953 995 769 683 --22322 1872 22119 172
NM_032486chr1682600 2254 2200 1955 1768 989 466 304 22327 2122 --1816
NM_032509chr821751 640 ----1894
NM_032523chr2----1492 --
NM_032536chr92666 470 ------
NM_032538chr632766 1024 659 --11047 11127
NM_032557chr4128 --1266 --
NM_032560chr141314 ------
NM_032569chr1631491 681 348 --21246 241 --
NM_032575chr1651959 1671 1491 1386 681 --41628 258 189 162 --
NM_032582chr172751 118 ----11577
NM_032595chr1731380 424 190 --3618 612 277 --
NM_032603chr2----133 --
NM_032636chr12481 136 --1451 1102
NM_032682chr333491 1156 672 ------
NM_032689chr1941290 1189 1075 1034 ------
NM_032711chr1774171 3787 3341 3159 2991 1606 1297 --64246 3620 3530 1621 1533 1379 13192
NM_032727chr1011171 1433 ----
NM_032728chr93877 846 142 --144 --
NM_032737chr1962148 2010 1811 1713 549 474 ------
NM_032741chr63823 371 185 ------
NM_032777chr821428 33 --11286 --
NM_032781chr11----1140 --
NM_032788chr211436 21362 1095 ----
NM_032800chr132517 461 139 --1483 --
NM_032801chr1142204 1951 364 131 12115 1271 --
NM_032806chr32289 36 --122 --
NM_032808chr154861 724 623 56 --2879 831 --
NM_032809chr931480 1070 1049 11244 21153 430 --
NM_032818chr941937 892 624 438 21861 192 11047 --
NM_032828chr19114211 3715 3626 3409 3195 1933 1794 930 346 337 202 21004 483 33276 1488 428 --
NM_032829chr1221072 137 --21025 447 --
NM_032840chr1241147 1074 873 262 --11019 1135
NM_032842chr71584 --1594 --
NM_032854chr17------1232
NM_032859chr131508 ------
NM_032875chr17--2628 588 ----
NM_032876chr142772 388 --2472 213 1434
NM_032900chr1063693 3299 3209 1546 1256 985 128 11380 12656
NM_032918chr12----1133 --
NM_032926chrX----149 --
NM_032947chr5193 --1933 --
NM_032961chr4188 ------
NM_032975chr1853087 2842 2677 1159 647 ------
NM_032980chr1853087 2842 2677 1159 647 ------
NM_032998chr12845 364 ------
NM_033008chr31461 ----1189
NM_033009chr31461 ----1189
NM_033010chr31461 ----1189
NM_033012chr134795 315 309 108 ------
NM_033014chr9----1371 --
NM_033018chrX2184 164 ------
NM_033020chr144051 3341 1863 1398 24285 3285 1868 --
NM_033027chr33974 293 96 1935 --1102
NM_033055chr11841 ------
NM_033058chr81149 1701 ----
NM_033102chr12123 89 1976 ----
NM_033102chr12123 89 1976 ----
NM_033116chr142226 88 ------
NM_033129chr2042070 1942 1543 642 --31623 1454 536 --
NM_033133chr1791370 1323 1194 1027 855 838 804 704 461 1576 21445 860 12474
NM_033135chr1122267 1580 12322 ----
NM_033141chr143485 444 230 21975 559 ----
NM_033143chr444462 4029 345 98 13444 22882 1559 --
NM_033158chr3----134 --
NM_033161chr961667 1572 1358 1342 729 27 21614 173 31810 1260 745 11289
NM_033201chr162209 160 ------
NM_033222chr911364 ------
NM_033224chr767922 6944 6807 6798 2929 1422 15102 ----
NM_033225chr853106 2316 1996 231 98 ------
NM_033226chr162525 100 ------
NM_033240chr1561686 1595 1483 673 470 360 ------
NM_033251chr161359 ------
NM_033255chr131150 --125 --
NM_033266chr161170 195 168 2339 41
NM_033267chr51106 1774 ----
NM_033274chr582338 1367 1303 1128 553 518 207 90 12705 22304 946 22946 2689
NM_033278chr11268 23 ------
NM_033290chrX43540 3134 1037 685 21377 1343 ----
NM_033300chr111353 1579 --11152
NM_033309chr164971 904 868 141 --1268 --
NM_033310chr11163 ------
NM_033315chr1771984 1805 1496 1393 722 333 36 1577 11434 --
NM_033317chr19268 44 --192 --
NM_033326chr1141993 1861 1700 91 ------
NM_033331chr952900 2883 2655 982 291 --1344 --
NM_033334chr91209 ------
NM_033360chr1211280 ------
NM_033375chr171451 --31372 1329 1198 --
NM_033389chr1733725 3055 803 --34442 4231 4225 --
NM_033393chr452513 1183 1078 1029 552 12895 ----
NM_033401chr161147 ------
NM_033425chr1142174 390 48 37 12675 ----
NM_033429chr151882 22150 874 42222 768 289 271 --
NM_033449chr531633 1406 1386 --3792 727 332 21686 311
NM_033480chr632413 1938 559 --12618 --
NM_033481chr632413 1938 559 --12618 --
NM_033495chrX--1167 ----
NM_033503chr15103427 3338 3148 2621 2464 741 716 693 603 530 12530 43368 2948 2937 2501 --
NM_033512chr8112899 2422 948 886 790 554 548 410 288 86 63 --1294 --
NM_033551chr543247 1293 1091 1022 12695 1378 --
NM_033626chrX71624 1588 1579 1250 1134 573 543 --1686 --
NM_033644chr542510 2098 351 51 ------
NM_033645chr542510 2098 351 51 ------
NM_033656chr2175072 4376 2127 561 528 173 62 ------
NM_044472chr11287 ------
NM_052818chr1311902 11864 11841 11950
NM_052820chr9--3479 388 351 ----
NM_052837chr11101 --124 --
NM_052849chr151797 ------
NM_052851chr131479 --11835 12051
NM_052864chr411888 21716 1359 ----
NM_052868chr1----1188 --
NM_052879chr1223295 484 ------
NM_052885chr1253903 1678 1573 910 443 2437 409 ----
NM_052898chr841778 1709 223 163 ----11617
NM_052900chr821713 1478 11257 ----
NM_052905chr221878 1175 1330 ----
NM_052907chr1223421 403 ----14129
NM_052910chr132524 423 11841 11900 --
NM_052911chr181980 ------
NM_052918chr1032688 1365 539 --21123 1118 --
NM_052928chr1741213 457 160 69 2383 84 ----
NM_052950chr1331399 249 161 ----12154
NM_052958chr8128 1625 ----
NM_052968chr11290 53 --1532 1736
NM_052978chr1421386 479 ------
NM_053002chr32889 462 --1937 --
NM_053016chr967102 6902 6221 1702 885 469 15667 11084 --
NM_053023chr1122872 669 --31303 1048 432 --
NM_053025chr31652 ------
NM_053026chr31652 ------
NM_053027chr31652 ------
NM_053028chr31652 ------
NM_053031chr31652 ------
NM_053032chr31652 ------
NM_053041chr20----2119 27 --
NM_053046chr193451 363 69 ------
NM_054013chr52848 620 --2594 153 --
NM_054025chr1162189 1832 576 411 73 44 --2421 351 --
NM_057091chr12281 45 --2446 422 --
NM_057175chr41754 --11836 --
NM_057178chr1751006 848 550 439 68 --12161 --
NM_058167chr141016 919 456 199 1510 2900 462 --
NM_058172chr411804 ------
NM_058175chr212817 281 --3641 555 186 --
NM_058241chr221761 278 ------
NM_058241chr221761 278 ------
NM_078474chr151510 ------
NM_078476chr621535 218 21466 1364 ----
NM_079420chr2141 ------
NM_079422chr2141 ------
NM_080415chr172829 98 ------
NM_080550chr171828 ------
NM_080588chr141304 1101 222 198 124 1536 --
NM_080604chr61621 --2602 489 --
NM_080611chr20122 --140 --
NM_080616chr203628 582 62 ------
NM_080621chr2021108 227 1457 21144 75 21302 125
NM_080664chr1422005 501 ------
NM_080669chr1794786 4076 3476 1947 1768 1663 1046 1016 581 1566 73836 3608 1824 1587 1581 1252 1105 --
NM_080670chr51680 ------
NM_080671chr252046 1732 1723 608 27 11589 11747 --
NM_080676chr2042662 1081 808 365 --31023 330 33 --
NM_080679chr62814 209 ----1638
NM_080680chr62814 209 ----1638
NM_080681chr62814 209 ----1638
NM_080686chr6----1129 --
NM_080702chr6191 ------
NM_080703chr6191 ------
NM_080732chr193451 363 69 ------
NM_080738chr131730 1346 25 ----11597
NM_080743chr61928 22571 1799 ----
NM_080764chr2231235 1209 218 --22691 2604 1763
NM_080798chr102325 22 ------
NM_080799chr102325 22 ------
NM_080800chr102325 22 ------
NM_080801chr102325 22 ------
NM_080802chr102325 22 ------
NM_080803chr102325 22 ------
NM_080804chr102325 22 ------
NM_080805chr102325 22 ------
NM_080806chr102325 22 ------
NM_080807chr102325 22 ------
NM_080808chr102325 22 ------
NM_080809chr102325 22 ------
NM_080810chr102325 22 ------
NM_080811chr102325 22 ------
NM_080812chr102325 22 ------
NM_080813chr102325 22 ------
NM_080814chr102325 22 ------
NM_080815chr102325 22 ------
NM_080865chr32703 287 ------
NM_080872chr823245 2911 23904 3795 ----
NM_080881chr56679 316 223 140 128 60 --1501 2550 281
NM_080927chr33639 347 46 --12916 --
NM_130387chr3150 ------
NM_130391chr912510 ------
NM_130392chr912510 ------
NM_130393chr912510 ------
NM_130434chr15137 ------
NM_130435chr1042549 2269 1913 688 1780 --1856
NM_130436chr213834 741 695 ----12731
NM_130438chr2131318 1272 233 ----13308
NM_130439chr1032119 1458 403 11950 ----
NM_130439chr1032119 1458 403 11950 ----
NM_130442chr7--1423 ----
NM_130459chr961469 1387 1356 1159 411 199 --21341 1329 21049 666
NM_130466chr1251833 1823 146 107 72 ------
NM_130468chr151706 --2280 88 --
NM_130469chr142654 85 --1337 --
NM_130474chr112806 742 128 1176 --
NM_130475chr112806 742 128 1176 --
NM_130797chr741740 1727 1117 31 ------
NM_130811chr201227 ------
NM_130848chr541298 775 757 99 ------
NM_133170chr2097795 7636 6414 2309 1912 1858 1090 653 134 26629 6238 32819 2786 290 --
NM_133171chr2061059 935 915 880 857 174 ----1384
NM_133264chr1783742 3160 2835 2709 2604 1060 980 61 12533 1962 --
NM_133265chrX33570 1260 932 --23475 2310 --
NM_133329chr231690 1158 499 ------
NM_133369chr53925 846 183 --1146 --
NM_133370chr431400 1294 1280 12417 12234 13483
NM_133372chr522667 2015 22238 369 ----
NM_133378chr21689 ------
NM_133432chr21689 ------
NM_133437chr21689 ------
NM_133444chr1961636 1373 1153 351 263 90 21388 1079 1125 --
NM_133445chr952551 2539 2301 1137 867 ------
NM_133476chr121106 --1389 --
NM_133486chrX182 ------
NM_133498chr191118 ------
NM_133499chrX3925 871 840 --1245 --
NM_133503chr121741 ------
NM_133504chr121741 ------
NM_133505chr121741 ------
NM_133506chr121741 ------
NM_133507chr121919 ------
NM_133625chr351300 1150 452 289 112 ------
NM_133634chr2141655 1477 1183 187 --1680 --
NM_133642chr221880 1129 ----
NM_134268chr1741081 973 854 185 ----11104
NM_134325chr131160 319 26 21120 610 ----
NM_134421chr24730 616 596 492 --1200 --
NM_134442chr221601 46 11525 ----
NM_138270chrX21077 104 --13014 --
NM_138288chr1432132 1430 1385 --11917 --
NM_138300chr181616 1362 1306 437 128 97 82 75 ------
NM_138316chr101329 ------
NM_138319chr154909 278 220 166 ------
NM_138338chr2293474 3379 3240 3174 3063 2899 2537 859 566 1952 ----
NM_138355chr172124 100 --122 --
NM_138356chr15272 58 ------
NM_138395chr21337 --1343 --
NM_138415chr2221183 291 --1326 --
NM_138426chr7--1499 11822 --
NM_138430chr132363 122 ------
NM_138441chr6--193 ----
NM_138444chr13193 11609 ----
NM_138473chr1235131 4196 3990 24146 1021 ----
NM_138555chr152514 403 ------
NM_138559chr211313 --1275 11125
NM_138576chr1453566 3409 1038 984 847 22939 1454 ----
NM_138578chr2081362 1275 1141 1092 1028 588 423 210 --21376 144 11350
NM_138619chr1741474 1106 253 180 1499 170 1516
NM_138621chr284082 4009 3408 3016 3003 1405 1161 995 1784 ----
NM_138633chr611782 1230 ----
NM_138638chr142947 364 11615 ----
NM_138689chr11129 ------
NM_138713chr1676877 6801 6257 2878 941 916 489 ------
NM_138714chr1676877 6801 6257 2878 941 916 489 ------
NM_138717chr62156 55 1566 ----
NM_138727chr142168 619 307 253 ------
NM_138728chr142168 619 307 253 ------
NM_138731chr1422912 355 ------
NM_138732chr111103 ------
NM_138734chr111103 ------
NM_138735chr221528 547 ------
NM_138768chr112565 301 --1892 --
NM_138771chr7177 ------
NM_138782chr51916 ----1971
NM_138795chr12596 293 --1201 --
NM_138799chr241919 1595 1375 806 11843 ----
NM_138802chr22224 47 ------
NM_138966chr181205 ------
NM_138967chr1532507 2024 1873 12204 52321 2169 1792 425 363 1379
NM_138969chr821241 470 1328 ----
NM_138970chr1421895 300 --1834 --
NM_138971chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138971chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138972chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138972chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138973chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138973chr1163611 2668 1318 1238 1003 440 23665 2579 ----
NM_138980chr4--1549 ----
NM_138981chr4--2680 553 ----
NM_138982chr4--1549 ----
NM_138992chr2131103 823 179 ------
NM_138994chr161147 ------
NM_139046chr10177 ------
NM_139057chr1531804 1110 188 --1900 --
NM_139062chr17141 ------
NM_139068chr51621 --175 --
NM_139069chr51621 --175 --
NM_139070chr51490 ------
NM_139071chr1261493 1482 1127 592 446 245 ------
NM_139135chr11909 ------
NM_139136chr122324 266 ------
NM_139156chr12766 246 1216 2802 331 --
NM_139159chr1931026 124 83 1510 1373 --
NM_139167chr8--1109 ----
NM_139169chr101181 1194 ----
NM_139181chr11123 ------
NM_139207chr1211419 ------
NM_139215chr17183 ------
NM_139245chr341367 1254 174 53 ------
NM_139246chr981970 1715 935 921 824 395 383 114 --1854 --
NM_139273chr111225 155 ----
NM_139276chr1762277 2093 2073 1822 1666 678 22147 608 11575 --
NM_139278chr851068 1016 975 377 21 --11093 1164
NM_139279chr252858 1431 1131 1034 846 --32355 608 487 23098 2695
NM_139320chr152311 122 --11041 --
NM_139321chr2033713 3616 2804 1554 23933 3657 --
NM_139323chr2021317 644 ------
NM_144568chr141430 --2436 30 --
NM_144571chr425369 635 15211 ----
NM_144575chr2--129 165 1182
NM_144576chr124609 501 154 74 ------
NM_144579chr2102714 2697 2607 2533 2386 2213 2026 915 835 503 1590 72772 2765 2597 1824 1171 1067 642 22845 2202
NM_144582chr292611 2362 2301 2216 1687 994 852 623 109 21906 169 2975 298 12200
NM_144595chr132685 67 ------
NM_144599chr1564996 4662 4220 3647 2107 56 24291 152 13600 --
NM_144609chr171275 11105 11212 --
NM_144610chr17129 ------
NM_144628chr2063051 2434 2420 2332 2129 1048 --21950 1185 --
NM_144631chr2167 ------
NM_144633chr32404 230 ------
NM_144635chr31824 11234 1481 --
NM_144636chr31632 --1689 --
NM_144641chr331145 142 46 2169 131 1237 1304
NM_144660chr102398 291 ------
NM_144667chr123951 942 859 ------
NM_144671chr12111854 1680 1217 797 749 718 711 646 616 387 133 --81380 637 621 516 511 481 298 115 --
NM_144685chr192277 221 --1260 1209
NM_144691chr191263 --2158 125 --
NM_144728chr11665 ------
NM_144729chr11665 ------
NM_144767chr15104582 4103 3928 1430 1059 922 826 494 275 43 13516 41534 1135 972 245 --
NM_144949chr21508 ------
NM_144973chr1233860 1720 872 23435 1646 ----
NM_144979chr41536 ------
NM_144982chr122209 85 ------
NM_144998chr171314 ----147
NM_145008chr11----1111 --
NM_145010chr1022211 389 1139 22193 1950 --
NM_145056chr19136 ------
NM_145058chr123349 177 29 ------
NM_145071chr32835 312 ----1130
NM_145112chr1421113 396 --1404 --
NM_145113chr1411385 --187 --
NM_145119chrX125 ------
NM_145159chr142656 372 1624 ----
NM_145166chr352717 2258 1071 960 399 --22057 1076 22799 1932
NM_145176chr62521 257 ------
NM_145206chr1032852 2229 678 12157 22258 1308 --
NM_145233chr192376 287 1302 ----
NM_145279chr121741 24 11649 ----
NM_145284chrX22010 347 --12518 --
NM_145296chr191826 ------
NM_145307chr101855 --1499 14313
NM_145313chr101437 --11321 --
NM_145349chr1742045 879 581 543 21536 553 ----
NM_145638chr112275 26 1417 4861 722 227 196 --
NM_145686chr232706 2525 681 --129 --
NM_145687chr232706 2525 681 --129 --
NM_145690chr8--11338 11565 --
NM_145698chr1011375 --11510 --
NM_145733chr22----11196 --
NM_145739chr2----1492 --
NM_145798chr171146 --2311 127 --
NM_145804chr1131150 887 225 ------
NM_145808chr722064 47 ------
NM_145861chr131730 1346 25 ----11597
NM_145891chr1621565 231 ------
NM_145892chr1621565 231 ------
NM_145893chr1621687 353 ------
NM_145899chr62403 120 --3530 438 223 --
NM_145901chr62403 120 --3530 438 223 --
NM_145902chr62403 120 --3530 438 223 --
NM_145903chr62403 120 --3530 438 223 --
NM_145904chr62403 120 --3530 438 223 --
NM_145905chr62403 120 --3530 438 223 --
NM_146388chr1941114 496 43 31 1134 1920 --
NM_147147chr683593 2965 1589 1580 1545 1523 1510 817 ------
NM_147150chr922889 1400 ------
NM_147156chr102326 139 ------
NM_147161chr151103 1036 376 346 313 1364 --1141
NM_147164chr9----1189 --
NM_147175chrX11518 ------
NM_147189chr841602 358 189 159 ------
NM_147190chr122550 68 ------
NM_147192chr141540 281 190 72 11465 1553 --
NM_147202chr962496 2351 930 712 370 299 22244 840 12123 --
NM_147223chr2----11527 199
NM_148174chr82689 53 11804 ----
NM_148571chr1721434 238 11468 ----
NM_148894chr41967 ------
NM_148898chr71308 ------
NM_148899chr71308 ------
NM_148911chr152311 122 --11041 --
NM_148921chr1741985 732 583 351 --21682 198 1332
NM_148977chr101329 ------
NM_148978chr101329 ------
NM_152233chr1421467 1399 21604 220 ----
NM_152237chr2241549 1317 1201 133 11749 3582 229 58 --
NM_152238chr11238 ------
NM_152244chr1731214 1127 414 --1463 --
NM_152253chr2283775 3576 2901 2684 1668 1170 765 511 11360 1822 13373
NM_152261chr1231823 870 137 ------
NM_152264chr11----2998 321 1977
NM_152265chr121128 576 --11091 11392
NM_152271chr83974 363 42 ------
NM_152299chr22----169 --
NM_152300chr1731923 647 233 ------
NM_152342chr164397 387 223 196 --1488 --
NM_152344chr1731434 1389 109 ------
NM_152371chr141464 655 597 311 11771 121 --
NM_152380chr12271 132 --11180 --
NM_152387chr21371 ------
NM_152388chr253929 3423 2585 1518 461 ------
NM_152407chr532271 787 228 13020 1976 --
NM_152408chr5141 ------
NM_152409chr52986 94 1918 13013 --
NM_152420chr9----1674 1723
NM_152424chrX74583 4577 3783 1878 1814 1792 618 11847 34279 3151 3009 --
NM_152440chr122820 416 ------
NM_152442chr1231369 1059 457 ----145
NM_152446chr144810 347 157 112 178 ----
NM_152450chr1521801 1427 ------
NM_152470chr1893445 3412 3104 1340 1333 1261 1148 920 220 --44112 2524 1267 817 --
NM_152493chr13452 355 139 --1563 1160
NM_152520chr22994 351 ------
NM_152538chr341343 1271 495 149 --11281 --
NM_152542chr42669 578 1593 ----
NM_152545chr4----162 --
NM_152549chr5--1210 ----
NM_152586chr102844 148 174 ----
NM_152594chr1512116 ------
NM_152598chr171295 --1250 --
NM_152622chr521232 403 ------
NM_152624chr567401 5259 5123 1994 1911 1744 --25545 4498 --
NM_152629chr943268 2696 1382 289 --1753 --
NM_152636chr1122399 739 22322 886 ----
NM_152641chr1222110 920 12045 ----
NM_152652chr162280 220 ------
NM_152678chr341786 1704 865 400 1789 ----
NM_152722chr1141651 707 230 50 ----1294
NM_152724chr1022569 279 12201 125 --
NM_152733chr676317 5122 4945 4572 4448 1973 1114 --66048 5397 4886 4680 4613 2199 14963
NM_152734chr6105331 5321 3862 1796 1510 1312 1269 1262 587 219 1200 24529 867 --
NM_152739chr7----1178 --
NM_152745chr71127 ------
NM_152749chr72971 239 ------
NM_152754chr743085 2347 871 565 ------
NM_152756chr51514 ------
NM_152758chr833040 2456 1010 ------
NM_152774chr722011 1781 ------
NM_152787chrX53097 2649 1123 414 327 ------
NM_152789chr71601 11025 ----
NM_152832chr11----1343 1388
NM_152835chr132704 2024 165 ------
NM_152836chr811754 ------
NM_152837chr811754 ------
NM_152838chr201946 ------
NM_152854chr202609 210 --160 --
NM_152860chr125532 498 204 136 53 --1276 --
NM_152874chr101435 11153 --11046
NM_152890chr12358 36 ------
NM_152919chr1932550 1513 571 31528 913 241 ----
NM_152924chr1586363 5471 5301 4592 4245 2427 2312 2290 25396 2457 34480 4226 938 24207 2204
NM_152932chr31326 ------
NM_152989chr1241567 1351 1255 1181 ------
NM_153000chr181553 --1215 --
NM_153026chr121502 ------
NM_153029chr1664023 3617 3535 3003 2762 39 --53622 3564 3416 835 830 12790
NM_153035chr153083 2741 2604 230 100 --1618 --
NM_153038chr21647 ------
NM_153047chr62409 149 ------
NM_153048chr62409 149 ------
NM_153050chr2284514 3709 3496 1217 1160 1153 1129 823 33201 1585 1264 21479 899 --
NM_153051chr2284514 3709 3496 1217 1160 1153 1129 823 33201 1585 1264 21479 899 --
NM_153181chr181205 ------
NM_153183chrX21179 221 ------
NM_153184chr3157 11698 ----
NM_153186chr92797 194 ------
NM_153188chr555070 5054 4386 1830 1502 ----1887
NM_153207chr1233571 2781 690 --23027 2986 --
NM_153234chr522151 2127 --22225 278 --
NM_153252chrX141 ------
NM_153262chr122493 416 12863 1714 --
NM_153273chr362684 1729 961 897 780 221 ----1787
NM_153333chrX----132 --
NM_153334chr228759 672 623 531 483 289 249 100 1141 ----
NM_153335chr1741242 1016 433 113 --1983 --
NM_153341chr11118 ------
NM_153342chr2----123 --
NM_153347chr1122274 2187 ----1902
NM_153354chr51667 ------
NM_153365chr442733 2434 249 159 ------
NM_153367chr1031387 1027 353 23414 1572 23493 1174 --
NM_153464chr192686 605 --1549 --
NM_153499chr1272650 2587 2500 2487 1884 551 309 --52739 2656 2033 2028 620 12046
NM_153500chr1272650 2587 2500 2487 1884 551 309 --52739 2656 2033 2028 620 12046
NM_153607chr532716 833 23 ------
NM_153616chr151218 ------
NM_153617chr151218 ------
NM_153618chr151218 ------
NM_153619chr1511456 ------
NM_153620chr71529 ------
NM_153631chr731656 1390 364 --1265 --
NM_153632chr731656 1390 364 --1265 --
NM_153634chr1211200 ------
NM_153649chr131608 1599 1453 --12105 --
NM_153685chr121829 --21133 112 --
NM_153686chr442366 1809 954 931 ------
NM_153697chr22647 122 1571 ----
NM_153715chr71326 --2417 46 --
NM_153748chr122324 266 ------
NM_153756chr151701 1362 492 302 144 --41376 772 604 103 --
NM_153812chr122234 688 1267 ----
NM_153827chr171731 ------
NM_170606chr71452 1235 ----
NM_170663chr171731 ------
NM_170665chr1284280 3688 3458 3092 2955 1508 541 104 --22791 1069 --
NM_170674chr15180 ------
NM_170677chr15180 ------
NM_170679chr5--11129 ----
NM_170696chr1511079 11195 ----
NM_170697chr1511079 11195 ----
NM_170706chr143529 3341 1662 32 13170 21648 428 --
NM_170711chr192664 589 1689 ----
NM_170719chr132406 86 ------
NM_170721chr17--21047 410 ----
NM_170731chr1152696 2469 876 648 521 ------
NM_170732chr1152696 2469 876 648 521 ------
NM_170733chr1152696 2469 876 648 521 ------
NM_170734chr1152696 2469 876 648 521 ------
NM_170735chr1152696 2469 876 648 521 ------
NM_170751chr611064 ------
NM_170752chr611064 ------
NM_170754chr12----177 --
NM_170768chr112236 40 ------
NM_170769chr62162 27 --2215 40 --
NM_171825chr582881 2651 2335 2307 2258 2139 2011 605 --21960 273 11950
NM_171998chrX21906 1018 1232 ----
NM_171999chr181560 ------
NM_172016chr61961 --21088 908 --
NM_172020chr751703 1551 796 672 119 1692 1484 --
NM_172057chr71249 130 ----
NM_172058chr811808 ------
NM_172059chr811808 ------
NM_172060chr811808 ------
NM_172070chr211419 ------
NM_172071chr145822 2815 2171 1687 26112 4703 ----
NM_172103chr622503 2074 --179 --
NM_172105chr622503 2074 --179 --
NM_172127chr411804 ------
NM_172128chr421760 832 ------
NM_172169chr1061720 1408 625 477 387 62 1357 1397 --
NM_172170chr1061720 1408 625 477 387 62 1357 1397 --
NM_172171chr1061720 1408 625 477 387 62 1357 1397 --
NM_172173chr1061720 1408 625 477 387 62 1357 1397 --
NM_172206chr1771679 1569 1358 1304 1200 319 248 ----1417
NM_172216chr1262552 2489 2402 2389 453 211 --52641 2558 1935 1930 522 11948
NM_172225chr141540 281 190 72 11465 1553 --
NM_172226chr1272650 2587 2500 2487 1884 551 309 --52739 2656 2033 2028 620 12046
NM_172315chr15180 ------
NM_172316chr15180 ------
NM_172344chr231690 1158 499 ------
NM_172373chr1311027 ------
NM_172375chr14----11090 1267
NM_173065chr153124 3115 3069 1259 350 --2518 260 --
NM_173074chr2--140 183 --
NM_173075chr41302 ----11614
NM_173156chr11676 ----169
NM_173171chr22353 224 ------
NM_173172chr22532 41 ------
NM_173173chr22353 224 ------
NM_173198chr932029 1014 439 1767 1152 --
NM_173199chr92484 400 ------
NM_173200chr932029 1014 439 1767 1152 --
NM_173201chr16----1265 --
NM_173214chr1676877 6801 6257 2878 941 916 489 ------
NM_173354chr2121586 721 --21535 74 --
NM_173359chr32759 102 ------
NM_173454chr152196 81 ------
NM_173465chr551018 871 860 786 111 --3925 834 266 --
NM_173468chr436106 4999 3680 1346 ----
NM_173469chr151247 ------
NM_173470chrX52811 2004 1956 500 137 ------
NM_173474chr16136 ------
NM_173475chr1631610 1413 1110 --11590 --
NM_173476chr1642025 1577 774 674 --51921 1507 871 512 275 11834
NM_173489chr5125 ------
NM_173491chr511065 --21368 108 11390
NM_173495chrX21856 988 ------
NM_173508chr131238 904 851 ------
NM_173511chr231178 494 85 ------
NM_173515chr62297 201 1406 132 --
NM_173525chr11159 ------
NM_173542chr121584 --1487 --
NM_173543chr3240 23 ------
NM_173546chr33507 93 62 ------
NM_173552chr3146 --11814 --
NM_173561chr63244 212 88 ----1877
NM_173564chr72687 251 --158 --
NM_173582chr1155848 5067 1325 151 106 35109 1602 1251 ----
NM_173587chr112248 49 --1225 --
NM_173595chr1294613 4415 4121 3805 3231 1834 1360 1219 170 --62084 1367 825 744 667 272 --
NM_173602chr1253751 3327 1480 1315 63 --21323 943 --
NM_173642chr1149129 8975 8643 8592 6332 6309 5955 3583 3252 2794 2451 2397 734 333 38314 6029 159 --16735
NM_173662chr4--150 ----
NM_173664chr541309 1088 630 514 11158 11447 1244
NM_173666chr521216 1147 ----1185
NM_173672chr662559 1740 1685 451 277 247 --12411 --
NM_173681chr741353 624 526 292 ----1118
NM_173694chrX42084 2041 1011 288 12019 ----
NM_173809chr1031400 1154 117 --21412 1112 --
NM_173822chr21793 ------
NM_173825chr322725 2381 1583 11169 12394
NM_173828chr5----2352 347 --
NM_173829chr535308 4755 2401 24368 2064 ----
NM_173854chr152284 2104 645 344 200 ------
NM_173872chr4--1745 1284 --
NM_174911chr813353 --2705 238 11128
NM_174921chr411010 1934 1326 --
NM_174934chr1183408 3128 2728 1387 975 672 656 647 1110 23579 272 --
NM_174963chr11231 ------
NM_174964chr11231 ------
NM_174965chr12584 250 ------
NM_174966chr11231 ------
NM_174967chr12584 250 ------
NM_174968chr11231 ------
NM_174969chr11231 ------
NM_174970chr12584 250 ------
NM_174971chr11231