TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4728-3p
miRNA Sequence: CAUGCUGACCUCCCUCCUGCCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541404 1387 265 240 ------
NM_000052chrX32841 1184 51 1210 ----
NM_000081chr121197 523 --11766 --
NM_000084chrX136969 6396 6075 5886 5311 4991 4870 2782 2662 2078 2019 1786 1589 12766 25614 554 --
NM_000089chr7----2673 602 --
NM_000090chr2--2876 134 ----
NM_000091chr262635 2600 2460 2364 2000 1845 21927 830 12006 --
NM_000108chr731646 541 237 --11875 --
NM_000109chrX1220 ------
NM_000111chr71146 1308 ----
NM_000115chr133678 249 183 --22006 639 --
NM_000138chr152821 541 22254 2061 ----
NM_000141chr102962 346 1374 --1143
NM_000151chr1751874 1498 1305 747 196 ------
NM_000158chr33658 619 233 ------
NM_000161chr1431232 529 50 21556 378 ----
NM_000165chr621429 1347 ------
NM_000168chr732926 1049 103 1569 1222 --
NM_000173chr17----1405 --
NM_000176chr52744 428 --13040 --
NM_000192chr1221138 167 11259 ----
NM_000194chrX3549 493 445 ------
NM_000202chrX42650 1368 1167 749 --13174 --
NM_000214chr202719 531 ------
NM_000217chr1274973 4699 4163 3332 1871 1166 38 --11112 --
NM_000232chr442796 2612 2158 1223 --1402 --
NM_000248chr322125 233 12877 ----
NM_000259chr15105659 4643 4363 4049 3887 2337 2212 1980 332 313 16174 15547 --
NM_000264chr942869 2340 1047 835 ----23350 345
NM_000267chr1732714 653 475 13040 12247 --
NM_000291chrX1153 --2355 51 --
NM_000304chr17--1302 1316 --
NM_000310chr131154 835 509 1907 ----
NM_000314chr1032794 2738 2521 --1595 --
NM_000321chr13--1361 11125 --
NM_000330chrX21702 1459 --12211 22124 791
NM_000332chr625548 84 --46585 2774 2329 468 17185
NM_000333chr32929 68 1318 ----
NM_000337chr576531 4899 2370 1427 752 662 227 52547 988 403 357 34 --12068
NM_000346chr1721748 393 ------
NM_000362chr2243411 2289 1203 115 ------
NM_000390chrX63147 2768 2325 2204 603 584 --22889 2467 --
NM_000397chrX42318 571 310 234 --12333 --
NM_000408chr283249 2252 1158 824 735 694 460 392 ------
NM_000430chr1753669 2964 2866 669 579 ------
NM_000436chr511551 ------
NM_000448chr1163282 2378 2143 2010 548 240 ------
NM_000449chr131147 588 515 --1428 --
NM_000461chr353521 3063 2915 2899 321 11239 11377 13705
NM_000462chr151720 ------
NM_000489chrX43167 2139 902 320 --21039 644 --
NM_000493chr62838 213 1717 1378 --
NM_000503chr871285 647 582 247 241 98 78 --1321 --
NM_000516chr202324 244 ------
NM_000523chr22788 477 1282 ----
NM_000530chr1------1835
NM_000533chrX21628 1329 21691 661 1743 --
NM_000555chrX117770 7528 7157 7128 7073 5846 2670 2618 1569 1511 242 11264 12927 --
NM_000599chr221141 582 --14485 --
NM_000610chr112225 189 ----2614 120
NM_000615chr1142878 2675 849 653 --22445 545 --
NM_000618chr1274104 2507 2198 1725 1167 876 383 11450 --1847
NM_000618chr1274104 2507 2198 1725 1167 876 383 11450 --1847
NM_000663chr1672964 2896 2872 2625 2599 2170 1250 12104 43115 2292 2272 721 --
NM_000693chr15----11510 --
NM_000719chr1245904 1365 736 108 --25090 1599 --
NM_000724chr1051751 666 351 154 59 ------
NM_000726chr231283 1256 95 ------
NM_000756chr83419 64 37 --1162 --
NM_000793chr1455070 3860 3818 3546 1255 --34653 3595 270 --
NM_000806chr511409 11716 11729 --
NM_000807chr42576 109 ------
NM_000811chr5172 --1295 --
NM_000813chr565220 3613 1867 1812 824 329 23534 906 25579 385 --
NM_000814chr1533415 3014 1077 --23520 1385 1155
NM_000817chr24974 324 287 167 --1452 --
NM_000826chr41247 12429 ----
NM_000829chr1131969 609 151 11811 ----
NM_000833chr1621481 1103 ------
NM_000842chr112554 143 ------
NM_000856chr42276 102 ------
NM_000859chr531733 1478 1312 --1555 --
NM_000860chr421477 1454 ------
NM_000861chr342304 1090 934 186 21688 1022 ----
NM_000868chrX32031 1898 984 11645 21909 881 --
NM_000875chr1586880 6136 5330 4936 2682 2363 2214 1601 16200 26100 5945 --
NM_000876chr631322 1178 1070 --1365 --
NM_000879chr5------1102
NM_000891chr1753501 3383 2615 1160 819 --32675 2605 1454 1173
NM_000899chr1223195 498 ------
NM_000921chr121446 ------
NM_000926chr11117960 7911 7540 6493 6433 6214 6029 2776 1951 1712 1203 12289 --11652
NM_000933chr203504 438 380 --11579 --
NM_000945chr221844 826 ------
NM_000950chrX12780 1313 53070 2483 1381 723 463 --
NM_000956chr14135 --11055 --
NM_000959chr163967 3716 1434 772 684 414 ------
NM_000961chr204716 464 378 109 ------
NM_000965chr321183 912 ------
NM_001001132chr211117 --21393 573 --
NM_001001323chr1242543 2233 580 546 --12169 1524
NM_001001330chr1021258 418 2939 311 ----
NM_001001389chr112225 189 ----2614 120
NM_001001390chr112225 189 ----2614 120
NM_001001391chr112225 189 ----2614 120
NM_001001392chr112271 235 ----2660 166
NM_001001395chr1212489 ------
NM_001001419chr534079 1259 560 ----1877
NM_001001420chr534079 1259 560 ----1877
NM_001001433chr2022503 362 --1334 --
NM_001001438chr21----1116 --
NM_001001481chr853057 1336 676 548 216 --1910 --
NM_001001485chr32180 125 ------
NM_001001486chr32122 67 ------
NM_001001487chr32122 67 ------
NM_001001549chr722596 2047 1609 ----
NM_001001550chr722596 2047 1609 ----
NM_001001555chr722596 2047 1609 ----
NM_001001664chr223797 3059 ------
NM_001001668chr1933751 258 27 21033 107 12757 --
NM_001001711chr112411 100 --1912 --
NM_001001852chr221820 ------
NM_001001890chr2123713 344 --13441 --
NM_001001928chr22118025 6726 5870 5329 2709 2657 2097 1813 1562 660 418 1145 37949 5109 2427 --
NM_001001933chr11518 ------
NM_001002243chr2----1656 --
NM_001002255chr6--1113 ----
NM_001002269chr92475 408 ------
NM_001002811chr141247 460 351 259 ------
NM_001002812chr141247 460 351 259 ------
NM_001002812chr141247 460 351 259 ------
NM_001002843chr151180 ------
NM_001002860chr1443573 3143 856 527 --1338 --
NM_001003652chr18168698 7789 7422 7211 6788 6319 2898 2643 2597 2266 2045 1320 1203 339 331 59 2969 776 16253 --
NM_001003665chr143142 2541 797 172 --22527 1184 --
NM_001003674chr18136729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 27096 5263 14517 21362 1122
NM_001003675chr18136729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 27096 5263 14517 21362 1122
NM_001003679chr131807 1568 1436 --21790 1473 --
NM_001003712chr1253676 3336 1406 965 440 --23769 3165 1696
NM_001003800chr993197 2805 2297 2277 1167 529 417 355 150 1455 ----
NM_001003810chr42263 45 ------
NM_001003895chrY------161
NM_001004051chrX----1233 --
NM_001004065chr942415 1466 456 112 ------
NM_001004317chr673072 2822 1689 1596 1169 830 73 --13485 --
NM_001004342chr175606 4937 3799 2375 1686 1223 126 --24579 291 --
NM_001004360chr23606 578 148 ------
NM_001004419chr1254619 3055 2808 531 480 --11736 14511
NM_001005375chrY175 --21331 513 --
NM_001005386chr21331 ----1359
NM_001005404chr173952 853 587 11468 34458 3438 1560 --
NM_001005463chr1042272 111 94 34 ------
NM_001005474chr321538 407 --11221 --
NM_001005743chr143886 502 404 ------
NM_001005744chr143886 502 404 ------
NM_001005745chr143886 502 404 ------
NM_001005746chr231283 1256 95 ------
NM_001005747chr231283 1256 95 ------
NM_001005781chr21176 ------
NM_001005782chr21350 ------
NM_001005909chr3179 ------
NM_001006605chr111147 1837 2413 136 --
NM_001006605chr111147 1837 2413 136 --
NM_001006610chr161947 ------
NM_001006612chrX----158 --
NM_001006613chrX----158 --
NM_001006614chrX----158 --
NM_001006684chrX1135 --153 --
NM_001006932chr683238 3218 3169 2917 2473 2230 37 24 --11077 --
NM_001007023chr1455070 3860 3818 3546 1255 --34653 3595 270 --
NM_001007027chr11----1214 --
NM_001007067chr8--2734 389 ----
NM_001007068chr8--2734 389 ----
NM_001007069chr8--2734 389 ----
NM_001007070chr8--2734 389 ----
NM_001007094chr1073632 3435 3155 2973 2726 912 766 23669 101 1302 13828
NM_001007097chr951745 1393 1298 940 503 24645 4192 11253 --
NM_001007102chr631494 1394 663 --2610 29 --
NM_001007156chr1521862 1598 ----11307
NM_001007237chr142411 2361 1852 844 ------
NM_001007245chr71195 ----1562
NM_001007246chr2111382 1720 --1132
NM_001007466chr674882 4861 1979 1511 575 84 31 13615 44948 4442 924 805 --
NM_001007553chr11415 ------
NM_001007559chr1861945 478 143 58 38 29 ------
NM_001007794chr1----1609 --
NM_001008239chr1863095 3087 1458 1161 1119 222 23823 2706 ----
NM_001008391chr11121 ------
NM_001008392chr333492 3079 1220 --11243 --
NM_001008393chr4--11804 1573 --
NM_001008405chr751834 577 550 189 132 ------
NM_001008408chr764939 1929 1772 1168 965 713 14654 15060 --
NM_001008541chr1071878 1704 1643 887 861 683 173 ------
NM_001008541chr1071878 1704 1643 887 861 683 173 ------
NM_001008564chr13--11403 ----
NM_001008567chr9167 ------
NM_001008660chr1131322 625 292 ------
NM_001008783chr62654 159 ------
NM_001008801chr1921987 804 --11867 --
NM_001008860chr152638 196 ----1765
NM_001008892chr152638 196 ----1765
NM_001008894chr152638 196 ----1765
NM_001008895chr1321098 1019 --1447 --
NM_001008925chr453036 956 768 559 177 1309 22688 2149 --
NM_001009552chr82593 176 ------
NM_001009555chr451743 427 331 281 246 ------
NM_001009899chr366026 4603 4143 2358 1038 521 --21019 442 --
NM_001009909chr1143726 2850 1450 404 --23541 373 --
NM_001009959chr241781 881 827 243 ------
NM_001009960chr752594 2488 2180 2080 1082 --32016 132 50 --
NM_001010000chr1842952 2157 128 104 12796 3809 618 113 --
NM_001010853chr662413 2399 2039 889 858 697 1866 ----
NM_001010854chr142306 282 ------
NM_001010861chr141740 792 762 417 --1483 12520
NM_001010862chrX21041 815 13069 ----
NM_001010888chrX74552 3731 3336 3138 1517 1272 960 ----14252
NM_001010895chr92740 443 ----1478
NM_001010927chr6--2517 119 ----
NM_001010942chr1241130 255 182 68 --11226 1391
NM_001010980chr143495 3426 841 549 ------
NM_001010986chrX22065 2033 22338 2270 ----
NM_001010989chr161455 ------
NM_001010990chr161455 ------
NM_001011513chr433697 2987 489 ----14100
NM_001011537chr321548 322 1836 ----
NM_001011553chr72719 122 ------
NM_001011663chr102683 128 --1942 --
NM_001011666chr786411 6223 4974 4802 4387 4107 1904 1412 14563 1688 --
NM_001011708chr222489 864 ------
NM_001011713chr1411316 ----11587
NM_001012267chr931689 1475 516 11604 1733 --
NM_001012393chr11104702 4545 3799 3703 3302 3186 1929 1401 1294 1042 24046 1779 ----
NM_001012398chr165900 825 418 329 224 ------
NM_001012420chr153786 462 374 --1254 --
NM_001012421chr92845 251 ------
NM_001012423chr151462 --1254 --
NM_001012732chr431129 499 103 ------
NM_001012989chrX1151 ------
NM_001013031chr1022522 515 --22379 364 --
NM_001013399chr62995 61 ------
NM_001013415chr421223 590 ------
NM_001013439chr32764 631 ------
NM_001014286chr13----196 --
NM_001014380chr1375755 3910 2055 1582 1241 1125 987 1455 14179 --
NM_001014434chr12180 148 ------
NM_001014797chr1097147 6209 5887 5666 5524 5005 1987 1490 372 11774 27627 6151 --
NM_001015048chr1433177 1014 572 --42763 2240 136 107 --
NM_001015049chr1433177 1014 572 --42763 2240 136 107 --
NM_001015508chr8188 ------
NM_001015877chrX62722 2296 2235 1232 914 582 ------
NM_001015880chr102355 207 11568 ----
NM_001015887chr31554 --21689 1661 --
NM_001017368chr1722267 2061 ------
NM_001017395chr363642 3451 1465 1375 660 229 1774 12988 --
NM_001017415chr11192 ------
NM_001017416chr11192 ------
NM_001017440chr778039 3290 3276 2724 708 669 131 17106 38099 7998 7976 --
NM_001017523chr1251713 1576 1425 1290 406 ------
NM_001017969chr91620 ------
NM_001017975chr11524 ------
NM_001018009chr321167 258 --11050 --
NM_001018025chrX2328 145 --2603 49 --
NM_001018037chr941440 1349 584 214 ------
NM_001018038chr92522 499 --185 --
NM_001018054chr111058 ------
NM_001018057chr1131086 572 136 11009 ----
NM_001018064chr961631 773 744 388 184 116 --11572 --
NM_001018065chr921886 283 --25493 1935 15403
NM_001018066chr921886 283 --25493 1935 15403
NM_001018067chr144816 3755 3249 632 13908 ----
NM_001018068chr144816 3755 3249 632 13908 ----
NM_001018069chr144816 3755 3249 632 13908 ----
NM_001018072chr1251713 1576 1425 1290 406 ------
NM_001018074chr52744 428 --13040 --
NM_001018075chr52744 428 --13040 --
NM_001018076chr52744 428 --13040 --
NM_001018077chr52744 428 --13040 --
NM_001018089chr1542747 2536 2487 83 11085 --13820
NM_001018111chr783811 3262 1511 1073 1024 968 857 663 13759 12608 --
NM_001023567chr1531855 1765 374 --2254 216 --
NM_001024094chr52744 428 --13040 --
NM_001024649chr532057 1805 122 11903 ----
NM_001024660chr3--1480 ----
NM_001024666chrX1130 ------
NM_001024680chr221289 1221 ------
NM_001024808chr1242820 2659 1777 49 12793 ----
NM_001024847chr32465 221 12038 1471 12193
NM_001024934chr61545 ----1161
NM_001024935chr61545 ----1161
NM_001024936chr61545 ----1161
NM_001024948chr163109 3049 2217 1251 1015 793 --1787 --
NM_001025068chr311576 11535 ----
NM_001025069chr311576 11535 ----
NM_001025076chr1075229 4926 4200 2265 1769 1036 82 --12221 --
NM_001025077chr1066587 6284 5558 5010 2394 1440 ------
NM_001025079chr353774 3105 868 471 370 --11240 --
NM_001025105chr551480 606 387 165 48 ----1146
NM_001025107chr12969 66 --12021 --
NM_001025107chr12969 66 --12021 --
NM_001025108chr254066 1158 1018 753 92 13898 2501 124 --
NM_001025233chr1262222 1063 437 360 39 33 --12009 12187
NM_001025252chr842491 928 798 670 ------
NM_001025253chr842491 928 798 670 ------
NM_001025366chr6----11303 --
NM_001025366chr6----11303 --
NM_001025367chr6----11303 --
NM_001025367chr6----11303 --
NM_001025368chr6----11303 --
NM_001025368chr6----11303 --
NM_001025369chr6----11319 --
NM_001025369chr6----11319 --
NM_001025370chr6----11303 --
NM_001025370chr6----11303 --
NM_001025580chrX33709 2776 468 34102 3961 234 ----
NM_001025603chr131147 588 515 --1428 --
NM_001029858chr642864 2797 2379 984 --12076 --
NM_001029863chr662926 2901 2673 2304 950 187 ------
NM_001029875chr532684 2126 2017 12469 --1854
NM_001030007chr16--11581 ----
NM_001030055chr1434149 3848 73 14293 14182 1271
NM_001031623chr63545 388 333 ------
NM_001031679chr1232189 1152 207 --12471 12973
NM_001031681chr1732173 2150 413 --1186 1288
NM_001031684chr231284 1083 1050 ------
NM_001031695chr2285249 4644 4033 1798 1557 1132 807 393 ------
NM_001031716chr21987 ------
NM_001031732chr473095 3001 1480 905 628 406 159 --12532 12519
NM_001031748chr121511 ------
NM_001031804chr1674291 2793 1678 1068 915 705 376 --1736 --
NM_001031812chr552134 1981 1892 620 332 --1515 --
NM_001032279chr111393 ------
NM_001032280chr621434 85 --21448 535 --
NM_001032288chr2021567 1247 ------
NM_001032290chr1251 31 ------
NM_001032291chr1251 31 ------
NM_001032296chr1352891 2788 2217 2053 1176 11890 12431 --
NM_001032363chr13848 575 111 ------
NM_001032363chr13848 575 111 ------
NM_001032393chrX2274 95 ------
NM_001032394chr652791 2427 1863 362 340 ------
NM_001032395chr652658 2294 1730 229 207 ------
NM_001033044chr111430 ------
NM_001033045chr254285 2846 2821 1223 1097 ----14164
NM_001033056chr111430 ------
NM_001033057chr311904 ------
NM_001033085chr2--1253 ----
NM_001033087chr2033187 2941 725 21233 458 ----
NM_001033112chr52349 58 ------
NM_001033551chr1753052 1400 1382 642 392 12719 1536 --
NM_001033564chr641818 508 156 54 ------
NM_001033566chr172633 165 1176 1674 --
NM_001033568chr172633 165 1176 1674 --
NM_001033578chr822431 2101 --21645 253 --
NM_001033602chr1372148 2140 1716 763 445 171 107 ------
NM_001033756chr6----11237 --
NM_001033756chr6----11237 --
NM_001034845chr43482 295 60 ------
NM_001034954chr1052878 2680 2589 2167 80 ------
NM_001034955chr1052878 2680 2589 2167 80 ------
NM_001034956chr1052878 2680 2589 2167 80 ------
NM_001034957chr1052878 2680 2589 2167 80 ------
NM_001035003chr441127 1024 933 889 ----182
NM_001035004chr441127 1024 933 889 ----182
NM_001035260chr102232 147 ----1375
NM_001037165chr768739 8294 7761 3571 1293 260 --28935 318 --
NM_001037174chr221974 386 --11645 11478
NM_001037317chr141740 792 762 417 --1483 12520
NM_001037332chr532179 850 686 1203 1793 --
NM_001037333chr532179 850 686 1203 1793 --
NM_001037494chr121183 ------
NM_001037495chr121183 ------
NM_001037954chr113531 421 376 --1926 --
NM_001038707chr112080 --11696 --
NM_001038707chr112080 --11696 --
NM_001039350chr731466 468 122 ------
NM_001039479chr1421606 290 --22340 899 --
NM_001039538chr253479 2942 913 854 766 --23153 968 --
NM_001039577chr173376 3294 3144 2954 1378 958 51 1119 31170 1152 1134 --
NM_001039585chr174224 3973 1691 1029 941 671 248 ------
NM_001039590chrX54024 3829 3659 1577 889 --23151 656 --
NM_001039591chrX54024 3829 3659 1577 889 --23151 656 --
NM_001039618chr1134830 4811 4789 11672 34528 1330 807 --
NM_001039649chr132318 122 ------
NM_001039762chr1042005 1983 1624 484 --1637 --
NM_001039802chr11938 --141 1922
NM_001039840chrX85454 5088 4926 2394 2195 2103 1443 1244 22176 2156 12221 21943 1340
NM_001039937chr1333602 2993 954 13416 1617 --
NM_001040020chr721281 170 --11471 --
NM_001040057chr71133 --11045 --
NM_001040142chr241909 889 181 166 ------
NM_001040143chr241909 889 181 166 ------
NM_001040152chr755012 3995 2016 646 246 --1848 --
NM_001040157chr452466 2004 1966 1959 1818 1241 12808 --
NM_001040159chr431179 1072 455 11384 21232 1009 --
NM_001040202chr432549 888 304 --12152 --
NM_001040284chr1685555 5050 3887 2347 2061 1975 374 116 --35600 1537 696 --
NM_001040402chr431090 1054 409 --13091 --
NM_001040424chr2142785 2070 1935 435 --11976 --
NM_001040429chr1333185 2823 2572 --1772 --
NM_001040441chr144885 4206 4125 322 13498 24861 630 --
NM_001040445chr295738 4711 4371 4102 3770 2268 1337 1320 759 13721 1537 --
NM_001040446chr522075 319 ------
NM_001040450chr1541906 1128 399 266 12182 ----
NM_001040453chr1541906 1128 399 266 12182 ----
NM_001040619chr171422 1168 1144 1118 1081 603 327 --21403 25 --
NM_001040633chr71924 ------
NM_001040653chr342345 2064 1809 870 --12070 --
NM_001040665chr734442 736 497 13338 1473 --
NM_001040708chr831091 198 85 ------
NM_001040712chr92743 366 ------
NM_001042403chr121950 ------
NM_001042424chr463216 2953 2598 1103 421 170 --2247 217 --
NM_001042425chr621434 85 --21448 535 --
NM_001042437chr21884 ------
NM_001042440chr52714 682 11532 21621 1245 --
NM_001042441chr52714 682 11532 21621 1245 --
NM_001042442chr52714 682 11532 21621 1245 --
NM_001042443chr52714 682 11532 21621 1245 --
NM_001042444chr52714 682 11532 21621 1245 --
NM_001042445chr52714 682 11532 21621 1245 --
NM_001042446chr52714 682 11532 21621 1245 --
NM_001042453chrX11191 ------
NM_001042481chr1412669 --11691 12478
NM_001042492chr1732714 653 475 13040 12247 --
NM_001042494chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_001042495chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_001042496chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_001042497chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_001042510chr831461 622 101 ------
NM_001042511chr831461 622 101 ------
NM_001042533chr323048 600 ------
NM_001042537chrX32416 1890 972 --22010 1908 --
NM_001042555chr12114200 3627 3585 2989 1671 1225 1131 1045 443 429 218 44645 3483 3061 1360 24038 1631 12903
NM_001042599chr247661 7409 5123 2571 16636 23003 442 --
NM_001042601chr342766 2526 2132 1151 12973 22070 1036 --
NM_001042603chr1221360 569 11258 53623 3494 3436 3378 3320 --
NM_001042604chr3134780 4182 3865 1896 1819 1768 1437 1418 1152 727 679 369 282 21236 439 --23701 1451
NM_001042683chr61423 --21700 415 --
NM_001042749chrX11903 --1479 --
NM_001042750chrX11903 --1479 --
NM_001042751chrX11903 --1479 --
NM_001043318chr1473404 3286 1398 879 640 197 122 13865 11144 --
NM_001044385chr273366 2653 1381 1340 1055 194 36 11314 ----
NM_001044722chr552134 1981 1892 620 332 --1515 --
NM_001044723chr552134 1981 1892 620 332 --1515 --
NM_001046chr532206 2147 2020 --1939 1959
NM_001048183chr13232 148 80 ------
NM_001068chr31246 ------
NM_001069chr61152 ------
NM_001083620chr41246 12427 ----
NM_001083621chr153835 3748 1162 180 114 ------
NM_001099678chr376360 6170 5930 5449 4347 2284 162 11603 --25478 2340
NM_001102566chr12258 202 --1916 --
NM_001106chr373782 3664 3353 2072 1992 705 244 27779 207 27594 6757 --
NM_001111chr12969 66 --12021 --
NM_001113490chrX53395 1374 1158 359 32 ----12557
NM_001117chr18----11867 --
NM_001121chr1031937 1238 483 1555 --1764
NM_001128chr16--11581 ----
NM_001143chrY1101 ------
NM_001145chr141174 ------
NM_001148chr461533 785 303 291 234 40 11577 22118 133 --
NM_001149chr1041211 251 72 44 1884 21342 189 --
NM_001160chr123558 518 110 ------
NM_001167chrX45147 2680 2641 1601 15128 21260 99 14670
NM_001172chr142691 251 ------
NM_001173chr1434149 3848 73 14293 14182 1271
NM_001177chr1232100 1968 1914 --2826 424 --
NM_001186chr2152652 2392 2262 834 55 1320 32243 2182 653 --
NM_001187chr211565 --1607 --
NM_001204chr236376 5538 101 --15304 --
NM_001206chr953046 2935 2498 627 529 ------
NM_001241chr252355 2185 1877 1840 1721 2544 35 1336 --
NM_001241chr252355 2185 1877 1840 1721 2544 35 1336 --
NM_001256chr1742703 1070 542 212 ------
NM_001257chr161181 --1515 11311
NM_001268chr133942 404 397 1889 1453 1302
NM_001270chr52117 110 ------
NM_001271chr1542954 2345 1042 808 --32638 2475 1072 --
NM_001284chr52528 370 --1153 --
NM_001304chr1743328 2921 2585 655 33395 1051 29 ----
NM_001310chr1242763 2740 1956 108 32361 809 554 22776 2750 --
NM_001329chr101602 ------
NM_001332chr521607 196 ------
NM_001349chr23454 247 99 --1400 1202
NM_001351chr331304 415 406 ------
NM_001356chrX52307 2287 2280 359 182 ------
NM_001357chr1178 ------
NM_001358chr41412 ------
NM_001364chr1144704 1732 818 205 --21577 1178 --
NM_001390chr1873151 2578 1446 871 836 508 394 --12232 --
NM_001391chr181938 --1149 --
NM_001394chr83833 714 655 ------
NM_001396chr2162812 2501 2341 2256 1941 297 ------
NM_001400chr131038 889 283 ------
NM_001401chr93648 572 139 --1442 --
NM_001406chr1731725 1436 446 11259 ----
NM_001418chr111234 ------
NM_001418chr111234 ------
NM_001419chr1953657 3425 1277 1006 574 1704 11700 --
NM_001427chr731994 1915 93 1612 ----
NM_001438chr152513 2470 1440 724 129 --12884 --
NM_001449chrX2187 145 11322 1181 --
NM_001452chr6----1553 --
NM_001463chr21699 --1749 --
NM_001490chr963040 1413 991 696 339 187 11280 21453 78 --
NM_001494chr101699 1491 1187 --
NM_001527chr654715 4541 4034 3705 868 --13644 --
NM_001530chr142909 249 ------
NM_001542chr142411 2361 1852 844 ------
NM_001543chr564608 3395 3221 1885 1660 613 --23505 372 --
NM_001550chr71195 ----1562
NM_001556chr841448 906 896 202 ------
NM_001614chr172152 24 ------
NM_001614chr172152 24 ------
NM_001616chr213233 11357 22766 757 --
NM_001620chr112233 106 ------
NM_001621chr732873 2432 90 ------
NM_001621chr732873 2432 90 ------
NM_001642chr111455 ------
NM_001649chrX22019 1557 --1920 --
NM_001650chr1844085 3286 526 432 --13059 --
NM_001656chr53623 449 150 11898 11414 11698
NM_001660chr33634 173 94 ----1711
NM_001661chr17----1563 --
NM_001663chr1421749 713 1607 1673 --
NM_001664chr32792 138 ------
NM_001668chr132274 2154 457 11607 ----
NM_001679chr32774 664 ------
NM_001682chr1252257 1947 1069 294 260 --11883 1238
NM_001690chr321855 41 21762 550 1462 11792
NM_001693chr811006 --11220 --
NM_001701chr921162 1091 ------
NM_001707chr74902 692 638 160 ------
NM_001746chr532057 1805 122 11903 ----
NM_001750chr52714 682 11532 21621 1245 --
NM_001753chr741167 723 705 455 ------
NM_001754chr2123713 344 --13441 --
NM_001755chr1642048 680 656 547 1602 ----
NM_001759chr1265117 4757 4659 3940 3810 1444 21897 214 1942 11398
NM_001777chr353774 3105 868 471 370 --11240 --
NM_001788chr72719 122 ------
NM_001791chr11938 --141 1922
NM_001796chr161107 ------
NM_001798chr12----1199 --
NM_001802chr163906 321 130 ----1652
NM_001806chr1932178 1892 138 12420 12096 22443 2283
NM_001819chr20--1199 ----
NM_001830chrX53100 2598 2467 1177 865 1932 2420 412 --
NM_001839chr11495 1213 124 1735
NM_001842chr91515 ------
NM_001845chr1331134 1061 506 1532 11067 --
NM_001851chr61182 --2128 103 --
NM_001852chr1----1551 --
NM_001858chr655164 4908 4361 4160 1040 1639 1179 --
NM_001859chr923947 3320 --1997 --
NM_001882chr51525 --1107 --
NM_001892chr551480 606 387 165 48 ----1146
NM_001896chr161394 ------
NM_001901chr62314 84 ------
NM_001904chr31960 ------
NM_001913chr71639 ------
NM_001918chr187318 7080 6292 5709 3440 3158 3049 2044 38320 2251 632 16757 18827
NM_001921chr431129 499 103 ------
NM_001936chr731466 468 122 ------
NM_001938chr131252 761 429 1674 --1209
NM_001942chr1821265 276 21868 1356 1183 --
NM_001946chr12263 46 1931 ----
NM_001949chr652862 2697 2441 409 260 ------
NM_001951chr81510 ------
NM_001964chr5----1300 --
NM_001968chr41285 ------
NM_001969chr1422863 221 131 ----
NM_001977chr41349 ------
NM_001981chr132369 932 405 ----1824
NM_001993chr1----2176 156 --
NM_001999chr521380 333 ----1280
NM_002006chr434654 3512 913 15292 14163 --
NM_002009chr1542494 1899 906 485 ------
NM_002013chr14133 ------
NM_002015chr1331311 1167 885 ------
NM_002017chr113871 240 211 --1362 --
NM_002024chrX52046 525 473 361 233 1723 ----
NM_002025chrX109156 8974 6747 5907 5684 3720 3697 3615 1925 24 27163 3397 2636 222 12683
NM_002026chr23815 768 72 --1250 --
NM_002032chr11--1309 ----
NM_002035chr181179 11599 1897 --
NM_002040chr2122153 943 12455 1283 --
NM_002041chr15141 ------
NM_002048chr931361 470 380 ----1436
NM_002063chrX1916 --1249 --
NM_002065chr111430 ------
NM_002077chr941841 1484 618 104 --1331 --
NM_002092chr464901 4018 1514 956 343 95 --14930 24125 3968
NM_002107chr12387 326 ------
NM_002114chr61517 ------
NM_002126chr1773710 3696 1459 922 510 189 93 --11651 --
NM_002128chr1332122 1589 226 ------
NM_002129chr4------1103
NM_002138chr42263 45 ------
NM_002139chrX1472 ------
NM_002140chr9139 ------
NM_002148chr22557 245 ------
NM_002158chr243186 3019 2890 714 13632 13307 --
NM_002160chr93395 241 157 ------
NM_002188chr52721 296 ------
NM_002192chr71406 ----1513
NM_002202chr5--1235 ----
NM_002214chr755317 4547 4379 2273 638 --21012 365 1269
NM_002222chr31337 ------
NM_002223chr1233914 3551 2791 13123 ----
NM_002226chr142782 176 ------
NM_002232chr1----133 --
NM_002253chr411421 11397 21386 1036 --
NM_002264chr354486 3569 3358 1287 1131 ------
NM_002267chr13----12198 --
NM_002268chr321804 713 --11692 --
NM_002270chr555315 4436 2281 2095 927 13593 14656 --
NM_002271chr1362443 2192 1930 1588 761 685 ----1353
NM_002285chr254066 1158 1018 753 92 13898 2501 124 --
NM_002293chr152764 1700 432 388 25 1448 ----
NM_002296chr161475 1309 1204 664 536 420 ------
NM_002298chr1321500 1241 --1441 --
NM_002310chr574086 1762 1262 1256 934 517 68 --11907 --
NM_002332chr121172 ------
NM_002336chr1223808 3277 ----11062
NM_002349chr231360 1128 476 --31394 451 76 --
NM_002350chr841045 1022 431 225 ------
NM_002351chrX1139 ------
NM_002355chr121886 ------
NM_002356chr642788 2486 2429 1065 --32761 1872 298 11826
NM_002372chr5----1244 --
NM_002374chr253479 2942 913 854 766 --23153 968 --
NM_002387chr594539 4210 3687 867 464 282 259 230 122 --14944 11135
NM_002395chr611024 ------
NM_002397chr531653 1359 203 1170 ----
NM_002402chr731164 996 765 ------
NM_002408chr14----2798 526 --
NM_002430chr2262339 2118 1865 1690 269 238 ------
NM_002444chrX21888 1394 --11579 --
NM_002473chr22----11307 1932
NM_002481chr1107973 7648 7391 6303 5428 3112 1812 1797 1239 39 --2511 371 15019
NM_002486chr922002 689 31954 1645 370 12077 --
NM_002487chr153614 124 97 ------
NM_002501chr1933760 3181 3161 13825 ----
NM_002505chr62413 335 --1147 --
NM_002507chr17----21793 1542 --
NM_002515chr1422074 281 --22014 335 --
NM_002519chr111436 ----11252
NM_002520chr5----1307 --
NM_002522chr1763862 2948 1566 761 729 480 ------
NM_002527chr122254 120 161 1268 --
NM_002538chr5----1144 --
NM_002545chr11104702 4545 3799 3703 3302 3186 1929 1401 1294 1042 24046 1779 ----
NM_002546chr81574 ------
NM_002577chr342901 1466 1252 248 --1687 --
NM_002581chr953657 2275 2220 1382 115 11781 ----
NM_002586chr611132 ------
NM_002590chr131203 ------
NM_002594chr20----12293 --
NM_002595chr1211359 ------
NM_002605chr154405 370 146 89 ------
NM_002613chr1695392 4873 3856 3756 1553 1011 741 348 132 ------
NM_002618chr21312 --1407 --
NM_002623chr201185 ------
NM_002629chr10------1896
NM_002646chr131946 324 25 ------
NM_002651chr1----1237 --
NM_002655chr844219 4093 4020 388 2137 91 1643 1551
NM_002687chr141288 ------
NM_002693chr151124 ------
NM_002698chr1952982 938 865 136 107 --32578 972 632 --
NM_002709chr232693 2631 762 ------
NM_002710chr121323 ------
NM_002715chr531028 961 24 --1363 --
NM_002717chr82459 61 ------
NM_002718chr332701 1085 248 12524 1989 --
NM_002726chr61179 ------
NM_002731chr162467 2097 860 789 735 394 12407 22553 2416 --
NM_002736chr72612 418 --11869 --
NM_002737chr1775233 4321 4247 2613 1915 1036 837 --1352 --
NM_002740chr322350 1969 ------
NM_002742chr142709 128 ----1561
NM_002745chr2264574 3166 1053 994 966 242 11090 21704 1061 14550
NM_002748chr1511148 ------
NM_002749chr17----1223 --
NM_002755chr151130 ----1661
NM_002819chr19191 --11297 --
NM_002822chr1231741 1724 566 ------
NM_002827chr2031661 1462 444 ------
NM_002828chr182929 283 ------
NM_002834chr1242702 1370 938 23 13723 ----
NM_002835chr71644 ------
NM_002839chr92743 366 ------
NM_002840chr141611 1034 1026 140 ------
NM_002841chr31493 ------
NM_002843chr1142934 2880 646 557 --21085 625 --
NM_002844chr61313 ------
NM_002849chr1221019 325 ------
NM_002851chr71228 --1680 --
NM_002869chr112330 105 11668 --1229
NM_002874chr95915 897 864 835 188 ------
NM_002886chr353952 1536 1146 297 231 ------
NM_002890chr52729 326 --136 --
NM_002892chr1441719 1540 516 284 11062 ----
NM_002897chr21641 1719 ----
NM_002902chr151609 --1433 --
NM_002906chr1132250 2093 170 1939 --12335
NM_002912chr61259 ------
NM_002923chr12481 420 ------
NM_002930chr18166 ------
NM_002938chr461621 1434 1388 1277 774 650 ------
NM_002945chr17--1881 ----
NM_002956chr1231387 526 67 1987 ----
NM_002959chr164193 3784 3589 2765 391 26 --24367 2779 --
NM_002968chr162818 26 ------
NM_002973chr121428 ------
NM_002977chr231051 941 158 1236 23052 2254 --
NM_002994chr421304 45 --11817 1225
NM_002998chr82762 740 --1341 --
NM_003010chr1722317 267 ----11974
NM_003011chr921330 526 --1444 --
NM_003012chr842623 2340 144 106 --12703 --
NM_003017chr6----11223 1926
NM_003022chrX11305 ------
NM_003026chr911042 ------
NM_003030chr311913 --11325 --
NM_003031chr161947 ------
NM_003034chr12106847 6235 5848 5733 5242 3034 2880 2770 2676 2108 17533 1158 11753
NM_003042chr312123 11409 1249 --
NM_003043chr343964 3424 3349 788 34164 3307 3257 11040 --
NM_003048chr242692 2052 1873 951 --1480 --
NM_003051chr11539 ----11330
NM_003068chr81374 ------
NM_003069chrX----1739 1629
NM_003074chr3----1313 12087
NM_003076chr1211518 --21282 639 11210
NM_003079chr171384 --1140 --
NM_003081chr2031129 996 341 ------
NM_003082chr1431107 1056 90 ------
NM_003107chr611904 12270 ----
NM_003108chr287045 6494 5198 4433 1744 1379 1016 896 --26758 1073 --
NM_003112chr722561 387 33142 2862 2536 ----
NM_003115chr11184 ------
NM_003128chr2155 --1259 1622
NM_003133chr131084 1025 297 --11033 --
NM_003144chr642016 2000 1571 532 --2550 465 11945
NM_003149chr341525 1230 508 227 21054 185 21672 1138 --
NM_003150chr1742083 1941 385 328 ----1562
NM_003155chr822245 187 22781 801 ----
NM_003161chr1763492 2773 1012 926 728 296 --1418 --
NM_003178chr312072 32119 2042 251 ----
NM_003181chr63622 180 123 ------
NM_003185chr202871 283 --11167 --
NM_003188chr63560 547 210 ------
NM_003189chr153347 3069 2883 2235 1170 ------
NM_003198chr1----1270 --
NM_003199chr1884291 2190 1794 1503 1488 1423 982 262 --21691 160 13553
NM_003217chr123750 683 168 ------
NM_003220chr621434 85 --21448 535 --
NM_003234chr3180 11716 ----
NM_003236chr253505 3432 914 902 212 ------
NM_003242chr32465 221 12038 1471 12193
NM_003244chr181336 ------
NM_003246chr1521674 403 11634 1192 --
NM_003253chr2121480 1383 ------
NM_003255chr1732678 1629 92 ----11771
NM_003262chr393961 3638 3324 3297 3214 1541 662 505 93 14873 14267 --
NM_003269chr621225 37 ----1368
NM_003290chr1941156 1061 360 245 ------
NM_003292chr121481 829 --22096 1513 --
NM_003298chr3106059 5646 4632 4212 4003 3968 1839 1447 451 417 14766 11257 --
NM_003300chr14127 1487 1394 --
NM_003304chr311211 21607 140 2447 245 --
NM_003336chrX11019 1866 1937 --
NM_003337chr521265 1097 ------
NM_003338chr1031575 495 64 --11466 1619
NM_003340chr43526 423 409 ------
NM_003342chr1722317 383 11263 23129 2973 --
NM_003344chr71125 2554 200 11749 --
NM_003348chr1231367 1324 151 ------
NM_003349chr2021567 1247 ------
NM_003352chr21350 ------
NM_003359chr421093 904 ----1473
NM_003360chr4195 ------
NM_003368chr11192 ------
NM_003369chr1122667 1720 1491 22786 940 --
NM_003373chr10--1580 --11618
NM_003374chr51747 145 ----
NM_003376chr6----11303 --
NM_003376chr6----11303 --
NM_003387chr242536 2492 2003 745 --12556 --
NM_003390chr111104 ------
NM_003392chr343752 3367 3255 967 11266 24229 2783 13378
NM_003400chr2257 43 ------
NM_003405chr221527 ------
NM_003406chr821815 1357 ------
NM_003410chrX22786 167 ----1659
NM_003411chrY51221 620 565 511 439 --1468 --
NM_003412chr3--11233 ----
NM_003413chrX----2733 514 --
NM_003418chr3------1676
NM_003421chr1073632 3435 3155 2973 2726 912 766 23669 101 1302 13828
NM_003439chr751290 781 324 287 145 --33385 3050 572 --
NM_003458chr383419 3216 3179 2911 1283 1037 742 700 ------
NM_003463chr632118 790 274 ----1221
NM_003466chr252406 1915 1578 707 119 ------
NM_003468chr264149 3890 3727 3241 2718 747 ----11371
NM_003471chr331494 512 95 ------
NM_003474chr1042301 2277 2255 1757 ------
NM_003478chr111209 22382 977 1170 1571
NM_003483chr123819 727 31 12542 12147 --
NM_003489chr2173328 3242 3065 2610 2601 2263 1002 ------
NM_003506chr82978 481 --21217 1187 --
NM_003507chr231923 1607 1408 ------
NM_003559chr1773735 3724 3620 3327 1314 1079 127 ------
NM_003566chr1243404 3329 1345 927 ------
NM_003574chr1884486 3888 2317 1765 1629 888 725 121 --14677 11184
NM_003576chr1352891 2788 2217 2053 1176 11890 12431 --
NM_003580chr82510 370 ------
NM_003583chr1293523 3355 2888 2707 1232 1131 997 435 126 --32450 1377 602 --
NM_003589chr1321098 1019 --1447 --
NM_003590chr253121 2919 2659 1382 389 ------
NM_003597chr251834 1440 1406 287 268 --22086 185 11743
NM_003603chr421679 1613 --1818 --
NM_003615chr333564 3177 1600 --1948 --
NM_003618chr231168 857 238 --1878 1180
NM_003620chr172258 133 ------
NM_003626chr1121357 49 ------
NM_003629chr163203 2367 2169 1178 845 772 --1611 --
NM_003635chr101113 ------
NM_003637chr131470 1371 1057 11552 ----
NM_003642chr2--1253 ----
NM_003663chr323199 1077 ------
NM_003664chr51382 1567 ----
NM_003671chr933259 2232 64 13409 13373 --
NM_003672chr131593 1423 748 ------
NM_003675chr101366 ------
NM_003677chr1211906 ------
NM_003679chr162650 2501 2482 805 395 353 ------
NM_003690chr2130 ----1197
NM_003701chr131987 1696 1129 --
NM_003702chr84538 518 261 86 ------
NM_003713chr11624 11713 11658 --
NM_003716chr33834 290 158 ------
NM_003722chr342511 2176 1703 857 1359 ----
NM_003743chr241715 1659 468 118 --11920 --
NM_003744chr143886 502 404 ------
NM_003746chr121183 ------
NM_003750chr10--1653 ----
NM_003758chr1531529 350 111 ------
NM_003758chr1531529 350 111 ------
NM_003759chr443603 1252 1203 331 --14281 --
NM_003760chr12778 303 ------
NM_003762chr1----11395 --
NM_003763chr2022503 362 --1334 --
NM_003768chr141726 1182 630 292 1570 ----
NM_003794chr32804 740 --11043 --
NM_003795chr6----176 1112
NM_003799chr1894318 4050 3672 3310 1217 904 548 429 351 1623 ----
NM_003800chr642132 2023 838 383 ------
NM_003812chr21209 ------
NM_003821chr81149 ------
NM_003822chr142886 2808 2264 730 12585 13173 --
NM_003825chr152419 279 --11498 --
NM_003829chr921202 364 ------
NM_003831chr18----21732 171 --
NM_003846chr11703 ------
NM_003851chr1123 ------
NM_003858chr141119 ------
NM_003861chr1452350 2313 2044 1772 680 ------
NM_003872chr252700 2100 1032 959 609 --1676 --
NM_003873chr101542 12487 ----
NM_003884chr31122 ----11327
NM_003885chr172845 79 --12039 --
NM_003887chr21163 --1539 --
NM_003895chr2152153 1883 1781 1683 1661 ------
NM_003896chr21884 ------
NM_003901chr1032730 1718 669 1919 ----
NM_003902chr12560 22 ----1769
NM_003907chr31141 ------
NM_003913chr674310 1720 1700 523 517 425 328 34004 2825 370 11254 13048
NM_003916chrX21342 411 1324 21086 106 1420
NM_003927chr1821093 706 ------
NM_003931chr61545 ----1161
NM_003934chr91425 ------
NM_003939chr1073205 2816 2617 1586 1405 1000 199 11568 13323 --
NM_003941chr742360 2014 735 545 --1912 --
NM_003948chr422262 520 ------
NM_003953chr182625 2489 1803 1144 685 484 478 27 --1418 --
NM_003958chr643973 3809 3752 2718 ------
NM_003966chr567664 6695 5367 1910 1765 1280 17769 26294 2270 11627
NM_003968chr3183 ------
NM_003971chr17------1217
NM_003972chr1031355 1295 61 ----1126
NM_003983chr1674073 3878 3628 3377 2906 1362 676 ----1753
NM_003992chr151313 ------
NM_003994chr1223195 498 ------
NM_004004chr1341318 930 89 38 --1321 --
NM_004006chrX1220 ------
NM_004007chrX1220 ------
NM_004009chrX1220 ------
NM_004010chrX1220 ------
NM_004011chrX1220 ------
NM_004012chrX1220 ------
NM_004013chrX1220 ------
NM_004014chrX1220 ------
NM_004015chrX1220 ------
NM_004016chrX1134 ------
NM_004017chrX1220 ------
NM_004018chrX1134 ------
NM_004020chrX1220 ------
NM_004021chrX1134 ------
NM_004022chrX1134 ------
NM_004023chrX1134 ------
NM_004024chr171331 1077 1053 1027 990 512 236 --21312 25 --
NM_004028chr1844085 3286 526 432 --13059 --
NM_004040chr21919 ------
NM_004067chr72557 462 --11146 --
NM_004075chr12--1505 ----
NM_004077chr1231161 950 915 ------
NM_004080chr71399 ----138
NM_004081chrY175 --21331 513 --
NM_004087chr32427 354 11958 ----
NM_004093chr1333107 2110 176 ------
NM_004094chr1422178 84 ------
NM_004096chr1011406 11709 ----
NM_004100chr662491 2128 807 672 525 292 12420 ----
NM_004113chr361801 1610 1578 1298 799 228 ------
NM_004114chrX11167 ------
NM_004117chr62878 717 ----12155
NM_004124chr1482716 2411 2374 2285 845 639 457 376 ------
NM_004126chr7------1262
NM_004130chr32593 522 ------
NM_004133chr8----12244 12484
NM_004156chr82593 176 ------
NM_004162chr3185 ----11161
NM_004170chr921716 1474 1537 11562 1651
NM_004171chr1187152 7091 3086 2550 1811 1470 1184 396 22843 43 38565 6836 6601 --
NM_004186chr32169 129 ------
NM_004225chr84985 954 355 96 21418 1228 ----
NM_004229chrX2803 732 --12080 --
NM_004232chr1833124 859 161 ------
NM_004235chr9----2634 48 --
NM_004238chr21222 ------
NM_004241chr10--1155 ----
NM_004262chr41455 ------
NM_004272chr511248 ------
NM_004274chr1442644 1077 613 243 2895 523 ----
NM_004277chr641063 685 361 241 --2444 41 --
NM_004279chr731973 326 257 1204 ----
NM_004296chr1463143 2799 1280 712 584 436 --1645 --
NM_004301chr31256 ------
NM_004302chr1252786 1034 844 740 729 --12868 --
NM_004319chr132958 2086 791 --1168 --
NM_004326chr11441 ------
NM_004329chr102964 152 --11416 --
NM_004330chr15----11104 --
NM_004331chr882631 2038 1933 1704 1080 692 414 302 --12094 --
NM_004338chr18136729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 27096 5263 14517 21362 1122
NM_004342chr752170 1863 1742 1630 353 ------
NM_004349chr82133 125 --1861 --
NM_004369chr2----1166 --
NM_004380chr1622029 523 ------
NM_004384chr552134 1981 1892 620 332 --1515 --
NM_004392chr1322144 976 1812 ----
NM_004393chr321474 613 ------
NM_004397chr1134054 3280 1524 23143 1462 13191 --
NM_004411chr72628 199 --3100 94 55 --
NM_004419chr1021050 220 ------
NM_004423chr31898 --12205 12542
NM_004428chr1----1157 --
NM_004430chr842652 2082 1767 1714 12794 ----
NM_004432chr942427 2319 2044 515 --21721 129 11949
NM_004436chr1----1673 --
NM_004440chr61554 ----21936 64
NM_004456chr71221 ------
NM_004457chr211139 --1243 --
NM_004458chrX21073 1030 12445 11622 --
NM_004459chr1711894 ------
NM_004463chrX1515 ------
NM_004482chr21252 ------
NM_004496chr141955 1101 ----
NM_004498chr151391 ------
NM_004500chr1441506 736 357 102 11430 11327 --
NM_004501chr124102 409 23788 2556 33253 239 211 --
NM_004503chr121655 ------
NM_004504chr211914 --1326 --
NM_004520chr5----1751 --
NM_004523chr1011565 ----11530
NM_004525chr22472 86 11331 ----
NM_004538chrX------1550
NM_004569chr143273 254 25 --1640 1170
NM_004578chr12775 307 ----1886
NM_004583chr172569 558 --1770 --
NM_004586chrX113522 1514 1300 1190 1143 989 891 593 421 316 180 11400 44916 3987 3639 1409 --
NM_004589chr17127 ------
NM_004606chrX189 ------
NM_004612chr934630 3598 1727 11009 1891 --
NM_004614chr1632381 2031 489 --22457 646 --
NM_004631chr111058 ------
NM_004655chr1711141 ------
NM_004660chrY72272 2211 2202 1930 1431 794 357 ----1695
NM_004663chr15--1982 11021 --
NM_004670chr102355 207 11568 ----
NM_004680chrY------161
NM_004684chr4298 33 --1110 --
NM_004686chr81320 --1299 --
NM_004687chr1751494 614 569 171 31 ------
NM_004697chr92898 125 ------
NM_004700chr11130 ------
NM_004703chr1762501 2385 1965 435 425 418 ----12043
NM_004705chr112638 284 ------
NM_004709chrX31699 1556 470 --1111 --
NM_004726chrX115333 5309 4498 2303 2199 2159 2130 1825 1759 1296 1195 --14421 13760
NM_004734chr1342430 2334 2029 410 12021 12475 --
NM_004742chr321304 280 ------
NM_004745chr887062 6537 6079 1869 1211 1127 854 692 --16444 --
NM_004748chr1554024 3939 2608 1383 21 11482 --11299
NM_004755chr142223 214 ----151
NM_004762chr1781331 1270 1246 755 743 736 258 212 --11810 --
NM_004774chr1742769 2248 1064 734 ----12801
NM_004775chr1821574 1555 ------
NM_004776chr2023343 224 12239 11061 --
NM_004779chr531134 849 267 ------
NM_004788chr112935 227 1821 ----
NM_004796chr1422435 2334 ------
NM_004798chr2051113 580 556 415 35 --1212 --
NM_004808chr1033208 2782 1074 --12191 --
NM_004822chr1783377 3255 2660 2580 1049 791 641 608 ------
NM_004824chr621390 1355 --11102 --
NM_004834chr232934 1093 836 ------
NM_004842chr631223 356 80 --1629 --
NM_004844chr321167 258 --11050 --
NM_004849chr611234 11472 ----
NM_004859chr1733046 2291 501 --12655 --
NM_004860chr171570 ------
NM_004866chr584919 3888 3838 3163 1999 1704 992 103 13334 13397 11664
NM_004873chr1433177 1014 572 --42763 2240 136 107 --
NM_004883chr51157 ------
NM_004896chr102147 62 ----1290
NM_004898chr452888 2829 2264 2113 113 ------
NM_004904chr786411 6223 4974 4802 4387 4107 1904 1412 14563 1688 --
NM_004906chr6--1656 ----
NM_004921chr171900 1748 982 725 716 691 129 --163 --
NM_004929chr83954 558 230 --11029 --
NM_004931chr2149 ------
NM_004937chr1742538 2515 778 340 --1551 1653
NM_004947chr352517 2316 987 189 35 ------
NM_004948chr1851051 277 187 129 109 ------
NM_004956chr754460 2923 1192 893 714 ------
NM_004961chrX21572 202 1497 ----
NM_004966chr102638 175 ------
NM_004968chr7----182 --
NM_004973chr611351 --1150 --
NM_004976chr1184926 4707 4558 3436 1869 615 264 144 ------
NM_004985chr1253883 1686 1046 729 189 13713 288 76 --
NM_004992chrX138456 8121 8031 6856 6514 5854 5216 3129 2931 2703 2339 1141 131 25601 2439 ----
NM_004992chrX138456 8121 8031 6856 6514 5854 5216 3129 2931 2703 2339 1141 131 25601 2439 ----
NM_004999chr674348 3796 3564 3527 2915 2849 1096 ------
NM_005023chr51364 139 --11322
NM_005025chr3--189 1172 --
NM_005028chr1031818 511 187 --1312 --
NM_005036chr22118025 6726 5870 5329 2709 2657 2097 1813 1562 660 418 1145 37949 5109 2427 --
NM_005044chrX64189 3740 1700 1618 1401 1375 21259 103 43251 3109 1660 623 --
NM_005045chr73353 347 263 ------
NM_005056chr1231604 813 246 11502 53867 3738 3680 3622 3564 --
NM_005063chr1053528 3223 2530 664 128 --23066 560 --
NM_005065chr1412006 13927 11421 1565
NM_005066chr11109 ------
NM_005079chr842491 928 798 670 ------
NM_005087chr32764 631 ------
NM_005095chr12668 428 ----11873
NM_005109chr341903 1887 1780 200 ------
NM_005116chr20104074 4017 3745 3690 3589 3337 2968 1738 1026 497 --34153 4126 4024 --
NM_005121chr1743659 2448 801 274 --33598 2963 2664 --
NM_005124chr62903 221 11008 ----
NM_005126chr322257 1900 11872 11479 --
NM_005133chr111393 ------
NM_005135chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_005156chr985376 5368 4872 4080 3948 3762 3605 45 15291 24434 4129 13625
NM_005160chr2296749 6085 5565 5228 5058 1367 1125 908 853 25516 1317 11817 16655
NM_005168chr241734 1589 1572 1229 --2463 168 --
NM_005171chr1241300 1227 1218 250 ------
NM_005181chr81248 --1640 --
NM_005188chr11128107 7822 7798 7155 6985 6563 6295 2428 1626 1478 1213 453 15917 23021 2343 --
NM_005190chr62995 61 ------
NM_005197chr1475606 5529 5092 4128 2063 378 86 11222 45293 3840 1358 49 --
NM_005201chr321003 311 --2817 102 --
NM_005204chr10134 1817 1988 --
NM_005206chr171995 ------
NM_005207chr2213733 ------
NM_005222chr71288 ------
NM_005230chr121594 --1153 --
NM_005233chr342325 1914 739 55 1282 --1261
NM_005235chr247661 7409 5123 2571 16636 23003 442 --
NM_005238chr1162996 2937 1232 857 596 354 11061 1641 --
NM_005241chr331298 352 45 ------
NM_005242chr511264 ------
NM_005243chr22----1262 --
NM_005256chr112626 263 159 ----
NM_005257chr181992 --11400 --
NM_005259chr231108 387 134 21520 508 ----
NM_005261chr8--1839 1185 --
NM_005275chr6134 ------
NM_005277chr441672 1657 1494 158 --11241 --
NM_005279chr2------127
NM_005296chrX1165 ------
NM_005311chr722596 2047 1609 ----
NM_005324chr1731550 1507 794 --11441 --
NM_005339chr443994 2658 698 292 13034 --11501
NM_005342chrX51796 1098 842 715 590 ------
NM_005347chr921632 163 ------
NM_005358chr132222 173 --21175 242 --
NM_005359chr1831878 877 368 11288 24704 4357 --
NM_005375chr62428 378 --1324 --
NM_005385chr352675 2452 1869 1748 1688 ----1365
NM_005389chr61544 175 1173 --
NM_005397chr783811 3262 1511 1073 1024 968 857 663 13759 12608 --
NM_005398chr1021399 100 ------
NM_005406chr1831315 1275 641 ------
NM_005412chr121530 ------
NM_005433chr1851827 1797 849 830 260 --1505 1203
NM_005436chr10113927 3619 3548 3211 2654 2614 1383 1222 1133 457 283 21497 1075 11048 13514
NM_005450chr17----1252 --
NM_005455chr121232 280 ------
NM_005458chr921931 753 22073 1781 ----
NM_005493chr62686 147 ------
NM_005494chr7----1429 1105
NM_005497chr1763727 1669 1196 445 306 206 25905 734 ----
NM_005499chr191169 ------
NM_005509chr541700 1649 1361 549 --1253 --
NM_005513chr331378 1302 220 11322 ----
NM_005517chr131207 1063 132 ----1374
NM_005520chr53278 97 88 ------
NM_005536chr81281 --1885 --
NM_005563chr11258 ------
NM_005566chr111464 ------
NM_005574chr112261 155 ------
NM_005575chr51187 --1321 --
NM_005578chr324023 2013 13315 --24697 4527
NM_005591chr111148 --1276 --
NM_005596chr956141 4655 4555 4370 639 --25880 1757 --
NM_005599chr131256 1114 164 ------
NM_005604chr621835 1681 --21824 1813 --
NM_005611chr16143 ----11185
NM_005625chr8--2734 389 ----
NM_005626chr11157 ------
NM_005627chr61127 ------
NM_005637chr1861945 478 143 58 38 29 ------
NM_005638chrX21088 390 11494 11553 --
NM_005639chr1261671 638 621 286 70 53 ------
NM_005644chr11317 ------
NM_005648chr8183 --140 --
NM_005649chr51394 ------
NM_005668chr534459 405 252 --22880 93 --
NM_005711chr53972 734 424 ------
NM_005721chr22899 692 ------
NM_005722chr21331 ----1359
NM_005725chr11609 ------
NM_005736chr1011415 ------
NM_005746chr732093 2068 509 ------
NM_005748chr1243400 2992 2632 2142 --11077 --
NM_005749chr171230 ------
NM_005759chr263943 3651 1062 859 565 146 21843 267 11692 24158 1354
NM_005779chr593588 3464 3442 3335 3235 2973 1392 925 549 12794 ----
NM_005786chr182905 291 ------
NM_005789chr1711437 11809 ----
NM_005795chr253028 1904 1119 844 211 ------
NM_005802chr93806 796 639 ------
NM_005808chr333492 3079 1220 --11243 --
NM_005813chr292582 2385 1665 980 929 912 860 854 383 1672 ----
NM_005822chr652286 1819 490 304 254 --22252 538 --
NM_005826chr11103 ------
NM_005828chr1754619 1342 828 409 97 11778 ----
NM_005840chrX67177 7100 1662 960 432 187 --23066 1312 --
NM_005842chr13----1476 --
NM_005859chr51473 ------
NM_005862chr32847 816 ------
NM_005868chr732469 1939 289 --172 1642
NM_005870chr1311255 --1220 --
NM_005871chr102195 131 ------
NM_005880chr1621262 62 11562 ----
NM_005898chr1122461 1045 --13070 --
NM_005899chr171152 11355 ----
NM_005901chr18168698 7789 7422 7211 6788 6319 2898 2643 2597 2266 2045 1320 1203 339 331 59 2969 776 16253 --
NM_005903chr534079 1259 560 ----1877
NM_005906chr6128 --1185 --
NM_005909chr573866 3627 2822 1282 1270 819 195 ------
NM_005922chr6--186 ----
NM_005923chr61115 ------
NM_005933chr1142873 1880 962 471 ------
NM_005935chr4105059 4555 4314 4052 3788 3354 3317 2005 830 388 ------
NM_005941chr863911 3059 1661 1595 940 201 --11396 13033
NM_005955chr175349 3846 3779 2217 1712 1366 615 ------
NM_005962chr1071878 1704 1643 887 861 683 173 ------
NM_005962chr1071878 1704 1643 887 861 683 173 ------
NM_005966chr222111 1852 --22283 608 --
NM_005977chr132855 301 ------
NM_005999chr151337 1224 1196 1152 1100 ------
NM_006007chr944289 4044 1097 533 32870 1127 327 11445 --
NM_006011chr1593746 3393 3309 3152 3058 2923 697 557 206 --11101 --
NM_006016chr612079 ------
NM_006022chr131152 --1226 --
NM_006024chr74817 568 351 33 --1768 1696
NM_006036chr271629 897 759 745 737 642 71 ------
NM_006037chr294863 3731 3690 3341 3261 3163 1609 1098 127 11739 ----
NM_006047chr2033506 1027 345 ------
NM_006079chr63791 740 83 ------
NM_006080chr72353 240 --12993 --
NM_006089chrX21372 78 ----1539
NM_006090chr1----1609 --
NM_006094chr821965 780 --22404 1973 --
NM_006095chr473962 3823 2887 1687 564 544 449 --43091 3049 1298 296 --
NM_006099chr11606 ------
NM_006106chr1142732 2302 2198 386 --1547 --
NM_006135chr121318 959 --126 --
NM_006136chr71352 ------
NM_006141chr1642738 808 538 520 ------
NM_006152chr12192 --147 --
NM_006154chr1532608 2235 850 ------
NM_006159chr12--1254 --1609
NM_006164chr21181 --1169 --
NM_006166chr1232169 556 497 ------
NM_006180chr961631 773 744 388 184 116 --11572 --
NM_006187chr1243170 2769 2675 626 13079 159 --
NM_006191chr121914 ------
NM_006195chr921223 571 --11217 --
NM_006203chr555042 4323 1841 700 220 --14655 --
NM_006206chr462407 2002 1074 679 540 213 --1347 --
NM_006212chr145304 1122 1003 226 ------
NM_006224chr1751897 1687 1669 1553 897 --22353 166 --
NM_006226chr2----1144 1473
NM_006241chr332051 1667 1553 --12244 --
NM_006243chr111062 ----190
NM_006252chr147475 2159 541 396 --12668 27188 4729
NM_006254chr31311 ------
NM_006256chr152716 2579 1989 1814 1071 --31973 805 715 1195
NM_006264chr41391 ------
NM_006265chr821099 451 ------
NM_006275chr2031866 1012 323 11800 --1854
NM_006282chr2074615 3657 3616 3374 1403 1348 837 24256 1506 24373 166 --
NM_006283chr874683 4568 4054 4047 3518 1587 1528 --24672 4167 11476
NM_006292chr11164 ------
NM_006298chr672721 2231 2080 1084 719 626 258 --32343 1257 37 12601
NM_006306chrX75719 5690 4950 4404 3892 3682 1651 14049 11981 14995
NM_006310chr173956 198 190 11096 ----
NM_006313chr122492 464 11116 11474 --
NM_006320chr41799 --21079 924 --
NM_006321chr332151 1517 610 ------
NM_006323chr41511 1594 ----
NM_006327chr10137 ------
NM_006330chr841578 324 271 37 ------
NM_006334chr91123 ------
NM_006335chr11134 ------
NM_006345chr431139 886 157 ------
NM_006352chr131534 654 144 --1166 --
NM_006359chrX32416 1890 972 --22010 1908 --
NM_006364chr143952 801 462 --1860 --
NM_006371chr323513 1045 --23838 681 --
NM_006380chr1774356 4071 3790 2817 2704 803 691 1470 1195 --
NM_006393chr1061726 1468 1118 756 188 180 ----14132
NM_006401chr91330 --138 --
NM_006407chr341347 1210 1084 126 ------
NM_006415chr921003 375 11054 1137 --
NM_006421chr81453 ------
NM_006424chr431555 308 206 1782 ----
NM_006434chr1052878 2680 2589 2167 80 ------
NM_006451chr53742 377 55 ------
NM_006457chr433697 2987 489 ----14100
NM_006469chr141641 1608 1075 552 ------
NM_006482chr1293523 3355 2888 2707 1232 1131 997 435 126 --32450 1377 602 --
NM_006485chr221680 --1434 --
NM_006489chr1422074 281 --22014 335 --
NM_006493chr1351398 1108 950 125 43 ------
NM_006496chr141550 138 128 114 ------
NM_006504chr1042230 1857 1006 437 --12680 143
NM_006517chrX42231 1433 738 113 --163 --
NM_006520chrX21172 195 1669 ----
NM_006527chr42485 109 ------
NM_006534chr2031088 665 421 22663 2101 12922 --
NM_006538chr254060 3842 3260 1620 1093 24052 2738 23308 1042 --
NM_006540chr811188 --11342 --
NM_006544chr1485792 4956 4860 2448 2150 889 577 63 --1457 --
NM_006546chr1776163 5580 1660 1297 1171 843 545 --21253 573 --
NM_006547chr721749 578 1297 11856 1455
NM_006549chr124998 675 528 77 ------
NM_006557chr931735 1182 249 ------
NM_006559chr111041 --1886 --
NM_006561chr1075229 4926 4200 2265 1769 1036 82 --12221 --
NM_006565chr163961 791 193 ------
NM_006570chr93416 356 302 ------
NM_006575chr1461379 1323 1248 1223 1102 519 11300 11317 --
NM_006595chr112535 293 --280 70 --
NM_006597chr11124 ------
NM_006599chr16107156 6495 6023 5687 5100 2904 2252 1822 1342 933 22610 1099 26220 5317 16967
NM_006601chr12--11047 1726 --
NM_006603chrX11903 --1479 --
NM_006609chr232082 1821 566 1630 11850 --
NM_006614chr332994 2291 1438 ----1293
NM_006621chr131565 1349 1256 ------
NM_006622chr51526 ------
NM_006625chr12863 67 ------
NM_006625chr12863 67 ------
NM_006625chr12863 67 ------
NM_006626chr942409 297 228 72 11072 ----
NM_006628chr1574202 2938 2888 2870 1783 1766 1697 12950 ----
NM_006633chr5----1750 --
NM_006634chr21215 ------
NM_006644chr131538 1585 ----
NM_006646chr1352952 2771 962 701 253 193 1159 --
NM_006654chr12114200 3627 3585 2989 1671 1225 1131 1045 443 429 218 44645 3483 3061 1360 24038 1631 12903
NM_006675chr1232859 2096 1334 --13408 --
NM_006682chr771825 790 633 579 225 139 60 1901 ----
NM_006698chr2031227 999 572 --21282 1046 --
NM_006699chr141784 792 517 415 ----11755
NM_006703chr62448 397 1473 ----
NM_006704chr132343 333 ------
NM_006710chr21417 --2244 108 --
NM_006717chr942855 2094 940 925 ------
NM_006722chr322125 233 12877 ----
NM_006724chr6--186 ----
NM_006726chr44926 869 451 178 ------
NM_006727chr51102 1385 ----
NM_006729chrX43745 1676 633 81 --23827 641 --
NM_006734chr641103 390 286 89 ------
NM_006750chr16128026 7932 7573 7541 6511 6287 6259 2691 2414 1423 1130 98 16505 ----
NM_006751chr21898 --1154 --
NM_006756chr831351 1273 176 11194 ----
NM_006761chr172858 315 --2771 270 --
NM_006763chr121346 360 ------
NM_006764chr3187 ------
NM_006766chr822243 759 ------
NM_006769chr1176 ------
NM_006775chr683056 2597 2310 2033 2015 1929 1252 989 --12529 --
NM_006777chrX31060 491 368 ----1329
NM_006788chr1842056 1863 1479 391 --22076 1598 11374
NM_006795chr1131473 1131 604 ------
NM_006811chr202857 372 ------
NM_006815chr122453 341 --1934 --
NM_006823chr83520 320 198 --21351 453 --
NM_006826chr21438 ------
NM_006827chr1422663 360 --1293 22370 917
NM_006832chr1411032 ------
NM_006837chr8137 ------
NM_006838chr1221438 1220 --11350 --
NM_006851chr122969 578 11120 12301 --
NM_006852chr1782818 1096 1018 734 649 236 159 60 --12001 --
NM_006857chr21350 1268 ----
NM_006874chr4----1916 11174
NM_006875chrX1124 ------
NM_006884chr311913 --11325 --
NM_006885chr1643649 3170 892 386 --1446 --
NM_006888chr1432853 987 787 12304 --13016
NM_006892chr20----11446 --
NM_006892chr20----11446 --
NM_006896chr721011 793 ------
NM_006908chr731386 513 174 --11481 --
NM_006913chr6----146 --
NM_006920chr22749 165 --11461 --
NM_006922chr23875 849 706 1465 ----
NM_006924chr1764369 3522 1745 1361 526 59 ------
NM_006939chr141197 1243 ----
NM_006947chr431809 1761 714 ------
NM_006948chr2181560 923 903 861 661 517 484 379 --1560 1494
NM_006981chr942929 2625 1004 696 ------
NM_006988chr212856 120 2237 89 ----
NM_006999chr511809 ------
NM_007011chr1556697 6145 4674 1938 117 12342 25891 268 --
NM_007017chr51199 1598 ----
NM_007034chr1----1347 --
NM_007038chr2144644 4465 1071 46 --35207 5189 1767 14309
NM_007043chr1232069 482 283 ------
NM_007050chr2096953 6207 5393 4936 2847 2749 1717 1049 644 ----16444
NM_007054chr523972 3826 ------
NM_007064chr3--1480 ----
NM_007067chr1731019 251 104 1629 ----
NM_007078chr1023063 1083 --22934 873 --
NM_007106chr1352691 857 645 463 394 --12621 --
NM_007107chr312249 --2910 143 --
NM_007124chr631348 305 55 ------
NM_007137chrX35469 4215 835 --13439 --
NM_007139chr7--11127 ----
NM_007146chr1751783 699 554 322 133 ----1676
NM_007157chrX61969 1118 1040 835 656 453 12883 ----
NM_007158chr11415 ------
NM_007166chr1131322 625 292 ------
NM_007175chr863583 3195 2963 2819 2396 431 --2769 697 --
NM_007189chr721416 485 ------
NM_007191chr121186 --1519 --
NM_007203chr942415 1466 456 112 ------
NM_007212chr1----21846 200 --
NM_007217chr3141 ------
NM_007218chr82684 107 ------
NM_007246chr41115 ----123
NM_007249chr13147614 7305 6929 6689 6398 6077 3745 2689 2531 2164 2115 1103 488 61 13126 12658 --
NM_007275chr32232 161 ------
NM_007282chr34778 737 361 310 ----1281
NM_007285chr161390 ------
NM_007345chr1832095 628 338 12346 11901 --
NM_007347chr1563207 2984 2882 1010 948 202 12130 ----
NM_007358chr131855 721 707 ------
NM_007373chr1011357 --11194 --
NM_007375chr152577 2476 2457 1874 135 ------
NM_012062chr12--1215 ----
NM_012071chr102272 100 ------
NM_012081chr553715 2438 2375 1470 737 --23115 114 --
NM_012082chr82756 217 ------
NM_012090chr12476 394 ------
NM_012095chr1062711 2654 2186 953 715 426 --12207 --
NM_012097chr221974 386 --11645 11478
NM_012098chr931497 1330 1285 --11471 --
NM_012104chr1143424 1280 698 450 11536 11339 --
NM_012104chr1143424 1280 698 450 11536 11339 --
NM_012110chr4------1302
NM_012129chr732204 1765 319 --1518 --
NM_012137chr12788 657 32302 2004 328 12543 12333
NM_012141chr1333602 2993 954 13416 1617 --
NM_012157chr32965 351 --1324 --
NM_012158chr13------1125
NM_012164chr976414 5817 5008 1581 1105 584 201 11810 --11914
NM_012175chr111108 ------
NM_012193chr11104818 4664 3824 3662 1652 1448 785 266 161 51 ------
NM_012197chr911199 11626 1658 --
NM_012199chr144630 4463 4386 1127 ------
NM_012207chr10138 --1769 --
NM_012210chr93975 541 257 ------
NM_012214chr296025 5794 5252 4658 4478 2323 1773 1763 1210 --25839 2481 --
NM_012215chr1051755 1703 1316 1262 305 ------
NM_012218chr1942855 2151 696 622 12921 1269 --
NM_012224chr41334 --11127 1752
NM_012234chr332763 2740 1368 ----1412
NM_012238chr10140 11528 155 --
NM_012249chr223571 189 1435 13392 --
NM_012250chr11--1941 11150 --
NM_012252chr714134 25046 270 34193 1157 965 --
NM_012255chr201375 --1400 --
NM_012257chr72692 124 ------
NM_012259chr621273 220 --1303 --
NM_012262chr155106 5092 1929 1117 647 ------
NM_012266chr921140 336 ------
NM_012281chr731540 910 646 12400 1698 --
NM_012286chrX1234 ------
NM_012294chr773596 2835 2714 1014 568 469 314 --12803 1111
NM_012296chr1162970 1557 1502 566 228 34 22819 894 ----
NM_012297chr462645 1594 1038 1024 774 609 21053 945 11666 --
NM_012300chr52929 399 --1473 --
NM_012301chr741567 604 597 168 11793 ----
NM_012304chr542410 2087 846 723 170 ----
NM_012307chr181251 --1200 1664
NM_012309chr1161661 1073 1044 823 432 278 ----1723
NM_012325chr201207 ------
NM_012329chr17130 ------
NM_012330chr10----2451 410 --
NM_012334chr524107 3922 13240 11207 13573
NM_012345chr132325 46 ----11309
NM_012399chr2231631 332 108 ------
NM_012411chr1194 ------
NM_012416chr931204 1005 785 1317 ----
NM_012425chr1042335 2069 1854 752 ------
NM_012428chr151830 1663 ----
NM_012454chr6--2517 119 ----
NM_012465chr1053245 2425 2137 1183 103 ------
NM_012479chr762698 1979 1742 595 569 346 ------
NM_012482chr11236 ------
NM_013229chr123558 518 110 ------
NM_013231chr1454405 3877 3615 3150 1488 --11212 --
NM_013233chr21294 ------
NM_013235chr5139 ------
NM_013238chr1341555 1425 1223 1210 ------
NM_013253chr1131086 572 136 11009 ----
NM_013254chr12----1106 --
NM_013257chr822431 2101 --21645 253 --
NM_013262chr6------11369
NM_013269chr1244546 2982 458 407 --11663 14438
NM_013277chr122197 29 --1101 --
NM_013286chr362805 2621 727 605 297 23 --21462 702 --
NM_013293chr7--1717 1128 --
NM_013316chr73959 340 210 ------
NM_013341chr222489 864 ------
NM_013352chr61370 ------
NM_013354chr861319 1310 577 522 234 139 ------
NM_013363chr3166 ------
NM_013374chr322590 1154 1203 12755 --
NM_013377chr121582 ------
NM_013381chr1231731 577 381 12247 22146 476 --
NM_013392chr2----185 --
NM_013423chrX----21154 947 --
NM_013427chrX----21154 947 --
NM_013436chr21661 2591 170 ----
NM_013437chr81191 ------
NM_013438chr92623 395 --11413 --
NM_013448chr14----1193 --
NM_013450chr231218 1026 788 ------
NM_013943chr143276 2890 2593 180 23284 2439 ----
NM_013951chr252406 1915 1578 707 119 ------
NM_013952chr252483 1992 1655 784 196 ------
NM_013953chr252483 1992 1655 784 196 ------
NM_013960chr83768 243 129 ------
NM_013981chr51157 ------
NM_013982chr51157 ------
NM_013983chr51157 ------
NM_013986chr22----1262 --
NM_013989chr1455070 3860 3818 3546 1255 --34653 3595 270 --
NM_013992chr252483 1992 1655 784 196 ------
NM_013995chrX21874 569 --12497 --
NM_014000chr10--1580 --11618
NM_014007chr911227 ------
NM_014011chr252516 1874 1675 209 105 ------
NM_014016chr32469 423 --21658 1303 --
NM_014021chr122828 2804 1937 13248 --
NM_014034chr62585 144 ------
NM_014043chr311121 ------
NM_014048chr16105287 5253 4840 4208 4112 2060 1637 735 267 180 13449 24956 976 23632 3353
NM_014051chr61480 --1513 --
NM_014055chr122428 95 ------
NM_014089chr13--11403 ----
NM_014112chr864393 4259 1138 1051 834 704 14784 13834 11229
NM_014117chr1662619 2300 2035 677 404 240 --22169 858 --
NM_014141chr755248 4771 4188 665 109 ------
NM_014154chr311530 ------
NM_014157chr1663810 3755 3334 2812 384 244 13159 1407 --
NM_014181chr232141 2064 842 1494 ----
NM_014238chr1731381 1221 56 ------
NM_014243chr411695 --1503 11677
NM_014253chrX52561 2023 953 706 217 --1864 --
NM_014263chr1021208 54 --21164 193 --
NM_014267chr11----1252 --
NM_014268chr1811401 ------
NM_014286chr983491 2625 2594 2289 1148 1056 616 470 --13316 --
NM_014289chrX41472 1133 455 164 11229 ----
NM_014290chr9144 ------
NM_014294chr811389 11194 164 --
NM_014305chr131173 ------
NM_014309chr2285239 4634 4023 1788 1547 1122 797 383 ------
NM_014319chr1221410 158 ------
NM_014331chr476588 5606 2671 1992 1327 1212 315 ----35244 2109 144
NM_014332chrX1334 ------
NM_014333chr1132082 1971 276 --12133 1803
NM_014335chr1551375 1356 1339 1138 1035 ------
NM_014345chr61843 --1120 --
NM_014361chr111369 ------
NM_014368chr921939 1695 1800 11320 --
NM_014372chr122014 1417 --11334 --
NM_014376chr532179 850 686 1203 1793 --
NM_014391chr10126 ------
NM_014399chr7----2872 275 --
NM_014411chr721450 1249 1354 ----
NM_014418chr1451628 1393 1379 344 101 ----11927
NM_014421chr431407 300 63 1761 ----
NM_014423chr544243 4098 3823 2190 --25350 4517 1394
NM_014445chr332251 309 92 --2919 541 --
NM_014454chr62229 40 --11065 --
NM_014456chr1031779 652 66 ------
NM_014458chr111402 ------
NM_014469chr112770 570 ------
NM_014502chr11140 ------
NM_014504chr731508 784 543 1128 22044 109 --
NM_014517chr351280 523 220 214 30 --21728 744 11968
NM_014522chrX2434 218 ------
NM_014547chr151160 ------
NM_014547chr151160 ------
NM_014548chr155651 566 534 502 148 ------
NM_014554chr1211435 1431 --1838
NM_014562chr21782 ------
NM_014572chr13----21668 187 11517
NM_014574chr1421435 220 --1551 --
NM_014583chr31199 ------
NM_014585chr221217 156 ------
NM_014588chr201613 ------
NM_014608chr15----189 --
NM_014612chr911118 --1377 --
NM_014614chr231408 962 281 11341 --11423
NM_014615chr1673275 3229 3038 1161 495 307 204 ------
NM_014616chr373441 2628 2609 2313 1245 954 599 --11350 1795
NM_014620chr12----1243 --
NM_014629chr841224 908 397 118 --2540 329 --
NM_014634chr2253232 3187 871 724 341 --1797 --
NM_014636chr933933 3681 2997 --14012 --
NM_014637chr8----21440 461 --
NM_014647chr1641731 908 829 434 1391 1788 --
NM_014660chr7----1707 1835
NM_014661chr1032701 808 761 13646 ----
NM_014663chr111126 ------
NM_014666chr531005 967 164 1294 ----
NM_014667chr32240 64 ------
NM_014670chr221091 23 ------
NM_014671chr731252 593 53 11491 --1609
NM_014682chr82714 691 ------
NM_014683chr171811 ------
NM_014685chr161455 ------
NM_014701chr1532854 2651 92 --12593 --
NM_014702chr652605 2270 1153 847 787 --13442 --
NM_014705chr731536 1392 855 1506 ----
NM_014707chr722051 741 ------
NM_014709chr2--1495 --1189
NM_014711chr1621762 830 1494 ----
NM_014717chr191227 1178 ----
NM_014720chr1031269 489 216 11859 142 --
NM_014721chr6117364 6178 5142 4813 2950 2652 2645 1741 1231 938 738 1590 14761 --
NM_014729chr831783 419 293 ------
NM_014730chr1253632 3583 3508 1784 658 --24637 1419 11097
NM_014730chr1253632 3583 3508 1784 658 --24637 1419 11097
NM_014733chr52266 161 ------
NM_014735chrX51601 1440 549 395 259 ----183
NM_014743chr472673 2607 2140 1225 518 501 354 12899 13097 --
NM_014746chr274368 4208 3291 2938 1727 1604 878 ------
NM_014747chr175798 5668 4488 4009 621 614 518 12266 25513 781 --
NM_014752chr1121539 332 ------
NM_014755chr222721 423 ------
NM_014761chr1621179 125 1756 ----
NM_014765chr172484 2477 2175 2065 1881 1775 584 ------
NM_014766chr773249 3234 2950 1512 1012 404 168 12667 11122 --
NM_014776chr1232812 2580 1953 --2406 137 --
NM_014779chr331034 400 207 --1126 --
NM_014781chr82517 378 --2401 109 --
NM_014783chr1521730 1453 21487 678 --11171
NM_014786chr111389 ------
NM_014787chr132828 1739 109 11836 21071 280 22521 516
NM_014795chr221034 265 --3903 460 397 --
NM_014797chr622410 1244 --1625 --
NM_014802chr121220 ------
NM_014803chr1052836 2777 2594 2200 951 11869 --196
NM_014806chr91364 --1151 --
NM_014810chr193109 2711 2674 2439 2255 1372 1278 442 131 ------
NM_014819chr522196 870 ------
NM_014820chr31389 --2531 104 --
NM_014824chr112665 570 1363 ----
NM_014829chr5--11586 12216 11903
NM_014830chr1283901 3584 2548 1534 1429 1347 517 486 ------
NM_014832chr1361367 768 754 629 461 22 ------
NM_014839chr141961 1947 406 272 ------
NM_014840chr1231165 471 429 --22155 1204 --
NM_014848chr1552804 2594 2495 762 525 ------
NM_014870chr153835 3748 1162 180 114 ------
NM_014872chr951754 753 345 322 120 ------
NM_014873chr123576 430 ------
NM_014877chr17127333 6930 6457 5803 5292 5237 4988 1894 1658 495 370 53 --12561 11816
NM_014881chr10122 ------
NM_014888chr721281 170 --11471 --
NM_014891chr741116 1050 345 230 ------
NM_014893chrY42027 703 179 46 ------
NM_014897chr1722947 2787 1490 23161 3014 --
NM_014903chr121465 186 ----
NM_014904chr1053519 2766 827 734 153 ------
NM_014906chr1753738 3669 3548 2727 1613 11576 1747 --
NM_014909chr1421465 825 --33890 3702 1121 --
NM_014912chr103497 317 294 22500 187 ----
NM_014913chr18----1302 1956
NM_014917chr13806 620 403 ------
NM_014920chr643616 3235 396 256 --1284 --
NM_014926chr32791 377 ------
NM_014932chr331221 610 488 11362 --1573
NM_014939chr1831299 1099 66 --1510 2628 244
NM_014946chr21766 ------
NM_014949chr1145 ------
NM_014950chr141168 ------
NM_014951chr1042555 803 795 157 ------
NM_014953chr1344392 3552 3131 1064 11035 ----
NM_014961chr431706 640 572 ------
NM_014962chr2042786 2005 743 175 ----11814
NM_014969chr12855 107 ------
NM_014978chr1011254 11756 11636 --
NM_014982chr1475401 5240 3630 3610 3562 2009 823 44259 1692 1514 467 11347 15248
NM_014988chr421941 1080 22339 217 2273 98 --
NM_014989chr621405 614 ------
NM_014990chr1431199 216 201 ------
NM_014991chr432928 1215 656 --1867 --
NM_014992chr14138 ------
NM_014996chr32275 63 --1237 --
NM_014999chr1221138 119 ------
NM_015000chr122447 406 ------
NM_015008chr363642 3451 1465 1375 660 229 1774 12988 --
NM_015017chr131237 923 913 1829 ----
NM_015020chr1643315 3189 2467 1225 --13469 --
NM_015025chr232586 1766 1661 12187 ----
NM_015026chr1231849 1333 148 1252 21709 1426 23406 3300
NM_015032chr1322485 1972 --1674 --
NM_015035chr2046173 5848 5815 1097 26411 2028 15361 --
NM_015039chr173953 682 619 443 404 365 287 --12686 --
NM_015040chr253157 3062 2795 2587 2316 ------
NM_015042chr1533786 520 224 ------
NM_015045chr1042160 1614 884 250 --2165 111 --
NM_015049chr252292 1294 548 301 37 12637 11288 --
NM_015051chr932109 843 40 1994 1402 --
NM_015064chr1253148 3128 2878 636 301 --22713 2477 --
NM_015069chr16----1201 --
NM_015071chr5115121 5071 4952 4537 4393 1565 919 475 218 193 101 --16289 15533
NM_015072chr141416 ------
NM_015074chr154774 4433 3751 3242 216 1676 ----
NM_015075chrX21845 298 12121 ----
NM_015076chr64745 739 719 433 11640 1286 11698
NM_015087chr1321822 95 12701 ----
NM_015090chr196114 5916 4855 4615 4461 1842 672 319 103 12264 14941 --
NM_015092chr1634031 1399 1341 --11387 --
NM_015093chr641427 1240 587 555 ----1171
NM_015094chr2222836 1238 13550 13687 --
NM_015097chr321870 220 ------
NM_015107chrX12358 ------
NM_015110chr9------22098 1832
NM_015115chr431090 1054 409 --13091 --
NM_015125chr19156 ------
NM_015132chr7--11928 31849 459 295 11647
NM_015143chr441135 364 132 27 ------
NM_015144chr1683413 3084 3047 2967 1057 932 604 468 ------
NM_015153chr61774 ------
NM_015156chr1443914 3886 3584 331 --1737 --
NM_015158chr91604 ------
NM_015170chr841954 1466 819 571 1691 ----
NM_015186chr91340 ------
NM_015187chr42914 303 ------
NM_015192chr2052600 2121 679 400 44 ------
NM_015199chr322645 1173 ------
NM_015200chr442620 2014 1875 849 --21916 978 --
NM_015206chr1543743 3083 1542 1116 --21351 769 13492
NM_015208chr1863776 3590 2942 2846 1334 708 ----13675
NM_015213chr111815 --1548 --
NM_015215chr14796 232 69 25 12159 ----
NM_015225chr952974 2104 1232 821 235 ------
NM_015231chr111663 ------
NM_015233chr1372148 2140 1716 763 445 171 107 ------
NM_015236chr411403 ------
NM_015239chr91216 ------
NM_015250chr951499 599 579 475 153 ------
NM_015252chr2------1891
NM_015263chr153281 250 244 ------
NM_015265chr211932 --1209 --
NM_015270chr1231565 1471 284 ------
NM_015271chr474221 3252 1257 928 907 684 567 1319 ----
NM_015272chr162618 37 --1560 --
NM_015277chr181732 ------
NM_015278chr631246 948 134 --11101 13387
NM_015282chr22348 93 --1128 1623
NM_015288chr521456 1198 ------
NM_015293chr61245 138 ----
NM_015296chr13--2930 797 ----
NM_015299chr1453338 3169 2902 1382 236 12537 13006 --
NM_015308chr111737 --1248 --
NM_015310chr8157507 6820 6592 5569 3163 3112 3009 2776 2447 2256 2216 2089 1676 1598 556 --27904 5385 12370
NM_015314chr762380 2075 2047 1618 135 69 --21656 129 1967
NM_015317chr21358 --42284 2152 1813 961 --
NM_015328chr763099 2013 1896 393 301 81 ------
NM_015335chr1242359 860 304 141 12543 1532 --
NM_015336chr1262517 2425 2403 1833 889 285 22280 1025 11680 --
NM_015338chr2011767 ------
NM_015342chr51115 ------
NM_015344chr832039 1576 1498 ----11536
NM_015349chr623021 2609 1338 ----
NM_015353chr1772708 2499 1997 749 432 245 44 --11950 --
NM_015355chr1731736 1438 176 ------
NM_015359chr832868 2526 2477 --12024 --
NM_015361chr21220 ------
NM_015365chrX33709 2776 468 34102 3961 234 ----
NM_015381chr2232028 1913 238 12004 --1468
NM_015385chr1052878 2680 2589 2167 80 ------
NM_015387chr21836 ------
NM_015396chr331421 1188 987 11091 ----
NM_015409chr121102 12750 12708 --
NM_015423chr1131717 1684 1399 --11327 --
NM_015435chr82343 141 --11092 2484 449
NM_015439chr61420 ------
NM_015443chr17----21316 372 --
NM_015455chr563837 3687 3368 3340 3045 1326 1317 23760 2691 --
NM_015458chr834345 3667 336 --43307 3278 1217 1145 --
NM_015461chr181559 ------
NM_015483chr711101 ----1153
NM_015508chr33530 91 47 ------
NM_015520chr322602 26 --1694 --
NM_015525chr61996 ------
NM_015534chr151063 828 406 184 116 ------
NM_015535chr254047 3621 298 243 227 ------
NM_015550chr72941 743 13247 1123 --
NM_015553chr644935 4724 4325 2015 --11755 13525
NM_015554chr1552149 2071 2063 1863 724 --12109 1744
NM_015555chr63545 388 333 ------
NM_015559chr182953 249 --1859 --
NM_015564chr553134 3046 2798 2731 798 12519 ----
NM_015565chr2141983 1907 1633 1453 ------
NM_015567chr131463 ------
NM_015568chr2064091 3008 2781 505 319 160 13507 23191 837 --
NM_015569chr143053 1126 1077 106 ------
NM_015570chr7--1677 21808 1699 --
NM_015576chr342567 2552 1889 458 --11094 --
NM_015578chr1941948 1823 1386 706 ------
NM_015589chr141176 ------
NM_015609chr152955 1188 1153 1095 1005 ------
NM_015626chr172456 328 11141 ----
NM_015640chr144816 3755 3249 632 13908 ----
NM_015646chr1241130 255 182 68 --11226 1391
NM_015678chr1331444 643 149 ----11507
NM_015840chr12969 66 --12021 --
NM_015841chr12969 66 --12021 --
NM_015865chr1831206 362 76 ------
NM_015879chr1887619 7298 6073 5844 5717 814 172 163 35861 5824 5469 18010 18034
NM_015881chr1131086 572 136 11009 ----
NM_015886chr895419 5354 4725 3957 3630 1190 874 435 155 --13993 15019
NM_015888chr132134 1093 356 --22635 2082 --
NM_015891chr62750 573 ----21950 647
NM_015905chr7166 ------
NM_015906chr1104491 4012 3707 3430 3199 1576 1010 924 593 150 --13453 --
NM_015912chr832012 1911 107 --1892 --
NM_015942chr8127 ------
NM_015975chrX4325 294 177 118 31587 345 58 11500 --
NM_015980chr521593 1163 11423 ----
NM_015984chr11556 --1411 --
NM_015986chr1741126 952 526 150 31296 941 60 --1211
NM_015995chr1575063 4942 4851 4454 1946 1890 1219 --34434 395 231 --
NM_016009chr154512 4005 3660 3161 360 11350 ----
NM_016018chr842097 1873 856 469 ------
NM_016019chr71129 11105 ----
NM_016021chr622471 2124 12337 11132 1864
NM_016023chr811712 11978 ----
NM_016025chr1641525 686 587 546 ------
NM_016026chr142491 97 ------
NM_016061chr221632 1576 --31090 486 82 --
NM_016072chr124916 209 157 70 1681 ----
NM_016076chr1103183 2934 2727 2684 2299 2159 2079 2010 1203 282 --12974 --
NM_016078chr1711007 ----1288
NM_016081chr442118 213 137 48 ------
NM_016083chr653466 1342 1053 895 490 13873 ----
NM_016087chr731209 1110 35 --21540 467 --
NM_016091chr221148 ------
NM_016096chr831461 622 101 ------
NM_016100chr201170 ------
NM_016107chr511392 11032 ----
NM_016120chrX41146 402 313 241 ------
NM_016121chr1168 --11036 --
NM_016125chr171510 --1418 --
NM_016131chr241865 1690 1616 1576 --12113 --
NM_016132chr151272 22848 139 --13456
NM_016152chr321183 912 ------
NM_016192chr2158 ------
NM_016203chr71924 ------
NM_016205chr421363 353 ------
NM_016206chr378883 7102 6930 6414 674 651 84 134 38458 6907 429 12930
NM_016217chr653526 2747 2268 1207 1081 ------
NM_016218chr53833 509 367 1474 ----
NM_016221chr532152 422 37 1258 12119 12252
NM_016230chr62378 148 ------
NM_016231chr1711384 1680 ----
NM_016240chr811650 ------
NM_016248chr1343905 3844 3456 574 ----13257
NM_016255chr663278 3109 1129 1082 895 884 23229 954 43310 2711 2171 62 --
NM_016260chr256888 3018 2736 1260 980 25243 904 31250 956 587 12374
NM_016271chr182765 757 --12093 --
NM_016275chr352780 2231 1862 948 58 ------
NM_016277chr631437 580 90 ------
NM_016279chr51152 ------
NM_016281chr121255 --1922 --
NM_016289chr232002 1619 548 --31512 59 38 --
NM_016291chr3179 ------
NM_016302chr31277 --1659 --
NM_016303chrX----158 --
NM_016308chr111282 --1834 --
NM_016320chr1121141 139 1182 ----
NM_016322chr943039 2331 903 766 22232 745 13067 --
NM_016338chr511142 ------
NM_016351chr7------1603
NM_016357chr123994 224 96 ------
NM_016377chr631223 356 80 --1629 --
NM_016396chr151977 --22115 991 --
NM_016410chr9----1564 --
NM_016422chr1132834 2095 578 ------
NM_016441chr241752 1673 729 629 ------
NM_016442chr51274 --21735 916 --
NM_016454chr151324 ----180
NM_016467chr221284 1219 ------
NM_016472chr141182 --11067 --
NM_016475chr1421194 511 ----1115
NM_016480chr52349 58 ------
NM_016485chr652148 1917 1655 232 162 ------
NM_016507chr1732894 2249 1112 --1348 11120
NM_016512chr81271 ------
NM_016513chr643616 3235 396 256 --1284 --
NM_016522chr1121388 1279 11030 ----
NM_016530chr1583652 3239 2704 2581 875 485 324 139 13081 ----
NM_016531chr484122 3733 3662 808 729 702 376 160 12922 43550 3409 3043 25 --
NM_016542chrX11191 ------
NM_016544chr253574 2437 1107 980 136 --12909 --
NM_016545chr11874 ------
NM_016559chr321254 1230 ------
NM_016577chr364327 2998 2904 2858 1384 901 14038 34514 3554 3394 --
NM_016603chr532076 282 232 12199 1851 --
NM_016613chr432451 159 92 1572 ----
NM_016618chr2----1144 --
NM_016620chr12991 244 ------
NM_016623chr82180 41 ------
NM_016626chr18----11394 11325
NM_016651chr1421072 965 ------
NM_016655chr15141 ------
NM_016734chr941652 735 377 107 ------
NM_016824chr1031937 1238 483 1555 --1764
NM_016830chr12124 ------
NM_016836chr21641 1719 ----
NM_016839chr21641 1719 ----
NM_016929chr653508 2959 1767 1589 170 --44004 3582 3268 258 --
NM_016946chr113576 ----12955
NM_016950chr431179 1072 455 11384 21232 1009 --
NM_017418chr9156 ------
NM_017420chr1443505 941 471 36 12609 1507 1630
NM_017423chr41758 ----1562
NM_017437chr141315 1713 12108 --
NM_017444chr811253 ------
NM_017455chr151830 1663 ----
NM_017456chr1781331 1270 1246 755 743 736 258 212 --11810 --
NM_017520chr131176 ------
NM_017522chr111058 ------
NM_017540chr552664 2409 1994 1245 740 --1615 --
NM_017551chr1032385 2094 208 --12695 --
NM_017577chr32346 144 --1526 --
NM_017580chr1072033 1917 1895 1511 422 361 329 --21736 1720 --
NM_017592chr1952783 2261 1099 812 743 ------
NM_017594chr931168 732 83 --22360 232 --
NM_017610chr1511407 ----1619
NM_017612chr12------1178
NM_017613chr212357 124 ------
NM_017632chr41399 ------
NM_017633chr653916 3518 2770 1464 615 ----13559
NM_017634chr81420 11948 ----
NM_017635chr11--2403 144 --1120
NM_017637chr9149355 8646 7228 7163 6448 6424 6096 2906 2894 2765 2539 2145 1723 895 18526 67406 3391 2603 2189 2060 672 1947
NM_017650chr775788 5735 1550 1506 1461 1235 830 14405 1823 --
NM_017654chr751586 1484 1138 130 38 ------
NM_017657chr2----1656 --
NM_017658chr1433845 782 118 --44532 1438 982 737 --
NM_017661chr151180 ------
NM_017667chr7----1484 --
NM_017680chr92765 366 ------
NM_017693chr1321364 313 --11081 --
NM_017694chr231717 1560 600 --1773 --
NM_017709chr13559 422 292 11278 22801 1220 --
NM_017724chr31294 ------
NM_017736chr1622583 1163 ----1654
NM_017737chr141818 1758 782 754 --1157 --
NM_017738chr921212 206 ------
NM_017742chr1841533 1375 1308 609 ------
NM_017747chr51108 ------
NM_017753chr92925 812 ------
NM_017754chr614577 --34982 4722 4510 --
NM_017769chr1442702 2037 1031 299 --12849 --
NM_017778chr841280 519 461 424 ------
NM_017779chr142696 1985 1904 712 ----1614
NM_017784chr311141 130 1107 --
NM_017787chr1052507 2057 1876 1125 517 ------
NM_017798chr201366 ------
NM_017811chr9187 --21038 959 --
NM_017813chr844055 1933 1620 825 14268 25609 706 15616
NM_017824chr1021015 388 --1246 --
NM_017830chr4185 ----1318
NM_017848chrX13600 --11867 --
NM_017857chr111669 ------
NM_017864chr8157 ------
NM_017866chr81290 --21074 810 --
NM_017867chr4129 ------
NM_017902chr10105735 5160 4237 4184 4036 3934 2010 1985 1653 768 15279 ----
NM_017915chr121290 1400 1765 --
NM_017919chr955733 5723 4609 2039 1757 11962 ----
NM_017922chr14--181 ----
NM_017933chr23520 32 22 --21427 1026 11601
NM_017938chrX2655 295 11879 11535 --
NM_017944chr1153113 2906 2898 1177 943 --23045 737 --
NM_017955chr142926 370 ------
NM_017987chr10----1106 --
NM_017988chr12--2854 147 1664 --
NM_017994chr752939 2835 2684 1062 915 ------
NM_018011chr131616 --1567 --
NM_018015chrX294 81 ----1330
NM_018023chr361951 1823 1714 763 460 248 --21676 104 --
NM_018053chr12859 120 ------
NM_018061chr131243 1079 495 --41577 1467 658 395 11211
NM_018078chr42320 176 --1103 --
NM_018084chr22775 544 12291 165 --
NM_018086chr22534 507 --11545 --
NM_018092chr161319 ----1506
NM_018098chr32999 87 ------
NM_018107chr141716 ------
NM_018120chr821092 989 ------
NM_018121chr1022595 2166 --32993 2122 1199 --
NM_018126chr451349 432 418 402 46 ------
NM_018128chr17140 11036 1283 --
NM_018133chr352132 1770 1628 1386 554 ------
NM_018150chr1--1941 ----
NM_018151chr21618 ------
NM_018155chr362771 2213 2162 1045 716 76 22108 1005 32849 563 443 11358
NM_018157chr1242694 2190 870 734 2803 142 141 --
NM_018159chrX21254 216 --123 --
NM_018164chr12------130
NM_018169chr121384 ------
NM_018181chr1841663 754 507 178 177 1252 --
NM_018184chr34455 429 361 203 ------
NM_018200chr1532130 1987 516 --12239 --
NM_018206chr162730 225 ------
NM_018211chr1143 ------
NM_018221chr21484 ------
NM_018223chr123470 246 30 ------
NM_018243chr443986 3735 1551 367 --11119 --
NM_018246chr862844 2504 2215 2124 826 579 1215 42777 1925 746 514 --
NM_018247chr643110 2572 2553 1916 ------
NM_018254chr191947 1940 1911 1903 1892 1868 742 488 234 1139 --11967
NM_018275chr71206 ------
NM_018286chr172280 270 ------
NM_018287chr1021123 261 ------
NM_018293chr352835 2464 770 624 264 ------
NM_018299chr853057 1336 676 548 216 --1910 --
NM_018307chr172633 165 1176 1674 --
NM_018312chr1141556 1431 1419 1364 ------
NM_018313chr332392 1704 52 ------
NM_018315chr421223 590 ------
NM_018323chr4----11617 --
NM_018327chr2031694 1266 366 --11486 --
NM_018328chr21376 ------
NM_018330chr1041297 675 388 174 --21356 1346 --
NM_018348chr162489 52 ------
NM_018351chr1294588 4226 2948 2891 1447 1176 1086 564 542 13146 34721 4301 1305 --
NM_018362chr1143589 855 734 576 --23635 1515 --
NM_018364chr153579 3002 1569 1522 205 ------
NM_018374chr7----25261 1251 14569
NM_018375chr1431685 1642 737 --1462 --
NM_018403chr364145 4027 3683 1189 649 597 11343 --11514
NM_018423chr121282 ------
NM_018429chr552696 2047 656 384 74 --21943 202 1664
NM_018439chr183729 302 253 --1118 1610
NM_018440chr8128163 7964 7488 6841 6020 5394 5315 3124 2259 1655 696 598 22753 2601 36588 5258 804 --
NM_018445chr152155 32 --1511 --
NM_018448chr123447 299 170 ------
NM_018462chr33886 830 234 ------
NM_018482chr8102552 2509 2250 2193 2089 1818 565 413 379 181 ------
NM_018488chr172751 45 ------
NM_018492chr8174 ------
NM_018557chr231651 1287 71 --2519 94 --
NM_018566chr1114992 4698 4356 4071 3992 3985 3771 3716 3685 1603 1140 24919 746 --21777 1561
NM_018590chr1021341 135 ------
NM_018638chr1235249 412 307 21955 672 11084 --
NM_018640chr1212489 ------
NM_018650chr141610 673 666 466 --1169 --
NM_018652chr15----1284 --
NM_018682chr72594 188 1653 ----
NM_018684chrX21199 395 ------
NM_018685chr72392 140 ----1741
NM_018691chr531049 852 184 --1992 --
NM_018697chr732236 1756 134 ------
NM_018698chrX31736 332 132 ------
NM_018713chr12889 107 ----1789
NM_018717chr432856 2108 298 ------
NM_018718chr721808 535 31763 556 251 --1798
NM_018723chr16194 ------
NM_018834chr51689 ------
NM_018844chr752076 819 792 431 374 ------
NM_018846chr72667 331 ------
NM_018847chr931389 741 531 1516 11540 --
NM_018890chr731386 513 174 --11481 --
NM_018947chr734700 1095 211 ----14480
NM_018948chr131400 434 22 --31092 1064 1009 --
NM_018955chr17196 ------
NM_018970chr782643 2442 2261 2249 890 856 663 104 1573 22663 347 --
NM_018979chr1242527 605 589 270 --1937 --
NM_018999chr1064830 4205 4128 4098 1625 457 24262 3603 ----
NM_019001chr3134780 4182 3865 1896 1819 1768 1437 1418 1152 727 679 369 282 21236 439 --23701 1451
NM_019002chr21229 ------
NM_019004chr742214 2102 855 656 --1685 --
NM_019006chr15------1493
NM_019008chr22113776 3004 2882 2831 2802 2602 1320 1105 729 529 487 --11459 --
NM_019022chr1822826 2576 1526 11034 --
NM_019027chr442115 1745 968 118 --2321 189 --
NM_019035chr421902 1449 ----21971 1892
NM_019045chrX133 ----1918
NM_019058chr103272 219 210 ------
NM_019063chr231993 1861 909 --21888 1794 --
NM_019072chr543596 3335 2759 463 12888 1736 --
NM_019084chr104428 335 276 191 --21966 1642 --
NM_019087chr521645 1222 --2182 101 --
NM_019091chr23990 320 215 ------
NM_019102chr7256 31 ------
NM_019102chr7256 31 ------
NM_019106chr2222973 2331 --1858 --
NM_019555chr3151 ------
NM_019558chr21314 ------
NM_019590chr102546 153 ------
NM_019593chr2022799 371 --1539 --
NM_019594chr961646 1380 1196 509 253 164 --1637 --
NM_019597chrX2274 95 ------
NM_019600chr152600 33 ----161
NM_019610chr111381 --2856 481 --
NM_019857chrX21757 600 --11725 --
NM_019903chr1031937 1238 483 1555 --1764
NM_020066chr13399 282 266 ------
NM_020116chr451692 1613 1577 688 203 ------
NM_020122chr275827 5419 5098 4398 1910 1049 389 --1974 11017
NM_020127chr11464 ------
NM_020141chr132294 723 126 --11879 --
NM_020144chr751775 1459 437 213 119 ----1153
NM_020148chr1842806 2033 1157 381 --141 --
NM_020150chr1042126 1715 1383 527 --1221 --
NM_020156chr71463 ------
NM_020159chr41529 --1315 --
NM_020177chr583130 2289 1145 1005 902 658 85 21 ----1567
NM_020193chr11------11272
NM_020200chr103246 103 37 ------
NM_020204chr12180 148 ------
NM_020239chr112080 --11696 --
NM_020245chr654788 4767 1885 1417 481 13521 44854 4348 830 711 --
NM_020319chr72642 611 ----2881 676
NM_020336chr2033593 2366 453 22411 1224 13640 --
NM_020337chr422855 978 13094 1530 --
NM_020338chr1053169 2689 2376 1242 471 ------
NM_020341chr202278 124 2761 421 ----
NM_020342chr211928 --21732 552 --
NM_020346chr11--11186 ----
NM_020348chr1062382 2288 2191 2053 730 643 1258 11906 --
NM_020357chr311410 11262 ----
NM_020369chr71129 ------
NM_020384chrX31540 1290 177 --21772 1675 --
NM_020390chr3104425 3994 3790 3456 1870 1799 1362 891 664 274 23775 354 24632 240 1755
NM_020403chr1321453 131 31644 1314 598 ----
NM_020416chr411875 11720 1817 --
NM_020420chrY175 --21331 513 --
NM_020432chr721866 331 12032 1529 --
NM_020443chr146851 5552 4869 2660 ------
NM_020449chrX2263 227 ------
NM_020455chr652791 2427 1863 362 340 ------
NM_020456chr1322047 594 1260 11968 1143
NM_020463chr22582 266 1130 1973 --
NM_020466chr683863 3726 3270 3206 781 392 204 107 --14285 --
NM_020474chr181353 21879 429 --156
NM_020546chr522503 402 --12265 --
NM_020640chr3--12172 11772 --
NM_020647chr841854 1612 846 551 ------
NM_020651chr241647 1351 1159 461 11442 ----
NM_020654chr33523 457 62 1285 11326 --
NM_020666chr51773 1148 ----
NM_020673chr2086698 5926 5513 2473 2438 1836 1269 343 --15561 1875
NM_020686chr1672964 2896 2872 2625 2599 2170 1250 12104 43115 2292 2272 721 --
NM_020697chr81438 --1926 --
NM_020699chr145337 3912 1609 152 --11448 14051
NM_020711chr241781 881 827 243 ------
NM_020718chr1686554 6079 1955 1778 1456 1429 1155 282 --11560 --
NM_020727chr21103879 3531 3474 1328 994 815 741 599 478 451 ----1300
NM_020728chr752350 2202 2013 1133 849 1797 --133
NM_020739chr1554024 3939 2608 1383 21 11482 --11299
NM_020740chr17----1348 --
NM_020742chrX72768 2739 2306 2095 718 197 46 ------
NM_020747chr52316 266 ------
NM_020750chr611511 ------
NM_020752chr1062910 2862 2776 2770 2197 1030 12349 21017 248 1526
NM_020755chr651494 1331 1223 340 56 ------
NM_020760chr241315 1297 1261 376 1737 ----
NM_020766chrX44321 4169 4036 1244 --11060 13165
NM_020771chr6--1977 1526 --
NM_020772chr17118218 7938 6732 6542 6198 2974 1415 1314 1023 559 37 13045 12743 17606
NM_020774chr1865035 4350 4102 2337 2046 1843 --15261 15676
NM_020776chr1842662 2192 570 121 ------
NM_020781chr731030 961 227 11975 ----
NM_020792chr341811 1777 465 439 ------
NM_020794chr11137 ------
NM_020801chr572471 2416 2184 1689 1049 803 440 ------
NM_020804chr662584 2132 1819 822 803 780 --1790 --
NM_020805chr1831921 1208 28 --1342 --
NM_020808chr11720 ------
NM_020809chr1141908 1784 838 757 1104 11566 --
NM_020810chr1442981 2292 1121 906 ----13223
NM_020818chr14141 ------
NM_020819chr621046 365 ------
NM_020824chr10--1257 ----
NM_020830chr272596 1323 1208 891 631 510 237 --1595 --
NM_020841chr1253676 3336 1406 965 440 --23769 3165 1696
NM_020843chr151299 ------
NM_020850chr1662230 708 498 486 333 228 --13222 --
NM_020854chr1831268 555 486 ------
NM_020858chr1552070 1473 924 918 515 22280 282 12162 --
NM_020865chr32475 125 ------
NM_020866chr131433 1262 ----
NM_020868chr23606 578 148 ------
NM_020870chr4----1593 --
NM_020871chrX62112 1996 1768 1004 695 384 1347 ----
NM_020872chr331257 410 387 ------
NM_020909chr254056 3158 3061 2700 34 11066 --21448 924
NM_020921chr1443335 2489 593 60 --13136 12896
NM_020927chr1631646 677 188 ----12401
NM_020935chr284572 3274 2995 1826 976 870 788 26 ------
NM_020948chr121218 535 ------
NM_020959chr191106 ------
NM_020960chr964854 4277 4063 3532 1732 1201 --14900 --
NM_020975chr1041324 1300 814 669 --1573 --
NM_020977chr461533 785 303 291 234 40 11577 22118 133 --
NM_020983chr1231565 1471 284 ------
NM_020987chr1041211 251 72 44 1884 21342 189 --
NM_020993chr1242820 2659 1777 49 12793 ----
NM_021005chr151347 --21020 970 --
NM_021007chr241909 889 181 166 ------
NM_021012chr1743171 1253 115 25 --11952 --
NM_021032chr361801 1610 1578 1298 799 228 ------
NM_021033chr1373180 3166 3060 2845 2733 514 179 ------
NM_021038chr333200 3048 2596 --12414 --
NM_021061chr844232 4069 1342 1128 --1446 --
NM_021069chr421679 1613 --1818 --
NM_021072chr522049 582 --21694 216 --
NM_021076chr222170 159 ------
NM_021083chrX33490 2554 459 11174 1634 --
NM_021097chr222041 800 13020 ----
NM_021111chr921316 131 --11212 --
NM_021116chr787734 7143 5920 5880 3320 2954 917 750 15704 1330 --
NM_021127chr1821208 447 --11395 --
NM_021132chr101327 --1428 --
NM_021135chr683238 3218 3169 2917 2473 2230 37 24 --11077 --
NM_021136chr141641 --1466 --
NM_021140chrX1412 --1801 --
NM_021145chr72716 199 ------
NM_021151chr71257 ------
NM_021183chrX52149 825 761 208 132 --21671 369 --
NM_021190chr11528 ----11348
NM_021191chr1242000 1772 957 815 11742 ----
NM_021202chr2052499 2204 1946 638 220 --21161 1054 --
NM_021204chr42895 756 ------
NM_021215chr201365 12434 ----
NM_021240chr92689 138 ------
NM_021255chr1433989 2872 200 --33748 3691 3335 --
NM_021629chr3104930 4660 4590 4502 3712 3678 3488 3174 1129 138 1716 --1907
NM_021639chr11890 1264 ----
NM_021643chr22168 25 --1379 --
NM_021644chr10138 --1769 --
NM_021648chr652434 2154 1815 141 74 ------
NM_021705chr62413 335 --1147 --
NM_021722chr7------1562
NM_021723chr7------1603
NM_021813chr654555 4495 2098 1236 131 14043 ----
NM_021815chr272985 2936 2732 2508 2060 1077 914 177 ----
NM_021911chr565220 3613 1867 1812 824 329 23534 906 25579 385 --
NM_021912chr1533415 3014 1077 --23520 1385 1155
NM_021914chr1421652 973 --1387 --
NM_021935chr31910 --1985 --
NM_021942chr41212 ------
NM_021947chr171444 ------
NM_021954chr1352954 2703 2254 926 184 13365 --12398
NM_021956chr61406 ----1496
NM_021960chr141712 630 464 226 1511 ----
NM_021961chr1167107 6708 6025 5217 4995 1368 --21804 1089 --
NM_021964chr375517 5510 5037 4634 1375 1128 400 22405 2212 26493 174 26286 383
NM_021967chr51183 11039 ----
NM_021970chr41496 2537 142 ----
NM_021984chrX21572 202 1497 ----
NM_021987chrX21572 202 1497 ----
NM_021988chr2021567 1247 ------
NM_021990chrX21572 202 1497 ----
NM_021998chrX21010 555 --11113 --
NM_021999chr13--145 1309 --
NM_022037chr22927 903 ------
NM_022041chr1652282 2165 2104 1682 650 --12558 --
NM_022048chr1595775 5636 5520 5189 1627 1394 1012 548 517 21479 382 ----
NM_022062chr1121977 130 ------
NM_022073chr1431633 1596 1118 --21671 1247 --
NM_022080chr2042712 2559 2437 232 ------
NM_022085chr651402 981 608 487 429 ------
NM_022103chr191883 --1938 --
NM_022114chr144062 2959 1471 501 --24034 111 --
NM_022118chr131197 ------
NM_022121chr6--11096 ----
NM_022129chr10182 ------
NM_022130chr52482 368 --11180 --
NM_022133chr821880 1656 ------
NM_022154chr421059 893 --1253 --
NM_022166chr16115762 5419 5200 4181 2470 2442 1447 1228 1130 690 151 ------
NM_022173chr22927 903 ------
NM_022307chr7----182 --
NM_022351chr812552 --2681 421 11358
NM_022373chr72895 784 ------
NM_022442chr2021567 1247 ------
NM_022459chr1385925 5854 5201 5078 4546 4530 2275 642 11528 ----
NM_022461chr3--11239 1120 --
NM_022465chr1212086 1241 --11238
NM_022469chr152932 2836 969 329 117 ------
NM_022473chr1532875 1213 244 1137 ----
NM_022474chr1442223 1853 955 467 1110 21828 1078 1796
NM_022476chr165900 825 418 329 224 ------
NM_022479chr711446 ------
NM_022494chr10------1426
NM_022497chr333774 3253 681 ------
NM_022574chr711398 ------
NM_022650chr52729 326 --136 --
NM_022652chr12263 46 1931 ----
NM_022719chr2243716 3454 2650 1531 --12939 --
NM_022735chr1--11325 1171 --
NM_022739chr173393 297 64 ------
NM_022745chr152582 2232 2209 1109 579 1707 22498 88 1212
NM_022748chr772826 2671 2243 1974 1960 1927 347 --32747 2162 1108 --
NM_022753chr152320 2080 846 295 58 12047 1512 --
NM_022758chr6----32469 689 176 --
NM_022763chr312199 --12909 --
NM_022771chr1221010 384 --2733 221 --
NM_022776chr32999 252 ------
NM_022780chr221474 577 ----21266 673
NM_022781chr92896 512 1416 32196 906 322 --
NM_022802chr101602 ------
NM_022824chr551898 1680 1240 543 38 ------
NM_022831chr131656 1219 47 174 21270 596 --
NM_022832chr452487 2464 971 921 915 --12127 --
NM_022840chr1821213 130 ------
NM_022841chr1542726 1923 538 140 ------
NM_022842chr373223 3170 3004 2699 2116 1010 648 1292 13213 --
NM_022843chr132609 183 --11406 --
NM_022845chr1642002 634 610 501 1556 ----
NM_022893chr222676 367 32389 948 828 1795 --
NM_022894chr22245 179 --21438 476 --
NM_022898chr1444196 3079 855 802 11437 24770 1500 --
NM_022900chr71477 11160 ----
NM_022912chr263025 2853 2136 2096 1072 457 ------
NM_022917chr92180 66 --1423 --
NM_022970chr102962 346 1374 --1143
NM_022977chrX21073 1030 12445 11622 --
NM_022978chr51183 11039 ----
NM_023000chr1441719 1540 516 284 11062 ----
NM_023001chr1441719 1540 516 284 11062 ----
NM_023012chr121534 --1711 --
NM_023016chr242509 2472 972 775 --12293 --
NM_023074chr19--1915 ----
NM_023076chr1642963 2775 2413 1851 --23008 2094 --
NM_023112chr1422991 2440 --12535 --
NM_023923chr13232 148 80 ------
NM_024007chr51611 ------
NM_024052chr1731975 990 728 --21043 589 --
NM_024068chr12191 ------
NM_024089chr131148 ------
NM_024122chrX----2101 70 --
NM_024294chr6----32469 689 176 --
NM_024345chr9126017 4525 3997 3859 3752 1519 943 768 731 217 202 166 ----14777
NM_024408chr131345 641 512 11114 ----
NM_024422chr1821541 708 ------
NM_024429chr71924 ------
NM_024496chr141329 1242 1278 --
NM_024501chr22726 664 ------
NM_024520chr2134 ------
NM_024524chr34805 663 226 38 --13176 --
NM_024525chr1----1504 --
NM_024529chr1--1793 1255 --
NM_024551chr1232327 1896 1652 12029 22440 930 --
NM_024551chr1232327 1896 1652 12029 22440 930 --
NM_024567chr8153 191 3497 274 184 --
NM_024569chr172702 2566 1880 762 561 555 104 --1495 --
NM_024582chr43740 250 103 ------
NM_024594chr511551 1111 11675 --
NM_024611chr1542747 2536 2487 83 11085 --13820
NM_024612chr174976 775 267 103 11106 1347 --
NM_024613chr831493 1409 394 ------
NM_024624chr221500 572 11092 ----
NM_024631chr11----1579 --
NM_024638chr322363 1996 ------
NM_024645chr821235 254 --140 --
NM_024652chr153867 856 482 ------
NM_024665chr3104033 3855 1850 1809 1657 1120 726 403 367 248 11169 11778 --
NM_024686chr11197 ------
NM_024689chrX11831 --21300 1158 --
NM_024721chr842078 1719 404 333 --12132 --
NM_024740chr1143630 1549 1099 1070 --1724 --
NM_024744chr22739 240 --22636 2614 --
NM_024749chr161740 895 528 403 386 62 --21606 457 --
NM_024759chr84795 757 182 152 --1212 --
NM_024761chr954047 1982 1374 863 615 ----14136
NM_024770chr286418 6221 6152 5058 5002 1100 178 172 11323 15589 --
NM_024795chr2130 ------
NM_024808chr131339 ------
NM_024834chr1041936 1681 451 164 ------
NM_024837chr1511935 ----11358
NM_024873chr41797 ----1291
NM_024885chrX--1180 ----
NM_024889chr1051747 1405 1322 272 21 ------
NM_024899chr181275 ------
NM_024920chr411301 11027 ----
NM_024939chr161639 ------
NM_024947chr3119331 9162 8881 7762 7263 6806 6489 6350 6333 2145 2041 13087 39172 5858 2685 --
NM_024949chr464268 4137 1287 930 494 256 13268 11850 --
NM_024989chr2127762 7062 5781 5495 5415 3002 2898 2782 1205 1028 1002 336 --46128 5607 1665 79 25574 5450
NM_024991chr1052878 2680 2589 2167 80 ------
NM_024993chr211489 21399 550 ----
NM_025047chr31190 ------
NM_025054chr824078 2804 23554 3243 ----
NM_025073chr143592 2922 470 348 --13397 --
NM_025079chr11512 ------
NM_025106chr151924 1209 219 208 97 ------
NM_025133chr21307 --1209 --
NM_025134chr1652289 1821 1727 730 404 1917 ----
NM_025137chr15138 ------
NM_025138chr133907 469 354 --1453 --
NM_025146chr342280 843 681 386 ------
NM_025147chr231110 989 357 ------
NM_025160chr161469 1120 1065 993 975 911 2780 547 13189 1287
NM_025164chr1141664 461 73 63 12114 ----
NM_025191chr122983 838 ----13155
NM_025205chr41237 ------
NM_025219chr2061678 281 235 184 177 148 ------
NM_025221chr441127 1024 933 889 ----182
NM_025222chr352685 2172 1075 889 752 ------
NM_025235chr1042030 431 369 206 --12022 --
NM_025263chr651653 1533 1219 573 347 1185 ----
NM_030579chr1683485 3465 3031 2877 2830 1116 1073 163 ------
NM_030623chr23560 535 107 ------
NM_030625chr1032580 818 754 1830 --22236 988
NM_030627chr584112 3934 3771 3644 3060 1417 880 610 --23269 1317 --
NM_030647chr7116250 6078 6038 5685 5200 4139 3908 2402 2269 1615 171 12000 --13853
NM_030648chr4104701 4260 3584 2151 1196 1043 897 400 247 127 --15293 --
NM_030650chr243750 3530 2766 887 1716 --13722
NM_030674chr1274670 4618 3813 3724 1983 1960 61 --13730 --
NM_030751chr1021686 1318 --31248 468 374 --
NM_030751chr1021686 1318 --31248 468 374 --
NM_030755chr1452421 2111 1203 748 195 --12683 --
NM_030758chr2221045 441 ------
NM_030759chr101770 ------
NM_030762chr1211722 --1566 --
NM_030763chrX1831 --1110 1756
NM_030786chr1150 11857 21758 1192 --
NM_030791chr1411174 --11244 --
NM_030806chr1178943 8929 8678 8485 6661 6505 6432 3210 3001 2884 2417 1718 1685 1207 999 910 91 18788 27270 6514 --
NM_030810chr651402 981 608 487 429 ------
NM_030906chr11150 1178 ----
NM_030911chr1311504 ----11380
NM_030915chr272341 2267 2130 1510 863 485 38 ------
NM_030918chr165297 5080 5063 4828 3819 1022 14861 ----
NM_030920chr152037 1515 770 601 564 ------
NM_030922chr152638 196 ----1765
NM_030934chr141882 1805 1522 94 11301 11591 --
NM_030935chr72371 120 ------
NM_030939chr6----2384 248 --
NM_030958chr81486 ----1136
NM_030965chr11560 --1674 --
NM_031216chr1831739 1496 527 --1871 --
NM_031263chr9139 ------
NM_031268chr1695392 4873 3856 3756 1553 1011 741 348 132 ------
NM_031284chr151887 ------
NM_031296chr431769 292 63 ------
NM_031314chr1441506 736 357 102 11430 11327 --
NM_031362chr262561 2526 2386 2290 1926 1771 21853 756 11932 --
NM_031365chr262697 2662 2522 2426 2062 1907 21989 892 12068 --
NM_031366chr262697 2662 2522 2426 2062 1907 21989 892 12068 --
NM_031369chr42263 45 ------
NM_031370chr42263 45 ------
NM_031419chr321538 407 --11221 --
NM_031422chr181392 ------
NM_031427chr1465896 5663 5302 2045 1204 460 --12305 --
NM_031442chrX62670 2424 2356 2085 2052 1260 12658 32795 591 497 --
NM_031461chr81246 ----11753
NM_031468chr778039 3290 3276 2724 708 669 131 17106 38099 7998 7976 --
NM_031469chr653460 3427 1393 110 56 --13654 12973
NM_031476chr1642780 1091 692 183 ------
NM_031492chr112507 112 ------
NM_031844chr124102 409 23788 2556 33253 239 211 --
NM_031845chr253479 2942 913 854 766 --23153 968 --
NM_031847chr253479 2942 913 854 766 --23153 968 --
NM_031858chr171152 11355 ----
NM_031862chr171152 11355 ----
NM_031892chrX1130 ------
NM_031904chr1132097 1428 121 ------
NM_031990chr19191 --11297 --
NM_031991chr19191 --11297 --
NM_032021chr112981 432 ------
NM_032051chr224673 549 201 106 ------
NM_032102chr1131979 1110 541 ------
NM_032116chr1375755 3910 2055 1582 1241 1125 987 1455 14179 --
NM_032121chrX32607 1979 572 ------
NM_032124chr1831226 997 81 ------
NM_032128chr43965 728 91 ------
NM_032144chr23466 207 180 11524 21138 35 179
NM_032146chr32373 26 ------
NM_032147chr121950 ------
NM_032154chr102683 128 --1942 --
NM_032160chr1853799 3380 2695 1377 831 13563 ----
NM_032182chr1041539 1350 1025 420 ----1285
NM_032186chr12991 244 ------
NM_032208chr252966 2465 2407 2363 765 1138 ----
NM_032217chr421073 338 --1211 2950 444
NM_032221chr2011321 11734 ----
NM_032228chr1142882 1385 998 690 2504 304 --23460 1337
NM_032229chr132986 439 ------
NM_032236chr111038 ------
NM_032242chr392981 2460 2324 2066 2055 1175 972 34 24 --1419 --
NM_032246chr151859 1921 ----
NM_032283chr111835 ------
NM_032287chr2224084 1077 146 --13705
NM_032288chr321548 322 1836 ----
NM_032289chr511835 ------
NM_032291chr11184 21904 606 1288 --
NM_032320chr112191 27 ------
NM_032329chr231105 783 245 --14384 --
NM_032352chr1421360 1320 ------
NM_032360chr1--136 ----
NM_032373chr1065916 5718 5297 4746 4203 1932 11080 1112 --
NM_032408chr74471 417 62 25 ------
NM_032424chr113438 117 23 1189 ----
NM_032435chr172437 2230 1607 1564 1477 837 280 ------
NM_032438chr631494 1394 663 --2610 29 --
NM_032439chr1041230 458 426 317 ------
NM_032440chr1082228 2174 2002 1806 1061 879 633 192 ------
NM_032445chr1552313 2041 1981 1888 1870 --21829 918 --
NM_032446chr512843 --23674 3114 13213
NM_032457chr41349 13059 --1723
NM_032458chrX53052 2626 2565 1244 912 ------
NM_032466chr82470 242 ------
NM_032471chr631053 829 118 ------
NM_032499chr1521111 461 --1233 11518
NM_032505chr332020 182 80 --1214 --
NM_032509chr811838 1213 --12056
NM_032521chr2012347 --13133 --
NM_032547chr41282 --11079 --
NM_032549chr71177 ------
NM_032557chr4----1352 --
NM_032560chr142942 25 ------
NM_032564chr11----1166 --
NM_032569chr1651576 1417 408 200 144 ------
NM_032575chr1611841 --21903 1813 11975
NM_032578chr101286 11537 1508 --
NM_032582chr1721282 725 ----11640
NM_032598chr17------126
NM_032635chr19169 ------
NM_032636chr1251 31 ------
NM_032682chr352691 1415 983 319 73 --22659 2345 --
NM_032689chr19--1561 ----
NM_032717chr4--1987 1814 --
NM_032765chr51697 ------
NM_032778chr323048 600 ------
NM_032784chr62726 391 ------
NM_032801chr1131810 372 350 --32218 2159 565 --
NM_032826chr7105299 4665 4495 4284 4003 3508 3401 1120 541 441 1701 34858 1361 273 --
NM_032833chr122437 980 129 ----
NM_032837chr1742157 2079 1394 786 --1505 --
NM_032859chr1353730 3500 1570 1229 878 13737 --23785 254
NM_032871chr1141727 1629 1280 574 ----11501
NM_032873chr1123639 3010 ----1116
NM_032883chr201582 ------
NM_032924chr72924 360 11131 ----
NM_032932chr17104455 4364 4245 4073 3958 2442 1351 1051 748 197 ------
NM_032949chr131203 ------
NM_032960chr11256 ------
NM_032961chr42170 31 --11279 --
NM_032968chrX64193 4124 4107 1023 353 283 ----11498
NM_032969chrX64193 4124 4107 1023 353 283 ----11498
NM_032973chrY64185 4116 4099 1023 353 283 ----11498
NM_032975chr1873151 2578 1446 871 836 508 394 --12232 --
NM_032978chr181938 --1149 --
NM_032979chr181938 --1149 --
NM_032980chr1873151 2578 1446 871 836 508 394 --12232 --
NM_032981chr181938 --1149 --
NM_032995chr231634 1514 623 ----193
NM_033012chr131987 1696 1129 --
NM_033020chr1104491 4012 3707 3430 3199 1576 1010 924 593 150 --13453 --
NM_033030chr211278 21424 465 1666 --
NM_033044chr12476 394 ------
NM_033055chr13301 219 32 ------
NM_033071chr61245 138 ----
NM_033083chr353453 3051 1338 941 356 --11271 --
NM_033105chr8----1161 --
NM_033117chr9----1118 --
NM_033121chr1211144 11570 ----
NM_033132chr13----2701 139 --
NM_033133chr1733191 1210 1128 --23050 2639 --
NM_033138chr752170 1863 1742 1630 353 ------
NM_033139chr752170 1863 1742 1630 353 ------
NM_033140chr752170 1863 1742 1630 353 ------
NM_033143chr444315 4066 553 55 1155 ----
NM_033157chr752170 1863 1742 1630 353 ------
NM_033181chr653466 1342 1053 895 490 13873 ----
NM_033211chr521353 377 ------
NM_033222chr951215 1151 1106 1009 183 1266 ----
NM_033224chr796916 5626 5479 2979 2262 1509 1264 1217 236 --26956 476 14931
NM_033225chr833123 2079 845 ------
NM_033227chr5--1428 --1228
NM_033228chr5--1468 ----
NM_033285chr874485 4393 4202 3764 3061 1714 781 11639 33111 479 298 --
NM_033300chr111058 ------
NM_033305chr941440 1349 584 214 ------
NM_033326chr1122405 107 ----12451
NM_033331chr933259 2232 64 13409 13373 --
NM_033360chr1254004 1807 1167 850 310 13834 2209 197 --
NM_033389chr1774463 4389 3059 1721 1502 1446 1177 --23975 1874 --
NM_033394chr2--11110 ----
NM_033396chr111312 ------
NM_033425chr113531 421 376 --1926 --
NM_033426chr1452880 2806 2471 2253 1109 1773 ----
NM_033427chr71604 ------
NM_033429chr1533152 2002 688 --12306 --
NM_033430chr461493 1067 885 295 240 153 --11568 13047
NM_033437chr461493 1067 885 295 240 153 --11568 13047
NM_033495chrX31042 999 273 --1806 --
NM_033505chr246122 5564 5007 4685 22448 1947 25345 108 --
NM_033515chr61498 ----11305
NM_033546chr181158 ------
NM_033631chr122430 870 --22616 1258 --
NM_033632chr421223 590 ------
NM_033637chr1073205 2816 2617 1586 1405 1000 199 11568 13323 --
NM_033642chrX11167 ------
NM_033644chr52929 399 --1473 --
NM_033645chr52929 399 --1473 --
NM_033656chr2143952 242 192 186 14500 14819 --
NM_033666chr102834 198 --2990 891 --
NM_044472chr11188 ------
NM_052827chr12----1199 --
NM_052832chr831968 1141 428 1860 23003 227 12825
NM_052840chr15--2450 197 ----
NM_052862chr111543 ------
NM_052879chr1212504 --23197 2515 1365
NM_052900chr821288 711 --2611 311 --
NM_052903chr151504 ------
NM_052905chr241833 736 257 127 --3750 744 717 --
NM_052907chr1263840 3593 1443 1407 1124 74 13153 --14269
NM_052918chr1022721 714 --22578 563 --
NM_052936chrX2686 86 1110 ----
NM_052937chr862525 2498 956 942 139 58 12626 1735 --
NM_052951chr201161 ------
NM_052978chr1431257 529 157 --11868 11563
NM_053016chr9108017 6730 3016 2909 2508 1498 1345 782 680 568 34949 4898 1536 27764 5501 --
NM_053023chr1172926 2193 1054 637 524 313 294 ------
NM_053024chr33591 227 92 ------
NM_053025chr351533 1480 1394 686 169 ------
NM_053026chr351533 1480 1394 686 169 ------
NM_053027chr351533 1480 1394 686 169 ------
NM_053028chr351533 1480 1394 686 169 ------
NM_053031chr351533 1480 1394 686 169 ------
NM_053032chr351533 1480 1394 686 169 ------
NM_053042chr432371 295 74 ------
NM_053043chr764939 1929 1772 1168 965 713 14654 15060 --
NM_053064chr1442303 2167 1989 90 12443 1880 --
NM_057158chr83833 714 655 ------
NM_057159chr93648 572 139 --1442 --
NM_057164chr2----1166 --
NM_057165chr2----1166 --
NM_057166chr2----1166 --
NM_057167chr2----1166 --
NM_057168chr731209 1110 35 --21540 467 --
NM_057169chr1232812 2580 1953 --2406 137 --
NM_057170chr1232812 2580 1953 --2406 137 --
NM_057175chr43939 817 404 1389 2745 449 --
NM_057178chr1722267 2061 ------
NM_057749chr8----11278 --
NM_058172chr411161 ------
NM_058237chr141796 --1365 1934
NM_058240chr142216 107 ------
NM_058241chr252255 2085 1777 1740 1621 1444 1236 --
NM_058241chr252255 2085 1777 1740 1621 1444 1236 --
NM_078469chr1041302 996 410 122 ------
NM_078485chr61182 --2128 103 --
NM_078487chr953149 2691 1254 842 703 ------
NM_080391chr11114 ------
NM_080425chr202324 244 ------
NM_080426chr202324 244 ------
NM_080491chr1162970 1557 1502 566 228 34 22819 894 ----
NM_080546chr931857 1765 761 ------
NM_080617chr201755 ----1192
NM_080664chr1431735 741 696 --1101 --
NM_080672chr20----1390 --
NM_080676chr2033187 2941 725 21233 458 ----
NM_080683chr41391 ------
NM_080684chr41391 ------
NM_080685chr41391 ------
NM_080717chr1221138 167 11259 ----
NM_080738chr12753 379 --11246 --
NM_080759chr1322144 976 1812 ----
NM_080760chr1322144 976 1812 ----
NM_080821chr202446 240 --31456 662 517 --
NM_080867chr1464473 3332 1741 1546 964 493 --21666 1066 --
NM_080872chr853842 3073 2647 1096 1054 --13475 --
NM_130386chr181255 ------
NM_130391chr92743 366 ------
NM_130392chr92743 366 ------
NM_130393chr92743 366 ------
NM_130435chr1042230 1857 1006 437 --12680 143
NM_130436chr2162812 2501 2341 2256 1941 297 ------
NM_130438chr2163389 3078 2918 2833 2518 874 ------
NM_130439chr1071878 1704 1643 887 861 683 173 ------
NM_130439chr1071878 1704 1643 887 861 683 173 ------
NM_130440chr141611 1034 1026 140 ------
NM_130446chr363614 3278 2826 1480 886 861 --1237 143
NM_130459chr94669 526 194 23 ------
NM_130469chr143961 135 125 1794 ----
NM_130773chr21144 2975 699 ----
NM_130797chr731466 468 122 ------
NM_130798chr152419 279 --11498 --
NM_130811chr2031129 996 341 ------
NM_130838chr151720 ------
NM_130839chr151720 ------
NM_130846chr1221019 325 ------
NM_133170chr2096953 6207 5393 4936 2847 2749 1717 1049 644 ----16444
NM_133265chrX53395 1374 1158 359 32 ----12557
NM_133330chr463216 2953 2598 1103 421 170 --2247 217 --
NM_133331chr463216 2953 2598 1103 421 170 --2247 217 --
NM_133334chr4105804 5572 4659 4332 1786 1748 1683 1612 1471 597 --2470 385 12437
NM_133335chr463216 2953 2598 1103 421 170 --2247 217 --
NM_133370chr473095 3001 1480 905 628 406 159 --12532 12519
NM_133379chr2125 --136 --
NM_133433chr51871 ------
NM_133468chr7179 12046 ----
NM_133473chr1921801 72 11735 11548 --
NM_133477chr432223 2113 2009 12520 --12266
NM_133486chrX1485 ------
NM_133496chr153402 3307 3080 1496 455 21087 632 13373 1533
NM_133638chr5167 ----1375
NM_133646chr275020 4102 3762 1964 1512 841 223 24996 4227 21804 1612 --
NM_133647chr1573794 3421 3391 2822 2684 2501 478 --23621 359 --
NM_133650chr61245 138 ----
NM_134265chr172456 328 11141 ----
NM_134266chr81392 ------
NM_138270chrX43167 2139 902 320 --21039 644 --
NM_138285chr23394 92 44 ------
NM_138333chr9--12244 --1364
NM_138426chr752427 1928 884 847 169 --32065 219 115 32496 2257 301
NM_138437chrX----1233 --
NM_138444chr1354500 3407 1513 962 597 --24093 1806 --
NM_138494chr752594 2488 2180 2080 1082 --32016 132 50 --
NM_138576chr1444196 3079 855 802 11437 24770 1500 --
NM_138621chr254060 3842 3260 1620 1093 24052 2738 23308 1042 --
NM_138633chr631223 356 80 --1629 --
NM_138638chr1421652 973 --1387 --
NM_138713chr16107156 6495 6023 5687 5100 2904 2252 1822 1342 933 22610 1099 26220 5317 16967
NM_138714chr16107156 6495 6023 5687 5100 2904 2252 1822 1342 933 22610 1099 26220 5317 16967
NM_138731chr1442818 2777 1163 93 33923 3824 1009 2788 708 --
NM_138782chr521709 245 11726 ----
NM_138799chr231666 247 59 --1554 --
NM_138811chr721275 459 ------
NM_138923chrX189 ------
NM_138959chr186678 4975 4482 1603 1488 791 457 133 16754 15467 --
NM_138967chr1532272 2084 492 ------
NM_138970chr1422435 2334 ------
NM_138971chr1143424 1280 698 450 11536 11339 --
NM_138971chr1143424 1280 698 450 11536 11339 --
NM_138972chr1143424 1280 698 450 11536 11339 --
NM_138972chr1143424 1280 698 450 11536 11339 --
NM_138973chr1143424 1280 698 450 11536 11339 --
NM_138973chr1143424 1280 698 450 11536 11339 --
NM_139032chr17----1223 --
NM_139033chr17----1223 --
NM_139034chr17----1223 --
NM_139035chrX----1739 1629
NM_139071chr1211518 --21282 639 11210
NM_139072chr22782 113 ------
NM_139126chr61778 ------
NM_139132chr1121141 139 1182 ----
NM_139207chr1231394 509 165 ----1598
NM_139211chr41246 ----190
NM_139212chr41246 ----190
NM_139276chr1742083 1941 385 328 ----1562
NM_139279chr253431 3074 2601 472 105 12754 42888 2673 2464 688 --
NM_139312chr1021208 54 --21164 193 --
NM_139318chr14--266 41 ----
NM_139321chr2053867 3226 1694 615 187 --14016 --
NM_144568chr142615 441 ------
NM_144571chr4106462 5585 5205 5106 4509 2227 2076 608 403 267 1591 25497 2755 --
NM_144574chr142519 419 ------
NM_144578chr1485374 5105 4527 4436 4184 3582 2008 533 --14126 14285
NM_144586chr21995 1920 1203 --
NM_144590chr1042613 693 461 165 32249 1205 792 ----
NM_144599chr15145450 4647 4410 3836 2198 1836 1741 1679 1611 1308 1281 1232 966 155 ----15385
NM_144632chr221920 151 185 1855 --
NM_144642chr311334 ------
NM_144664chr1142171 620 579 152 --12383 --
NM_144665chr11181 ------
NM_144721chr462570 2373 2189 2053 622 489 ------
NM_144722chr521269 874 1414 1277 --
NM_144778chr1322102 396 --1411 --
NM_144949chr252516 1874 1675 209 105 ------
NM_144963chr832035 479 201 --11038 1574
NM_144968chrX2152 136 ------
NM_144973chr1235193 1385 1368 --24514 1441 14645
NM_144978chr2197 ------
NM_145011chr103900 859 136 12101 1802 1745
NM_145044chr311822 11761 21510 358 --
NM_145055chr1863095 3087 1458 1161 1119 222 23823 2706 ----
NM_145159chr142782 176 ------
NM_145176chr623341 2995 ------
NM_145203chr132386 47 ------
NM_145206chr1062984 1101 915 889 650 577 --13118 --
NM_145207chr454798 3903 3645 663 120 ------
NM_145259chr23463 139 117 15414 --11485
NM_145274chr171197 ------
NM_145284chrX11714 11639 ----
NM_145291chr42386 44 ------
NM_145307chr1054257 3188 1770 1591 1189 --24331 467 --
NM_145320chr72941 743 13247 1123 --
NM_145321chr72941 743 13247 1123 --
NM_145322chr72941 743 13247 1123 --
NM_145331chr63560 547 210 ------
NM_145332chr64708 695 358 123 ------
NM_145333chr64708 695 358 123 ------
NM_145341chr1031779 652 66 ------
NM_145686chr232934 1093 836 ------
NM_145687chr232934 1093 836 ------
NM_145690chr821815 1357 ------
NM_145725chr14127 1487 1394 --
NM_145726chr14127 1487 1394 --
NM_145731chr222652 206 --1474 --
NM_145735chr1332763 984 541 ------
NM_145738chr222652 206 --1474 --
NM_145808chr72772 730 ------
NM_145859chr3141 ------
NM_145860chr3141 ------
NM_145861chr12753 379 --11246 --
NM_145891chr1631576 677 94 ------
NM_145892chr1631576 677 94 ------
NM_145893chr1621698 216 ------
NM_145912chr2264133 3855 3400 1680 646 348 ------
NM_147150chr942415 1466 456 112 ------
NM_147156chr102559 143 1295 ----
NM_147164chr91515 ------
NM_147166chr72771 74 --1140 --
NM_147175chrX11739 --11711 --
NM_147181chr441127 1024 933 889 ----182
NM_147182chr441127 1024 933 889 ----182
NM_147183chr441127 1024 933 889 ----182
NM_147188chr1521309 389 --21403 582 11291
NM_147223chr251898 1842 651 301 167 --12103 --
NM_147233chr241715 1659 468 118 --11920 --
NM_152222chr1141727 1629 1280 574 ----11501
NM_152261chr1241840 1794 1009 502 1175 --12010
NM_152265chr131231 995 103 --21336 145 --
NM_152275chr262350 2315 2075 1908 1623 422 ----1456
NM_152277chr521737 509 ----11797
NM_152280chr12405 176 ------
NM_152292chr432304 776 249 --21546 429 --
NM_152317chr121231 ------
NM_152320chr12--1685 ----
NM_152330chr1412669 --11691 12478
NM_152344chr1731540 63 30 --1127 --
NM_152347chr172559 156 --153 --
NM_152352chr1872607 939 826 453 429 228 221 22512 2388 ----
NM_152375chr152514 2501 1816 879 746 1897 ----
NM_152388chr273366 2653 1381 1340 1055 194 36 11314 ----
NM_152390chr22634 462 ------
NM_152400chr442004 1904 1750 561 ----21648 530
NM_152409chr573208 2963 2641 2274 1289 967 192 2789 370 ----
NM_152420chr92782 275 ------
NM_152424chrX53381 3198 571 517 442 --11364 --
NM_152440chr1241101 1073 998 460 --1249 2764 729
NM_152449chr1541435 354 135 34 ------
NM_152478chr191539 1553 ----
NM_152493chr1----11315 --
NM_152529chr254285 2846 2821 1223 1097 ----14164
NM_152538chr31554 --21689 1661 --
NM_152556chr73604 242 82 22512 1699 22458 236 --
NM_152570chr93255 58 49 --1301 --
NM_152574chr91343 --244 38 --
NM_152594chr15------22206 262
NM_152608chr121634 78 12094 ----
NM_152622chr531297 492 201 --23387 123 --
NM_152624chr5116147 5811 4938 4911 4677 1750 894 729 690 600 219 --26395 456 --
NM_152626chr7--11127 ----
NM_152638chr12160 11106 11188 --
NM_152641chr1262862 2627 2421 536 462 307 ------
NM_152665chr131190 1134 489 ------
NM_152666chr12784 616 --1341 --
NM_152678chr322630 1825 --22383 289 --
NM_152688chr62250 225 ------
NM_152694chrX2918 154 ------
NM_152704chr131827 ------
NM_152724chr1042335 2069 1854 752 ------
NM_152737chr641739 1380 273 195 ------
NM_152742chr7122 --1483 --
NM_152745chr7------1193
NM_152749chr7--1897 ----
NM_152753chr61242 ------
NM_152754chr723751 2778 ----11102
NM_152756chr543869 3758 3079 1257 ------
NM_152758chr872611 2144 2020 1919 931 245 161 11091 11033 --
NM_152780chrX51208 959 923 326 216 ------
NM_152787chrX13531 13256 ----
NM_152789chr71133 --11045 --
NM_152793chr753933 1587 1317 119 89 11527 177 --
NM_152835chr152822 2791 2247 1929 1177 --1332 --
NM_152836chr821880 1656 ------
NM_152837chr821880 1656 ------
NM_152838chr2033506 1027 345 ------
NM_152905chr121197 --173 --
NM_152924chr1556697 6145 4674 1938 117 12342 25891 268 --
NM_152991chr113505 475 462 --1639 --
NM_152996chr131302 548 417 1717 ----
NM_152998chr71221 ------
NM_152999chr734442 736 497 13338 1473 --
NM_153020chr61477 --11577 --
NM_153042chr611518 --1435 11146
NM_153182chr323048 600 ------
NM_153184chr332003 1660 129 ------
NM_153186chr91604 ------
NM_153188chr555315 4436 2281 2095 927 13593 14656 --
NM_153201chr11124 ------
NM_153207chr1273560 3553 1100 728 678 358 132 --12543 --
NM_153235chr622044 821 1222 --152
NM_153252chrX1342 1137 ----
NM_153261chr161407 --1208 --
NM_153262chr173137 3068 2817 1969 1962 991 295 140 --13086
NM_153267chr9----1601 --
NM_153321chr17--1302 1316 --
NM_153322chr17--1302 1316 --
NM_153331chr3--1661 ----
NM_153332chr843147 3019 2999 213 --1834 --
NM_153333chrX1135 --153 --
NM_153365chr482660 2529 2439 2224 1953 953 583 261 ----1359
NM_153367chr1073698 3593 3452 3421 3286 826 484 23122 971 13107 --
NM_153456chr1386155 5950 5605 4717 4088 1392 1159 1038 --24314 3982 --
NM_153487chr634058 2923 1866 --34860 3879 1477 11930
NM_153499chr1241096 773 626 175 ------
NM_153500chr1241096 773 626 175 ------
NM_153607chr5--21963 142 191 --
NM_153616chr1552070 1473 924 918 515 22280 282 12162 --
NM_153617chr1552070 1473 924 918 515 22280 282 12162 --
NM_153618chr1552070 1473 924 918 515 22280 282 12162 --
NM_153619chr1523308 2711 23518 67 13400 12585
NM_153633chr12----1243 --
NM_153634chr1241459 619 569 116 ------
NM_153646chr1432451 1832 463 11870 11721 --
NM_153647chr1432451 1832 463 11870 11721 --
NM_153648chr1432451 1832 463 11870 11721 --
NM_153686chr43807 622 513 --2126 43 --
NM_153689chr242350 2048 1979 1668 ------
NM_153693chr121655 ------
NM_153697chr21339 ------
NM_153704chr8------133
NM_153756chr131850 1665 27 ------
NM_153757chr431279 866 302 1351 ----
NM_153810chr1054945 3515 910 459 314 11985 21903 514 --
NM_170587chr84538 518 261 86 ------
NM_170665chr1274199 3900 3823 3320 1499 394 329 --1505 --
NM_170686chr731030 961 227 11975 ----
NM_170695chr181336 ------
NM_170706chr173953 682 619 443 404 365 287 --12686 --
NM_170709chr822431 2101 --21645 253 --
NM_170719chr133907 469 354 --1453 --
NM_170751chr621390 1355 --11102 --
NM_170752chr621390 1355 --11102 --
NM_171998chrX42263 2140 1853 621 --11715 22185 426
NM_171999chr182686 658 ------
NM_172037chr821269 182 --172 --
NM_172058chr871285 647 582 247 241 98 78 --1321 --
NM_172059chr871285 647 582 247 241 98 78 --1321 --
NM_172060chr871285 647 582 247 241 98 78 --1321 --
NM_172071chr154919 4532 2953 2674 218 --17479 --
NM_172103chr662491 2128 807 672 525 292 12420 ----
NM_172105chr662491 2128 807 672 525 292 12420 ----
NM_172127chr4----11921 --
NM_172128chr4----11877 --
NM_172159chr331494 512 95 ------
NM_172160chr331494 512 95 ------
NM_172163chr11130 ------
NM_172216chr124998 675 528 77 ------
NM_172226chr1241096 773 626 175 ------
NM_172236chr203565 302 127 ----1275
NM_172375chr141222 21000 975 166 --
NM_173054chr73353 347 263 ------
NM_173060chr52714 682 11532 21621 1245 --
NM_173061chr52714 682 11532 21621 1245 --
NM_173063chr52714 682 11532 21621 1245 --
NM_173083chr13215 176 163 ------
NM_173156chr11482 ------
NM_173172chr211037 ------
NM_173198chr942929 2625 1004 696 ------
NM_173199chr9169 --1338 --
NM_173200chr942929 2625 1004 696 ------
NM_173207chr181336 ------
NM_173208chr181336 ------
NM_173209chr181336 ------
NM_173210chr181336 ------
NM_173211chr181336 ------
NM_173214chr16107156 6495 6023 5687 5100 2904 2252 1822 1342 933 22610 1099 26220 5317 16967
NM_173359chr311652 --1687 --
NM_173454chr154405 370 146 89 ------
NM_173468chr465726 4696 3767 1601 1322 1295 25631 3902 11152 --
NM_173469chr1511391 1154 ----
NM_173470chrX22790 398 --1957 --
NM_173478chr172841 667 --2709 309 1717
NM_173494chrX1781 --1866 --
NM_173495chrX22562 1648 --11788 11758
NM_173508chr131203 347 328 ------
NM_173510chr2272802 2518 2256 1803 867 698 520 12439 ----
NM_173511chr253875 3739 3068 1338 883 --11354 --
NM_173515chr61921 --190 --
NM_173552chr342036 1599 982 857 ------
NM_173582chr1166315 5589 4581 3988 3833 357 1608 2535 84 --
NM_173591chr124819 680 330 139 1278 1899 --
NM_173595chr1233715 1349 549 --11554 --
NM_173631chr192477 178 ------
NM_173642chr1128432 7191 7112 7007 6292 5783 3239 3001 2737 1492 306 21 18526 47903 557 224 127 11310
NM_173648chr22846 823 1144 ----
NM_173667chr531861 1603 563 --1423 --
NM_173694chrX22131 2099 22404 2336 ----
NM_173794chrX----2431 144 --
NM_173808chr164024 3531 1599 964 102 87 1848 1605 --
NM_173812chr1211544 --11356 --
NM_173822chr221663 1368 1232 ----
NM_173825chr322214 2106 12222 ----
NM_173826chr321705 85 ------
NM_173827chr432842 970 499 12125 ----
NM_173829chr5116165 5791 5721 5557 5442 5223 4423 2384 2357 2164 1519 15139 14562 36132 2223 893
NM_173830chr61135 ----1723
NM_173848chr82140 92 --1342 --
NM_173851chr853527 2992 2979 285 206 --1898 --
NM_174886chr181336 ------
NM_174890chr101512 ------
NM_174907chr3127 ------
NM_174911chr823247 1351 11543 ----
NM_174916chr1521721 171 --11562 --
NM_174936chr111216 ------
NM_175061chr741975 1868 259 88 ------
NM_175566chr111369 ------
NM_175607chr331607 601 564 11690 11521 --
NM_175612chr331607 601 564 11690 11521 --
NM_175624chr1286303 6187 4958 4824 3132 2179 1576 423 ----11872
NM_175625chr1286303 6187 4958 4824 3132 2179 1576 423 ----11872
NM_175630chr22701 171 ------
NM_175634chr82133 125 --1861 --
NM_175635chr82133 125 --1861 --
NM_175636chr82133 125 --1861 --
NM_175736chr1287533 7452 7354 6794 6444 4894 2607 1780 --16712 --
NM_175767chr531715 1204 388 2711 426 11393 --
NM_175768chr62610 96 ----1700
NM_175847chr19191 --11297 --
NM_175848chr20----11446 --
NM_175848chr20----11446 --
NM_175849chr20----11446 --
NM_175849chr20----11446 --
NM_175850chr20----11446 --
NM_175850chr20----11446 --
NM_175854chr1332787 1006 400 ----1497
NM_175856chr51824 ------
NM_175859chrX21757 600 --11725 --
NM_175861chr1245202 4749 1633 81 14361 35251 5091 1763 13681
NM_175866chr121231 455 --1272 --
NM_175876chr142653 908 855 280 1563 11102 182
NM_175907chr181882 --42881 2659 2464 325 --
NM_175920chr51187 --1321 --
NM_176863chr1711437 11809 ----
NM_177414chr11624 11713 11658 --
NM_177424chr12784 372 31718 405 92 --11672
NM_177524chr731164 996 765 ------
NM_177525chr731164 996 765 ------
NM_177538chr247708 2212 2175 90 1196 ----
NM_177553chr112626 263 159 ----
NM_177967chr131252 --1197 --
NM_177968chr231643 207 190 --1138 --
NM_177976chr32373 26 ------
NM_177985chr221974 386 --11645 11478
NM_177989chr31256 ------
NM_177990chr202278 124 2761 421 ----
NM_178011chr1052875 2744 2563 2101 209 ------
NM_178037chr1253148 3128 2878 636 301 --22713 2477 --
NM_178038chr1253148 3128 2878 636 301 --22713 2477 --
NM_178042chr31256 ------
NM_178151chrX117770 7528 7157 7128 7073 5846 2670 2618 1569 1511 242 11264 12927 --
NM_178152chrX117770 7528 7157 7128 7073 5846 2670 2618 1569 1511 242 11264 12927 --
NM_178153chrX117770 7528 7157 7128 7073 5846 2670 2618 1569 1511 242 11264 12927 --
NM_178270chrX2686 86 1110 ----
NM_178313chr221931 1389 2292 189 21786 795 --
NM_178426chr132374 2254 557 11707 ----
NM_178427chr132274 2154 457 11607 ----
NM_178450chr52246 133 1546 ----
NM_178496chr3--1167 ----
NM_178554chr383528 3418 3020 2695 2309 1313 1262 763 ------
NM_178565chr82150 110 --1450 --
NM_178566chr9--21566 526 ----
NM_178585chr432928 1215 656 --1867 --
NM_178812chr831569 1427 188 ------
NM_178815chr1072789 2629 2561 1018 1000 233 85 --22072 854 --
NM_181054chr1421055 395 ------
NM_181077chr1531853 1763 374 --2254 216 --
NM_181302chr142519 419 ------
NM_181308chr142519 419 ------
NM_181332chrX72768 2739 2306 2095 718 197 46 ------
NM_181351chr1142878 2675 849 653 --22445 545 --
NM_181354chr821642 23 ------
NM_181358chr133758 2718 977 13138 24222 3623 --
NM_181359chr162362 1820 835 706 276 189 --1886 --
NM_181427chr15141 ------
NM_181443chr2042786 2005 743 175 ----11814
NM_181481chr18136729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 27096 5263 14517 21362 1122
NM_181482chr18147091 6729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 15263 14517 21362 1122
NM_181483chr18136729 5761 5478 4871 4841 4378 2823 2603 1682 1023 998 953 866 27096 5263 14517 21362 1122
NM_181486chr1221138 167 11259 ----
NM_181500chr71639 ------
NM_181504chr523722 2861 ----1700
NM_181521chr16106911 6253 5920 4393 2036 1627 1544 878 390 372 11445 1198 16149
NM_181523chr523722 2861 ----1700
NM_181524chr523722 2861 ----1700
NM_181527chr201170 ------
NM_181659chr2031088 665 421 22663 2101 12922 --
NM_181659chr2031088 665 421 22663 2101 12922 --
NM_181702chr8--1839 1185 --
NM_181713chr2--1172 --2883 306
NM_181714chr621293 57 --1603 --
NM_181715chr11115 ------
NM_181723chr821831 908 --11447 --
NM_181762chrX11019 1866 1937 --
NM_181777chrX11019 1866 1937 --
NM_181782chr622239 534 22008 683 --1368
NM_181787chr843754 3262 1285 901 13210 ----
NM_181789chr1543134 2278 596 26 ------
NM_181794chr631053 829 118 ------
NM_181795chr631053 829 118 ------
NM_181836chr51646 --11760 11917
NM_181839chr83520 320 198 --21351 453 --
NM_181846chr1962976 2647 2439 1966 610 33 12960 1349 --
NM_181861chr123558 518 110 ------
NM_181868chr123558 518 110 ------
NM_181869chr123643 603 195 ------
NM_181876chr411875 11720 1817 --
NM_181886chr43526 423 409 ------
NM_181887chr43526 423 409 ------
NM_181888chr43526 423 409 ------
NM_181889chr43526 423 409 ------
NM_181890chr43526 423 409 ------
NM_181891chr43526 423 409 ------
NM_181892chr43573 470 456 --1900 --
NM_181893chr43526 423 409 ------
NM_181897chr332701 1085 248 12524 1989 --
NM_182485chr43981 840 141 --12797 --
NM_182488chr131734 ------
NM_182493chr161340 21422 1108 24024 528 --
NM_182501chr252958 2901 2768 2563 887 --22252 1275 --
NM_182515chr1946131 5927 2648 2614 --14884 --
NM_182527chr2212194 ------
NM_182540chrX1777 ------
NM_182641chr1711894 ------
NM_182643chr821965 780 --22404 1973 --
NM_182646chr43981 840 141 --12797 --
NM_182648chr14----1193 --
NM_182680chrX2125 95 ------
NM_182685chr1----1157 --
NM_182697chr71125 2554 200 11749 --
NM_182762chr785284 5145 5010 4671 4597 4406 1391 560 --45177 4431 2286 871 25748 1194
NM_182763chr141701 619 453 215 1500 ----
NM_182765chr1052210 530 463 158 38 --12220 --
NM_182767chr1271846 1787 1514 1469 697 487 437 21625 139 ----
NM_182789chr53742 377 55 ------
NM_182797chr203524 458 400 --11599 --
NM_182830chr1441852 1779 1681 270 ------
NM_182896chr361348 1310 659 173 84 35 --168 --
NM_182898chr786411 6223 4974 4802 4387 4107 1904 1412 14563 1688 --
NM_182899chr786411 6223 4974 4802 4387 4107 1904 1412 14563 1688 --
NM_182920chr311346 ----11400
NM_182931chr72594 188 1653 ----
NM_182936chr142216 107 ------
NM_182944chr141159 ------
NM_182948chr162467 2097 860 789 735 394 12407 22553 2416 --
NM_182961chr61245 138 ----
NM_182972chr122428 1062 --12839 1228
NM_182976chr11544 ------
NM_183002chr142216 107 ------
NM_183004chr1422863 221 131 ----
NM_183043chr132855 301 ------
NM_183044chr132855 301 ------
NM_183078chr643879 3715 3658 2624 ------
NM_183227chr631437 580 90 ------
NM_183244chr20----1390 --
NM_183246chr20----1390 --
NM_183323chr53742 377 55 ------
NM_183353chrX41146 402 313 241 ------
NM_183381chr34778 737 361 310 ----1281
NM_183383chr34778 737 361 310 ----1281
NM_183384chr34778 737 361 310 ----1281
NM_183393chr33834 290 158 ------
NM_183394chr33834 290 158 ------
NM_183419chr82343 141 --11092 2484 449
NM_183422chr131152 --1226 --
NM_194247chr264234 3983 3077 1689 701 31 14204 1683 --
NM_194278chr1473404 3286 1398 879 640 197 122 13865 11144 --
NM_194285chr1121259 964 1675 ----
NM_194291chr8147 23008 95 1120 12762
NM_194292chr131755 1259 1198 ------
NM_194301chr1431027 44 29 ------
NM_194314chr124786 4506 1845 24755 1354 --
NM_194318chr1372407 1959 1951 1002 949 816 510 ------
NM_194328chr92896 512 1416 32196 906 322 --
NM_194329chr92896 512 1416 32196 906 322 --
NM_194330chr92896 512 1416 32196 906 322 --
NM_194332chr92896 512 1416 32196 906 322 --
NM_194434chr1884486 3888 2317 1765 1629 888 725 121 --14677 11184
NM_194442chr161475 1309 1204 664 536 420 ------
NM_197941chr562886 2822 2677 2570 2383 351 ------
NM_197970chr211278 21424 465 1666 --
NM_198066chr1432943 2868 755 ------
NM_198123chr821288 711 --2611 311 --
NM_198124chr821288 711 --2611 311 --
NM_198128chr182765 757 --12093 --
NM_198158chr322125 233 12877 ----
NM_198159chr322125 233 12877 ----
NM_198177chr322125 233 12877 ----
NM_198178chr322125 233 12877 ----
NM_198181chr1522175 1837 --32800 340 307 12123
NM_198189chr21417 --2244 108 --
NM_198195chr3183 ------
NM_198215chr101536 ------
NM_198240chr1231387 526 67 1987 ----
NM_198261chr121534 --1711 --
NM_198262chr121534 --1711 --
NM_198268chr133758 2718 977 13138 24222 3623 --
NM_198269chr133758 2718 977 13138 24222 3623 --
NM_198270chrX62397 2230 1131 897 143 106 ----1232
NM_198273chr562488 1187 1093 625 495 359 --23093 2957 --
NM_198279chrX2811 186 ------
NM_198281chr452717 2630 1369 1052 304 ------
NM_198321chr552664 2409 1994 1245 740 --1615 --
NM_198324chr1231161 950 915 ------
NM_198353chr42136 23 ------
NM_198399chr311576 11535 ----
NM_198400chr1532608 2235 850 ------
NM_198401chr831678 1113 375 --1516 --
NM_198446chr11205 ------
NM_198465chrX62819 2615 949 897 405 289 ------
NM_198513chr821891 1624 ------
NM_198567chr51124 ------
NM_198569chr652658 2294 1730 229 207 ------
NM_198581chr2126109 6033 5958 5817 2621 2209 1855 977 505 423 393 233 31431 782 683 12076 --
NM_198793chr353770 3101 864 467 366 --11236 --
NM_198794chr1461379 1323 1248 1223 1102 519 11300 11317 --
NM_198829chr731386 513 174 --11481 --
NM_198844chr174917 883 184 97 11006 ----
NM_198859chr3114881 4865 4330 4197 4176 4129 3495 822 735 358 129 --1936 11701
NM_198889chr421073 338 --1211 2950 444
NM_198896chr112330 105 11668 --1229
NM_198900chr1287533 7452 7354 6794 6444 4894 2607 1780 --16712 --
NM_198904chr511420 11837 --11740
NM_198965chr121425 ------
NM_198966chr121425 ------
NM_198990chr742697 1259 1099 75 2481 439 ----
NM_199000chr72783 179 ----12067
NM_199003chr811551 1283 ----
NM_199044chr152800 2722 2024 189 138 --1975 --
NM_199053chr41234 ------
NM_199072chr742455 2071 1067 946 ----11222
NM_199132chr1921987 804 --11867 --
NM_199138chr131827 ------
NM_199144chr2021567 1247 ------
NM_199168chr1031324 295 167 1190 ----
NM_199185chr5----1307 --
NM_199188chr1212504 --23197 2515 1365
NM_199189chr51689 ------
NM_199190chr1212504 --23197 2515 1365
NM_199203chr2021567 1247 ------
NM_199320chr41531 22351 505 ----
NM_199320chr41531 22351 505 ----
NM_199321chr174917 883 184 97 11006 ----
NM_199324chr452879 1245 1174 757 633 ------
NM_199421chr1464473 3332 1741 1546 964 493 --21666 1066 --
NM_199436chr21766 ------
NM_199454chr144062 2959 1471 501 --24034 111 --
NM_199461chr1073529 953 830 592 551 455 99 --1335 --
NM_199464chr132102 90 ------
NM_199478chrX21628 1329 21691 661 1743 --
NM_199482chr21836 ------
NM_201263chr151787 1742 1358 1333 386 ----1406
NM_201266chr252700 2100 1032 959 609 --1676 --
NM_201269chr12991 244 ------
NM_201279chr252700 2100 1032 959 609 --1676 --
NM_201434chr172569 558 --1770 --
NM_201437chr831351 1273 176 11194 ----
NM_201439chr12----1134 --
NM_201440chr12----1134 --
NM_201515chr12----1134 --
NM_201542chr11114 1279 ----
NM_201545chr131101 1045 385 ------
NM_201568chr11482 ------
NM_201569chr11482 ------
NM_201570chr1051751 666 351 154 59 ------
NM_201571chr1051751 666 351 154 59 ------
NM_201572chr1051751 666 351 154 59 ------
NM_201590chr1051751 666 351 154 59 ------
NM_201591chr441672 1657 1494 158 --11241 --
NM_201592chr441672 1657 1494 158 --11241 --
NM_201593chr1051751 666 351 154 59 ------
NM_201596chr1051751 666 351 154 59 ------
NM_201597chr1051751 666 351 154 59 ------
NM_201613chr121334 ------
NM_201624chr131237 923 913 1829 ----
NM_201999chr4----1916 11174
NM_203282chr1911706 ------
NM_203301chr1431569 435 69 --1107 --
NM_203327chr20104074 4017 3745 3690 3589 3337 2968 1738 1026 497 --34153 4126 4024 --
NM_203349chr1552012 868 715 676 516 --22033 1862 --
NM_203350chr121127 175 ------
NM_203364chr111994 1944 ----
NM_203372chr211139 --1243 --
NM_203382chr521440 486 ------
NM_203394chr12----12123 --
NM_203399chr11258 ------
NM_203401chr11258 ------
NM_203406chr52894 644 1558 31788 1050 874 --
NM_203437chr2----1656 --
NM_203446chr2162963 2693 2591 2493 2471 517 ------
NM_203453chr931601 471 321 --1726 --
NM_203454chr12255 236 --2966 897 --
NM_203459chr12579 157 ----12089
NM_203463chr274229 3975 3644 1173 571 227 95 22991 1944 23132 3063 --
NM_203487chr1321453 131 31644 1314 598 ----
NM_203488chr14----1300 --
NM_203504chr462645 1594 1038 1024 774 609 21053 945 11666 --
NM_203505chr462645 1594 1038 1024 774 609 21053 945 11666 --
NM_205768chr131534 654 144 --1166 --
NM_205833chrX2789 247 ------
NM_205842chr21661 2591 170 ----
NM_205848chr132677 2497 158 ----11134
NM_205860chr142886 2808 2264 730 12585 13173 --
NM_206594chr152513 2470 1440 724 129 --12884 --
NM_206595chr152513 2470 1440 724 129 --12884 --
NM_206852chr141641 --1466 --
NM_206853chr643277 2515 375 66 ------
NM_206854chr674538 3776 1636 1327 676 594 200 --11186 13269
NM_206855chr685503 4741 2292 1641 1559 1165 779 770 --12151 14234
NM_206857chr141641 --1466 --
NM_206866chr2152652 2392 2262 834 55 1320 32243 2182 653 --
NM_206876chr232693 2631 762 ------
NM_206909chr8157507 6820 6592 5569 3163 3112 3009 2776 2447 2256 2216 2089 1676 1598 556 --27904 5385 12370
NM_207012chr1062711 2654 2186 953 715 426 --12207 --
NM_207042chr1----1673 --
NM_207045chr1----1673 --
NM_207046chr1----1673 --
NM_207292chr333200 3048 2596 --12414 --
NM_207293chr333200 3048 2596 --12414 --
NM_207294chr333200 3048 2596 --12414 --
NM_207295chr333200 3048 2596 --12414 --
NM_207296chr333200 3048 2596 --12414 --
NM_207297chr333225 3073 2621 --12439 --
NM_207299chr92925 812 ------
NM_207304chr1331989 1026 283 --1298 --
NM_207317chr51453 ------
NM_207321chr102463 424 --1999 --
NM_207325chr1972084 1666 1654 1645 1592 1391 607 ------
NM_207344chr1231370 1210 515 ------
NM_207371chr1011226 ------
NM_207372chr1031960 426 372 --21556 874 --
NM_207396chr121350 1187 --11838 --
NM_207405chr442070 1633 1581 799 22226 228 ----
NM_207406chr475373 4485 2624 1309 1102 954 474 --12431 --
NM_207445chr1541695 759 196 40 11369 ----
NM_207481chr211325 ------
NM_207517chr1541784 1466 1262 234 ------
NM_207645chr1121106 40 ------
NM_207647chr922254 179 --1870 --
NM_212474chr23815 768 72 --1250 --
NM_212475chr23815 768 72 --1250 --
NM_212476chr23815 768 72 --1250 --
NM_212478chr23815 768 72 --1250 --
NM_212482chr23815 768 72 --1250 --
NM_212539chr31311 ------
NM_213589chr245522 5501 5418 933 11725 ----
NM_213654chr311530 ------
NM_213662chr1752177 2035 479 422 25 ----1656