TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4728-5p
miRNA Sequence: UGGGAGGGGAGAGGCAGCAAGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5163 ------
NM_000018chr17----140 --
NM_000021chr141883 2695 134 --1905
NM_000024chr52437 372 ------
NM_000025chr83991 231 110 --21173 864 11162
NM_000037chr8102515 2189 2167 2074 2067 1768 1661 924 184 31 31824 1747 613 22169 551 22457 2196
NM_000051chr1133256 1225 701 --22217 2212 --
NM_000070chr154370 354 140 59 ------
NM_000074chrX2657 112 --1661 --
NM_000075chr123218 103 48 ----1188
NM_000080chr173919 610 248 1270 2836 91 --
NM_000081chr11320 1434 ----
NM_000084chrX86151 5850 5828 5363 4814 2471 1815 1458 55809 4358 4225 1772 1095 25414 2218 15867
NM_000088chr1751208 1169 1161 419 392 11267 21186 1125 31221 407 31
NM_000089chr7--197 1193 --
NM_000092chr273550 3473 3073 3013 2919 2824 1485 1203 1991 --
NM_000093chr952189 2141 968 726 106 12277 2541 110 1116
NM_000104chr2--1402 ----
NM_000127chr8--165 ----
NM_000129chr641363 1181 462 210 21421 218 ----
NM_000135chr163845 388 263 ----1273
NM_000141chr102306 183 2943 77 --1245
NM_000153chr1421674 41 ------
NM_000163chr531625 721 621 21760 1592 ----
NM_000165chr631096 533 300 ------
NM_000166chrX5597 153 135 118 66 124 4249 139 123 60 --
NM_000167chrX3295 265 135 21464 1324 ----
NM_000168chr762637 2491 2239 2153 766 244 22114 772 --12807
NM_000170chr9141 180 143 --
NM_000176chr513085 11101 13517 --
NM_000188chr102486 30 --2492 206 170
NM_000192chr122532 311 1982 ----
NM_000202chrX52692 2613 2491 2451 235 11026 53938 2768 2718 2482 2414 22697 43
NM_000212chr1761967 1924 978 762 541 276 3849 742 408 1551 --
NM_000216chrX2620 114 --13175 --
NM_000217chr12105222 4938 3654 3449 3353 1956 1695 1003 827 316 --23358 1602 14062
NM_000238chr71129 ------
NM_000248chr322382 509 1778 12388 --
NM_000258chr31243 153 --1166
NM_000259chr1574673 4519 4143 2425 1916 405 143 32417 2249 114 45018 4887 4546 4238 14627
NM_000264chr943133 1058 820 284 11175 32076 1215 1086 --
NM_000266chrX1113 ------
NM_000267chr1743475 3458 1124 388 22426 2142 32935 887 62 12862
NM_000271chr18--1224 ----
NM_000276chrX22129 1957 2784 355 2435 152 1300
NM_000280chr111688 ------
NM_000284chrX21754 794 ------
NM_000303chr1651311 1169 948 496 235 41453 1321 1266 78 1356 --
NM_000304chr1721037 411 --1385 1416
NM_000314chr1012424 ------
NM_000318chr83806 559 527 62749 2033 2020 1907 1894 692 --11874
NM_000319chr12----3989 69 67 --
NM_000322chr631206 238 66 21162 98 3267 128 24 --
NM_000330chrX12018 1440 ----
NM_000332chr696511 6288 5482 4887 2869 938 610 498 441 16711 25911 34 12325
NM_000333chr341128 449 395 112 --1399 --
NM_000334chr1762085 1959 1937 1855 411 271 11896 102205 2104 2087 1972 1942 1807 1797 1782 413 292 --
NM_000335chr331548 847 95 11567 21898 852 21536 527
NM_000337chr596062 5275 5265 5176 4919 4653 1256 705 533 25429 1301 12147 --
NM_000345chr42867 182 ------
NM_000346chr1721947 303 ----11924
NM_000353chr165810 417 248 200 177 21082 843 1252 --
NM_000361chr2031812 440 48 1575 22123 108 1521
NM_000362chr22193546 2884 2687 2679 2214 1454 1392 1291 845 821 416 410 396 371 360 195 175 50 29 53407 2908 832 388 70 53006 1210 823 37 33 13126
NM_000365chr122322 111 --3377 324 26 1380
NM_000368chr994241 3810 3695 3012 1158 1132 929 913 716 --34361 4356 196 2457 221
NM_000378chr113782 80 72 --1321 --
NM_000386chr173563 228 24 129 ----
NM_000388chr341152 1031 853 336 1481 --1883
NM_000389chr681430 1118 531 360 330 286 261 124 21482 1342 41138 979 600 290 1382
NM_000391chr11101664 1446 1183 1145 1116 1081 528 253 194 125 --41578 1191 477 255 --
NM_000399chr102421 330 --2103 99 --
NM_000411chr2173069 2813 2448 2243 2044 666 89 --1253 32454 1229 232
NM_000421chr171126 ------
NM_000423chr121172 ----246 31
NM_000424chr12--127 ----
NM_000425chrX2711 589 2715 211 4170 122 59 55 --
NM_000430chr1743039 2336 1347 838 13433 23062 23 --
NM_000435chr1910746 718 646 630 284 266 251 244 79 56 1297 1121 1218
NM_000439chr51136 11615 ----
NM_000442chr171513 --1225 --
NM_000445chr84883 726 704 235 2308 95 2833 299 1774
NM_000448chr1121010 47 12006 ----
NM_000449chr141255 1058 1016 62 11358 --11063
NM_000450chr141464 390 95 77 --1326 --
NM_000451chrX82034 1884 1385 1353 538 459 250 96 41772 1522 653 563 ----
NM_000452chr1311888 11760 ----
NM_000458chr174678 223 197 64 1917 3680 631 629 1226
NM_000461chr394279 4133 3583 3308 2965 2873 1312 1157 1095 1879 33339 1710 1222 21232 585
NM_000462chr151166 ----1410
NM_000474chr71526 ------
NM_000478chr15663 649 172 161 94 150 2467 216 --
NM_000484chr2121051 294 ------
NM_000489chrX33068 798 295 1265 13045 --
NM_000493chr61195 1858 1151 --
NM_000495chrX1954 ------
NM_000503chr811385 ------
NM_000505chr5----127 --
NM_000508chr4--3824 727 329 ----
NM_000516chr20----1120 1235
NM_000522chr72838 137 --1139 --
NM_000523chr23821 268 141 ------
NM_000525chr1151481 1145 1052 564 107 1206 31234 237 235 --
NM_000530chr13358 304 271 ------
NM_000533chrX2758 107 2257 71 21830 175 --
NM_000542chr22258 77 1327 2153 141 --
NM_000555chrX137663 7648 5659 5033 4994 4934 4853 2777 2764 2701 2574 1619 711 56979 5901 5177 5002 2052 77002 7000 6996 6994 5627 2705 1958 --
NM_000557chr202390 350 1363 150 --
NM_000567chr14897 769 79 31 2964 891 1163 --
NM_000572chr12409 115 ------
NM_000578chr261769 1733 1631 1214 464 168 21717 678 11310 --
NM_000599chr2164314 4105 4050 3979 3531 3482 3464 2994 1678 1458 1449 1275 610 567 550 67 23190 2918 33291 640 552 23471 36
NM_000609chr10122795 2783 2614 2557 2488 2314 2162 2081 852 627 500 82 12993 --12665
NM_000611chr11136844 6326 5308 5291 4820 4726 2537 2396 2173 1723 957 407 256 35251 5057 25 46337 6197 2184 2043 --
NM_000612chr11153666 3630 3616 2874 2606 2360 628 521 509 342 246 179 167 149 50 --83679 3552 2902 2900 2895 2418 320 258 --
NM_000618chr12135642 5600 5412 5380 5286 4944 4658 4222 2563 1262 532 497 350 75835 5547 5114 2619 2332 1066 297 14786 --
NM_000618chr12135642 5600 5412 5380 5286 4944 4658 4222 2563 1262 532 497 350 75835 5547 5114 2619 2332 1066 297 14786 --
NM_000620chr1292135 2069 1952 1876 1867 1697 1400 505 99 32026 1534 721 4826 255 168 130 --
NM_000621chr1321433 1284 ------
NM_000633chr1894827 4796 3397 3379 3182 1211 1167 1045 560 25043 3419 11262 13193
NM_000635chr1951582 1399 600 445 21 --2447 290 1453
NM_000637chr82478 446 ------
NM_000638chr17129 --156 --
NM_000660chr191230 --3222 218 212 --
NM_000665chr72194 25 --1173 --
NM_000684chr101808 139 ----
NM_000687chr204284 199 56 25 ------
NM_000706chr121635 ------
NM_000719chr12186605 6332 6315 6279 5886 5706 5671 5329 5198 4480 4213 2657 2506 2048 1853 407 308 164 25781 4448 86458 6320 5200 4458 4228 2357 2140 250 22146 253
NM_000721chr1112118 2098 1894 1835 1816 1687 1048 524 434 310 299 --32655 1737 1733 32121 2084 313
NM_000723chr17111640 1624 1557 1226 1206 613 606 449 361 274 106 41405 496 369 258 61294 1286 1282 1099 491 110 1289
NM_000724chr1031453 1226 225 21435 1386 ----
NM_000725chr125940 780 639 258 190 1268 --1332
NM_000726chr221101 952 ------
NM_000738chr114903 842 132 24 2940 113 2786 782 --
NM_000757chr18891 883 876 296 165 110 90 37 1741 4893 734 319 78 1333
NM_000767chr1941563 1397 340 326 31120 1070 476 1126 --
NM_000795chr116921 758 320 310 107 41 21119 35 1936 2942 265
NM_000800chr54514 422 361 283 ----1670
NM_000801chr2041007 995 966 191 --11064 --
NM_000809chr4149273 8552 7655 7531 6857 6829 5907 5762 3605 3581 3332 2843 2648 579 12588 26065 3199 --
NM_000810chr152391 82 ------
NM_000813chr533811 1167 39 ------
NM_000814chr1543938 3640 2818 524 13914 23940 1674 --
NM_000816chr52520 426 --1170 --
NM_000817chr22238 45 ------
NM_000824chr41387 ------
NM_000826chr41959 ------
NM_000827chr5102166 1841 1834 1613 1599 858 569 557 463 64 21871 911 1629 --
NM_000831chr1135404 5258 4825 4743 4391 4154 3979 1261 525 295 263 194 135 35925 5294 394 75575 5533 4422 4103 3841 1767 1068 11627
NM_000833chr1621266 1226 21012 557 ----
NM_000834chr1271298 1261 897 317 216 208 188 ----1267
NM_000836chr196992 933 853 819 791 724 1742 2698 627 1939
NM_000837chr85438 365 208 130 85 1530 5411 406 369 142 90 --
NM_000838chr61560 21016 47 ----
NM_000841chr62723 347 --7851 610 598 596 314 310 256 --
NM_000842chr111655 ------
NM_000855chr11127 ------
NM_000864chr11960 --2952 271 1825
NM_000868chrX32356 292 272 --2260 256 --
NM_000870chr53652 559 204 1240 21307 425 --
NM_000872chr10--21323 312 ----
NM_000875chr15156448 5966 5867 5842 4780 4416 4372 2799 1580 858 845 610 336 325 97 24749 1854 64800 1720 1582 1337 1335 316 1959
NM_000876chr61172 --1379 --
NM_000880chr8148 ------
NM_000883chr73619 227 68 --1483 --
NM_000883chr73619 227 68 --1483 --
NM_000891chr1733138 1122 663 ------
NM_000894chr19--265 22 ----
NM_000902chr352386 2321 2303 2038 1293 32914 1973 484 --12899
NM_000914chr62302 139 ------
NM_000924chr1261144 1086 1020 865 468 366 1321 41195 1127 972 167 --
NM_000933chr201314 ------
NM_000935chr311067 ------
NM_000939chr2--186 265 31 --
NM_000944chr41673 11556 ----
NM_000960chr191800 --1499 --
NM_000961chr20123728 3301 2904 2872 2438 1107 1035 636 594 529 358 120 63798 3467 3334 3038 133 67 ----
NM_000962chr972638 2281 2059 2022 1042 933 209 12305 22156 1921 --
NM_000964chr1771311 1262 1174 973 410 306 35 --41335 1228 127 105 --
NM_000965chr321058 954 ------
NM_000966chr1241041 939 681 673 3756 300 64 91024 929 882 744 740 338 173 105 103 2711 116
NM_000984chr171437 ------
NM_001001132chr2131367 1289 1031 11253 ----
NM_001001323chr121162 --1170 1173
NM_001001331chr362311 2217 2058 1842 899 353 --31904 1874 267 --
NM_001001342chr1031312 1072 983 21300 1281 --11062
NM_001001344chrX32412 887 584 11690 11638 --
NM_001001395chr121963 --12661 --
NM_001001433chr2062736 2698 2667 475 148 42 --1153 13051
NM_001001481chr832820 2614 2230 122 ----
NM_001001484chr1031710 957 298 ------
NM_001001502chr53239 112 91 ------
NM_001001522chr112320 160 --134 --
NM_001001523chr141230 534 51 26 1539 21260 28 1919
NM_001001549chr772019 1906 852 601 550 541 205 ----1604
NM_001001550chr772019 1906 852 601 550 541 205 ----1604
NM_001001555chr772019 1906 852 601 550 541 205 ----1604
NM_001001557chr811588 ----3661 554 172
NM_001001560chr222159 127 1748 1165 --
NM_001001661chr72601 502 ------
NM_001001664chr262855 2556 1202 1113 502 46 ------
NM_001001684chr1721983 748 32135 1786 226 ----
NM_001001740chr11200 --197 --
NM_001001740chr11200 --197 --
NM_001001787chr1186 ------
NM_001001890chr2194246 4167 3993 2943 2855 2812 1111 177 67 13478 54172 4084 2859 2794 2790 --
NM_001001924chr861870 1482 1429 1386 463 205 11714 11488 --
NM_001001925chr861870 1482 1429 1386 463 205 11714 11488 --
NM_001001931chr861870 1482 1429 1386 463 205 11714 11488 --
NM_001001936chr1041141 953 482 327 1913 ----
NM_001001995chrX--1161 --1554
NM_001002009chr72178 26 ------
NM_001002010chr72178 26 ------
NM_001002018chr16386 39 31 --191 125
NM_001002031chr12131 ------
NM_001002033chr172698 41 ------
NM_001002233chr862126 1863 1361 691 380 114 --21448 774 --
NM_001002243chr21359 --151 --
NM_001002252chr12287 30 165 ----
NM_001002257chr252479 1112 666 561 423 --1458 12484
NM_001002296chr8178 1504 ----
NM_001002762chr10132589 2375 2300 2261 2085 2034 1185 981 633 531 250 240 224 --42036 966 828 515 22625 2042
NM_001002814chr893798 3792 3612 3322 1361 1005 691 380 114 33629 3089 2911 21448 774 13618
NM_001002838chrX51787 706 668 466 440 11676 1674 --
NM_001002860chr1484287 1680 1547 1497 1194 620 552 518 11864 11499 --
NM_001002909chr1792118 1639 1546 1405 1387 372 344 273 204 32073 1593 209 2316 222 21918 1910
NM_001003406chr2283216 3132 2959 2934 2857 2326 1253 454 21304 1227 22859 2647 23221 190
NM_001003652chr1888306 7643 6860 5947 5567 2866 2450 2225 38496 6296 939 12817 1207
NM_001003676chr114375 261 249 239 1735 5643 363 348 337 150 --
NM_001003682chr14561 536 476 413 ------
NM_001003694chr32569 46 --2434 148 --
NM_001003712chr1211116 ------
NM_001003760chr643448 1131 675 408 ----23489 288
NM_001003792chr31450 ------
NM_001003793chr31450 ------
NM_001003799chr74581 561 241 130 --1644 --
NM_001003800chr973399 3286 1512 1358 1328 1224 574 21108 862 11483 21301 1141
NM_001003809chr18176 --278 45 --
NM_001003810chr41156 ------
NM_001003940chr1573025 2822 2759 1428 1247 1176 1031 43550 3190 3015 428 73611 3584 2570 2506 2390 2388 1256 --
NM_001003942chr1573025 2822 2759 1428 1247 1176 1031 43550 3190 3015 428 73611 3584 2570 2506 2390 2388 1256 --
NM_001003943chr1573029 2826 2763 1432 1251 1180 1035 43554 3194 3019 432 73615 3588 2574 2510 2394 2392 1260 --
NM_001004065chr963351 2931 2559 1383 518 337 ----12860
NM_001004105chr5------166
NM_001004127chr133845 786 636 ------
NM_001004196chr3--1204 1802 --
NM_001004317chr651641 1222 1028 908 570 --31643 956 353 11225
NM_001004342chr1215817 5552 5074 4774 4619 4504 1907 1678 1613 1480 1315 815 795 776 737 702 683 607 455 437 382 85564 4390 1999 1912 1433 1348 1249 1241 105827 5822 1421 1408 841 837 750 746 710 706 --
NM_001004354chr95858 816 783 361 179 1220 9873 862 822 820 810 806 761 755 59 --
NM_001004356chr431550 1367 1267 ------
NM_001004358chr431550 1367 1267 ------
NM_001004360chr2--1585 11598 --
NM_001004419chr1254363 4355 4334 4315 4036 44160 3699 1332 273 24369 4367 --
NM_001004439chr1571077 921 480 352 280 154 131 11012 41020 942 926 511 --
NM_001004441chr5--11375 ----
NM_001004720chr24677 298 77 28 1150 ----
NM_001004722chr24846 467 246 197 1319 ----
NM_001005158chr3------1366
NM_001005159chr3------1366
NM_001005209chr22680 79 --2100 98 1182
NM_001005210chr1182524 2381 2309 2269 1605 545 228 22 3758 662 632 165 --
NM_001005242chr1221592 670 ------
NM_001005271chr1771123 1058 341 273 151 85 22 2304 278 4857 853 138 93 1994
NM_001005273chr1771123 1058 341 273 151 85 22 2304 278 4857 853 138 93 1994
NM_001005290chr12374 366 2210 109 ----
NM_001005335chr19--1210 ----
NM_001005336chr94451 178 106 67 --189 1496
NM_001005354chr121518 --121 149
NM_001005366chr121770 --1883 --
NM_001005375chrY21397 1379 197 ----
NM_001005377chr191113 --155 --
NM_001005386chr22204 99 ------
NM_001005404chr1743595 3360 2844 1567 2130 62 21335 969 --
NM_001005417chr13626 211 180 --3243 232 228 --
NM_001005463chr1042433 2012 1842 863 1716 11879 --
NM_001005473chr556304 5640 5462 1476 850 14923 22305 374 14837
NM_001005505chr32377 241 1458 41167 326 100 64 --
NM_001005527chr31231 --1169 --
NM_001005609chrX93669 3633 3447 3390 3031 2675 2373 1032 415 53465 3452 2418 1423 604 21404 35 --
NM_001005739chr2--1638 ----
NM_001005743chr1441177 397 367 251 ------
NM_001005744chr1441177 397 367 251 ------
NM_001005745chr1441177 397 367 251 ------
NM_001005746chr221101 952 ------
NM_001005747chr221101 952 ------
NM_001005782chr21203 --1216 --
NM_001005785chrY21397 1379 197 ----
NM_001005786chrY21397 1379 197 ----
NM_001005849chr171564 --1140 --
NM_001005910chr31499 ------
NM_001005911chr31499 ------
NM_001005920chr1651088 820 722 357 317 --1824 --
NM_001006115chr382250 2127 2036 1792 1750 683 407 392 21885 877 52356 2352 2237 1126 30 2722 196
NM_001006617chr91909 --11096 --
NM_001006619chr91909 --11096 --
NM_001006620chr91909 --11096 --
NM_001006621chr91909 --11096 --
NM_001006634chr162518 23 ------
NM_001006641chr93407 397 378 31508 532 518 1195 21570 1197
NM_001006642chr93407 397 378 31508 532 518 1195 21570 1197
NM_001006643chr93407 397 378 31508 532 518 1195 21570 1197
NM_001006657chr223035 2989 12579 22840 243 --
NM_001006665chr1--160 1172 --
NM_001006946chr281645 1424 612 297 124 106 86 23 11650 1299 --
NM_001007024chr17133752 3736 3518 3116 1771 1309 1074 615 535 476 459 430 255 3847 740 719 6448 446 442 440 436 434 --
NM_001007025chr17133752 3736 3518 3116 1771 1309 1074 615 535 476 459 430 255 3847 740 719 6448 446 442 440 436 434 --
NM_001007067chr811012 --184 --
NM_001007068chr811012 --184 --
NM_001007069chr811012 --184 --
NM_001007070chr811012 --184 --
NM_001007156chr1561761 1685 1677 1643 422 54 21842 1765 21223 198 1433
NM_001007226chr1741419 1298 1031 1025 ------
NM_001007227chr1741419 1298 1031 1025 ------
NM_001007228chr1741419 1298 1031 1025 ------
NM_001007229chr1741419 1298 1031 1025 ------
NM_001007230chr1741419 1298 1031 1025 ------
NM_001007237chr142680 2515 1939 168 --21960 50 --
NM_001007257chr1--11031 --11416
NM_001007271chr104852 765 374 168 ----1189
NM_001007277chr116778 428 249 236 194 76 ----1447
NM_001007471chr9155 ------
NM_001007544chr11427 --1352 --
NM_001007553chr141114 1008 144 77 --191 --
NM_001007559chr1821738 73 41874 1707 698 91 ----
NM_001007565chr31276 149 ----
NM_001008220chr5123485 3316 3253 2628 2586 2533 1032 638 304 166 142 120 23629 3608 4884 882 591 155 --
NM_001008222chrX21169 999 2560 381 41105 1015 319 295 --
NM_001008223chr123510 57 34 --3460 119 40 --
NM_001008239chr1852898 2822 1391 299 148 1594 32505 790 142 139
NM_001008392chr363575 2691 2323 343 316 22 23379 2640 23410 1159 --
NM_001008407chr761796 1449 564 531 288 194 ----1655
NM_001008408chr7116056 5943 5797 5630 5618 5598 4151 4130 4021 762 101 46206 5756 1381 680 75620 5493 5489 4071 4067 3942 3930 15592
NM_001008495chr81505 --1753 --
NM_001008541chr101707 1195 22255 388 --
NM_001008541chr101707 1195 22255 388 --
NM_001008566chr222440 368 ------
NM_001008660chr112595 256 ------
NM_001008701chr19152934 2741 2504 2492 2478 1228 1181 871 861 816 658 505 436 331 112 32946 1246 666 112966 2962 2839 2753 2284 2020 1193 889 688 322 317 1325
NM_001008726chr1421691 1650 ------
NM_001008738chr512346 42928 2359 2058 1892 11053 11058
NM_001008744chr1421249 85 21501 1494 ----
NM_001008777chr171231 ------
NM_001008800chr1146 ------
NM_001008801chr1911542 41715 1581 1549 29 ----
NM_001008883chr1146 ------
NM_001009184chr85438 365 208 130 85 1530 5411 406 369 142 90 --
NM_001009185chr51722 1736 ----
NM_001009552chr81504 ------
NM_001009554chr433428 1828 887 11509 11757 --
NM_001009554chr433428 1828 887 11509 11757 --
NM_001009555chr421437 506 1711 ----
NM_001009566chr161415 1323 1065 292 223 177 2256 61 31118 1116 120 --
NM_001009571chr731705 1637 1557 11356 11561 --
NM_001009598chr1244 29 ------
NM_001009880chr22134808 4546 4373 4310 4156 3588 1905 1805 1731 887 503 261 191 21253 830 53641 1568 1498 1087 195 --
NM_001009955chr11112 ----2529 134
NM_001009955chr11112 ----2529 134
NM_001009960chr722160 162 42540 2038 918 906 ----
NM_001009996chr31198 ------
NM_001010861chr112682 ------
NM_001010867chr1195666 5657 5605 5405 5258 2603 2596 2275 2101 1759 1598 1460 1390 807 788 654 642 202 75 65393 2633 2323 2070 1583 619 --25942 815
NM_001010888chrX24080 1408 31254 668 533 54492 4103 4093 3748 3744 14085
NM_001010891chr535506 2586 1792 55202 5170 2756 2619 1370 --15338
NM_001010895chr91638 --1456 --
NM_001010924chr102332 249 --1993 --
NM_001010926chr12113 57 --179 --
NM_001010934chr72966 238 ------
NM_001011551chrX1460 ------
NM_001011553chr71627 ------
NM_001011658chrX31374 702 670 31407 504 340 ----
NM_001011663chr10--1290 ----
NM_001011666chr7106358 6002 5954 4759 4445 2466 1718 1449 1417 572 35053 1579 1437 34783 4513 2471 25957 1264
NM_001011708chr232794 1155 1119 12562 22024 1159 11130
NM_001012264chr149935 764 668 633 390 237 225 210 86 1787 --2244 117
NM_001012300chr121226 --2214 30 --
NM_001012329chr192214 2154 1913 1583 704 493 343 331 101 21577 1538 52158 2094 1663 1554 107 11718
NM_001012338chr15262 40 --147 167
NM_001012393chr1174587 4184 4162 1358 891 608 294 1627 33210 958 275 34168 3218 1016
NM_001012398chr161960 ------
NM_001012415chr93730 661 217 ------
NM_001012426chr6173353 3290 3074 3024 2994 2393 1362 1328 1178 1059 960 886 708 567 494 278 66 62800 2662 2630 2127 1084 899 202877 2482 2464 1373 1246 1242 1187 1111 962 947 920 906 796 459 325 308 258 247 86 41 43346 2997 1076 46
NM_001012427chr6173353 3290 3074 3024 2994 2393 1362 1328 1178 1059 960 886 708 567 494 278 66 62800 2662 2630 2127 1084 899 202877 2482 2464 1373 1246 1242 1187 1111 962 947 920 906 796 459 325 308 258 247 86 41 43346 2997 1076 46
NM_001012514chr24905 155 137 128 --276 69 --
NM_001012516chr24905 155 137 128 --276 69 --
NM_001012614chr4--1242 ----
NM_001012644chr202127 45 166 ----
NM_001012732chr451090 1050 903 347 260 --1867 --
NM_001012751chr10--1508 ----
NM_001012755chrX104599 4572 4355 1377 1303 1271 370 359 214 45 41582 1441 1087 496 34414 3145 986 --
NM_001012968chrX1815 2386 349 4577 573 567 326 --
NM_001012977chrX61315 1158 920 287 187 177 --9523 492 488 208 202 198 159 147 81 --
NM_001012989chrX1607 --1250 --
NM_001013031chr1052403 1304 816 683 483 1866 2234 232 22670 2420
NM_001013415chr411426 --156 --
NM_001013438chr31271 ------
NM_001013439chr31117 ------
NM_001013615chr16958 466 334 302 75 58 2481 322 1792 --
NM_001013620chr1267203 2944 2912 1694 1550 1023 57542 6007 5994 3080 754 ----
NM_001013624chr174908 352 295 53 41027 983 197 162 21151 182 --
NM_001013635chr1271216 1123 1011 893 831 453 294 --41155 1149 1048 27 21117 297
NM_001013690chr12162397 2361 2182 1935 1806 1758 1619 876 654 528 500 486 463 374 363 38 1936 82368 2363 2121 904 477 473 409 357 31746 1625 1601
NM_001013693chr182493 2451 2163 2154 1972 1830 733 89 --42245 429 235 205 22475 2157
NM_001013693chr182493 2451 2163 2154 1972 1830 733 89 --42245 429 235 205 22475 2157
NM_001014434chr1--1774 ----
NM_001014435chr165566 511 247 180 88 --2414 112 --
NM_001014443chr11237 1182 ----
NM_001014794chr11291 63 1210 ----
NM_001014795chr11291 63 1210 ----
NM_001014797chr10157729 7603 7448 7236 7206 5645 5584 2769 2515 2352 1632 1460 1216 1050 437 23155 2943 37738 7240 2337 17608
NM_001014809chr43825 756 624 --1251 1295
NM_001014839chr161036 907 821 424 106 65 --21040 94 --
NM_001014841chr161036 907 821 424 106 65 --21040 94 --
NM_001014987chr162402 366 ------
NM_001014988chr162402 366 ------
NM_001014989chr162402 366 ------
NM_001015045chr46961 575 548 461 357 115 ------
NM_001015048chr1432188 1036 975 --13148 --
NM_001015049chr1432188 1036 975 --13148 --
NM_001015053chr17121542 1451 1408 1266 1232 1116 523 414 324 272 190 21 1214 41494 555 237 121 --
NM_001015508chr82702 102 1630 1707 --
NM_001015877chrX1657 23006 816 ----
NM_001015882chr9----2793 155 --
NM_001017368chr1752489 2202 444 407 309 1164 2931 336 22219 1732
NM_001017371chr211087 1876 ----
NM_001017392chr197989 925 869 370 273 251 214 ------
NM_001017395chr373139 1050 1013 963 676 416 33 --23082 418 --
NM_001017424chr13740 504 271 1580 1530 --
NM_001017425chr13740 504 271 1580 1530 --
NM_001017440chr7237614 7533 7449 7391 7345 6920 6552 6410 3029 2817 2371 2350 1960 1854 1740 1629 1601 1515 1093 882 849 510 72 57960 5583 2944 2650 737 42546 2250 2093 1605 46607 2096 1523 888
NM_001017916chr1771743 814 702 600 431 236 165 21714 706 51664 1393 775 758 329 1817
NM_001017917chr1771743 814 702 600 431 236 165 21714 706 51664 1393 775 758 329 1817
NM_001017920chr21127 ------
NM_001017923chr14----134 149
NM_001017926chr811816 ------
NM_001017930chrX11019 ------
NM_001017973chr5----125 --
NM_001017974chr5----125 --
NM_001017981chr22----3570 275 39 --
NM_001017995chr5184676 4594 4231 4206 4116 3627 3131 3050 1807 1622 1483 1428 1273 1167 936 736 317 274 53678 1823 648 478 138 64005 3375 3027 1672 1047 555 33630 1625 193
NM_001018005chr15157 123 ----
NM_001018050chr22133306 3252 3088 3015 2788 2763 2734 2692 2615 2366 1172 177 155 --62564 2524 2487 2352 2133 251 22739 2702
NM_001018052chr22133306 3252 3088 3015 2788 2763 2734 2692 2615 2366 1172 177 155 --62564 2524 2487 2352 2133 251 22739 2702
NM_001018054chr1----1483 --
NM_001018064chr941802 284 227 100 --1780 129
NM_001018070chr114255 235 44 32 --1265 147
NM_001018074chr513085 11101 13517 --
NM_001018075chr513085 11101 13517 --
NM_001018076chr513085 11101 13517 --
NM_001018077chr513085 11101 13517 --
NM_001018108chr15112032 1820 1507 734 727 654 214 173 78 34 26 --41827 1825 177 158 1217
NM_001018111chr741202 593 431 294 1587 33235 1056 610 1123
NM_001020658chr12449 441 --21411 131 11385
NM_001020658chr12449 441 --21411 131 11385
NM_001023567chr151577 1187 ----
NM_001023587chr3145 --11180 --
NM_001024094chr513085 11101 13517 --
NM_001024226chr1136 --1939 --
NM_001024227chr1136 --1939 --
NM_001024228chr1136 --1939 --
NM_001024401chr1692562 2433 2267 2060 1929 1877 1806 1771 362 42551 1095 962 401 102811 2082 2078 2015 2011 787 777 586 474 447 11880
NM_001024455chrX122694 2451 2444 2433 2408 2308 971 350 326 312 230 37 22596 769 21767 784 --
NM_001024463chr151847 ----1129
NM_001024666chrX2661 181 ------
NM_001024680chr241470 1410 1385 1349 ------
NM_001024807chr194346 218 40 21 ----1309
NM_001024808chr1292490 2128 1905 1037 823 536 492 478 404 32653 2321 865 42422 2364 737 732 --
NM_001024809chr1771311 1262 1174 973 410 306 35 --41335 1228 127 105 --
NM_001024845chr12885 421 1809 3867 862 780 --
NM_001024858chr14122949 2765 2690 2630 2553 2419 2045 1990 693 622 186 69 1444 112705 2634 2570 2562 2558 2285 2102 885 680 314 301 72506 2384 2109 890 717 627 307
NM_001024912chr193406 261 83 11199 3415 411 300 1474
NM_001024934chr62556 127 ----1559
NM_001024935chr62556 127 ----1559
NM_001024936chr62556 127 ----1559
NM_001024937chr177698 692 643 246 184 76 63 1202 9717 710 703 607 585 515 279 86 45 1253
NM_001024948chr122423 1273 1711 ----
NM_001025076chr1085047 4977 4904 4340 4269 2441 1110 394 25929 4922 65122 5030 4738 4280 4275 2255 15003
NM_001025077chr10126405 6335 6262 5698 5627 2468 1752 1212 1162 1052 222 163 27287 6280 66480 6388 6096 5638 5633 442 16361
NM_001025079chr353728 3096 1105 737 635 --21135 904 1662
NM_001025081chr1841191 626 322 308 31250 1035 487 51278 1195 1002 247 106 --
NM_001025090chr1841191 626 322 308 31250 1035 487 51278 1195 1002 247 106 --
NM_001025092chr1841191 626 322 308 31250 1035 487 51278 1195 1002 247 106 --
NM_001025101chr1841191 626 322 308 31250 1035 487 51278 1195 1002 247 106 --
NM_001025105chr5159 11382 21344 1333 --
NM_001025109chr14936 864 734 418 2788 389 6954 872 325 312 110 50 --
NM_001025205chr3292 28 --4113 97 68 41 1297
NM_001025233chr1232707 625 311 22089 1035 ----
NM_001025252chr842682 2673 2370 382 22883 655 ----
NM_001025253chr842682 2673 2370 382 22883 655 ----
NM_001025266chr3124398 4322 4027 3833 1900 1831 1700 1668 1610 1347 489 159 23968 3802 33958 1278 493 14401
NM_001025366chr651706 697 604 246 25 --31487 1417 606 --
NM_001025366chr651706 697 604 246 25 --31487 1417 606 --
NM_001025367chr651706 697 604 246 25 --31487 1417 606 --
NM_001025367chr651706 697 604 246 25 --31487 1417 606 --
NM_001025368chr651706 697 604 246 25 --31487 1417 606 --
NM_001025368chr651706 697 604 246 25 --31487 1417 606 --
NM_001025369chr651722 713 620 262 41 --41503 1433 1168 622 --
NM_001025369chr651722 713 620 262 41 --41503 1433 1168 622 --
NM_001025370chr651706 697 604 246 25 --31487 1417 606 --
NM_001025370chr651706 697 604 246 25 --31487 1417 606 --
NM_001025579chr1771175 1127 807 763 478 183 22 178 2819 121 --
NM_001025580chrX93668 3603 3257 3205 3195 391 333 319 33 44123 3480 1389 49 44115 395 383 364 14097
NM_001025595chr411559 ------
NM_001025603chr141255 1058 1016 62 11358 --11063
NM_001025780chr921033 1001 11164 ----
NM_001029858chr662843 2661 1312 853 841 132 11030 --12997
NM_001029860chr8--187 ----
NM_001029863chr662651 1159 996 977 431 34 ------
NM_001029864chr2072413 2086 1878 1606 1572 308 267 42131 969 835 822 32449 2122 371 --
NM_001029869chr5121 --141 --
NM_001029882chr13183 157 114 1122 --2171 75
NM_001029882chr13183 157 114 1122 --2171 75
NM_001029891chrX3602 182 58 --2740 40 168
NM_001029976chr8143 185 1148 --
NM_001029998chr431351 1128 368 ------
NM_001030006chr1792346 2308 2165 1982 945 640 604 298 22 32294 2253 214 22414 867 --
NM_001030007chr1653631 2717 1060 392 184 33088 2837 2472 12821 1267
NM_001030055chr1424032 836 --14422 11481
NM_001030059chr101301 1339 ----
NM_001031679chr1262805 2726 2658 2628 2240 1249 --23156 2730 --
NM_001031680chr192009 1957 985 747 632 473 421 277 21 --32112 2013 1867 --
NM_001031685chr11383 ------
NM_001031690chr7112864 2774 2739 2246 1178 1169 1124 941 819 409 133 62118 2043 1228 1189 1138 27 42758 2251 70 66 --
NM_001031695chr22125348 5093 4985 4932 4922 4379 4042 3906 1877 1295 608 600 --75200 5086 5081 4468 3910 3474 612 24996 1385
NM_001031702chr33830 595 89 ------
NM_001031732chr432784 2769 1138 32997 2894 1180 1658 --
NM_001031738chr21204 ------
NM_001031740chr12631 180 --11181 --
NM_001031804chr1653594 3518 3462 3264 446 31206 1149 778 ----
NM_001031812chr52944 559 ------
NM_001032221chr991503 1463 1390 1311 737 669 304 159 97 21352 58 51845 1593 1495 1416 695 11508
NM_001032279chr111338 --2340 50 --
NM_001032280chr671191 1178 1110 1060 226 200 59 --41476 454 177 93 127
NM_001032288chr2071308 1057 627 617 578 424 381 21235 400 4407 392 33 27 1550
NM_001032289chrX5764 336 235 190 109 --3174 70 50 1224
NM_001032293chr17--1120 ----
NM_001032296chr1352723 2280 840 392 53 22498 216 32849 2173 662 --
NM_001032380chr101131 1528 ----
NM_001033025chr131243 1234 1225 ------
NM_001033026chr192161 86 --2449 51 --
NM_001033045chr224369 99 1702 ----
NM_001033047chr461863 474 429 298 77 68 21873 245 31935 630 190 12294
NM_001033057chr321786 334 --1664 --
NM_001033059chr651552 799 667 650 408 --2656 654 --
NM_001033081chr161593 1585 1393 695 684 60 2615 244 5610 455 191 66 64 --
NM_001033082chr161593 1585 1393 695 684 60 2615 244 5610 455 191 66 64 --
NM_001033085chr21238 ------
NM_001033117chr3204786 4697 4556 4481 4437 4403 4303 4281 4111 1865 1857 1614 1478 1457 1345 1318 768 319 292 197 54045 1881 691 545 83 64395 3471 1568 1445 1327 1322 1814
NM_001033507chr1--21493 314 ----
NM_001033551chr17143740 3688 3134 2688 1647 1637 1433 1377 1086 1069 1055 329 241 22 41280 1090 258 150 154069 4054 3821 3712 3623 3365 3361 3191 2879 1129 593 432 428 417 221 21436 227
NM_001033561chr175808 799 327 298 110 1835 3826 337 314 --
NM_001033566chr17--1282 ----
NM_001033568chr17--1282 ----
NM_001033578chr81303 ----12033
NM_001033602chr1352402 2354 880 136 42 1507 --12430
NM_001033659chr1721454 1112 ------
NM_001033723chr852608 2465 1996 953 766 12517 ----
NM_001033756chr641640 631 538 180 --31421 1351 540 --
NM_001033756chr641640 631 538 180 --31421 1351 540 --
NM_001033859chr17----140 --
NM_001033925chr1011748 --2445 440 --
NM_001034025chr121240 2350 266 ----
NM_001034837chr51291 ----1745
NM_001034838chr51291 ----1745
NM_001034850chr5--1319 1136 --
NM_001034954chr1032453 1248 335 --1269 --
NM_001034955chr1032453 1248 335 --1269 --
NM_001034956chr1032453 1248 335 --1269 --
NM_001034957chr1032453 1248 335 --1269 --
NM_001035254chr9122115 1946 1821 895 831 729 661 644 392 333 118 82 21991 1883 52457 1726 734 555 188 2749 169
NM_001035256chr2--186 265 31 --
NM_001035260chr101456 ------
NM_001035511chr182134 1876 1448 747 721 714 660 170 --2754 752 --
NM_001035512chr182241 1983 1555 854 828 821 767 277 --2861 859 --
NM_001035513chr182241 1983 1555 854 828 821 767 277 --2861 859 --
NM_001035521chr22737 131 --2204 87 --
NM_001035534chr961376 1262 1048 1028 461 342 11010 81434 1180 1095 970 446 296 292 47 11248
NM_001037131chr231165 408 122 --31039 126 101 --
NM_001037132chr712140 --11696 172
NM_001037133chr712140 --11696 172
NM_001037164chr721786 202 --199 --
NM_001037317chr112682 ------
NM_001037332chr592253 2171 2116 2081 1791 481 344 259 124 4559 522 348 335 2583 493 1171
NM_001037333chr592253 2171 2116 2081 1791 481 344 259 124 4559 522 348 335 2583 493 1171
NM_001037335chr206880 768 191 124 108 76 2791 220 165 --
NM_001037553chr21134761 3333 1904 1822 1799 1266 1154 928 787 433 312 269 252 1187 24923 4919 --
NM_001037582chr43628 596 323 1461 ----
NM_001037954chr1133397 2445 1346 ------
NM_001038493chr251099 343 302 208 138 --1225 --
NM_001038707chr1101540 1446 839 828 454 448 440 174 165 112 1636 31431 190 86 11726
NM_001038707chr1101540 1446 839 828 454 448 440 174 165 112 1636 31431 190 86 11726
NM_001039348chr2------11001
NM_001039349chr2------11001
NM_001039350chr731281 1128 237 --41099 275 173 73 11102
NM_001039355chr144937 742 461 433 1962 122 --
NM_001039459chr73458 307 128 1227 3469 328 323 2295 29
NM_001039538chr2----21033 925 --
NM_001039547chr322719 2695 52867 2734 1869 1856 1216 47146 5111 2699 1244 1557
NM_001039550chr23748 88 79 --155 --
NM_001039570chr22214239 4198 4154 4130 4113 4036 3950 3826 3630 3531 3490 3420 1825 1307 1206 601 575 192 94 65 34 44182 3980 1840 139 74385 3283 1678 248 135 104 99 14438
NM_001039571chr22214239 4198 4154 4130 4113 4036 3950 3826 3630 3531 3490 3420 1825 1307 1206 601 575 192 94 65 34 44182 3980 1840 139 74385 3283 1678 248 135 104 99 14438
NM_001039574chr15915 869 688 339 302 1139 3906 902 891 --
NM_001039577chr1104489 3984 3926 3764 3526 3386 2875 1337 1285 78 34392 1447 738 13073 --
NM_001039580chr454527 4494 3548 1825 1290 --14499 14513
NM_001039582chrX1370 1361 4225 86 74 51 --
NM_001039583chr223419 210 122 --3227 222 218 --
NM_001039584chr223419 210 122 --3227 222 218 --
NM_001039585chr121611 48 23858 3646 11412 13447
NM_001039590chrX43839 3125 2879 1089 ------
NM_001039591chrX43839 3125 2879 1089 ------
NM_001039618chr1155316 5150 5079 307 234 ------
NM_001039690chr1662219 2201 2163 1587 1492 911 31814 591 449 1150 --
NM_001039711chr121051 193 --3901 895 169 187
NM_001039712chr121051 193 --3901 895 169 187
NM_001039762chr1031952 1559 933 1116 ----
NM_001039771chr146979 881 860 820 315 98 1889 41057 1053 1030 58 1219
NM_001039802chr111425 11041 2429 175 21320 183
NM_001039840chrX76000 5946 5924 5236 2343 1673 1037 --15684 1890
NM_001039877chr193845 764 743 --3614 180 164 2816 563
NM_001039888chr12792 663 ------
NM_001039916chr121239 --31023 347 193 2394 245
NM_001039917chr121239 --31023 347 193 2394 245
NM_001039918chr121239 --31023 347 193 2394 245
NM_001039919chr121239 --31023 347 193 2394 245
NM_001039920chr121239 --31023 347 193 2394 245
NM_001039937chr1343195 2862 1001 246 ----11497
NM_001039938chr131182 11507 ----
NM_001039960chr1261318 514 455 446 395 237 1303 ----
NM_001040001chr622035 346 21638 519 --1339
NM_001040002chr1791344 1068 1062 480 361 326 205 105 79 21251 330 187 --
NM_001040020chr721499 489 ----1528
NM_001040057chr7----11253 --
NM_001040110chr731454 1311 559 21466 576 31474 1462 597 --
NM_001040144chr1662219 2201 2163 1587 1492 911 31814 591 449 1150 --
NM_001040146chr1662219 2201 2163 1587 1492 911 31814 591 449 1150 --
NM_001040151chr11124390 4262 3830 3220 3144 1839 1487 1118 650 359 313 110 43998 3232 1254 826 43774 3767 773 269 --
NM_001040152chr753427 1706 1624 1271 343 35024 2049 1795 25054 5020 --
NM_001040158chr52387 71 ------
NM_001040159chr4180 ------
NM_001040167chr721046 734 11012 11025 --
NM_001040172chr53652 559 204 1240 21307 425 --
NM_001040173chr53652 559 204 1240 21307 425 --
NM_001040181chr31865 2397 73 1978 --
NM_001040182chr31865 2397 73 1978 --
NM_001040183chr31865 2397 73 1978 --
NM_001040199chr31865 2397 73 1978 --
NM_001040200chr31865 2397 73 1978 --
NM_001040214chr632217 205 64 1279 ----
NM_001040280chr61265 --11298 --
NM_001040284chr1645274 5177 4735 747 ------
NM_001040424chr2172881 2826 2091 932 910 856 279 ------
NM_001040429chr1323508 376 --167 --
NM_001040431chr172310 43 1318 ----
NM_001040439chr1671310 1140 938 552 440 142 98 31160 341 110 11122 --
NM_001040446chr561854 844 813 719 687 656 12112 1598 --
NM_001040450chr1522347 380 ------
NM_001040453chr1522347 380 ------
NM_001040458chr581688 734 676 644 609 474 453 113 --2725 440 --
NM_001040624chr852068 1914 1863 474 133 --1532 12351
NM_001040625chr852068 1914 1863 474 133 --1532 12351
NM_001040626chr852068 1914 1863 474 133 --1532 12351
NM_001040627chr852068 1914 1863 474 133 --1532 12351
NM_001040628chr852068 1914 1863 474 133 --1532 12351
NM_001040629chr852068 1914 1863 474 133 --1532 12351
NM_001040630chr852068 1914 1863 474 133 --1532 12351
NM_001040697chr111510 ------
NM_001040708chr811025 ------
NM_001040709chr1102283 1633 970 909 829 820 644 621 187 80 42481 882 753 539 4913 475 426 98 1170
NM_001040712chr92428 40 --12529 1431
NM_001040715chr1651001 954 816 457 181 1427 3377 373 232 --
NM_001042357chr102586 53 2226 22 ----
NM_001042358chr102586 53 2226 22 ----
NM_001042360chr102586 53 2226 22 ----
NM_001042361chr102617 84 2257 53 ----
NM_001042363chr102586 53 2226 22 ----
NM_001042364chr102617 84 2257 53 ----
NM_001042365chr102617 84 2257 53 ----
NM_001042368chr95567 315 181 132 79 184 2542 134 1328
NM_001042387chr102617 84 2257 53 ----
NM_001042388chr181106 ------
NM_001042389chr102586 53 2226 22 ----
NM_001042390chr102586 53 2226 22 ----
NM_001042392chr102586 53 2226 22 ----
NM_001042393chr102617 84 2257 53 ----
NM_001042395chr102586 53 2226 22 ----
NM_001042396chr102617 84 2257 53 ----
NM_001042397chr102617 84 2257 53 ----
NM_001042404chr141934 1755 502 289 ------
NM_001042413chr9124060 3822 1594 1133 1125 1111 1104 1091 1000 849 819 266 32981 2535 1587 13808 --
NM_001042424chr492779 2527 2290 1273 1157 1074 635 148 130 --12094 1291
NM_001042425chr671191 1178 1110 1060 226 200 59 --41476 454 177 93 127
NM_001042437chr2--3880 681 155 ----
NM_001042472chr204558 505 231 54 --2463 41 1422
NM_001042475chr61291 ------
NM_001042476chr1671997 1933 1829 706 477 369 363 52196 2178 1859 654 217 21788 1783 1122
NM_001042478chr1125 ------
NM_001042486chr2041528 1369 1224 471 --61560 1134 580 576 528 410 1173
NM_001042492chr1743475 3458 1124 388 22426 2142 32935 887 62 12862
NM_001042494chr1593640 3343 3331 2626 2594 1108 938 902 53 12771 11003 --
NM_001042495chr1593640 3343 3331 2626 2594 1108 938 902 53 12771 11003 --
NM_001042496chr1593640 3343 3331 2626 2594 1108 938 902 53 12771 11003 --
NM_001042497chr1593640 3343 3331 2626 2594 1108 938 902 53 12771 11003 --
NM_001042498chrX5901 372 327 246 85 1128 3311 207 187 1361
NM_001042506chrX51000 920 287 187 177 --101156 523 492 488 208 202 198 159 147 81 --
NM_001042510chr841407 1344 578 147 ------
NM_001042511chr841407 1344 578 147 ------
NM_001042533chr331086 497 129 ------
NM_001042537chrX22028 1533 1834 --11681
NM_001042539chr1651058 983 249 241 162 --41067 937 243 122 2167 103
NM_001042543chr411531 ------
NM_001042555chr1284276 4168 4143 4135 3034 1845 1212 533 13191 23041 2983 14146
NM_001042576chr201465 1168 ----
NM_001042599chr297611 7592 6716 6370 5512 2637 2599 2526 1956 45979 3038 2811 114 47060 5766 5473 61 --
NM_001042601chr32661 504 --12171 --
NM_001042603chr1245334 3910 1789 1546 2619 463 21550 1369 15116
NM_001042604chr314148 13466 ----
NM_001042632chr2092544 1928 1903 1806 1661 1576 885 533 365 11618 32316 1907 121 --
NM_001042633chr2092544 1928 1903 1806 1661 1576 885 533 365 11618 32316 1907 121 --
NM_001042646chr351551 731 103 64 49 21577 1388 41711 631 93 68 1121
NM_001042663chr171353 1330 1075 524 505 94 58 11008 --1348
NM_001042664chr171353 1330 1075 524 505 94 58 11008 --1348
NM_001042665chr171353 1330 1075 524 505 94 58 11008 --1348
NM_001042681chr172618 2399 2250 2156 344 268 204 ------
NM_001042682chr172618 2399 2250 2156 344 268 204 ------
NM_001042682chr172618 2399 2250 2156 344 268 204 ------
NM_001042683chr611186 ------
NM_001042724chr191270 1300 3757 565 533 1273
NM_001042728chr1241041 939 681 673 3756 300 64 91024 929 882 744 740 338 173 105 103 2711 116
NM_001042729chr13550 412 404 1544 123 --
NM_001042747chr13550 412 404 1544 123 --
NM_001042749chrX11815 1759 ----
NM_001042750chrX11815 1759 ----
NM_001042751chrX11815 1759 ----
NM_001043318chr14123711 3439 3392 3253 3167 3003 2725 1615 1376 1062 888 808 53282 2869 1598 1273 752 51488 1362 1095 814 501 --
NM_001043351chr151514 1483 784 177 33 11652 3420 141 137 --
NM_001044305chr61620 1286 ----
NM_001044385chr263805 3716 1332 1205 883 413 --13809 --
NM_001044722chr52944 559 ------
NM_001044723chr52944 559 ------
NM_001048183chr173717 3418 3230 2889 2679 1133 547 73773 3187 3043 3024 2846 2712 87 1318 --
NM_001077628chr11462 --3487 482 40 --
NM_001079874chr12306 124 1271 21866 129 21446 141
NM_001080418chr15578 538 475 212 165 --1540 1453
NM_001083620chr41958 ------
NM_001083621chr1104460 3817 3270 989 856 562 545 230 74 27 33394 1181 659 74618 4492 1316 806 522 500 234 14497
NM_001087chr21326 1402 1150 1329
NM_001092chr1782411 789 477 463 350 221 214 45 --31889 844 621 1495
NM_001094chr174577 342 203 29 --2667 581 --
NM_001095chr12111856 1719 1708 1494 1298 1272 466 366 276 162 73 21687 1284 71724 1667 1249 1223 1221 705 258 2487 369
NM_001096chr172169 48 ------
NM_001100108chr1138240 7470 6816 6652 6002 5852 1794 1571 1562 1422 1221 1155 793 57855 6444 2201 2154 708 26753 1101 17653
NM_001106chr3148001 7991 7172 6610 6274 2961 2816 2248 1837 507 494 487 460 309 17478 42252 520 515 511 --
NM_001113490chrX43478 3467 1346 772 --1657 12459
NM_001116chr16122343 2290 2144 2049 2032 1237 1141 1031 796 781 480 182 1768 42165 2038 196 98 --
NM_001117chr182758 741 11718 1760 --
NM_001122631chr111438 1446 ----
NM_001122679chr5163 ------
NM_001124chr114662 561 74 57 --1171 --
NM_001127chr227988 828 777 388 366 326 76 2885 402 2873 176 --
NM_001128chr1653631 2717 1060 392 184 33088 2837 2472 12821 1267
NM_001130chr191199 --3632 333 203 1639
NM_001131chr61369 --1339 --
NM_001140chr174478 226 202 59 2466 100 1114 182
NM_001144chr162199 29 ------
NM_001146chr831935 1758 103 11676 --1108
NM_001148chr411659 1530 ----
NM_001149chr101925 ------
NM_001153chr2--1128 ----
NM_001163chr961002 974 877 326 158 38 --51019 952 892 811 96 1333
NM_001167chrX34979 2538 400 15725 --26289 2110
NM_001172chr142611 147 1505 ----
NM_001173chr1424032 836 --14422 11481
NM_001174chrX1115 --11576 --
NM_001175chr12198 --174 --
NM_001177chr1241990 1855 1518 45 --149 --
NM_001183chrX3598 141 87 1232 --1185
NM_001186chr2123218 195 1442 1706 --
NM_001190chr192276 64 ------
NM_001191chr2061116 945 380 330 59 39 1482 51398 1337 1120 572 453 131
NM_001194chr194506 417 258 168 ------
NM_001198chr621902 550 1829 2844 806 1311
NM_001199chr8----1185 1205
NM_001200chr2021053 818 ------
NM_001201chr463749 2925 2727 909 595 506 12894 13612 --
NM_001204chr247393 5215 686 93 45319 1188 779 609 15219 24791 111
NM_001206chr942811 2784 1191 150 12349 1152 --
NM_001221chr41103 ------
NM_001222chr1051955 1695 1613 391 177 --31318 1260 166 --
NM_001225chr11----131 --
NM_001237chr41354 ------
NM_001237chr41354 ------
NM_001256chr173603 273 64 1548 ----
NM_001257chr163499 489 189 --1194 --
NM_001259chr756231 6097 5989 1127 922 26309 112 15463 --
NM_001265chr131317 --188 2192 94
NM_001273chr12399 71 44 --1181 --
NM_001275chr14----1275 --
NM_001277chr116861 817 808 757 749 68 --1691 1770
NM_001280chr19195 130 ----
NM_001282chr1792346 2308 2165 1982 945 640 604 298 22 32294 2253 214 22414 867 --
NM_001283chr72460 151 --2165 107 --
NM_001292chr152857 342 1892 ----
NM_001299chr192189 103 --288 86 --
NM_001300chr101128 ------
NM_001304chr1773593 2939 2622 1532 1200 642 170 124 1174 23303 2496
NM_001310chr1222442 2100 21063 703 22339 2105 --
NM_001313chr43825 756 624 --1251 1295
NM_001315chr64823 786 107 67 --11892 11878
NM_001319chr194836 414 313 231 ------
NM_001328chr4--1242 ----
NM_001329chr101611 1556 ----
NM_001331chr11102187 1736 1101 923 741 622 501 217 200 118 21749 229 1206 32021 1739 1111
NM_001332chr5----11249 --
NM_001343chr541451 693 357 327 2645 620 ----
NM_001351chr321371 1353 ------
NM_001352chr19134 ------
NM_001356chrX----1242 --
NM_001358chr41177 ------
NM_001364chr11184373 4300 4174 4006 3803 3709 3516 3341 3316 3288 3262 3188 3172 3121 3070 3042 932 294 21921 1514 1855 33194 937 393
NM_001365chr172109 97 1558 1322 1102
NM_001382chr115183 118 99 85 62 ------
NM_001383chr173598 253 31 ----1589
NM_001385chr8153 ------
NM_001386chr84873 842 208 77 2900 330 21583 1579 --
NM_001387chr583002 2925 2579 2441 2297 2269 2099 1009 22914 917 2803 225 11241
NM_001389chr211165 ------
NM_001390chr1863568 2680 1341 1318 1126 1001 130 22861 2427 --
NM_001391chr1821101 303 ------
NM_001392chr18166 ------
NM_001396chr211643 --21102 699 --
NM_001397chr1112307 2284 2277 2046 1991 1952 1826 1794 1035 984 708 12260 62557 2367 2300 2289 2021 499 1932
NM_001399chrX93669 3633 3447 3390 3031 2675 2373 1032 415 53465 3452 2418 1423 604 21404 35 --
NM_001401chr94385 219 56 35 ------
NM_001406chr17171648 1622 1484 1381 1158 555 534 498 475 451 440 273 218 126 118 53 38 41519 1149 565 374 41306 1162 412 194 1501
NM_001407chr371675 1546 1505 1441 419 379 99 11317 31657 1642 592 --
NM_001408chr1101497 1485 1295 1287 1102 1051 598 520 401 360 2394 382 41305 1263 42 37 2601 363
NM_001412chrX23166 3048 ----13064
NM_001417chr1231726 1302 37 21746 1469 31780 1778 521 --
NM_001418chr11------1666
NM_001418chr11------1666
NM_001419chr19103614 3590 3578 3519 1859 931 835 625 513 279 11867 33054 3035 1742 13607
NM_001420chr1972931 2708 2592 2510 1207 409 221 --102940 2830 2812 2581 2556 2554 2529 2520 1163 31 2387 22
NM_001421chrX91684 1613 1467 1436 1359 1335 1234 610 325 11262 51668 1471 1444 1442 1365 --
NM_001423chr1242082 526 450 241 ------
NM_001426chr25612 602 593 506 58 --136 --
NM_001427chr771726 1402 829 793 768 745 736 --3718 701 690 --
NM_001428chr1122 --152 --
NM_001429chr222907 236 ------
NM_001430chr251282 484 470 253 61 --2304 300 --
NM_001432chr421409 1195 ------
NM_001438chr161326 428 366 321 268 161 1221 2433 382 124
NM_001439chr131243 1234 1225 ------
NM_001447chr531031 938 529 1485 11242 11229
NM_001448chrX31173 503 382 --11440 --
NM_001449chrX31055 441 121 2362 134 2509 101 --
NM_001453chr631259 367 147 1394 31520 372 357 --
NM_001455chr684838 4086 3926 3654 3443 3149 1605 908 --1470 --
NM_001465chr521619 307 --11875 --
NM_001478chr125792 689 242 219 44 2820 344 3972 970 179 1222
NM_001493chrX4744 229 210 75 1774 2735 183 1505
NM_001494chr101141 ------
NM_001495chr86983 907 823 401 311 277 1145 1911 --
NM_001497chr982058 1112 1105 1027 1002 497 484 117 --21789 1122 186
NM_001500chr62227 29 ------
NM_001518chr71925 --1806 --
NM_001520chr162460 107 --2226 23 128
NM_001521chr22737 131 --2204 87 --
NM_001523chr19----1112 --
NM_001533chr19--1210 ----
NM_001542chr142680 2515 1939 168 --21960 50 --
NM_001543chr5134825 4441 4122 3870 3577 1602 1581 1568 1284 706 636 397 213 34221 3472 914 84722 4529 1872 1570 1395 1209 580 330 21923 811
NM_001546chr611246 ------
NM_001554chr1----1436 --
NM_001555chrX131 ------
NM_001560chrX72553 2168 1763 1707 1694 856 622 151 ----
NM_001584chr1111023 --21030 1025 11033
NM_001587chrX22129 1957 2784 355 2435 152 1300
NM_001604chr111688 ------
NM_001610chr113581 244 111 132 2677 21 --
NM_001616chr231369 828 577 23320 834 1269 --
NM_001634chr651552 799 667 650 408 --2656 654 --
NM_001642chr1131235 844 120 --1912 --
NM_001650chr1832697 2561 616 2557 60 --1683
NM_001654chrX4417 395 308 39 1335 ----
NM_001655chr1141529 441 299 271 21480 608 ----
NM_001658chr1136 --1939 --
NM_001659chr12132627 2076 2016 1815 1683 1087 755 748 446 380 285 154 145 11070 92503 889 671 591 416 414 272 159 78 11686
NM_001662chr72252 106 196 ----
NM_001663chr1412695 --2550 541 --
NM_001664chr31993 --1221 1946
NM_001665chr112575 198 --2426 37 --
NM_001668chr172123 2107 596 501 164 136 94 --52267 1524 105 100 96 --
NM_001677chr11724 ------
NM_001678chr17151730 1644 1635 1619 1608 1560 1553 1403 1323 668 639 562 497 304 29 21233 206 71698 1327 1191 726 583 447 73 11207
NM_001679chr3--171 ----
NM_001681chr121236 1127 ----
NM_001683chr362311 2217 2058 1842 899 353 --31904 1874 267 --
NM_001686chr12131 ------
NM_001690chr392543 2293 980 740 708 650 542 291 206 22502 875 ----
NM_001693chr831139 1044 964 1332 ----
NM_001694chr16--1343 152 --
NM_001699chr1941723 1692 1664 1458 31750 668 533 21639 154 3243 74 29
NM_001701chr921355 82 ------
NM_001702chr83555 520 481 1436 --1455
NM_001706chr3137 --1189 --
NM_001707chr73770 122 24 1578 ----
NM_001709chr11--1775 1867 --
NM_001717chr15--11480 2531 193 --
NM_001723chr62329 195 ------
NM_001730chr1311517 ------
NM_001730chr1311517 ------
NM_001731chr12--1277 ----
NM_001742chr711352 31216 202 86 ----
NM_001743chr23151 138 90 ------
NM_001753chr731408 730 663 --11212 --
NM_001754chr2194246 4167 3993 2943 2855 2812 1111 177 67 13478 54172 4084 2859 2794 2790 --
NM_001759chr12104936 4700 4382 4119 4094 4025 3998 3703 1418 1035 13436 73574 3373 3323 1871 1157 1062 1058 12134
NM_001760chr67829 817 730 390 213 116 62 --1801 1807
NM_001768chr25865 452 331 91 44 1433 167 --
NM_001773chr171302 1230 1100 970 247 70 59 41154 1025 86 64 71320 1238 476 416 119 76 47 1122
NM_001777chr353728 3096 1105 737 635 --21135 904 1662
NM_001782chr91231 1246 155 --
NM_001783chr19293 68 1386 1343 --
NM_001788chr71627 ------
NM_001789chr351404 1390 213 57 37 1145 11465 --
NM_001791chr111425 11041 2429 175 21320 183
NM_001802chr16148 1933 2788 783 155
NM_001806chr19--32867 1057 299 ----
NM_001810chr204690 553 223 125 --1699 --
NM_001821chr143896 1433 971 36 31718 1704 1197 ----
NM_001825chr51132 ------
NM_001830chrX53052 2908 2823 2694 1044 2982 743 11364 13509
NM_001838chr172850 33 1385 1122 2619 36
NM_001842chr91537 --4489 462 432 193 --
NM_001843chr122177 49 177 ----
NM_001844chr122320 149 --1154 1130
NM_001852chr14603 567 100 58 2542 264 1533 --
NM_001854chr11253 ------
NM_001859chr923262 87 1194 33526 3129 3007 13265
NM_001862chr2--184 ----
NM_001863chr19131 143 ----
NM_001891chr4----128 --
NM_001892chr5159 11382 21344 1333 --
NM_001893chr172301 120 ------
NM_001895chr2031004 383 277 2792 364 21018 53 1283
NM_001896chr16--136 ----
NM_001915chr1771743 814 702 600 431 236 165 21714 706 51664 1393 775 758 329 1817
NM_001920chr122771 654 --1656 --
NM_001921chr451090 1050 903 347 260 --1867 --
NM_001923chr112470 200 --365 59 33 --
NM_001927chr22681 106 --3697 692 129 --
NM_001933chr143985 462 58 1422 2191 187 --
NM_001936chr731281 1128 237 --41099 275 173 73 11102
NM_001937chr131010 904 118 ------
NM_001945chr561001 990 475 275 258 246 1143 11003 --
NM_001946chr12142 ------
NM_001949chr651145 1130 308 98 22 13047 184 --
NM_001951chr81129 ------
NM_001954chr64525 269 220 173 1591 6278 207 182 98 92 24 --
NM_001958chr20----129 --
NM_001964chr53335 185 131 11198 2190 136 --
NM_001965chr2190 --169 --
NM_001969chr1452938 2775 2542 967 50 ------
NM_001970chr172243 177 1108 6594 578 535 477 235 62 --
NM_001971chr12------129
NM_001975chr124794 245 119 44 1817 2767 182 --
NM_001990chr1----5157 153 149 145 23 --
NM_001995chr43545 521 321 ------
NM_001999chr51119 11337 ----
NM_002006chr495839 5437 5259 1844 1755 1502 1420 554 198 21465 729 ----
NM_002009chr1512397 1871 21804 1063 --
NM_002010chr131191 ------
NM_002015chr1363134 3059 2350 2326 2192 2119 --1140 12353
NM_002025chrX88353 7560 7545 6814 6242 3055 2519 915 15693 37565 7534 7528 18691
NM_002026chr211014 ------
NM_002028chr1481312 890 845 807 509 400 290 40 --1278 --
NM_002035chr1831284 798 171 23774 408 --11206
NM_002045chr33350 142 66 --493 58 41 36 --
NM_002048chr93222 197 183 1122 ----
NM_002060chr13486 200 169 --2372 75 --
NM_002062chr631276 466 188 21157 230 51562 1539 498 152 21 --
NM_002063chrX1788 ----1236
NM_002072chr94788 391 372 225 --3816 395 32 --
NM_002074chr151608 1367 552 231 111 ----11345
NM_002076chr1283235 2687 2440 2373 1298 1097 800 783 22852 2720 22535 2171 12540
NM_002077chr941918 1561 1547 152 22067 1518 1508 --
NM_002079chr101449 ------
NM_002080chr161833 1864 1223 --
NM_002083chr142245 119 ------
NM_002086chr1761941 1876 1850 1793 1662 499 1531 42034 1880 1423 254 31853 1668 135
NM_002087chr17496 79 68 55 --1209 --
NM_002092chr464802 4788 4644 4612 4050 2009 34406 4239 3933 44811 3763 3758 731 --
NM_002094chr161101 --1103 --
NM_002099chr421834 1545 ----11903
NM_002103chr195816 773 713 150 37 1263 ----
NM_002105chr114752 271 252 35 1769 4684 144 139 133 21019 906
NM_002114chr61456 --165 --
NM_002126chr1773804 3746 3061 2798 2782 1044 342 1314 53496 991 327 323 302 1242
NM_002128chr1312082 ------
NM_002135chr122386 364 --1411 --
NM_002138chr41156 ------
NM_002139chrX2600 135 --1611 --
NM_002141chr71585 --183 --
NM_002145chr17170 ----173
NM_002146chr1721368 929 --2148 144 1504
NM_002147chr173246 68 60 1229 4801 359 354 168 --
NM_002160chr91171 ------
NM_002161chr9----135 --
NM_002167chr1172 --1143 --
NM_002168chr15158 --194 --
NM_002181chr23667 640 496 2683 55 2238 23 --
NM_002187chr51957 ------
NM_002193chr231312 564 403 1612 ----
NM_002196chr205740 309 229 222 178 --1854 --
NM_002196chr205740 309 229 222 178 --1854 --
NM_002199chr4--1226 ----
NM_002204chr1731262 933 195 2530 361 41345 1339 1203 213 11311
NM_002205chr123269 222 118 --4941 837 181 120 --
NM_002206chr124333 174 141 36 1163 145 2413 144
NM_002214chr772245 1895 1282 1250 1092 1044 645 33562 1418 334 11408 --
NM_002220chr151328 --2364 282 --
NM_002221chr172960 2230 1029 586 431 45 38 12291 42888 2886 2247 104 1710
NM_002223chr1253944 3857 3716 2753 1326 43437 3224 1536 615 11328 --
NM_002226chr142719 688 1762 2882 744 --
NM_002228chr11943 11182 1197 --
NM_002229chr19--2160 59 2369 364 2188 140
NM_002230chr1711986 958 830 430 339 215 137 85 60 45 28 --1991 179
NM_002232chr13217 207 140 1963 3226 146 144 1850
NM_002240chr21232 23 1254 1168 --
NM_002241chr1112193 2030 1232 1016 609 392 226 197 118 109 44 52269 2089 1223 349 177 ----
NM_002247chr1031961 907 665 --11839 --
NM_002249chr12443 61 ------
NM_002253chr41996 1208 ----
NM_002254chr2112245 2054 1820 1725 1442 883 800 772 621 533 170 31571 649 410 --11728
NM_002264chr351258 1023 893 343 196 14409 11264 14554
NM_002265chr17--2307 50 11051 --
NM_002267chr132450 225 12157 --12048
NM_002268chr31770 --11622 --
NM_002270chr575450 5059 4551 4253 4040 1505 1408 24211 1669 23943 573 --
NM_002274chr173274 243 227 --1109 --
NM_002290chr621382 1024 ------
NM_002293chr182708 2414 1736 968 494 377 251 31 12164 1348 --
NM_002294chrX--162 ----
NM_002306chr141105 ------
NM_002310chr534808 1975 972 35500 5421 1048 35611 1885 1840 --
NM_002315chr111106 --1189 --
NM_002319chr761077 812 301 265 188 120 1218 5745 326 321 307 37 --
NM_002333chr1951265 981 822 435 102 --1257 --
NM_002334chr1161750 1515 1309 688 309 104 31990 693 115 1771 11486
NM_002336chr1264961 4301 1802 1423 745 632 12037 14965 --
NM_002355chr1211032 1571 21371 166 --
NM_002356chr642610 1944 176 41 --1181 --
NM_002359chr17163939 3821 3792 3756 3513 3321 3045 2822 2759 2728 1418 386 124 115 97 73 13827 32831 1129 102 13050
NM_002361chr191219 181 176 --
NM_002372chr5--2288 224 2586 582 --
NM_002373chr1551321 1310 977 482 331 --31286 268 164 --
NM_002374chr2----21033 925 --
NM_002375chr3132153 1830 1702 1604 1577 680 622 368 182 166 54 46 32 2344 82 101590 656 624 533 296 292 78 73 69 67 --
NM_002382chr1481308 1038 942 399 346 217 118 55 --2490 182 11041
NM_002383chr165881 806 350 72 64 2375 329 4890 760 299 66 --
NM_002384chr18--1395 1210 --
NM_002385chr1841191 626 322 308 31250 1035 487 51278 1195 1002 247 106 --
NM_002387chr573592 3429 1782 873 752 425 210 11917 3299 293 214 1757
NM_002390chr1761916 1637 400 228 207 118 --2563 364 --
NM_002397chr511788 ------
NM_002399chr152884 119 ------
NM_002401chr1741835 1737 783 644 2414 86 32350 1679 143 22360 647
NM_002403chr1----2163 33 --
NM_002406chr55932 702 352 170 96 1861 5766 744 412 392 29 --
NM_002419chr113532 452 409 ------
NM_002430chr2261992 841 826 616 258 84 --71733 749 452 61 43 37 22 1710
NM_002442chr1291728 1712 1567 1329 1278 1184 608 294 208 --101573 1571 1294 1292 441 342 308 243 241 104 11592
NM_002444chrX71730 1666 1435 1356 643 219 177 1576 3376 371 29 21314 499
NM_002465chr12130 1238 ----
NM_002466chr202391 94 1273 2355 124 --
NM_002473chr227447 416 153 125 115 80 53 1512 3285 209 82 3866 199 60
NM_002479chr12481 209 2535 81 1145 --
NM_002480chr121130 ------
NM_002499chr1521635 215 22049 697 1175 --
NM_002500chr21863 ------
NM_002501chr19244120 3936 3919 3900 3871 3261 3198 3126 2972 2901 1593 1574 1559 1546 1518 1497 1336 1223 897 798 618 473 352 180 --244056 3889 3728 3687 3220 3109 3105 3101 3097 3059 3006 2986 1407 1392 874 595 591 587 583 579 575 570 551 454 --
NM_002505chr62570 423 11272 --1396
NM_002506chr1242 32 --254 21 --
NM_002507chr1781919 1906 1745 1533 1277 490 237 186 31397 766 289 61944 1911 1485 1283 793 479 21897 316
NM_002508chr141819 1604 1570 220 31955 1271 339 1359 1666
NM_002509chr204779 767 293 216 --1295 --
NM_002515chr1441604 1373 1272 1260 --21739 38 11746
NM_002516chr19354 47 34 139 5265 239 228 206 58 --
NM_002522chr1793046 2885 2758 2734 2524 2508 1237 1167 842 23856 1378 62584 2535 975 874 673 82 21129 836
NM_002526chr621249 582 ------
NM_002530chr15262 40 --147 167
NM_002542chr31211 --265 41 --
NM_002544chr17138 ------
NM_002545chr1174587 4184 4162 1358 891 608 294 1627 33210 958 275 34168 3218 1016
NM_002546chr81172 ------
NM_002547chrX3656 340 115 13921 33983 3942 3935 --
NM_002553chr71400 ------
NM_002556chr1151983 1772 1622 662 302 11843 21783 338 --
NM_002558chr1741026 354 302 87 1909 --31055 268 109
NM_002569chr1561278 1182 987 455 435 363 1130 31404 353 38 41410 1330 1307 222
NM_002570chr155919 402 369 121 58 2876 202 ----
NM_002576chr1131097 314 84 41124 330 228 106 ----
NM_002577chr3103124 2606 1528 986 910 896 812 793 411 194 22743 781 51625 1504 1499 1487 900 11010
NM_002578chrX4386 370 327 30 ------
NM_002581chr941238 976 790 95 21042 262 12269 21481 1447
NM_002585chr11261 --1306 174
NM_002586chr661571 1163 1098 531 376 237 21104 1089 5399 326 322 215 131 21487 329
NM_002588chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_002599chr113140 48 21 139 1971 --
NM_002601chr22328 73 --1318 --
NM_002603chr8131 ------
NM_002607chr731119 890 132 ------
NM_002608chr2271488 1358 1326 563 263 152 142 41525 1401 404 191 31516 1342 339 41494 1274 532 173
NM_002609chr581712 1672 1333 555 485 438 208 118 --2353 321 --
NM_002610chr232823 2287 524 31263 1250 165 ----
NM_002612chr7190 11461 ----
NM_002613chr16104451 4258 3924 2139 1944 1860 1412 970 547 26 1945 43673 1519 1418 441 13931
NM_002616chr172526 381 2229 117 --1375
NM_002628chr3----1461 --
NM_002634chr175934 857 721 220 70 ----1745
NM_002636chr62385 64 --1398 2429 420
NM_002641chrX1601 ------
NM_002642chr1--150 ----
NM_002645chr112904 638 ------
NM_002646chr171511 1479 864 848 798 724 79 32156 2149 1645 31857 596 64 --
NM_002648chr661208 983 975 195 73 22 31199 222 172 2932 28 --
NM_002649chr72623 144 ------
NM_002650chr222138 75 ------
NM_002651chr14867 594 272 212 1887 3650 222 46 --
NM_002653chr54930 823 792 197 2149 142 2846 138 --
NM_002657chr20173656 3608 3416 3254 3240 3057 2645 2517 2454 1346 1290 1031 615 530 310 291 284 53166 2522 2493 1547 1149 53660 3211 2649 2475 2372 12908
NM_002660chr2021170 97 1278 ----
NM_002687chr141334 --11207 --
NM_002697chr1199 ------
NM_002698chr19142965 2599 2378 2340 2324 2260 2222 1131 1065 1011 753 313 214 186 12607 62330 2291 2272 1197 1072 1033 32716 2117 319
NM_002699chr161365 1078 1056 580 500 345 --51253 972 428 426 157 --
NM_002705chr164260 228 80 65 --282 45 --
NM_002707chr2146 --1154 --
NM_002710chr12----1121 --
NM_002714chr64983 938 360 193 ------
NM_002715chr52814 439 ------
NM_002716chr1163521 3508 3494 3112 2442 406 22496 758 ----
NM_002717chr84516 494 479 465 ------
NM_002718chr362569 2322 891 649 359 182 3896 620 239 ----
NM_002719chr1441706 1513 832 301 32111 318 181 ----
NM_002721chr93357 69 39 ------
NM_002730chr1961267 1162 1110 459 206 134 1912 61164 1130 974 239 224 214 31256 276 227
NM_002734chr1741981 1523 33 21 --135 --
NM_002742chr141664 ------
NM_002745chr2274179 3482 1322 1311 388 320 198 23210 61 1325 --
NM_002746chr165593 248 192 144 44 --4494 206 59 57 --
NM_002747chr1831509 1415 563 --291 81 --
NM_002753chr43299 50 22 ------
NM_002755chr152573 67 ----172
NM_002760chrY85499 5196 2220 2200 1723 1593 1487 640 31907 1289 66 14678 --
NM_002763chr11140 ------
NM_002773chr161102 --3383 381 59 --
NM_002776chr1961950 1936 737 159 140 86 2697 603 31633 359 106 1165
NM_002779chr102358 98 --1417 --
NM_002791chr141102 1114 --1105
NM_002808chr31106 ------
NM_002821chr66555 547 505 309 157 87 ------
NM_002823chr23157 68 61 ------
NM_002824chr128394 381 310 176 159 136 126 35 --2465 460 1313
NM_002827chr2041716 731 388 157 11692 1324 1203
NM_002829chr94853 273 69 45 1349 ----
NM_002833chr1551115 414 325 311 37 2357 122 31426 366 315 --
NM_002834chr1273996 3350 2970 1239 1149 1141 999 21053 204 254 52 12994
NM_002838chr12484 34 ------
NM_002839chr92428 40 --12529 1431
NM_002840chr171218 604 596 517 371 324 225 ----193
NM_002843chr1143269 2419 738 701 22886 2110 52427 2217 2215 1116 1112 22705 750
NM_002844chr61368 ------
NM_002846chr23517 481 43 1485 2460 119 1496
NM_002847chr741370 1347 1332 1088 --21004 121 11335
NM_002850chr1991110 973 965 942 394 359 237 196 69 1247 156 --
NM_002854chr222132 33 --274 63 --
NM_002855chr11203633 3376 3198 3119 2638 1478 1360 1281 1034 815 724 702 572 455 350 327 282 255 191 37 21410 80 83551 3279 2669 2283 1340 208 196 49 33557 1447 1438
NM_002859chr12111713 1640 1567 1352 667 637 465 412 243 236 121 1543 71611 1336 598 219 208 201 30 1551
NM_002865chr8----161 --
NM_002866chr193497 39 26 --3499 212 48 --
NM_002868chr12112411 2263 2172 2160 1817 1557 916 417 330 314 129 2250 200 72234 2176 1987 1930 1496 419 369 12414
NM_002869chr1141771 442 381 101 31782 859 400 11757 --
NM_002874chr91651 --2890 874 --
NM_002880chr31562 --1227 1644
NM_002881chr22460 231 31013 939 95 1102 31405 420 245
NM_002885chr17991 896 852 713 704 335 138 --2305 147 --
NM_002886chr364597 3634 3362 1875 1349 244 21132 1093 14149 --
NM_002892chr1411431 11225 1151 123
NM_002893chrX--1341 ----
NM_002895chr202852 835 ------
NM_002896chr114318 311 302 66 ------
NM_002903chr17123 --1255 --
NM_002904chr6183 ------
NM_002907chr121423 ------
NM_002912chr6--1306 ----
NM_002918chr195784 764 720 305 41 1321 41061 1059 355 143 1286
NM_002924chr11587 ------
NM_002933chr144204 62 45 29 --173 --
NM_002941chr331291 207 57 ------
NM_002942chr31942 ------
NM_002945chr172589 254 162 ----
NM_002953chr1--160 1172 --
NM_002956chr1221018 166 ------
NM_002959chr1124058 4016 3957 3490 3328 3102 3068 2914 1586 1265 965 895 33062 1435 679 24148 4115 14174
NM_002962chr1292 28 --194 2113 99
NM_002966chr1278 25 ------
NM_002968chr16--164 196 --
NM_002971chr31367 ------
NM_002973chr12----138 --
NM_002997chr281645 1424 612 297 124 106 86 23 11650 1299 --
NM_003001chr182241 1983 1555 854 828 821 767 277 --2861 859 --
NM_003009chr191265 ----146
NM_003010chr1742377 1909 1819 1542 31960 1848 1688 ----
NM_003011chr95661 381 312 100 28 --1241 --
NM_003012chr822714 1143 11068 32066 1084 158 --
NM_003013chr41127 ------
NM_003016chr1751852 1688 1337 771 355 ------
NM_003017chr611374 ------
NM_003026chr92424 27 --1465 1427
NM_003028chr9123775 3588 3321 3236 3004 2920 2624 2531 2438 2373 1542 1468 43683 1496 1255 284 83779 3126 2626 2479 2357 1066 991 233 23597 2541
NM_003029chr151429 1380 344 194 35 --3557 276 196 1401
NM_003030chr33760 110 58 --11412 --
NM_003034chr1298109 6278 6262 5271 5090 1613 724 598 480 36611 6445 2736 22605 518 16265
NM_003036chr131081 873 814 11159 2992 433 --
NM_003037chr11117 1187 ----
NM_003039chr13247 200 137 145 ----
NM_003042chr331713 470 418 185 1696 1542
NM_003043chr363358 2917 1304 1188 908 658 64002 3933 3430 3247 3060 512 73759 3743 3588 3446 3444 3052 946 --
NM_003045chr13134943 4866 3657 3416 3321 3119 1289 1044 801 423 362 339 279 --44303 3694 1608 77 1924
NM_003047chr1131343 1160 1061 980 506 411 322 306 275 205 187 173 160 --41244 257 109 83 --
NM_003051chr121644 1264 11549 --1652
NM_003060chr55929 892 508 411 188 ------
NM_003062chr5128 ------
NM_003068chr8------1841
NM_003070chr92746 41 ------
NM_003071chr321903 1382 ------
NM_003072chr19--1359 ----
NM_003074chr32255 137 11407 31394 733 159 --
NM_003075chr123317 135 127 --386 66 23 --
NM_003076chr12111680 1489 1415 1406 1322 1037 583 474 449 364 202 31657 1525 189 91436 1420 1373 1333 1043 1041 505 479 239 1669
NM_003077chr176646 573 223 121 114 53 123 ----
NM_003079chr172405 323 1983 --1371
NM_003081chr2031147 269 24 1151 ----
NM_003085chr53239 112 91 ------
NM_003091chr20----1191 --
NM_003096chr2136 ------
NM_003099chr15106056 5924 1252 1136 944 809 775 555 529 58 35934 5243 1506 36060 1462 115 15944
NM_003100chr51356 ------
NM_003108chr286501 6453 2869 2660 1877 1853 1038 864 12085 55579 2775 1815 279 275 26374 5063
NM_003110chr175840 696 412 164 52 --4849 847 401 198 --
NM_003111chr211087 1876 ----
NM_003112chr71217 1277 ----
NM_003128chr252873 2513 1937 404 27 21949 1052 11939 --
NM_003131chr6122205 1963 666 650 523 406 394 369 329 249 200 189 2679 222 62111 1429 820 802 673 525 21970 146
NM_003132chr1290 70 ------
NM_003137chr6274 43 --151 1280
NM_003139chr115817 615 256 232 48 4784 679 669 139 4764 719 238 218 2770 221
NM_003145chr13368 192 47 --122 3375 50 28
NM_003149chr341539 1211 533 521 21226 497 11544 --
NM_003150chr1771880 1678 1644 1599 1578 916 371 --22200 319 --
NM_003155chr872440 2327 2076 537 323 244 224 22095 1038 12081 12086
NM_003156chr1151164 1155 399 376 58 --61179 246 71 67 63 40 21158 382
NM_003161chr1711142 ------
NM_003164chr113473 376 179 1548 145 --
NM_003165chr991602 1562 1489 1410 768 403 258 196 118 21451 157 41944 1692 1594 1515 11607
NM_003170chr173387 198 66 --280 70 --
NM_003173chrX41240 1047 388 57 --173 --
NM_003178chr342235 451 406 270 11766 11665 31483 273 87
NM_003179chrX81448 1393 1362 1288 1196 416 373 66 1396 111419 1356 1223 1219 1206 1122 908 383 280 267 229 21451 69
NM_003184chr82232 108 ------
NM_003185chr204990 490 301 241 --6524 520 515 510 472 468 1479
NM_003186chr112320 160 --134 --
NM_003189chr183149 2833 2810 2439 1259 693 675 249 12427 --2403 276
NM_003194chr64487 141 36 25 ------
NM_003199chr1835523 3657 1381 11098 ----
NM_003200chr1992344 2076 2034 2016 1827 1750 1560 931 917 11611 52078 2018 1893 1761 933 --
NM_003202chr54581 515 116 61 1134 1606 --
NM_003203chr2179 2914 901 ----
NM_003205chr153731 302 51 --1568 --
NM_003214chr651102 1087 1020 134 47 --21197 1192 --
NM_003215chr431244 1094 395 21161 178 11400 --
NM_003216chr22132884 2866 2357 2260 2168 2057 1312 941 897 778 532 469 309 13215 63167 3137 2348 2076 1072 340 21118 979
NM_003220chr671191 1178 1110 1060 226 200 59 --41476 454 177 93 127
NM_003223chr162284 22 --3551 545 24 1583
NM_003234chr31388 32026 1782 958 1691 --
NM_003236chr273017 2291 1385 930 677 377 106 ------
NM_003239chr144847 838 731 710 1775 3733 721 697 --
NM_003247chr63636 140 103 ------
NM_003253chr211562 --2467 65 --
NM_003255chr1792567 2317 2091 1793 1648 642 280 210 146 1341 31017 837 80 2999 285
NM_003257chr1511062 ------
NM_003263chr4129 ------
NM_003269chr62502 86 ------
NM_003270chrX4795 482 296 29 ------
NM_003274chr214964 559 518 257 2491 31 21815 261 --
NM_003285chr14521 345 222 205 1369 2558 541 1210
NM_003286chr20----2441 436 1446
NM_003289chr9139 --1200 1193
NM_003292chr12528 179 ------
NM_003298chr386015 5924 5196 4069 3999 2188 1630 870 23961 41 12309 24503 1047
NM_003304chr311409 21483 1015 ----
NM_003317chr144714 584 553 48 --2542 52 --
NM_003319chr22978 697 ------
NM_003320chr11113269 2743 2703 1582 1469 1327 1294 983 829 530 98 --54188 4184 4155 3569 1319 --
NM_003322chr64335 152 134 77 1125 4342 340 277 154 --
NM_003325chr22--177 1214 --
NM_003326chr142212 915 686 496 32146 2080 98 22036 143 --
NM_003336chrX4928 184 151 65 --1160 --
NM_003337chr51486 155 ----
NM_003339chr551503 1405 635 626 111 1209 ----
NM_003340chr41135 1445 ----
NM_003342chr1782693 2535 2257 2112 2098 2080 962 855 --22539 2190 --
NM_003348chr1251425 1396 1319 597 55 11706 1250 --
NM_003349chr2071308 1057 627 617 578 424 381 21235 400 4407 392 33 27 1550
NM_003352chr21203 --1216 --
NM_003359chr4--3355 221 189 1917 --
NM_003363chr33603 555 117 ------
NM_003367chr191202 --3180 94 57 --
NM_003369chr1142581 1750 526 242 --2689 684 --
NM_003370chr194739 260 217 161 --3589 574 230 1745
NM_003371chr951711 863 612 584 422 1107 3746 674 633 --
NM_003373chr1061493 1257 735 495 353 241 1452 31751 610 500 11499
NM_003374chr52798 121 ----1160
NM_003376chr651706 697 604 246 25 --31487 1417 606 --
NM_003376chr651706 697 604 246 25 --31487 1417 606 --
NM_003378chr75410 385 377 356 62 1366 1163 --
NM_003381chr62687 633 140 ----
NM_003385chr22275 269 ------
NM_003387chr272420 1856 941 930 400 373 85 --32803 2105 71 --
NM_003390chr112825 21 --3803 735 363 --
NM_003392chr353562 2933 1049 1019 511 13418 21039 515 --
NM_003394chr124621 470 219 179 3597 276 81 1543 --
NM_003400chr2--1169 ----
NM_003403chr14274 21 ------
NM_003404chr2031625 1444 1364 11497 11755 --
NM_003406chr851747 1734 1678 1650 1482 ------
NM_003407chr192562 437 --1278 --
NM_003409chr181245 --1249 --
NM_003410chrX22415 1941 12002 12905 --
NM_003412chr331173 1105 1097 --11115 12713
NM_003413chrX31899 289 248 --1253 --
NM_003418chr3----124 --
NM_003439chr733335 2224 598 1187 1723 --
NM_003442chr111335 ------
NM_003457chr17--1120 ----
NM_003458chr3193931 3849 3737 3556 3449 3239 3051 3006 2936 2541 2444 1316 1303 1289 1017 974 585 552 407 31122 724 370 124002 3832 3828 3817 3292 3210 3208 1488 976 937 446 331 --
NM_003459chr23660 652 293 --2117 109 1122
NM_003463chr642748 2668 2646 993 1515 --1986
NM_003466chr2112456 2303 2175 851 694 584 513 503 475 437 197 12186 32237 959 856 --
NM_003468chr273492 3259 3161 1127 958 595 238 22897 502 41084 1077 1070 111 --
NM_003470chr1651500 543 502 354 81 11560 51872 1727 1722 1269 529 --
NM_003471chr3----1125 --
NM_003473chr103182 149 109 ------
NM_003474chr101883 22266 1613 11984 --
NM_003478chr1142447 2376 350 185 12832 ----
NM_003481chr123389 362 87 --2466 394 1365
NM_003482chr1282490 1017 977 772 532 390 200 52 --92648 2644 2510 1730 981 755 753 726 507 --
NM_003483chr1252777 2235 2068 1055 209 --21061 1057 --
NM_003485chr1451223 1096 883 81 74 31271 1245 353 31101 887 873 --
NM_003487chr171201 ------
NM_003489chr2122192 747 ------
NM_003490chr222378 267 2856 787 152 --
NM_003505chr771666 777 734 698 569 562 467 1661 4604 591 585 469 --
NM_003507chr271654 599 568 464 327 105 38 11944 1584 --
NM_003559chr1792984 2504 1128 1006 842 643 599 444 247 62789 2737 2638 1010 860 487 73543 3539 3537 3099 3097 2745 416 --
NM_003563chr1741419 1298 1031 1025 ------
NM_003564chr12577 169 1430 3537 197 171 131
NM_003574chr1854143 4125 3820 710 475 25146 2212 21695 1693 --
NM_003575chr751202 1082 623 338 268 41371 1098 1036 976 --1517
NM_003576chr1352723 2280 840 392 53 22498 216 32849 2173 662 --
NM_003581chr24677 298 77 28 1150 ----
NM_003586chr162493 191 --1584 --
NM_003591chr101280 ------
NM_003593chr171600 1185 ----
NM_003595chr222440 368 ------
NM_003603chr451625 389 371 200 81 ------
NM_003607chr173458 1562 1424 1376 71 31 24 43657 3468 1149 56 23950 1104 11012
NM_003613chr15122 ------
NM_003615chr313699 ------
NM_003617chr1134559 4545 4524 4078 3619 3517 3247 3107 1480 685 670 450 44 2890 85 24550 553 --
NM_003620chr172772 719 ------
NM_003621chr11121 ------
NM_003624chr1961237 913 554 427 380 238 11203 51327 932 559 248 243 1383
NM_003627chr11----2512 419 1487
NM_003629chr173127 2523 1094 1045 815 806 438 --53471 2867 1379 1107 627 12849
NM_003631chr101181 235 28 ----
NM_003632chr178761 754 735 678 670 354 210 58 --160 1359
NM_003633chr562353 1758 1594 1021 525 407 --12440 --
NM_003634chr224925 855 209 23 --4868 864 213 27 --
NM_003635chr102427 41 --199 --
NM_003636chr191814 1689 1187 582 527 509 475 405 274 3535 296 146 31873 1725 1189 41817 1223 585 43
NM_003642chr21238 ------
NM_003644chr17276386 6362 6324 6191 6021 5943 5673 5565 5419 4897 4687 4501 4184 4173 4159 2534 2467 2181 2158 2142 2054 1763 1350 1251 1192 785 356 26380 600 86158 6153 2519 1260 957 737 496 92 26026 788
NM_003654chr112142 116 --3528 93 89 196
NM_003655chr172576 540 --4581 237 227 85 2592 200
NM_003656chr3----269 64 --
NM_003660chr193754 631 43 --4542 538 536 64 --
NM_003663chr322125 581 ------
NM_003664chr51358 1407 --192
NM_003670chr331391 322 36 ------
NM_003671chr983234 2911 2796 2755 2674 2298 1072 272 21206 819 33093 2761 923 22775 1307
NM_003673chr171409 --151 --
NM_003680chr12253 24 --1160 --
NM_003685chr194791 766 393 379 1228 2809 805 1624
NM_003705chr21858 --1691 --
NM_003711chr5--1216 ----
NM_003713chr141241 578 424 65 21202 156 ----
NM_003714chr552766 2681 2638 2276 32 ------
NM_003726chr172108 23 --127 --
NM_003735chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_003736chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_003740chr641678 671 135 42 1145 11441 --
NM_003743chr232005 1611 577 --1476 --
NM_003744chr1441177 397 367 251 ------
NM_003745chr161135 1276 187 --
NM_003749chr1341918 1663 913 509 --12421 --
NM_003750chr101290 ------
NM_003758chr1531124 574 373 ------
NM_003758chr1531124 574 373 ------
NM_003759chr443218 2843 598 580 33232 3148 44 ----
NM_003760chr1--1553 ----
NM_003762chr121225 170 ------
NM_003763chr2062736 2698 2667 475 148 42 --1153 13051
NM_003768chr171575 1554 1471 730 317 309 63 21636 303 153 11546
NM_003774chr123960 880 834 11269 --11233
NM_003779chr13443 136 57 --3407 187 138 --
NM_003780chr13626 211 180 --3243 232 228 --
NM_003787chr1811145 ----11125
NM_003791chr161239 --1149 --
NM_003795chr62507 489 ------
NM_003800chr621848 1808 ------
NM_003822chr142552 2538 1170 424 --22276 488 --
NM_003829chr91451 146 1456 --
NM_003831chr181396 21418 199 ----
NM_003840chr842067 1895 1533 30 11965 22054 1427 11898
NM_003842chr842054 1912 1809 1740 3506 487 437 2876 32 31900 1743 128
NM_003861chr1462872 2851 2030 1051 366 145 22346 2326 ----
NM_003870chr1521986 151 12051 ----
NM_003872chr242434 2174 1024 834 --22751 878 22235 197
NM_003873chr102892 308 1746 3314 297 288 11839
NM_003877chr123892 206 178 --1210 --
NM_003884chr31147 ------
NM_003885chr1711692 1234 32653 2019 127 1424
NM_003888chr1531322 1228 382 31238 387 345 51625 418 414 396 48 --
NM_003893chr10----2460 417 --
NM_003895chr2131774 720 182 ----1359
NM_003896chr2--3880 681 155 ----
NM_003900chr561319 1078 929 894 536 33 31473 1274 942 1276 11197
NM_003906chr21----132 --
NM_003913chr622694 2673 24036 1052 22680 2675 --
NM_003916chrX31363 913 62 ------
NM_003922chr15----233 24 --
NM_003924chr41230 --1199 1634
NM_003927chr182808 776 ------
NM_003930chr722002 92 1795 11951 --
NM_003931chr62556 127 ----1559
NM_003936chr2101096 987 772 420 409 378 362 339 289 246 --6774 427 425 394 390 295 --
NM_003938chr194958 393 227 75 1202 --1771
NM_003939chr10193990 3867 3806 3461 3429 3417 3354 3328 3145 2745 1499 1381 902 735 677 622 557 479 274 41395 1056 740 656 33820 1529 279 13812
NM_003941chr722304 1694 ------
NM_003947chr36884 304 242 201 165 89 164 ----
NM_003948chr422519 691 12368 1208 --
NM_003949chr17131982 1962 1789 1767 1684 1307 615 576 543 310 292 270 115 21997 250 102060 1880 1857 1855 1799 1795 1791 1346 1259 578 31600 1264 423
NM_003954chr1751299 1054 502 402 45 21223 170 11194 --
NM_003955chr1741483 603 537 296 11032 71142 1138 539 153 151 140 53 --
NM_003958chr683218 3198 3169 3104 2483 883 667 510 41020 1007 988 160 2519 515 --
NM_003966chr577704 6950 6018 5802 2695 2054 1259 21848 409 56022 2680 2215 1261 895 11230
NM_003968chr3----1150 --
NM_003969chr192332 128 --1133 --
NM_003971chr17161 ------
NM_003972chr10--1305 ----
NM_003975chr1------171
NM_003983chr16164423 4328 4300 4142 4049 3688 3608 3180 1599 1411 1302 1233 1220 1043 473 83 23843 3435 43614 2715 1603 1238 --
NM_004019chrX1333 154 169 --
NM_004028chr1832697 2561 616 2557 60 --1683
NM_004035chr1774424 4393 3629 3597 3317 3303 553 74875 4560 3749 3617 3547 3463 721 13932 23449 405
NM_004036chr22121 76 1236 ----
NM_004050chr1452469 2255 2037 790 555 1598 52004 868 760 607 594 1874
NM_004055chr1172208 1637 1617 1554 1444 896 231 4665 539 441 401 1151 --
NM_004061chr51524 ------
NM_004063chr82222 114 1389 ----
NM_004067chr731415 1068 581 21435 233 11431 --
NM_004068chr3292 28 --4113 97 68 41 1297
NM_004074chr112160 87 ------
NM_004077chr1271235 1101 1077 1045 851 417 174 1495 31049 473 195 1476
NM_004081chrY21397 1379 197 ----
NM_004082chr2242 27 --1228 --
NM_004083chr12------176
NM_004086chr141640 ------
NM_004087chr311592 11545 ----
NM_004090chr1752439 741 387 364 293 33020 1016 491 32723 452 368 32352 665 517
NM_004093chr1362375 1311 949 269 130 59 --21298 596 --
NM_004097chr23717 283 267 1257 1361 --
NM_004099chr942083 559 527 260 2708 25 11688 --
NM_004100chr622540 1002 12637 --12546
NM_004102chr12492 452 --1584 --
NM_004103chr85798 759 745 707 56 --5771 553 143 141 116 --
NM_004105chr2------11001
NM_004107chr19165 ----1162
NM_004113chr3123 173 449 44 38 27 155
NM_004114chrX------1335
NM_004116chr2------151
NM_004117chr681687 1627 1582 823 713 641 611 539 41930 874 615 146 3828 628 45 --
NM_004124chr1422309 352 --12728 --
NM_004134chr51584 ------
NM_004136chr1532709 617 332 ------
NM_004156chr81504 ------
NM_004157chr33892 339 284 ------
NM_004161chr211069 ------
NM_004162chr321124 1040 --11007 1187
NM_004171chr11159035 8654 8593 8503 7771 6862 6827 6513 6426 3527 2806 2061 2029 1169 291 58960 7819 3326 2195 301 16572 --
NM_004183chr11--1630 ----
NM_004185chr1388 78 27 142 ----
NM_004187chrX91094 1082 1066 979 448 434 417 352 213 11241 5462 458 456 365 217 --
NM_004188chr91475 1447 ----
NM_004193chr102390 195 136 ----
NM_004199chr5----125 --
NM_004200chr11143211 2955 2901 2339 2075 2063 1104 1096 1088 916 807 782 762 311 42294 2157 1130 993 72747 1206 1064 1053 920 834 387 --
NM_004202chrY--1176 ----
NM_004203chr16----150 --
NM_004205chr113476 368 21 --129 --
NM_004206chr3--144 ----
NM_004210chr10122126 2002 1653 1417 814 768 634 548 390 266 113 85 31646 1608 1546 41349 552 244 234 31638 675 473
NM_004215chr81502 1148 ----
NM_004225chr841288 1198 242 80 11006 ----
NM_004227chr752511 833 302 251 68 --11212 12654
NM_004229chrX11613 11557 1589 --
NM_004231chr74268 208 192 46 --248 28 --
NM_004233chr61265 --11298 --
NM_004235chr9173 ------
NM_004248chr103661 652 139 151 ----
NM_004249chr4------172
NM_004253chr93872 679 273 ------
NM_004272chr52588 121 1718 ----
NM_004274chr1463059 2983 2782 2214 328 80 53034 2760 261 163 145 2335 298 1341
NM_004277chr6--11624 --21203 660
NM_004283chr192875 680 1672 3108 103 32 1880
NM_004287chr1742244 2196 889 882 --1505 --
NM_004295chr1741243 424 244 127 11345 1132 --
NM_004296chr14143950 3622 3224 3001 2994 2766 2745 2710 1577 1127 1087 897 632 450 21092 462 63815 3813 3346 2686 1408 235 13399
NM_004301chr3127 ------
NM_004302chr1272540 2306 2254 2030 858 103 85 42463 2396 1113 203 62119 1787 781 777 762 481 1450
NM_004305chr2144 1149 ----
NM_004308chr11131734 1461 1448 1194 748 736 607 452 382 241 213 58 28 11328 31742 740 124 11634
NM_004309chr1761057 447 303 203 134 106 --5990 181 171 80 75 1118
NM_004311chr10112910 2791 2760 2555 2479 2256 2245 2136 2027 1198 427 1343 62739 2727 2563 2485 2326 2159 --
NM_004313chr172136 95 1354 3180 148 103 --
NM_004316chr124899 466 433 426 ------
NM_004321chr273353 2953 2930 2857 2702 1287 1113 33058 2488 482 53155 2554 1399 88 47 --
NM_004326chr151151 834 827 801 764 2909 358 31143 1010 838 11159
NM_004341chr2--166 ----
NM_004342chr742289 1959 1636 1479 11604 ----
NM_004349chr82904 286 ------
NM_004350chr192009 1957 985 747 632 473 421 277 21 --32112 2013 1867 --
NM_004364chr1971279 1209 1086 489 377 216 126 --3381 162 158 --
NM_004370chr631957 812 802 1594 --11778
NM_004371chr12602 65 1965 2618 83 --
NM_004379chr22522 199 --1262 --
NM_004380chr1611700 1519 12319 --
NM_004383chr152255 146 --1447 --
NM_004384chr52944 559 ------
NM_004391chr382035 1898 1886 1434 1420 616 584 70 21488 1361 91592 1584 1505 1501 1293 805 228 154 102 1377
NM_004392chr131425 ------
NM_004393chr331801 1545 694 32086 1831 167 41851 1849 738 156 --
NM_004395chr55695 525 302 231 147 --5684 539 517 274 270 --
NM_004396chr17--1280 ----
NM_004397chr1193752 3037 2882 1583 1354 934 600 401 74 ----13040
NM_004405chr24380 318 215 106 1363 5915 290 286 178 78 --
NM_004408chr94375 177 102 30 ----1420
NM_004409chr192760 621 --1546 --
NM_004416chr1261087 762 747 690 233 57 1741 227 23 1696
NM_004418chr23255 115 71 1562 1549 --
NM_004420chr11142361 2209 2199 2130 2099 2089 2020 1898 1871 1803 1619 541 440 422 11743 92417 2383 2275 1886 1879 1589 1528 834 452 32223 2113 287
NM_004422chr173341 319 160 --1167 --
NM_004423chr392700 2455 2443 2347 1008 785 421 304 57 32527 916 249 42599 2594 2592 2588 --
NM_004426chr1251573 1316 667 462 42 ----1471
NM_004427chr17893 460 405 289 256 151 39 21007 414 3826 795 114 --
NM_004429chrX41276 942 249 55 --4458 316 209 78 21335 339
NM_004430chr87810 622 391 136 110 44 34 1979 3954 794 207 21072 945
NM_004431chr13198 115 61 1335 1321 --
NM_004432chr911839 ------
NM_004433chr191485 581 550 428 311 271 187 89 58 --2540 196 1553
NM_004436chr1138 --281 43 --
NM_004437chr1122792 2664 2419 2410 1388 1113 1077 741 607 373 308 295 32399 1421 39 4644 640 638 436 --
NM_004438chr233203 356 98 --2900 856 --
NM_004440chr61280 21776 110 11786 --
NM_004442chr1121598 1558 1517 1451 1362 1152 672 540 369 359 47 31 41388 1356 1272 1160 51683 1602 1562 1156 68 11592
NM_004443chr32264 256 --2230 164 --
NM_004444chr74637 550 285 37 1278 ----
NM_004446chr1122 135 ----
NM_004450chr141321 ------
NM_004451chr112559 536 --1157 1169
NM_004454chr312118 1666 12032 --
NM_004456chr7----125 --
NM_004458chrX12281 11691 ----
NM_004461chr19130 ------
NM_004463chrX3472 463 410 --176 2475 82
NM_004468chr11133 --3251 249 220 1608
NM_004472chr52192 88 --1104 --
NM_004474chr14406 377 303 46 --148 1397
NM_004475chr1781194 874 461 398 241 191 179 163 1480 144 --
NM_004480chr141633 ------
NM_004484chrX1116 --1318 --
NM_004485chr1153992 3802 3379 3209 2991 2770 2755 2726 2699 1414 1030 875 673 641 26 43159 1736 1550 808 73388 3384 2861 2788 1168 1063 1035 --
NM_004494chr1111205 1180 1015 956 816 489 351 330 273 242 116 21069 345 41240 1238 1171 971 11174
NM_004496chr143322 310 284 --2414 301 --
NM_004499chr51150 ------
NM_004500chr1461923 1908 741 367 120 85 --21925 87 1137
NM_004501chr131550 1250 489 23589 849 21260 1254 --
NM_004502chr172533 373 --1431 1448
NM_004503chr124781 310 203 38 --5794 169 59 30 26 --
NM_004504chr2156 ------
NM_004505chr171420 1670 --1733
NM_004514chr1792880 2807 2614 2321 1883 1024 994 270 64 42812 2288 335 111 ----
NM_004516chr19151 --21262 993 --
NM_004517chr11291 63 1210 ----
NM_004519chr81164 --125 --
NM_004525chr231257 1206 616 11194 ----
NM_004527chr1791344 1068 1062 480 361 326 205 105 79 21251 330 187 --
NM_004529chr91237 ------
NM_004535chr2041695 175 96 49 1555 11721 --
NM_004537chr1221154 55 ------
NM_004543chr2171 ------
NM_004555chr161179 --182 --
NM_004556chr63353 274 39 ------
NM_004573chr155743 661 238 198 46 --3542 537 141 1705
NM_004574chr17134 ----164
NM_004575chr431473 1163 54 ------
NM_004578chr11841 ------
NM_004583chr174608 539 260 33 1252 1525 1279
NM_004586chrX54684 4615 4054 3898 155 14517 12175 --
NM_004587chr201465 1168 ----
NM_004588chr11174074 3972 3611 3215 3195 2971 2947 2762 1627 1100 1085 650 459 128 92 41 25 23249 152 147 32648 1088 943
NM_004598chr562924 2580 1053 633 337 262 1708 12397 --
NM_004602chr2041301 529 370 283 ----11409
NM_004603chr761126 914 387 343 153 136 1843 61049 974 972 302 118 114 184
NM_004606chrX1267 --133 --
NM_004608chr163307 166 39 --149 --
NM_004609chr20182 --2488 394 --
NM_004612chr9125 23871 150 14513 13558
NM_004615chrX3676 623 301 --2125 123 --
NM_004625chr31236 --124 --
NM_004630chr1171055 1047 1037 940 281 258 213 --31059 309 283 1372
NM_004631chr1----1483 --
NM_004634chr32569 46 --2434 148 --
NM_004637chr331174 890 864 --41239 452 448 76 --
NM_004639chr6----122 --
NM_004642chr12164 1119 ----
NM_004643chr14----1636 --
NM_004645chr17----1831 --
NM_004654chrY1405 ------
NM_004655chr172994 541 ------
NM_004656chr371262 1220 880 397 284 249 75 1155 162 1885
NM_004660chrY1234 21575 1495 1239 --
NM_004664chr12--1221 ----
NM_004673chr1----11484 --
NM_004674chr82176 111 2609 87 ----
NM_004684chr4138 ------
NM_004685chr1322321 317 ------
NM_004687chr172389 130 ------
NM_004690chr61609 ------
NM_004693chr126404 299 283 159 71 21 --5414 307 303 165 161 --
NM_004694chr17193 ------
NM_004711chr22122769 2548 2510 2281 1308 1207 962 879 838 804 699 658 63305 2747 1281 1213 1170 675 83577 3375 3118 2836 2805 2758 46 31 23266 2534
NM_004714chr192333 82 --243 27 --
NM_004717chr741503 598 350 111 --153 --
NM_004723chr12858 239 1766 1420 --
NM_004730chr52611 39 ------
NM_004734chr133435 74 31 ------
NM_004736chr121418 342 ------
NM_004738chr2021606 338 11028 32445 356 136 --
NM_004739chr112151 66 --4550 545 541 70 --
NM_004742chr351675 1257 1243 431 71 ------
NM_004745chr8176923 6784 6221 6180 6136 5908 5726 5427 4907 4624 4290 2197 1666 1648 1593 608 89 26311 6256 21484 22 15034
NM_004746chr18176 --278 45 --
NM_004747chr1061483 1146 547 527 399 144 1623 ----
NM_004750chr191292 --126 --
NM_004755chr1421022 404 1117 ----
NM_004759chr1112101 2021 1917 1777 1574 1566 1405 1328 724 569 431 1231 52023 1980 1510 643 463 --
NM_004762chr1781569 1386 760 592 520 270 229 55 --21573 1235 --
NM_004768chr11444 ------
NM_004772chr511403 --21409 1405 --
NM_004774chr1752852 2372 984 863 341 11929 22857 2376 --
NM_004779chr55509 256 239 216 73 2918 882 ----
NM_004781chr11482 1390 ----
NM_004781chr11482 1390 ----
NM_004783chr164484 242 219 132 ----1631
NM_004789chr9----1364 --
NM_004796chr14--12452 ----
NM_004798chr2063131 1149 376 335 309 189 --2315 292 --
NM_004807chr262169 1968 1774 750 293 284 12253 32420 620 484 12338
NM_004808chr1032649 2540 2180 22844 2337 ----
NM_004814chr1----195 --
NM_004815chr144549 4431 4355 4064 --14436 --
NM_004818chr122245 77 --1570 --
NM_004821chr51625 --1782 --
NM_004822chr17103729 3070 1496 1481 1446 1368 586 539 529 303 43717 3704 913 284 73750 3734 3713 2878 2648 1387 169 --
NM_004824chr621291 439 11148 ----
NM_004830chr61177 ------
NM_004831chr193763 169 93 --1782 --
NM_004834chr21309 --32734 148 143 --
NM_004839chr152453 172 ------
NM_004841chr141152 880 75 47 --1921 --
NM_004845chrX104102 3914 3719 3447 3377 3205 1659 1636 505 169 73219 3084 3052 1212 552 414 324 ----
NM_004850chr2--1522 ----
NM_004857chr1443593 1719 1567 1227 21734 1600 ----
NM_004859chr1742734 2601 591 253 22662 530 1766 --
NM_004860chr171225 1374 4370 233 187 23 --
NM_004863chr1435019 3927 188 54594 717 601 450 439 3416 336 33 1339
NM_004869chr1821147 160 ------
NM_004871chr17133752 3736 3518 3116 1771 1309 1074 615 535 476 459 430 255 3847 740 719 6448 446 442 440 436 434 --
NM_004872chr11308 ------
NM_004873chr1432188 1036 975 --13148 --
NM_004874chr8172 ------
NM_004879chr115656 306 127 114 72 ----1325
NM_004884chr1551664 1632 659 622 401 11579 61670 1668 1570 569 567 226 1575
NM_004893chr52387 71 ------
NM_004896chr101371 ------
NM_004898chr442745 2537 2276 2080 12917 3476 474 462 --
NM_004902chr201175 ------
NM_004904chr7106358 6002 5954 4759 4445 2466 1718 1449 1417 572 35053 1579 1437 34783 4513 2471 25957 1264
NM_004907chr193300 239 87 --1780 --
NM_004922chr102846 219 2997 342 ----
NM_004924chr1991059 937 901 842 374 364 156 112 75 ----1309
NM_004926chr149681 572 547 531 491 441 72 66 23 --5516 232 161 159 155 --
NM_004930chr12276 221 --6530 175 147 96 91 79 --
NM_004947chr392340 1719 845 795 788 690 549 281 207 1850 32086 870 378 1723
NM_004952chr15915 767 700 152 70 2873 106 7843 721 668 325 323 161 102 1848
NM_004956chr723213 3147 --13568 --
NM_004959chr981398 1375 1368 1361 1007 599 590 301 --41403 1130 388 282 --
NM_004960chr16--177 ----
NM_004961chrX41406 1349 238 32 --4556 519 170 168 --
NM_004965chr21139 ------
NM_004966chr101735 ------
NM_004969chr10--1370 ----
NM_004973chr631603 1331 630 --11676 --
NM_004975chr203369 241 219 ------
NM_004976chr11214827 4763 4676 4630 4423 4314 4291 4207 3781 3601 3576 3308 3301 1826 1747 1356 1331 1252 846 588 412 1832 114862 4849 4844 4644 4336 3915 3172 2009 1735 1507 1502 34852 4726 568
NM_004978chr161578 1532 1351 1284 1270 503 21219 419 51569 1565 1554 659 623 --
NM_004979chrX81057 1012 829 795 389 310 252 102 21074 191 --1287
NM_004981chr221287 --1152 173
NM_004992chrX287885 7752 7691 7460 6803 6443 6353 6173 6133 5974 5776 3418 2814 2622 2608 2568 1634 1566 1505 1490 1378 1303 1282 1222 761 447 322 92 15872 158065 7978 7974 7791 7465 6982 6976 6785 6357 5924 5280 5278 1798 1272 327 67888 7798 6009 3010 2523 1228
NM_004992chrX287885 7752 7691 7460 6803 6443 6353 6173 6133 5974 5776 3418 2814 2622 2608 2568 1634 1566 1505 1490 1378 1303 1282 1222 761 447 322 92 15872 158065 7978 7974 7791 7465 6982 6976 6785 6357 5924 5280 5278 1798 1272 327 67888 7798 6009 3010 2523 1228
NM_004994chr20----1135 --
NM_004995chr1451263 195 166 148 118 1472 41310 174 170 107 --
NM_005010chr712140 --11696 172
NM_005011chr731454 1311 559 21466 576 31474 1462 597 --
NM_005017chr3127 ------
NM_005020chr7--1179 1161 --
NM_005022chr173162 55 22 --1180 --
NM_005023chr5------11428
NM_005027chr1991113 1105 911 355 312 271 226 183 146 --41030 286 165 161 1962
NM_005028chr1041775 1662 1465 115 --2744 619 --
NM_005032chrX3721 326 256 1261 1341 1726
NM_005045chr72127 51 1708 ----
NM_005051chr3130 ------
NM_005052chr173343 283 236 ------
NM_005053chr193407 211 183 1159 1468 --
NM_005055chr11128 --1161 --
NM_005056chr1255578 4154 2033 1790 190 2863 707 21794 1613 15360
NM_005057chr131542 674 482 5658 595 497 371 112 51747 586 484 190 186 --
NM_005060chr141230 534 51 26 1539 21260 28 1919
NM_005063chr10113360 3088 2990 1441 1423 1200 992 679 604 235 211 1280 1262 11135
NM_005065chr1454832 3573 1854 970 637 34540 1648 99 12033 --
NM_005074chr62246 41 ------
NM_005078chr1571708 1521 1174 1147 500 328 223 --21176 1153 1503
NM_005079chr842682 2673 2370 382 22883 655 ----
NM_005080chr223741 300 50 1102 ----
NM_005087chr31117 ------
NM_005095chr141838 1583 804 403 ------
NM_005096chrX71192 1019 884 813 800 449 437 2838 226 1283 --
NM_005099chr141334 892 244 226 21173 1028 1131 --
NM_005105chr13804 768 692 21807 760 11531 --
NM_005109chr382528 2476 986 632 617 250 156 108 1867 ----
NM_005110chr53662 625 531 1598 1578 --
NM_005112chr42857 778 --1966 --
NM_005116chr20124606 4228 3958 3857 1762 1711 1003 962 520 443 383 267 --34190 3967 763 44141 2900 1433 321
NM_005119chr131307 1284 1166 1167 21168 430 --
NM_005121chr1753329 2388 1527 1462 1337 --11506 13609
NM_005122chr1----121 --
NM_005124chr61133 ------
NM_005126chr32310 197 ----11772
NM_005133chr111338 --2340 50 --
NM_005134chr181106 ------
NM_005135chr1593640 3343 3331 2626 2594 1108 938 902 53 12771 11003 --
NM_005146chr115352 309 224 217 70 --157 --
NM_005155chr63664 208 184 2226 161 1173 1466
NM_005156chr934707 3526 1927 --11526 --
NM_005161chr11142190 2087 2014 1978 1603 1586 1519 1496 803 694 483 366 332 140 --51908 1647 1395 465 40 1448
NM_005166chr194346 218 40 21 ----1309
NM_005167chr1133 150 --123
NM_005169chr115496 229 193 144 53 ----174
NM_005176chr12131 ------
NM_005178chr193312 160 67 ----1277
NM_005182chr165566 511 247 180 88 --2414 112 --
NM_005183chrX----149 --
NM_005184chr1991422 1347 1320 1158 1143 1089 328 195 182 --3430 309 279 --
NM_005186chr115500 476 435 131 103 2148 64 6565 561 509 142 41 37 --
NM_005187chr16141625 1494 1487 1401 1371 1341 1333 1316 1306 524 381 345 335 244 11656 51643 597 530 359 164 11619
NM_005188chr11217928 7734 7648 7582 6967 6636 5787 5743 5721 5714 5549 5490 5458 3134 3094 2980 2624 2274 1364 1306 630 47072 5104 2925 1144 126786 6619 6454 5734 5494 2739 2726 1736 1374 1290 930 116 --
NM_005197chr1494998 4943 4725 4275 3820 2452 1707 307 166 14548 35502 5276 3830 --
NM_005201chr31274 ------
NM_005202chr1111803 895 887 622 481 422 396 347 148 78 33 --21596 724 2901 350
NM_005203chr101164 ------
NM_005206chr1731097 929 408 176 1902 --
NM_005219chr561625 1119 729 583 490 289 --31375 494 463 11388
NM_005220chr1781304 1290 1251 958 469 449 225 194 11433 41096 198 131 120 11443
NM_005225chr2041134 974 953 902 184 41017 928 794 118 --
NM_005229chrX81230 940 796 344 335 170 55 28 --2992 806 1997
NM_005232chr7185 ----188
NM_005233chr31884 12196 11004 --
NM_005234chr193313 110 84 ------
NM_005235chr297611 7592 6716 6370 5512 2637 2599 2526 1956 45979 3038 2811 114 47060 5766 5473 61 --
NM_005238chr1152890 2867 2547 2477 1192 22537 41 ----
NM_005240chr12803 547 ------
NM_005248chr13550 412 404 1544 123 --
NM_005250chr1631936 1240 27 11196 --11245
NM_005252chr14185 ------
NM_005254chr1521284 980 2873 455 ----
NM_005257chr1821356 1267 --11175 --
NM_005263chr181125 382 372 360 164 149 97 55 --2961 376 1325
NM_005264chr101733 ------
NM_005271chr1041186 1002 261 96 ------
NM_005273chr71252 --197 1131
NM_005275chr6125 --1117 130
NM_005277chr4--1322 ----
NM_005281chr15944 777 658 298 60 --1673 --
NM_005311chr772019 1906 852 601 550 541 205 ----1604
NM_005312chr9122580 1950 1832 1697 1679 1006 899 661 540 439 325 178 22035 312 92141 1862 1857 972 968 947 903 386 298 1740
NM_005334chrX101653 1547 1231 1130 674 482 455 387 247 129 11191 71506 1166 1153 579 486 397 131 2324 77
NM_005336chr2102153 2079 1879 1798 474 417 401 171 114 92 --61923 1457 866 421 120 25 11926
NM_005337chr122337 40 1425 ----
NM_005342chrX42683 1929 937 757 32853 2180 1106 12126 12014
NM_005347chr911650 2551 538 1518 --
NM_005349chr42487 143 ------
NM_005354chr191554 --3580 112 35 --
NM_005370chr1921167 833 --11249 186
NM_005374chr1742263 2128 2108 841 42122 1527 435 428 72373 2267 2085 2080 658 371 65 12159
NM_005376chr13384 371 89 --1776 1782
NM_005380chr161280 1207 1061 920 860 21 2516 504 21230 865 31069 868 28
NM_005382chr8--187 1161 --
NM_005386chr204879 814 591 196 1604 --1199
NM_005387chr11--1608 ----
NM_005392chr94487 149 129 115 170 ----
NM_005397chr741202 593 431 294 1587 33235 1056 610 1123
NM_005398chr1031432 952 261 --1270 1275
NM_005399chr173580 2923 2791 1576 591 405 44 31099 563 242 1616 --
NM_005400chr262804 518 451 406 162 99 --1423 1172
NM_005402chr711748 ------
NM_005406chr1811310 ------
NM_005407chr1461583 1392 1383 287 273 202 168 51248 310 298 264 206 1639
NM_005412chr124488 423 140 43 1111 148 1146
NM_005413chr2398 83 21 164 572 52 37 32 26 --
NM_005415chr2--1747 1500 --
NM_005417chr2071752 1430 756 633 522 248 100 --61808 614 368 263 250 136 --
NM_005418chr114587 500 117 76 2581 572 1693 1698
NM_005426chr11383 ------
NM_005430chr12141039 881 852 845 823 815 667 386 378 370 310 235 199 35 4901 646 417 153 5802 654 243 239 47 1143
NM_005433chr1811946 ------
NM_005436chr1043796 2506 862 744 13583 1415 12569
NM_005438chr113209 124 51 --2481 57 --
NM_005439chr126506 496 351 130 75 23 --3466 462 132 --
NM_005442chr31432 1105 ----
NM_005450chr17189 ------
NM_005453chr62475 230 188 3457 221 190 1423
NM_005458chr94904 532 461 29 21671 121 11799 --
NM_005461chr2051524 1278 1268 1225 288 1227 ----
NM_005465chr11103 ------
NM_005474chr17121542 1451 1408 1266 1232 1116 523 414 324 272 190 21 1214 41494 555 237 121 --
NM_005475chr1282994 2692 2409 2273 2148 1024 779 148 53076 2609 1303 434 92 32753 2202 174 --
NM_005476chr921008 31 1393 ----
NM_005477chr1562424 1901 1587 1045 747 21 32033 1910 837 62284 1906 798 794 45 41 12522
NM_005477chr1562424 1901 1587 1045 747 21 32033 1910 837 62284 1906 798 794 45 41 12522
NM_005479chr1051280 1208 1153 1014 323 1314 11221 --
NM_005488chr226658 650 635 227 122 66 --274 70 --
NM_005493chr6--1781 ----
NM_005502chr933019 2634 643 ------
NM_005504chr1244284 1247 514 287 21068 491 ----
NM_005505chr125842 688 382 281 80 1128 1332 191
NM_005507chr114442 325 175 127 --3444 422 75 2334 204
NM_005512chr1151921 1762 1558 1479 1345 21997 349 4745 741 739 167 --
NM_005515chr72185 59 1624 ----
NM_005520chr51768 ------
NM_005522chr711436 --3384 379 249 --
NM_005523chr721500 408 31028 654 605 1351 11480
NM_005542chr741712 1193 639 195 1277 ----
NM_005552chr145468 147 92 82 72 ------
NM_005557chr173104 52 28 ------
NM_005562chr1--1523 --11251
NM_005563chr1126 1621 287 37 --
NM_005565chr5132 --1107 --
NM_005569chr2251149 992 525 144 52 11107 --11121
NM_005576chr15168 --2117 32 138
NM_005578chr344803 4780 4765 1587 33863 3778 1458 14785 --
NM_005581chr192337 330 --5129 125 111 109 91 --
NM_005584chr132251 37 ------
NM_005587chr15--1343 ----
NM_005596chr934138 2500 1104 12203 12193 --
NM_005598chr1111520 1508 1478 1462 1343 681 487 209 78 32 23 --21566 1169 --
NM_005599chr111046 ----1485
NM_005604chr64704 676 583 72 --283 42 --
NM_005605chr81295 ------
NM_005607chr8132 2883 57 2973 866 --
NM_005610chr12897 103 ------
NM_005614chr72908 884 1676 1138 --
NM_005618chr62207 146 ------
NM_005619chr19261 51 --193 --
NM_005625chr811012 --184 --
NM_005626chr13378 181 166 1154 ----
NM_005627chr6--1217 1942 --
NM_005637chr1821738 73 41874 1707 698 91 ----
NM_005639chr1221553 198 ------
NM_005644chr11353 --1357 --
NM_005647chrX73225 3022 2907 2661 2610 1335 599 1750 82747 2508 854 788 778 770 661 405 1781
NM_005649chr5--1473 ----
NM_005652chr1661165 1110 914 432 205 173 1340 21200 1026 --
NM_005653chr12259 36 ------
NM_005656chr2161479 1244 538 459 425 63 1346 1194 11154
NM_005663chr4------1370
NM_005665chr144786 4369 3860 615 33613 752 584 ----
NM_005667chr21345 ------
NM_005668chr5--2912 746 --13039
NM_005677chr351406 1061 1042 977 406 21342 217 ----
NM_005678chr154884 859 806 763 --1128 --
NM_005686chr171453 1428 1208 1136 337 284 27 --51248 1243 1078 174 170 21211 407
NM_005688chr31888 181 11060 --
NM_005697chr151188 --1153 --
NM_005698chr12230 105 1209 ----
NM_005716chr191530 2554 542 4472 455 422 178 --
NM_005722chr22204 99 ------
NM_005730chr1293463 3207 1457 1134 1084 731 682 654 346 53499 2960 2595 1412 327 13403 32788 2611 1047
NM_005731chr22280 264 1274 ----
NM_005736chr1051534 1421 1199 451 25 --1267 --
NM_005737chr242738 2082 998 523 22810 385 --1334
NM_005738chr721786 202 --199 --
NM_005746chr722527 2403 12699 ----
NM_005749chr17167 ------
NM_005759chr263295 3024 1115 612 443 360 33223 661 48 23395 3028 14141
NM_005768chr123507 256 52 --1543 --
NM_005776chr141540 ------
NM_005779chr553293 3259 849 268 28 33424 854 733 13635 --
NM_005786chr1821120 111 ------
NM_005789chr1762147 1946 1483 792 303 115 41897 1421 520 488 121951 1919 1573 1516 1509 797 708 704 317 313 309 208 11495
NM_005796chr16269 35 150 143 --
NM_005797chr1151737 537 467 173 151 ----1435
NM_005801chr175757 505 327 318 61 --167 --
NM_005807chr11222 --1228 1233
NM_005808chr363575 2691 2323 343 316 22 23379 2640 23410 1159 --
NM_005811chr12397 88 24 ------
NM_005813chr211912 22020 305 1997 11859
NM_005814chr191240 1094 540 349 283 130 99 65 50 1586 3935 569 221 11231
NM_005819chr182482 2315 1348 1273 812 286 160 29 13440 1389 13461
NM_005822chr63373 135 118 12222 --1723
NM_005828chr17195036 4753 4586 4571 4153 3873 3755 3528 2026 1853 1788 1542 1101 583 559 530 236 203 172 24226 739 64591 3881 3736 1926 1319 1315 24280 4160
NM_005833chr91178 ------
NM_005834chrX196 --143 --
NM_005840chrX226881 6524 6470 6411 6295 5496 4698 2891 2581 2153 1832 1752 1095 916 591 576 534 495 478 460 342 114 26023 443 1596 --
NM_005841chr43731 118 25 ------
NM_005843chr221327 135 11941 --194
NM_005850chr1121 ------
NM_005851chr117348 319 313 280 154 132 63 1295 --1283
NM_005852chr1771123 1058 341 273 151 85 22 2304 278 4857 853 138 93 1994
NM_005853chr16------1113
NM_005857chr131442 571 539 ------
NM_005859chr511444 ------
NM_005862chr3--11019 ----
NM_005864chr144567 284 162 28 1145 ----
NM_005870chr132189 69 ------
NM_005876chr22682 622 1704 --2790 749
NM_005877chr2241819 604 408 42 152 12139 --
NM_005880chr1611589 ------
NM_005881chr16161 --1306 --
NM_005885chr51168 --129 --
NM_005892chr172327 105 --1287 --
NM_005895chr12133852 3837 3708 3627 2979 2823 2799 2709 2672 1072 668 613 401 53234 3113 1091 804 637 13217 11536
NM_005898chr1122972 93 ------
NM_005901chr1888306 7643 6860 5947 5567 2866 2450 2225 38496 6296 939 12817 1207
NM_005902chr15114612 4090 3270 3022 2895 1764 1274 1085 594 365 115 54582 4095 3837 2921 2866 64591 2904 2899 1075 598 301 24254 604
NM_005904chr182473 74 --3978 597 592 --
NM_005909chr584255 4090 4031 3592 3530 3322 3221 1291 32914 1591 1154 23327 2702 --
NM_005910chr17153665 3632 3204 3070 2849 2835 2766 1424 1248 907 868 821 737 315 89 43936 3719 3223 1351 73779 3686 3575 3210 1530 873 632 11126
NM_005911chr221072 493 1947 2483 79 --
NM_005920chr1223595 3588 3506 3492 3225 3087 2840 2520 2436 2422 2416 2370 1500 1232 1196 1139 1129 978 737 226 83 30 23058 23 143508 3284 3146 3140 2716 1489 1472 1467 1267 1153 1151 834 830 66 33276 2514 388
NM_005922chr61180 1104 ----
NM_005927chr51177 --11026 --
NM_005933chr1172415 2243 2007 1954 711 696 236 22228 517 32706 2419 700 1703
NM_005934chr19102394 2156 2128 946 924 740 504 479 429 406 32017 928 771 82077 1782 1780 1727 717 170 76 71 22251 1789
NM_005937chr17123275 3114 2585 2573 1458 1217 1191 1108 824 674 613 185 33039 900 465 73960 1048 1044 945 920 518 200 33751 3535 1196
NM_005938chrX21077 1043 --41316 1288 1087 81 1255
NM_005941chr831451 840 822 2893 861 14195 --
NM_005943chr681511 1409 1318 1261 1244 515 397 211 --1159 --
NM_005944chr3--1204 1802 --
NM_005955chr194358 3988 2083 1963 1622 1054 1038 758 420 44999 2098 1935 1476 33872 2177 1701 --
NM_005962chr101707 1195 22255 388 --
NM_005962chr101707 1195 22255 388 --
NM_005964chr1751229 1047 130 100 62 --11051 --
NM_005966chr212317 --11660 --
NM_005967chr127637 593 557 123 112 102 67 --1277 1519
NM_005984chr222441 98 1358 1474 1101
NM_005985chr202541 24 1664 2107 53 1206
NM_005996chr121344 --21542 102 --
NM_005998chr1146 ------
NM_006007chr943715 3509 949 452 33901 3491 2959 1210 --
NM_006011chr15184048 3828 3678 3456 3386 3377 3365 3186 3099 3039 2972 2964 2678 2668 965 908 787 341 53762 3703 3092 1434 1317 114119 4091 3939 3830 3603 3588 3473 3318 3017 2891 2834 33206 3130 3085
NM_006015chr181246 1009 912 246 173 159 146 128 2917 167 1178 --
NM_006016chr6--21837 879 ----
NM_006022chr132415 350 --1314 --
NM_006030chr32377 241 1458 41167 326 100 64 --
NM_006032chr141161 137 ----
NM_006034chr11142386 1848 1805 1787 785 762 734 686 419 377 260 151 143 65 22377 1960 51789 1749 852 514 496 1737
NM_006035chr1431130 1076 76 21087 264 11186 --
NM_006036chr23427 291 179 --31965 849 847 1296
NM_006037chr233246 3092 1922 14109 13335 24929 3772
NM_006038chr2081363 733 705 569 561 485 402 251 1687 2516 468 2488 368
NM_006040chr1671394 1243 1090 568 508 454 114 --1573 21246 924
NM_006047chr2042746 2512 2374 920 --12748 --
NM_006048chr141215 508 335 22 --3434 428 426 --
NM_006054chr1121420 450 1142 --11389
NM_006067chr162773 249 ------
NM_006070chr31276 149 ----
NM_006077chr106793 743 663 145 52 27 --2155 107 --
NM_006078chr22182 198 ----
NM_006079chr61228 ------
NM_006091chr15141716 1671 1608 1397 1291 607 576 564 490 473 251 166 66 36 31794 1721 1649 21750 634 1570
NM_006094chr832108 1911 810 ------
NM_006095chr453974 2841 1694 473 36 22850 1776 11785 --
NM_006096chr82402 267 11505 61562 1264 1260 276 176 54 --
NM_006099chr14687 587 360 86 1597 1812 1817
NM_006113chr12306 124 1271 21866 129 21446 141
NM_006133chr1192360 2157 1935 1729 1606 1570 701 672 291 32275 690 348 42161 1000 979 871 31611 1546 373
NM_006134chr2121467 1186 11119 --1603
NM_006135chr11494 1394 ----
NM_006136chr7--11011 ----
NM_006142chr1286 34 1475 ----
NM_006145chr192407 335 1455 1261 --
NM_006154chr1522499 1903 22507 107 ----
NM_006156chr142266 216 161 2220 94 --
NM_006158chr8138 --1628 --
NM_006160chr1791574 1468 1234 461 328 267 190 134 21 --61260 1038 338 296 231 215 2401 242
NM_006161chr51268 --3213 86 33 --
NM_006162chr185677 516 371 205 25 ------
NM_006167chr83450 346 203 11683 52037 2032 950 946 44 --
NM_006176chr114627 300 74 56 --3722 594 97 1235
NM_006177chr145990 935 789 763 434 2984 829 1208 --
NM_006178chr1761499 1396 1172 1046 318 270 1509 3994 992 159 21179 233
NM_006180chr941802 284 227 100 --1780 129
NM_006185chr113659 242 61 --2553 229 178
NM_006186chr2------1132
NM_006187chr12173188 2999 2804 2472 2415 2202 1069 1032 947 916 874 845 803 702 412 377 345 42174 402 308 201 33203 397 331 1177
NM_006191chr124788 286 119 46 1204 --3793 155 49
NM_006194chr145453 105 97 55 39 1931 190 --
NM_006195chr91993 --11259 --
NM_006196chr2--144 ----
NM_006197chr82221 139 ------
NM_006198chr212231 217 ------
NM_006201chrX51091 866 848 823 80 1286 11096 11156
NM_006203chr524502 2132 24840 4200 --15439
NM_006206chr442437 950 716 448 126 12238 --
NM_006211chr8252 42 ------
NM_006212chr181764 756 653 507 488 103 63 49 1950 1657 --
NM_006224chr17102232 2141 1914 1615 871 864 767 276 225 161 22377 1968 1713 171
NM_006228chr83313 289 122 --1178 --
NM_006237chr1372149 768 738 590 144 128 79 11510 1701 --
NM_006245chr67374 343 199 178 172 109 63 --2388 379 --
NM_006246chr142468 245 ------
NM_006247chr193403 325 38 --1450 1409
NM_006251chr531165 600 581 1747 22212 495 --
NM_006252chr176324 6177 5811 2641 2461 979 345 26269 5346 16326 16246
NM_006255chr141766 ----182
NM_006256chr1163 11713 ----
NM_006259chr41697 1839 ----
NM_006265chr82519 482 ------
NM_006266chr95567 315 181 132 79 184 2542 134 1328
NM_006267chr22578 539 ------
NM_006268chr117981 890 368 253 87 80 47 1325 11105 --
NM_006275chr2012483 --2191 189 --
NM_006278chr112465 112 2487 428 ----
NM_006279chr13935 737 642 ------
NM_006282chr2054640 1260 709 544 104 43289 3155 3123 319 ----
NM_006293chr154865 836 752 659 1123 1355 --
NM_006301chr121447 --1236 --
NM_006305chr15176 --266 64 --
NM_006306chrX114975 4935 4698 4576 4480 4398 3948 991 729 583 92 --51963 1528 264 82 49 2643 52
NM_006311chr17----191 --
NM_006313chr1211638 ------
NM_006315chr484490 3572 3563 994 910 419 313 224 1207 74513 4233 4217 1394 1182 999 226 --
NM_006317chr58608 596 360 128 115 101 92 49 ------
NM_006320chr421031 292 ------
NM_006321chr361859 1845 1629 617 416 51 1880 12049 11422
NM_006328chr117589 581 472 255 248 236 120 --1137 --
NM_006329chr141701 2685 33 ----
NM_006333chr22153 44 ------
NM_006336chr951346 1241 1232 1126 1059 3961 535 100 41423 1352 1348 86 11429
NM_006337chr121226 --2214 30 --
NM_006347chr1----129 --
NM_006352chr131308 1267 389 --31290 1280 1276 --
NM_006358chr225944 870 452 75 51 --1374 --
NM_006359chrX22028 1533 1834 --11681
NM_006361chr1771641 1388 1311 767 745 572 121 31633 693 442 31744 1297 577 2430 124
NM_006364chr141908 ------
NM_006367chr14966 818 783 698 --130 --
NM_006369chr12359 134 --3314 310 286 --
NM_006373chr1761340 1263 891 462 380 358 --5450 157 146 114 110 --
NM_006375chrX31578 1480 221 --11272 --
NM_006377chr971156 1047 1020 978 911 305 112 11102 ----
NM_006379chr7--1725 ----
NM_006380chr1733560 3528 1123 11633 ----
NM_006383chr156587 497 485 244 232 189 1466 --1192
NM_006386chr2272242 2233 1979 639 629 615 286 1792 ----
NM_006387chr195460 421 352 284 55 2917 356 ----
NM_006389chr1171128 1059 1007 853 534 503 215 1881 61011 538 407 403 399 40 1414
NM_006390chr1231498 663 550 --1104 11505
NM_006391chr11--155 ----
NM_006396chr11125 ------
NM_006401chr91179 1167 ----
NM_006405chr14160 --134 --
NM_006411chr67874 357 268 180 102 90 44 3931 239 25 3880 109 107 --
NM_006415chr92350 26 --1354 --
NM_006420chr2063245 1032 984 760 689 344 ------
NM_006421chr8138 --1256 --
NM_006422chr12382 61 26 ------
NM_006424chr461475 1423 1300 480 427 57 21892 1291 21487 429 2383 66
NM_006430chr22483 397 1205 ----
NM_006434chr1032453 1248 335 --1269 --
NM_006439chr42510 356 --1515 --
NM_006440chr22----1104 --
NM_006449chr242125 1981 1733 1574 --11483 11580
NM_006454chr492858 2153 2074 1985 1944 945 806 86 57 12413 32886 2335 2243 32546 555 189
NM_006455chr171918 --1828 --
NM_006458chr113344 333 261 --2139 135 --
NM_006459chr1021896 118 ----11908
NM_006460chr1711314 --1300 11577
NM_006464chr294409 3769 2941 2871 1758 1604 1477 294 100 13749 51626 1615 1592 384 167 --
NM_006465chr15172268 2187 2141 1995 1783 1768 1708 1425 866 831 811 597 480 422 349 271 34 21942 293 42180 1997 822 360 1509
NM_006475chr131195 ------
NM_006478chr22384 64 36 ------
NM_006480chr5----2360 107 --
NM_006483chr192333 82 --243 27 --
NM_006484chr192333 82 --243 27 --
NM_006489chr1441604 1373 1272 1260 --21739 38 11746
NM_006494chr194761 672 112 104 1769 2638 126 1641
NM_006496chr11336 ------
NM_006497chr171134 1629 7755 656 651 647 562 303 272 --
NM_006500chr1151008 357 257 214 102 --2530 25 --
NM_006509chr19--1381 3336 332 100 --
NM_006516chr151472 1424 1324 521 483 11016 11335 1524
NM_006517chrX122075 1971 1757 1501 1463 630 614 577 312 267 182 40 2519 221 1585 1917
NM_006520chrX1459 ------
NM_006521chrX21286 1075 --31103 508 192 187
NM_006526chr2031481 725 620 ------
NM_006527chr42277 37 ------
NM_006529chr411522 --11681 --
NM_006532chr1971690 1463 1394 584 423 271 239 --2427 181 --
NM_006534chr2042604 2283 2216 2123 1260 21176 204 --
NM_006540chr81267 ------
NM_006544chr1435676 5298 5244 15392 --15128
NM_006546chr17206516 6277 6217 6069 5938 5537 5525 5216 4239 4155 2645 2504 2152 2144 1516 1416 766 422 277 21 56521 4360 4353 4222 1422 126000 5952 5513 5161 4348 4218 4213 2345 1553 789 787 65 25965 4562
NM_006547chr71275 ------
NM_006548chr32287 228 ----147
NM_006555chr751961 1715 1513 620 466 --11717 --
NM_006557chr931204 1104 497 --1487 21128 269
NM_006559chr13810 138 131 21136 64 ----
NM_006561chr1085047 4977 4904 4340 4269 2441 1110 394 25929 4922 65122 5030 4738 4280 4275 2255 15003
NM_006562chr104293 112 93 60 ------
NM_006563chr19126 1362 1124 1457
NM_006565chr16172 2363 341 1299 --
NM_006572chr1733399 2188 1258 2461 260 ----
NM_006577chr24953 321 265 142 1343 ----
NM_006584chr17125 ------
NM_006589chr1--1426 --1139
NM_006595chr1121352 439 --31910 1904 1356 --
NM_006599chr16107547 7390 6325 5866 5566 5152 2578 1758 1154 1083 27185 775 47562 7557 7555 7551 --
NM_006601chr12--11128 ----
NM_006603chrX11815 1759 ----
NM_006608chr1----125 --
NM_006609chr21342 ------
NM_006612chr173472 375 75 --1458 1464
NM_006618chr131309 1054 333 --21592 430 --
NM_006621chr121814 1631 11345 1599 21609 244
NM_006624chr102850 171 196 31603 859 854 --
NM_006625chr11151 ------
NM_006625chr11151 ------
NM_006625chr11151 ------
NM_006626chr931048 793 256 ------
NM_006628chr1564220 4012 3522 3192 1835 1155 54239 3690 3555 1742 748 --14650
NM_006633chr5--1722 ----
NM_006640chr1781855 1306 705 412 263 191 157 122 --41563 1368 1193 615 2721 66
NM_006646chr1342051 1140 789 745 --11238 --
NM_006650chr5123485 3316 3253 2628 2586 2533 1032 638 304 166 142 120 23629 3608 4884 882 591 155 --
NM_006651chr4111508 1474 1372 1300 1225 1201 962 559 497 147 56 --2431 42 11288
NM_006653chr62135 26 --2277 82 --
NM_006654chr1284276 4168 4143 4135 3034 1845 1212 533 13191 23041 2983 14146
NM_006662chr162126 46 1135 ----
NM_006675chr12123207 3161 2908 2807 2531 2251 1310 1228 1113 1019 984 85 --83261 3006 2851 2849 2821 1314 988 319 22483 1025
NM_006690chr2082283 2059 1980 1925 939 929 486 372 --31984 786 50 --
NM_006694chr13287 272 259 ------
NM_006695chr172238 97 ------
NM_006698chr2031125 423 390 --2373 270 1396
NM_006706chr51560 ------
NM_006708chr641084 992 304 260 --1134 --
NM_006709chr6155 --2108 23 --
NM_006722chr322382 509 1778 12388 --
NM_006724chr61180 1104 ----
NM_006726chr421108 914 --2829 824 --
NM_006735chr7----2117 112 --
NM_006736chr281758 742 610 602 530 439 432 118 1708 2750 615 2536 134
NM_006742chr16122009 1457 1317 779 713 663 614 563 436 424 318 258 31715 1337 571 41493 785 783 78 --
NM_006749chr82981 130 --1185 1135
NM_006750chr16147999 7523 6230 3186 3177 2745 2356 1804 1744 1722 578 428 372 91 97307 7045 5470 3153 2203 2049 1999 606 519 17157 2431 111
NM_006754chr7--1280 ----
NM_006756chr811290 --1146 --
NM_006761chr172736 721 --5742 725 711 705 43 1629
NM_006763chr182004 1722 1710 1606 1301 561 431 202 --31683 1547 1434 11743
NM_006766chr862619 2587 1796 1647 620 447 --22623 655 --
NM_006769chr1----1151 --
NM_006772chr6151647 1577 1570 1531 1445 1312 1270 1240 1202 668 456 435 280 118 106 --81651 1581 1557 1436 1189 1075 590 224 1206
NM_006775chr662067 1997 1210 812 327 176 ----12011
NM_006777chrX42872 2837 1085 535 --2546 195 1360
NM_006778chr631317 1249 23 ------
NM_006788chr1841870 828 558 427 1465 --11875
NM_006795chr11111409 1242 1113 1099 1085 566 484 465 418 264 119 11372 31248 526 521 --
NM_006801chr194517 439 130 24 ------
NM_006802chr12397 44 21163 71 1382 --
NM_006805chr51179 --3671 190 104 --
NM_006807chr17--1362 ----
NM_006809chr202726 365 2699 140 1119 --
NM_006814chr20112252 2132 970 685 571 523 263 241 180 141 32 1272 12136 --
NM_006816chr51220 ------
NM_006818chr15826 664 373 243 45 1934 297 60 150
NM_006819chr111384 --122 1275
NM_006822chr173132 96 35 ------
NM_006823chr821342 531 1869 --11147
NM_006826chr221104 186 --1411 --
NM_006827chr1463200 2604 2572 2264 826 433 32740 349 24 13034 --
NM_006838chr1241710 1535 397 376 --1223 11713
NM_006841chr34775 611 507 141 1501 1283 1529
NM_006851chr1222749 405 --22082 2080 --
NM_006852chr1762561 2365 2226 723 694 589 --31142 595 593 12456
NM_006854chr732028 1557 1541 --21561 679 --
NM_006856chr121874 2371 197 51158 1104 884 880 365 179
NM_006861chr1251513 542 495 152 114 --8573 568 387 375 218 200 163 42 11317
NM_006873chr263316 3001 2256 878 601 446 1365 ----
NM_006874chr4------11222
NM_006875chrX4797 770 212 189 2357 217 1875 1192
NM_006884chr33760 110 58 --11412 --
NM_006885chr1693512 3442 2935 1516 1365 1356 1112 1042 302 33521 1128 1106 22870 2823 --
NM_006887chr22738 459 --1183 --
NM_006888chr1473456 3374 3176 2560 2445 2192 32 --12382 11002
NM_006889chr35578 443 292 152 135 1352 ----
NM_006892chr204920 368 190 131 --31032 903 306 --
NM_006892chr204920 368 190 131 --31032 903 306 --
NM_006896chr731074 1062 233 11139 122 1428
NM_006898chr24577 170 124 40 --2225 98 --
NM_006901chr153504 162 22 ----1360
NM_006906chr114374 154 120 101 ----1774
NM_006908chr771396 1279 1249 1001 980 474 436 ------
NM_006913chr64434 338 328 96 --169 --
NM_006917chr1122 --1101 --
NM_006920chr2------1539
NM_006922chr21156 12600 ----
NM_006924chr1753766 3760 2804 1378 163 --2989 697 --
NM_006930chr541780 1699 1234 641 ----11785
NM_006931chr1271665 1583 1574 427 291 47 22 --249 26 --
NM_006937chr171564 --1140 --
NM_006940chr1241598 1452 1250 555 ------
NM_006943chr20163057 3042 2828 2621 2115 1034 799 670 530 511 442 373 286 278 266 101 --183127 2840 2818 2627 2623 1054 988 977 457 453 355 329 307 238 222 202 161 120 1742
NM_006946chr112177 77 1424 4491 487 229 32 1232
NM_006950chrX7864 773 729 315 169 103 41 2689 127 2633 359 1595
NM_006958chr8143 185 1148 --
NM_006981chr952789 753 654 97 31 12669 1740 --
NM_006987chr1781230 1187 1179 207 171 144 65 28 1841 61124 489 487 483 481 248 31172 526 254
NM_006990chr1132533 2491 2155 1872 1718 658 612 508 330 240 185 163 40 22339 2083 1187 1663
NM_006996chr1--1699 ----
NM_007005chr931034 1004 34 1153 1385 --
NM_007008chr2--1589 ----
NM_007011chr15136469 5848 5490 4532 4239 2718 2654 2001 1560 1242 1087 253 83 115077 5040 5000 4962 4883 4583 4394 2680 635 492 77 54537 4176 1982 645 36 31961 1113 438
NM_007013chr8--21012 115 1416 --
NM_007024chr32469 30 158 --136
NM_007026chr172478 104 --168 --
NM_007027chr31137 ------
NM_007030chr5125075 4639 4494 4472 3246 3149 1473 995 688 512 360 147 44302 938 379 164 63193 1441 1188 890 160 151 44529 973 226 191
NM_007036chr51823 ------
NM_007039chr1412052 --32067 2063 2057 --
NM_007040chr198989 920 304 258 242 144 126 45 61105 936 911 423 391 252 4888 351 164 70 1364
NM_007042chr322493 403 22469 2109 ----
NM_007045chr61399 1545 ----
NM_007050chr20147776 5940 5603 5074 5049 3230 2789 2731 1450 1426 1160 781 753 480 26667 5736 55345 2823 2733 617 380 17146
NM_007052chrX--1109 --1391
NM_007054chr512728 22895 878 13605 --
NM_007067chr1771439 1295 1278 1210 1119 318 306 --21532 1079 21281 1108
NM_007084chr132564 74 --31238 447 87 11201
NM_007106chr1322628 2432 ------
NM_007107chr322314 875 1433 ----
NM_007112chr11162 ------
NM_007114chr3--12781 ----
NM_007115chr2--1178 ----
NM_007122chr11246 --1587 --
NM_007124chr61219 ------
NM_007125chrY1407 1118 ----
NM_007126chr9----2380 376 --
NM_007129chr134654 376 366 289 --5853 209 55 26 24 --
NM_007144chr1751085 961 400 38 21 3950 100 49 31272 484 472 --
NM_007146chr1762667 2640 2188 1101 1061 380 --1932 22793 939
NM_007158chr141114 1008 144 77 --191 --
NM_007159chr3131 --11778 --
NM_007162chr66580 511 202 119 78 67 --3241 239 123 2473 72
NM_007166chr112595 256 ------
NM_007170chr14784 273 188 85 1248 2788 260 --
NM_007172chr2233141 2283 427 12996 1187 --
NM_007174chr1271714 1554 806 693 571 222 109 21594 1527 31850 1845 785 1699
NM_007178chr12--171 ----
NM_007181chr19--1146 1105 --
NM_007182chr32713 201 --2648 111 --
NM_007185chr16809 683 433 340 197 173 2223 54 174 1159
NM_007189chr761377 587 559 249 202 128 1207 1130 --
NM_007192chr1461045 1001 894 440 414 36 ------
NM_007202chr173775 648 605 --1684 --
NM_007203chr963351 2931 2559 1383 518 337 ----12860
NM_007207chr12276 33 1198 --1799
NM_007212chr11908 ------
NM_007217chr3----199 --
NM_007219chr203924 836 289 --3932 926 664 --
NM_007221chr12406 287 --1298 --
NM_007222chr811816 ------
NM_007224chr126638 591 506 207 65 30 2469 109 1623 168
NM_007232chr203303 165 35 1329 2718 125 --
NM_007236chr1551715 1562 436 254 59 41730 1595 1582 101 1374 --
NM_007245chr162180 130 1759 1169 2751 367
NM_007247chr172831 100 --1716 --
NM_007249chr1397880 7514 7410 6861 5822 2082 1384 1356 77 47273 6216 1324 396 --29162 6671
NM_007271chr641246 1171 1155 639 21634 64 ----
NM_007275chr34937 825 817 451 --1915 1245
NM_007278chr174151 143 100 72 --1339 --
NM_007282chr3175 ------
NM_007286chr562132 2035 722 695 616 290 1664 62026 2024 1315 479 474 212 31872 619 293
NM_007287chr352386 2321 2303 2038 1293 32914 1973 484 --12899
NM_007288chr352386 2321 2303 2038 1293 32914 1973 484 --12899
NM_007289chr352386 2321 2303 2038 1293 32914 1973 484 --12899
NM_007292chr1774424 4393 3629 3597 3317 3303 553 74875 4560 3749 3617 3547 3463 721 13932 23449 405
NM_007294chr1731277 440 195 185 ----
NM_007295chr1731277 440 195 185 ----
NM_007296chr1731277 440 195 185 ----
NM_007297chr1731277 440 195 185 ----
NM_007298chr1731277 440 195 185 ----
NM_007299chr1731277 440 195 185 ----
NM_007300chr1731277 440 195 185 ----
NM_007302chr1731277 440 195 185 ----
NM_007303chr1731277 440 195 185 ----
NM_007304chr1731277 440 195 185 ----
NM_007305chr1731277 440 195 185 ----
NM_007308chr41182 ------
NM_007320chr191238 --2248 243 --
NM_007322chr194554 427 380 238 --1559 1383
NM_007327chr971191 1149 952 888 868 434 127 2852 288 51114 916 829 754 32 --
NM_007345chr1841677 589 262 250 ------
NM_007350chr1224321 102 34396 3191 1621 ----
NM_007353chr772328 2102 2016 834 736 661 430 2627 560 11154 42383 904 739 664
NM_007363chrX2728 433 197 ----
NM_007365chr1112044 1709 1661 1596 1466 840 729 626 586 484 29 31873 848 536 2153 53 11599
NM_007371chr9164 ------
NM_007375chr142591 2039 1880 492 ------
NM_012069chrX41941 1909 273 233 42705 2077 714 405 1623 12567
NM_012074chr149824 768 758 727 171 151 132 111 42 1140 2959 160 --
NM_012081chr532274 191 160 22329 695 ----
NM_012090chr11196 1862 ----
NM_012098chr931191 332 24 --11388 1191
NM_012102chr172618 2399 2250 2156 344 268 204 ------
NM_012104chr1172398 2382 1520 1443 1390 1242 1220 --52461 2451 1448 1229 115 --
NM_012104chr1172398 2382 1520 1443 1390 1242 1220 --52461 2451 1448 1229 115 --
NM_012110chr4169 ------
NM_012115chr61404 ------
NM_012134chr141593 1229 377 204 157 11239 --
NM_012141chr1343195 2862 1001 246 ----11497
NM_012154chr82589 152 --183 --
NM_012158chr1311529 --21606 1320 --
NM_012161chr4--21035 807 ----
NM_012164chr9106692 6678 6134 6082 5694 2294 2040 1665 1545 1146 46325 6254 2462 2327 21553 790 --
NM_012166chr931463 457 444 --294 88 41318 1023 480 449
NM_012168chr11110 1115 293 22 --
NM_012181chr19126 --4374 306 106 89 --
NM_012183chr13446 165 125 --1127 --
NM_012189chr182428 151 ------
NM_012193chr11155150 4902 4804 4796 4632 4421 4372 4046 4014 3604 3576 3331 1624 1515 686 24179 146 --24997 3579
NM_012199chr1164257 4080 4055 3953 3829 3598 2921 1476 1438 1153 1093 1068 753 673 638 601 23648 1087 44114 1527 1480 782 24453 1307
NM_012214chr235006 733 383 23954 154 22517 2422 12319
NM_012215chr10--1401 ----
NM_012218chr1942795 1926 275 94 42240 2224 1100 1078 ----
NM_012232chr1762077 2054 1887 1806 332 40 12184 81892 1849 1847 1621 1455 334 321 115 --
NM_012234chr321503 598 ------
NM_012242chr10--1133 ----
NM_012244chr14131658 1648 1634 1567 1504 701 624 506 496 362 288 54 28 21497 192 71664 1476 1428 1289 520 344 99 21369 349
NM_012247chr102750 648 ------
NM_012249chr233099 2523 384 ----12275
NM_012250chr11159 ----11108
NM_012257chr71871 ------
NM_012259chr6141 --1178 --
NM_012272chr122410 353 1151 ----
NM_012281chr732150 1668 980 11763 ----
NM_012282chrX4769 664 299 196 272 65 135 189
NM_012287chr364158 4150 1354 1316 442 344 11489 --11553
NM_012288chr6184641 4522 4153 4047 3950 3935 3878 3757 3588 3572 2304 2262 2226 2019 1825 242 226 80 64791 4745 3640 2214 1864 769 84895 4893 2029 2023 1914 1261 1239 72 14953
NM_012296chr11143360 3004 2915 2845 2831 1526 1487 848 418 396 191 98 61 52 63378 2682 2644 2629 2535 88 93494 3431 3194 2488 157 75 73 68 66 33251 2963 55
NM_012297chr42806 768 ------
NM_012298chr32287 65 --1217 1102
NM_012300chr551812 1660 1578 212 187 21642 745 2921 247 11818
NM_012301chr751772 1531 1462 616 317 --11551 --
NM_012304chr5102477 2363 1001 933 924 897 604 443 434 297 22335 1957 2390 386 1927
NM_012306chr12223557 3316 3305 3210 3168 3121 3068 2812 2407 2346 2296 2269 2229 1311 1228 1180 1077 1008 896 434 150 27 42922 2590 829 376 93542 3408 3125 2409 2260 1035 657 62 45 13399
NM_012307chr18180 1176 ----
NM_012308chr11112087 1823 1675 970 908 588 455 193 119 67 40 3957 822 548 9808 590 580 576 471 348 195 137 111 1200
NM_012309chr11103976 3880 3816 3550 1501 1411 1362 608 491 378 44196 3372 916 462 24170 3798 --
NM_012311chr101588 ------
NM_012316chr1163878 3870 3689 3682 1991 1920 1871 1641 1566 1317 974 754 745 402 171 63 53640 2207 860 821 606 73558 2052 1680 703 699 380 153 --
NM_012323chr2251077 484 363 132 35 --31039 1013 52 1374
NM_012325chr2011107 --11259 --
NM_012326chr24707 626 46 36 2764 272 2775 50 --
NM_012330chr1021663 260 --1380 --
NM_012333chr1--11562 11298 --
NM_012334chr553079 3061 1564 364 49 53957 3093 1714 1597 427 13970 --
NM_012340chr202264 82 1193 ----
NM_012384chr2072186 1783 985 786 615 558 219 42230 2032 1773 514 --1880
NM_012395chr763002 2355 2293 2108 1164 313 12195 52382 2333 2325 2321 2317 12308
NM_012398chr19102784 2647 2370 2278 2016 1077 928 735 729 131 31896 659 178 42375 517 228 164 --
NM_012399chr2211438 --21800 1549 11448
NM_012402chr112416 100 1243 ----
NM_012406chr1211201 21133 980 ----
NM_012407chr223419 210 122 --3227 222 218 --
NM_012410chr164484 467 123 87 --4456 99 45 40 1370
NM_012417chr17--1604 ----
NM_012420chr10139 41967 1754 1428 776 ----
NM_012421chr11175 ------
NM_012423chr191159 --144 --
NM_012425chr102559 44 31736 142 29 ----
NM_012428chr151144 --188 --
NM_012434chr631486 1240 315 --1524 --
NM_012446chr5146 --2439 145 --
NM_012448chr1752551 2164 2041 686 241 22226 1840 61719 695 690 547 545 541 1246
NM_012456chr11142 ----145
NM_012461chr145659 557 476 269 190 1137 2466 50 1256
NM_012464chr422026 1171 ----12231
NM_012473chr224672 557 217 87 3594 515 266 3241 91 76 3508 222 63
NM_012475chr11237 1182 ----
NM_012478chr177833 643 408 324 297 230 101 3688 190 24 --152
NM_012479chr722208 2188 11848 21767 941 1109
NM_013230chrY2589 35 ------
NM_013231chr1453302 3237 2811 1200 700 11155 23437 1026 --
NM_013233chr231149 968 59 190 168 --
NM_013236chr222471 352 11118 ----
NM_013243chr151165 ------
NM_013245chr164726 260 226 121 ----1547
NM_013246chr113292 162 31 1172 ----
NM_013247chr22114 42 ------
NM_013252chr732669 869 476 ----1445
NM_013257chr81303 ----12033
NM_013261chr4--13017 164 --
NM_013269chr1254290 4282 4261 4242 3963 44087 3626 1259 200 24296 4294 --
NM_013275chr16------1155
NM_013277chr122165 78 125 1170 --
NM_013279chr11122220 2140 2096 2058 1641 1621 1600 732 612 370 361 228 22198 2127 32045 1537 500 11626
NM_013305chr181202 1921 3116 55 41 --
NM_013309chr1522033 827 ------
NM_013316chr74909 134 83 55 ----160
NM_013323chr1751116 991 964 477 259 --31121 1100 1095 --
NM_013341chr232794 1155 1119 12562 22024 1159 11130
NM_013346chrX268 25 ------
NM_013353chr1288 65 ------
NM_013354chr811354 --1375 1380
NM_013357chr82868 704 ----1204
NM_013365chr222159 127 1748 1165 --
NM_013368chr194494 442 115 28 ------
NM_013372chr1551341 600 472 464 121 --1343 --
NM_013373chr221936 --4829 811 303 67 --
NM_013381chr1222113 215 ------
NM_013382chr1472118 2058 1817 1752 1629 1598 828 141 52023 1767 1763 1758 560 22028 565
NM_013392chr2----6174 169 110 105 72 63 --
NM_013396chr212270 61 21292 338 ----
NM_013400chr75967 914 696 336 300 1763 21060 751 1680
NM_013403chr193845 764 743 --3614 180 164 2816 563
NM_013417chr9----135 --
NM_013423chrX2260 46 ------
NM_013427chrX2260 46 ------
NM_013433chr1951942 1925 1878 1448 533 11285 51934 1432 1346 182 141 --
NM_013434chr2101939 1742 1642 1464 1300 797 696 586 452 247 11891 11746 21770 250
NM_013434chr2101939 1742 1642 1464 1300 797 696 586 452 247 11891 11746 21770 250
NM_013438chr911296 1642 11300 --
NM_013443chr96996 986 903 891 360 143 1110 ----
NM_013444chrX4277 251 225 171 11002 4236 214 210 160 1165
NM_013446chr72421 86 1101 ----
NM_013448chr14----1680 --
NM_013449chr12132815 2717 2374 2114 853 840 828 660 627 339 324 176 37 52994 821 646 565 48 5832 632 531 185 180 32379 2117 845
NM_013450chr2------21052 360
NM_013951chr2112456 2303 2175 851 694 584 513 503 475 437 197 12186 32237 959 856 --
NM_013952chr2112533 2380 2252 928 771 661 590 580 552 514 274 12263 32314 1036 933 --
NM_013953chr2112533 2380 2252 928 771 661 590 580 552 514 274 12263 32314 1036 933 --
NM_013958chr8143 ------
NM_013959chr8143 ------
NM_013960chr84569 291 166 102 2258 149 ----
NM_013961chr8143 ------
NM_013962chr8143 ------
NM_013992chr2112533 2380 2252 928 771 661 590 580 552 514 274 12263 32314 1036 933 --
NM_013993chr64525 269 220 173 1591 6278 207 182 98 92 24 --
NM_013994chr64525 269 220 173 1591 6278 207 182 98 92 24 --
NM_013999chr17101381 1105 1099 517 398 363 242 142 116 23 21288 367 1124 --
NM_014000chr1061493 1257 735 495 353 241 1452 31751 610 500 11499
NM_014002chr15539 479 290 168 115 1155 2631 119 --
NM_014010chr9137 ------
NM_014011chr21480 21822 410 ----
NM_014015chr16123 --1134 --
NM_014016chr311392 ------
NM_014021chr143349 2328 138 129 --11318 --
NM_014023chr1021051 655 31879 1134 250 ----
NM_014028chr622581 552 12596 11333 --
NM_014030chr1791139 1051 870 858 828 802 352 245 225 --61123 989 813 745 479 419 1253
NM_014034chr621129 970 1334 ----
NM_014038chr72292 126 ------
NM_014042chr111220 ------
NM_014048chr1664515 4310 3814 1656 1413 1114 11709 ----
NM_014056chr321763 1724 41894 1732 1438 487 21576 1572 --
NM_014079chr3183 2814 335 2715 267 --
NM_014106chr1532330 1921 689 2939 823 ----
NM_014109chr81357 1455 1451 1413
NM_014112chr843861 1106 857 132 --1667 1516
NM_014117chr1642244 1782 1045 94 1749 21055 1036 --
NM_014141chr733901 3504 212 55056 4849 3943 3911 1241 24224 4204 --
NM_014149chr71594 1202 ----
NM_014153chr161121 ------
NM_014154chr3--2607 311 ----
NM_014157chr1693246 3177 2865 2487 1565 1434 1346 628 553 33270 925 80 31275 1271 544 32621 831 278
NM_014166chr132819 809 ------
NM_014178chr141242 ------
NM_014182chr123725 501 241 --1475 --
NM_014186chr1192339 2161 2075 1719 598 577 539 520 61 22174 2122 12111 --
NM_014188chr12269 59 --3310 306 302 --
NM_014190chr441654 1359 740 463 2559 106 51724 701 673 592 63 --
NM_014203chr192264 134 --1305 2296 271
NM_014212chr125945 788 614 171 162 --1387 1948
NM_014217chr13740 504 271 1580 1530 --
NM_014223chr14685 508 110 76 1640 1510 --
NM_014231chr12141925 1894 1844 1712 1699 1615 1582 1485 476 233 133 98 83 59 22029 1958 --21805 1670
NM_014232chr17131630 1493 1031 438 413 398 381 360 313 273 253 62 39 41379 1036 386 70 81344 1211 423 343 278 262 240 41 --
NM_014232chr17131630 1493 1031 438 413 398 381 360 313 273 253 62 39 41379 1036 386 70 81344 1211 423 343 278 262 240 41 --
NM_014233chr1751372 360 219 107 75 21782 1362 61728 1633 1526 527 525 51 21636 418
NM_014234chr62172 55 ------
NM_014238chr175572 545 280 248 178 3404 379 41 2386 186 --
NM_014240chr3103378 1597 1143 1052 683 668 636 309 299 179 33517 3366 2869 23578 449 --
NM_014243chr431541 169 51 21752 59 ----
NM_014245chr33824 792 225 1960 ----
NM_014251chr72818 210 --3692 314 62 --
NM_014252chr131126 ------
NM_014253chrX3714 632 554 11775 1537 --
NM_014263chr1011313 --11179 --
NM_014271chrX1179 ------
NM_014275chr54892 829 818 751 --3931 782 663 --
NM_014283chr1------1356
NM_014284chr161036 907 821 424 106 65 --21040 94 --
NM_014286chr9183577 3508 3112 3094 2904 2831 2811 2532 2515 2437 1173 973 924 908 309 262 152 41 --93230 2761 2756 2680 1274 1233 1229 1216 158 --
NM_014289chrX51242 1181 958 354 125 31003 448 151 21257 1214 11123
NM_014292chr22101578 1565 1413 1232 687 668 549 500 412 322 --81795 1679 1616 1611 1493 94 90 40 21571 285
NM_014293chr22124003 3720 3366 3307 1384 1088 1046 580 570 561 539 420 53862 3472 3448 2724 126 134005 3980 3743 3722 3701 1031 767 485 276 101 97 71 27 23797 3282
NM_014299chr19132075 2065 2043 1946 1758 1401 860 762 653 432 400 264 227 1580 1436 153
NM_014305chr13----1257 --
NM_014309chr22125338 5083 4975 4922 4912 4369 4032 3896 1867 1285 598 590 --75190 5076 5071 4458 3900 3464 602 24986 1375
NM_014316chr1671997 1933 1829 706 477 369 363 52196 2178 1859 654 217 21788 1783 1122
NM_014319chr12----11880 --
NM_014323chr221408 1163 --2415 386
NM_014332chrX1101 ------
NM_014333chr112850 359 22254 396 21987 441 --
NM_014335chr1521000 991 ------
NM_014342chr1121322 578 11482 11326 --
NM_014345chr63945 393 161 1276 ----
NM_014352chr1141289 619 608 249 21174 1015 --1226
NM_014360chr143630 102 91 --2207 197 --
NM_014368chr941898 1615 1343 210 --21617 167 11622
NM_014374chr75967 914 696 336 300 1763 21060 751 1680
NM_014376chr592253 2171 2116 2081 1791 481 344 259 124 4559 522 348 335 2583 493 1171
NM_014388chr174988 4802 4520 3849 3688 2327 2002 66034 4391 3744 3709 2171 2035 23869 3864 --
NM_014393chr832297 1713 371 ----12060
NM_014397chr941407 1243 996 330 11198 ----
NM_014400chr192412 57 ----128
NM_014408chr13535 75 68 ------
NM_014409chr12293 146 --3851 113 105 --
NM_014415chr321383 1162 ----11386
NM_014417chr192381 59 ----153
NM_014418chr1431866 1374 472 1661 31458 1454 1302 --
NM_014421chr411349 31756 1706 1393 ----
NM_014423chr554689 4526 3756 1381 1183 --21658 1656 --
NM_014426chr202541 252 --1666 --
NM_014431chr1021582 361 --1366 --
NM_014437chr1154 --263 58 --
NM_014445chr312206 ------
NM_014447chr411558 ------
NM_014450chr9----1205 --
NM_014454chr62884 291 ------
NM_014458chr131274 1268 253 2883 258 ----
NM_014469chr111295 ------
NM_014470chr122637 40 ------
NM_014491chr71770 ------
NM_014494chr1652074 2051 1910 414 315 --11857 11850
NM_014501chr19139 --151 --
NM_014507chr226914 824 493 451 444 206 ------
NM_014515chr1221075 31 ------
NM_014516chr19----3203 195 31 --
NM_014517chr3--11237 --21460 1267
NM_014553chr293004 2513 1196 878 517 433 381 369 208 --1212 --
NM_014554chr1232015 1606 94 --21411 550 --
NM_014563chrX31374 702 670 31407 504 340 ----
NM_014570chr222307 210 --1224 --
NM_014573chr1751834 1339 708 437 265 21568 294 ----
NM_014575chr31430 ------
NM_014584chr1421502 1363 21280 1267 ----
NM_014587chr1631472 1252 264 --2200 198 --
NM_014591chr1051070 919 347 106 73 2296 81 51281 1047 844 267 234 21237 391
NM_014592chr51291 ----1745
NM_014604chr174557 196 146 38 1159 3818 539 151 --
NM_014606chr451257 1119 962 463 30 --21029 505 --
NM_014612chr921181 139 ------
NM_014613chr552643 2310 2133 2070 1905 1279 1253 32168 708 26
NM_014614chr2--2589 407 ----
NM_014620chr12--2611 130 4693 197 192 45 1202
NM_014621chr2----2172 28 --
NM_014623chr6195 ------
NM_014630chr1583820 3433 2505 2471 982 929 474 417 22685 270 43461 3276 3070 530 --
NM_014632chr11393 77 25 --261 29 170
NM_014634chr2273579 3289 2741 1108 642 626 451 33624 2840 35 73204 3200 2907 1113 53 30 25 --
NM_014636chr9114233 4123 3457 2710 1357 1099 978 884 837 779 650 23017 1732 83135 2877 2873 2714 980 871 842 260 1887
NM_014640chr21210 --1113 --
NM_014641chr61526 1397 --126
NM_014644chr11128 1301 ----
NM_014646chr1882494 2220 2117 2086 862 645 615 137 2650 290 3242 95 41 22832 149
NM_014647chr1631556 1547 712 ------
NM_014657chr202342 325 --137 --
NM_014659chr151847 ----1129
NM_014660chr71369 ------
NM_014661chr10163853 3751 3538 3477 3295 3004 2450 2382 1274 1029 822 752 694 626 515 427 21256 205 --1507
NM_014663chr111056 1220 ----
NM_014665chr8143501 3315 3294 2756 2679 2563 2495 2370 2348 830 660 365 350 152 42527 2287 843 706 63557 3528 3296 2310 1220 367 --
NM_014666chr511257 ------
NM_014667chr311675 12315 12281 --
NM_014670chr22259 92 1297 ----
NM_014674chr3113664 3506 3206 3180 3165 2874 2835 640 474 242 177 ------
NM_014676chr12449 441 --21411 131 11385
NM_014677chr831110 1058 1035 --1498 --
NM_014678chr222592 46 1190 ----
NM_014682chr81538 ------
NM_014683chr1721897 1886 11483 --11900
NM_014686chr1922177 811 21853 821 2422 413 --
NM_014690chr7112864 2774 2739 2246 1178 1169 1124 941 819 409 133 62118 2043 1228 1189 1138 27 42758 2251 70 66 --
NM_014700chr1661467 1000 459 396 358 273 41261 1234 416 292 1617 --
NM_014701chr1533240 1210 373 11001 --13256
NM_014702chr633292 2953 2462 ------
NM_014707chr712263 1347 1474 --
NM_014711chr1611775 ------
NM_014712chr162412 178 ----1504
NM_014723chr20173141 2961 2700 2661 2636 2621 2601 2581 2312 2297 2078 2045 1277 1124 569 473 282 32926 882 76 23082 68 12964
NM_014726chr1771238 1151 977 494 284 154 39 1913 31250 394 286 31154 980 276
NM_014727chr192243 36 ----189
NM_014729chr82435 216 ------
NM_014730chr12165058 4824 4763 3847 3837 3732 3680 3649 3444 3321 1474 923 814 627 275 211 34869 4856 1904 83747 3742 3599 3241 1486 1311 1307 927 35224 4963 819
NM_014730chr12165058 4824 4763 3847 3837 3732 3680 3649 3444 3321 1474 923 814 627 275 211 34869 4856 1904 83747 3742 3599 3241 1486 1311 1307 927 35224 4963 819
NM_014731chr2091533 1521 1502 1441 1251 701 476 144 84 31445 1357 407 6575 501 497 480 149 68 31238 485 163
NM_014735chrX31810 1537 1451 --21453 1416 --
NM_014741chr1162105 1478 1365 338 323 161 3302 127 62 32089 1690 369 --
NM_014742chr2081254 1117 585 576 570 561 471 259 11472 21450 473 --
NM_014746chr263200 3046 1699 891 820 78 43368 3233 2873 1134 33977 63 52 1827
NM_014747chr1225417 5386 5141 5124 4318 4118 3966 3958 3858 3689 3648 2104 1782 1592 1255 1226 1217 901 814 718 549 63 34661 3970 1835 74919 4451 4446 4442 2050 1467 485 34934 4611 3709
NM_014751chr822147 2090 2848 769 12092 22152 1428
NM_014755chr253828 3450 3439 1237 1004 21565 1437 22875 1530 --
NM_014757chr551803 1708 943 831 714 31835 1763 752 21635 747 1726
NM_014761chr165435 306 284 159 138 --11057 --
NM_014764chr122515 191 ------
NM_014765chr121060 722 22534 2078 1543 --
NM_014766chr7123525 3476 1265 1254 594 491 481 195 175 113 75 23 2628 40 32829 792 577 --
NM_014767chr10183166 3067 2861 2731 2700 2648 2347 2250 1399 1362 1331 1286 1164 701 486 406 299 291 33574 3096 585 12711 --
NM_014770chr1241149 1039 178 91 1157 61100 992 964 224 184 182 31042 997 499
NM_014771chr165885 688 287 91 62 1815 --1691
NM_014774chr183026 2868 2824 2799 2643 2201 266 93 --22203 865 --
NM_014776chr1262426 1244 1218 1061 926 22 12064 42641 2621 2128 768 --
NM_014779chr32344 158 ----1307
NM_014784chr17808 712 430 388 221 95 39 --5976 744 740 435 206 --
NM_014786chr117991 972 943 885 200 192 59 --161 1420
NM_014798chr1771789 1782 1692 1510 1287 1232 205 21551 152 41794 1400 1278 194 --
NM_014800chr73458 307 128 1227 3469 328 323 2295 29
NM_014802chr1221022 216 ------
NM_014803chr101832 12098 1357 1647
NM_014807chr116598 590 338 281 101 51 --5715 623 619 603 67 157
NM_014810chr183456 2817 2609 2586 1416 1359 1269 60 ------
NM_014812chr141934 1755 502 289 ------
NM_014819chr51273 ------
NM_014820chr341905 1368 48 27 ------
NM_014824chr1131903 1883 501 1156 --11399
NM_014826chr173458 1562 1424 1376 71 31 24 43657 3468 1149 56 23950 1104 11012
NM_014827chr121472 251 ------
NM_014830chr1293415 2929 2672 2615 1574 1205 1002 927 312 33780 3754 2880 63667 2804 2580 2578 302 77 --
NM_014836chr101131 1528 ----
NM_014838chr2262666 2530 2470 1865 164 128 --22427 1939 --
NM_014839chr111771 --11821 --
NM_014840chr1262889 2739 2363 2298 2291 831 22442 247 ----
NM_014841chr611375 1403 ----
NM_014846chr81249 148 ----
NM_014849chr16911 522 357 307 280 57 --71260 1094 892 888 344 67 62 31187 970 475
NM_014850chr3204786 4697 4556 4481 4437 4403 4303 4281 4111 1865 1857 1614 1478 1457 1345 1318 768 319 292 197 54045 1881 691 545 83 64395 3471 1568 1445 1327 1322 1814
NM_014858chr171186 978 849 813 168 136 99 21090 299 --1870
NM_014870chr1104460 3817 3270 989 856 562 545 230 74 27 33394 1181 659 74618 4492 1316 806 522 500 234 14497
NM_014871chr12----232 30 --
NM_014872chr922041 1555 11625 21931 1927 11936
NM_014873chr161606 1321 1289 854 594 371 ------
NM_014876chr2271937 1603 1530 659 119 91 37 2825 691 123 --
NM_014877chr1767001 6777 5991 1276 958 901 16024 15584 --
NM_014880chr232314 2266 322 22451 2044 ----
NM_014883chr46961 575 548 461 357 115 ------
NM_014887chr132655 638 ------
NM_014888chr721499 489 ----1528
NM_014891chr731112 529 136 --1538 --
NM_014893chrY52166 1575 882 159 29 ----122
NM_014897chr1762582 2292 1100 923 539 97 --22298 2296 --
NM_014901chr551432 750 417 261 103 --91888 1588 1584 1573 752 497 286 265 201 1716
NM_014902chr2041528 1369 1224 471 --61560 1134 580 576 528 410 1173
NM_014903chr122521 430 --1364 --
NM_014905chr231599 684 193 1790 --11579
NM_014906chr1752512 1417 306 293 255 --33373 1369 32 2296 258
NM_014909chr14133962 3821 3730 3644 3357 3264 3227 3167 3140 3072 2579 2477 918 33378 993 413 43900 2778 2770 2674 13360
NM_014912chr1022443 536 ------
NM_014914chr231165 408 122 --31039 126 101 --
NM_014918chr15--1532 11304 --
NM_014921chr19152934 2741 2504 2492 2478 1228 1181 871 861 816 658 505 436 331 112 32946 1246 666 112966 2962 2839 2753 2284 2020 1193 889 688 322 317 1325
NM_014923chr1322270 473 --21714 244 --
NM_014924chr1421982 310 22119 51 ----
NM_014925chr122763 199 3657 380 240 ----
NM_014926chr34897 797 766 747 --1175 1181
NM_014931chr194589 124 52 40 2670 214 1666 --
NM_014932chr31711 ------
NM_014933chr41372 ------
NM_014938chr12102014 1994 1936 1916 1636 800 600 497 251 108 --52016 1853 403 84 46 --
NM_014939chr1811224 11284 ----
NM_014944chr161415 1323 1065 292 223 177 2256 61 31118 1116 120 --
NM_014945chr581289 1279 1252 1236 642 596 442 80 --61851 1240 695 690 644 616 1418
NM_014946chr211025 11145 ----
NM_014947chr152597 2506 1032 1000 205 11168 ----
NM_014949chr11671 ----1766
NM_014950chr1421777 598 ------
NM_014952chr1562034 1373 586 447 384 373 41802 713 682 635 11798 --
NM_014961chr431370 826 190 --1731 --
NM_014963chr194465 418 224 48 2586 230 3433 422 214 1468
NM_014969chr1--2428 414 --1739
NM_014974chr1031476 1311 366 2537 523 ----
NM_014977chr141408 --1207 1212
NM_014978chr1081393 1201 696 378 371 298 244 119 2342 235 ----
NM_014982chr1462140 1139 1108 897 160 149 13756 1663 139
NM_014988chr422067 1133 ------
NM_014989chr641682 1356 619 562 --11360 --
NM_014990chr1431125 435 95 ------
NM_014991chr432145 2095 255 --145 --
NM_014992chr14145 ------
NM_014994chr15172212 2161 2118 2083 1528 1473 912 838 791 783 760 678 631 557 466 225 60 12040 21953 324 2472 136
NM_014996chr351004 844 210 147 126 ------
NM_015000chr1212220 ------
NM_015001chr12926 903 136 ----
NM_015002chr1251664 796 675 194 168 1140 --1665
NM_015008chr373139 1050 1013 963 676 416 33 --23082 418 --
NM_015017chr12342 310 1477 ----
NM_015020chr1642366 1133 610 225 43704 3300 2880 363 1353 --
NM_015023chr1111674 1425 1218 1208 1177 1148 614 308 242 91 46 41716 1684 1455 1274 111695 1691 1463 1431 1241 1220 1140 1136 1132 1126 506 11437
NM_015024chr84974 908 265 147 11125 ----
NM_015025chr22917 897 ------
NM_015026chr1244468 3528 864 121 --14472 --
NM_015027chr1631239 673 379 1633 1531 --
NM_015032chr1321820 517 11949 ----
NM_015033chr9133081 2692 2424 2222 1290 1044 893 799 505 308 141 103 34 21212 1077 4857 349 254 169 --
NM_015039chr183699 3138 1521 1428 588 71 63 36 4400 361 322 283 21297 396 33854 3261 439
NM_015042chr15164260 3845 3671 3661 3640 3442 2894 2830 1744 1513 1490 1482 1433 1342 609 489 33645 2709 1361 43850 3283 3243 855 53323 3261 3100 1496 861
NM_015044chr1693202 2990 2753 2736 2236 2067 2006 771 22 ------
NM_015045chr10----1287 --
NM_015050chr65969 865 345 142 85 11121 1958 --
NM_015051chr942850 2812 962 144 1788 ----
NM_015052chr741233 493 198 90 11381 150 --
NM_015053chr172236 2216 2203 1988 1781 65 27 2601 391 51990 1761 1722 311 81 1514
NM_015054chr121219 ------
NM_015063chr1991342 938 383 346 217 207 196 123 103 21271 1143 71348 498 445 387 297 186 139 --
NM_015064chr12113121 2759 2728 2698 2612 1098 1036 707 141 114 54 2991 701 33022 2255 2253 --
NM_015068chr751524 1317 558 476 123 33876 901 647 23906 3872 --
NM_015069chr162412 25 ------
NM_015074chr1103448 3421 3145 3126 1925 1910 1678 1451 564 121 23154 58 54748 3227 3208 150 125 --
NM_015075chrX112246 2091 1986 1900 1573 854 621 415 367 179 98 1337 82102 2097 2095 1727 1446 818 807 353 3844 795 141
NM_015076chr632991 2856 909 12825 1213 11816
NM_015077chr17234589 4380 4117 3851 3729 3715 3542 3532 3347 3060 3048 2884 2876 1751 1490 1362 1292 819 796 710 476 327 82 23866 1677 104594 4003 3549 2892 2888 1687 1457 650 129 125 12897
NM_015079chr15133178 2777 2434 2402 2350 2309 2267 1080 883 464 450 423 123 22272 656 22314 234 32550 1197 728
NM_015080chr11----7404 173 98 96 72 70 38 1226
NM_015082chr582478 2093 1993 873 656 484 435 315 32506 2399 1851 2678 439 12108
NM_015085chr17174051 3790 3639 3474 3395 3343 1698 1656 1461 1390 1328 1015 832 441 252 237 42 1268 63794 2999 1396 1380 1222 1020 2218 208
NM_015086chr1291587 1441 1390 1372 1170 1003 616 578 67 21282 1050 1560 11008
NM_015090chr1195838 5711 5133 4741 4338 4258 4217 2099 1788 1741 1557 962 758 703 614 596 462 385 190 35220 5200 4849 55929 4721 4597 2467 2086 46019 5178 1130 177
NM_015092chr1654528 3194 2836 993 657 34134 3911 3623 12842 --
NM_015093chr61524 ------
NM_015094chr22244639 4469 4321 4297 4254 3477 3056 2999 2957 2884 1882 1871 1633 1589 1518 815 798 779 677 570 551 219 124 26 13936 84332 4152 4097 3761 2865 1121 487 483 24472 4335
NM_015097chr332294 1520 688 1294 11522 12309
NM_015099chr175685 460 292 134 123 --4465 181 169 141 --
NM_015100chr131719 829 154 11567 41353 748 633 629 11646
NM_015102chr1387 78 23 --159 --
NM_015107chrX92442 1886 1826 1630 1520 575 530 258 151 1873 21660 175 --
NM_015113chr1761915 1881 1832 733 333 106 11705 12052 2573 499
NM_015125chr194460 211 106 82 --4521 215 170 154 1469
NM_015132chr731767 1573 1279 --11783 --
NM_015133chr1671310 1140 938 552 440 142 98 31160 341 110 11122 --
NM_015138chr1592784 2325 2110 792 502 479 197 166 61 42674 940 813 187 22598 202 --
NM_015144chr1643341 2458 870 285 43789 3264 958 823 33225 662 658 1314
NM_015150chr32289 126 ----1152
NM_015155chr1042480 980 904 156 --22967 2765 162
NM_015156chr144636 627 283 176 31567 324 195 1285 1642
NM_015157chr1161108 1099 1073 927 152 104 1409 51003 775 773 324 260 21114 780
NM_015163chr1441832 507 499 179 ------
NM_015171chr162414 147 3112 78 62 ----
NM_015172chr11594 ------
NM_015176chr111260 ------
NM_015178chr8112376 2127 2093 1959 1940 1888 1869 950 713 609 58 1312 2829 725 --
NM_015185chrX82660 2323 2211 2175 1900 942 561 518 11010 42748 2328 960 315 12315
NM_015187chr4122 ------
NM_015194chr1771671 1404 1328 628 421 347 144 51871 1821 1679 1480 73 --31360 619 113
NM_015199chr352906 2232 2193 2070 943 1618 22197 1830 --
NM_015200chr421993 235 --1241 --
NM_015203chr11181 --1207 1187
NM_015205chr13114215 4121 3954 3878 3522 1332 1275 1098 764 612 562 13722 24083 3976 --
NM_015206chr1563883 3090 2776 2734 2644 2609 22800 873 12614 --
NM_015213chr111298 --1262 --
NM_015215chr11140 1747 12934 --
NM_015233chr1352402 2354 880 136 42 1507 --12430
NM_015235chr1032007 1876 779 1115 1111 1840
NM_015236chr41233 --1983 --
NM_015250chr931701 1588 248 --365 60 54 --
NM_015254chr8132932 2911 2491 2447 2247 1255 933 875 848 724 408 214 150 32269 530 478 3922 635 97 --
NM_015256chr51722 1736 ----
NM_015260chr1951551 1302 1104 577 113 31472 472 105 31468 1108 377 --
NM_015261chr113134 89 63 ------
NM_015263chr151400 ------
NM_015264chr22134808 4546 4373 4310 4156 3588 1905 1805 1731 887 503 261 191 21253 830 53641 1568 1498 1087 195 --
NM_015265chr212065 ------
NM_015267chr123240 63 45 --21428 1343 1599
NM_015268chr32480 56 ------
NM_015270chr1281926 1880 1683 1657 1482 512 397 387 --52220 1869 1643 349 246 1536
NM_015271chr42894 574 12925 13383 --
NM_015272chr1631984 1725 1604 11931 1189 --
NM_015282chr282581 2503 2488 2410 2340 931 411 74 2656 52 1664 1142
NM_015284chr172058 1933 1873 1672 821 261 88 21536 414 22090 187 31573 1312 567
NM_015286chr1572225 1959 1621 1573 1007 260 103 ----11578
NM_015288chr593392 3379 2831 2803 2752 2578 2352 992 855 2997 207 52835 1152 708 642 637 13297
NM_015291chr132579 2188 273 32413 2294 2281 2409 312 --
NM_015293chr6----1128 --
NM_015296chr13145 ------
NM_015299chr14113960 3747 3445 3428 3271 2894 1592 1319 918 372 77 33555 3402 3245 53815 3595 3301 3291 374 --
NM_015305chr1441421 1410 605 417 --51292 267 124 117 113 --
NM_015310chr8147558 7223 7153 6756 6598 6587 6224 5472 3297 2491 2111 1517 987 272 32802 1946 881 57155 5474 2730 1762 1715 --
NM_015313chr1141623 1583 685 230 24824 3526 33541 3472 3242 --
NM_015315chr593124 2779 2665 2166 1233 639 571 549 394 --73168 3166 3100 867 641 206 199 12684
NM_015317chr232886 2461 2386 12519 ----
NM_015319chr123401 313 153 --2158 110 147
NM_015321chr19184339 4179 4035 3732 3600 3505 3392 3041 3029 1516 1461 1410 1346 1276 436 247 159 48 34087 3547 3407 114761 3863 3397 3203 1887 1642 1485 1448 823 672 265 11279
NM_015326chr1132709 2688 2480 2298 2094 2072 781 665 540 201 194 177 133 32785 1018 142 22076 179 1185
NM_015327chr181252 1124 975 504 418 369 257 45 11215 5965 867 485 479 54 --
NM_015328chr772694 2547 2324 2288 2187 815 672 12240 32702 2684 419 --
NM_015335chr1241914 508 111 41 11004 ----
NM_015336chr12----12651 --
NM_015338chr2081852 1513 1430 1262 767 239 169 151 21376 1267 2403 124 11518
NM_015339chr201303 ------
NM_015343chr17----1125 1117
NM_015344chr82589 129 --11926 11767
NM_015346chr1471629 1567 1432 526 440 81 68 41595 1325 1225 608 2390 150 1532
NM_015349chr682514 2258 2249 2114 2071 997 649 546 --11010 11013
NM_015355chr1711532 ------
NM_015359chr86927 825 819 739 308 230 22211 863 1220 1490
NM_015361chr2--1256 145 148
NM_015365chrX93668 3603 3257 3205 3195 391 333 319 33 44123 3480 1389 49 44115 395 383 364 14097
NM_015367chr2221663 248 1647 --1360
NM_015374chr2281446 1033 532 513 474 433 201 64 1236 1210 --
NM_015378chr163018 2710 1824 1814 931 623 --42763 2386 2323 1828 --
NM_015385chr1032453 1248 335 --1269 --
NM_015393chr453501 2963 675 166 140 32561 2381 1129 22971 145 --
NM_015396chr321328 39 21056 956 ----
NM_015397chr941862 1510 1279 778 31497 739 698 1783 --
NM_015401chr124798 722 715 256 --1436 --
NM_015404chr94563 486 465 130 124 1529 --
NM_015426chr33583 175 146 ----1511
NM_015443chr1741027 1020 516 216 --4541 465 429 323 1435
NM_015444chr33658 263 111 ------
NM_015447chr9----1178 --
NM_015455chr5--13893 1404 --
NM_015457chr113975 849 67 --6800 232 228 90 72 21 --
NM_015460chr332082 580 566 ------
NM_015464chr71341 --1363 --
NM_015465chr53663 551 484 ------
NM_015469chr9--173 ----
NM_015470chr291115 1103 950 781 429 419 289 163 124 1397 61120 1054 952 130 126 57 1974
NM_015472chr31100 --1125 --
NM_015472chr31100 --1125 --
NM_015475chr24984 745 404 214 ------
NM_015477chr152984 113 ------
NM_015481chr1291120 1086 1073 1011 969 928 844 764 106 --81088 930 811 313 231 229 111 80 41018 882 288 22
NM_015488chr291683 1516 1372 1321 1269 1154 683 638 535 1526 61599 1571 1506 405 301 294 --
NM_015493chr1962106 1690 484 147 78 62 --1137 --
NM_015503chr16127 --1540 --
NM_015508chr321558 1242 ------
NM_015509chr1251541 1411 1158 614 93 11140 ----
NM_015514chr141229 --1432 --
NM_015520chr342484 1714 1032 361 ------
NM_015527chr166737 706 619 593 252 36 3527 207 200 1597 2699 265
NM_015530chr23871 851 344 1921 ----
NM_015534chr11888 ------
NM_015535chr293774 3742 3515 3000 1210 1202 996 965 123 33909 2600 1489 23524 3520 --
NM_015541chr31576 ------
NM_015542chr10162 ------
NM_015548chr61305 --127 --
NM_015550chr773570 2729 2634 860 845 643 376 1821 12638 23552 379
NM_015553chr695054 5021 4628 4154 4122 3406 1489 1241 314 34274 3609 122 23584 3285 --
NM_015554chr1542765 2673 2610 751 31991 1177 1046 --1754
NM_015560chr342374 2303 613 172 12494 11877 1953
NM_015564chr542665 2403 929 393 33252 2577 553 ----
NM_015568chr2093991 3786 3684 3220 1727 1655 1506 1467 236 33917 1525 1183 43878 3876 1394 1130 23651 1193
NM_015569chr121725 1443 ------
NM_015570chr71598 --1118 --
NM_015575chr262994 2699 2516 2259 854 709 43397 2531 1204 311 63149 3135 3133 2421 523 30 --
NM_015576chr31292 11985 1619 --
NM_015577chr581636 1370 1321 713 502 351 226 124 3552 370 153 1294 --
NM_015589chr14----2129 127 --
NM_015605chr102617 84 2257 53 ----
NM_015609chr192759 2458 2100 2021 866 733 186 180 46 52505 2490 2172 2094 1086 22446 737 32651 873 198
NM_015635chr931830 881 374 21758 1593 ----
NM_015642chr32309 224 ------
NM_015649chr194374 307 119 30 --2288 75 --
NM_015652chr102484 457 --2627 488 --
NM_015660chr7--1222 ----
NM_015670chr173107 84 57 197 --160
NM_015680chr22617 116 2609 594 2577 273 --
NM_015686chrX52503 2249 2231 2084 823 181 52419 2380 1763 491 446 1246
NM_015689chr7--130 ----
NM_015694chr7--1146 2142 128 --
NM_015695chr681824 1803 1723 1675 803 443 133 98 2762 723 51730 1728 738 705 462 1105
NM_015711chr197684 668 655 294 223 144 76 1270 5670 657 148 33 21 --
NM_015716chr177698 692 643 246 184 76 63 1202 9717 710 703 607 585 515 279 86 45 1253
NM_015719chr195739 595 523 273 245 1204 3578 254 250 --
NM_015726chr161870 1690 1364 1136 335 247 11851 1249 --
NM_015831chr76938 769 591 365 350 166 1160 5917 597 356 103 38 --
NM_015834chr213915 397 342 ------
NM_015844chr18--1395 1210 --
NM_015845chr181213 1173 ----
NM_015846chr18--1395 1210 --
NM_015847chr18--1395 1210 --
NM_015850chr861731 1717 1612 183 171 134 --3271 173 21 1248
NM_015864chr6146 ------
NM_015866chr1--11031 --11416
NM_015872chr151702 1455 1410 1158 589 1134 101773 1417 1392 1333 734 730 720 447 431 129 31764 1461 1161
NM_015874chr42487 143 ------
NM_015878chr8--11405 ----
NM_015879chr18158345 8269 7766 7428 7167 6123 5947 5220 2720 2644 2493 1630 1217 746 468 67853 7633 6057 3061 904 301 1502 --
NM_015886chr835254 4343 672 25162 1187 ----
NM_015898chr19162480 2288 2145 2118 1915 1864 1652 943 882 761 628 601 589 577 441 215 11685 152492 2443 2314 2312 2253 1846 1844 1745 898 884 581 544 251 238 197 22260 901
NM_015904chr22249 233 1713 3283 239 235 1698
NM_015906chr164566 4508 3721 3662 3349 121 1762 1430 --
NM_015911chr13656 496 102 --1609 --
NM_015913chr11588 1546 --1226
NM_015926chr3481 75 67 55 ------
NM_015933chr3159 ------
NM_015955chr21158 ------
NM_015974chr13177 131 ----
NM_015980chr511466 31339 1223 1185 ----
NM_015981chr5122968 2961 2796 2602 2583 2503 1190 1037 552 519 420 201 52036 1224 210 103 78 82352 583 463 409 281 279 225 223 2610 412
NM_015982chr171298 ------
NM_015986chr172520 478 ----1289
NM_015987chr12152 182 ----
NM_015993chr166689 646 542 323 129 24 --2631 546 --
NM_015995chr15125213 4565 4410 3807 2103 2068 1267 1254 1234 1145 984 658 14902 41496 1492 699 292 25216 2223
NM_015999chr1--136 2296 228 --
NM_016006chr31266 ------
NM_016009chr114246 34727 3323 3122 23113 1737 --
NM_016021chr642165 2074 666 107 --11894 --
NM_016022chr14854 730 711 314 --4879 874 432 318 --
NM_016025chr1632006 240 38 --1749 --
NM_016026chr14--2376 118 ----
NM_016032chrX21169 999 2560 381 41105 1015 319 295 --
NM_016037chr13899 867 163 31039 470 457 1167 --
NM_016045chr20143 1375 ----
NM_016057chr1251150 1123 374 249 157 --3995 952 169 --
NM_016072chr12--22429 1991 --1721
NM_016073chr152422 151 ------
NM_016076chr13830 621 205 1879 1110 1601
NM_016081chr421756 1467 ------
NM_016083chr613047 --11278 --
NM_016084chr171107 --1112 1457
NM_016096chr841407 1344 578 147 ------
NM_016099chr8178 1504 ----
NM_016107chr52454 275 ------
NM_016129chr41323 ------
NM_016131chr252017 1975 947 795 769 --1799 --
NM_016147chr1141074 318 207 86 31186 1098 360 3270 239 22 --
NM_016148chr19--1133 188 --
NM_016151chr165344 163 139 105 89 153 1363 1349
NM_016152chr321058 954 ------
NM_016156chr1152267 2171 2125 2033 717 11758 ----
NM_016169chr10123266 3259 3013 2599 2538 2327 2212 1291 1196 1125 338 171 62352 1304 1249 1019 731 417 63096 2542 2481 1174 643 260 11119
NM_016170chr22570 133 ------
NM_016185chr172698 41 ------
NM_016201chr362275 2067 770 719 328 231 1758 42279 2160 43 38 --
NM_016206chr397506 7474 7279 6465 3374 3363 2355 1607 244 57640 7212 1915 1596 787 27281 3348 --
NM_016211chr41372 ------
NM_016227chr1------1356
NM_016231chr1711124 ----11224
NM_016248chr1352980 1318 1285 1246 758 34002 1302 1275 51298 1291 1271 1266 1250 --
NM_016250chr142236 43 1786 1778 --
NM_016252chr21883 ------
NM_016257chr183001 2881 2332 575 447 438 198 66 41405 227 80 51 2140 108 1467
NM_016258chr11217 ------
NM_016260chr2106590 5974 5668 5637 5611 5218 2947 1370 1081 564 15077 15557 --
NM_016269chr43483 322 205 1345 ----
NM_016272chr22102564 2453 2426 1943 1767 1736 883 786 716 355 11957 51953 1741 620 439 360 --
NM_016277chr6--11573 ----
NM_016281chr124978 903 894 882 --4988 982 907 183 --
NM_016284chr163796 731 151 ------
NM_016287chr181927 1802 835 803 520 447 274 107 11376 11610 --
NM_016289chr211561 11604 ----
NM_016293chr12123 ------
NM_016320chr114842 360 343 144 --3802 121 117 1856
NM_016322chr922797 213 22928 384 1322 1797
NM_016329chr3------1366
NM_016337chr14--1326 ----
NM_016338chr54974 852 227 26 ------
NM_016340chr521034 129 ------
NM_016351chr71115 ------
NM_016352chr741440 1081 936 102 1251 5541 537 533 291 134 --
NM_016373chr163823 288 91 ----180
NM_016374chr11641 1250 ----
NM_016374chr11641 1250 ----
NM_016396chr1532617 2528 2050 12518 12061 --
NM_016418chr22143687 3235 2949 2917 2698 2665 2428 1424 1124 875 845 792 344 215 63767 3084 2335 2322 1457 1076 33537 2671 1039 21182 1044
NM_016436chr2042015 932 783 234 ------
NM_016453chr35671 485 453 267 229 --121 --
NM_016456chr15305 138 131 104 82 1329 3684 679 86 --
NM_016463chr5----128 --
NM_016470chr201555 ------
NM_016483chr33323 224 54 1234 ----
NM_016486chr11184 1141 ----
NM_016489chr72178 26 ------
NM_016492chr172125 98 ------
NM_016505chr11134 2521 98 1294 --
NM_016506chr11----2129 44 --
NM_016507chr1733066 681 556 149 22279 2274 12282
NM_016516chr2--1638 ----
NM_016519chr42166 92 144 ----
NM_016522chr1131673 423 334 --11545 --
NM_016525chr95795 710 604 274 223 ----2713 262
NM_016531chr441591 755 258 181 166 2586 186 --
NM_016544chr293799 3423 2864 2855 2834 1443 1251 1218 1163 --11172 188
NM_016547chr12547 255 --1641 1513
NM_016559chr321446 326 --11464 --
NM_016569chr121344 --21542 102 --
NM_016574chr116921 758 320 310 107 41 21119 35 1936 2942 265
NM_016575chr12115234 5178 5101 5078 4758 3839 2091 1339 576 351 182 64844 3380 1506 1372 787 148 35180 5028 661 --
NM_016577chr384369 3741 3302 1681 970 697 435 394 44033 1355 440 25 63743 3543 2967 2965 1494 1475 --
NM_016588chr6----1732 --
NM_016592chr2021245 334 --21211 338 11326
NM_016596chr124798 722 715 256 --1436 --
NM_016598chr321251 930 1418 ----
NM_016603chr51221 ----1176
NM_016604chr551155 834 510 132 96 ----1841
NM_016605chr5142578 2535 2347 1920 1878 1863 1806 1745 1681 949 942 909 844 394 12172 2722 232 --
NM_016607chrX3656 486 297 ------
NM_016618chr21155 123 ----
NM_016621chr11184348 4254 4232 4196 4118 4043 3839 3790 3746 3620 3482 3129 3018 1538 1531 769 717 657 24649 3808 54321 4290 3137 1687 722 14278
NM_016623chr81131 ------
NM_016626chr181689 ------
NM_016652chr20------11782
NM_016654chr1521284 980 2873 455 ----
NM_016733chr2251149 992 525 144 52 11107 --11121
NM_016819chr33518 409 71 1145 3372 348 190 1214
NM_016823chr172967 278 ------
NM_016829chr34521 175 164 40 --2308 233 --
NM_016830chr123206 74 61 1391 --2167 32
NM_016834chr17153665 3632 3204 3070 2849 2835 2766 1424 1248 907 868 821 737 315 89 43936 3719 3223 1351 73779 3686 3575 3210 1530 873 632 11126
NM_016835chr17153665 3632 3204 3070 2849 2835 2766 1424 1248 907 868 821 737 315 89 43936 3719 3223 1351 73779 3686 3575 3210 1530 873 632 11126
NM_016841chr17153665 3632 3204 3070 2849 2835 2766 1424 1248 907 868 821 737 315 89 43936 3719 3223 1351 73779 3686 3575 3210 1530 873 632 11126
NM_016929chr663992 3727 3275 1517 1115 186 34014 1457 1065 23972 382 --
NM_016936chr1621753 796 2161 62 31819 1794 1490 --
NM_016946chr173194 1384 1368 565 553 289 172 73412 3360 3227 2346 1269 528 497 41311 947 189 185 --
NM_016950chr4180 ------
NM_016952chr11124039 3906 3751 3638 3610 2904 2809 1172 557 544 207 197 52710 824 683 526 277 ----
NM_017409chr12387 36 21 3590 532 144 4515 52 42 26 1599
NM_017410chr1231108 787 289 --31066 480 420 11114
NM_017412chr8--11405 1979 --
NM_017413chrX91669 964 677 394 351 297 277 156 53 2941 666 32046 1820 239 1766
NM_017415chr564216 3152 2778 1792 439 126 11731 54222 1585 1254 1252 1062 --
NM_017420chr1442830 2790 2470 2440 ------
NM_017423chr43794 492 123 ------
NM_017447chr2123981 790 146 13948 13951
NM_017449chr1121598 1558 1517 1451 1362 1152 672 540 369 359 47 31 41388 1356 1272 1160 51683 1602 1562 1156 68 11592
NM_017450chr1731197 498 73 21187 1070 31309 198 50 --
NM_017452chr2041301 529 370 283 ----11409
NM_017453chr2041301 529 370 283 ----11409
NM_017454chr2041301 529 370 283 ----11409
NM_017455chr151144 --188 --
NM_017456chr1781569 1386 760 592 520 270 229 55 --21573 1235 --
NM_017459chr1----2163 33 --
NM_017488chr251432 1375 489 368 260 2394 252 41304 385 361 294 --
NM_017491chr42857 778 --1966 --
NM_025027chr1911144 1111 ----
NM_025054chr822740 1629 ------
NM_025057chr142270 150 11119 145 --
NM_025058chr110605 555 549 298 209 188 131 105 94 36 1146 1777 --
NM_025061chr192895 314 --2393 316 1431
NM_025099chr1761232 398 352 139 70 32 1421 172 --
NM_025104chr1711161 124 11464 --
NM_025115chr81125 141 ----
NM_025124chr11287 45 ------
NM_025133chr21999 ------
NM_025134chr1631964 1811 371 1818 11927 --
NM_025140chr124474 453 443 144 --1423 --
NM_025146chr332584 104 68 11889 1108 --
NM_025151chr862126 1863 1361 691 380 114 --21448 774 --
NM_025160chr163966 3593 3294 2839 1444 304 --53309 1459 1302 1297 1295 --
NM_025164chr1162006 1822 1783 790 472 102 --1446 11619
NM_025179chr1184392 4209 4139 3731 3550 3318 3261 3213 3189 3060 3011 1816 1366 1273 958 480 456 147 31628 1379 473 34437 1755 149 34487 961 461
NM_025181chr21783 ------
NM_025182chr93414 306 91 4834 749 424 388 2743 210 --
NM_025187chr1641319 1300 891 24 11226 21344 524 --
NM_025191chr122967 227 2799 787 ----
NM_025222chr352601 799 465 374 366 --1928 1130
NM_025224chr2082206 2177 2068 1856 1486 931 725 121 1668 5848 456 451 112 100 --
NM_025232chr82344 23 --2292 118 --
NM_025237chr1711021 2970 140 1988 --
NM_025248chr17103268 3188 730 605 466 311 285 265 97 57 32890 609 389 92744 2070 449 447 378 369 143 62 37 22943 2772
NM_025251chr891047 812 470 452 392 339 320 255 115 1434 4479 475 397 70 --
NM_025256chr6155 --2108 23 --
NM_025261chr6_qbl_hap22169 52 130 397 56 26 1156
NM_025263chr64729 395 258 140 2747 678 1541 --
NM_030576chr17102569 2533 2467 2244 2118 397 248 175 161 26 21753 1723 2672 252 12536
NM_030594chr1541327 854 239 227 1101 31217 1213 1015 11172
NM_030621chr1442869 1677 932 418 ------
NM_030623chr211191 21213 622 21424 33 --
NM_030625chr10--1802 ----
NM_030627chr533177 984 888 --23166 69 --
NM_030629chr1631725 1432 760 --51436 1392 1390 1215 637 --
NM_030634chr162311 918 881 472 184 100 1328 12087 2884 477
NM_030640chr121868 ------
NM_030645chr191187 1098 1045 982 466 181 121 108 95 --6971 930 440 317 187 75 1469
NM_030647chr775077 4774 4754 4543 4253 1636 28 --34759 4556 710 11991
NM_030648chr475200 5184 4887 4779 4310 3906 918 34880 1486 114 11686 --
NM_030651chr63652 334 194 2759 44 1557 1703
NM_030661chr741625 1396 106 36 --21631 1551 --
NM_030664chr1031710 957 298 ------
NM_030665chr173981 929 363 ------
NM_030674chr12104686 4290 4031 3889 3867 1302 1241 765 301 182 24554 3879 31714 1388 1246 25113 3773
NM_030751chr1021329 519 ------
NM_030751chr1021329 519 ------
NM_030759chr101504 ------
NM_030761chr192660 2562 2502 1033 954 809 450 426 188 31885 607 71 22223 2192 22198 1036
NM_030762chr122238 214 ------
NM_030763chrX--1842 ----
NM_030784chr6174 ------
NM_030797chr21220 ------
NM_030802chr173681 652 174 1756 3101 96 60 --
NM_030803chr231193 843 320 3390 280 109 31157 497 38 11127
NM_030806chr1189219 9171 8879 8603 8426 8322 7745 7384 7058 6480 3383 3267 3160 2109 1878 1461 722 328 58510 8350 3458 2092 786 89175 8324 7990 7750 7434 1028 840 425 28429 886
NM_030808chr1751089 1041 721 392 97 --3733 419 35 --
NM_030810chr621182 24 31489 1298 1257 ----
NM_030815chr204714 605 539 63 1314 1705 --
NM_030816chr132731 2448 666 13506 ----
NM_030881chr2272242 2233 1979 639 629 615 286 1792 ----
NM_030884chr3132153 1830 1702 1604 1577 680 622 368 182 166 54 46 32 2344 82 101590 656 624 533 296 292 78 73 69 67 --
NM_030913chr12129 47 --2527 112 1272
NM_030914chr96863 782 259 132 108 83 1313 4927 919 851 671 1857
NM_030915chr2122295 2194 1930 1879 1808 1703 1475 774 699 540 229 209 1797 2945 877 1895
NM_030918chr1164675 4397 4273 4253 4058 3436 1930 1691 1399 1328 1122 970 537 510 190 97 34212 3309 2084 104790 4610 4099 4094 2124 1943 840 835 606 160 1742
NM_030920chr1----2812 792 --
NM_030923chr21221 --1225 --
NM_030926chr24905 155 137 128 --276 69 --
NM_030927chr1041185 452 215 142 --41323 1187 1076 359 --
NM_030935chr72337 65 ------
NM_030937chr141453 948 490 350 11356 137 --
NM_030939chr6--1343 ----
NM_030948chr6183 ------
NM_030957chr194470 409 241 197 --1482 1216
NM_030958chr81202 ------
NM_030962chr112410 133 ------
NM_030964chr583394 2332 1501 695 647 636 361 94 22554 1110 103063 2680 1381 1379 1062 506 388 369 365 355 42999 819 700 346
NM_030981chr1191139 1077 1020 978 935 807 390 349 76 --386 82 80 1319
NM_031216chr1831678 1627 104 --184 1107
NM_031231chr202101 46 ----2742 496
NM_031232chr202101 46 ----2742 496
NM_031266chr51150 ------
NM_031268chr16104451 4258 3924 2139 1944 1860 1412 970 547 26 1945 43673 1519 1418 441 13931
NM_031289chr124996 972 919 736 1945 ----
NM_031309chr8112218 1755 1470 856 744 692 678 397 388 344 172 1248 92258 1557 1480 587 453 338 221 216 103 2627 400
NM_031314chr1461923 1908 741 367 120 85 --21925 87 1137
NM_031369chr41156 ------
NM_031370chr41156 ------
NM_031371chr11641 1250 ----
NM_031371chr11641 1250 ----
NM_031372chr441151 520 473 424 --11367 --
NM_031407chrX1149 --1183 --
NM_031411chr54599 264 210 104 22060 286 --160
NM_031417chr1982096 1797 513 486 417 361 307 231 1600 8958 930 869 798 711 706 309 23 --
NM_031426chr9112477 2249 2205 2104 1780 638 613 336 218 63 43 11025 72194 1071 226 222 210 206 47 130
NM_031432chr961024 956 243 130 93 30 --11029 --
NM_031433chr117586 548 490 445 418 185 24 --3579 573 175 --
NM_031438chr531337 689 507 ------
NM_031439chr871553 1463 1325 1233 352 246 157 2271 95 31259 186 40 1509
NM_031442chrX42350 862 596 492 ------
NM_031445chr263313 1269 386 253 145 74 ------
NM_031450chr117400 251 231 161 68 57 37 --1570 --
NM_031468chr7237614 7533 7449 7391 7345 6920 6552 6410 3029 2817 2371 2350 1960 1854 1740 1629 1601 1515 1093 882 849 510 72 57960 5583 2944 2650 737 42546 2250 2093 1605 46607 2096 1523 888
NM_031469chr623046 2768 ------
NM_031475chr12613 47 1525 4310 127 110 105 --
NM_031477chr163327 278 66 1316 ----
NM_031478chr163686 464 186 2675 248 3204 28 22 1572
NM_031483chr2032409 2360 482 1152 13339 1487
NM_031492chr112543 180 ------
NM_031844chr131550 1250 489 23589 849 21260 1254 --
NM_031845chr2----21033 925 --
NM_031847chr2----21033 925 --
NM_031849chr54599 264 210 104 22060 286 --160
NM_031857chr54599 264 210 104 22060 286 --160
NM_031860chr54599 264 210 104 22060 286 --160
NM_031866chr104389 245 222 97 1202 4945 751 749 322 --
NM_031886chr1932450 187 35 12362 12270 --
NM_031890chr22182859 2633 2546 2467 2390 2355 2249 2166 2145 2007 1915 1213 1114 983 956 945 702 341 41900 1221 1155 1070 52906 2595 2173 582 212 --
NM_031892chrX2661 181 ------
NM_031911chr422328 1947 11734 ----
NM_031935chr11139 1247 --166
NM_031953chr41118 ------
NM_031954chr1282773 1976 1944 1050 921 472 97 89 22111 997 42666 925 894 27 --
NM_031992chr731475 237 112 11484 1637 --
NM_032012chr975194 5003 4317 1812 630 127 73 33591 773 511 --182
NM_032013chr2041214 251 241 123 11350 ----
NM_032017chr1101867 1835 1764 1681 1515 1435 1379 1290 835 432 --101319 847 783 736 698 672 482 437 342 97 41926 1815 584 450
NM_032028chr51162 --1132 --
NM_032040chr192265 119 1280 133 --
NM_032041chr852068 1914 1863 474 133 --1532 12351
NM_032042chr552512 2132 993 384 55 21901 108 2610 390 --
NM_032050chr221408 1163 --2415 386
NM_032052chr224936 911 287 267 2548 28 ----
NM_032088chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_032092chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_032102chr111341 ------
NM_032104chr14630 263 191 30 2694 211 134 --
NM_032105chr1247804 7763 7695 7510 7019 6813 6800 6693 5656 5018 4905 2859 2121 2111 1831 1737 1132 1049 763 737 630 263 191 30 87364 7238 7111 6774 5816 1038 694 211 76802 6593 6351 5334 5056 849 34 27766 2952
NM_032108chr195969 901 895 835 144 --3982 954 176 --
NM_032109chr57436 422 315 240 228 189 140 --5488 460 345 298 64 1250
NM_032121chrX32569 2056 591 4897 761 729 228 ----
NM_032139chr195720 402 362 337 193 1344 ----
NM_032153chr322732 721 --22548 2148 --
NM_032154chr10--1290 ----
NM_032160chr18113730 3344 3317 3279 2868 1541 756 738 636 323 203 13864 11502 22691 1519
NM_032174chr141001 490 204 76 1385 2230 145 1496
NM_032181chr22751 241 ------
NM_032182chr1011431 --11215 --
NM_032192chr175704 552 532 230 92 --1733 --
NM_032195chr21----1194 --
NM_032199chr102433 416 21348 608 --1219
NM_032204chr222324 75 1148 1242 --
NM_032207chr1931292 1033 800 160 11255 --
NM_032208chr243433 3044 1348 385 1940 ----
NM_032214chr2041242 274 157 63 2891 188 11095 --
NM_032221chr2031257 292 68 ----1690
NM_032239chr41448 ------
NM_032242chr3113058 2911 2826 2544 2267 2163 2105 988 920 826 352 12808 52833 2831 742 138 134 23180 674
NM_032246chr15286 62 --4116 105 103 54 --
NM_032256chr121730 ------
NM_032268chr16132601 2476 2199 2173 1243 1097 662 654 569 536 471 151 122 33031 1198 29 42681 491 222 155 --
NM_032271chr166569 511 336 254 241 167 11313 3516 203 143 --
NM_032281chr1972931 2708 2592 2510 1207 409 221 --102940 2830 2812 2581 2556 2554 2529 2520 1163 31 2387 22
NM_032283chr161715 1655 1600 747 170 43 21184 338 41591 1373 704 67 --
NM_032289chr5101746 1739 1605 1377 749 619 473 418 348 231 31829 479 319 2212 210 --
NM_032294chr1741539 392 243 227 11841 1127 --
NM_032298chr192420 381 ------
NM_032312chr2--1940 ----
NM_032320chr11157 ------
NM_032325chr1181904 1502 1379 1365 1287 769 517 121 31859 1651 1516 --1598
NM_032345chr123157 140 120 1180 2394 169 --
NM_032352chr1421241 991 --1995 --
NM_032353chr173405 379 347 3444 355 34 ----
NM_032364chr1231005 227 195 2372 215 2644 79 --
NM_032375chr193788 229 106 2161 117 ----
NM_032379chr11123 ------
NM_032382chr16--1507 ----
NM_032387chr172243 27 ------
NM_032403chr5101715 1405 1374 717 531 502 482 355 315 37 41397 647 542 440 61651 1485 1258 359 174 39 --
NM_032408chr751112 1052 997 990 139 21122 162 ----
NM_032410chr81151 ----1963
NM_032420chr55727 234 179 87 79 2198 159 5756 282 217 181 30 --
NM_032430chr195404 373 345 318 35 --2360 46 --
NM_032431chr114332 299 292 221 --185 --
NM_032434chr261363 1224 1042 321 154 128 1539 1180 1254
NM_032440chr1022813 2146 12970 --12293
NM_032445chr1552181 1929 1601 899 353 --22293 2110 11608
NM_032452chr1461441 1395 1305 551 514 242 11151 71445 1350 1310 1229 1072 623 226 21458 344
NM_032457chr442409 529 252 222 --1262 --
NM_032458chrX1987 23336 1146 ----
NM_032491chr122510 292 ------
NM_032499chr151382 1364 3427 425 421 --
NM_032505chr321768 429 ------
NM_032511chr62375 22 ------
NM_032514chr201416 ------
NM_032521chr2042585 1095 960 606 51215 1118 993 739 594 ----
NM_032538chr6222748 2451 2439 2385 2362 2333 2295 2179 1859 1849 1140 1097 1050 944 925 833 517 473 419 297 257 228 21900 251 122738 2684 2678 2519 2515 2413 2297 1819 1089 893 437 233 22751 1840
NM_032550chr1041141 953 482 327 1913 ----
NM_032552chr981856 1797 1735 1683 1577 1244 436 157 1789 51503 693 278 169 109 --
NM_032560chr141216 --158 --
NM_032569chr1681367 1249 792 556 439 50 40 28 --41840 1787 1474 166 2430 387
NM_032574chr22109 86 ------
NM_032575chr1692024 1950 1543 1439 1347 711 513 325 294 2602 166 91531 1529 1360 1349 459 422 398 360 308 51433 1363 465 363 311
NM_032576chrY193 ------
NM_032580chr172398 214 1380 1367 --
NM_032581chr7--122 1239 --
NM_032582chr172431 203 1685 --1756
NM_032595chr1761563 1169 546 139 127 53 --81341 1183 511 472 470 465 83 58 3373 90 43
NM_032603chr21542 --1158 --
NM_032622chr411488 1576 ----
NM_032632chr1431497 1433 129 11622 21655 815 --
NM_032638chr33493 477 399 --2497 123 11216
NM_032645chr11128 --1161 --
NM_032664chr841303 693 619 571 21363 609 ----
NM_032673chr2----134 --
NM_032682chr333486 1267 267 --11170 1885
NM_032687chr8179 ----153
NM_032689chr1921408 519 ------
NM_032711chr17163939 3821 3792 3756 3513 3321 3045 2822 2759 2728 1418 386 124 115 97 73 13827 32831 1129 102 13050
NM_032741chr67874 357 268 180 102 90 44 3931 239 25 3880 109 107 --
NM_032758chr222513 22 --2150 145 --
NM_032772chr102208 190 ----1450
NM_032778chr331086 497 129 ------
NM_032781chr114374 154 120 101 ----1774
NM_032784chr61397 ------
NM_032786chr121177 --179 --
NM_032789chr82116 26 134 ----
NM_032800chr172628 2612 2402 2276 2084 1964 386 12298 42511 970 380 305 --
NM_032808chr156882 764 123 102 91 74 --2175 127 185
NM_032810chr1021567 625 ------
NM_032812chr101261 ------
NM_032813chr1311121 ------
NM_032827chr25804 791 384 216 162 1134 51091 741 168 166 42 --
NM_032829chr1261061 1029 951 436 332 261 --2901 198 --
NM_032830chr16125 ------
NM_032832chr66623 593 583 450 415 388 ------
NM_032833chr142223 1714 1682 222 11851 ----
NM_032836chr197923 801 772 651 94 40 28 2959 342 41033 1031 895 891 --
NM_032839chr3----1379 --
NM_032840chr1261140 989 975 810 42 30 21158 74 41025 882 878 399 1737
NM_032842chr72500 257 2636 469 ----
NM_032846chr1441267 1205 170 30 2325 220 --11273
NM_032854chr175898 768 709 696 304 ------
NM_032875chr172567 70 ------
NM_032876chr142556 62 2393 380 ----
NM_032892chr151109 1114 ----
NM_032900chr10103533 3088 2899 2649 2394 1571 1401 1037 748 524 22934 740 43687 3364 1202 752 --
NM_032905chr101214 ------
NM_032906chr41727 1191 ----
NM_032918chr1221113 44 1120 ----
NM_032943chr11123 ------
NM_032960chr191474 1394 1290 1150 947 512 326 311 97 --31396 1353 418 --
NM_032961chr42282 236 ------
NM_032968chrX44087 2637 2626 524 ----13293
NM_032969chrX44087 2637 2626 524 ----13293
NM_032971chrY------162
NM_032972chrY------162
NM_032973chrY34079 2625 524 ----13288
NM_032975chr1863568 2680 1341 1318 1126 1001 130 22861 2427 --
NM_032978chr1821101 303 ------
NM_032979chr1821101 303 ------
NM_032980chr1863568 2680 1341 1318 1126 1001 130 22861 2427 --
NM_032981chr1821101 303 ------
NM_032982chr7102138 2027 1961 1777 1671 917 818 803 567 431 42423 1908 1685 122 31849 934 841 --
NM_032995chr291250 1206 1099 1092 687 480 357 282 177 21214 391 2643 492 --
NM_032998chr121051 193 --3901 895 169 187
NM_032999chr71925 --1806 --
NM_033000chr71925 --1806 --
NM_033001chr71925 --1806 --
NM_033016chr2271488 1358 1326 563 263 152 142 41525 1401 404 191 31516 1342 339 41494 1274 532 173
NM_033018chrX51091 866 848 823 80 1286 11096 11156
NM_033020chr164566 4508 3721 3662 3349 121 1762 1430 --
NM_033023chr741095 866 517 108 ------
NM_033025chr195959 394 324 315 267 --2952 704 --
NM_033027chr35774 761 747 727 210 190 --1782
NM_033030chr211243 11173 ----
NM_033036chr1121134 142 1480 41477 451 398 230 3403 237 44
NM_033044chr11196 1862 ----
NM_033058chr82950 137 ------
NM_033063chr112135 54 ------
NM_033071chr6----1128 --
NM_033082chr12149 ------
NM_033089chr205935 502 346 304 47 --51133 507 325 317 236 --
NM_033103chr191982 21091 955 ----
NM_033121chr1241759 1231 537 127 1561 11354 --
NM_033127chr11545 270 31 179 --
NM_033129chr20161972 1770 1703 1628 1556 1396 1320 776 757 587 531 325 297 192 152 38 1551 82013 1714 1709 1503 1480 1331 299 116 1330
NM_033132chr132500 436 2915 458 21934 1482 --
NM_033133chr17173733 3612 3255 3174 3114 2807 2615 2597 1359 1297 1276 1120 1110 978 612 173 58 33620 1508 694 53522 2619 723 161 157 --
NM_033136chr55695 603 542 464 159 ------
NM_033137chr55695 603 542 464 159 ------
NM_033138chr742289 1959 1636 1479 11604 ----
NM_033139chr742289 1959 1636 1479 11604 ----
NM_033140chr742289 1959 1636 1479 11604 ----
NM_033141chr1441504 1427 447 271 1406 1339 --
NM_033147chr23229 102 83 ------
NM_033148chr23229 102 83 ------
NM_033150chr122320 149 --1154 1130
NM_033157chr742289 1959 1636 1479 11604 ----
NM_033161chr971334 1254 471 387 243 210 100 11347 2110 104 --
NM_033181chr613047 --11278 --
NM_033201chr165479 275 212 89 47 --1467 2482 424
NM_033211chr51785 ------
NM_033221chr972143 773 593 553 306 269 150 11763 32066 803 351 3809 354 23
NM_033224chr778006 7547 6681 2932 2764 2465 456 36850 6714 2938 ----
NM_033225chr852610 1287 957 937 539 --42860 2856 1111 85 190
NM_033226chr163724 249 83 1257 --1114
NM_033228chr52430 223 ------
NM_033238chr1592604 2586 2130 981 924 645 545 515 160 2629 474 32608 1067 240 11850
NM_033254chr31584 1510 ----
NM_033259chr35941 896 882 732 346 1756 2590 318 --
NM_033267chr53602 561 195 268 49 ----
NM_033272chr2177 1353 ----
NM_033274chr5153143 3000 2911 2824 1377 1157 1046 912 822 594 424 286 165 146 22 33423 409 108 73346 3181 3135 3113 809 596 115 2815 588
NM_033278chr113344 333 261 --2139 135 --
NM_033285chr844015 3194 1195 1089 1318 1804 --
NM_033300chr1----1483 --
NM_033306chr11----131 --
NM_033309chr16184 1273 ----
NM_033315chr17102073 1783 1772 1636 883 665 645 443 169 137 22107 704 22033 1812 1455
NM_033316chr32617 109 ------
NM_033326chr1132298 1901 1865 1876 150 --
NM_033331chr983234 2911 2796 2755 2674 2298 1072 272 21206 819 33093 2761 923 22775 1307
NM_033360chr121972 --24222 703 --
NM_033375chr1791467 1416 1401 589 512 463 442 136 52 1130 31341 1120 149 263 25
NM_033380chrX1954 ------
NM_033381chrX1954 ------
NM_033387chr9122543 2480 2377 1967 879 852 756 639 467 460 255 153 22581 863 62390 981 857 762 447 108 22318 941
NM_033389chr1744751 4618 3161 325 34456 4140 840 21002 807 34017 3825 933
NM_033396chr112171 119 122 ----
NM_033405chr206880 768 191 124 108 76 2791 220 165 --
NM_033414chr5145 ------
NM_033421chr2051888 1272 1247 773 229 --31660 1251 574 --
NM_033425chr1133397 2445 1346 ------
NM_033429chr152902 24 1301 12879 --
NM_033430chr434017 3677 3208 11189 ----
NM_033437chr434017 3677 3208 11189 ----
NM_033449chr592083 1902 1876 1677 1424 1364 1325 674 149 11410 21638 1458 1152
NM_033495chrX1102 ------
NM_033496chr102486 30 --2492 206 170
NM_033497chr102486 30 --2492 206 170
NM_033498chr102486 30 --2492 206 170
NM_033500chr102486 30 --2492 206 170
NM_033503chr1573025 2822 2759 1428 1247 1176 1031 43550 3190 3015 428 73611 3584 2570 2506 2390 2388 1256 --
NM_033505chr275644 5436 4560 2441 2034 725 58 --35632 935 930 --
NM_033512chr8112964 2821 2063 1196 1189 1167 1147 1004 692 336 28 1159 41215 1210 1172 861 11153
NM_033535chr4--21035 807 ----
NM_033540chr311004 ------
NM_033542chr2031670 1438 67 --11649 --
NM_033549chr55952 778 692 151 28 3810 119 94 3780 698 175 2752 270
NM_033551chr593124 2779 2665 2166 1233 639 571 549 394 --73168 3166 3100 867 641 206 199 12684
NM_033624chr1251664 796 675 194 168 1140 --1665
NM_033626chrX91472 1367 1237 1121 553 510 426 407 394 21629 1382 11495 --
NM_033631chr15984 791 240 233 29 33530 3331 711 3976 682 215 --
NM_033632chr411426 --156 --
NM_033637chr10193990 3867 3806 3461 3429 3417 3354 3328 3145 2745 1499 1381 902 735 677 622 557 479 274 41395 1056 740 656 33820 1529 279 13812
NM_033642chrX------1335
NM_033644chr551812 1660 1578 212 187 21642 745 2921 247 11818
NM_033645chr551812 1660 1578 212 187 21642 745 2921 247 11818
NM_052837chr12230 105 1209 ----
NM_052840chr1551606 1516 1461 1112 568 --187 --
NM_052845chr12123183 2627 2304 2163 2086 1314 660 219 209 161 69 34 22328 2018 1902 1395
NM_052851chr1352130 829 686 495 186 --22134 454 --
NM_052854chr114455 256 167 95 2133 106 2474 141 1202
NM_052867chr1311106 ------
NM_052868chr1----4180 85 83 61 --
NM_052876chr1982396 2351 1866 1690 877 479 129 34 1450 122621 2593 2513 2496 2121 2096 1856 1851 867 341 138 91 2440 40
NM_052879chr1243696 1236 1219 814 139 21228 1224 --
NM_052880chr221967 ----21255 58
NM_052885chr1241816 901 592 254 1539 ----
NM_052896chr162528 2203 2160 2139 1976 341 --32055 1994 1960 22014 1941
NM_052897chr124785 678 651 642 1657 2293 141 --
NM_052898chr831254 256 237 1171 11874 --
NM_052899chr54946 178 82 50 1312 2874 631 2634 154
NM_052901chr93407 397 378 31508 532 518 1195 21570 1197
NM_052905chr21157 ------
NM_052906chr22194993 4979 4912 4774 4705 4690 4552 4491 4434 3449 3417 3315 1948 1880 1248 1178 986 440 418 33470 594 502 114999 4995 4934 4790 4786 4782 4778 4533 3858 3615 1698 21355 443
NM_052910chr1341439 1362 1347 603 --51729 1499 1454 184 50 11815
NM_052911chr181940 ----1712
NM_052918chr1042602 1015 882 682 22276 1065 2433 431 22869 2619
NM_052925chr1951012 982 972 856 736 --141003 998 993 987 889 885 881 862 773 769 724 720 716 667 --
NM_052926chrX----127 --
NM_052927chr5------11815
NM_052933chr72270 21 ------
NM_052934chr16736 700 598 555 276 127 21765 186 91747 1425 770 500 162 158 153 142 136 --
NM_052936chrX1576 1261 1194 --
NM_052937chr821906 642 ------
NM_052939chr13151 83 60 198 ----
NM_052953chr3--177 ----
NM_052961chr61110 2326 48 ----
NM_052978chr1451787 1337 1237 616 98 ------
NM_052996chr1661578 1260 1143 1131 457 374 --11089 21663 1366
NM_052998chr11211 ------
NM_053016chr9187452 7317 7270 7172 7078 6523 5590 5302 4932 4891 2859 2756 1138 1037 418 260 200 43 17158 27047 4937 15834
NM_053023chr11163162 2950 2794 2597 2443 2156 1023 725 660 618 564 405 399 179 163 156 32701 2624 2161 --32364 954 653
NM_053024chr32332 138 11003 2334 174 --
NM_053025chr33709 529 413 1454 1419 1548
NM_053026chr33709 529 413 1454 1419 1548
NM_053027chr33709 529 413 1454 1419 1548
NM_053028chr33709 529 413 1454 1419 1548
NM_053031chr33709 529 413 1454 1419 1548
NM_053032chr33709 529 413 1454 1419 1548
NM_053043chr7116056 5943 5797 5630 5618 5598 4151 4130 4021 762 101 46206 5756 1381 680 75620 5493 5489 4071 4067 3942 3930 15592
NM_053046chr191413 1406 179 --
NM_053053chr1--1671 ----
NM_053056chr1132855 2386 2377 13109 180 1163
NM_053279chr8102642 2542 1873 1777 1089 937 857 709 293 95 --1892 21094 160
NM_054012chr9299 31 ------
NM_054013chr54892 829 818 751 --3931 782 663 --
NM_054025chr1113834 739 733 719 710 579 539 520 291 206 77 56 23 31607 1466 49 3415 112 58 --
NM_054033chr2------2180 85
NM_054035chr172208 45 --1802 --
NM_057159chr94385 219 56 35 ------
NM_057161chr65450 444 352 187 22 --5493 377 358 211 27 --
NM_057169chr1262426 1244 1218 1061 926 22 12064 42641 2621 2128 768 --
NM_057170chr1262426 1244 1218 1061 926 22 12064 42641 2621 2128 768 --
NM_057175chr41260 ------
NM_057178chr1752489 2202 444 407 309 1164 2931 336 22219 1732
NM_057749chr821198 932 ------
NM_058004chr222138 75 ------
NM_058172chr4--2532 123 ----
NM_058175chr214776 558 306 104 3726 694 617 2599 340 --
NM_058238chr227760 421 210 197 186 173 162 1201 172 --
NM_058240chr1471215 1208 627 378 315 269 63 21282 350 180 --
NM_058243chr192808 309 --2550 119 1717