TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4729
miRNA Sequence: UCAUUUAUCUGUUGGGAAGCUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr562059 1913 1551 837 797 103 2821 676 --21706 534
NM_000051chr11163579 3530 3513 3176 3049 3042 3017 2486 2393 2253 1182 927 764 745 655 128 22353 105 11388 12492
NM_000084chrX156828 6804 5906 5474 5210 4764 4503 2450 2406 2008 1144 1104 836 707 241 25270 640 25273 5072 1933
NM_000109chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_000112chr5145571 5384 4900 4804 4676 4624 4497 4026 1735 1422 1069 936 699 253 55239 3732 3642 3609 918 13741 --
NM_000115chr1372137 1789 1697 939 505 389 128 4976 968 562 415 12630 --
NM_000138chr15112644 2418 2308 1931 703 586 580 429 123 113 46 12651 2882 451 --
NM_000216chrX94040 3479 2825 1349 1332 1236 626 607 392 1517 11261 --
NM_000217chr12135271 5263 4645 3923 3829 1367 1048 1029 966 858 731 608 513 23932 1511 ----
NM_000245chr782227 2194 1917 1890 1633 1371 803 515 12140 11882 1896
NM_000252chrX81416 1405 1396 1347 1278 1249 1109 419 11098 11531 1562
NM_000259chr15186345 6201 5771 5720 5339 5204 5180 5154 4426 2084 1835 1757 1747 1733 1654 1417 686 345 1666 21463 596 25407 373
NM_000314chr10113146 2777 2733 2404 2315 2232 2145 2011 1239 1212 435 12297 1824 --
NM_000332chr6157148 6836 6427 6039 5786 5726 5695 5062 4822 4740 2039 2003 1623 925 650 15304 35162 1628 1328 24981 1360
NM_000337chr5146549 6024 5365 5141 4572 4408 2627 2483 1858 747 655 189 179 169 76477 5638 4415 2537 2294 1641 640 14119 1644
NM_000390chrX133395 3377 3313 2663 2319 2264 1152 1012 951 793 622 579 246 22232 1047 ----
NM_000393chr282045 1877 1815 1538 831 700 289 142 ----22057 1706
NM_000397chrX32203 163 75 1730 21008 27 32538 738 734
NM_000430chr17143801 3415 3271 1138 1131 1100 992 650 464 452 190 140 109 90 23292 486 21225 531 --
NM_000461chr3134610 4471 4161 4124 3481 2957 1842 1689 1566 1415 439 213 163 24459 3561 13970 14238
NM_000538chr1381739 1673 1524 1398 431 323 147 123 11605 21140 78 152
NM_000555chrX127199 7030 6899 6525 5727 2873 2853 1629 1601 1144 855 217 36258 1475 1250 ----
NM_000584chr481216 1088 890 796 754 407 352 159 21110 779 ----
NM_000611chr11135861 5221 4938 4927 4827 2715 1846 1638 1621 1314 985 807 792 25544 1119 44888 2658 1895 854 11276
NM_000618chr12206318 5031 4973 4722 4508 4442 4143 4054 2188 2066 1786 1630 1473 1433 839 614 407 397 328 100 ----11644
NM_000618chr12206318 5031 4973 4722 4508 4442 4143 4054 2188 2066 1786 1630 1473 1433 839 614 407 397 328 100 ----11644
NM_000633chr1894754 4726 4368 4260 4043 3541 3510 3450 367 11394 54992 4981 4561 4301 3664 --
NM_000726chr271250 1089 257 214 203 188 177 ------
NM_000793chr14124987 4696 3926 3679 3116 1913 1868 1749 1653 1582 1148 135 24729 3232 13126 14576
NM_000806chr551975 1854 1719 1597 418 --31391 689 426 --
NM_000809chr4279315 9024 8715 8376 8320 8233 7973 7681 7361 7035 6977 6741 6490 3689 3426 3240 2713 2703 2433 1984 1962 1569 1191 1079 660 412 59 18327 39222 3479 1975 21026 997
NM_000813chr595634 5585 4102 4068 3961 3908 3581 3441 178 14089 34523 4207 1465 15523
NM_000814chr1574185 4102 2558 717 661 425 419 11464 --14211
NM_000826chr482456 2389 2258 2121 2079 904 705 596 11593 21905 145 12280
NM_000868chrX122643 2552 2425 2346 2188 2158 1964 1648 792 444 233 93 12195 22385 1023 --
NM_000891chr1773325 3053 2913 2737 2513 714 229 --33351 1172 216 --
NM_000899chr12164214 4188 4154 3912 3561 3289 3243 3082 2873 1628 1406 1156 972 923 837 357 ----170
NM_000910chr4111870 1579 1557 1402 1368 1265 1217 348 116 51 32 --11232 --
NM_000926chr11199401 9303 8456 7321 7267 6977 6744 6359 3483 3131 2695 2425 2273 1821 1804 995 644 557 130 48723 2186 1554 1286 22121 1557 --
NM_000950chrX123520 3427 3386 3355 2626 2562 2511 1243 1122 831 558 262 --32791 2611 80 --
NM_000959chr163616 3578 2829 1544 739 679 23871 2875 32906 2767 2582 23998 3850
NM_000963chr162480 2245 2198 2039 1977 1933 1475 12493 1705
NM_000990chr1183904 3817 3453 1016 1006 928 775 28 1285 34028 3690 2964 --
NM_001001132chr2141485 1424 471 378 --11410 1384
NM_001001323chr1253199 2901 947 922 300 1529 22480 777 1723
NM_001001419chr594465 4098 4002 3885 3725 3207 974 917 156 43923 1252 587 525 23892 617 --
NM_001001420chr594465 4098 4002 3885 3725 3207 974 917 156 43923 1252 587 525 23892 617 --
NM_001001481chr8103287 3279 3005 2245 1059 1013 1001 700 552 461 11289 1764 --
NM_001001664chr2143882 3702 3683 3379 3335 3287 3040 2689 2604 1353 953 872 487 387 ----31337 1092 985
NM_001001668chr1993624 2937 2766 1488 1471 1234 1134 1128 937 13038 34295 2873 290 --
NM_001001890chr21124300 4276 3522 3089 1661 1599 1311 889 821 577 567 330 --23763 3161 --
NM_001001928chr22107583 6750 6524 5924 5182 2929 1634 1294 455 448 --18307 15641
NM_001002258chr291848 1818 1694 1529 1494 1429 605 505 352 --31858 1499 1422 --
NM_001002926chr7102832 2732 2640 2598 1976 1756 1110 1084 579 170 --42417 1024 746 61 22395 54
NM_001003652chr18168358 8114 8093 7744 7456 5800 2735 2391 1715 1557 1339 1279 1250 1151 1039 177 12853 15691 1376
NM_001003674chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_001003675chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_001003679chr1112168 1994 1924 1825 1763 1700 1414 897 441 349 180 22038 633 1173 --
NM_001003712chr12213926 3820 3795 3373 3261 2635 2601 2520 1491 1471 1456 1335 1243 1062 939 669 660 625 575 391 214 --43605 594 563 126 --
NM_001004317chr6104368 3806 3637 2755 1458 1112 1080 779 406 335 --23602 720 --
NM_001004419chr12114452 4228 3829 3602 3514 3254 3178 2831 568 311 76 12864 23641 1551 1781
NM_001005473chr5196266 5601 5494 4868 4256 2550 2515 2501 2411 2367 1845 1741 1310 790 690 656 425 185 26 12215 26531 6325 --
NM_001005502chr12135217 4543 4470 4153 4130 4070 3290 1598 1588 756 748 349 205 --14766 14198
NM_001005746chr271250 1089 257 214 203 188 177 ------
NM_001005747chr271250 1089 257 214 203 188 177 ------
NM_001005753chr262348 2282 884 342 289 181 12218 1186 1330
NM_001007023chr14124987 4696 3926 3679 3116 1913 1868 1749 1653 1582 1148 135 24729 3232 13126 14576
NM_001007075chr471141 1125 1059 999 985 200 88 --1755 2410 252
NM_001007097chr9125064 5005 4814 4433 4333 3741 1847 1660 1537 1142 800 132 11923 25072 437 --
NM_001008539chr8185406 5344 5276 5239 4894 4377 4367 4355 3890 3438 2066 1321 1226 934 576 568 397 217 35286 1520 777 ----
NM_001008707chr1421462 1367 11226 21855 1229 31931 1927 1923
NM_001008738chr5112955 2854 2814 2709 1173 811 792 721 541 339 289 1111 22485 2229 1848
NM_001008756chr352595 899 864 853 396 --12342 12051
NM_001008925chr4133545 3398 3386 3301 3152 2936 2749 2392 2240 2180 1382 1001 669 31131 503 378 13339 --
NM_001009554chr4114691 4443 4417 4142 3568 3548 3284 3071 1616 675 159 13039 14020 --
NM_001009554chr4114691 4443 4417 4142 3568 3548 3284 3071 1616 675 159 13039 14020 --
NM_001009899chr3186512 6506 6469 6359 6262 6130 6038 5805 4380 2547 1228 1134 1109 902 711 602 528 136 --24830 1347 --
NM_001009909chr1173392 3094 2956 2927 997 247 233 13637 12877 21286 634
NM_001009960chr752664 742 518 256 167 12634 32141 418 346 12651
NM_001010861chr1102423 1928 1747 1113 1084 901 786 752 672 348 1780 21783 944 --
NM_001010888chrX124292 3829 3131 3123 3009 1859 1449 980 858 342 206 37 11772 14557 --
NM_001010891chr5156694 6481 6152 5590 4794 4763 4466 2414 1989 1072 793 597 565 490 338 32420 1454 213 --16899
NM_001011513chr4204157 4135 4088 3990 3961 3184 3075 3039 2969 2828 2567 1540 1457 1130 967 460 368 313 285 127 ----14141
NM_001011666chr7116397 6239 6185 5803 5571 5478 5376 2336 1834 1783 379 --14077 1901
NM_001012398chr1641027 844 428 349 --21067 776 1705
NM_001012420chr15122941 2846 2829 2735 2713 2610 2452 2189 2171 1070 155 97 --11899 --
NM_001012423chr15132941 2846 2829 2735 2713 2610 2452 2189 2171 1070 1031 155 97 --22754 1899 --
NM_001012751chr1081964 1759 1437 678 390 155 136 130 ----1688
NM_001012754chr1392114 1998 1627 1435 1387 832 412 189 56 12075 11528 12079
NM_001012755chrX105104 4846 4724 4662 4288 3950 3848 1152 843 274 ------
NM_001013620chr12178493 8065 7990 6747 6368 6066 5728 5717 3140 2485 1907 1484 1061 557 519 302 167 46360 2551 2374 566 47467 6664 3347 2443 58153 6629 2322 2004 1636
NM_001013659chr19145365 5131 4707 4180 4038 3913 3370 2076 1563 1216 1160 956 848 384 35457 1778 1315 11672 15090
NM_001014380chr13195890 5805 5715 5471 5183 4761 4726 4303 4253 4046 4025 2162 1727 1600 1534 1030 726 475 151 32102 1304 1141 23634 1278 14916
NM_001014797chr10177550 6855 6761 6402 6354 6138 5711 5703 5281 5255 5157 2600 2570 1358 622 570 80 26197 466 66394 6370 716 473 181 126 1338
NM_001015045chr482177 2093 1861 1811 1729 1602 1029 591 --32536 2515 737 12046
NM_001015887chr32633 32 11579 41748 1582 481 37 11745
NM_001017440chr7158208 8088 7855 7230 6795 6675 6639 5228 2110 1756 1413 1373 1355 559 244 38025 7815 6767 ----
NM_001018067chr1155378 5363 4728 4571 4271 3658 3557 3442 3242 2054 1334 1276 893 742 269 23727 3391 1939 --
NM_001018068chr1155378 5363 4728 4571 4271 3658 3557 3442 3242 2054 1334 1276 893 742 269 23727 3391 1939 --
NM_001018069chr1155378 5363 4728 4571 4271 3658 3557 3442 3242 2054 1334 1276 893 742 269 23727 3391 1939 --
NM_001024647chr12207700 7591 7341 7182 7004 6989 6941 6750 4733 2563 2057 2040 1911 1793 1748 1265 877 281 264 223 56514 6299 1407 758 713 57617 7255 761 706 269 --
NM_001024956chr11235871 5836 5682 5577 5474 5305 4901 4852 4761 4667 4476 4300 4273 4253 4215 3987 3843 3736 3672 1407 658 311 108 34021 1996 553 22160 2068 --
NM_001025076chr1066247 5387 1182 1021 963 228 14082 23766 1319 15800
NM_001025077chr10147605 6745 5116 2540 2379 2321 1586 1364 1280 835 808 800 788 773 15440 35124 2677 338 17158
NM_001025079chr394126 3944 3670 3616 3495 3086 2751 1053 521 23040 2758 ----
NM_001025233chr123577 127 118 32735 746 480 1813 12573
NM_001025780chr941584 595 336 61 31450 1382 646 1115 11454
NM_001029863chr682920 2716 2541 2519 2415 938 914 797 --12968 12614
NM_001030055chr14164762 4633 4580 4513 4200 3635 3277 3165 3122 3034 1703 1578 1468 1405 1302 137 1336 --31411 1208 615
NM_001031732chr483698 3688 3658 3141 2306 1321 761 80 21085 609 21123 280 --
NM_001031812chr5162295 2173 2147 2086 1927 1674 1617 1444 865 805 660 641 541 340 276 246 1932 --11685
NM_001032394chr6132853 2832 2759 2584 2287 2002 1914 1879 917 783 605 568 211 1771 ----
NM_001032395chr6132720 2699 2626 2451 2154 1869 1781 1746 784 650 472 435 78 1638 ----
NM_001033045chr2124288 3966 3522 3394 2956 2896 2849 1022 930 762 751 243 23807 2870 24466 3676 14052
NM_001033059chr651804 1345 1330 128 67 --1197 21566 1264
NM_001037174chr282224 1737 1389 870 565 344 243 25 --1923 138
NM_001037317chr1102423 1928 1747 1113 1084 901 786 752 672 348 1780 21783 944 --
NM_001039538chr2123177 3033 2452 2309 2273 907 779 773 574 472 160 106 --22457 500 --
NM_001039580chr4125121 5103 4822 4810 4755 3893 2012 1879 1725 895 108 58 1420 14910 14249
NM_001039585chr173873 3835 3086 2629 996 936 275 24128 3132 33163 3024 2839 24255 4107
NM_001039618chr11155823 5536 5341 5287 5188 4673 4536 4318 4253 3824 1919 1605 1243 978 645 21177 1068 55490 3781 2350 1711 154 --
NM_001039840chrX196088 5910 5710 5516 5502 5081 4905 4819 4734 4283 3766 2074 1988 1238 689 651 560 269 249 ----23841 665
NM_001039937chr1394159 3826 3673 3061 2896 2880 1279 1055 55 --33891 1628 515 23888 2778
NM_001040020chr7121588 1513 1392 1376 1252 1187 632 617 301 177 161 79 --41558 1397 626 61 --
NM_001040152chr7115157 4983 4955 4917 4670 3748 3736 2025 1429 1150 516 23122 580 24726 3730 23976 1378
NM_001040202chr462580 2290 1885 1717 924 398 11629 1266 22105 2101
NM_001040284chr16175883 5521 5349 4964 4404 4224 3632 3590 2291 2181 2000 1561 1381 1236 295 285 242 11488 24009 3766 15803
NM_001040402chr4103226 3074 2949 2749 2637 2518 2076 643 598 64 22987 374 12942 22085 998
NM_001040441chr195448 4969 4405 3875 3719 3477 1947 1499 354 --25510 4852 15436
NM_001040665chr7144948 4618 3761 3645 3550 3229 3125 3072 1550 1537 1191 997 311 190 23912 118 33982 3637 1075 13979
NM_001040875chr8142702 2492 2434 2366 2303 2235 1921 991 985 772 664 515 486 477 1584 1757 --
NM_001042355chr1693889 1924 1646 1473 1381 850 789 354 271 51735 1675 1659 1199 239 1359 35360 1129 633
NM_001042412chr1693889 1924 1646 1473 1381 850 789 354 271 51735 1675 1659 1199 239 1359 35360 1129 633
NM_001042555chr12124648 4383 3925 3818 3647 3261 3003 2965 1791 1737 1422 787 24604 264 13792 13990
NM_001042599chr2197836 7336 7254 6706 6657 6584 5967 5947 5902 5802 5297 2797 2745 2612 2184 1929 1734 1506 1436 35685 5405 2920 34856 2013 1511 27871 903
NM_001042603chr12104423 2134 1940 1516 1417 1230 1222 1190 1159 1112 --35171 3951 109 --
NM_001042604chr3204863 4581 4545 3924 3670 3313 1814 1603 1530 1496 1412 1374 1095 696 674 451 353 232 113 56 --14476 --
NM_001044722chr5162295 2173 2147 2086 1927 1674 1617 1444 865 805 660 641 541 340 276 246 1932 --11685
NM_001044723chr5162295 2173 2147 2086 1927 1674 1617 1444 865 805 660 641 541 340 276 246 1932 --11685
NM_001079874chr172156 2139 2050 2006 1538 352 52 11635 21876 336 1615
NM_001083620chr482454 2387 2256 2119 2077 903 704 595 11592 21903 145 12278
NM_001099678chr3246447 6394 6318 5855 5740 5547 5166 4711 4685 4664 4613 2222 2154 2052 1953 1693 1375 1359 1011 857 801 311 266 104 34489 1930 213 46350 4534 2271 2139 11959
NM_001100108chr1178289 7945 7694 5979 5277 3096 2797 1901 1768 1555 917 780 586 417 208 202 187 37448 6304 3189 12590 18295
NM_001106chr3179696 9205 9171 8701 8187 8090 7844 7721 7552 7093 6861 6581 3088 1958 1644 1271 974 16028 17938 --
NM_001146chr862163 1587 1482 812 536 331 21525 803 2659 118 --
NM_001160chr12112818 2693 2374 2213 2122 2071 2020 1858 1846 1795 146 ----1543
NM_001167chrX156387 5462 5242 4505 4427 4328 4318 2223 1126 871 760 648 438 304 51 54924 2171 1816 1034 311 21495 378 --
NM_001173chr14164762 4633 4580 4513 4200 3635 3277 3165 3122 3034 1703 1578 1468 1405 1302 137 1336 --31411 1208 615
NM_001177chr12142484 2049 1721 950 939 894 570 530 397 354 193 154 141 86 ------
NM_001201chr4153826 3638 3175 3086 2823 2564 2506 2418 1477 1091 973 525 221 194 24 11018 --13575
NM_001204chr2217657 7643 7529 7471 7297 6464 6296 5992 5740 4781 2948 2880 2861 2508 2191 1879 1639 1004 790 508 142 12572 37648 2608 1009 12230
NM_001206chr993085 2958 2929 2300 2276 2269 2037 1123 820 --12310 13168
NM_001233chr792406 2318 2257 2117 1980 1928 1681 711 535 --1641 31842 1799 1745
NM_001241chr2102416 2049 1684 1545 940 615 472 302 225 80 1464 1371 --
NM_001241chr2102416 2049 1684 1545 940 615 472 302 225 80 1464 1371 --
NM_001259chr7125670 5240 4882 4261 3985 2360 2141 1232 867 636 532 311 24805 2425 22124 1660 --
NM_001289chrX81677 1527 1441 449 442 379 333 154 31227 627 238 21088 325 --
NM_001304chr17103455 3446 3044 2862 2804 1392 716 553 364 32 23744 729 23481 558 --
NM_001356chrX112534 2427 2367 2205 1909 1902 884 741 694 474 394 ----1898
NM_001412chrX83662 3291 2566 2293 1441 1122 902 475 21029 183 22510 99 --
NM_001432chr493911 3847 3607 2720 2549 2481 1046 693 247 --23757 2982 12377
NM_001438chr1123579 3546 3460 2966 2730 2657 2502 2248 2230 1298 1217 998 13208 ----
NM_001546chr65974 586 512 321 304 11018 1561 2518 455
NM_001616chr243544 2747 652 494 1364 22139 730 23474 459
NM_001621chr7133084 3004 2949 2733 2588 2554 2505 2387 1135 1073 964 917 546 12787 2790 483 --
NM_001621chr7133084 3004 2949 2733 2588 2554 2505 2387 1135 1073 964 917 546 12787 2790 483 --
NM_001627chr3111949 1914 1831 1629 1473 856 844 761 640 311 268 ------
NM_001634chr651804 1345 1330 128 67 --1197 21566 1264
NM_001650chr1874004 3404 3261 3243 1496 144 89 ----23637 2657
NM_001682chr1262913 2615 1156 1104 661 636 1243 22194 491 1437
NM_001684chr1123370 3304 3087 3069 2781 2612 2601 2558 1547 832 748 641 --13510 11668
NM_001689chr291848 1818 1694 1529 1494 1429 605 505 352 --31858 1499 1422 --
NM_001730chr1361426 1406 1362 1231 642 556 11021 --21412 1139
NM_001730chr1361426 1406 1362 1231 642 556 11021 --21412 1139
NM_001742chr7101790 1679 1535 1496 1427 1150 725 609 560 141 11331 ----
NM_001754chr21124300 4276 3522 3089 1661 1599 1311 889 821 577 567 330 --23763 3161 --
NM_001755chr1682024 1999 1978 1743 1466 1420 667 457 21839 486 --21754 917
NM_001777chr394126 3944 3670 3616 3495 3086 2751 1053 521 23040 2758 ----
NM_001830chrX54020 3664 3560 3544 1377 2280 271 1312 162
NM_001858chr6145061 4768 4713 4636 4044 4019 3314 3180 1889 1610 1344 711 482 270 24758 4518 24898 1027 --
NM_001874chr12135217 4543 4470 4153 4130 4070 3290 1598 1588 756 748 349 205 --14766 14198
NM_001918chr1149069 8015 8009 7960 7712 6605 3545 3030 2640 2346 1475 1168 1030 174 59210 6563 2953 1389 100 58313 2657 2110 1298 754 --
NM_001966chr381440 1430 1319 1269 404 271 207 116 11361 41324 1145 332 306 1326
NM_001981chr1102419 2152 2128 2110 2000 1928 1812 1582 653 123 1778 32427 2036 1889 --
NM_002006chr4145807 5669 5652 4740 4605 4592 4234 4048 3648 2325 1341 1283 1147 1019 33524 1603 686 35513 426 86 15551
NM_002009chr1592243 2223 2016 1737 768 625 580 493 51 --22726 1835 11698
NM_002015chr1393287 3275 2782 2387 854 790 723 649 454 12755 23266 2708 1745
NM_002025chrX188104 7828 7616 7360 7166 6528 6195 6024 3327 2671 2603 2511 1615 1608 1449 948 759 528 28015 6837 37077 6741 3707 27727 572
NM_002033chr11104066 3929 3512 3464 3349 1572 1506 1159 652 608 --33319 3092 2891 --
NM_002040chr2193171 3021 2681 972 674 525 511 413 134 ----22431 339
NM_002069chr791892 1882 1774 1657 1296 623 455 377 181 1395 21325 261 --
NM_002092chr4105081 4499 3893 3231 3124 1868 1528 1439 896 285 21912 597 25000 4492 21337 303
NM_002126chr17113967 3906 2999 2590 1474 1375 1217 1207 1161 670 539 13736 21303 35 --
NM_002128chr13102372 2157 1945 1876 1660 1606 549 446 433 239 12603 22184 1002 --
NM_002137chr7102285 2219 1657 721 632 550 455 184 128 37 12373 22144 615 --
NM_002158chr2133835 3468 2997 2659 1427 1089 1053 1029 1016 826 795 537 350 23671 3557 1231 --
NM_002203chr594178 3935 3892 3761 2547 1216 1127 463 66 13674 43973 3813 3163 2641 --
NM_002210chr2103490 3449 3347 3311 2938 2753 1294 681 168 60 13292 --12365
NM_002214chr7115371 5129 4169 4141 2195 2157 1675 976 795 721 686 35503 1023 494 15081 21133 502
NM_002268chr391561 1551 1506 1410 1329 1218 651 466 420 1481 3673 484 263 --
NM_002270chr5165673 5249 5211 4795 4639 4176 4155 4083 3864 3541 3460 2258 1948 1696 1636 1068 24421 2017 35667 1314 729 1364
NM_002310chr5206614 6070 6024 5942 5840 5770 5712 5526 5208 5136 5087 4829 4813 4026 2562 2342 2166 1629 1428 387 26332 463 46505 5974 4662 1991 16257
NM_002336chr12145043 4605 4179 3855 1997 1705 1355 1325 1034 812 710 428 52 46 24415 1477 24980 3731 --
NM_002374chr2123177 3033 2452 2309 2273 907 779 773 574 472 160 106 --22457 500 --
NM_002481chr197989 7823 7754 6751 6526 6014 2930 2537 2346 15179 37868 6275 881 17983
NM_002594chr2042472 2260 2099 486 --31901 1822 1743 12398
NM_002595chr1281627 1537 1365 1230 1196 480 398 361 ----1509
NM_002613chr1695373 5311 5270 5213 5150 3559 3362 3318 958 14552 --14921
NM_002645chr11123114 2764 2747 2502 2449 2253 933 848 784 677 610 494 --1589 23001 939
NM_002655chr8155314 4146 4136 4117 4046 4000 3773 3643 1880 1865 1382 1269 487 459 401 33721 1312 55 34395 3507 517 --
NM_002709chr293478 3459 3315 2955 2806 2326 1131 301 189 23403 1059 21062 63 --
NM_002734chr1782266 2014 1819 1618 1577 723 199 178 42150 1838 1710 363 22185 432 --
NM_002740chr3112704 2528 2040 1863 1766 1124 1073 916 509 490 143 12296 12491 --
NM_002837chr12134630 4328 3418 2952 1781 1772 1333 1119 1052 738 577 463 205 21733 1503 14545 --
NM_002886chr3125217 5096 3911 3788 3773 3743 3529 2021 1971 1244 1006 64 24576 4542 ----
NM_002892chr1491470 1307 1298 1213 687 601 556 542 48 --11074 1195
NM_002977chr2103406 3370 3326 3312 3112 3015 2115 1143 351 270 12630 23379 471 --
NM_003034chr12128132 7997 7197 6888 5958 5334 2863 2457 1871 1686 1005 840 --27122 1412 15197
NM_003042chr342258 2192 2046 1916 21848 1661 12202 22176 663
NM_003046chr8185406 5344 5276 5239 4894 4377 4367 4355 3890 3438 2066 1321 1226 934 576 568 397 217 35286 1520 777 ----
NM_003048chr232163 1920 738 52143 1732 525 400 286 --22433 149
NM_003071chr391917 1856 1800 1371 796 784 704 678 196 1512 --1583
NM_003112chr7163253 3200 3128 2701 2656 2516 2503 2316 2125 2058 1179 919 892 520 377 228 11240 ----
NM_003155chr87824 769 740 454 437 418 405 12599 2902 482 --
NM_003161chr17123618 3495 3191 2996 2639 2621 846 774 664 542 523 22 33631 3598 2383 33601 2434 1255 23026 1349
NM_003199chr18164049 3620 3540 2227 2180 1888 1833 1813 1804 1544 1442 903 768 653 641 136 45641 3848 2047 1367 14568 11509
NM_003262chr3105268 4723 4290 4003 3416 3374 1893 1467 1358 1257 21266 25 32050 1549 1477 --
NM_003274chr2172724 2691 2350 2324 1164 1095 1024 --42069 1169 1125 687 --
NM_003298chr3156182 6158 5470 5110 4835 4665 4420 3877 1874 1490 1414 1350 659 626 389 46232 5346 4814 4045 24111 4048 --
NM_003338chr1071732 1398 1354 375 323 131 70 21687 526 11671 11668
NM_003342chr1783269 2823 2756 2599 2592 2368 1319 366 11157 22523 795 33279 2852 887
NM_003392chr393993 3704 3060 1466 1460 1454 914 888 454 ----1847
NM_003410chrX53036 2860 2819 846 203 12459 1448 12515
NM_003463chr6123398 3309 3259 2842 2475 2403 2315 2232 2084 1333 1261 1027 ----23341 3019
NM_003477chr113781 514 284 ----2669 189
NM_003478chr1193262 3217 3074 2725 2677 2143 2080 830 108 43053 2709 2428 677 12820 --
NM_003489chr21103198 2770 2104 1036 681 491 293 280 181 68 --12868 23465 265
NM_003566chr12143332 3209 3138 2915 2594 2417 2153 1003 960 872 828 601 546 269 12119 33379 2956 55 12201
NM_003574chr18125715 4946 4440 3964 2300 1813 1283 1187 995 466 328 265 --34022 3744 1754 14632
NM_003590chr2153753 3628 3419 3182 3093 1491 1353 1316 1035 938 825 730 508 366 243 ------
NM_003615chr3173744 3493 3454 2808 2706 2659 2619 2593 2494 2470 1175 1124 1111 905 892 500 31 33982 2815 336 33168 1388 1360 --
NM_003617chr1164974 4862 4728 4317 3900 3852 3726 3492 3330 3282 1278 836 607 588 377 341 --2756 324 --
NM_003633chr592596 2484 2043 1894 1741 741 663 601 153 1904 --41836 1807 622 236
NM_003672chr181975 1911 1732 1246 565 490 374 366 11387 31501 1390 191 --
NM_003679chr183484 3383 1007 1001 547 423 291 128 23234 973 13430 --
NM_003722chr362757 2526 2018 1079 362 349 1409 21023 342 --
NM_003772chr1181319 1240 1181 1035 901 517 219 213 1403 ----
NM_003774chr1262933 2217 1094 1040 296 272 43298 1115 1103 632 31126 797 402 31123 1119 1107
NM_003794chr381110 1068 904 315 289 116 107 58 ----11116
NM_003799chr18124401 3909 1380 1329 1298 1039 1033 615 496 468 462 108 --14434 --
NM_003884chr361744 1345 1330 240 210 109 1540 1371 31215 368 279
NM_003913chr674018 3879 3635 3183 1351 88 34 11122 44142 3969 3197 374 --
NM_003930chr762346 1908 515 459 200 194 1177 ----
NM_003932chr2241623 1577 1396 476 --21915 723 21690 1252
NM_003948chr492689 2642 2611 2177 2140 2077 1925 1796 626 1598 32102 433 300 --
NM_003966chr5197848 7808 7772 7293 6859 6699 6479 6438 6030 5936 5374 5263 5168 4888 2422 2158 1710 350 30 57087 5900 3124 2629 216 25903 301 --
NM_003994chr12164214 4188 4154 3912 3561 3289 3243 3082 2873 1628 1406 1156 972 923 837 357 ----170
NM_004006chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004007chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004009chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004010chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004011chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004012chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004013chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004014chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004015chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004016chrX92358 2188 2175 1681 680 633 616 608 88 1901 ----
NM_004017chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004018chrX92358 2188 2175 1681 680 633 616 608 88 1901 ----
NM_004020chrX92444 2274 2261 1767 766 719 702 694 174 1987 189 --
NM_004021chrX92358 2188 2175 1681 680 633 616 608 88 1901 ----
NM_004022chrX92358 2188 2175 1681 680 633 616 608 88 1901 ----
NM_004023chrX92358 2188 2175 1681 680 633 616 608 88 1901 ----
NM_004028chr1874004 3404 3261 3243 1496 144 89 ----23637 2657
NM_004035chr1775119 4855 4766 1556 1508 182 105 24941 160 44906 1614 362 124 --
NM_004094chr14122949 2820 2200 2162 1079 990 868 581 405 167 130 59 ------
NM_004124chr14143386 3323 2972 2947 2861 2654 2621 2362 1236 1112 780 507 469 65 11171 ----
NM_004133chr872608 1749 1670 1084 980 433 324 --32589 2453 35 --
NM_004170chr971735 1689 1632 1625 1414 1227 442 --11554 11703
NM_004171chr11189638 8434 8348 8166 8135 7944 7584 7342 3244 3073 2936 2682 2541 2323 1911 1868 1345 238 18917 59675 9410 8119 3006 2968 16463
NM_004232chr1863903 3777 3420 3329 2855 414 2837 376 2967 697 33280 2756 2649
NM_004293chr993569 2590 2534 1528 1319 1298 761 651 203 --1637 23864 1368
NM_004329chr1051291 1144 929 250 224 ----2459 369
NM_004338chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_004384chr5162295 2173 2147 2086 1927 1674 1617 1444 865 805 660 641 541 340 276 246 1932 --11685
NM_004434chr1421462 1367 11226 21855 1229 31931 1927 1923
NM_004458chrX62678 2534 2404 1841 870 319 1728 12269 12357
NM_004464chr4103372 3283 3270 2975 2709 2703 1313 1023 803 517 12676 33653 1181 525 --
NM_004501chr1113161 3059 3042 2845 2813 1202 1138 965 793 446 434 --33792 3314 3268 --
NM_004504chr282837 2225 2151 1187 1002 818 616 376 11938 11941 1418
NM_004525chr231049 263 244 1341 21540 1380 31409 1405 1377
NM_004586chrX115389 5195 4847 4501 3971 3773 1914 1060 1033 641 275 44754 2054 1183 171 ----
NM_004612chr9144416 4330 4258 4207 4133 3640 3199 1809 1208 1125 981 882 649 460 11766 ----
NM_004685chr13122599 2343 2110 1969 1949 1917 1071 1024 924 418 309 165 11823 --1376
NM_004725chr104361 317 180 22 --2322 308 --
NM_004726chrX125794 4556 4221 3572 2177 847 797 743 630 601 267 60 23897 3875 45779 3923 1751 88 --
NM_004744chr4143620 3388 2873 2862 2683 1549 1197 908 842 804 752 526 391 41 23849 595 --12913
NM_004745chr8177052 7028 6790 6558 6522 6394 6388 6376 6304 5597 5554 5203 4729 2485 1802 1066 358 37035 5284 1977 11037 25836 1932
NM_004748chr15134241 3989 3202 3193 3120 3006 1631 1531 1281 1230 786 640 103 1288 14230 23067 792
NM_004815chr1174944 4882 4498 4160 3923 3748 3032 1605 1527 1397 1208 1170 713 560 420 305 163 11700 43932 3112 808 391 --
NM_004857chr14104659 3894 3255 3228 3163 1440 1385 1157 978 480 13155 44812 3628 3272 1332 --
NM_004863chr1475329 4426 4046 1239 1126 1025 162 21395 150 25295 5037 12079
NM_004866chr5115057 4799 4738 3908 3318 1690 1669 1456 1180 1082 228 ----11299
NM_004904chr7116397 6239 6185 5803 5571 5478 5376 2336 1834 1783 379 --14077 1901
NM_004921chr192565 2394 2361 2155 1712 1661 195 154 87 --42482 781 670 169 --
NM_004956chr7134341 3478 2896 1844 1633 1578 1450 1086 900 834 495 405 241 1663 --11211
NM_004985chr12144445 3887 3486 3290 3241 2972 2818 1698 1437 842 681 315 182 139 14049 33350 517 384 11467
NM_004999chr6124502 4123 3821 3570 3449 2923 1780 1451 1025 902 760 739 31648 1583 558 14507 --
NM_005023chr551534 1371 959 590 225 11048 11300 1562
NM_005036chr22107583 6750 6524 5924 5182 2929 1634 1294 455 448 --18307 15641
NM_005056chr1294667 2184 1760 1661 1474 1466 1434 1403 1356 --35415 4195 353 --
NM_005065chr14145398 4961 4245 3898 3823 3545 3518 3496 1772 1743 828 347 201 175 14107 11874 --
NM_005121chr17123846 3442 3156 3139 2784 1269 993 775 641 470 463 357 1317 ----
NM_005156chr9105249 5005 4218 2162 1540 1267 1208 1195 699 452 1592 35391 5208 3434 --
NM_005160chr22156818 6805 6565 6361 5601 5494 5465 4557 4312 2188 2080 1740 1320 961 275 15401 21188 990 21055 1051
NM_005164chr1262689 2627 2270 670 511 273 --11716 22520 1925
NM_005197chr14116145 5945 5055 4907 4826 4327 3780 1384 1369 1344 719 35520 4716 4345 ----
NM_005235chr2197836 7336 7254 6706 6657 6584 5967 5947 5902 5802 5297 2797 2745 2612 2184 1929 1734 1506 1436 35685 5405 2920 34856 2013 1511 27871 903
NM_005339chr4174106 3717 3704 3591 3447 3185 3064 2725 2707 1465 1435 1110 829 658 192 166 83 --44336 3099 2835 2684 42681 2677 2673 2669
NM_005359chr18126254 5733 5095 4659 4234 4150 2538 1791 1586 1566 1291 937 55931 5883 5311 1990 1403 --36265 4970 4966
NM_005399chr183945 3587 2935 1723 1695 1462 1352 230 1642 11060 34107 3243 1504
NM_005433chr1882673 2477 2362 1866 959 592 299 192 12588 --1987
NM_005497chr1795969 5957 5886 5813 5014 4572 1481 1173 408 11530 1479 1692
NM_005504chr12246132 6119 6094 5893 5862 5659 5163 4858 4687 4670 4513 4457 4237 2413 1485 1400 840 742 727 683 534 336 169 85 16320 35287 4047 2312 --
NM_005509chr591599 1523 1501 1442 1291 1247 1177 525 317 ----1517
NM_005578chr3155074 5048 4874 4621 4205 3335 3299 3276 1527 1512 680 576 567 322 138 24401 4235 --14010
NM_005604chr682341 2274 2104 1762 1637 520 354 333 12415 21976 1922 --
NM_005668chr5174628 4425 4132 3974 3949 3552 3433 3344 2952 1854 1552 1342 1199 499 466 241 212 ------
NM_005725chr1102396 2335 2214 2167 2118 1979 789 631 415 178 12450 ----
NM_005746chr782162 1783 1770 1696 1083 1071 979 481 21108 946 1853 --
NM_005759chr2134267 4100 4066 3982 3241 3235 3165 3065 1921 1288 1194 590 548 13839 12901 14397
NM_005776chr147699 635 607 223 208 143 33 2818 301 --1574
NM_005795chr2142722 2653 2483 2436 2394 2371 1957 1092 931 806 800 334 214 106 33041 2184 95 ----
NM_005813chr292590 2509 2427 2209 1889 762 551 338 332 12268 --1129
NM_005840chrX107634 7510 6108 5107 4654 2703 2192 1938 979 726 11046 46727 4938 2835 714 11840
NM_005901chr18168358 8114 8093 7744 7456 5800 2735 2391 1715 1557 1339 1279 1250 1151 1039 177 12853 15691 1376
NM_005903chr594465 4098 4002 3885 3725 3207 974 917 156 43923 1252 587 525 23892 617 --
NM_005909chr5104104 3431 3400 3205 3085 2964 2612 1474 1034 959 13126 13422 11400
NM_005935chr4104915 4871 4713 4254 4169 3845 3433 1679 532 269 21967 1326 21652 281 14889
NM_005941chr883983 3947 3430 3111 1444 1415 1270 1074 22704 1167 11187 --
NM_005955chr1105552 5396 5390 5291 4473 4440 4325 3515 1754 1229 1321 --1232
NM_006007chr9104330 3993 3960 3582 2860 2729 1470 1262 625 182 13102 24511 2874 21220 304
NM_006037chr2104904 3636 3626 3620 3612 1621 1583 1542 1519 1127 --11258 --
NM_006047chr2072827 2670 2559 2363 2329 2279 1267 22970 605 12236 1225
NM_006080chr7172978 2756 2705 2612 2602 2471 2209 2182 2103 1990 1050 1032 872 655 414 222 149 1512 --1812
NM_006094chr882430 2204 1878 1807 1768 1668 485 463 11796 21863 495 --
NM_006095chr4174461 4127 4106 4040 3969 3863 3760 3333 3215 3030 2989 2972 2935 2818 664 548 290 43423 2827 1344 383 64119 3638 3461 3195 994 524 --
NM_006106chr11113407 3371 3285 2929 2491 2188 1377 1207 671 638 325 ------
NM_006113chr172156 2139 2050 2006 1538 352 52 11635 21876 336 1615
NM_006158chr871469 1369 1124 679 414 407 165 2665 314 --11377
NM_006166chr1272577 2494 2334 877 593 444 423 --1587 1184
NM_006183chr126452 401 175 162 151 127 1577 --1546
NM_006203chr5135068 4950 4786 4708 4451 3424 2032 1601 1150 1102 1067 740 608 11328 --15247
NM_006206chr482842 2769 2109 1872 1861 689 604 362 12932 2248 162 32956 1962 159
NM_006212chr1125421 5296 5212 4630 4551 4424 4076 3858 3748 3392 1211 616 11939 ----
NM_006241chr3102339 2196 2111 1565 1484 965 757 630 440 37 32017 1627 138 ----
NM_006251chr5153269 3095 2572 2526 2493 2427 2249 1304 1148 1003 439 373 360 179 50 13001 12506 12847
NM_006252chr1207078 6720 6697 6394 6355 5763 4744 4656 2940 2504 2439 2426 1874 1847 1660 1176 484 371 213 111 37412 886 853 26455 1935 26443 1687
NM_006256chr1102790 2627 2345 2311 2162 1083 797 557 355 198 --1578 12678
NM_006282chr2094558 4477 3831 3757 3739 3526 393 386 366 11353 13452 21802 1035
NM_006283chr8104869 4732 4704 4244 1908 1575 1561 1534 1363 1353 --21823 538 --
NM_006306chrX185942 5931 5739 5496 5317 5051 4998 4515 4326 4225 3914 3743 3602 2132 1739 1455 1109 689 14110 14117 24114 672
NM_006313chr12101719 1455 1420 1406 1399 1291 1254 479 254 124 ----11514
NM_006315chr4104047 3924 3658 3463 3453 3322 3290 2855 1765 366 24014 455 24479 2899 --
NM_006380chr17144409 4393 4239 3908 3872 3673 3350 1490 1138 1108 978 946 861 822 14037 34040 1095 542 --
NM_006457chr4204157 4135 4088 3990 3961 3184 3075 3039 2969 2828 2567 1540 1457 1130 967 460 368 313 285 127 ----14141
NM_006464chr254691 4644 4416 1325 811 --24505 3836 24454 1178
NM_006467chr5122344 2307 2121 1821 1652 1500 801 786 775 685 593 91 --1267 --
NM_006520chrX81720 1150 1097 1063 619 572 373 235 196 1403 11224
NM_006529chr481689 1640 1351 1078 1047 505 263 187 21172 1071 ----
NM_006534chr20133437 3292 2891 2748 2465 2371 2166 1327 1254 1226 1195 972 960 1140 1742 --
NM_006544chr14146098 5670 5488 4649 4531 4078 2275 1383 1132 996 857 709 493 242 65286 5156 5106 4132 4016 1965 24975 3860 12080
NM_006561chr1066247 5387 1182 1021 963 228 14082 23766 1319 15800
NM_006583chr4------2481 356
NM_006599chr16237317 7092 7023 6970 6441 6248 5874 5406 5397 5350 3147 3058 2742 2536 2092 2027 1716 1544 1175 1102 807 755 126 27899 6612 37827 7252 5936 --
NM_006614chr3133441 3153 2973 2936 2508 2469 2387 2361 2305 1188 1137 888 638 --2935 338 --
NM_006620chr6124850 4567 4375 4359 3950 3937 3882 3848 904 897 768 706 64276 4245 3994 1420 1241 112 24141 243 14527
NM_006628chr15124552 3752 1638 1622 1527 1077 835 724 513 472 216 23 23309 672 14679 --
NM_006654chr12124648 4383 3925 3818 3647 3261 3003 2965 1791 1737 1422 787 24604 264 13792 13990
NM_006717chr9103332 2843 2506 2431 1033 834 710 698 290 98 23229 2178 23180 2181 --
NM_006729chrX105493 5234 5133 4403 3716 1812 1265 1110 676 346 22247 1157 21563 100 --
NM_006731chr9155833 5697 5666 4980 4650 3821 3813 3624 3540 1694 1525 1202 1117 1051 638 55603 4215 1354 1340 220 34754 3521 90 34915 1631 224
NM_006750chr16238109 8075 7975 7293 7284 6992 6749 6623 6527 5645 5539 5407 5279 5170 5134 2862 2843 2252 1953 1841 1735 1019 654 22394 806 37982 5045 2827 16572
NM_006775chr682624 2513 2392 2357 2259 1138 694 439 11055 23070 2409 12964
NM_006777chrX102777 2490 2276 2133 1095 981 905 486 449 298 32620 1946 917 1414 --
NM_006885chr16104194 3788 3761 3289 3234 3022 1009 836 803 32 --13603 13911
NM_006888chr14123489 3420 3049 2822 2598 971 930 906 846 427 230 131 --12910 --
NM_006918chr11235871 5836 5682 5577 5474 5305 4901 4852 4761 4667 4476 4300 4273 4253 4215 3987 3843 3736 3672 1407 658 311 108 34021 1996 553 22160 2068 --
NM_006922chr282608 2406 2132 1994 1849 919 784 586 1441 22383 1690 --
NM_006924chr17154471 4299 4250 4066 4019 3430 3403 3137 2947 2754 1755 1495 1193 258 178 1192 --13331
NM_006939chr1441191 922 853 801 1809 1354 11024
NM_006948chr21102473 2278 2182 2115 1763 1752 1699 1521 942 571 22305 992 11679 1623
NM_007007chr12214484 4256 4034 3977 3840 3698 3578 3509 3488 3321 3269 3242 1858 1058 1018 997 820 728 616 319 134 13061 2403 160 --
NM_007038chr21116122 6116 5635 5569 4485 4254 2442 1882 1313 661 391 35174 4558 1451 32162 1749 259 14096
NM_007054chr5113922 3816 3401 3179 3166 3130 1574 728 302 291 122 12453 33768 555 437 13102
NM_007073chr6144252 4016 3743 3178 3137 3072 3048 2910 2902 2875 2830 2726 1650 1209 22982 1564 12880 --
NM_007114chr3153311 3097 3035 2917 2773 2657 2426 2048 821 717 481 363 288 77 33 43297 2966 782 588 1914 --
NM_007125chrY81392 1382 1189 1164 1107 1054 967 308 21295 24 11199 11272
NM_007157chrX122999 2981 2799 2786 749 739 659 559 462 252 233 82 --42809 1057 965 698 --
NM_007172chr22103298 3202 2112 1224 1196 548 226 167 160 108 1277 --23343 1180
NM_007175chr883608 3164 3069 2776 2715 1346 234 59 --22910 2695 23435 3001
NM_007195chr18143601 3573 3219 2975 2855 2646 2632 2443 2315 691 449 278 150 93 1593 1600 23700 597
NM_007236chr1562479 2387 1787 606 271 243 12283 --22240 2236
NM_007249chr13179296 9085 9047 9027 8936 8524 8238 7386 7191 6283 5997 5801 3497 2110 1826 1015 390 49361 9216 2722 2544 48742 7699 6887 229 11378
NM_007292chr1775119 4855 4766 1556 1508 182 105 24941 160 44906 1614 362 124 --
NM_007347chr1573218 2169 680 597 380 307 50 --23032 856 11037
NM_007375chr1102816 2781 2681 2608 2269 2021 1758 1108 596 189 31062 1049 1017 11052 --
NM_012081chr592931 2561 2546 2488 2426 2340 1292 550 464 ----11486
NM_012097chr282224 1737 1389 870 565 344 243 25 --1923 138
NM_012129chr7122371 2066 1756 1747 1733 1677 809 673 635 506 257 180 ------
NM_012141chr1394159 3826 3673 3061 2896 2880 1279 1055 55 --33891 1628 515 23888 2778
NM_012158chr1341849 1217 543 464 --3634 572 497 1159
NM_012164chr9147533 7520 7332 6558 6420 5907 5623 5251 4848 4669 4609 1003 578 572 52187 1244 1226 949 322 24835 2910 11294
NM_012214chr2156194 5308 4803 4555 4547 4471 4411 2429 1251 917 809 793 423 415 392 16237 1628 11117
NM_012238chr1041462 445 291 136 --168 21569 1170
NM_012249chr293549 3331 2981 2842 2721 2370 2238 313 213 23075 1185 22951 1018 12772
NM_012252chr7184873 4526 4424 4327 4268 4012 3994 3763 3680 2070 1936 1843 1824 1453 904 521 506 181 15381 33999 562 511 --
NM_012262chr1135285 5109 4222 4174 3741 3592 1764 1526 1511 1398 962 578 363 11352 --25272 3960
NM_012281chr782285 1691 814 673 335 308 299 82 42303 2263 1501 236 1900 --
NM_012287chr3114558 4519 4468 4030 1765 1712 1672 1016 822 150 113 23222 1604 34439 3779 568 --
NM_012300chr592474 2453 2338 2249 627 504 327 283 131 12026 12033 12030
NM_012382chr5174564 4543 4470 4433 4318 4028 3272 3148 3033 1817 1656 1571 1343 1035 676 184 85 44069 2966 764 268 1767 --
NM_012464chr492801 2544 2375 2334 2254 1925 1889 1875 479 42814 1966 850 645 1289 --
NM_013229chr12112818 2693 2374 2213 2122 2071 2020 1858 1846 1795 146 ----1543
NM_013255chr7278790 8764 8520 7489 7439 7186 6821 6727 6622 6612 6577 6218 5688 3403 2934 2828 2725 2560 2554 2416 2188 2068 2008 1711 1112 474 397 17799 46154 5380 3060 2236 18796
NM_013261chr4103745 3390 3101 2694 2665 2554 1163 1095 896 533 ----13482
NM_013269chr12104379 4155 3756 3529 3441 3181 3105 2758 495 238 12791 23568 1478 1708
NM_013309chr1562051 1951 1675 731 558 528 2699 78 165 22504 1905
NM_013372chr1563405 3335 3007 2957 2565 879 22728 2674 22249 373 13135
NM_013374chr3102701 2012 991 869 596 589 566 469 449 116 --43147 2105 771 66 --
NM_013396chr2131107 529 358 31122 1083 403 --21201 492
NM_013989chr14124987 4696 3926 3679 3116 1913 1868 1749 1653 1582 1148 135 24729 3232 13126 14576
NM_014011chr242371 2355 1869 440 31846 1805 689 11915 11767
NM_014021chr1123477 3240 2943 2464 2362 1233 903 666 555 500 383 328 12554 32337 1188 244 12293
NM_014028chr6123296 3118 2946 2829 2806 2680 2225 2052 996 678 640 332 138 23060 41 --
NM_014048chr16125187 5155 3846 2044 1866 1767 1757 1601 1474 1347 649 78 14030 ----
NM_014057chr951624 429 336 181 163 --2595 281 126
NM_014141chr795349 5305 4885 4587 1316 1049 964 957 512 14146 34797 4786 1576 --
NM_014155chr11157180 6350 5624 5087 4893 4785 2470 2146 2050 1928 1769 1712 1213 965 776 16433 26849 5582 15579
NM_014319chr1291716 1611 1562 1321 1252 772 545 110 79 --2719 588 --
NM_014331chr4237826 7683 7627 7605 6727 6509 6164 6149 6026 5964 5736 5683 5086 5008 3034 3021 2884 2852 2732 2310 2151 1153 1019 27529 5950 87417 6907 6129 5911 4963 3120 1295 396 --
NM_014415chr351695 1322 1095 514 282 --11425 2659 298
NM_014423chr5165651 5640 5123 4981 4260 4011 3728 1905 1674 1128 903 699 397 370 292 206 21717 1441 ----
NM_014445chr3102378 2261 2229 2049 1852 1762 1709 1498 568 214 --1501 --
NM_014616chr393444 3287 3266 2176 1257 1251 778 610 408 22602 1012 2668 321 --
NM_014630chr1563718 3534 3034 2957 1603 1586 --13422 33734 3730 3711
NM_014637chr861060 1050 918 492 279 89 --1355 21036 410
NM_014701chr15103405 2995 2760 2619 2579 2329 2192 1257 278 180 32734 1148 448 1660 11249
NM_014702chr6133141 2720 2434 2380 2360 2320 2131 1262 1023 865 687 600 229 32195 888 822 32558 1238 723 22768 809
NM_014721chr6246871 6788 6721 6197 6142 5986 5814 5706 5695 5655 5327 5234 5136 2784 2096 1472 1403 1219 867 671 646 639 359 91 17197 47084 5774 1604 461 --
NM_014733chr572142 1796 741 731 645 285 94 ----1897
NM_014739chr6104227 3788 3494 2908 2773 1375 1257 1243 900 385 13556 12637 --
NM_014751chr8112186 2124 2047 1921 1820 694 564 471 413 310 202 --11852 --
NM_014755chr2124242 3917 3817 3633 3626 3170 3081 3055 2677 503 362 328 33658 983 274 ----
NM_014781chr871305 1215 896 447 362 355 174 11114 --11311
NM_014803chr1082864 2274 2246 2071 1142 695 595 386 22946 671 --12111
NM_014810chr193711 3695 3648 3626 3516 2810 1458 1021 359 1919 42505 594 418 364 --
NM_014819chr5102480 2428 2180 2174 2163 731 282 194 86 40 1337 12277 --
NM_014829chr562363 1806 960 918 741 255 32329 1757 85 1535 --
NM_014839chr192389 2249 2046 1631 915 821 803 782 321 --12489 --
NM_014841chr62480 408 --21234 255 21134 45
NM_014867chr8133853 3805 3332 3251 3088 3072 1527 1107 1071 1046 798 775 473 12626 13024 --
NM_014873chr184824 4563 4413 4376 3335 3309 946 706 23416 991 34775 4707 57 13326
NM_014877chr17137320 7172 7062 7036 6472 6461 5821 5505 2746 2307 1819 882 508 37491 2913 1240 36376 2111 85 --
NM_014883chr482177 2093 1861 1811 1729 1602 1029 591 --32536 2515 737 12046
NM_014888chr7121588 1513 1392 1376 1252 1187 632 617 301 177 161 79 --41558 1397 626 61 --
NM_014904chr10154022 3921 3344 3276 3031 2995 2978 1463 1065 831 475 337 233 199 146 13423 23097 238 --
NM_014912chr1073337 3015 2742 1426 1058 898 670 11149 32747 2587 1044 --
NM_014923chr13112314 2054 1917 1825 1629 764 628 616 602 499 394 12098 1582 --
NM_014934chr13124005 3955 3512 3393 3164 2955 2782 1150 820 799 751 297 --23977 3712 33907 3862 3626
NM_014936chr692880 2665 2581 2517 2485 2163 537 383 210 1343 --12820
NM_014946chr293076 3024 1956 1893 1178 584 505 352 301 ----13132
NM_014947chr1123145 2789 2765 2689 2432 2378 2193 851 575 561 504 361 11978 13130 --
NM_014950chr1461633 1542 1477 407 401 235 11269 31659 1650 1625 1650
NM_014953chr13144275 3954 3733 3660 3405 2685 1693 1524 1059 1005 828 556 286 79 13632 21104 641 --
NM_014962chr2072908 2835 2813 2658 2534 917 722 --12889 31849 1819 113
NM_014982chr14155432 5329 4844 4455 4402 4299 3896 3763 3587 3438 1730 1457 1263 1195 510 13408 1964 --
NM_014991chr4133303 3257 3192 3059 2783 2530 2159 2023 1202 982 556 427 391 22867 2101 12217 --
NM_015000chr1272908 2794 2696 2284 1949 939 918 12441 22805 1246 13040
NM_015002chr1282130 2123 2006 1532 1464 766 701 639 21675 807 32287 2255 2022 11851
NM_015025chr251906 692 349 322 311 1419 12619 1635
NM_015026chr12124399 4189 4112 4046 3409 3399 1695 1634 1473 698 573 216 24031 191 1511 --
NM_015040chr293406 3247 2838 2751 2408 879 799 352 170 32994 2450 812 12623 --
NM_015049chr292922 2796 2382 2186 828 783 295 117 51 12256 1201 22894 198
NM_015068chr794009 3835 3807 3769 3522 2600 2588 877 281 --23578 2582 22828 230
NM_015087chr13132473 2355 2162 2129 1869 1723 1684 637 627 464 175 136 105 --11644 --
NM_015092chr1684570 4492 4089 3694 1196 1106 912 549 13092 --11803
NM_015115chr4103226 3074 2949 2749 2637 2518 2076 643 598 64 22987 374 12942 22085 998
NM_015172chr151410 1303 1094 1061 619 1324 1264 1609
NM_015199chr392971 2960 2658 2264 2178 1080 914 807 564 32677 2462 503 1951 12681
NM_015206chr15113633 3414 3395 3144 2546 2498 1490 1446 1309 352 270 1135 13765 --
NM_015208chr18153730 3201 2967 2931 1631 1535 1476 1380 1329 1177 1049 1036 988 546 466 23504 969 1958 --
NM_015216chr541464 1410 1384 1257 --21422 987 11001
NM_015225chr9123094 3001 2657 2505 2127 2052 1141 837 772 638 522 364 12519 1669 --
NM_015247chr1693889 1924 1646 1473 1381 850 789 354 271 51735 1675 1659 1199 239 1359 35360 1129 633
NM_015271chr4164133 3978 3798 3790 3726 3652 3625 3544 3314 3134 2828 1097 950 514 348 138 12689 43821 2751 1701 1479 --
NM_015310chr8258423 8398 8331 8282 8256 8246 8171 8140 7602 7005 6340 5534 3240 2812 2333 2199 2126 2031 1793 1725 1651 1122 894 409 259 15852 --16511
NM_015313chr11104747 3836 3501 3372 3138 2971 1797 1528 1380 865 14388 --11885
NM_015317chr2102807 1008 754 631 502 307 195 188 146 89 1764 11036 --
NM_015335chr1272675 2611 2393 2104 1883 1071 852 --22095 222 12092
NM_015347chr1232871 2756 662 128 32578 2231 671 22829 2825
NM_015358chr214884 524 239 84 ----21207 494
NM_015393chr463552 3133 2353 2336 1205 73 13322 23645 50 23143 1166
NM_015394chr1262432 2158 1702 1650 257 208 11733 12474 11740
NM_015436chr4123364 3217 3205 3120 2971 2755 2568 2211 2059 1201 820 488 3950 322 197 13158 --
NM_015446chr171589 1035 573 222 137 107 97 41647 1625 1419 1406 61670 1650 1563 1539 1085 1040 --
NM_015455chr593753 3095 2910 2706 1336 1330 813 742 692 --34138 3827 1548 --
NM_015458chr8105354 5345 4904 4885 3784 1092 1073 604 155 112 ----23534 262
NM_015488chr2--11793 11785 21801 1797
NM_015560chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_015564chr5103099 1256 1214 664 601 534 367 180 117 35 32613 188 164 23437 3233 --
NM_015565chr2162280 2013 465 430 282 189 11458 22224 2075 1833
NM_015569chr1134860 3753 3622 3280 3256 2982 1833 1779 1416 1022 702 76 37 34021 4011 3361 13063 --
NM_015571chr692600 2467 2210 1869 959 729 572 436 174 143 22538 124 --
NM_015576chr372926 2820 2687 517 392 341 322 11021 --11119
NM_015602chr171814 1699 1448 480 399 145 119 11782 11563 --
NM_015640chr1155378 5363 4728 4571 4271 3658 3557 3442 3242 2054 1334 1276 893 742 269 23727 3391 1939 --
NM_015713chr893495 3123 2800 2538 983 627 583 191 44 13244 33595 3077 410 --
NM_015852chr7103545 3378 3319 3210 2676 2385 2277 2268 1421 1368 22713 2491 33538 392 149 --
NM_015878chr8112192 2149 2011 1549 1538 895 869 851 834 741 461 11956 32197 628 490 --
NM_015879chr18168614 8572 8566 8449 7901 7731 6957 5939 5827 5741 3335 3137 3039 2485 1771 960 27092 2055 38153 7379 2140 18123
NM_015886chr8165240 4926 4216 4011 3940 3552 3495 2259 2232 2102 1920 1841 654 336 316 138 24026 420 13657 11818
NM_015888chr1113387 3064 2954 2871 2844 2661 2379 2241 1354 524 308 13209 --13343
NM_015906chr1174742 4253 4103 3877 3796 3533 3332 3302 3249 3132 3103 1330 1300 981 379 352 86 --13167 --
NM_015912chr8142395 2370 2355 2281 2076 1924 1692 1630 973 697 646 476 460 398 1193 1837 --
NM_015990chr471141 1125 1059 999 985 200 88 --1755 2410 252
NM_016009chr1144750 4038 1852 1789 1474 1041 887 867 669 607 481 381 338 160 24051 1724 ----
NM_016023chr881911 1845 1628 1375 639 627 596 81 --11720 12215
NM_016040chr1142529 2037 1856 1747 1120 1068 960 810 795 521 459 424 375 193 1235 --1307
NM_016072chr1262410 2334 2261 1892 943 448 22041 843 --1787
NM_016075chr1393112 2982 2866 2811 2446 2090 212 201 125 33125 2272 581 12577 13129
NM_016079chr262348 2282 884 342 289 181 12218 1186 1330
NM_016083chr6133796 3697 3650 3529 3419 3410 3297 3082 2993 2900 2665 2480 321 22739 224 11086 --
NM_016087chr791559 1522 1503 1400 1393 1274 1166 688 447 1597 --1673
NM_016132chr1553004 2771 2659 1190 342 2490 221 32213 792 224 --
NM_016195chr105871 340 113 71 28 --178 2877 153
NM_016206chr3168314 6843 6743 6579 6490 6394 6374 5944 5543 5482 5437 2317 2058 1727 1029 37 28445 2448 25487 900 18367
NM_016217chr6123584 3515 3049 2736 2579 2358 2333 1341 849 767 680 426 ------
NM_016224chr6111814 1781 1675 1646 1503 1450 1432 358 340 333 159 11438 11604 --
NM_016248chr13104023 3191 3126 3074 2849 1433 1392 1205 525 124 12690 --1615
NM_016260chr2157600 7535 7160 7110 6810 5248 5046 2963 2772 2344 2229 1899 1467 858 420 ----25270 5160
NM_016275chr392591 2258 2160 2038 1839 1827 691 578 404 --12284 12484
NM_016315chr261320 1266 616 573 484 35 1240 11592 21904 742
NM_016322chr9143160 3098 2858 2634 2077 1273 720 650 495 423 260 225 207 172 ------
NM_016422chr11133042 2967 2955 2885 2737 2662 2618 2612 2557 2203 2063 2012 754 1419 12046 22563 2249
NM_016485chr672282 2185 1962 1451 870 678 500 --31927 1418 397 --
NM_016530chr15114083 3563 3352 3193 3116 2864 2710 1552 1483 1056 762 43624 3244 1361 645 14005 --
NM_016531chr4144236 3910 3781 3697 3612 3532 2764 2651 1564 1490 1431 1238 358 167 13260 12873 --
NM_016607chrX71689 1495 1436 1256 1097 577 109 --11500 2263 175
NM_016652chr2081805 1394 1320 574 521 511 144 40 --21660 1128 --
NM_016831chr162288 1744 1567 373 304 103 21604 82 32238 2169 446 --
NM_016953chr2125598 5554 4238 1314 1302 1152 1063 955 736 604 569 433 35811 5381 4423 14685 --
NM_017420chr1483793 2684 1487 1389 1270 1208 1201 210 12864 3634 444 228 --
NM_017423chr4102172 2148 2095 1935 1894 1886 1568 651 222 43 ------
NM_017447chr21114432 4019 3391 3238 3207 1746 1705 1647 1222 686 594 --1462 22761 1390
NM_017580chr1082389 2146 2103 1693 1649 1622 1604 263 1823 1276 --
NM_017628chr4144823 4609 4088 3746 3547 3409 3342 3208 1913 1372 1344 677 591 181 21808 1467 11352 --
NM_017633chr683941 3382 3126 2893 1197 1027 929 661 33405 1538 1225 21551 171 --
NM_017637chr9229395 8282 7689 6844 6745 6551 6474 6386 5767 3729 3665 3520 3169 3072 2746 2220 1856 1493 1280 899 806 528 58387 7041 3163 2378 1755 13035 --
NM_017644chr3114761 4574 4157 3531 3400 3194 2079 2010 1941 1816 318 44529 4288 3142 1981 21419 660 11447
NM_017645chr9123189 3161 3037 2745 2610 2465 2445 1194 793 703 378 68 2621 290 12580 --
NM_017650chr7156035 5777 5682 4992 4953 4943 4774 2367 2330 2296 2205 2045 1448 1112 636 196 25252 2308 --
NM_017658chr14194487 4355 3789 3488 3396 3268 3240 3207 2987 1841 1630 1450 813 707 599 573 530 456 190 1419 31821 422 298 --
NM_017694chr271862 1848 1606 822 713 359 330 21874 1625 11709 11916
NM_017719chr372264 1861 1765 1614 918 813 707 --21675 286 12094
NM_017769chr14163278 3055 3045 2741 2462 2407 2358 2137 2100 1144 1088 461 343 255 232 133 21061 946 23287 2369 --
NM_017776chrX51228 1130 566 339 171 --71328 559 504 495 413 330 246 11615
NM_017801chr392630 2426 2404 2297 2270 1863 1617 563 181 --22234 1636 1294
NM_017813chr8135845 5372 5099 4768 4615 4433 4197 4165 3935 3579 931 389 327 --11070 1893
NM_017831chr18154774 4612 3843 3829 3495 3301 3172 3126 3113 1604 1357 1310 1266 1154 1033 13377 ----
NM_017847chr192200 1810 1802 760 689 649 298 228 57 11882 --12189
NM_017848chrX74534 4097 1861 1527 1010 877 572 14085 54030 2836 932 217 88 14340
NM_017919chr9115845 5528 5512 4937 4862 3938 3650 2147 1981 635 380 35035 4260 1876 21738 142 --
NM_017944chr1192945 2652 2036 1918 1229 863 743 463 50 12887 --2406 402
NM_018003chr1562462 2213 1866 1519 579 533 1152 1594 1748
NM_018015chrX51113 1027 944 924 832 2914 893 11077 --
NM_018084chr2123168 2271 2198 2071 1093 915 716 621 463 412 379 325 22889 2787 ----
NM_018098chr381215 1121 931 889 387 310 115 71 21166 422 11031 1371
NM_018133chr372115 1853 1764 1688 1500 338 102 ----22214 712
NM_018155chr3113399 3023 2906 2701 1236 1171 1138 1008 932 378 123 23094 1084 1757 1754
NM_018157chr1263285 2341 2168 1300 527 424 22115 2002 --22935 641
NM_018191chr13132069 1878 1789 1775 1503 746 667 629 582 569 461 237 222 --3844 412 211 11835
NM_018227chr4132982 2816 2794 2720 2519 2508 2431 2220 2206 2178 1094 722 382 11159 12549 1866
NM_018247chr6103160 2864 2320 2174 1214 1168 1123 941 844 688 12441 33040 1242 497 --
NM_018257chr2052367 2274 2119 1018 655 11756 32611 2580 432 1819
NM_018299chr8103287 3279 3005 2245 1059 1013 1001 700 552 461 11289 1764 --
NM_018351chr12134758 4728 4707 4351 3666 3130 3088 1907 1720 1259 887 567 63 --1779 --
NM_018362chr11114061 4011 3752 2936 1624 1562 1355 1095 847 564 281 11319 33739 783 138 --
NM_018364chr1154041 3975 3779 3642 3340 3250 2727 2689 1512 1478 1436 946 665 382 317 ----23884 2754
NM_018374chr7215094 5007 4837 3797 3611 3400 3353 3287 1998 1582 1425 1324 1211 1069 900 826 769 734 450 373 288 24961 1080 ----
NM_018409chr4103242 3187 3144 2482 2403 2360 2236 1227 1130 644 12306 22786 556 1959
NM_018440chr8178653 8428 8346 7713 6805 6455 3351 3024 2984 2766 2414 2267 1510 1345 1280 1006 732 17725 32620 1331 953 17257
NM_018566chr1135125 4758 4752 4401 4273 4093 4024 3258 1981 1298 1247 651 557 35138 1211 535 24256 630 15160
NM_018638chr12195672 5231 4919 4746 4175 4091 2126 1629 1614 1608 1585 1307 1185 707 681 675 470 376 122 65633 5278 5071 4057 1767 167 35281 1704 1412 25583 3582
NM_018972chr8142702 2492 2434 2366 2303 2235 1921 991 985 772 664 515 486 477 1584 1757 --
NM_018976chr1292907 2796 2488 2407 2212 675 566 530 348 ----1146
NM_018979chr1251649 852 837 826 25 --22452 831 --
NM_018999chr10134949 4900 4185 4166 4067 3608 3524 3424 1730 1478 1376 1244 178 24650 3996 14266 --
NM_019001chr3204863 4581 4545 3924 3670 3313 1814 1603 1530 1496 1412 1374 1095 696 674 451 353 232 113 56 --14476 --
NM_019004chr792368 1955 1921 1479 737 567 434 267 147 126 22384 774 --
NM_019022chr1873082 3064 2774 2433 2411 1984 1227 22992 2156 22310 2043 22367 2040
NM_019041chr692411 1907 989 604 525 461 426 240 139 --22618 2092 1538
NM_019050chr492191 1713 1646 1441 1415 757 637 612 93 --22153 790 --
NM_019072chr5124297 3763 3512 3232 2826 1325 1143 1137 925 874 522 161 13080 1507 151
NM_019084chr1062427 2298 513 487 373 163 42585 678 558 100 21994 1618 --
NM_019117chrX93484 3191 2357 1237 1208 745 651 197 186 23244 2412 ----
NM_019593chr20103204 2664 2219 1083 726 615 422 317 258 236 32898 2652 1964 43209 2396 1163 1006 --
NM_019610chr182159 2127 2017 802 791 641 378 231 21386 319 11349 11963
NM_019891chr161237 900 887 331 159 128 --11344 1188
NM_020122chr2105991 5938 5573 1959 1802 1339 1300 336 326 196 32327 2105 843 24310 1986 --
NM_020139chr472063 1454 1436 1398 1376 653 252 11913 42075 1594 1381 312 --
NM_020148chr1863066 2596 947 711 534 156 11107 --22682 1001
NM_020156chr72245 208 2162 107 --2474 139
NM_020177chr5113330 2888 2839 2773 2722 2587 2311 2094 2050 1202 179 12902 22483 516 161
NM_020337chr4143149 3134 3016 2914 2783 2635 2495 2461 2282 1076 1063 995 952 557 ----22398 2308
NM_020341chr2081777 1729 1657 1493 1355 1326 1272 228 2612 34 12062 11289
NM_020455chr6132853 2832 2759 2584 2287 2002 1914 1879 917 783 605 568 211 1771 ----
NM_020456chr1352218 2189 2071 1572 233 1718 --2881 83
NM_020466chr6145028 4467 4409 3806 3416 3351 1913 1758 1114 1102 973 652 278 249 24333 876 23997 1716 --
NM_020673chr20137534 5478 5057 3024 2988 2578 1630 1248 946 934 925 587 461 --37571 7110 811 --
NM_020704chr772389 2022 1864 1797 1689 1638 30 2827 758 --12140
NM_020718chr16106617 6202 5820 5296 4583 2282 2114 1449 1391 613 24907 4122 25635 4393 --
NM_020734chr1242092 1284 1233 431 12169 --22215 150
NM_020739chr15134241 3989 3202 3193 3120 3006 1631 1531 1281 1230 786 640 103 1288 14230 23067 792
NM_020766chrX114572 4197 3875 3400 1746 1731 848 741 328 285 123 ----23492 721
NM_020772chr17208578 8463 8188 7968 7822 7609 7081 6218 5929 5521 5480 2308 1326 1174 1003 945 319 303 297 110 47174 5803 3185 2615 58669 8333 5532 3188 545 15529
NM_020774chr18215967 5819 5561 5280 5234 5107 5030 4294 4281 3916 3906 3795 2183 2093 1684 1323 1183 576 463 317 137 --25680 1336 --
NM_020782chr12154675 4368 3724 3599 3366 3262 3156 1895 1805 1194 889 827 796 667 137 1398 --13452
NM_020787chr17101367 1339 1216 1118 1017 988 531 68 45 26 ------
NM_020792chr382581 1108 500 445 382 203 189 173 ----12715
NM_020794chr171431 1193 1143 337 273 171 57 11494 --11275
NM_020813chr1982736 2617 2492 2393 2371 2360 2350 2200 --189 --
NM_020819chr66921 867 839 415 88 79 ----11223
NM_020841chr12213926 3820 3795 3373 3261 2635 2601 2520 1491 1471 1456 1335 1243 1062 939 669 660 625 575 391 214 --43605 594 563 126 --
NM_020844chr8227650 7414 7191 7136 6995 6385 6281 5046 4928 4809 3018 2988 2719 2698 2612 1969 1561 1129 1060 608 445 215 46914 6506 1874 1224 35447 2426 1959 --
NM_020871chrX102558 2480 2318 2188 2170 1860 1728 639 73 24 21782 715 12545 --
NM_020872chr361478 1246 670 156 135 129 11537 1245 --
NM_020940chr1082829 2709 2687 2346 1085 1035 604 413 31000 522 490 ----
NM_020948chr192665 2391 2353 1073 849 840 296 218 34 32841 304 226 1393 --
NM_021033chr1393536 3471 3091 2449 2339 1354 1126 856 404 --33065 2474 1405 12623
NM_021083chrX103645 3618 3451 3399 3326 3159 3074 1292 773 661 1322 13045 --
NM_021097chr292657 2638 2609 2420 2096 2001 426 263 23 12085 12950 11196
NM_021136chr144760 745 738 223 --1750 1555
NM_021167chr762817 2798 2708 2315 2229 2216 1191 --11122
NM_021205chr172911 2652 2371 2313 2106 1774 220 12855 12705 12894
NM_021629chr3114819 4630 4274 3978 3943 3807 1659 1539 1346 1176 1150 34205 1354 1183 44924 3812 1672 722 --
NM_021647chr4114691 4443 4417 4142 3568 3548 3284 3071 1616 675 159 13039 14020 --
NM_021813chr6115764 5738 4711 4693 4597 4245 3657 2105 1160 1027 363 25622 894 22123 1949 --
NM_021815chr2163110 3024 2905 2597 2502 2407 2072 1190 861 849 838 753 459 448 323 254 ----13065
NM_021911chr595634 5585 4102 4068 3961 3908 3581 3441 178 14089 34523 4207 1465 15523
NM_021912chr1574185 4102 2558 717 661 425 419 11464 --14211
NM_021914chr1472301 2030 1781 1695 779 523 340 --21811 684 1132
NM_021954chr13133593 3292 3273 3236 3220 3050 2999 2918 1219 1122 1070 1038 790 1771 11229 --
NM_021961chr11117334 7171 6804 6574 1656 1619 1555 992 944 844 24 26842 569 35803 5578 468 --
NM_021964chr3196058 6034 5931 5204 5083 4879 4514 4345 4240 4042 2582 1944 1820 1387 1110 473 130 74 21 36573 5154 1268 24474 1338 25679 2390
NM_022041chr16112541 2463 2435 2390 2301 2257 653 591 261 236 224 --12571 --
NM_022351chr8183809 3793 3628 3407 3234 2897 2821 1408 1401 1361 1272 1167 1149 872 634 321 223 126 ------
NM_022456chr12207700 7591 7341 7182 7004 6989 6941 6750 4733 2563 2057 2040 1911 1793 1748 1265 877 281 264 223 56514 6299 1407 758 713 57617 7255 761 706 269 --
NM_022459chr13146373 6363 5906 5781 5576 5265 5191 4573 1649 1643 1115 413 234 191 --26311 4807 25974 4021
NM_022473chr15114206 3324 3293 697 687 572 555 430 203 166 140 23630 3178 ----
NM_022476chr1641027 844 428 349 --21067 776 1705
NM_022483chr581948 1605 1473 1453 1432 1300 768 458 ----1451
NM_022491chr12103498 3224 3144 3031 2450 2302 2177 697 637 515 --22759 550 13331
NM_022572chr2--11793 11785 21801 1797
NM_022763chr3123130 3072 2953 2943 2407 2379 2170 2119 2009 673 409 25 12692 13206 --
NM_022781chr9103276 3209 3175 3161 2744 2317 2014 926 759 691 12947 33334 435 407 --
NM_022841chr1562774 2485 2068 782 684 470 --22032 717 12614
NM_022845chr1681978 1953 1932 1697 1420 1374 621 411 21793 440 --21708 871
NM_022893chr292858 2773 2260 1152 1037 631 609 577 260 13047 11962 --
NM_022894chr251664 1385 693 546 170 21232 25 31162 509 52 1506
NM_022918chr11102182 2168 1901 1817 1771 1605 1413 487 145 32 --21976 600 --
NM_022977chrX62678 2534 2404 1841 870 319 1728 12269 12357
NM_023000chr1491470 1307 1298 1213 687 601 556 542 48 --11074 1195
NM_023001chr1491470 1307 1298 1213 687 601 556 542 48 --11074 1195
NM_023016chr262647 2306 2104 2048 447 47 ----42861 1975 303 291
NM_023039chr54440 365 126 77 --1161 156
NM_023929chr892701 2656 2305 2227 2191 1995 956 688 49 12825 2807 343 21867 1023
NM_024345chr9186142 5944 4833 4652 4503 4341 4050 2444 2272 2197 2169 2147 1525 1113 1078 715 481 96 46155 5650 1918 66 15736 15749
NM_024408chr183704 3693 3583 3411 2972 2627 240 44 23639 3614 23029 2668 13417
NM_024416chr951624 429 336 181 163 --2595 281 126
NM_024423chr18114102 3741 3627 3569 3111 1667 1006 936 508 495 418 54221 4213 3090 1567 569 24279 788 --
NM_024511chr472873 2603 2570 2467 1401 1148 119 22587 1292 --1920
NM_024524chr3143183 2798 2753 2608 2507 2440 2336 2203 1056 1028 874 812 759 709 ----13240
NM_024539chrX101263 1219 1173 967 957 907 810 147 85 76 ------
NM_024596chr885434 3902 3676 3400 3368 1462 1224 179 ----34595 4576 1435
NM_024636chr7102955 1923 1806 1035 959 900 838 532 517 76 21016 388 22940 2766 11054
NM_024646chr173769 3650 3479 3185 1104 973 402 21512 1097 11331 --
NM_024665chr3134534 4284 4170 3959 3886 3587 3137 3036 1874 1464 1367 816 605 33546 682 338 136 --
NM_024751chr442129 829 806 778 11867 12055 1788
NM_024770chr2136147 6023 5984 5978 5489 5155 4752 4324 2538 2451 2404 2244 164 26542 6098 14073 --
NM_024828chr9101539 1369 1327 1215 1054 1031 1001 482 322 205 21594 248 1185 --
NM_024899chr189716 664 621 591 479 230 224 202 111 --2470 251 --
NM_024947chr3269398 9384 9341 8736 8628 8583 8151 7875 7807 7561 6908 6774 6732 6363 6356 6336 5862 3668 3567 3125 2882 2707 2199 1821 1806 906 38780 7012 6138 49100 7704 3707 1518 26381 5914
NM_024949chr4115033 4858 4653 3520 3485 3429 3285 1612 1395 1087 809 44780 3491 1830 1743 ----
NM_024989chr2228215 8202 8069 7582 7148 6682 6579 6255 6134 5732 5306 2938 2070 1355 1300 1286 1055 737 679 581 439 330 15524 47678 7003 5633 2124 18113
NM_025054chr8124183 3795 3712 3557 3485 3083 2641 1222 984 899 823 207 --14233 1845
NM_025073chr1204773 4523 4407 4390 4361 4318 4044 3536 3340 2977 2883 1859 1776 1597 1426 1153 799 706 612 81 11587 12987 --
NM_025160chr1154322 4212 4151 3526 3466 3391 3231 2827 2707 2676 1606 1479 1209 681 363 --13020 --
NM_025191chr183554 3206 3158 2823 2552 2217 865 497 23275 489 13426 --
NM_030623chr291749 1525 1326 1199 607 320 157 71 22 21222 361 21658 1351 --
NM_030625chr1072643 2112 1905 1897 607 600 563 --12438 11911
NM_030627chr5123558 3370 3362 2705 2693 2667 2570 1502 1432 1377 1243 773 24154 3260 3910 902 41 --
NM_030647chr7145569 5269 5206 4604 4318 4107 2251 2221 1767 1551 1398 1205 956 432 15344 46291 5109 4994 2379 11466
NM_030648chr4145564 5443 5010 4844 4114 4077 3876 3602 2193 1986 936 784 530 458 34126 2127 1309 14082 15472
NM_030674chr12135828 4976 4964 4507 4209 2267 1916 1773 1623 1492 1083 1019 479 35751 5727 719 15057 --
NM_030755chr1453108 3007 2664 2132 1035 22976 2736 22652 424 --
NM_030780chr891743 1588 1427 1328 1173 1121 1096 434 313 1323 21578 326 11234
NM_030806chr1148627 7805 7358 7007 5930 5863 2680 2363 2189 1786 1705 1397 1294 43 18802 19059 --
NM_030816chr1153088 3039 2873 2809 2800 2708 2507 1224 890 716 526 457 396 390 338 22589 573 21315 223 1577
NM_031243chr7102285 2219 1657 721 632 550 455 184 128 37 12373 22144 615 --
NM_031268chr1695373 5311 5270 5213 5150 3559 3362 3318 958 14552 --14921
NM_031418chr11132828 2804 2749 2653 2455 2370 2009 1105 1099 908 745 351 64 --22518 778 11721
NM_031427chr14185989 5955 5855 5369 5083 4864 4759 4696 4613 4530 4119 3838 1401 1138 927 839 54 37 35607 2327 2123 15610 --
NM_031431chr1361774 697 335 325 244 29 11743 11860 11439
NM_031435chr1293242 3163 2867 2619 1241 695 603 302 232 12778 22583 737 --
NM_031438chr5111958 1941 1907 1847 1687 1619 1410 1237 414 395 333 --11978 --
NM_031442chrX143071 2746 2731 2622 2616 2602 2586 2540 1252 1243 1233 1199 846 516 12840 1837 12778
NM_031461chr8132292 1560 1541 1487 1418 882 860 686 588 354 348 334 134 1868 32243 2131 633 --
NM_031468chr7158208 8088 7855 7230 6795 6675 6639 5228 2110 1756 1413 1373 1355 559 244 38025 7815 6767 ----
NM_031469chr6133888 3779 3682 2986 2870 2736 2693 1534 1511 1356 847 758 348 --34133 2718 296 --
NM_031483chr20112858 2641 2631 2546 2492 2388 2327 2190 879 532 124 13141 125 --
NM_031844chr1113161 3059 3042 2845 2813 1202 1138 965 793 446 434 --33792 3314 3268 --
NM_031845chr2123177 3033 2452 2309 2273 907 779 773 574 472 160 106 --22457 500 --
NM_031847chr2123177 3033 2452 2309 2273 907 779 773 574 472 160 106 --22457 500 --
NM_032012chr9125187 4464 4424 3970 3861 3287 1953 860 825 552 545 494 35307 1279 938 44141 941 726 378 --
NM_032042chr592726 2637 2263 2166 2080 1956 1072 784 565 1164 12405 12344
NM_032105chr198122 7956 7887 6884 6659 6147 3063 2670 2479 15312 38001 6408 1014 18116
NM_032116chr13195890 5805 5715 5471 5183 4761 4726 4303 4253 4046 4025 2162 1727 1600 1534 1030 726 475 151 32102 1304 1141 23634 1278 14916
NM_032160chr18124218 4106 3969 3550 3455 3122 3017 1694 1574 670 596 63 33449 1036 263 23253 1132 11560
NM_032228chr11113177 2631 2394 2295 1052 901 668 607 127 72 49 33041 1150 532 --12706
NM_032229chr1391012 981 931 870 814 353 231 217 64 1878 2973 69 --
NM_032321chr283051 2323 2302 2280 2249 1287 753 258 22936 547 22657 51 12308
NM_032373chr10105611 5349 4982 4885 4794 3816 1980 1912 1480 31 12316 21811 1073 24522 2057
NM_032445chr1551777 1745 1711 1584 959 1632 11670 22497 1590
NM_032446chr5133877 3492 3449 3320 3314 2940 2919 2399 1553 906 898 825 92 --22343 526 11357
NM_032457chr493896 3568 3559 3509 3157 3137 2928 2791 2649 ----12642
NM_032521chr2083055 2998 2957 2844 2484 2171 2112 811 13176 12535 13102
NM_032826chr775408 4130 4010 3998 3591 3309 1303 13607 44417 3616 1837 1276 25068 4414
NM_032828chr1954642 4421 1517 716 646 --23932 1160 1628
NM_032859chr13203992 3942 3880 3816 3793 3103 2938 2765 2723 2708 2469 1393 1265 1237 631 498 375 323 314 260 1441 23540 662 --
NM_032873chr1184548 4003 3561 3312 3265 3075 3063 92 1161 24196 3346 34560 1267 1097
NM_032968chrX133861 3682 3325 3218 3159 1639 1589 1175 979 552 130 108 96 23982 2908 23242 1432 --
NM_032969chrX133861 3682 3325 3218 3159 1639 1589 1175 979 552 130 108 96 23982 2908 23242 1432 --
NM_032973chrY133853 3674 3320 3213 3154 2570 1588 1175 979 552 130 108 96 23974 2903 23237 1432 --
NM_033014chr951624 429 336 181 163 --2595 281 126
NM_033020chr1174742 4253 4103 3877 3796 3533 3332 3302 3249 3132 3103 1330 1300 981 379 352 86 --13167 --
NM_033143chr4103703 3614 3601 3306 3040 3034 1644 1354 1134 848 13007 33984 1512 856 --
NM_033181chr6133796 3697 3650 3529 3419 3410 3297 3082 2993 2900 2665 2480 321 22739 224 11086 --
NM_033222chr971411 1187 1024 914 908 207 169 --1919 --
NM_033224chr7167575 7487 7437 7365 7010 6023 5362 4887 3046 2850 2737 1904 1597 1498 1344 325 28114 7318 27566 5742 35982 3160 961
NM_033285chr894488 4064 3966 3876 3812 3483 3341 844 453 32735 1650 1598 24336 4262 --
NM_033360chr12154566 4008 3607 3411 3362 3093 2939 1819 1558 963 802 436 303 260 123 14170 33471 638 505 11588
NM_033430chr4113808 3792 3538 3057 2826 1306 1239 1145 1019 980 913 --43991 3772 761 158 --
NM_033437chr4113808 3792 3538 3057 2826 1306 1239 1145 1019 980 913 --43991 3772 761 158 --
NM_033505chr2135768 5665 5014 4862 4743 4267 1894 1488 851 845 451 49 35 42146 1711 1283 1266 44203 1383 613 40 25596 1627
NM_033624chr1282130 2123 2006 1532 1464 766 701 639 21675 807 32287 2255 2022 11851
NM_033644chr592474 2453 2338 2249 627 504 327 283 131 12026 12033 12030
NM_033645chr592474 2453 2338 2249 627 504 327 283 131 12026 12033 12030
NM_033656chr21176003 5884 5402 4812 4799 4638 4552 4513 4292 3890 2026 2003 1263 1107 1031 677 439 35387 4779 4435 35616 1888 131 --
NM_052879chr12163920 3822 3763 3691 3489 3321 2753 2656 1641 1576 1548 1133 981 596 213 188 23641 581 --12744
NM_052885chr12124875 4787 4739 4578 4280 4216 3964 3486 3060 1569 1244 274 14964 1830 34362 3729 1520
NM_052907chr1274031 3430 1672 1162 1102 436 50 13813 33824 1415 1048 11271
NM_052918chr1072977 2807 2498 1474 1398 202 193 12832 12468 12465
NM_053016chr9117795 7732 7469 6569 6389 2832 2520 2028 1508 1227 848 12620 16316 25457 2384
NM_053064chr1493042 2920 2777 2559 2207 2063 715 428 380 --23093 951 12098
NM_057168chr791559 1522 1503 1400 1393 1274 1166 688 447 1597 --1673
NM_058241chr292316 1949 1584 1445 840 515 372 202 125 1364 1271 --
NM_058241chr292316 1949 1584 1445 840 515 372 202 125 1364 1271 --
NM_080867chr14155083 5069 5040 4891 4282 3515 3469 3353 3311 1791 1341 782 503 196 139 --21349 1301 --
NM_130809chr5113147 3136 3128 3035 2842 2833 2806 2698 1239 1124 378 194 11199 11111
NM_130831chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130832chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130833chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130834chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130835chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130836chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130837chr352593 2464 2205 1038 726 32902 2805 2741 12287 32451 2211 1827
NM_130847chr1174371 4223 4124 4003 2217 635 87 24153 1634 55938 5858 5103 4317 150 14595
NM_133370chr483698 3688 3658 3141 2306 1321 761 80 21085 609 21123 280 --
NM_133372chr5112955 2854 2814 2709 1173 811 792 721 541 339 289 1111 22485 2229 1848
NM_133477chr4143203 3114 2923 2848 2533 2200 2089 2000 1285 1163 1017 861 120 83 12624 23285 2169 --
NM_133493chr6144175 4126 3963 3679 3658 3537 3289 2836 1662 1589 1399 1163 560 168 24139 3500 1207 13696
NM_133646chr284945 4887 2169 1497 1159 777 313 218 --35313 3741 1926 11956
NM_138292chr11163579 3530 3513 3176 3049 3042 3017 2486 2393 2253 1182 927 764 745 655 128 22353 105 11388 12492
NM_138395chr25977 891 862 844 94 --11117 1856
NM_138444chr13214931 4692 4564 4444 4367 4071 4051 4043 4012 3770 3532 3251 3192 3165 1895 1681 1622 1576 1476 1310 1131 23263 1564 1956 11714
NM_138459chr6113677 3006 2991 2908 2823 2687 2587 1245 1186 1096 841 --2881 224 --
NM_138468chr2106338 5395 4816 4605 4578 4093 4020 417 402 166 2926 449 ----
NM_138494chr752664 742 518 256 167 12634 32141 418 346 12651
NM_138638chr1472301 2030 1781 1695 779 523 340 --21811 684 1132
NM_138713chr16237317 7092 7023 6970 6441 6248 5874 5406 5397 5350 3147 3058 2742 2536 2092 2027 1716 1544 1175 1102 807 755 126 27899 6612 37827 7252 5936 --
NM_138714chr16237317 7092 7023 6970 6441 6248 5874 5406 5397 5350 3147 3058 2742 2536 2092 2027 1716 1544 1175 1102 807 755 126 27899 6612 37827 7252 5936 --
NM_138731chr14114029 3200 3097 1370 1265 1031 759 693 566 384 287 --14050 13594
NM_138782chr5102381 2357 1872 1576 1539 906 711 444 411 169 1201 12278 1583
NM_138959chr156044 5607 5263 4425 2559 46584 4475 2375 586 11985 36592 6588 6202
NM_139321chr20104224 4035 3531 3053 2623 810 792 630 603 432 ----1999
NM_144571chr4125908 4813 2543 2371 1902 1695 1008 821 396 345 282 58 45577 1650 1503 417 27027 4645 --
NM_144578chr14124998 4720 4261 4135 3971 2169 1457 1280 1213 704 406 206 44553 3868 3756 1695 33838 1218 62 25391 5387
NM_144599chr15125472 4429 4173 3523 1584 1365 1338 1088 897 577 429 277 13506 25438 1507 15039
NM_144664chr1192313 2246 2135 1817 868 537 485 111 39 1518 2776 762 --
NM_144722chr581304 1091 1026 878 417 408 141 21 11114 --1980
NM_144949chr242371 2355 1869 440 31846 1805 689 11915 11767
NM_144973chr12164977 4711 4703 4648 4620 4219 4054 3661 3655 3613 1907 1288 373 304 224 215 14227 35121 3501 3441 14154
NM_145165chr1452890 2435 1029 580 545 ----21136 573
NM_145176chr622371 627 52823 2307 1221 208 189 12900 11002
NM_145259chr2197081 7017 7000 6733 6708 6656 6345 5697 4466 2373 2266 1954 1512 1290 1194 994 482 124 67 45438 4343 4316 545 --26776 345
NM_145307chr10194696 4187 3938 3559 3279 3268 3081 3005 2913 2894 2834 1663 1383 1228 1060 952 864 558 93 33617 702 197 23643 3048 21693 665
NM_147128chr781648 1375 1342 1299 1275 558 516 502 ----11138
NM_147147chr6144252 4016 3743 3178 3137 3072 3048 2910 2902 2875 2830 2726 1650 1209 22982 1564 12880 --
NM_148174chr8112192 2149 2011 1549 1538 895 869 851 834 741 461 11956 32197 628 490 --
NM_152277chr572089 1790 1570 1557 783 416 250 1318 1114 21380 570
NM_152332chr14122764 2277 2190 2112 1892 1865 1106 1096 490 295 264 170 1792 12881 --
NM_152433chr11111735 1430 1414 1322 604 508 377 344 313 136 41 21516 1388 ----
NM_152529chr2124288 3966 3522 3394 2956 2896 2849 1022 930 762 751 243 23807 2870 24466 3676 14052
NM_152538chr32633 32 11579 41748 1582 481 37 11745
NM_152551chr6102780 2136 1125 882 679 513 357 325 314 160 1226 12917 1743
NM_152556chr7102236 2162 2129 2017 1881 1639 1631 427 409 351 11936 ----
NM_152622chr5133359 3337 3245 3101 3018 2871 2661 2421 2215 2206 2187 417 394 23303 1207 32321 1155 179 --
NM_152624chr5167325 7192 6742 6030 5827 5029 4633 2549 2067 1899 1808 1768 1485 846 174 22 56405 5786 2663 2472 423 22755 1357 16894
NM_152636chr11133033 2933 2699 2147 2133 2075 1949 994 910 567 547 475 285 11982 13104 13023
NM_152641chr12142769 2693 2655 2560 2437 2388 2207 1068 791 637 618 609 274 106 --1771 --
NM_152734chr6135463 5382 4710 4522 3924 3635 3332 2159 1991 1655 1506 1185 1153 --23337 2099 --
NM_152754chr7143830 3313 3193 2865 2840 2546 1416 1041 962 864 739 294 254 149 13512 187 13674
NM_152756chr5123766 2752 2742 2663 1743 1317 1273 1093 921 606 392 25 21284 378 ----
NM_152758chr8112863 2798 2744 2425 2317 2206 1199 774 755 491 66 72986 2654 2393 2279 2130 1041 297 32060 1078 300 --
NM_152774chr742277 953 742 722 32457 525 496 32372 1896 783 1694
NM_152785chr352595 899 864 853 396 --12342 12051
NM_152787chrX83966 3821 3476 3131 2633 2479 994 878 23860 3389 --1837
NM_152793chr7155104 5087 5038 4817 4588 4015 3707 2065 1647 877 640 582 475 439 341 1450 24610 718 --
NM_152835chr192814 2743 2675 2665 2658 2188 881 439 212 1691 --11944
NM_152838chr2072827 2670 2559 2363 2329 2279 1267 22970 605 12236 1225
NM_152999chr7144948 4618 3761 3645 3550 3229 3125 3072 1550 1537 1191 997 311 190 23912 118 33982 3637 1075 13979
NM_153013chr542020 902 503 472 12210 3710 607 338 1604
NM_153184chr351991 1958 1827 723 41 ----21318 447
NM_153188chr5165673 5249 5211 4795 4639 4176 4155 4083 3864 3541 3460 2258 1948 1696 1636 1068 24421 2017 35667 1314 729 1364
NM_153207chr1293819 3563 3187 2511 1620 1168 1142 1091 522 1174 43972 3441 1263 527 12886
NM_153235chr662082 740 706 682 620 349 --2556 502 1761
NM_153262chr173232 2450 2390 2290 1953 596 478 --11270 2336 169
NM_153365chr4122675 2648 2544 2260 2085 1992 1830 1762 930 840 575 484 --42380 1968 495 72 --
NM_153371chr1331490 874 158 --11608 21496 438
NM_153456chr13106327 6165 5571 4984 4355 4016 2198 1854 1240 530 34761 1070 473 --35112 1827 822
NM_153607chr592309 1170 1153 741 704 522 488 246 61 13135 2989 682 1147
NM_153645chr22103298 3202 2112 1224 1196 548 226 167 160 108 1277 --23343 1180
NM_153686chr492482 2085 1893 1771 1583 1515 965 697 449 1685 12430 --
NM_153810chr1075126 4658 4607 4377 3436 1884 725 45119 3304 1028 292 11234 24113 1032
NM_170665chr12144604 4537 4497 4409 4333 4305 3717 3674 3638 1184 1135 881 841 746 1253 24191 362 --
NM_170710chr483218 2533 2281 2127 1198 1188 548 539 1404 32415 2214 559 13106
NM_172070chr2112048 1955 1736 1696 1677 1640 753 655 631 614 242 ----12148
NM_172071chr1167435 7192 6701 5347 5327 5274 5260 5194 4790 2070 1856 1385 1099 1065 993 799 57492 6654 6567 1890 265 ----
NM_172373chr1391381 1174 942 864 507 331 184 82 23 21248 145 ----
NM_173214chr16237317 7092 7023 6970 6441 6248 5874 5406 5397 5350 3147 3058 2742 2536 2092 2027 1716 1544 1175 1102 807 755 126 27899 6612 37827 7252 5936 --
NM_173468chr4206112 6088 5986 5260 4296 4225 4141 1870 1861 1586 1492 1412 1379 1168 1080 761 419 382 337 216 11624 24689 2420 --
NM_173505chr1861123 967 833 450 433 427 ------
NM_173531chr19133279 2979 2920 2894 2839 2715 2622 2380 1306 819 269 217 110 23843 1207 1487 --
NM_173576chr1051977 1825 1651 254 164 21916 1886 11893 21986 1890
NM_173582chr11136237 6124 5900 5678 4585 4538 3962 2380 2127 864 611 387 171 14897 14413 --
NM_173642chr1136856 5929 5798 3639 3617 3402 3264 3196 2630 1918 1553 986 423 22613 1180 25906 1746 17560
NM_173698chrX82073 1355 1348 657 454 419 289 253 --1340 11302
NM_173808chr1184414 4353 4281 4239 3958 3862 3553 3547 3541 3298 3033 2785 1791 1434 1412 887 854 152 --24490 3558 14337
NM_173822chr281946 1714 1704 1594 1543 1354 1347 213 --1622 22122 2092
NM_173825chr3123118 2196 2045 2037 2021 1227 1112 955 930 626 245 223 22867 277 33123 2350 2247 --
NM_173826chr361751 1628 1407 623 531 349 21349 457 1497 1494
NM_173829chr5156172 6103 5645 5488 5216 5078 2314 2204 2079 2057 1405 1294 896 303 97 36229 597 576 2942 579 35175 4952 1024
NM_175623chr12207700 7591 7341 7182 7004 6989 6941 6750 4733 2563 2057 2040 1911 1793 1748 1265 877 281 264 223 56514 6299 1407 758 713 57617 7255 761 706 269 --
NM_175624chr12207795 7686 7436 7277 7099 7084 7036 6845 4828 2658 2152 2135 2006 1888 1843 1360 972 376 359 318 56609 6394 1502 853 808 57712 7350 856 801 364 --
NM_175625chr12207795 7686 7436 7277 7099 7084 7036 6845 4828 2658 2152 2135 2006 1888 1843 1360 972 376 359 318 56609 6394 1502 853 808 57712 7350 856 801 364 --
NM_175861chr12126008 5975 5856 5132 4701 4553 4353 1978 1324 993 981 424 45547 3782 1736 557 35528 4111 1858 --
NM_177538chr2168858 8690 8646 8624 8232 8165 8123 8031 7731 6490 5763 5644 2573 2184 2152 133 28874 3000 11102 28878 3258
NM_177947chrX71689 1495 1436 1256 1097 577 109 --11500 2263 175
NM_177948chrX71689 1495 1436 1256 1097 577 109 --11500 2263 175
NM_177985chr282224 1737 1389 870 565 344 243 25 --1923 138
NM_177990chr2081777 1729 1657 1493 1355 1326 1272 228 2612 34 12062 11289
NM_178151chrX127199 7030 6899 6525 5727 2873 2853 1629 1601 1144 855 217 36258 1475 1250 ----
NM_178152chrX127199 7030 6899 6525 5727 2873 2853 1629 1601 1144 855 217 36258 1475 1250 ----
NM_178153chrX127199 7030 6899 6525 5727 2873 2853 1629 1601 1144 855 217 36258 1475 1250 ----
NM_178585chr4133303 3257 3192 3059 2783 2530 2159 2023 1202 982 556 427 391 22867 2101 12217 --
NM_180989chr13122456 2073 2030 1999 1923 1786 1722 1527 958 915 513 385 2538 369 52228 2173 1947 886 263 22366 177
NM_181077chr1572326 2214 2115 2057 1917 1416 97 --21793 1575 11572
NM_181265chr483218 2533 2281 2127 1198 1188 548 539 1404 32415 2214 559 13106
NM_181358chr174281 4111 3925 3163 1130 969 791 21505 779 33749 1159 356 --
NM_181443chr2072908 2835 2813 2658 2534 917 722 --12889 31849 1819 113
NM_181481chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_181482chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_181483chr18137003 6285 6140 5549 5114 5000 4365 2800 2770 1063 757 487 106 24279 536 12582 25076 354
NM_181521chr16106142 4538 2763 2284 2138 1878 1458 949 635 327 26581 1187 17296 12149
NM_181659chr20133437 3292 2891 2748 2465 2371 2166 1327 1254 1226 1195 972 960 1140 1742 --
NM_181659chr20133437 3292 2891 2748 2465 2371 2166 1327 1254 1226 1195 972 960 1140 1742 --
NM_181705chr5105766 5373 4478 4356 4189 2128 1125 982 792 257 25687 5305 35690 4716 1155 2601 113
NM_181723chr8112332 2287 1963 1930 1766 1725 1656 1527 448 280 121 11600 21935 304 --
NM_181783chr1291962 1797 1611 1541 1232 738 616 555 429 21348 326 ----
NM_181787chr8123547 3518 3409 3358 3326 1508 1188 1064 760 481 369 191 3676 665 614 21172 1159 --
NM_181861chr12112818 2693 2374 2213 2122 2071 2020 1858 1846 1795 146 ----1543
NM_181868chr12112818 2693 2374 2213 2122 2071 2020 1858 1846 1795 146 ----1543
NM_181869chr12112903 2778 2459 2298 2207 2156 2105 1943 1931 1880 231 ----1628
NM_182503chr6155610 5174 4957 4442 4279 3838 3790 3650 3557 2018 1915 930 767 657 493 11704 25484 683 --
NM_182515chr19116356 5388 4288 2470 2104 1394 1380 1276 749 662 533 26068 2627 11125 --
NM_182643chr882430 2204 1878 1807 1768 1668 485 463 11796 21863 495 --
NM_182757chr6103492 3434 2457 2448 2259 2176 1077 915 878 834 --11025 1253
NM_182762chr786194 5861 5492 4859 4532 2373 1662 1424 1755 34869 1363 1198 15518
NM_182767chr1292105 1859 1615 1573 1544 1487 450 423 375 --21502 1492 21781 1426
NM_182896chr341781 1756 606 475 ----21649 359
NM_182898chr7116397 6239 6185 5803 5571 5478 5376 2336 1834 1783 379 --14077 1901
NM_182899chr7116397 6239 6185 5803 5571 5478 5376 2336 1834 1783 379 --14077 1901
NM_183376chr1572119 1881 1044 1035 748 694 622 1281 12260 1107
NM_183416chr172065 1675 702 659 413 335 111 11617 31762 430 189 --
NM_194071chr7135478 5435 5374 4746 4709 4685 4447 4201 4185 3931 1689 1361 729 15344 13410 --
NM_194247chr2103849 3446 2935 1367 1062 659 624 510 336 254 --21747 598 14033
NM_194282chr4102542 2473 2349 2185 893 739 634 307 268 233 1156 2788 25 --
NM_194291chr8152961 2898 2811 2710 2664 2518 2486 2403 1858 1088 1023 1015 544 280 98 ----1914
NM_194314chr1145657 5349 4905 4537 4087 3974 3902 3717 1673 1525 1042 774 690 166 25125 4306 25565 4800 --
NM_194328chr9103276 3209 3175 3161 2744 2317 2014 926 759 691 12947 33334 435 407 --
NM_194329chr9103276 3209 3175 3161 2744 2317 2014 926 759 691 12947 33334 435 407 --
NM_194330chr9103276 3209 3175 3161 2744 2317 2014 926 759 691 12947 33334 435 407 --
NM_194332chr9103276 3209 3175 3161 2744 2317 2014 926 759 691 12947 33334 435 407 --
NM_194434chr18125715 4946 4440 3964 2300 1813 1283 1187 995 466 328 265 --34022 3744 1754 14632
NM_194463chrX101263 1219 1173 967 957 907 810 147 85 76 ------
NM_197941chr583062 2925 2719 2177 2105 1153 548 294 12799 12802 11166
NM_198181chr15102854 2615 2499 2398 2378 2215 1915 1089 1048 82 1264 11934 11807
NM_198212chr792368 2280 2219 2079 1942 1890 1643 673 497 --1603 31804 1761 1707
NM_198268chr174281 4111 3925 3163 1130 969 791 21505 779 33749 1159 356 --
NM_198269chr174281 4111 3925 3163 1130 969 791 21505 779 33749 1159 356 --
NM_198270chrX123294 3163 2696 2488 2428 2257 726 709 657 615 482 454 ----1126
NM_198273chr5123042 3010 2897 2211 1221 981 909 842 574 232 207 193 12738 ----
NM_198281chr4143490 3384 3368 3285 3198 3158 2600 979 929 648 586 565 480 32 12315 ----
NM_198320chr12135217 4543 4470 4153 4130 4070 3290 1598 1588 756 748 349 205 --14766 14198
NM_198439chr11111735 1430 1414 1322 604 508 377 344 313 136 41 21516 1388 ----
NM_198450chrX152047 1856 851 537 505 475 445 413 391 365 339 288 185 153 72 1207 1163 --
NM_198503chr1102419 2130 1900 1843 910 449 394 214 142 83 --11993 1647
NM_198549chr192933 2612 2573 2213 2134 1257 1079 727 595 11281 22729 2338 --
NM_198569chr6132720 2699 2626 2451 2154 1869 1781 1746 784 650 472 435 78 1638 ----
NM_198581chr2177479 7406 7003 5783 2989 2901 2752 2557 2332 2311 1715 1563 1161 912 639 579 253 41844 1520 1352 567 --1326
NM_198584chr8102609 2557 2462 2151 2141 2077 1940 1880 975 677 --1954 --
NM_198715chr1206340 6332 6196 6114 5807 5660 5568 5111 4791 4484 4385 3821 2480 2216 1930 1515 1043 910 890 130 11420 46222 5303 4973 2152 1282
NM_198793chr394122 3940 3666 3612 3491 3082 2747 1049 517 23036 2754 ----
NM_198904chr582034 1902 1858 1778 670 544 403 135 --1606 11478
NM_198935chr2083227 2926 2601 2375 2289 1259 718 712 13001 22574 1286 --
NM_198968chr13124005 3955 3512 3393 3164 2955 2782 1150 820 799 751 297 --23977 3712 33907 3862 3626
NM_199000chr762133 2055 2022 922 758 511 --21630 311 1122
NM_199039chr471141 1125 1059 999 985 200 88 --1755 2410 252
NM_199072chr793237 2958 2889 2735 2698 866 718 272 211 22982 1135 --13256
NM_199188chr12163920 3822 3763 3691 3489 3321 2753 2656 1641 1576 1548 1133 981 596 213 188 23641 581 --12744
NM_199190chr12163920 3822 3763 3691 3489 3321 2753 2656 1641 1576 1548 1133 981 596 213 188 23641 581 --12744
NM_199324chr4143714 3696 3623 3411 3185 3066 2363 800 768 423 342 334 306 259 13059 ----
NM_199328chr2161219 1096 1050 909 872 423 11181 11184 1341
NM_199421chr14155083 5069 5040 4891 4282 3515 3469 3353 3311 1791 1341 782 503 196 139 --21349 1301 --
NM_199436chr293076 3024 1956 1893 1178 584 505 352 301 ----13132
NM_203282chr1971855 1522 1314 740 618 384 43 1181 --11215
NM_203329chr11135861 5221 4938 4927 4827 2715 1846 1638 1621 1314 985 807 792 25544 1119 44888 2658 1895 854 11276
NM_203330chr11135861 5221 4938 4927 4827 2715 1846 1638 1621 1314 985 807 792 25544 1119 44888 2658 1895 854 11276
NM_203331chr11135861 5221 4938 4927 4827 2715 1846 1638 1621 1314 985 807 792 25544 1119 44888 2658 1895 854 11276
NM_203406chr552945 2848 2320 627 134 12654 22921 2880 12565
NM_203458chr1103513 3391 3176 3147 2536 1262 1029 1000 560 137 ----1306
NM_203463chr2114278 3799 3708 3333 1423 1305 1295 643 614 277 62 1165 11477 --
NM_206594chr1123579 3546 3460 2966 2730 2657 2502 2248 2230 1298 1217 998 13208 ----
NM_206595chr1123579 3546 3460 2966 2730 2657 2502 2248 2230 1298 1217 998 13208 ----
NM_206852chr144760 745 738 223 --1750 1555
NM_206853chr6124131 3931 3566 3346 1656 1588 1411 1197 1079 712 229 130 53538 3308 654 519 345 53974 2977 576 561 522 --
NM_206854chr6115392 5192 4827 4607 3473 3389 1973 1490 1391 1059 741 54799 4569 1915 1780 1606 65235 4238 1837 1822 1783 937 --
NM_206855chr6166357 6157 5792 5572 4438 4354 4160 4108 3882 2455 2356 2024 1706 796 470 210 35764 5534 389 46200 5203 1902 647 1577
NM_206857chr144760 745 738 223 --1750 1555
NM_206876chr293478 3459 3315 2955 2806 2326 1131 301 189 23403 1059 21062 63 --
NM_206907chr5153269 3095 2572 2526 2493 2427 2249 1304 1148 1003 439 373 360 179 50 13001 12506 12847
NM_206909chr8258423 8398 8331 8282 8256 8246 8171 8140 7602 7005 6340 5534 3240 2812 2333 2199 2126 2031 1793 1725 1651 1122 894 409 259 15852 --16511
NM_207303chr1093651 3240 3135 2761 2539 1602 1551 452 311 32798 874 365 ----
NM_207406chr4176375 6236 6161 5731 5611 5213 4754 4543 4467 4251 2372 1439 1301 890 741 431 57 1239 16565 1492
NM_212471chr1782266 2014 1819 1618 1577 723 199 178 42150 1838 1710 363 22185 432 --
NM_212472chr1782266 2014 1819 1618 1577 723 199 178 42150 1838 1710 363 22185 432 --
NM_212558chr9154037 3267 2880 1702 1289 1235 1048 847 816 675 533 412 329 274 155 33799 3048 1369 44118 4042 3802 640 --
NM_213589chr2125612 5547 5383 5008 4327 3941 3532 2095 1685 1479 1456 689 --45312 4646 448 390 12014