TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4732-3p
miRNA Sequence: GCCCUGACCUGUCCUGUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000449chr121223 1165 11383 --21342 296
NM_001003652chr1847344 5527 3049 2567 1983 --12486
NM_001009959chr242380 2305 2030 629 ----11651
NM_001014797chr1077955 7620 7275 7184 2921 2470 231 16772 13236 --
NM_001025603chr121223 1165 11383 --21342 296
NM_001042599chr2107551 7319 6488 5418 5082 2520 2498 2474 996 240 11479 ----
NM_001100108chr1118179 7631 7024 6122 5881 5480 2679 2543 2384 1484 475 26395 1344 ----
NM_002214chr745665 4536 1580 1228 ----11486
NM_002737chr171163 11092 16334 25210 2600
NM_003034chr1246562 5168 3043 45 --1319 12697
NM_003644chr17126164 5983 5864 5705 5467 4538 2289 1445 626 429 395 22 2861 756 25843 1019 12264
NM_005235chr2107551 7319 6488 5418 5082 2520 2498 2474 996 240 11479 ----
NM_005901chr1847344 5527 3049 2567 1983 --12486
NM_007050chr2097949 6780 6764 6688 6462 6306 6230 6156 486 13040 ----
NM_017676chr531338 553 546 11215 11784 --
NM_017902chr10115695 5299 5168 5008 4629 4318 1429 1402 1272 386 140 35154 4264 3729 24933 1360 --
NM_020711chr242380 2305 2030 629 ----11651
NM_020947chr1632294 2130 1937 9506 487 468 449 430 411 392 373 354 ----
NM_021116chr7108139 7349 6817 6308 6032 3298 2760 1856 712 521 ----12767
NM_024345chr942034 1610 1345 948 --12069 14133
NM_030806chr179131 8250 7087 6741 5741 5706 1378 26999 3060 23484 3303 17644
NM_032846chr143338 243 203 1178 --1597
NM_133170chr2097949 6780 6764 6688 6462 6306 6230 6156 486 13040 ----
NM_133634chr2171621 1527 1449 1439 757 665 573 11318 --11456
NM_153607chr522416 252 --11031 11038
NM_173642chr168046 7999 2821 2774 2039 1356 1541 15760 29001 8189
NM_199320chr432597 723 645 ----2954 569
NM_199320chr432597 723 645 ----2954 569
NM_201432chr17126164 5983 5864 5705 5467 4538 2289 1445 626 429 395 22 2861 756 25843 1019 12264
NM_201433chr17126164 5983 5864 5705 5467 4538 2289 1445 626 429 395 22 2861 756 25843 1019 12264