TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4732-5p
miRNA Sequence: UGUAGAGCAGGGAGCAGGAAGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51110 ------
NM_000038chr5----1523 11294
NM_000051chr1183541 2953 2777 1152 1063 958 357 194 ------
NM_000052chrX113272 3108 2803 2636 2516 2485 1086 808 683 188 176 13416 ----
NM_000061chrX--1133 127 --
NM_000081chr151847 1408 1363 1163 187 ------
NM_000084chrX146952 6712 6683 6595 6589 6532 6165 5610 5373 5358 4928 1817 1745 943 ------
NM_000090chr22668 63 ------
NM_000091chr262721 2454 2156 1889 992 711 22772 1948 ----
NM_000092chr223703 1839 34341 4307 383 1260 23315 2960
NM_000109chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_000111chr71142 ------
NM_000125chr653750 3660 2954 2705 399 --1685 --
NM_000129chr641388 1281 422 241 11366 1457 --
NM_000138chr1522450 347 ------
NM_000141chr10--11474 ----
NM_000142chr42565 368 ------
NM_000153chr1431112 512 505 --11036 --
NM_000165chr611204 ------
NM_000167chrX31552 1273 526 31702 476 383 ----
NM_000168chr753294 2733 2378 2043 1005 1448 ----
NM_000176chr523053 1112 ------
NM_000183chr2--1382 ----
NM_000192chr1231510 597 333 ------
NM_000208chr1953257 1586 1327 831 95 34513 3558 548 ----
NM_000210chr2144 21478 853 12316 --
NM_000214chr20----21629 1561 --
NM_000216chrX63829 3755 3273 2851 2585 1510 1623 ----
NM_000217chr1245334 4745 1525 105 --1128 --
NM_000222chr421664 227 11598 ----
NM_000230chr752642 2366 2325 1139 717 ------
NM_000232chr422370 642 42174 916 688 507 23001 414 --
NM_000233chr24649 611 602 136 ------
NM_000237chr841867 1227 685 414 ----21701 1331
NM_000248chr331989 658 123 12623 1882 --
NM_000252chrX11119 ----11033
NM_000259chr1556311 6034 5217 2175 1157 24075 410 ----
NM_000264chr923173 711 22336 685 13104 --
NM_000266chrX1855 2148 124 ----
NM_000267chr1733519 2742 209 12927 1369 --
NM_000274chr10167 ------
NM_000276chrX42028 1783 574 156 22070 1818 ----
NM_000280chr11------1125
NM_000289chr122338 298 ------
NM_000297chr472055 1891 1623 1617 1302 661 161 ------
NM_000304chr17129 1289 ----
NM_000314chr1053137 3011 2981 2850 2811 11116 ----
NM_000315chr112288 34 --178 --
NM_000319chr122252 162 ------
NM_000321chr1321711 282 11771 ----
NM_000332chr685201 4950 4363 2697 2021 446 436 121 ----11273
NM_000337chr586003 4524 4238 4133 2342 513 466 53 25815 1717 14614 --
NM_000340chr341412 1234 270 255 ------
NM_000345chr4----1893 --
NM_000361chr2021536 852 1458 ----
NM_000367chr641765 1512 453 124 ------
NM_000368chr974824 4410 3825 3505 1072 992 242 1492 23735 278 --
NM_000378chr112279 184 ------
NM_000386chr172595 160 ------
NM_000390chrX23407 1356 23280 1149 ----
NM_000393chr211765 21521 859 11437 --
NM_000396chr12446 359 ------
NM_000399chr101293 1395 ----
NM_000408chr253033 2691 2292 324 165 13460 ----
NM_000411chr2172576 2292 2021 1109 820 351 183 12958 ----
NM_000421chr171271 ------
NM_000428chr1442007 846 739 216 ------
NM_000430chr1733017 1248 79 ------
NM_000434chr63529 143 43 ------
NM_000449chr12989 197 11321 ----
NM_000451chrX2444 318 ------
NM_000461chr363652 3278 1635 1623 939 218 14199 ----
NM_000462chr151569 ------
NM_000480chr1111167 ------
NM_000484chr211381 4833 372 220 206 1745 --
NM_000489chrX73341 3195 2105 1223 898 611 528 1387 ----
NM_000495chrX4966 208 197 90 ------
NM_000503chr85609 520 474 143 36 11780 ----
NM_000522chr711240 ------
NM_000530chr11714 11074 ----
NM_000533chrX3478 287 41 11230 --11656
NM_000536chr11------1553
NM_000555chrX67826 7334 7180 3027 1361 848 26182 5856 15496 --
NM_000572chr13920 725 72 123 ----
NM_000575chr241049 409 289 80 1810 ----
NM_000585chr42217 52 ------
NM_000586chr41172 ------
NM_000589chr5132 ------
NM_000596chr7--1184 ----
NM_000600chr7191 ------
NM_000609chr1093091 3047 2775 2632 2535 2391 2335 2144 46 12786 ----
NM_000610chr1132571 2039 131 ------
NM_000618chr1295950 5027 4084 2565 2515 1920 1691 646 244 1435 --157
NM_000618chr1295950 5027 4084 2565 2515 1920 1691 646 244 1435 --157
NM_000621chr13--11294 ----
NM_000627chr21824 137 ----
NM_000633chr1874143 3762 3624 3476 1806 1389 846 25130 3908 ----
NM_000678chr203727 126 74 ------
NM_000684chr1021242 1053 ------
NM_000698chr101327 ------
NM_000702chr131874 452 44 --1702 11662
NM_000719chr1295427 5118 4750 4215 2334 2007 1345 516 360 14671 22265 1744 --
NM_000722chr71255 ------
NM_000723chr173608 321 35 ------
NM_000724chr1021973 677 ------
NM_000725chr121965 ------
NM_000739chr72679 87 1301 ----
NM_000750chr151665 ------
NM_000759chr17135 ----1249
NM_000780chr84815 804 514 191 1830 11160 --
NM_000782chr2021225 507 182 1364 --
NM_000788chr441357 1316 575 401 ------
NM_000792chr11682 2974 344 ----
NM_000793chr1454337 4053 3812 3461 1969 11129 1407 --
NM_000801chr2021116 968 ------
NM_000806chr551985 1519 694 524 83 136 ----
NM_000807chr41450 1544 ----
NM_000809chr4138051 7424 7063 6230 6148 5699 5632 1552 1544 1391 1019 914 87 48150 6155 2307 2252 26867 3504 --
NM_000813chr545285 4355 4333 3608 11571 ----
NM_000814chr1553990 3845 1681 1156 58 --12667 1859
NM_000817chr22316 160 2244 69 ----
NM_000820chr131243 ------
NM_000824chr41186 ------
NM_000826chr432406 666 343 ------
NM_000827chr531826 1781 1713 1505 ----
NM_000828chrX1583 ------
NM_000831chr175953 5896 5107 3858 1823 1437 448 15629 ----
NM_000834chr121490 11128 ----
NM_000839chr31491 ------
NM_000844chr31163 ------
NM_000859chr53648 487 43 ----1210
NM_000865chr61193 ------
NM_000868chrX21717 180 2456 147 1468 --
NM_000872chr1011028 ------
NM_000875chr1577033 6468 4667 2802 2393 1165 343 36964 4634 155 --15818
NM_000876chr641421 1293 944 327 ------
NM_000882chr31434 ------
NM_000883chr72648 475 ------
NM_000883chr72648 475 ------
NM_000885chr222015 853 ------
NM_000891chr1773549 3542 3261 3101 2951 2733 370 135 ----
NM_000899chr1294402 4243 3692 2812 1172 566 378 244 80 21137 423 --11477
NM_000902chr333165 2816 2142 --22538 693 11062
NM_000910chr421963 760 --11498 --
NM_000912chr853466 3144 2547 1081 994 12840 ----
NM_000919chr51520 ------
NM_000933chr202671 520 1484 ----
NM_000935chr331072 833 187 ------
NM_000945chr231525 688 377 11404 21779 1296 --
NM_000950chrX83502 3351 2874 2376 2252 848 347 67 --12893 1904
NM_000958chr521062 270 --1368 --
NM_000961chr2063870 1361 1143 673 651 36 --42867 2817 331 199 --
NM_000964chr1741408 308 61 53 --11300 --
NM_000966chr1241047 839 764 343 --197 --
NM_000983chr161424 1310 1248 1193 607 232 2655 83 ----
NM_001001132chr2111443 11084 ----
NM_001001323chr1252673 2162 1939 1018 588 22576 2138 ----
NM_001001331chr322607 939 --1762 --
NM_001001342chr1011228 ------
NM_001001389chr1132571 2039 131 ------
NM_001001390chr1132571 2039 131 ------
NM_001001391chr1132571 2039 131 ------
NM_001001392chr1132617 2085 177 ------
NM_001001396chr133392 2763 419 1261 14299 --
NM_001001419chr555232 4189 1887 1569 820 21410 120 ----
NM_001001420chr555232 4189 1887 1569 820 21410 120 ----
NM_001001433chr2062949 2651 2609 2560 930 727 22191 488 ----
NM_001001481chr833496 1068 781 12238 --12503
NM_001001484chr1031680 857 596 ------
NM_001001521chr2188 ------
NM_001001523chr12999 529 ----1515
NM_001001549chr762609 2481 2377 950 713 552 1211 ----
NM_001001550chr762609 2481 2377 950 713 552 1211 ----
NM_001001555chr762609 2481 2377 950 713 552 1211 ----
NM_001001556chr1521522 159 ------
NM_001001557chr83761 320 183 --1696 --
NM_001001586chr1----1388 --
NM_001001664chr242546 1349 482 178 --23671 3086 --
NM_001001787chr13437 164 97 ------
NM_001001890chr2153750 3649 3142 2833 2700 ------
NM_001001937chr18149 ------
NM_001001974chr1052063 1524 862 703 32 ------
NM_001001994chrX3465 117 33 ------
NM_001001995chrX41814 1622 298 41 ----167
NM_001001996chrX3465 117 33 ------
NM_001002027chr17----178 --
NM_001002243chr22727 77 ------
NM_001002255chr62124 21 ------
NM_001002257chr221426 52 32999 925 892 ----
NM_001002259chr12139 ------
NM_001002814chr8123133 2995 2825 2804 2371 1125 932 694 645 410 204 145 11369 12654 13431
NM_001002838chrX21484 280 ----11269
NM_001002843chr1531268 483 129 ------
NM_001002860chr1464649 4175 3220 1247 786 123 34454 1686 277 ----
NM_001002909chr1751828 1548 462 337 324 2818 276 ----
NM_001003407chr10105142 3499 2012 1848 1690 1626 1144 965 619 563 35098 4677 1077 --11454
NM_001003408chr10105142 3499 2012 1848 1690 1626 1144 965 619 563 35098 4677 1077 --11454
NM_001003652chr18138445 8382 8022 7541 6465 6441 6213 6201 6142 3142 2445 2100 1403 42615 2116 1620 1266 15466 12150
NM_001003674chr18136999 6590 6516 5446 4711 2762 2517 2482 2201 1883 1724 1418 895 36565 6263 5948 ----
NM_001003675chr18136999 6590 6516 5446 4711 2762 2517 2482 2201 1883 1724 1418 895 36565 6263 5948 ----
NM_001003678chr11190 ------
NM_001003683chr22281 39 ------
NM_001003688chr421195 990 ------
NM_001003712chr1243434 2966 1304 913 24056 3483 ----
NM_001003760chr663118 3031 2259 819 703 151 22474 349 ----
NM_001003792chr3------1973
NM_001003793chr3------1973
NM_001003800chr932910 2444 1312 23575 2656 ----
NM_001003940chr15103803 3737 3639 3618 3386 2941 2514 1208 469 272 ----13342
NM_001003942chr15103803 3737 3639 3618 3386 2941 2514 1208 469 272 ----13342
NM_001003943chr15103807 3741 3643 3622 3390 2945 2518 1212 473 276 ----13346
NM_001004051chrX2333 305 ------
NM_001004065chr973797 3105 2790 2715 2470 941 717 21580 660 ----
NM_001004127chr131821 ----1912
NM_001004304chr1233029 1256 174 13275 12025 --
NM_001004317chr641633 1454 929 30 11738 ----
NM_001004328chr1231840 536 431 22069 477 ----
NM_001004329chr1251499 495 291 262 132 ------
NM_001004346chr4--198 ----
NM_001004360chr21424 ------
NM_001004419chr1234113 3579 1565 24437 4257 ----
NM_001004720chr22204 106 1962 ----
NM_001004722chr22373 275 11131 1148 --
NM_001005158chr34425 391 96 65 ------
NM_001005159chr34425 391 96 65 ------
NM_001005207chr171223 ------
NM_001005271chr174844 817 749 369 1142 ----
NM_001005273chr174844 817 749 369 1142 ----
NM_001005290chr13515 406 36 ------
NM_001005353chr131182 426 179 1224 ----
NM_001005353chr131182 426 179 1224 ----
NM_001005366chr121965 174 ----
NM_001005375chrY31537 612 57 ------
NM_001005386chr25689 495 306 299 104 12288 1700 --
NM_001005404chr1743321 2775 1190 233 23392 3364 --11444
NM_001005476chr2----1195 --
NM_001005611chrX1520 ------
NM_001005739chr22605 326 ------
NM_001005781chr21163 ------
NM_001005782chr21346 ------
NM_001005849chr172121 21 ------
NM_001005910chr31245 124 1561 --
NM_001005911chr31245 124 1561 --
NM_001006600chr542361 2149 2094 796 ------
NM_001006610chr16--1771 ----
NM_001006612chrX188 ------
NM_001006613chrX188 ------
NM_001006614chrX188 ------
NM_001006623chr23754 239 134 21696 858 ----
NM_001006626chr72679 87 1301 ----
NM_001006627chr72679 87 1301 ----
NM_001006628chr72679 87 1301 ----
NM_001006629chr72679 87 1301 ----
NM_001006630chr72679 87 1301 ----
NM_001006631chr72679 87 1301 ----
NM_001006632chr72679 87 1301 ----
NM_001006933chrX188 ----1163
NM_001006935chrX256 36 ------
NM_001006936chrX256 36 ------
NM_001006937chrX256 36 ------
NM_001006938chrX4571 502 163 138 ----1214
NM_001007023chr1454337 4053 3812 3461 1969 11129 1407 --
NM_001007024chr1793839 1723 1311 1260 960 923 884 804 764 24105 370 ----
NM_001007025chr1793839 1723 1311 1260 960 923 884 804 764 24105 370 ----
NM_001007027chr112227 60 ------
NM_001007097chr984327 1532 1524 1419 1276 1152 978 893 11682 ----
NM_001007098chr14357 244 194 153 ------
NM_001007102chr62669 38 ------
NM_001007156chr1521777 72 1608 --1335
NM_001007237chr132738 2558 919 ------
NM_001007246chr211784 21612 123 ----
NM_001007255chr1--126 ----
NM_001007267chr23830 230 162 ------
NM_001007269chr191126 --1218 --
NM_001007270chr191126 --1218 --
NM_001007466chr694595 4541 3604 3502 3152 1126 1058 1049 844 2784 676 34230 3760 394 --
NM_001007471chr9196 ------
NM_001007527chr51715 190 ----
NM_001007538chr1331646 452 27 11752 ----
NM_001007544chr12397 35 ------
NM_001007553chr13460 376 258 ------
NM_001007793chr10126 ------
NM_001008220chr552862 2630 508 448 114 --13815 13677
NM_001008222chrX----21271 1255 --
NM_001008226chr1531565 1390 563 11783 ----
NM_001008239chr1853079 2756 1514 1012 294 33691 1268 26 --11486
NM_001008392chr363225 2873 2764 2401 607 292 23393 442 ----
NM_001008393chr462674 1932 1089 1014 886 734 ------
NM_001008401chr191409 11461 ----
NM_001008539chr834246 4135 3344 24238 3656 25361 450 --
NM_001008541chr1031525 760 397 ----1579
NM_001008541chr1031525 760 397 ----1579
NM_001008566chr222523 185 --1450 --
NM_001008660chr111375 21531 1282 ----
NM_001008701chr1972889 2310 1949 660 359 334 63 --1225 --
NM_001008707chr141605 --11247 --
NM_001008738chr532934 2509 2129 1281 ----
NM_001008783chr62688 625 ------
NM_001008860chr152810 306 ------
NM_001008892chr152810 306 ------
NM_001008894chr152810 306 ------
NM_001008938chr113195 167 34 ------
NM_001009552chr81211 ------
NM_001009554chr484754 4424 3977 3708 3270 1316 908 267 ------
NM_001009554chr484754 4424 3977 3708 3270 1316 908 267 ------
NM_001009555chr41219 21140 399 ----
NM_001009571chr741682 1573 1516 1174 --1273 --
NM_001009814chr13--165 ----
NM_001009880chr2264870 4573 4014 1275 841 524 54699 4205 3594 3502 264 --11607
NM_001009881chr1--1473 ----
NM_001009882chr1--1473 ----
NM_001009955chr11437 ------
NM_001009955chr11437 ------
NM_001009959chr262511 1970 1019 854 824 196 11709 12503 --
NM_001009993chr273821 3444 2960 2882 1638 941 792 24390 3751 11656 12831
NM_001010000chr1862960 1191 952 924 528 454 12525 ----
NM_001010861chr182776 2496 2248 2066 1863 1827 1073 547 22077 343 ----
NM_001010862chrX42396 859 752 494 1337 32965 2674 1308 --
NM_001010867chr1146651 6130 4949 4867 4479 2465 2064 2048 2013 1717 1551 1269 886 357 26057 1910 24145 833 --
NM_001010888chrX54345 4097 3763 1700 479 --14008 21057 101
NM_001010922chr1103925 3332 3033 2717 2685 1629 1478 1051 922 242 33911 2877 1418 24003 3100 --
NM_001010923chr621231 290 ------
NM_001010924chr102862 312 ------
NM_001010927chr62570 391 ------
NM_001010935chr14889 832 188 23 ------
NM_001010986chrX1225 11589 ----
NM_001010989chr161225 --1510 --
NM_001010990chr161225 --1510 --
NM_001011513chr463786 2791 1251 639 238 137 12671 ----
NM_001011537chr32581 86 ----12296
NM_001011538chr42947 845 ------
NM_001011553chr73857 401 212 ------
NM_001011666chr7106166 5811 5235 4794 4535 4440 4269 2584 2382 1736 24820 4765 11082 --
NM_001011713chr1431473 1441 1111 --11431 --
NM_001011718chr204966 954 813 753 ------
NM_001012264chr142848 26 ------
NM_001012267chr91399 11939 ----
NM_001012329chr172274 1853 753 717 706 359 351 ------
NM_001012333chr111116 ------
NM_001012334chr111116 ------
NM_001012393chr1174960 3710 3431 3377 734 323 286 11437 2615 207 --
NM_001012398chr162781 144 ------
NM_001012420chr1572804 2571 2003 1165 1057 752 657 ------
NM_001012423chr1572804 2571 2003 1165 1057 752 657 ------
NM_001012426chr653079 2741 2093 569 408 43423 3171 926 890 ----
NM_001012427chr653079 2741 2093 569 408 43423 3171 926 890 ----
NM_001012446chr9175 ------
NM_001012732chr41198 1906 ----
NM_001012751chr1041746 1579 1318 727 ------
NM_001012753chr1911108 ------
NM_001012968chrX52769 2715 2468 1053 423 ------
NM_001012969chr15159 ------
NM_001012979chrX2161 88 ------
NM_001012989chrX1473 ------
NM_001013031chr1053500 2975 505 342 145 --22947 208 --
NM_001013437chr181332 ------
NM_001013438chr31807 1252 1744 --
NM_001013439chr31653 198 1590 --
NM_001013620chr12128325 7838 7704 7085 6947 2809 2765 1982 1596 1002 996 871 47206 6503 5694 55 ----
NM_001013635chr1221014 982 ----1484
NM_001013690chr12112419 2373 2287 2255 2171 2142 1900 1650 656 619 560 1389 --12478
NM_001013717chr511058 31366 478 82 ----
NM_001013843chr154861 350 335 58 ------
NM_001014286chr13169 ------
NM_001014445chr177997 870 740 388 348 324 46 --1299 --
NM_001014797chr1098128 7918 7023 2900 1908 1115 949 937 763 21182 833 11429 --
NM_001014839chr11880 1911 ----
NM_001014841chr11880 1911 ----
NM_001015508chr81199 ------
NM_001015877chrX43042 2939 2877 2008 1389 1319 --
NM_001015881chrX11282 1105 ----
NM_001017368chr1732186 2166 460 --12820 --
NM_001017369chr43995 181 164 ------
NM_001017371chr2----1487 --
NM_001017395chr373399 3017 2727 2220 1394 1015 437 191 ----
NM_001017440chr776335 5649 2073 1556 1014 427 217 42580 1857 1693 797 ----
NM_001017523chr121123 --11248 163
NM_001017926chr831370 675 396 ------
NM_001017930chrX2953 540 --11475 --
NM_001017977chr1180 2345 72 ----
NM_001017979chr41116 ------
NM_001017992chr541454 1038 586 334 ------
NM_001017995chr584799 4671 3432 3172 2976 1631 1356 465 14134 148 --
NM_001018008chr15--1168 1536 --
NM_001018009chr31117 ------
NM_001018025chrX--1337 ----
NM_001018054chr121247 530 ------
NM_001018056chr91192 ------
NM_001018057chr1131184 273 68 ----1301
NM_001018065chr9105117 4814 4779 4476 4016 2208 1774 1365 191 85 --25320 4697 --
NM_001018066chr9105117 4814 4779 4476 4016 2208 1774 1365 191 85 --25320 4697 --
NM_001018067chr175350 5209 5056 4256 3998 1171 1032 24333 4325 21449 1116 --
NM_001018068chr175350 5209 5056 4256 3998 1171 1032 24333 4325 21449 1116 --
NM_001018069chr175350 5209 5056 4256 3998 1171 1032 24333 4325 21449 1116 --
NM_001018072chr121123 --11248 163
NM_001018074chr523053 1112 ------
NM_001018075chr523053 1112 ------
NM_001018076chr523053 1112 ------
NM_001018077chr523053 1112 ------
NM_001018100chr152132 43 --2863 806 --
NM_001018108chr1511460 --11502 --
NM_001018111chr763285 3010 2892 2539 2530 595 13591 ----
NM_001018676chr81175 ------
NM_001018677chr81175 ------
NM_001020658chr12368 82 ------
NM_001020658chr12368 82 ------
NM_001023587chr33994 988 980 ------
NM_001024094chr523053 1112 ------
NM_001024226chr13985 352 38 --143 --
NM_001024227chr13985 352 38 --143 --
NM_001024228chr13985 352 38 --143 --
NM_001024372chr851840 1759 1739 291 217 22002 1688 ----
NM_001024455chrX32674 1654 245 ----1377
NM_001024647chr12116436 6014 5852 5499 5249 4934 981 911 447 307 128 35864 2433 807 26840 6382 --
NM_001024649chr531936 994 918 ------
NM_001024660chr321109 391 ------
NM_001024666chrX1252 ------
NM_001024680chr241670 1280 671 148 ------
NM_001024688chr81797 11600 11913 1456
NM_001024809chr1741408 308 61 53 --11300 --
NM_001024847chr351907 1768 986 934 771 11589 11610 1352
NM_001024858chr1462428 2184 838 686 569 555 12434 ----
NM_001024912chr1921386 36 21770 1658 ----
NM_001024948chr192841 2758 2260 2233 387 338 329 231 184 12268 12320 --
NM_001024956chr1135271 4783 947 22338 996 34717 4173 1715 --
NM_001025076chr10116227 4982 4946 4844 4805 4561 4045 3964 2326 2140 1444 14534 ----
NM_001025077chr10127585 6340 6304 6202 6163 5919 5403 5322 4871 2802 1045 994 25892 4785 ----
NM_001025079chr332892 2630 2621 ------
NM_001025107chr172538 2137 1949 1844 948 447 258 ------
NM_001025107chr172538 2137 1949 1844 948 447 258 ------
NM_001025108chr242750 1259 658 31 13400 ----
NM_001025109chr13931 436 331 2186 54 --1964
NM_001025201chr21198 ------
NM_001025252chr852101 1051 473 174 90 1760 --2314 116
NM_001025253chr852101 1051 473 174 90 1760 --2314 116
NM_001025266chr3124788 4712 4599 3023 1663 1569 1546 1528 1342 1336 803 95 24214 1655 34015 3796 3702 --
NM_001025366chr64759 700 402 171 11690 11481 --
NM_001025366chr64759 700 402 171 11690 11481 --
NM_001025367chr64759 700 402 171 11690 11481 --
NM_001025367chr64759 700 402 171 11690 11481 --
NM_001025368chr64759 700 402 171 11690 11481 --
NM_001025368chr64759 700 402 171 11690 11481 --
NM_001025369chr63716 418 187 11706 11497 --
NM_001025369chr63716 418 187 11706 11497 --
NM_001025370chr64759 700 402 171 11690 11481 --
NM_001025370chr64759 700 402 171 11690 11481 --
NM_001025389chr1111167 ------
NM_001025390chr1111167 ------
NM_001025580chrX32821 1089 643 137 13790 14193
NM_001025595chr431287 521 129 ------
NM_001025603chr12989 197 11321 ----
NM_001029839chr331095 984 592 --11468 --
NM_001029840chr331095 984 592 --11468 --
NM_001029858chr653411 2123 943 622 182 --12087 --
NM_001029860chr8137 ------
NM_001029863chr642366 2097 804 95 11097 ----
NM_001029875chr532819 2028 817 1531 12644 --
NM_001029997chr19--1547 1620 --
NM_001030006chr1752537 2418 2288 905 403 1292 --1676
NM_001030007chr1643860 3809 536 399 1374 1732 13558
NM_001030055chr14104776 4701 4428 3210 1860 1757 1725 1495 1450 574 13855 ----
NM_001030272chr112506 437 ------
NM_001030273chr112506 437 ------
NM_001031679chr1263390 2854 2644 2304 787 204 33160 2230 362 ----
NM_001031684chr221470 441 ------
NM_001031685chr1--1283 ----
NM_001031695chr2244577 4015 2152 1246 186 23948 3337 --
NM_001031710chr71341 ------
NM_001031711chr531456 1435 622 ------
NM_001031716chr231032 311 301 --11010 --
NM_001031746chr1051389 1359 1011 363 25 11232 ----
NM_001031804chr1644172 2996 1459 79 ------
NM_001031812chr51205 11888 ----
NM_001032280chr631406 1372 1275 1210 ----
NM_001032282chr82947 321 ------
NM_001032283chr1241097 410 254 235 ------
NM_001032284chr1241097 410 254 235 ------
NM_001032288chr2021526 373 ------
NM_001032363chr152117 1987 1536 667 119 --11510 --
NM_001032363chr152117 1987 1536 667 119 --11510 --
NM_001032999chr2054292 3947 3431 3287 1445 34102 3496 204 25353 4208 --
NM_001033045chr253170 1777 1562 623 461 ----14006
NM_001033049chr2141798 1703 1530 237 --1310 --
NM_001033057chr361965 1759 367 278 43 27 ------
NM_001033059chr651749 505 480 420 225 1286 ----
NM_001033081chr161588 1482 1431 1403 384 294 2556 375 --1771
NM_001033082chr161588 1482 1431 1403 384 294 2556 375 --1771
NM_001033087chr2072649 2341 2161 1120 785 125 35 ------
NM_001033506chr11128 ------
NM_001033507chr121213 72 ------
NM_001033557chr2151 ------
NM_001033561chr172186 98 1888 ----
NM_001033566chr173854 294 62 ------
NM_001033568chr173854 294 62 ------
NM_001033602chr1321882 520 12473 --11893
NM_001033723chr872559 2047 1974 1122 1020 798 791 ------
NM_001033756chr64693 634 336 105 11624 11415 --
NM_001033756chr64693 634 336 105 11624 11415 --
NM_001033925chr1021694 546 ------
NM_001034025chr12156 ------
NM_001034194chr41143 ------
NM_001034841chr16105538 4801 4703 3823 3648 2112 1258 506 379 135 23940 1658 ----
NM_001035003chr4148 ------
NM_001035004chr4148 ------
NM_001035260chr1011429 1490 --11477
NM_001035511chr171909 1850 1739 1471 1386 771 247 ------
NM_001035512chr172016 1957 1846 1578 1493 878 354 ------
NM_001035513chr172016 1957 1846 1578 1493 878 354 ------
NM_001035521chr2--1161 ----
NM_001035534chr941496 1478 1001 70 ------
NM_001037131chr21410 ------
NM_001037132chr711739 21891 285 1677 --
NM_001037133chr711739 21891 285 1677 --
NM_001037164chr7------21272 718
NM_001037165chr7118849 8545 8505 7902 6600 6497 6043 5705 2710 1555 740 17669 27012 6104 1876
NM_001037174chr252142 1826 1417 315 53 ------
NM_001037281chr16--1121 ----
NM_001037317chr182776 2496 2248 2066 1863 1827 1073 547 22077 343 ----
NM_001037334chr1841775 1522 706 75 ------
NM_001037339chr121359 570 1472 ----
NM_001037340chr121359 570 1472 ----
NM_001037341chr121359 570 1472 ----
NM_001037341chr121359 570 1472 ----
NM_001037442chr41511 ------
NM_001037533chr12261 75 1211 1170 --
NM_001037535chrX11177 2541 481 ----
NM_001037536chrX11177 2541 481 ----
NM_001037540chrX11177 2541 481 ----
NM_001037872chr22647 521 ------
NM_001037954chr1163273 3097 2287 1385 254 248 23036 2776 ----
NM_001038493chr241479 1182 578 358 ----11206
NM_001038702chr541832 1078 449 82 22043 2025 --1973
NM_001038707chr192067 2043 1774 1649 830 724 574 527 167 --11558 --
NM_001038707chr192067 2043 1774 1649 830 724 574 527 167 --11558 --
NM_001039199chr2094332 3578 3315 1961 1531 1371 905 839 493 1852 ----
NM_001039348chr2--1105 11056 --
NM_001039349chr2--1105 11056 --
NM_001039465chr141413 ------
NM_001039479chr1462057 1911 976 904 380 163 11619 ----
NM_001039538chr222724 65 13412 1249 1217
NM_001039547chr387488 6200 6182 5593 4991 2645 1726 592 37827 6388 5821 ----
NM_001039569chr233003 1246 232 ------
NM_001039570chr22134490 4241 3682 3661 3257 1671 1465 1145 874 726 404 375 109 1252 14125 --
NM_001039571chr22134490 4241 3682 3661 3257 1671 1465 1145 874 726 404 375 109 1252 14125 --
NM_001039577chr183960 3303 2797 1794 1243 1050 410 95 11504 ----
NM_001039580chr431304 1111 303 51444 1364 1144 1123 947 --14800
NM_001039585chr151536 1071 642 570 99 31236 791 126 33848 3680 1144 --
NM_001039618chr1145711 5109 3966 1413 15945 1325 --
NM_001039693chr2103956 3748 3719 2909 2578 1550 1338 1198 557 136 ------
NM_001039709chr2054292 3947 3431 3287 1445 34102 3496 204 25353 4208 --
NM_001039711chr12367 80 1235 ----
NM_001039712chr12367 80 1235 ----
NM_001039715chr11682 2974 344 ----
NM_001039716chr11746 21038 408 ----
NM_001039762chr1031746 1710 1589 11606 ----
NM_001039840chrX51352 1279 511 444 381 14112 25827 4575 --
NM_001039888chr13715 609 192 ------
NM_001039916chr121441 ------
NM_001039917chr121441 ------
NM_001039918chr121441 ------
NM_001039919chr121441 ------
NM_001039920chr121441 ------
NM_001039937chr1353905 3127 2755 935 297 --21014 521 --
NM_001040001chr651928 1618 1511 485 181 ------
NM_001040100chr34875 227 201 118 ------
NM_001040101chr42253 212 ------
NM_001040102chr1062576 2173 2157 754 202 124 ------
NM_001040103chr1062576 2173 2157 754 202 124 ------
NM_001040110chr7------11677
NM_001040113chr161639 1154 ----
NM_001040118chr11125 1460 ----
NM_001040142chr21524 1515 ----
NM_001040143chr21524 1515 ----
NM_001040147chr182709 200 ------
NM_001040152chr755099 4755 3888 1177 503 15088 13706 --
NM_001040153chr1331001 355 260 ------
NM_001040157chr452892 2719 2140 1853 768 --2676 194 --
NM_001040158chr51374 ------
NM_001040159chr421464 434 131 ----
NM_001040179chr63880 699 676 --1661 --
NM_001040202chr431015 601 124 ----1177
NM_001040214chr622047 412 2349 140 1754 --
NM_001040272chr941685 760 625 26 ------
NM_001040284chr1685393 4397 4140 1554 1202 1156 671 314 24389 1227 ----
NM_001040402chr432847 2058 625 --1157 --
NM_001040409chr2192 2714 166 ----
NM_001040429chr1352974 1178 837 478 114 12386 12306 --
NM_001040432chr31132 ------
NM_001040440chr51179 ------
NM_001040441chr175425 5122 3631 2168 2000 1746 891 24928 3971 ----
NM_001040446chr552617 2098 877 526 440 22230 722 --12223
NM_001040450chr1542760 2033 1147 341 --1553 --
NM_001040453chr1542760 2033 1147 341 --1553 --
NM_001040624chr832452 2046 291 12580 12129 --
NM_001040625chr832452 2046 291 12580 12129 --
NM_001040626chr832452 2046 291 12580 12129 --
NM_001040627chr832452 2046 291 12580 12129 --
NM_001040628chr832452 2046 291 12580 12129 --
NM_001040629chr832452 2046 291 12580 12129 --
NM_001040630chr832452 2046 291 12580 12129 --
NM_001040653chr322569 320 1824 ----
NM_001040665chr794333 3364 3299 3092 1963 1141 952 942 65 21847 1512 22014 38 --
NM_001040709chr162195 1922 796 559 340 303 ------
NM_001040712chr923201 411 23361 3045 ----
NM_001040876chr42663 155 --11651 --
NM_001042355chr1695320 5187 3883 3638 3603 1613 1376 905 262 33653 1298 824 ----
NM_001042369chr1182 ------
NM_001042370chr11232 ------
NM_001042403chr122382 290 ------
NM_001042404chr111837 21451 1434 ----
NM_001042406chr621142 85 ------
NM_001042412chr1695320 5187 3883 3638 3603 1613 1376 905 262 33653 1298 824 ----
NM_001042413chr943973 1624 1407 355 24073 1333 ----
NM_001042424chr462009 1159 1139 833 508 297 12348 --11314
NM_001042425chr631406 1372 1275 1210 ----
NM_001042453chrX1536 21654 326 ----
NM_001042454chr162356 238 ------
NM_001042472chr202604 35 ------
NM_001042473chr101221 ------
NM_001042481chr1462538 2271 2183 2165 820 475 32505 1921 72 1260 --
NM_001042486chr2051188 531 432 330 179 --11351 --
NM_001042492chr1733519 2742 209 12927 1369 --
NM_001042494chr1583847 3345 3303 2702 2589 1121 1060 577 33876 3440 825 ----
NM_001042495chr1583847 3345 3303 2702 2589 1121 1060 577 33876 3440 825 ----
NM_001042496chr1583847 3345 3303 2702 2589 1121 1060 577 33876 3440 825 ----
NM_001042497chr1583847 3345 3303 2702 2589 1121 1060 577 33876 3440 825 ----
NM_001042510chr85723 634 434 350 42 ----11384
NM_001042511chr85723 634 434 350 42 ----11384
NM_001042517chr134365 282 206 53 ------
NM_001042533chr343072 2670 2385 353 12277 ----
NM_001042537chrX22475 2078 ------
NM_001042543chr421526 62 11584 1282 --
NM_001042555chr1294730 4161 4137 3604 3489 3087 1784 1262 731 24454 3527 11287 --
NM_001042599chr2136978 6293 6175 6134 5918 5519 4750 2888 2696 1756 705 666 85 67435 5858 5045 2830 872 227 ----
NM_001042601chr342915 2839 2443 901 21215 55 1789 --
NM_001042603chr1265366 4914 1316 1181 283 177 ------
NM_001042604chr374400 4305 3357 3004 1318 1041 604 14690 14869 --
NM_001042683chr621721 1521 1515 ----
NM_001042728chr1241047 839 764 343 --197 --
NM_001042784chr4--124 ----
NM_001043351chr13708 604 169 ------
NM_001044385chr253869 3690 3351 2999 1512 ----1519
NM_001044722chr51205 11888 ----
NM_001044723chr51205 11888 ----
NM_001046chr532885 2635 2588 12131 ----
NM_001071775chr1371543 1480 1403 289 280 228 147 ----140
NM_001079874chr142029 1551 372 311 ------
NM_001083620chr432404 665 342 ------
NM_001095chr1241921 1300 173 167 --21608 1199 --
NM_001096chr17191 --1248 --
NM_001099678chr395293 5126 5009 4849 2330 2310 1707 1067 641 26058 5631 ----
NM_001106chr3188145 8102 7288 7261 7167 7071 5906 3806 3263 3173 2543 2474 2450 1473 1260 489 482 417 29667 5969 26056 216 15930
NM_001109977chr42244 94 ------
NM_001111chr172538 2137 1949 1844 948 447 258 ------
NM_001113490chrX42847 2312 687 229 1915 ----
NM_001116chr163483 467 32 12394 12771 --
NM_001117chr1852226 2059 1852 601 92 1168 ----
NM_001119chr441376 450 378 74 --146 --
NM_001121chr1041812 1630 1507 454 --1232 11655
NM_001122631chr113672 261 229 ------
NM_001122679chr51110 ------
NM_001128chr1643860 3809 536 399 1374 1732 13558
NM_001146chr841851 1578 248 188 ------
NM_001149chr1031361 1068 1010 ------
NM_001153chr24792 363 279 183 167 ----
NM_001156chr10--2448 191 ----
NM_001157chr102711 206 ------
NM_001159chr22705 533 ------
NM_001160chr121484 ------
NM_001163chr92955 151 --1699 --
NM_001167chrX86353 5591 4133 1919 1443 1235 971 835 25291 2328 ----
NM_001172chr141149 1566 ----
NM_001173chr14104776 4701 4428 3210 1860 1757 1725 1495 1450 574 13855 ----
NM_001174chrX32324 1556 1514 --12119 1205
NM_001178chr112506 437 ------
NM_001186chr2152164 2054 728 580 463 21057 168 ----
NM_001198chr622307 1877 --32447 1811 791 194
NM_001202chr141194 ------
NM_001204chr296864 4935 2362 1763 1658 727 630 135 87 36305 4731 1505 ----
NM_001206chr932839 1972 1022 23014 2127 ----
NM_001233chr742328 649 267 98 1430 ----
NM_001237chr41784 11143 ----
NM_001237chr41784 11143 ----
NM_001241chr251910 1746 963 233 129 32429 2062 343 11709 --
NM_001241chr251910 1746 963 233 129 32429 2062 343 11709 --
NM_001254chr172425 238 1888 --176
NM_001256chr1762899 1053 757 639 312 81 ------
NM_001257chr1611172 1144 ----
NM_001259chr7156099 5685 5466 4628 3954 2328 2079 2000 1682 1650 1490 1442 1314 793 200 45177 1623 1561 369 1138 --
NM_001270chr52926 368 ------
NM_001271chr1543052 1199 666 178 ------
NM_001273chr121475 ------
NM_001278chr1041128 860 476 137 ------
NM_001280chr19----1699 --
NM_001282chr1752537 2418 2288 905 403 1292 --1676
NM_001290chr4166 --11063 --
NM_001304chr1773623 2780 2441 938 581 424 342 ------
NM_001310chr1241088 327 175 136 22120 518 ----
NM_001316chr201143 ------
NM_001319chr191839 1214 11037 --
NM_001326chr112197 128 ------
NM_001329chr1011232 ----1336
NM_001332chr53641 584 274 11253 ----
NM_001333chr91194 ------
NM_001343chr541453 322 210 152 ------
NM_001351chr331511 711 514 ------
NM_001356chrX22399 627 ------
NM_001358chr4141 1131 ----
NM_001364chr11123827 3805 3643 3592 3283 3236 3133 3092 2963 1632 640 353 ------
NM_001386chr832306 2222 1994 11789 ----
NM_001387chr533096 2215 2050 12090 32055 280 169 --
NM_001391chr1831207 884 52 1391 ----
NM_001392chr18123 ------
NM_001396chr2122657 1914 --12452 --
NM_001397chr142532 2279 1897 1637 1988 1677 12181
NM_001400chr131347 240 37 ------
NM_001402chr642059 1679 803 775 ------
NM_001407chr331714 1612 1500 --1129 --
NM_001408chr121037 80 ------
NM_001412chrX63571 3168 2839 2695 1272 876 --11177 --
NM_001417chr123494 394 73 ------
NM_001418chr112500 482 ------
NM_001418chr112500 482 ------
NM_001419chr1953567 3019 1945 881 308 24823 3876 1536 --
NM_001423chr1241970 1663 548 164 11377 ----
NM_001426chr21231 --1274 --
NM_001430chr241696 563 377 31 ------
NM_001438chr182958 2367 2304 1329 908 409 349 188 --11067 --
NM_001448chrX41652 1552 287 64 ------
NM_001449chrX1503 21260 1150 ----
NM_001451chr161966 ------
NM_001452chr61590 ------
NM_001453chr61188 ------
NM_001483chr72743 350 ------
NM_001494chr101719 ------
NM_001497chr962598 2163 1853 751 61 48 21983 1085 --22624 207
NM_001498chr611268 31170 987 967 ----
NM_001518chr741030 1004 792 124 ----1989
NM_001521chr2--1161 ----
NM_001523chr191276 1117 ----
NM_001530chr141144 176 ----
NM_001542chr132738 2558 919 ------
NM_001546chr631195 580 555 2489 211 1397 --
NM_001558chr1161790 1631 1539 1449 1292 48 ------
NM_001565chr41219 --1244 1689
NM_001584chr1121127 322 ------
NM_001587chrX42028 1783 574 156 22070 1818 ----
NM_001604chr11------1125
NM_001610chr111744 ------
NM_001614chr171647 ------
NM_001614chr171647 ------
NM_001616chr262703 2656 2624 2609 1271 154 1226 13351 --
NM_001621chr772477 2087 1025 931 564 457 334 ------
NM_001621chr772477 2087 1025 931 564 457 334 ------
NM_001634chr651749 505 480 420 225 1286 ----
NM_001635chr711005 2958 322 ----
NM_001642chr1121260 885 ------
NM_001650chr1841109 1072 881 355 23582 3072 ----
NM_001655chr114759 309 303 133 ------
NM_001656chr532010 772 160 ------
NM_001658chr13985 352 38 --143 --
NM_001661chr171265 ------
NM_001663chr1431986 562 236 ----1131
NM_001664chr32901 210 1226 1406 --
NM_001668chr152165 1961 1766 454 155 ----11865
NM_001677chr151075 802 735 399 196 ----1125
NM_001682chr1242387 1876 732 302 22290 1852 ----
NM_001683chr322607 939 --1762 --
NM_001684chr123109 136 --14016 --
NM_001690chr331636 323 187 ------
NM_001699chr19121603 1543 1527 1512 1407 1190 1129 733 725 386 336 304 ------
NM_001701chr9144 ------
NM_001703chr1148 ------
NM_001704chr63557 542 459 ------
NM_001706chr31790 173 ----
NM_001709chr1162844 2708 2242 1993 1909 309 --1516 1148
NM_001726chr11121 ------
NM_001730chr131572 --1226 --
NM_001730chr131572 --1226 --
NM_001731chr121607 2926 344 ----
NM_001742chr731595 1529 1210 21484 524 ----
NM_001744chr51170 ------
NM_001746chr531936 994 918 ------
NM_001753chr731492 715 264 ----11746
NM_001754chr2153750 3649 3142 2833 2700 ------
NM_001755chr1631944 925 853 183 ----
NM_001759chr1285008 4329 4048 3861 3847 3499 3472 1985 35063 1255 593 ----
NM_001773chr131297 1052 972 2552 420 --11330
NM_001777chr332892 2630 2621 ------
NM_001788chr73857 401 212 ------
NM_001792chr182291 82 ------
NM_001797chr162768 567 ------
NM_001799chr5--1113 ----
NM_001806chr1922929 2438 ------
NM_001822chr21198 ------
NM_001825chr5--1120 ----
NM_001830chrX94032 3756 3734 3644 3176 3000 2503 673 197 ------
NM_001839chr11696 1491 ----
NM_001845chr1331047 379 169 ------
NM_001854chr11399 ------
NM_001855chr91574 1124 ----
NM_001858chr645032 5010 4222 3851 ----1222
NM_001859chr963677 3449 2606 1324 1191 625 12524 ----
NM_001865chr62139 49 ------
NM_001875chr241085 725 369 333 11012 ----
NM_001881chr102494 378 ------
NM_001884chr5--2446 373 1219 --
NM_001893chr171356 --168 --
NM_001894chr2221235 887 ------
NM_001901chr62983 265 1943 ----
NM_001903chr52793 284 ------
NM_001908chr852308 1995 1813 689 564 ------
NM_001918chr1117871 6753 3368 3101 3070 2732 2471 2342 801 409 150 69131 8538 8098 5776 1729 83 16969 13271
NM_001920chr122773 649 ------
NM_001921chr41198 1906 ----
NM_001924chr11471 ------
NM_001935chr2--1985 ----
NM_001938chr151239 1228 1207 363 339 1331 ----
NM_001939chrX62918 1328 794 674 533 130 11392 --13280
NM_001945chr52891 542 ------
NM_001949chr632128 931 804 1980 ----
NM_001951chr83189 180 144 ------
NM_001955chr63870 752 103 162 ----
NM_001964chr541165 1095 254 139 ------
NM_001967chr31186 ------
NM_001968chr4--1361 ----
NM_001969chr1441279 1160 955 322 1119 ----
NM_001970chr172419 81 --1572 --
NM_001977chr411345 1245 --1340
NM_001980chr121346 --12292 --
NM_001981chr121572 508 12161 ----
NM_001999chr511188 ------
NM_002006chr4145248 5088 5035 4937 4788 4362 3665 3607 1627 1576 1507 697 589 269 22023 1402 14094 --
NM_002009chr1532506 2341 916 12585 ----
NM_002013chr14121 ------
NM_002014chr121135 1620 ----
NM_002015chr1342048 1308 1143 729 ------
NM_002017chr1121216 175 ----11269
NM_002019chr133750 733 606 1617 ----
NM_002025chrX219071 9013 8848 8512 7550 6959 6678 6599 6133 5800 5623 2439 2308 1908 1762 1122 910 420 264 48 42 38030 6259 1699 ----
NM_002026chr23907 117 40 ----1895
NM_002027chr81175 ------
NM_002033chr1173967 3782 3411 2944 1407 988 61 43308 1048 781 675 1124 --
NM_002035chr1843746 3637 3239 613 11568 ----
NM_002040chr213952 409 402 ----1423
NM_002044chr1521522 159 ------
NM_002060chr1----1495 188
NM_002061chr121777 1339 ------
NM_002063chrX11031 ------
NM_002069chr72433 235 ------
NM_002076chr1273292 3199 2174 1084 614 188 120 --11003 --
NM_002077chr951944 1512 629 458 428 ------
NM_002086chr1742233 745 599 378 12097 ----
NM_002089chr42565 548 ------
NM_002090chr4----1157 --
NM_002092chr484990 4181 4032 3430 1201 1031 856 408 ------
NM_002103chr194962 875 290 40 1377 1851 --
NM_002114chr61208 1479 ----
NM_002126chr1761664 655 526 390 283 99 ------
NM_002128chr1342115 1887 833 812 1821 ----
NM_002136chr121431 ------
NM_002137chr732280 1755 916 41795 1766 849 690 ----
NM_002146chr1741297 1042 581 59 ------
NM_002147chr171372 --177 --
NM_002154chr56509 408 383 372 63 44 ------
NM_002158chr21606 144 ----
NM_002166chr21659 ------
NM_002190chr61256 1535 ----
NM_002196chr202408 401 11047 ----
NM_002196chr202408 401 11047 ----
NM_002199chr41653 2858 628 ----
NM_002201chr151115 ----1105
NM_002202chr52821 715 ------
NM_002205chr122930 58 ------
NM_002210chr253498 3357 2664 2573 1357 11051 1100 --
NM_002211chr10172 1763 --1387
NM_002214chr795422 4868 4681 4357 4162 2188 2126 1245 239 65063 4953 4894 3987 2204 308 14930 --
NM_002223chr1283651 3233 2899 1454 1425 723 669 583 11309 ----
NM_002226chr141145 ------
NM_002227chr11821 21335 1287 ----
NM_002228chr11883 ------
NM_002232chr1--11256 ----
NM_002233chr111435 ------
NM_002246chr23847 382 182 11105 ----
NM_002247chr1011521 11964 ----
NM_002252chr22429 60 ------
NM_002254chr261466 933 657 378 205 151 22187 1979 ----
NM_002264chr344946 3149 1869 572 14902 14877 --
NM_002266chr17166 ------
NM_002267chr1312133 ------
NM_002268chr3--3735 344 257 ----
NM_002270chr575389 5323 2180 1996 1825 1658 1612 297 72 --13492
NM_002271chr1361909 1895 1886 1503 334 184 ----1381
NM_002285chr242750 1259 658 31 13400 ----
NM_002293chr132176 2153 105 22696 2473 ----
NM_002296chr121201 461 ------
NM_002298chr1321435 1340 1109 ----
NM_002313chr10105142 3499 2012 1848 1690 1626 1144 965 619 563 35098 4677 1077 --11454
NM_002315chr11180 ------
NM_002332chr12--1749 ----
NM_002333chr19277 66 ------
NM_002336chr1254985 4830 4290 1693 361 24393 3126 11639 --
NM_002356chr641948 1931 736 259 --11753 --
NM_002361chr192249 223 ------
NM_002373chr1521228 526 ------
NM_002374chr222724 65 13412 1249 1217
NM_002376chr141166 ------
NM_002380chr81399 ------
NM_002382chr1411315 --1446 --
NM_002384chr181968 ------
NM_002391chr111116 ------
NM_002395chr641445 1236 544 27 ------
NM_002397chr521791 378 ------
NM_002398chr211102 ------
NM_002401chr1742341 1838 791 561 12305 32376 1710 545 --
NM_002408chr14198 1782 ----
NM_002416chr43734 217 43 11660 ----
NM_002430chr2252412 2226 1641 752 26 --1781 --
NM_002436chrX2449 68 1120 ----
NM_002442chr121445 11533 ----
NM_002444chrX42006 1499 1406 570 11390 1787 --
NM_002445chr891656 1479 1438 1392 460 363 315 190 31 ------
NM_002455chr1134 ------
NM_002480chr12--11008 --11098
NM_002485chr81797 11600 11913 1456
NM_002487chr152733 639 ------
NM_002489chr74302 138 126 29 ------
NM_002499chr1532438 1705 588 ------
NM_002501chr1963931 3894 3648 3488 1273 598 33951 3841 880 ----
NM_002505chr63573 498 104 ------
NM_002506chr1--136 ----
NM_002507chr1721535 1403 1430 ----
NM_002508chr131607 500 50 11822 ----
NM_002514chr831187 487 458 ------
NM_002515chr1431843 343 42 1214 ----
NM_002518chr22339 36 2940 233 ----
NM_002519chr111616 11271 ----
NM_002522chr1733886 3405 2448 1590 1806 --
NM_002524chr13380 284 165 ----11033
NM_002537chr152950 277 --121 1956
NM_002538chr52214 131 149 ----
NM_002545chr1174960 3710 3431 3377 734 323 286 11437 2615 207 --
NM_002568chr82424 331 ------
NM_002569chr1531514 1356 474 ------
NM_002570chr1541035 914 275 115 ------
NM_002572chr112391 50 ------
NM_002577chr331136 825 724 142 --1526
NM_002578chrX2109 59 ------
NM_002581chr975671 4591 4583 3951 2142 1282 308 34873 4276 3648 1858 --
NM_002589chr4154 ------
NM_002594chr2052273 1654 722 658 184 11644 --1982
NM_002595chr122385 219 ------
NM_002599chr1121230 776 1257 2820 812 --
NM_002600chr121359 570 1472 ----
NM_002605chr154962 832 821 800 1979 ----
NM_002607chr731121 903 103 --11178 1477
NM_002610chr242661 2317 2169 552 ------
NM_002612chr722009 24 1706 ----
NM_002613chr1685350 5260 4973 4824 4213 3667 2065 602 11126 13648 11324
NM_002615chr171112 ------
NM_002628chr3198 --1778 --
NM_002634chr172724 258 --1870 --
NM_002641chrX2574 45 1126 11890 --
NM_002645chr1142691 2336 769 388 11174 ----
NM_002655chr865334 5110 4894 4718 3489 3380 23656 3605 1355 --
NM_002657chr2073789 2884 2725 1341 843 164 36 22994 1308 ----
NM_002660chr202440 201 ------
NM_002667chr61202 ------
NM_002670chr311337 31444 1007 639 ----
NM_002687chr1431175 1122 856 ------
NM_002698chr1932137 1178 1058 ------
NM_002703chr421847 300 21736 423 ----
NM_002709chr243269 2598 834 688 43537 2293 1039 664 1749 1482
NM_002710chr122933 386 ------
NM_002713chr111024 ------
NM_002718chr342213 1661 943 639 42038 589 309 255 11845 --
NM_002719chr1452338 1504 740 713 393 1424 ----
NM_002721chr9--172 ----
NM_002726chr6--1350 ----
NM_002729chr101339 ------
NM_002731chr142240 1992 816 648 1159 ----
NM_002733chr122232 64 ------
NM_002734chr1762172 2120 2047 918 212 67 ------
NM_002736chr71171 11634 ----
NM_002737chr1796154 5858 5817 4621 2142 1565 1046 509 257 11891 35665 2088 1357 --
NM_002738chr1641034 879 452 172 ------
NM_002739chr194563 502 258 140 1191 1126 --
NM_002745chr2264462 4449 3342 1450 400 277 21049 342 11222 14036
NM_002747chr1841473 512 279 94 11418 11814 --
NM_002748chr15--1159 ----
NM_002753chr4----1646 --
NM_002755chr151145 ------
NM_002763chr11427 1401 ----
NM_002787chr7--1102 1493 --
NM_002788chr14137 ------
NM_002790chr1144 ------
NM_002791chr14--1139 ----
NM_002814chrX1551 --1213 --
NM_002815chr171180 --196 --
NM_002822chr124688 524 479 298 ------
NM_002823chr21685 ------
NM_002825chr71442 ------
NM_002827chr2031112 503 44 --11759 --
NM_002828chr182997 673 ------
NM_002834chr1241241 1154 1144 979 22564 243 ----
NM_002837chr1294635 4467 4248 3738 3078 2872 1709 374 239 11584 --1285
NM_002839chr923201 411 23361 3045 ----
NM_002844chr61352 1477 ----
NM_002847chr721509 1469 11443 ----
NM_002848chr1221044 516 ------
NM_002849chr125726 688 392 290 107 ------
NM_002851chr71627 ------
NM_002852chr3----1583 --
NM_002855chr11103378 3067 2731 818 773 767 689 415 260 237 --13169 11169
NM_002858chr12961 405 --1349 --
NM_002859chr1241685 1468 1186 21 1719 1622 --
NM_002865chr81103 ------
NM_002867chr11761 2239 165 ----
NM_002869chr1131534 842 757 --1488 --
NM_002874chr922368 342 ------
NM_002884chr14889 832 188 23 ------
NM_002886chr334716 4381 4010 --24836 30 --
NM_002890chr51627 ------
NM_002892chr1421475 239 ------
NM_002897chr22170 86 ------
NM_002898chr124542 187 172 27 1420 ----
NM_002902chr15----158 --
NM_002906chr1121553 1537 1807 ----
NM_002912chr61634 ------
NM_002924chr11211 ------
NM_002928chr141496 1486 1438 332 ------
NM_002930chr18190 ------
NM_002938chr451997 1862 1568 1478 233 1583 ----
NM_002940chr42663 155 --11651 --
NM_002941chr3----11082 --
NM_002942chr331077 471 31 --1327 --
NM_002945chr173770 717 256 ------
NM_002959chr163644 3081 2944 2885 205 111 --1431 --
NM_002968chr161170 ------
NM_002970chrX1116 ------
NM_002971chr31459 --1865 1840
NM_002973chr12256 47 ------
NM_002977chr243124 3078 2645 837 53358 2688 1121 636 560 ----
NM_002994chr431360 633 235 ------
NM_002996chr1641596 1222 393 246 11645 21537 577 --
NM_002998chr851626 1597 593 411 22 ------
NM_003001chr172016 1957 1846 1578 1493 878 354 ------
NM_003002chr114681 673 206 51 ------
NM_003010chr1772426 2382 2217 2046 1947 708 632 --11875 1546
NM_003011chr961427 1249 423 284 207 140 --1319 --
NM_003017chr62574 173 1225 ----
NM_003022chrX31291 1219 1018 ----1350
NM_003026chr911217 ------
NM_003030chr311415 ------
NM_003031chr16--1771 ----
NM_003034chr12158113 8104 7925 6943 6898 6821 4907 3126 3115 3052 1723 1553 600 435 149 25467 1845 15122 --
NM_003036chr12259 178 ------
NM_003042chr332271 2147 512 12057 ----
NM_003043chr333461 2788 83 1486 13200 --
NM_003046chr834246 4135 3344 24238 3656 25361 450 --
NM_003051chr131937 624 62 ------
NM_003068chr811071 ------
NM_003069chrX4764 319 301 115 ------
NM_003070chr92129 60 --1553 --
NM_003074chr32750 326 22049 293 --11556
NM_003075chr121290 ------
NM_003076chr1211290 1427 --11382
NM_003077chr175607 227 200 128 116 ------
NM_003079chr172361 25 ------
NM_003099chr1585621 4754 4728 4438 1086 946 500 214 22641 2620 25874 1003 --
NM_003100chr5--1329 ----
NM_003106chr33980 408 364 ------
NM_003107chr662222 2076 2035 2022 900 230 1688 ----
NM_003108chr255997 2002 1809 1615 823 36075 5490 1709 14912 --
NM_003110chr172262 146 --2881 186 --
NM_003111chr2----1487 --
NM_003112chr762763 2529 2434 2178 1048 799 22410 416 ----
NM_003114chr82803 611 1164 ----
NM_003128chr221999 1137 1531 ----
NM_003131chr632200 2123 1882 177 2689 467 --
NM_003134chr15------1391
NM_003139chr112263 72 1820 --1707
NM_003144chr651996 1601 769 746 31 21764 1522 11593 --
NM_003155chr861829 846 784 677 653 262 ------
NM_003161chr1743010 1387 1121 792 11084 ----
NM_003162chr22750 271 ------
NM_003174chr101666 ----1739
NM_003176chr11328 ------
NM_003176chr11328 ------
NM_003178chr3--21876 1491 11466 --
NM_003184chr821002 139 ------
NM_003185chr201497 2967 98 1352 --
NM_003188chr6----1613 --
NM_003189chr153151 598 383 150 94 13258 ----
NM_003194chr61398 ------
NM_003206chr6190 1142 ----
NM_003214chr61179 --1260 --
NM_003216chr2293172 3127 2886 2449 2359 2059 913 668 49 3689 578 378 22959 1037 --
NM_003217chr1251896 1701 1361 254 136 ----11373
NM_003220chr631406 1372 1275 1210 ----
NM_003221chr663955 3624 3245 2660 1465 75 --11392 --
NM_003234chr321697 349 12325 ----
NM_003238chr1--1221 ----
NM_003242chr351907 1768 986 934 771 11589 11610 1352
NM_003246chr1521740 301 11645 11275 --
NM_003250chr172338 61 ------
NM_003253chr2151631 1502 1418 612 55 ------
NM_003255chr1752490 2351 914 216 69 1483 ----
NM_003257chr1531007 374 68 11096 ----
NM_003259chr191131 ------
NM_003262chr363996 3479 2027 1728 1338 1167 21008 884 11600 --
NM_003269chr62504 396 11129 ----
NM_003270chrX2244 32 ------
NM_003286chr20----1293 --
NM_003288chr2051242 631 559 355 67 --11300 --
NM_003289chr92180 60 ------
NM_003292chr1--1745 21408 263 --
NM_003298chr356166 5998 4517 1848 1696 25703 4302 15718 --
NM_003311chr111259 ------
NM_003319chr21790 126 ----
NM_003320chr1183741 3496 2795 2705 1741 1163 843 169 23726 2697 --13076
NM_003334chrX1156 ------
NM_003336chrX41055 918 186 154 ------
NM_003337chr531725 1445 607 ------
NM_003338chr1021777 1325 1602 ----
NM_003339chr531553 1152 516 21584 28 --1244
NM_003340chr431059 479 340 ------
NM_003341chr31640 ------
NM_003342chr1762696 1277 993 987 913 80 12607 12429 13266
NM_003344chr731498 1176 311 11236 ----
NM_003347chr2242276 2119 1947 204 1139 11918 --
NM_003349chr2021526 373 ------
NM_003350chr8143 --1364 --
NM_003352chr21346 ------
NM_003374chr51144 ------
NM_003376chr64759 700 402 171 11690 11481 --
NM_003376chr64759 700 402 171 11690 11481 --
NM_003383chr91192 ------
NM_003387chr242219 1864 508 21 ------
NM_003390chr111345 ------
NM_003392chr333286 2971 2936 14075 11143 --
NM_003394chr122133 70 ------
NM_003400chr21844 132 ----
NM_003403chr142210 174 --1201 --
NM_003404chr2032012 1627 1320 ------
NM_003405chr221497 ------
NM_003406chr821920 1752 11799 ----
NM_003409chr1821280 970 2944 330 ----
NM_003410chrX22382 2198 ------
NM_003411chrY31751 1741 1589 1144 1274 --
NM_003412chr332933 2111 561 ------
NM_003413chrX31917 1226 729 41827 547 267 233 ----
NM_003418chr3----1117 --
NM_003430chr191251 31607 541 289 ----
NM_003439chr733153 2357 968 23035 958 1687 --
NM_003442chr11----1789 --
NM_003455chr1151467 462 432 259 184 ------
NM_003458chr383971 3247 2892 2473 1358 1020 96 88 2637 283 11025 --
NM_003466chr241781 1533 962 536 22309 578 --11975
NM_003468chr211306 23495 1385 11469 23357 319
NM_003471chr341578 1445 905 647 ------
NM_003474chr1021734 168 12168 ----
NM_003482chr123912 558 230 12480 ----
NM_003483chr1222707 24 ------
NM_003489chr2162812 2632 1343 1166 1030 730 ------
NM_003496chr73832 785 48 ------
NM_003507chr222010 112 ------
NM_003557chr141585 1302 1290 94 ------
NM_003559chr1773905 3390 1443 1422 1303 1044 124 ------
NM_003566chr1232385 565 493 ------
NM_003574chr1834424 1933 480 25409 5066 31669 1648 1373 --
NM_003575chr71460 ------
NM_003580chr82377 38 1577 ----
NM_003581chr22204 106 1962 ----
NM_003583chr12123833 3804 3575 3227 2688 2555 2470 1240 786 224 190 106 12909 ----
NM_003586chr162488 169 ------
NM_003590chr273938 3253 551 460 265 143 120 31625 1610 221 --23493 191
NM_003595chr222523 185 --1450 --
NM_003603chr421973 231 ------
NM_003607chr184253 4177 3318 2890 2738 897 847 768 11479 ----
NM_003613chr152576 136 1253 ----
NM_003615chr373925 3669 3162 848 819 478 413 ------
NM_003626chr1141087 985 850 479 133 --1499
NM_003628chr2----1195 --
NM_003629chr143153 3129 3037 2491 33362 82 45 1402 --
NM_003632chr172672 604 1849 1102 --
NM_003633chr552089 1974 1901 159 71 ------
NM_003655chr171297 --1278 --
NM_003659chr2--1160 ----
NM_003660chr192314 267 ------
NM_003663chr353306 3185 2884 1260 1199 1927 ----
NM_003664chr51142 1471 ----
NM_003672chr13737 634 105 11799 21942 1267 --
NM_003676chr11651 ------
NM_003677chr12--1259 ----
NM_003692chr92677 247 ------
NM_003705chr23259 251 200 ------
NM_003713chr141244 1185 561 250 ------
NM_003714chr553041 2650 2640 874 301 --22088 2052 12738
NM_003718chr72189 110 ------
NM_003722chr342601 1710 1040 189 ------
NM_003728chr41174 ------
NM_003741chr31125 ------
NM_003749chr1342307 2019 1920 908 ------
NM_003759chr473075 1520 1304 1131 692 436 274 --23821 949 --
NM_003762chr121291 228 ------
NM_003763chr2062949 2651 2609 2560 930 727 22191 488 ----
NM_003766chr172528 386 --1450 --
NM_003768chr121854 159 ------
NM_003769chr12----1276 --
NM_003773chr3138 ------
NM_003778chr31679 ------
NM_003784chr182709 200 ------
NM_003787chr1821140 1059 1640 ----
NM_003791chr161577 --1222 1134
NM_003795chr62174 65 ------
NM_003796chr191563 ------
NM_003797chr111185 ------
NM_003799chr1854390 3384 1729 260 240 ----11000
NM_003800chr612338 --1822 --
NM_003816chr81372 ------
NM_003822chr142349 994 517 128 --22975 23 --
NM_003825chr1521300 584 --1186 --
NM_003831chr181386 1705 --11695
NM_003861chr1452856 2713 2422 1876 280 ------
NM_003862chr5----1103 --
NM_003872chr232164 286 244 1487 ----
NM_003877chr124898 836 780 84 ------
NM_003884chr311793 1718 ----
NM_003893chr102450 338 1200 131 --
NM_003895chr2152232 1737 1649 699 444 12069 ----
NM_003901chr102319 296 12557 ----
NM_003902chr1------1342
NM_003913chr663950 3557 2850 1100 972 774 13151 23753 1210 --
NM_003916chrX--1938 --11057
NM_003918chrX4611 566 239 117 ------
NM_003927chr181753 1974 ----
NM_003932chr2261641 1472 1352 481 372 301 ------
NM_003934chr91229 11293 ----
NM_003941chr732253 1716 1696 2821 189 22216 96 1557
NM_003947chr331369 1027 209 ------
NM_003948chr432679 2583 1691 12525 1540 --
NM_003951chrX267 42 ------
NM_003953chr131933 1811 1158 1229 12499 --
NM_003957chr111886 1855 ----
NM_003970chr81452 ------
NM_003971chr17163 --1156 --
NM_003980chr6--148 21022 488 1424
NM_003983chr1641432 897 530 386 --12970 --
NM_003993chr1--1119 ----
NM_003994chr1294402 4243 3692 2812 1172 566 378 244 80 21137 423 --11477
NM_004006chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004007chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004009chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004010chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004011chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004012chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004013chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004014chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004015chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004016chrX72278 2235 2077 1993 1851 509 332 12123 22572 1628 --
NM_004017chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004018chrX72278 2235 2077 1993 1851 509 332 12123 22572 1628 --
NM_004019chrX1401 ------
NM_004020chrX72364 2321 2163 2079 1937 595 418 12209 22658 1714 --
NM_004021chrX72278 2235 2077 1993 1851 509 332 12123 22572 1628 --
NM_004022chrX72278 2235 2077 1993 1851 509 332 12123 22572 1628 --
NM_004023chrX72278 2235 2077 1993 1851 509 332 12123 22572 1628 --
NM_004024chr111308 ------
NM_004028chr1841109 1072 881 355 23582 3072 ----
NM_004034chr10--2448 191 ----
NM_004036chr23751 699 155 1611 ----
NM_004040chr221326 1242 11169 ----
NM_004046chr18149 ------
NM_004050chr1432132 2039 798 --1675 12656
NM_004071chr21254 ------
NM_004081chrY31537 612 57 ------
NM_004085chrX1241 ------
NM_004087chr31329 ----11427
NM_004089chrX11282 1105 ----
NM_004090chr1742922 2674 2497 727 --12309 --
NM_004093chr1333183 2525 2178 1305 --1526
NM_004094chr1452788 2483 2305 259 135 1542 ----
NM_004100chr652194 1860 961 289 194 11006 --183
NM_004105chr2--1105 11056 --
NM_004109chr1122068 766 --1115 --
NM_004112chr173521 455 448 --31651 1425 134 --
NM_004113chr331662 1600 816 11730 ----
NM_004119chr13----1667 --
NM_004124chr1433517 2606 813 ------
NM_004132chr101848 11069 ----
NM_004133chr82544 334 ------
NM_004156chr81211 ------
NM_004171chr1199268 8886 3299 2478 1968 1440 1291 647 199 36716 6552 2253 ----
NM_004172chr5----11802 11985
NM_004180chr22601 32 ------
NM_004181chr41261 ------
NM_004187chrX31251 1131 921 ------
NM_004202chrY--138 ----
NM_004206chr3135 1427 ----
NM_004209chr162832 340 21175 911 ----
NM_004215chr81456 ------
NM_004225chr811205 183 1932 --
NM_004232chr1853273 3180 2925 2522 2459 13589 ----
NM_004236chr151188 ------
NM_004242chr61103 ------
NM_004249chr4----182 --
NM_004263chr221510 488 --21630 1435 --
NM_004272chr511429 ----173
NM_004273chr1054398 3745 3331 392 364 --11844 --
NM_004274chr1472976 2817 2179 1041 1029 664 288 --12608 --
NM_004277chr621334 87 ------
NM_004279chr711873 --1314 --
NM_004281chr10144 ------
NM_004288chr2--1771 ----
NM_004290chr53881 310 268 ------
NM_004301chr34154 144 55 22 ------
NM_004302chr1272857 2625 2380 2189 2167 832 462 --11957 --
NM_004311chr1042826 2168 1193 692 21202 228 11001 12993
NM_004321chr283560 2882 2569 817 811 383 288 220 11290 12667 --
NM_004327chr2272139 1971 1847 1678 1553 815 336 ------
NM_004329chr1061010 946 557 435 308 215 11035 ----
NM_004330chr151973 11178 ----
NM_004331chr832047 1987 435 1869 --12347
NM_004338chr18136999 6590 6516 5446 4711 2762 2517 2482 2201 1883 1724 1418 895 36565 6263 5948 ----
NM_004341chr21237 ------
NM_004342chr762143 1739 1531 1501 256 69 ------
NM_004344chrX122 ------
NM_004349chr8----1347 --
NM_004380chr1622290 792 ------
NM_004384chr51205 11888 ----
NM_004389chr2--1320 ----
NM_004392chr1332375 2111 1881 1149 22400 2031 --
NM_004397chr1184208 3853 3560 2884 2701 1585 1339 607 ----31733 1391 852
NM_004399chr121665 ------
NM_004407chr42869 849 1930 ----
NM_004408chr92477 202 ------
NM_004414chr212394 166 ------
NM_004423chr382602 2392 2076 1815 667 467 423 222 1307 22664 672 1182
NM_004424chr16------1150
NM_004426chr123727 710 686 1227 21508 205 --
NM_004428chr1--1731 ----
NM_004430chr832802 1699 706 1397 11096 --
NM_004432chr911672 12258 ----
NM_004434chr141605 --11247 --
NM_004437chr183532 3272 2336 2280 854 609 311 29 22956 242 ----
NM_004438chr222926 2413 1720 --22086 1106
NM_004440chr641634 1273 1228 685 ------
NM_004441chr3--11200 11133 --
NM_004442chr131748 1321 49 --178 --
NM_004447chr122437 236 ------
NM_004451chr113692 586 207 ------
NM_004454chr331935 1730 395 1382 11487 --
NM_004458chrX42257 1064 458 189 ------
NM_004459chr17--21847 726 ----
NM_004463chrX2492 67 ------
NM_004464chr463896 3769 1622 1453 1006 244 33848 3546 445 ----
NM_004472chr51194 1599 1182 --
NM_004474chr12974 296 1242 1184 --
NM_004480chr142262 90 ------
NM_004491chr1984105 3507 2790 1428 1385 783 385 325 12897 1528 1564
NM_004494chr151315 1290 1250 1198 124 11209 ----
NM_004496chr1421217 852 11202 ----
NM_004497chr191665 ------
NM_004498chr15140 --1361 --
NM_004499chr51173 ------
NM_004500chr14143 12052 ----
NM_004501chr143652 2692 2686 1166 21341 1172 --1253
NM_004504chr242470 1896 664 97 --12874 --
NM_004505chr1712014 11686 ----
NM_004514chr1792476 2330 1957 1902 1200 1031 928 485 247 1443 ----
NM_004515chr1------171
NM_004519chr8--1218 ----
NM_004521chr102305 90 ------
NM_004525chr211533 ------
NM_004529chr91157 ------
NM_004540chr211698 --1309 --
NM_004559chr1121 ------
NM_004569chr141217 ------
NM_004576chr51165 ------
NM_004580chr1551902 1510 727 151 56 ------
NM_004583chr172637 269 ------
NM_004586chrX115118 4727 4222 3657 2179 1953 1865 1596 1151 726 166 --13702 --
NM_004588chr1163456 3220 2803 2755 1229 206 --23154 829 --
NM_004598chr532929 2861 1182 23071 116 ----
NM_004599chr221456 ------
NM_004607chr5--1198 ----
NM_004612chr984098 4082 3853 3248 1660 701 470 309 11585 178 --
NM_004622chr242159 2068 700 111 1184 ----
NM_004631chr121247 530 ------
NM_004637chr321101 1043 ------
NM_004655chr171422 --11302 --
NM_004660chrY42318 623 245 214 ------
NM_004663chr1521544 150 11272 ----
NM_004664chr12------1206
NM_004673chr131578 1130 360 1102 ----
NM_004684chr4147 1271 ----
NM_004685chr1352874 2554 900 859 510 ------
NM_004687chr1751843 684 646 477 184 12121 ----
NM_004690chr62684 114 ------
NM_004693chr12123 ------
NM_004697chr921043 86 1389 ----
NM_004703chr1732425 1889 394 --12493 --
NM_004705chr111307 ------
NM_004707chr53402 127 61 11108 ----
NM_004710chr174864 628 386 47 ------
NM_004713chr14--2545 254 ----
NM_004717chr71391 2573 439 ----
NM_004719chr1282443 2420 2211 1920 1114 884 254 148 11890 ----
NM_004723chr11881 ------
NM_004725chr1011247 ------
NM_004726chrX54893 1861 1520 814 542 24817 654 24914 4312 --
NM_004730chr521498 1470 22133 2124 11747 --
NM_004734chr1331200 926 269 ----22206 995
NM_004736chr11844 145 ----
NM_004737chr2241272 395 324 186 ------
NM_004741chr1011560 1136 ----
NM_004742chr31441 31812 702 114 ----
NM_004744chr453766 3667 2435 859 384 --1672 --
NM_004745chr876655 5454 4944 2633 2111 1969 247 46964 4715 1596 1576 1932 15042
NM_004748chr1531350 987 76 11249 ----
NM_004759chr172172 1569 1420 618 571 361 293 1675 ----
NM_004760chr721626 545 41557 755 256 35 --12184
NM_004770chr8----1248 --
NM_004772chr541537 629 600 130 1450 ----
NM_004774chr1742969 2536 2436 639 ------
NM_004775chr183618 571 186 ------
NM_004776chr2033073 2271 897 --22581 26 --
NM_004779chr53907 891 195 ------
NM_004788chr1132600 2276 2182 42542 2465 1989 739 ----
NM_004796chr1442301 1979 1640 283 1723 1917 --
NM_004798chr2053582 3325 3102 922 796 2866 363 --1884
NM_004805chr221439 242 ------
NM_004808chr1083179 3020 2838 2824 2106 1213 827 641 ------
NM_004817chr92500 183 ------
NM_004821chr52747 87 ------
NM_004834chr22739 248 --12716 --
NM_004836chr22386 257 ------
NM_004839chr152474 64 ------
NM_004840chrX32473 754 715 22309 367 ----
NM_004841chr131084 204 64 ------
NM_004844chr31117 ------
NM_004849chr631713 1320 188 ------
NM_004850chr211623 ------
NM_004857chr1453981 3457 748 382 170 23238 1807 ----
NM_004859chr1742844 2736 2081 54 12887 ----
NM_004863chr14114771 3965 3957 3938 1629 1319 1032 946 724 655 276 14085 13248 --
NM_004866chr554671 4209 1795 1715 168 165 ----
NM_004867chrX3525 123 110 2702 677 ----
NM_004869chr1831322 1312 457 ------
NM_004871chr1793839 1723 1311 1260 960 923 884 804 764 24105 370 ----
NM_004879chr112346 116 --1102 --
NM_004888chr92405 72 ------
NM_004893chr51374 ------
NM_004896chr1011344 1405 --11392
NM_004897chr101911 ------
NM_004898chr452010 1959 924 538 124 22417 2084 ----
NM_004904chr7106166 5811 5235 4794 4535 4440 4269 2584 2382 1736 24820 4765 11082 --
NM_004915chr212205 162 ------
NM_004921chr131706 528 49 ------
NM_004922chr102988 214 ------
NM_004926chr141452 11371 ----
NM_004929chr821043 511 ------
NM_004932chr541614 1513 534 391 21694 1121 198 --
NM_004946chr5--1426 ----
NM_004947chr3----1144 --
NM_004948chr1811306 ------
NM_004952chr13958 231 154 2638 630 ----
NM_004956chr754141 3128 3104 955 588 1463 ----
NM_004969chr101446 ------
NM_004973chr61104 ----11668
NM_004974chr1------185
NM_004976chr1163303 1628 1580 1103 1069 637 --35168 1409 283 --
NM_004979chrX31083 459 360 ------
NM_004985chr1221529 1405 23160 2967 13513 12764
NM_004990chr12168 ------
NM_004991chr3151 ------
NM_004992chrX117778 7079 6997 5383 3064 1803 1569 1362 1025 649 80 17245 37616 2533 1434 --
NM_004992chrX117778 7079 6997 5383 3064 1803 1569 1362 1025 649 80 17245 37616 2533 1434 --
NM_004999chr673942 3666 3639 3432 2789 1102 575 ------
NM_005010chr711739 21891 285 1677 --
NM_005011chr7------11677
NM_005016chr12--1123 ----
NM_005022chr171242 ------
NM_005028chr1031691 598 194 1779 11953 22206 166
NM_005030chr161278 ----1192
NM_005033chr41143 ------
NM_005045chr72934 677 ------
NM_005054chr21407 ------
NM_005056chr1265610 5158 1560 1425 527 421 ------
NM_005060chr12999 529 ----1515
NM_005066chr11719 ------
NM_005073chr132787 54 ------
NM_005077chr91505 ------
NM_005079chr852101 1051 473 174 90 1760 --2314 116
NM_005087chr31653 198 1590 --
NM_005093chr2054292 3947 3431 3287 1445 34102 3496 204 25353 4208 --
NM_005095chr121585 326 ------
NM_005097chr10--139 ----
NM_005105chr142026 2007 256 199 1161 ----
NM_005109chr331899 421 122 1932 ----
NM_005110chr53804 797 146 ------
NM_005112chr43998 183 77 1151 ----
NM_005114chr41172 1238 ----
NM_005117chr112713 109 174 ----
NM_005119chr12346 243 1868 ----
NM_005121chr1741303 1130 537 185 1822 ----
NM_005126chr31481 22153 1891 11639 --
NM_005135chr1583847 3345 3303 2702 2589 1121 1060 577 33876 3440 825 ----
NM_005139chr4----1284 --
NM_005151chr1841775 1522 706 75 ------
NM_005156chr954787 4774 4672 3847 3441 21309 218 ----
NM_005159chr1542064 1966 880 152 1896 ----
NM_005160chr22106602 5906 5557 4385 2447 2094 2033 1985 1855 1573 24707 1299 14647 --
NM_005164chr1222281 1023 21918 1667 ----
NM_005168chr231465 1109 611 21496 406 ----
NM_005171chr122816 510 ------
NM_005175chr17----178 --
NM_005180chr1011221 21261 302 ----
NM_005181chr81693 ------
NM_005187chr1681942 1489 1311 808 711 390 375 289 --1326 --
NM_005188chr11118183 7819 7265 7132 6993 6792 5321 3057 2662 1788 1004 37737 3286 1922 --15763
NM_005191chr331231 197 114 11436 ----
NM_005197chr1465380 5047 4144 1862 1646 758 11622 ----
NM_005206chr1721297 896 21100 933 11030 --
NM_005207chr2243420 1464 885 466 13171 33402 2836 2831 --
NM_005221chr7154 ------
NM_005222chr72848 224 ------
NM_005233chr31977 12211 ----
NM_005235chr2136978 6293 6175 6134 5918 5519 4750 2888 2696 1756 705 666 85 67435 5858 5045 2830 872 227 ----
NM_005238chr1142840 868 626 269 ------
NM_005239chr2122033 204 ------
NM_005244chr202475 460 ------
NM_005252chr141700 ------
NM_005254chr1561257 1234 1078 476 167 143 ------
NM_005257chr1831258 975 887 ------
NM_005259chr221333 331 ------
NM_005264chr102805 769 1817 ----
NM_005274chr11129 ------
NM_005277chr4123 1207 ----
NM_005278chrX3465 117 33 ------
NM_005281chr14946 756 332 121 --1212 --
NM_005284chr6--1180 ----
NM_005311chr762609 2481 2377 950 713 552 1211 ----
NM_005324chr1741723 1303 767 702 ------
NM_005327chr42705 21 ----1244
NM_005328chr83707 557 304 ------
NM_005329chr1672183 1686 898 797 569 427 172 12279 12041 --
NM_005339chr474078 3569 2759 1303 1159 996 161 13337 ----
NM_005342chrX42172 2052 866 149 1535 ----
NM_005349chr42512 404 ------
NM_005358chr1351858 1659 585 510 417 --1576 --
NM_005359chr18145298 5191 5151 4228 2497 2392 2162 1712 1456 1422 1396 885 502 101 1354 ----
NM_005374chr17----42249 1823 1751 874 --
NM_005375chr61931 1843 ----
NM_005376chr111200 11126 1343 --
NM_005381chr21412 ------
NM_005384chr92247 184 ------
NM_005385chr382444 1998 1938 738 518 459 309 82 ----12522
NM_005386chr201683 1857 ----
NM_005387chr112602 263 1207 ----
NM_005388chr93537 451 338 11074 ----
NM_005392chr911673 21278 324 1331 --
NM_005397chr763285 3010 2892 2539 2530 595 13591 ----
NM_005398chr1031413 521 388 11371 ----
NM_005399chr1104183 3744 3481 3390 3295 3095 2839 2814 1156 173 23377 489 1143 --
NM_005400chr252952 2835 2294 2172 571 --2899 380 --
NM_005402chr72534 390 ------
NM_005406chr18------1619
NM_005410chr52269 260 1678 ----
NM_005424chr12376 48 --129 --
NM_005426chr1--1283 ----
NM_005433chr1842233 2152 1948 94 2100 66 ----
NM_005437chr1031365 1062 472 ----1598
NM_005440chr1753272 3138 2261 1050 562 ------
NM_005443chr42555 540 1443 ----
NM_005455chr121186 37 11640 1670 --
NM_005458chr932371 992 85 1423 --1749
NM_005460chr51522 ------
NM_005475chr12133066 2857 2703 2641 2465 2334 1262 1160 862 530 516 505 379 12277 --1914
NM_005476chr941217 1055 520 308 1944 ----
NM_005479chr1021214 1057 --2411 72 11033
NM_005483chr191130 ------
NM_005493chr6--1862 167 1126
NM_005494chr72615 148 ------
NM_005497chr17126043 5871 5580 5240 4693 4336 1694 1575 928 463 453 92 35440 4031 230 ----
NM_005502chr943087 2943 1066 268 22637 2464 1567 --
NM_005503chr1521087 467 ------
NM_005504chr1266438 5560 4378 4134 4026 1323 46515 5194 5056 1160 ----
NM_005506chr462927 2672 2403 2061 209 190 1330 ----
NM_005509chr521733 79 1312 ----
NM_005522chr721054 993 ------
NM_005542chr711867 ------
NM_005544chr21204 ------
NM_005552chr141537 ------
NM_005563chr14785 580 301 251 --1806 --
NM_005573chr52665 47 ------
NM_005575chr54757 310 259 126 1853 160 --
NM_005576chr151300 1201 ----
NM_005578chr364513 4042 3929 3891 1273 494 44085 3540 3349 3204 ----
NM_005582chr5152 ------
NM_005584chr132648 319 ------
NM_005586chr62634 237 ------
NM_005587chr151948 1124 ----
NM_005596chr964581 1597 1408 1174 793 395 35764 4680 816 24882 776 --
NM_005598chr151707 1320 1049 401 344 --1284 11196
NM_005602chr331161 102 93 --11227 --
NM_005604chr652410 1864 1592 854 636 ------
NM_005607chr81321 ------
NM_005610chr1--2945 106 ----
NM_005613chr151373 147 94 47 41 ------
NM_005627chr61300 ------
NM_005639chr1251832 1556 1450 1311 375 ------
NM_005644chr1------1100
NM_005647chrX73305 2750 2522 2327 2136 924 312 --33482 693 71 11225
NM_005655chr82947 321 ------
NM_005659chr222455 438 ------
NM_005664chr151273 1925 ----
NM_005665chr194699 4296 3374 1611 1448 1347 1194 249 187 13052 14658 --
NM_005667chr2--1288 ----
NM_005668chr554188 1424 987 689 174 43832 3583 3311 1151 --11740
NM_005669chr532291 712 323 1871 1384 --
NM_005686chr121497 495 11258 ----
NM_005697chr151190 ------
NM_005707chr153999 390 151 ------
NM_005715chr652250 1030 1018 672 27 11729 ----
NM_005721chr2------1329
NM_005722chr25689 495 306 299 104 12288 1700 --
NM_005724chr153610 238 189 ------
NM_005725chr151829 1815 1691 798 240 ------
NM_005730chr1251324 1111 982 140 61 12851 ----
NM_005734chr112511 140 ------
NM_005737chr232865 2424 603 21857 160 ----
NM_005738chr7------21272 718
NM_005739chr152583 98 2787 85 ----
NM_005744chr15137 ------
NM_005746chr732302 775 345 1632 12783 --
NM_005748chr1242777 858 710 319 23047 209 ----
NM_005751chr71391 ------
NM_005754chr51392 ------
NM_005759chr224015 965 11879 11458 --
NM_005760chr2133 ------
NM_005765chrX2818 77 198 ----
NM_005766chr1321288 509 ------
NM_005768chr122672 135 ------
NM_005776chr142757 619 ------
NM_005778chr3--1485 ----
NM_005779chr543451 944 394 93 11014 1979 --
NM_005780chr13199 ------
NM_005783chr23634 228 149 ------
NM_005786chr1811212 ------
NM_005795chr252849 1998 826 584 385 --1171 --
NM_005796chr161293 ------
NM_005808chr363225 2873 2764 2401 607 292 23393 442 ----
NM_005822chr642086 1910 636 217 1454 ----
NM_005826chr1147 ------
NM_005828chr17124678 4663 4637 3972 3875 3292 1930 1791 695 341 140 53 14756 31729 1514 1294 --
NM_005832chr31150 11037 ----
NM_005839chr12779 83 ------
NM_005840chrX177656 6982 6867 6242 5985 5866 5527 4727 4663 3010 2992 2450 1508 1035 665 623 355 42921 2372 1835 214 42826 2396 2176 1362 16172
NM_005852chr174844 817 749 369 1142 ----
NM_005859chr521428 1370 ------
NM_005862chr32824 34 ------
NM_005871chr10--130 --140
NM_005877chr2232113 883 749 --32529 2316 2159 12015
NM_005880chr1611508 ----1185
NM_005885chr5--136 ----
NM_005895chr1273738 3228 2926 2891 2683 1371 307 13581 22622 425 --
NM_005898chr1122386 2302 32747 286 200 ----
NM_005900chr421195 990 ------
NM_005901chr18138445 8382 8022 7541 6465 6441 6213 6201 6142 3142 2445 2100 1403 42615 2116 1620 1266 15466 12150
NM_005903chr555232 4189 1887 1569 820 21410 120 ----
NM_005906chr641251 1233 539 91 --1490 --
NM_005909chr532640 1188 249 23909 3194 --13565
NM_005910chr1753061 2510 912 349 91 1740 12803 --
NM_005911chr2162 --21503 463 --
NM_005920chr123498 2842 23803 3388 ----
NM_005923chr63658 550 431 ------
NM_005933chr1172716 2399 2197 2079 2073 1956 1204 11848 12217 --
NM_005938chrX2104 67 ------
NM_005941chr832989 454 245 23329 260 12681 12573
NM_005955chr164857 4348 1470 1166 1046 731 ----1670
NM_005962chr1031525 760 397 ----1579
NM_005962chr1031525 760 397 ----1579
NM_005964chr1721525 1340 21300 1180 --1373
NM_005966chr21955 11605 ----
NM_005994chr171624 ------
NM_006005chr41186 1311 ----
NM_006007chr944169 1027 780 431 21569 314 1808 --
NM_006009chr121134 ------
NM_006011chr1554124 3887 3483 1690 1157 43932 3460 2915 1268 --13117
NM_006015chr111139 --1266 --
NM_006016chr621978 682 21540 521 ----
NM_006022chr131945 11032 ----
NM_006024chr72216 112 ------
NM_006029chr142753 21 1513 ----
NM_006037chr263528 3397 3353 897 692 506 ------
NM_006040chr1651323 1109 441 400 362 ------
NM_006047chr2043409 1423 1330 1303 12223 ----
NM_006063chr2157 ------
NM_006080chr762908 2446 2378 1189 881 822 ------
NM_006089chrX31541 1251 531 ------
NM_006091chr15147 1648 11148 --
NM_006094chr842282 1777 826 355 ----11837
NM_006095chr464531 4102 3792 2868 1770 27 53846 1705 1490 1379 1220 ----
NM_006106chr1192509 2450 2313 2161 1318 1236 1128 205 142 ------
NM_006107chr171419 --1424 --
NM_006113chr142029 1551 372 311 ------
NM_006121chr12128 ------
NM_006122chr1532157 806 417 --2260 127 11104
NM_006134chr2131598 1438 1194 1119 ----
NM_006135chr121481 183 ------
NM_006136chr71185 --11054 --
NM_006139chr221954 63 12632 --12893
NM_006141chr1632724 2586 860 ------
NM_006143chr12146 ------
NM_006145chr192437 67 1726 ----
NM_006147chr12411 385 ------
NM_006154chr1552954 2592 901 470 264 1916 ----
NM_006156chr14125 ------
NM_006158chr821820 1250 11466 --11241
NM_006160chr1721470 1392 ------
NM_006161chr52512 114 ------
NM_006183chr12--1109 ----
NM_006191chr122312 302 ------
NM_006194chr1431194 1010 482 2890 321 ----
NM_006195chr9----1103 --
NM_006196chr2--1114 ----
NM_006202chr1941612 1548 430 75 ------
NM_006203chr575357 4117 1973 1964 1285 1201 970 1553 ----
NM_006206chr42825 148 1806 ----
NM_006212chr1105277 4789 4758 2167 1993 1329 907 807 775 109 12015 15252 --
NM_006218chr31217 ------
NM_006224chr1762315 1760 847 726 620 546 1738 ----
NM_006226chr221221 442 ------
NM_006232chr33235 207 26 ------
NM_006237chr132502 70 ------
NM_006241chr352206 856 663 303 206 11959 ----
NM_006243chr14908 869 350 22 ------
NM_006245chr64967 336 302 72 ------
NM_006246chr1411076 194 --11197
NM_006251chr543021 2873 2121 1153 11287 --1871
NM_006252chr196436 6136 6024 5387 4975 2547 1113 811 403 ------
NM_006256chr132150 1853 583 1866 ----
NM_006258chr101292 1185 ----
NM_006264chr43401 122 67 ------
NM_006265chr811172 ----11351
NM_006267chr221647 700 1533 ----
NM_006275chr2042513 571 407 162 ------
NM_006277chr24710 547 240 133 ------
NM_006282chr2064520 2965 1859 1529 822 94 13868 ----
NM_006287chr242094 1726 898 31 1603 ----
NM_006296chr21112 ------
NM_006300chr1941818 810 195 139 ----12454
NM_006306chrX95936 5837 5010 4005 1365 813 636 598 585 ------
NM_006310chr171309 ------
NM_006312chr122964 767 ------
NM_006313chr1231540 659 363 ------
NM_006315chr433752 3431 315 ----11120
NM_006317chr53276 84 72 ------
NM_006321chr32496 184 --2896 81 11901
NM_006323chr41272 1240 ----
NM_006327chr10188 ------
NM_006328chr114550 238 217 122 ------
NM_006330chr821536 1106 11570 ----
NM_006336chr9132 --21481 1088 --
NM_006345chr421095 951 162 ----
NM_006350chr5173 1355 ----
NM_006352chr111955 158 ----
NM_006353chr6241 23 21365 944 ----
NM_006357chr21112 176 ----
NM_006359chrX22475 2078 ------
NM_006361chr1751961 1946 1696 331 93 11703 ----
NM_006364chr142995 230 ----1103
NM_006366chr631275 101 42 ------
NM_006367chr141034 312 113 85 ------
NM_006369chr12335 90 ------
NM_006379chr732042 361 44 11782 186 --
NM_006380chr1784174 3737 3381 2966 2756 765 684 526 1559 14020 --
NM_006386chr2252312 1754 1669 624 450 11834 ----
NM_006389chr1151405 1076 938 526 509 ------
NM_006393chr1041784 1388 554 27 1712 ----
NM_006400chr12181 ------
NM_006407chr32497 157 1562 ----
NM_006408chr71982 1944 ----
NM_006410chr111487 --1401 1149
NM_006420chr2043177 2505 1338 140 ----134
NM_006421chr831064 964 40 1349 ----
NM_006422chr12--190 ----
NM_006427chr141124 ------
NM_006439chr42527 63 1578 ----
NM_006449chr211627 1699 ----
NM_006451chr54810 708 318 230 ------
NM_006457chr463786 2791 1251 639 238 137 12671 ----
NM_006459chr1041914 1685 740 727 ------
NM_006463chr2--1605 ----
NM_006467chr541804 829 472 215 1460 12054 --
NM_006469chr121601 1428 1428 1563 --
NM_006471chr18------183
NM_006482chr12123833 3804 3575 3227 2688 2555 2470 1240 786 224 190 106 12909 ----
NM_006489chr1431843 343 42 1214 ----
NM_006496chr121270 393 --11501 --
NM_006504chr1052992 2938 2852 2568 2273 3552 526 333 ----
NM_006517chrX61869 1818 1475 632 602 287 ------
NM_006520chrX31697 1078 116 ------
NM_006526chr202622 260 ------
NM_006532chr1941834 1692 605 540 --1556 --
NM_006533chr19144 ------
NM_006534chr2042480 1286 533 512 ------
NM_006537chr151216 --1179 --
NM_006538chr254131 3692 3223 3140 2715 ------
NM_006544chr1464259 4025 1648 1551 1396 1209 35788 4284 40 --16040
NM_006546chr1766199 5393 4667 4241 4112 1880 11520 ----
NM_006547chr71207 ----1269
NM_006549chr1262849 2796 2445 2273 1926 769 ------
NM_006552chr11192 ------
NM_006555chr721970 311 --11384 --
NM_006557chr941206 617 492 24 11729 ----
NM_006559chr1--1164 182 --
NM_006561chr10116227 4982 4946 4844 4805 4561 4045 3964 2326 2140 1444 14534 ----
NM_006565chr161349 ------
NM_006572chr1752780 487 304 293 111 ----12885
NM_006575chr1421350 97 11263 ----
NM_006595chr1131854 110 52 11470 ----
NM_006599chr16117467 7457 7377 7173 6775 6642 6020 5639 2830 887 681 27329 6155 25707 2116 21250 1200
NM_006602chr202563 284 --2700 82 --
NM_006609chr262848 2591 2315 2245 344 28 ------
NM_006614chr3----23689 2549 --
NM_006618chr131304 1007 632 ------
NM_006620chr673253 1512 1449 1020 758 692 321 31677 1547 169 24841 1275 --
NM_006621chr171875 1430 1388 1373 1275 654 270 ------
NM_006624chr1022102 2070 ------
NM_006626chr94966 796 756 750 --1774 --
NM_006628chr15124015 3858 3517 3031 1705 1350 1336 1157 536 480 372 273 21439 1142 ----
NM_006629chr182668 357 ------
NM_006636chr2192 2714 166 ----
NM_006644chr131660 165 ----
NM_006646chr1322732 1120 4596 370 325 61 1573 --
NM_006650chr552862 2630 508 448 114 --13815 13677
NM_006654chr1294730 4161 4137 3604 3489 3087 1784 1262 731 24454 3527 11287 --
NM_006660chr151266 2342 68 ----
NM_006662chr16--1328 ----
NM_006670chr6157 135 ----
NM_006675chr1253386 2399 2390 1001 527 12724 ----
NM_006682chr772709 2199 2081 1878 1036 1013 441 1647 ----
NM_006690chr2052043 941 734 76 21 --1856 --
NM_006698chr2031485 969 450 ------
NM_006699chr142498 1952 994 99 12730 22181 1715 --
NM_006704chr132131 117 ------
NM_006713chr5136 ------
NM_006716chr721165 935 21375 150 ----
NM_006717chr933377 2548 122 13308 22650 550 --
NM_006720chr10105142 3499 2012 1848 1690 1626 1144 965 619 563 35098 4677 1077 --11454
NM_006722chr331989 658 123 12623 1882 --
NM_006726chr441076 975 69 26 ------
NM_006727chr5143 ------
NM_006729chrX125325 5224 4921 4573 3685 3613 2221 1800 1637 1443 891 303 25426 1840 13416 11249
NM_006734chr62464 254 ------
NM_006738chr1574400 3936 3653 3079 1239 1041 197 --14428 --
NM_006745chr43995 181 164 ------
NM_006746chrX11177 2541 481 ----
NM_006750chr16128124 7959 5848 5458 5061 2922 2358 1694 882 675 583 276 27972 2404 --16189
NM_006751chr21267 ------
NM_006756chr831402 1189 60 ----11078
NM_006759chr2188 ------
NM_006761chr171622 ------
NM_006763chr141770 1590 619 464 1734 11705 --
NM_006765chr8--139 ----
NM_006766chr811809 1309 ----
NM_006769chr11743 ------
NM_006772chr641572 1280 567 308 ------
NM_006775chr622438 225 ------
NM_006777chrX42128 1934 551 374 22032 942 12893 --
NM_006778chr641647 1308 1285 116 ----21726 514
NM_006788chr1832133 578 205 21815 1724 ----
NM_006803chr841719 584 529 320 --31470 833 442 --
NM_006805chr541739 602 251 163 11578 ----
NM_006806chr211310 ------
NM_006807chr1721209 155 1379 167 --
NM_006818chr12340 141 1685 ----
NM_006819chr11--1114 ----
NM_006822chr172237 175 1624 ----
NM_006823chr821284 977 ------
NM_006826chr2--1402 ----
NM_006827chr1433174 3040 473 --11317 --
NM_006832chr144936 806 696 355 ------
NM_006833chr71134 1350 --1330
NM_006837chr82106 23 ------
NM_006839chr22281 124 ------
NM_006850chr15919 829 336 274 241 ------
NM_006851chr1231948 810 160 22454 794 ----
NM_006852chr1732534 2346 263 12806 ----
NM_006856chr12----11146 --
NM_006857chr21356 ------
NM_006874chr441245 938 815 465 ------
NM_006884chr311415 ------
NM_006885chr1653322 2699 2600 1541 657 13117 12733 --
NM_006888chr1443476 2650 638 405 12595 ----
NM_006893chr1148 1107 ----
NM_006897chr12----2410 217 --
NM_006901chr151506 ------
NM_006902chr163298 2106 1045 632 560 221 21279 1233 ----
NM_006908chr731253 1147 197 ------
NM_006910chr162329 159 ------
NM_006912chr152282 2268 2177 1558 906 --22230 231 1344
NM_006914chr9--1335 ----
NM_006915chrX2977 607 1253 ----
NM_006918chr1135271 4783 947 22338 996 34717 4173 1715 --
NM_006920chr221842 1832 1494 ----
NM_006922chr251650 1597 819 592 376 ----1741
NM_006924chr1744060 3687 2850 1222 --13477 --
NM_006925chr141413 ------
NM_006930chr541762 757 540 419 ------
NM_006931chr1252012 1810 1667 1495 1325 --1447 --
NM_006937chr172121 21 ------
NM_006939chr142999 841 2919 274 ----
NM_006940chr124763 574 547 346 ----1338
NM_006951chr10----1637 --
NM_006965chr1811044 ------
NM_006981chr922915 884 ------
NM_006990chr172203 1785 1542 616 554 510 408 11884 12421 --
NM_006991chr33919 255 101 ------
NM_006996chr141456 1180 458 441 2508 41 ----
NM_006997chr101453 ------
NM_006999chr541800 1572 1527 825 2134 38 ----
NM_007005chr941510 1215 1059 52 21464 550 ----
NM_007007chr1234542 4021 3140 14336 1177 --
NM_007008chr21583 ------
NM_007011chr15106829 5495 4543 4359 4222 2734 2429 1954 1874 905 25624 5332 1941 15346
NM_007013chr851029 961 884 293 170 --1361 --
NM_007023chr21798 1101 ----
NM_007026chr171447 ------
NM_007033chr162079 882 870 547 495 156 --12116 --
NM_007036chr51703 1904 132 --
NM_007045chr62392 101 ----1450
NM_007050chr20137640 7606 7415 6620 6351 5891 2591 2493 2281 1315 747 421 92 15248 22498 462 36815 5192 157
NM_007054chr522723 847 21046 89 ----
NM_007064chr321109 391 ------
NM_007067chr1731590 524 441 ------
NM_007073chr654109 3738 2970 1056 97 ------
NM_007074chr161102 ------
NM_007076chr121110 ------
NM_007078chr1073054 2640 1962 858 799 658 545 12217 ----
NM_007084chr1321410 548 ------
NM_007106chr1342434 2118 1716 538 --11992 --
NM_007107chr342316 2284 1804 1608 ------
NM_007114chr343148 2595 1315 1169 12177 ----
NM_007118chr53864 567 204 ------
NM_007124chr631836 1643 1603 1394 1136 --
NM_007125chrY51472 1396 463 292 159 ------
NM_007137chrX54975 4343 3677 3537 2207 ------
NM_007144chr1731044 415 82 ----1353
NM_007145chr1911401 ------
NM_007146chr1742739 2283 888 583 --22613 2118 --
NM_007158chr13460 376 258 ------
NM_007159chr351772 1124 199 142 92 ------
NM_007166chr111375 21531 1282 ----
NM_007170chr11302 ------
NM_007173chr1132366 2266 1802 --2686 170 12163
NM_007174chr1232120 287 70 ------
NM_007184chr31559 ------
NM_007185chr12975 672 --1361 --
NM_007191chr121714 ------
NM_007195chr1843516 3201 2606 1468 12691 ----
NM_007200chr1574400 3936 3653 3079 1239 1041 197 --14428 --
NM_007203chr973797 3105 2790 2715 2470 941 717 21580 660 ----
NM_007212chr122113 680 ------
NM_007214chr63839 462 373 ------
NM_007219chr202970 88 ------
NM_007221chr11394 --1281 --
NM_007222chr831370 675 396 ------
NM_007224chr121655 ------
NM_007231chrX52084 1702 868 306 250 12374 ----
NM_007235chr121544 1477 ----
NM_007236chr1562064 1557 927 792 689 65 1683 1513 --
NM_007249chr13118763 7957 7161 6155 3321 3258 2427 2101 736 269 200 38987 6500 5737 --12040
NM_007271chr641218 537 398 198 ------
NM_007275chr311109 1375 ----
NM_007278chr17--139 ----
NM_007282chr31653 1116 ----
NM_007286chr542095 1930 164 126 --2631 487 --
NM_007287chr333165 2816 2142 --22538 693 11062
NM_007288chr333165 2816 2142 --22538 693 11062
NM_007289chr333165 2816 2142 --22538 693 11062
NM_007325chrX1583 ------
NM_007347chr1532557 2309 688 --12921 --
NM_007350chr1244528 1152 1008 347 --43924 3353 2904 1462 14332
NM_007351chr431061 477 80 21009 96 ----
NM_007358chr131970 1482 543 --12002 11598
NM_007361chr142485 179 2579 503 ----
NM_007363chrX2428 69 ------
NM_007373chr1031415 565 529 --11844 --
NM_007374chr141376 ------
NM_007375chr131983 1738 373 22597 537 ----
NM_012062chr122875 287 ------
NM_012064chr1221000 392 ------
NM_012074chr141113 ------
NM_012081chr553386 3263 3142 963 71 ----23738 3404
NM_012082chr82684 51 --1921 --
NM_012089chr11421 --11398 --
NM_012090chr11336 --11133 --
NM_012095chr1063111 2837 2391 1232 755 171 ------
NM_012096chr352949 2570 1237 902 106 43361 2487 1374 460 --12703
NM_012097chr252142 1826 1417 315 53 ------
NM_012104chr11113206 2477 2427 1531 1320 1312 992 882 481 221 135 33441 1193 904 --12523
NM_012104chr11113206 2477 2427 1531 1320 1312 992 882 481 221 135 33441 1193 904 --12523
NM_012105chr211892 --1263 --
NM_012110chr4------196
NM_012124chr111919 ------
NM_012129chr742433 1971 701 553 --1945 --
NM_012137chr162057 2023 1167 990 941 590 12209 12225 --
NM_012141chr1353905 3127 2755 935 297 --21014 521 --
NM_012153chr1121773 272 22559 585 --12199
NM_012158chr1341627 686 351 85 11493 11718 --
NM_012161chr441135 1080 266 63 1354 ----
NM_012164chr9127360 7000 6344 6308 6217 5498 4823 4582 2766 2677 1364 67 1783 12099 --
NM_012175chr112667 136 188 ----
NM_012189chr182153 58 ------
NM_012193chr1185183 5158 4873 4009 3958 1577 402 68 ----13677
NM_012199chr144123 3306 2976 1751 34236 3052 1485 ----
NM_012207chr101356 ----1311
NM_012210chr951014 535 279 201 122 ------
NM_012214chr265009 4785 2207 1371 748 81 12130 ----
NM_012215chr10--1733 ----
NM_012218chr1951155 852 599 398 25 ------
NM_012223chr221190 381 ------
NM_012224chr41484 ----1459
NM_012234chr363716 3488 2516 1418 1149 964 11073 12960 --
NM_012238chr1021362 618 ------
NM_012243chr1--179 ----
NM_012245chr142414 163 ------
NM_012249chr243228 2824 2432 1345 --11195 --
NM_012250chr111508 ------
NM_012255chr201137 140 ----
NM_012259chr611297 21435 69 ----
NM_012262chr164675 1226 1086 912 422 179 ------
NM_012281chr722081 983 ------
NM_012286chrX1552 1451 ----
NM_012287chr353543 1481 1098 90 83 24096 1036 ----
NM_012288chr6125531 5252 4096 4080 3945 3868 3680 1917 1472 1334 747 316 ------
NM_012290chr221176 366 21230 678 ----
NM_012296chr1173930 2782 2413 347 316 195 104 11070 ----
NM_012297chr432480 855 758 12257 12467 --
NM_012300chr531703 1677 116 ------
NM_012301chr721977 292 22087 1431 ----
NM_012302chr131138 400 87 --1782 --
NM_012304chr542099 1999 654 614 11792 12486 --
NM_012309chr11104588 4107 4072 3982 1680 1638 1179 1111 910 396 13074 13545 24573 952
NM_012311chr104630 590 417 77 ------
NM_012316chr185466 3873 1361 1320 1003 518 412 112 14277 11910 --
NM_012323chr2211139 21334 99 ----
NM_012325chr2021637 1449 ------
NM_012328chr741211 407 385 255 21360 553 ----
NM_012329chr1711405 1535 ----
NM_012333chr11623 ------
NM_012334chr574510 3656 3587 1572 1559 1425 1139 --1225 --
NM_012338chr72367 142 11015 ----
NM_012345chr1351905 1850 1625 707 162 21870 1758 ----
NM_012382chr544053 2746 1486 855 13551 ----
NM_012383chr9----1330 --
NM_012394chr1281 28 ------
NM_012395chr742731 2360 1134 650 2316 179 ----
NM_012402chr1121241 421 ------
NM_012405chr1103778 3380 3023 2727 2669 2530 1305 1166 637 469 1681 ----
NM_012412chr7--1595 1638 --
NM_012416chr931118 1038 852 ------
NM_012417chr171626 ------
NM_012425chr1032301 407 276 ------
NM_012428chr151348 ------
NM_012431chr743509 3132 2626 623 3813 177 150 ----
NM_012434chr651642 1444 1301 212 28 ------
NM_012444chr201330 1202 ----
NM_012446chr51473 ------
NM_012448chr1752475 2152 2146 1678 492 11574 ----
NM_012454chr62570 391 ------
NM_012460chr14151 ------
NM_012461chr141607 1482 --1669
NM_012465chr10113444 3242 2855 2791 2539 2444 2305 1281 1146 1085 481 12861 ----
NM_012479chr742218 2041 1717 668 2972 602 12391 1435
NM_012482chr12717 164 182 1504 --
NM_013229chr121484 ------
NM_013231chr1443999 3383 2797 1449 14375 ----
NM_013233chr231362 1151 203 ------
NM_013236chr2231012 473 61 ------
NM_013238chr1341691 1652 1167 423 21232 720 ----
NM_013246chr111706 1229 ----
NM_013248chr202240 44 ------
NM_013249chr112210 27 ------
NM_013253chr1131184 273 68 ----1301
NM_013254chr121286 197 ----
NM_013255chr7158777 8636 8583 8316 6607 6252 6042 5892 5448 2283 1893 1628 1543 1366 498 11007 28451 2483 1893
NM_013261chr423190 2730 23690 109 ----
NM_013262chr631345 1243 220 ------
NM_013266chr10159 ------
NM_013267chr121420 ------
NM_013269chr1234040 3506 1492 24364 4184 ----
NM_013281chr201603 --2303 77 --
NM_013286chr353702 2888 1524 478 73 23825 3283 33653 3465 2981 --
NM_013309chr1512274 22198 246 ----
NM_013313chr2283315 2729 2699 2246 1367 473 436 240 --1323 --
NM_013316chr72868 694 ------
NM_013346chrX127 ------
NM_013354chr831256 1238 292 1516 ----
NM_013357chr82715 709 ------
NM_013372chr1573374 3167 2158 1131 938 250 212 1983 ----
NM_013374chr362981 2207 1992 1119 85 79 22642 308 --12310
NM_013381chr1222444 201 --12337 12286
NM_013386chr121495 259 ------
NM_013390chr941675 1418 1285 1276 11462 ----
NM_013392chr2--1333 ----
NM_013396chr212972 555 ------
NM_013400chr741004 878 664 438 ------
NM_013410chr131182 426 179 1224 ----
NM_013423chrX31286 518 476 --11081 1270
NM_013427chrX31286 518 476 --11081 1270
NM_013433chr1931664 1356 265 ------
NM_013437chr81166 169 ----
NM_013438chr921698 73 1379 ----
NM_013441chr14435 104 57 43 1217 ----
NM_013444chrX188 ------
NM_013445chr21147 ------
NM_013446chr731290 1138 423 ------
NM_013448chr14------1709
NM_013449chr121394 12724 11982 --
NM_013450chr23846 497 330 ------
NM_013951chr241781 1533 962 536 22309 578 --11975
NM_013952chr241858 1610 1039 613 22386 655 --12052
NM_013953chr241858 1610 1039 613 22386 655 --12052
NM_013958chr83317 167 101 ------
NM_013959chr83317 167 101 ------
NM_013961chr83317 167 101 ------
NM_013962chr83317 167 101 ------
NM_013989chr1454337 4053 3812 3461 1969 11129 1407 --
NM_013992chr241858 1610 1039 613 22386 655 --12052
NM_013995chrX32190 775 252 12259 22466 389 --
NM_013999chr1711281 ----11141
NM_014007chr93904 514 144 ----1926
NM_014011chr232293 1757 697 ----11637
NM_014016chr331091 184 63 ------
NM_014021chr162633 2301 1229 526 415 376 13307 ----
NM_014028chr643271 3254 2903 704 22189 1290 ----
NM_014043chr321260 305 ------
NM_014046chr62554 140 --1584 --
NM_014048chr16134635 4518 4473 4448 4329 4241 3545 1658 1221 1170 972 796 559 1193 ----
NM_014057chr921561 375 ------
NM_014110chr111024 ------
NM_014112chr845422 4657 3571 3465 23517 1554 11610 --
NM_014117chr1652043 2019 665 634 151 ------
NM_014141chr765078 3850 3237 990 347 316 1726 14966 14471
NM_014154chr341498 1359 592 338 ------
NM_014155chr11107576 6869 6692 6211 5636 5033 4652 4595 2229 1223 15097 16962 --
NM_014178chr14--1514 ----
NM_014181chr272582 2505 2483 2294 1821 1174 673 22950 2526 ----
NM_014182chr121631 196 ----
NM_014189chr441376 450 378 74 --146 --
NM_014211chr541473 1425 672 164 1409 11443 --
NM_014214chr181343 --1105 --
NM_014231chr1241940 1897 629 54 2753 744 ----
NM_014240chr363788 3609 3229 3104 1592 556 11438 ----
NM_014243chr422075 562 21823 95 ----
NM_014252chr132165 132 ------
NM_014253chrX42304 950 339 333 ------
NM_014263chr102602 314 ------
NM_014271chrX1616 ------
NM_014278chr41301 ------
NM_014283chr121331 130 ------
NM_014284chr11880 1911 ----
NM_014286chr973510 2876 2748 2416 2320 443 216 22907 265 11223 --
NM_014289chrX1482 11141 ----
NM_014294chr851098 986 539 372 49 21087 492 ----
NM_014309chr2244567 4005 2142 1236 176 23938 3327 --
NM_014331chr476291 6237 6004 1459 1422 540 182 35288 5069 302 --15296
NM_014333chr114967 453 365 185 --12067 --
NM_014337chr2272072 1972 1574 952 760 368 93 21528 637 ----
NM_014361chr112105 34 ------
NM_014363chr1321051 485 ------
NM_014372chr121841 736 11507 1576 --
NM_014374chr741004 878 664 438 ------
NM_014382chr341604 1519 1123 665 ------
NM_014392chr42253 212 ------
NM_014393chr831553 548 307 ------
NM_014399chr73954 652 146 1157 ----
NM_014409chr131092 1074 265 ------
NM_014415chr341408 577 519 164 ------
NM_014423chr5115578 4673 4026 2229 2004 1450 1309 1104 1027 469 437 51514 1384 642 601 515 ----
NM_014426chr201622 1136 ----
NM_014432chr641135 1094 232 141 ------
NM_014447chr431286 521 129 ------
NM_014456chr1041546 1257 614 373 1588 ----
NM_014469chr111332 ------
NM_014480chr19--1544 ----
NM_014488chr111564 ------
NM_014491chr71765 ------
NM_014494chr162495 203 1112 --1630
NM_014506chr921664 626 1640 ----
NM_014521chr221752 28 11799 ----
NM_014547chr151192 ------
NM_014547chr151192 ------
NM_014572chr1331800 1714 459 1345 ----
NM_014577chr221593 1320 ----
NM_014584chr141293 11507 ----
NM_014585chr2199 21213 975 --1985
NM_014587chr1641404 1363 1217 175 ------
NM_014588chr201145 ------
NM_014591chr10145 1904 ----
NM_014606chr41293 21283 405 ----
NM_014607chr23189 87 66 11552 1585 --
NM_014608chr151425 ------
NM_014612chr91965 ------
NM_014615chr1653541 3384 2666 2372 680 23284 2775 ----
NM_014616chr372901 2597 891 879 839 438 86 13432 ----
NM_014618chr92327 160 ------
NM_014621chr2193 ------
NM_014629chr821276 905 21231 1026 ----
NM_014630chr1543142 1180 629 202 12803 43040 487 394 87 --
NM_014635chr221629 371 11139 ----
NM_014636chr953107 2840 592 474 327 34086 3303 1221 --13229
NM_014647chr162658 135 22294 1575 ----
NM_014653chr1261777 1633 1547 515 248 198 ------
NM_014657chr20--1269 ----
NM_014660chr71991 ------
NM_014661chr1023887 350 1999 43333 1314 1309 786 --
NM_014665chr843207 929 600 372 ------
NM_014667chr352342 2288 989 804 724 11536 ----
NM_014670chr231579 270 254 ------
NM_014671chr741578 1441 1219 979 11093 ----
NM_014676chr12368 82 ------
NM_014677chr811025 ------
NM_014683chr1732186 1477 1362 ------
NM_014685chr161225 --1510 --
NM_014686chr1942588 2372 2267 701 12541 12078 --
NM_014701chr1573437 1205 1185 1125 377 328 23 23265 1302 ----
NM_014702chr683432 3297 2440 1341 1292 943 758 36 ------
NM_014705chr721846 1565 11626 ----
NM_014709chr22509 109 ------
NM_014711chr1631870 1724 348 1374 ----
NM_014720chr1011740 --1404 --
NM_014721chr666231 5299 2514 1326 684 272 22314 2087 36996 6754 4623 --
NM_014723chr2073058 2804 2420 2140 2047 2006 1127 ----12883
NM_014726chr1761167 1097 473 425 291 178 11257 ----
NM_014729chr841961 866 577 278 11541 ----
NM_014730chr12155039 4628 4609 4135 4099 3657 3593 3357 1692 1667 1403 1331 976 899 879 --14984 --
NM_014730chr12155039 4628 4609 4135 4099 3657 3593 3357 1692 1667 1403 1331 976 899 879 --14984 --
NM_014733chr512031 11711 --1214
NM_014736chr154845 393 385 282 ------
NM_014739chr674000 2667 2642 1266 1154 822 310 --14087 1378
NM_014746chr224078 1050 1241 23195 2885 --
NM_014747chr1145115 4619 4051 3758 3512 2098 1957 1945 1475 1292 1195 702 443 207 33814 2223 1258 2841 493 15649
NM_014751chr862111 2059 1621 1564 1512 1484 179 ----
NM_014752chr112753 188 11830 ----
NM_014754chr81907 ------
NM_014755chr253691 3462 2933 2759 822 23716 3444 ----
NM_014756chr113195 167 34 ------
NM_014757chr552357 2318 1977 919 257 1956 ----
NM_014758chr1142057 2011 1679 385 ------
NM_014762chr121923 813 ----1924
NM_014764chr12172 11234 ----
NM_014766chr733551 3133 2933 21176 526 ----
NM_014767chr1093168 1474 1408 1029 918 514 456 434 48 ------
NM_014776chr1242485 1154 1126 39 186 --13170
NM_014779chr341024 818 787 196 1143 ----
NM_014783chr1541641 1105 534 257 1702 21539 119 --
NM_014786chr1121069 278 --1129 --
NM_014795chr21310 ------
NM_014802chr121188 ------
NM_014807chr113740 731 675 ------
NM_014810chr142480 2320 1264 781 1641 12556 --
NM_014812chr111837 21451 1434 ----
NM_014813chr1----2386 100 --
NM_014819chr542450 2213 2070 1538 21730 866 ----
NM_014820chr321896 1387 --11358 11818
NM_014822chr41640 ----1525
NM_014824chr11--11983 ----
NM_014826chr184253 4177 3318 2890 2738 897 847 768 11479 ----
NM_014827chr151518 1430 664 606 528 ------
NM_014828chr1442064 1624 995 944 1608 12339 --
NM_014829chr512264 2635 616 ----
NM_014832chr1331764 1683 1511 ------
NM_014838chr2252525 2069 819 508 409 --22404 80 1653
NM_014839chr152284 2067 615 499 55 22163 2041 12337 --
NM_014840chr1283274 2651 2503 2494 1122 779 771 235 ----1858
NM_014841chr61896 ------
NM_014846chr81301 ------
NM_014847chr11553 ------
NM_014857chr1183 ------
NM_014858chr131050 1034 760 --2460 360 --
NM_014860chr232472 859 617 1908 ----
NM_014862chr1594230 4141 3637 3473 3198 2608 1415 1186 432 23315 1071 23397 3292 --
NM_014864chr164371 2884 2714 977 373 332 ------
NM_014868chr121116 1196 1367 --
NM_014871chr123182 44 37 ------
NM_014872chr962332 2319 2212 2097 1978 486 11799 ----
NM_014873chr1104873 4472 4419 4179 3962 1899 1284 916 898 233 24580 617 --14011
NM_014876chr22--21764 67 ----
NM_014877chr1797512 6320 5935 4943 2609 2592 2368 1217 936 17009 36616 2423 1701 --
NM_014884chr19----168 --
NM_014892chr61451 ------
NM_014893chrY42341 1781 244 31 31991 753 449 --11665
NM_014897chr1752046 1979 1170 882 108 ------
NM_014899chr573146 2780 2739 2448 1139 998 270 --31022 707 372 --
NM_014900chr21225 1317 ----
NM_014902chr2051188 531 432 330 179 --11351 --
NM_014903chr1221681 766 1944 ----
NM_014904chr1042798 2625 1216 1148 --1615 --
NM_014906chr1733954 3070 833 13941 --24022 2702
NM_014909chr1433838 759 361 23179 230 22801 748 --
NM_014912chr1073455 3081 2355 1168 1054 730 565 ------
NM_014914chr21410 ------
NM_014917chr11974 ------
NM_014918chr152543 396 --11184 --
NM_014920chr662692 1497 1363 592 585 541 31489 1241 362 172 --
NM_014921chr1972889 2310 1949 660 359 334 63 --1225 --
NM_014923chr132468 27 ------
NM_014924chr1462746 1218 1059 1002 580 232 22601 2177 --13152
NM_014926chr31837 183 1758 --
NM_014934chr1343969 3255 2907 1386 13545 13664 13292
NM_014938chr12102606 2356 2241 2021 1856 883 680 433 255 119 ------
NM_014939chr181417 11228 1405 --
NM_014942chr642630 1011 928 653 1132 --1854
NM_014946chr272620 2112 1117 1111 1094 434 280 ------
NM_014947chr153163 3033 2038 724 105 12997 ----
NM_014950chr1421364 1357 21783 1668 ----
NM_014952chr151491 --1420 11711
NM_014961chr451645 756 750 316 88 21768 341 11745 --
NM_014962chr2062613 2474 2419 1871 1068 131 32673 1966 653 ----
NM_014964chr1731828 1718 550 1147 1586 --
NM_014966chr3159 ------
NM_014969chr1--1981 ----
NM_014978chr1011804 --1252 --
NM_014982chr1485234 5213 4769 4716 4508 3624 1442 308 24991 1864 2914 889 25121 3638
NM_014988chr432719 2702 40 --22402 499 --
NM_014989chr621936 36 21335 360 ----
NM_014990chr142430 44 1422 ----
NM_014991chr411127 12123 21245 1011 --
NM_014992chr142808 705 ------
NM_014994chr1552163 1475 753 455 62 --11500 --
NM_014997chr722584 1140 ------
NM_014999chr1261697 1411 1279 1199 1072 265 1202 ----
NM_015000chr1252992 2684 2497 2398 1988 2573 133 ----
NM_015001chr11208 ----146
NM_015005chr1431763 331 47 ------
NM_015008chr373399 3017 2727 2220 1394 1015 437 191 ----
NM_015009chr31252 ------
NM_015015chr191441 11739 ----
NM_015017chr1297 23 ------
NM_015020chr16103634 3354 3108 2779 2618 2592 792 694 484 357 22851 78 ----
NM_015023chr161859 1395 1258 630 288 48 --1671 --
NM_015024chr821494 1339 --1493 --
NM_015025chr24551 338 154 82 --12020 --
NM_015026chr1264578 4182 4143 941 210 132 13258 24670 586 --
NM_015027chr1641822 1507 614 58 1391 ----
NM_015032chr1332859 324 170 32438 665 429 ----
NM_015035chr20166451 6417 5380 5010 4976 4865 4717 4421 2560 2530 1405 1366 1273 583 251 79 26352 336 1713 --
NM_015039chr1154249 3694 3104 1516 1380 911 452 424 410 385 371 346 332 307 293 --13981 --
NM_015040chr253335 3325 1184 996 778 21026 480 ----
NM_015042chr1594290 4255 4084 3972 3409 1415 1373 1337 335 1568 13827 --
NM_015045chr1021511 304 12015 ----
NM_015051chr912503 13043 ----
NM_015056chr2121854 676 22442 560 1613 --
NM_015064chr1283515 3372 2486 2306 798 538 375 116 31215 565 520 1666 --
NM_015068chr743951 3607 2740 29 13940 12558 --
NM_015071chr5106278 5513 4546 2185 2155 1891 1096 678 461 149 25891 5691 15675 22393 33
NM_015074chr164633 3955 1905 1345 1186 172 11519 ----
NM_015076chr683797 3664 3636 3120 2768 1371 651 539 ------
NM_015077chr1773641 3599 3378 3134 1180 914 523 11046 ----
NM_015082chr512567 ------
NM_015086chr123983 518 106 11135 11192 --
NM_015087chr131921 12340 --12441
NM_015090chr175713 5189 3927 2426 1903 1781 616 12398 14440 --
NM_015091chr141706 ------
NM_015092chr1644084 3292 1625 683 23547 2986 23700 1307 --
NM_015093chr631742 1589 661 --11198 --
NM_015097chr361957 1579 1549 1527 1490 366 11513 ----
NM_015100chr121989 682 21852 653 ----
NM_015107chrX72086 1888 1560 1511 523 265 32 ------
NM_015110chr931759 1567 344 1875 --11786
NM_015111chr564100 3935 2816 965 920 401 --22591 845 --
NM_015115chr432847 2058 625 --1157 --
NM_015129chrX11815 --1443 --
NM_015130chr42908 542 --11082 --
NM_015132chr761885 1799 1728 1585 1491 683 ------
NM_015138chr1521835 245 2393 311 ----
NM_015143chr431302 921 485 11076 ----
NM_015144chr1653189 2795 951 898 530 13819 1117 --
NM_015153chr62544 160 ------
NM_015155chr1042769 828 367 320 23038 916 12472 --
NM_015156chr1443052 1502 395 223 13509 ----
NM_015161chr1641538 1493 355 118 ------
NM_015163chr1431518 1320 806 2145 136 1158 2641 526
NM_015172chr121143 1117 11325 ----
NM_015173chr41248 11788 --1649
NM_015176chr131274 1194 230 1563 ----
NM_015178chr861829 1675 944 729 351 60 21943 547 ----
NM_015180chr141564 ------
NM_015185chrX52798 2751 2392 665 376 11067 11893 12906
NM_015186chr91383 ------
NM_015187chr41274 ------
NM_015191chr1122527 1063 11967 ----
NM_015192chr2032635 1996 351 12584 ----
NM_015194chr172684 399 --1469 11707
NM_015199chr362863 2795 2315 2152 2115 946 12074 ----
NM_015200chr421886 125 21744 391 ----
NM_015205chr1374822 4783 4048 3466 1363 1089 599 --11127 --
NM_015206chr1532779 1317 1003 1123 23370 867 --
NM_015208chr1843915 3654 2568 316 22558 97 ----
NM_015215chr133171 2503 2412 2595 143 ----
NM_015226chr1673372 3013 2260 1245 1130 1109 1012 1667 ----
NM_015233chr1321882 520 12473 --11893
NM_015239chr9--1529 ----
NM_015242chr11125 1460 ----
NM_015247chr1695320 5187 3883 3638 3603 1613 1376 905 262 33653 1298 824 ----
NM_015250chr93746 512 188 11877 ----
NM_015252chr23599 129 123 ------
NM_015263chr15--1240 ----
NM_015264chr2264870 4573 4014 1275 841 524 54699 4205 3594 3502 264 --11607
NM_015265chr272346 2091 1854 1652 308 270 116 1428 ----
NM_015267chr1221994 158 1243 ----
NM_015268chr31639 --1548 --
NM_015269chr1--1473 ----
NM_015271chr484306 4234 3881 3386 1576 1268 560 209 13373 21586 889 --
NM_015272chr1641816 1773 1460 181 11657 ----
NM_015275chr1232080 667 144 2820 797 1177 --
NM_015277chr1821251 534 21810 272 ----
NM_015282chr262804 2405 1000 963 831 323 11931 1872 --
NM_015285chr1832530 1889 64 22297 1826 --1213
NM_015291chr152700 2660 2554 1113 157 23241 2490 ----
NM_015293chr63631 543 120 ------
NM_015296chr131999 1864 ----
NM_015299chr1483319 2835 1251 1178 1123 1081 388 79 12530 1581 11040
NM_015305chr1451842 1629 1249 672 177 ------
NM_015310chr8188112 7809 7774 7584 7402 7231 7183 7086 6468 5845 5147 3299 1988 1840 1540 1289 1215 865 37139 5776 909 16765 26667 1588
NM_015313chr1164403 4182 3795 1372 582 225 ------
NM_015315chr553429 3292 2245 667 478 2342 190 11188 --
NM_015317chr222238 877 12410 12691 12541
NM_015326chr142279 196 106 23 12020 ----
NM_015328chr762943 2689 2678 2290 2255 1192 22952 2433 ----
NM_015330chr2242590 2386 767 761 --22511 1835 --
NM_015332chr783430 2601 1400 1204 627 493 445 338 ------
NM_015336chr1212339 11876 ----
NM_015346chr1441316 454 361 242 --1108 11310
NM_015347chr1262933 2509 1997 818 527 465 --2702 400 --
NM_015349chr632857 2813 2761 --12478 --
NM_015354chr9----1323 --
NM_015355chr1731604 1547 353 --1156 --
NM_015358chr212957 119 ------
NM_015359chr831983 344 103 12845 1993 --
NM_015361chr2----1315 1817
NM_015365chrX32821 1089 643 137 13790 14193
NM_015367chr2231588 1067 437 ----21218 574
NM_015381chr2241903 1632 739 103 1815 ----
NM_015382chr141130 1229 ----
NM_015396chr31495 21121 450 ----
NM_015401chr1231116 897 812 ----1362
NM_015415chr11219 1175 ----
NM_015420chr8--161 ----
NM_015429chr32899 417 ------
NM_015435chr841236 977 369 195 2992 339 ----
NM_015436chr442533 598 452 317 12586 11158 1189
NM_015446chr121620 1186 21633 347 ----
NM_015455chr563718 1478 608 396 267 194 1685 12816 --
NM_015457chr1121046 33 ------
NM_015465chr52631 493 2279 61 ----
NM_015475chr21853 ------
NM_015488chr261365 1184 1156 1128 624 516 11617 21302 1173 --
NM_015497chr1511079 ----11132
NM_015507chrX1169 1304 ----
NM_015508chr321578 609 ------
NM_015509chr1221160 545 --21428 1071 --
NM_015520chr362663 2457 1065 976 741 725 ------
NM_015523chr111292 ------
NM_015525chr631129 1026 130 1859 ----
NM_015535chr264082 3686 3066 2851 468 158 34178 3053 1320 ----
NM_015541chr32966 38 ------
NM_015542chr102390 169 ------
NM_015550chr753565 1116 1005 654 292 23303 167 23292 3011 --
NM_015553chr6105061 4268 4117 4066 3395 3301 1972 902 728 274 --11700 --
NM_015554chr1562927 2398 912 295 57 33 ------
NM_015557chr153623 3037 2375 723 417 11174 ----
NM_015564chr522774 321 1291 ----
NM_015567chr132359 255 11198 ----
NM_015568chr2042691 1665 1623 248 23840 3025 2289 112 23957 3524
NM_015569chr164671 3688 928 787 607 213 11407 ----
NM_015570chr721717 1369 --1457 --
NM_015571chr63768 428 26 ------
NM_015575chr253481 3288 2424 1429 897 1102 1748 --
NM_015576chr332488 623 613 12012 22653 198 21160 79
NM_015577chr551516 1402 1281 1146 321 ------
NM_015578chr1911743 --11735 11484
NM_015601chr101826 ------
NM_015630chr22845 812 ------
NM_015635chr91139 22202 1848 ----
NM_015640chr175350 5209 5056 4256 3998 1171 1032 24333 4325 21449 1116 --
NM_015641chr72293 57 11225 --1359
NM_015642chr3--1315 ----
NM_015660chr71294 ------
NM_015675chr192623 506 ------
NM_015676chr141295 ------
NM_015687chr62546 473 184 ----
NM_015690chr22428 57 1244 ----
NM_015695chr632171 1636 653 --12001 1770
NM_015713chr843399 2530 791 64 126 13129 --
NM_015723chr72528 228 ------
NM_015726chr121713 114 --1211 --
NM_015833chr2141798 1703 1530 237 --1310 --
NM_015840chr172538 2137 1949 1844 948 447 258 ------
NM_015841chr172538 2137 1949 1844 948 447 258 ------
NM_015844chr181968 ------
NM_015846chr181968 ------
NM_015847chr181968 ------
NM_015850chr852061 1614 851 622 476 ------
NM_015852chr723463 1271 53288 1305 1060 774 186 ----
NM_015855chr111615 ------
NM_015874chr42512 404 ------
NM_015878chr831916 1623 1452 11782 ----
NM_015881chr1131184 273 68 ----1301
NM_015886chr874644 4143 4048 2180 1882 1241 738 24312 2087 --13626
NM_015888chr152730 2162 1297 654 535 --1496 --
NM_015898chr191499 12232 12070 --
NM_015902chr81745 ------
NM_015905chr72419 408 ------
NM_015906chr184763 1717 1400 1355 1128 610 492 263 ----22941 1455
NM_015912chr862492 1830 1008 580 381 53 12273 12207 --
NM_015915chr141301 ------
NM_015927chr162356 238 ------
NM_015933chr3162 ------
NM_015939chr201643 ------
NM_015949chr741009 943 705 681 --1872 --
NM_015955chr22187 70 ------
NM_015975chrX11644 31187 1130 313 --1697
NM_015980chr521566 1138 ------
NM_015981chr552461 1213 1040 942 779 ------
NM_015986chr1741447 1387 279 75 ------
NM_015995chr1594912 4593 4584 4507 4299 3775 1863 1751 528 21444 661 ----
NM_015999chr11653 ------
NM_016002chr12645 54 ------
NM_016009chr1104942 4249 3873 3759 3469 1071 963 686 292 256 14844 --11757
NM_016018chr832021 1870 451 1440 22695 2306 --
NM_016021chr683049 2600 2570 1865 973 853 668 398 ------
NM_016023chr871765 886 846 563 515 77 58 ------
NM_016025chr1631721 1477 225 ------
NM_016032chrX----21271 1255 --
NM_016040chr172743 2483 2131 1980 984 491 352 22057 1814 ----
NM_016057chr1251293 957 919 831 386 ------
NM_016072chr1242361 1822 636 183 1111 ----
NM_016073chr15--1730 ----
NM_016076chr163040 2834 2647 2508 2110 262 12264 ----
NM_016078chr1711134 ----1391
NM_016083chr63789 624 100 23493 3116 --11471
NM_016090chr111432 ----1101
NM_016094chr31272 --1581 --
NM_016096chr85723 634 434 350 42 ----11384
NM_016100chr202385 41 --181 --
NM_016107chr531253 448 364 ------
NM_016120chrX11119 ------
NM_016121chr1156 21003 95 ----
NM_016131chr232359 908 783 ------
NM_016132chr1563077 2341 1347 756 512 298 --12249 --
NM_016133chr2--21135 213 ----
NM_016141chr32620 57 2813 193 ----
NM_016169chr1052989 2491 2286 1109 978 --12682 1542
NM_016195chr102823 704 1106 ----
NM_016200chr7--1145 ----
NM_016201chr362152 2086 839 330 211 47 ------
NM_016206chr3168617 8577 8227 7773 7419 7084 6774 6736 6201 3438 3365 2388 2346 1569 1171 567 12866 21236 386 16092
NM_016219chr95591 453 143 124 113 --1363 --
NM_016224chr61231 ------
NM_016227chr121331 130 ------
NM_016231chr1711119 ------
NM_016235chr161586 11270 ----
NM_016248chr1373603 3597 3499 3042 2456 1023 815 ----22477 1162
NM_016257chr173074 2580 2301 1310 450 350 128 1853 ----
NM_016260chr2117261 6548 6086 5220 1978 1751 1556 1113 848 552 270 --1165 --
NM_016261chr172576 123 ------
NM_016271chr1832346 496 205 22158 1483 ----
NM_016272chr2222443 1112 --11762 --
NM_016275chr322034 1078 22540 575 ----
NM_016277chr611388 ----1143
NM_016279chr5--1347 ----
NM_016281chr121349 --11085 --
NM_016287chr12269 166 21583 690 ----
NM_016303chrX188 ------
NM_016308chr131614 729 664 ------
NM_016315chr261764 1738 1185 1178 293 231 ------
NM_016316chr22647 521 ------
NM_016322chr932269 603 466 ------
NM_016329chr34425 391 96 65 ------
NM_016339chr1761774 1487 1352 1152 601 261 ------
NM_016340chr52891 131 ------
NM_016357chr1241185 968 297 204 ------
NM_016374chr121599 475 11369 ----
NM_016374chr121599 475 11369 ----
NM_016376chr1744263 2906 1344 752 1937 2438 58 1638
NM_016396chr1552973 2493 717 652 379 12008 ----
NM_016418chr223647 270 59 ------
NM_016424chr1761924 1384 769 730 524 428 1803 11929 --
NM_016436chr2032262 790 757 1912 ----
NM_016441chr251941 911 417 147 55 ----12346
NM_016451chr11------130
NM_016470chr20127 ------
NM_016485chr651951 1475 785 766 61 1288 1652 --
NM_016492chr171144 ------
NM_016499chr111520 1213 ----
NM_016505chr11689 --2653 533 --
NM_016506chr112681 221 --1451 --
NM_016507chr173921 741 234 12222 ----
NM_016513chr662692 1497 1363 592 585 541 31489 1241 362 172 --
NM_016516chr22605 326 ------
NM_016522chr1131401 1062 337 --11299 --
NM_016525chr93813 679 651 ------
NM_016530chr1553763 2887 1428 670 369 13294 ----
NM_016531chr433637 1195 416 13304 ----
NM_016542chrX1536 21654 326 ----
NM_016545chr13920 720 342 ------
NM_016559chr321433 988 ------
NM_016582chr11135 ------
NM_016588chr62680 240 ------
NM_016596chr1231116 897 812 ----1362
NM_016603chr532264 2067 1526 ------
NM_016604chr51148 1451 ----
NM_016605chr541949 944 914 600 1638 --12229
NM_016607chrX11311 ------
NM_016613chr472783 2761 2063 1746 1724 907 714 31753 480 459 ----
NM_016620chr11354 21260 1023 ----
NM_016621chr1164045 4019 3178 1771 668 285 13387 12985 --
NM_016623chr81260 ------
NM_016626chr1821141 113 2435 34 ----
NM_016644chr5174 ------
NM_016654chr1561257 1234 1078 476 167 143 ------
NM_016818chr212205 162 ------
NM_016824chr1041812 1630 1507 454 --1232 11655
NM_016834chr1753061 2510 912 349 91 1740 12803 --
NM_016835chr1753061 2510 912 349 91 1740 12803 --
NM_016836chr22170 86 ------
NM_016839chr22170 86 ------
NM_016841chr1753061 2510 912 349 91 1740 12803 --
NM_016929chr62376 347 ------
NM_016936chr1671949 1765 1539 312 260 229 214 ------
NM_016948chr16--1121 ----
NM_016950chr421464 434 131 ----
NM_017409chr122541 526 ------
NM_017412chr8--1928 ----
NM_017413chrX32242 1683 567 ------
NM_017415chr5104556 4438 4347 3980 3881 3704 3693 393 340 201 1274 ----
NM_017420chr1483668 3283 3049 2933 1310 1096 1059 651 23629 287 ----
NM_017423chr432012 1931 279 12083 ----
NM_017426chr41521 ------
NM_017440chr121103 ------
NM_017443chr931079 961 494 ------
NM_017447chr2144173 3213 1696 1278 24236 1073 14375 11096
NM_017449chr131748 1321 49 --178 --
NM_017451chr1711056 11111 1383 --
NM_017455chr151348 ------
NM_017491chr43998 183 77 1151 ----
NM_017519chr61118 1508 ----
NM_017520chr131599 ------
NM_017522chr121247 530 ------
NM_017534chr17188 ------
NM_017548chr3181 21523 249 2437 167 --
NM_017551chr1052496 2146 659 366 253 ------
NM_017563chr365807 2182 1556 1479 212 163 25212 1078 --1358
NM_017569chr131106 ------
NM_017577chr321601 433 1322 ----
NM_017582chr151600 1593 1552 1312 1133 --1126 --
NM_017590chr2252695 2097 1015 471 302 ----11887
NM_017596chr184672 4591 3956 3268 3096 2919 671 446 11406 1885 --
NM_017610chr1532024 780 320 --1124 --
NM_017613chr211341 ------
NM_017629chr131552 1406 109 31612 584 290 ----
NM_017633chr633589 2574 1433 13738 13705 --
NM_017634chr831564 1302 487 31519 1351 1245 ----
NM_017637chr988400 7993 6890 6018 5782 2466 2255 132 --48353 7786 2314 656 1762
NM_017641chr121233 ------
NM_017643chr1772581 2198 2052 1255 854 841 87 22284 1239 1974 --
NM_017644chr354949 3697 3417 1500 1151 32025 1973 63 --14995
NM_017646chr12451 270 3528 168 108 ----
NM_017650chr764986 4490 1891 1492 1000 115 --1561 --
NM_017657chr22727 77 ------
NM_017658chr1464210 2920 1836 1643 1330 397 34163 3817 1585 23929 1343 --
NM_017661chr1531268 483 129 ------
NM_017664chr1331056 1031 821 2946 204 ----
NM_017666chrX41897 1684 412 259 1903 ----
NM_017672chr1521120 527 ------
NM_017680chr9172 1873 --1983
NM_017684chr1561800 714 485 434 209 67 --21514 508 --
NM_017686chr1----1976 --
NM_017693chr1321662 654 ------
NM_017709chr1124152 3551 3003 2925 2731 1635 1537 1412 1192 1164 310 113 13280 ----
NM_017714chr201330 1316 ----
NM_017715chr7177 --1567 --
NM_017719chr362200 1632 806 763 617 402 ------
NM_017721chr191328 ------
NM_017728chr1752306 1144 877 254 119 21125 690 ----
NM_017730chr32571 214 ------
NM_017736chr1611113 12120 145 12468
NM_017737chr141550 1467 700 358 ------
NM_017742chr1811628 ----1522
NM_017744chr132389 955 575 ----11499
NM_017745chrX1218 ------
NM_017747chr51105 --1369 --
NM_017752chrX11732 1596 12144 --
NM_017753chr91196 ------
NM_017758chr171398 --1482 11529
NM_017768chr11264 ------
NM_017770chr632167 1165 420 ------
NM_017778chr821166 171 11522 11231 --
NM_017784chr32798 168 21020 937 ----
NM_017786chr82478 91 ------
NM_017787chr1082892 2210 2018 1939 964 956 657 387 ------
NM_017798chr202817 27 ------
NM_017805chr19150 ------
NM_017811chr952803 2614 2446 675 227 1298 12208 --
NM_017812chr72729 629 1709 ----
NM_017813chr855800 4500 2023 1527 1470 24225 406 15023 --
NM_017824chr1022474 1791 ------
NM_017831chr1864219 4078 3079 653 452 161 ------
NM_017845chr42680 319 ------
NM_017848chrX74259 4249 3911 3639 3573 473 350 13078 ----
NM_017866chr82719 311 ------
NM_017902chr10145732 5221 4661 4428 3891 3822 1885 1663 1552 1317 832 734 552 233 15248 13770 --
NM_017919chr9125190 5172 4589 3943 2044 1843 1689 1682 1468 1314 786 619 ------
NM_017926chr142875 237 --2666 242 --
NM_017933chr21244 1330 --21575 541
NM_017938chrX42073 2056 1742 1639 11859 21972 748 --
NM_017944chr1132279 2084 1933 11224 ----
NM_017946chr741304 475 466 365 --1532 --
NM_017953chr121141 784 157 ----
NM_017954chr741682 1573 1516 1174 --1273 --
NM_017957chr1731563 1083 135 1336 --11318
NM_017958chr252102 1154 1095 860 720 ------
NM_017964chr21203 --1380 --
NM_017969chr2129 1211 ----
NM_017972chr142875 237 --2666 242 --
NM_017988chr121956 ------
NM_017994chr742032 1202 863 83 --1773 13009
NM_018003chr1531647 487 123 1682 ----
NM_018011chr131128 ----1147
NM_018014chr21417 --11068 --
NM_018015chrX31023 114 47 1849 ----
NM_018017chr1042336 2279 902 63 22431 1113 ----
NM_018018chr123749 694 225 --1279 --
NM_018024chr82585 392 ------
NM_018027chr1052963 2112 688 370 42 13279 --12388
NM_018028chr192200 125 ------
NM_018030chr1831119 329 83 ------
NM_018043chr11--11051 ----
NM_018048chr1241392 1257 679 242 --11835 --
NM_018061chr11663 ------
NM_018063chr101344 ------
NM_018070chr11437 ------
NM_018072chr1127 1143 ----
NM_018076chr10--136 ----
NM_018084chr232419 1308 809 ------
NM_018085chr1147915 7907 7251 6967 6374 6212 6038 2926 2380 1706 1284 483 286 258 2902 559 ----
NM_018086chr251670 1405 1398 423 368 ------
NM_018092chr1641385 353 224 198 1394 ----
NM_018095chr112681 221 --1451 --
NM_018096chr177997 870 740 388 348 324 46 --1299 --
NM_018107chr143823 803 195 ------
NM_018112chr91383 --1211 --
NM_018117chr103714 263 129 ------
NM_018120chr821218 982 1609 --1304
NM_018121chr1032528 1986 1232 ------
NM_018126chr42423 320 ------
NM_018128chr1721497 433 ------
NM_018133chr31699 ------
NM_018145chr151496 ------
NM_018149chr171220 ------
NM_018155chr352150 1389 1042 869 261 --12824 --
NM_018157chr1252766 2545 960 850 34 22242 2041 1952 --
NM_018159chrX21291 175 11691 ----
NM_018167chr141370 ------
NM_018171chr12----1734 --
NM_018173chr12188 1341 ----
NM_018179chr121237 ------
NM_018181chr1831738 1230 774 --11949 --
NM_018182chr1742075 1897 461 400 1913 ----
NM_018184chr342007 1331 671 256 11909 ----
NM_018191chr1331956 1676 35 --171 11591
NM_018195chr1121368 1345 12064 11758 --
NM_018199chr14----11191 --
NM_018200chr1512634 ------
NM_018202chr12767 750 1217 ----
NM_018208chr141137 1106 473 216 --2924 794 --
NM_018211chr12602 49 139 --1507
NM_018214chr621013 40 ------
NM_018221chr2--1329 ----
NM_018223chr121134 --1159 --
NM_018224chr7153 ------
NM_018227chr421251 560 --22903 2023 --
NM_018243chr453374 2976 1371 204 62 42687 1445 1401 806 --12888
NM_018244chr2031344 1188 482 11095 ----
NM_018247chr622124 1118 ------
NM_018254chr112285 31864 966 954 ----
NM_018265chr181801 1633 1540 530 368 362 355 282 11979 ----
NM_018270chr202744 249 ------
NM_018286chr172873 47 ------
NM_018293chr332566 2296 2067 2806 421 ----
NM_018299chr833496 1068 781 12238 --12503
NM_018307chr173854 294 62 ------
NM_018312chr1152106 1772 511 238 59 1109 ----
NM_018332chr1621083 934 --11333 --
NM_018340chr1694794 4766 4542 3958 3502 3190 1963 1644 710 31455 1080 248 13791 --
NM_018348chr161983 --171 --
NM_018354chr20129 ------
NM_018360chrX1103 ------
NM_018361chr863291 2702 1392 1016 540 245 1458 ----
NM_018362chr1153955 3783 3195 2515 414 1442 ----
NM_018363chr101326 ------
NM_018364chr143619 1381 771 505 22844 434 ----
NM_018373chr1495499 5448 4824 2485 1835 1672 1604 1194 832 26494 91 14026 --
NM_018374chr741491 1298 1175 763 ------
NM_018375chr1421716 458 1111 1404 --
NM_018383chr251946 1778 1602 1268 653 12079 12023 --
NM_018403chr373950 3849 3222 2862 1407 1026 680 13074 --1471
NM_018419chr20--1343 181 --
NM_018423chr12--3278 173 130 ----
NM_018425chr1072478 2159 1955 985 705 698 122 1976 2655 318 --
NM_018429chr522880 776 ------
NM_018439chr1871983 1946 1856 1808 1783 1732 1056 11914 ----
NM_018440chr888172 7314 6857 6549 6251 5940 737 103 16730 15730 11945
NM_018442chr1180 2345 72 ----
NM_018444chr821782 747 11871 --11972
NM_018445chr151204 ------
NM_018452chr6_random42608 2370 1087 51 ----22710 543
NM_018462chr31321 --1153 136
NM_018465chr91187 ------
NM_018476chrX190 ------
NM_018482chr832572 1815 258 1790 --1269
NM_018509chr1721549 328 21725 677 11464 --
NM_018553chr1731653 1403 183 11256 21816 246 --
NM_018557chr231160 652 488 31756 1696 362 ----
NM_018561chr61220 1629 ----
NM_018566chr174879 2023 1387 800 423 316 54 15047 11026 --
NM_018590chr1021667 65 11490 1269 --
NM_018602chr152655 80 ------
NM_018638chr12155705 5596 5137 3836 3702 3611 2159 1997 1685 1540 1367 1338 847 656 117 ------
NM_018639chr1241206 1150 979 938 ------
NM_018650chr121834 535 1456 ----
NM_018653chr172397 141 ------
NM_018657chr33769 527 178 ------
NM_018667chr1672209 1964 1872 1093 770 580 26 22782 254 1158 --
NM_018684chrX21289 305 1932 ----
NM_018685chr72755 94 ------
NM_018686chr12----1137 --
NM_018695chr542361 2149 2094 796 ------
NM_018698chrX31681 740 180 11498 ----
NM_018703chr162329 159 ------
NM_018710chr8------11166
NM_018712chr1141573 1271 600 63 ------
NM_018718chr792255 2225 2181 1739 1660 1555 1520 548 225 11758 ----
NM_018841chr1123509 3416 2963 2941 2447 1464 1274 1021 864 234 182 146 ------
NM_018846chr71341 ------
NM_018847chr91348 ------
NM_018890chr731253 1147 197 ------
NM_018896chr171285 ------
NM_018898chr541744 1518 633 316 --1183 12092
NM_018899chr541744 1518 633 316 --1183 12092
NM_018900chr541744 1518 633 316 --1183 12092
NM_018901chr541744 1518 633 316 --1183 12092
NM_018902chr541744 1518 633 316 --1183 12092
NM_018903chr541744 1518 633 316 --1183 12092
NM_018904chr541744 1518 633 316 --1183 12092
NM_018905chr541744 1518 633 316 --1183 12092
NM_018906chr541744 1518 633 316 --1183 12092
NM_018907chr541744 1518 633 316 --1183 12092
NM_018908chr541744 1518 633 316 --1183 12092
NM_018909chr541744 1518 633 316 --1183 12092
NM_018910chr541744 1518 633 316 --1183 12092
NM_018911chr541744 1518 633 316 --1183 12092
NM_018947chr744244 3821 3297 1844 23435 677 ----
NM_018951chr711186 --21193 70 --
NM_018952chr173566 518 183 ------
NM_018958chr1554081 3865 3842 2860 2634 ------
NM_018959chr191255 ------
NM_018970chr772218 1139 1036 1008 793 305 47 12021 ----
NM_018976chr1231871 1843 960 22081 2002 ----
NM_018977chrX2881 413 1924 ----
NM_018979chr1252108 2086 774 766 572 ------
NM_018999chr1083574 3460 3260 3201 3166 3070 865 784 11396 --155
NM_019001chr374400 4305 3357 3004 1318 1041 604 14690 14869 --
NM_019004chr732049 306 21 22356 2206 ----
NM_019006chr15--1205 ----
NM_019009chr1152316 2063 1987 1818 1637 12475 1680 --
NM_019022chr1863120 2202 2057 918 769 275 188 ----
NM_019027chr432538 951 842 ------
NM_019030chr5127 ------
NM_019036chr621142 85 ------
NM_019045chrX1217 ------
NM_019048chr2167 --175 --
NM_019049chr11187 ------
NM_019050chr41519 ------
NM_019060chr11315 ------
NM_019063chr221685 780 ------
NM_019074chr151831 1979 ----
NM_019080chr1321509 1092 ----1456
NM_019084chr10----12465 1480
NM_019087chr53589 271 140 ------
NM_019091chr23734 725 424 1100 --1948
NM_019096chr64764 447 86 24 1357 ----
NM_019114chr962410 2141 2055 1007 208 104 ------
NM_019116chr1653636 3100 2763 2294 1344 --33534 3071 2877 --
NM_019117chrX12553 53201 2814 2732 1230 846 ----
NM_019556chrX31244 444 72 ------
NM_019557chr11844 ------
NM_019558chr21341 ------
NM_019590chr1041297 989 570 467 1596 ----
NM_019592chr92133 66 --1636 --
NM_019593chr2073180 2733 2626 2281 2150 2112 760 ------
NM_019595chr24710 547 240 133 ------
NM_019600chr151695 1728 ----
NM_019610chr1----21547 1359 --
NM_019860chr1011107 ------
NM_019885chr232306 1000 847 --12746 1267
NM_019903chr1041812 1630 1507 454 --1232 11655
NM_020039chr1241921 1300 173 167 --21608 1199 --
NM_020066chr12751 371 ------
NM_020116chr431802 1665 261 --11683 --
NM_020122chr255077 4810 4630 4304 225 24571 1677 --1574
NM_020123chr1021249 99 ------
NM_020130chr8--1896 ----
NM_020137chrX1399 1349 ----
NM_020141chr131996 1906 510 ------
NM_020144chr731608 367 128 11637 ----
NM_020147chr1551084 203 134 49 22 1800 ----
NM_020148chr1832206 703 296 ------
NM_020150chr1011442 1820 ----
NM_020156chr71157 ------
NM_020157chr2021037 818 ------
NM_020159chr42333 302 ------
NM_020177chr562379 531 521 438 411 331 ------
NM_020182chr2033461 2761 2317 21126 271 --13045
NM_020186chr71495 ------
NM_020193chr1121002 344 ------
NM_020199chr511163 ------
NM_020205chr133377 2803 2734 1216 11110 --
NM_020227chr52591 292 ------
NM_020228chr112455 65 ------
NM_020235chr32308 57 --133 --
NM_020239chr192067 2043 1774 1649 830 724 574 527 167 --11558 --
NM_020240chr541832 1078 449 82 22043 2025 --1973
NM_020245chr684501 4447 3510 3408 1032 964 955 750 2690 582 34136 3666 300 --
NM_020248chr172274 1853 753 717 706 359 351 ------
NM_020307chr31335 ------
NM_020309chr192697 281 ------
NM_020337chr441992 1942 632 509 1121 --13030
NM_020341chr2051610 1524 1515 634 222 ------
NM_020346chr1121612 1221 11110 11745 --
NM_020357chr311655 ------
NM_020374chr1231911 1618 821 1776 ----
NM_020379chr1--2363 225 ----
NM_020381chr611751 ------
NM_020390chr354582 4553 4034 1001 63 ----2832 396
NM_020403chr132179 66 187 11773 --
NM_020416chr452004 1017 948 736 332 1788 12413 --
NM_020420chrY31537 612 57 ------
NM_020422chr161642 ------
NM_020423chr1----1385 --
NM_020429chr783030 2992 2481 2309 2180 2166 334 199 --12391 11040
NM_020432chr731736 1674 1438 ------
NM_020443chr1106375 6364 5088 2725 2491 2354 2317 1216 775 766 26079 1935 ----
NM_020449chrX2747 139 2656 212 ----
NM_020463chr21153 1600 ----
NM_020465chr162673 600 11377 11448 --
NM_020466chr664248 4071 4055 1797 788 411 24543 3315 --14499
NM_020473chrX2574 45 1126 11890 --
NM_020474chr1811681 2746 111 ----
NM_020475chr852403 2215 1883 702 661 --11651 1562
NM_020476chr852403 2215 1883 702 661 --11651 1562
NM_020477chr852403 2215 1883 702 661 --11651 1562
NM_020480chr852403 2215 1883 702 661 --11651 1562
NM_020482chr62680 238 ------
NM_020526chr141690 1249 644 105 21558 1550 ----
NM_020532chr21583 ------
NM_020640chr32298 213 ------
NM_020644chr111284 ------
NM_020647chr822325 586 160 ----
NM_020651chr221757 94 ------
NM_020676chr31747 ------
NM_020699chr184810 4631 1818 1297 1229 697 267 224 ------
NM_020704chr782054 1739 1715 1601 850 503 299 262 --2684 60 --
NM_020708chr2022472 689 --1391 --
NM_020711chr262511 1970 1019 854 824 196 11709 12503 --
NM_020715chr1441849 1777 1454 150 ------
NM_020717chrX84795 4151 3707 1897 1818 1228 198 119 1723 3787 603 402 --
NM_020718chr1675108 4780 4612 4557 4428 4081 457 12363 14333 14415
NM_020727chr2121533 391 11189 ----
NM_020728chr782719 2514 2454 2105 1276 302 263 48 1373 ----
NM_020732chr61118 1508 ----
NM_020734chr1262448 1018 778 496 460 159 --1836 --
NM_020739chr1531350 987 76 11249 ----
NM_020742chrX52513 743 273 263 31 12479 ----
NM_020747chr53772 252 54 ----1791
NM_020752chr103880 783 427 22934 2060 --12624
NM_020755chr621103 260 ----1266
NM_020760chr22689 143 1578 ----
NM_020764chr1621071 188 ------
NM_020766chrX94584 4485 3686 3445 2968 2908 1162 556 387 --11780 --
NM_020768chr583011 2688 2580 2371 2281 920 353 149 ------
NM_020769chrX3927 745 383 2954 936 ----
NM_020770chr121028 342 --3482 67 62 --
NM_020771chr631330 1308 323 1311 ----
NM_020772chr1797601 5989 5937 5449 5434 5416 2837 2062 343 38593 8423 5257 37791 7267 1564 27436 696
NM_020774chr1855732 4315 2485 921 114 --24178 1976 --
NM_020776chr1833093 1029 730 --11003 --
NM_020778chr1584455 4011 1786 1763 1602 1155 1049 472 1327 --1745
NM_020791chr1721292 1233 11328 --1978
NM_020792chr34998 651 357 106 12439 ----
NM_020794chr121510 542 21441 168 ----
NM_020796chr523053 2049 ------
NM_020800chr321069 583 ------
NM_020801chr572582 2502 1785 1666 784 529 156 ------
NM_020803chr452294 1674 912 468 312 11506 ----
NM_020805chr182659 646 11484 --1258
NM_020808chr13393 293 278 --31084 761 457 --
NM_020819chr631027 168 92 1965 ----
NM_020821chr1561800 714 485 434 209 67 --21514 508 --
NM_020824chr10------1146
NM_020825chr1633737 3234 3061 2688 405 1297 --
NM_020839chr321028 46 11329 ----
NM_020841chr1243434 2966 1304 913 24056 3483 ----
NM_020843chr15--1138 ----
NM_020845chr1242499 1008 786 776 ------
NM_020850chr1651300 1098 853 166 22 11090 --11310
NM_020854chr1811501 11147 ----
NM_020856chr1931572 1340 461 ------
NM_020858chr1562227 2199 2095 970 783 31 12311 ----
NM_020860chr421151 332 ------
NM_020868chr21424 ------
NM_020871chrX32142 2003 507 12435 ----
NM_020872chr31113 31497 622 582 11680 --
NM_020873chr32297 54 ------
NM_020897chr141228 1214 1186 368 11250 ----
NM_020899chr174693 551 330 309 22449 831 --12462
NM_020917chr1953804 3362 3352 769 450 12931 ----
NM_020918chr1053474 2755 2367 536 225 ----1177
NM_020922chrX21484 280 ----11269
NM_020925chr13912 546 502 ------
NM_020927chr1632330 585 274 ------
NM_020929chr11--1107 ----
NM_020935chr274596 3829 3726 3256 1238 93 70 ------
NM_020940chr1062418 1957 861 848 210 196 ------
NM_020948chr163399 2942 2613 1341 947 245 ------
NM_020951chr1921666 539 12041 12247 --
NM_020952chr9196 ------
NM_020961chr41110 ------
NM_020962chr1562190 1867 1544 762 663 488 2824 577 ----
NM_020963chr11225 ------
NM_020964chr18114336 4295 4140 3898 3197 3162 3097 1463 1419 1404 1196 13073 ----
NM_020967chr2051028 301 129 93 64 ------
NM_020987chr1031361 1068 1010 ------
NM_020988chr1611070 ------
NM_021003chr141332 ------
NM_021005chr151464 ------
NM_021007chr21524 1515 ----
NM_021032chr331662 1600 816 11730 ----
NM_021033chr1363383 3194 1278 1062 785 673 ------
NM_021035chr2031320 1007 217 ------
NM_021045chr1062637 2139 2020 2000 1872 1620 32008 596 508 ----
NM_021069chr421973 231 ------
NM_021079chr1763108 2590 2547 2278 2254 2124 12615 1131 --
NM_021083chrX31327 1223 1114 13599 12969 13390
NM_021097chr242820 768 649 338 12544 ----
NM_021105chr32730 102 1704 ----
NM_021116chr7139052 8726 7798 7631 7354 7315 6864 6692 6667 6352 2703 1872 1352 1910 27001 412 16824
NM_021120chrX52933 2774 1086 648 451 --11208 --
NM_021129chr10189 ------
NM_021132chr1011238 ------
NM_021140chrX1307 ------
NM_021155chr1963042 2256 1055 932 652 187 ------
NM_021159chr42114 83 ------
NM_021163chr722882 420 ----12338
NM_021183chrX31564 801 124 183 --12378
NM_021190chr11212 ------
NM_021194chr1136 ------
NM_021202chr2073076 2855 2813 2740 907 500 317 ------
NM_021235chr19--1140 ----
NM_021240chr92209 196 ------
NM_021249chr1451705 1627 1597 1233 654 1282 ----
NM_021252chr1032060 1412 554 11391 ----
NM_021255chr1453603 3410 1630 1515 489 ------
NM_021260chr1421263 445 ------
NM_021574chr2272139 1971 1847 1678 1553 815 336 ------
NM_021614chr52271 86 ------
NM_021619chr9----11163 --
NM_021622chr1052063 1524 862 703 32 ------
NM_021627chr331066 995 420 ------
NM_021629chr375076 5060 4984 4881 3301 1509 79 --14741 --
NM_021635chr631828 1454 534 1729 ----
NM_021639chr13883 337 190 ------
NM_021643chr231599 1354 344 ------
NM_021644chr101356 ----1311
NM_021645chr133500 343 68 ----11703
NM_021647chr484754 4424 3977 3708 3270 1316 908 267 ------
NM_021648chr64695 655 244 130 --12500 --
NM_021705chr63573 498 104 ------
NM_021728chr1431022 892 778 1667 ----
NM_021738chr101666 ----1739
NM_021784chr202586 220 ------
NM_021785chrX2245 136 ------
NM_021813chr655144 5050 4842 2319 1760 25524 4115 ----
NM_021814chr631476 1434 498 11606 ----
NM_021818chr1421040 38 1128 ----
NM_021905chr641565 373 135 35 1316 ----
NM_021911chr545285 4355 4333 3608 11571 ----
NM_021912chr1553990 3845 1681 1156 58 --12667 1859
NM_021913chr19121603 1543 1527 1512 1407 1190 1129 733 725 386 336 304 ------
NM_021914chr1432321 2117 1570 1941 ----
NM_021943chr652110 1898 1835 1710 763 2856 710 ----
NM_021950chr1161630 1555 858 632 569 113 31461 514 93 ----
NM_021951chr91715 --2906 209 --
NM_021961chr11127180 7167 6345 5908 5874 4800 2969 2902 2237 1964 1095 247 1316 22785 1721 --
NM_021963chrX1734 ------
NM_021964chr366502 6145 4448 2486 2361 708 66612 6255 4291 1214 898 422 15882 11654
NM_021988chr2021526 373 ------
NM_021998chrX--1115 ----
NM_021999chr13--160 1120 --
NM_022036chr172397 141 ------
NM_022037chr21346 ------
NM_022048chr1545664 5531 719 207 26006 2518 ----
NM_022072chr31229 ------
NM_022073chr1411160 --11446 --
NM_022079chr101826 ------
NM_022085chr641418 1214 1177 1097 1168 ----
NM_022103chr192810 344 ------
NM_022105chr201190 1597 ----
NM_022114chr143871 3499 1705 1342 13398 1312 --
NM_022118chr132257 38 --1486 1565
NM_022130chr511009 --11143 --
NM_022132chr51131 ------
NM_022133chr831724 1334 726 ------
NM_022140chr562043 1963 1923 1786 1553 815 12371 11496 --
NM_022143chr721476 194 1432 ----
NM_022144chrX1145 1158 ----
NM_022166chr16105626 5619 4964 4886 4115 2347 2298 1748 678 405 ----1512
NM_022167chr173853 587 539 ------
NM_022170chr721501 375 ------
NM_022173chr21346 ------
NM_022336chr252188 2008 1636 482 57 1719 ----
NM_022340chr353576 3107 886 482 325 1290 1473 1549
NM_022343chr92941 470 11137 ----
NM_022346chr421197 52 ------
NM_022351chr842883 1389 1031 580 13163 ----
NM_022374chr22434 26 ------
NM_022442chr2021526 373 ------
NM_022444chr731453 665 74 1676 ----
NM_022456chr12116436 6014 5852 5499 5249 4934 981 911 447 307 128 35864 2433 807 26840 6382 --
NM_022459chr1364658 4159 4051 1977 1510 1452 --14490 --
NM_022462chr19233759 3612 3331 2956 2938 2741 2556 2496 2371 1390 1364 1206 915 821 790 721 636 618 553 315 301 163 117 23778 3523 --11334
NM_022465chr1272879 2462 2307 803 510 436 163 1453 ----
NM_022467chr192385 103 ------
NM_022473chr1583828 3413 2955 2946 1391 1137 568 550 1751 2615 154 --
NM_022476chr162781 144 ------
NM_022482chr2072130 2084 2037 817 392 282 155 21774 119 ----
NM_022483chr551766 1575 695 550 183 --1275 --
NM_022484chr731442 1311 942 --1892 1306
NM_022495chr142391 166 ------
NM_022497chr342760 1416 807 349 33298 1077 137 42884 775 387 206 --
NM_022572chr261365 1184 1156 1128 624 516 11617 21302 1173 --
NM_022574chr71865 1176 ----
NM_022650chr51627 ------
NM_022716chr183142 1950 1262 1202 889 476 404 65 21123 1077 ----
NM_022725chr1162082 1701 1695 765 714 310 --11669 --
NM_022726chr6----1121 --
NM_022730chr22362 82 ------
NM_022737chr191245 ------
NM_022739chr1731174 1081 30 1303 ----
NM_022753chr142317 1910 822 411 1340 ----
NM_022763chr372841 2711 2648 2555 1243 897 780 ------
NM_022768chr1186 ------
NM_022771chr123838 184 99 ----1148
NM_022780chr231574 556 192 ----1598
NM_022781chr932313 1183 101 1949 23259 2688 --
NM_022782chr12------1358
NM_022802chr1011232 ----1336
NM_022810chrX267 42 ------
NM_022821chr1------1155
NM_022824chr52485 393 21275 715 --11549
NM_022825chrX184 ------
NM_022828chr551629 1458 1387 1223 128 1501 --11696
NM_022831chr131495 1342 65 1706 ----
NM_022833chr941496 1478 1001 70 ------
NM_022836chr151248 631 625 568 478 1112 ----
NM_022838chrX1268 ------
NM_022841chr151807 --12600 --
NM_022844chr161639 1154 ----
NM_022845chr1631898 879 807 137 ----
NM_022893chr263107 2838 2781 1111 765 599 1565 ----
NM_022894chr221745 1575 1701 ----
NM_022896chr2021117 1099 ----11657
NM_022897chr53841 748 264 1970 2983 813 --
NM_022898chr1464613 3667 3632 3248 3171 1576 ------
NM_022900chr71256 ------
NM_022902chr51426 ------
NM_022910chr162673 600 11377 11448 --
NM_022912chr231168 1104 108 --12257 --
NM_022918chr1112122 32189 1877 391 ----
NM_022965chr42565 368 ------
NM_022970chr10--11474 ----
NM_022977chrX42257 1064 458 189 ------
NM_023000chr1421475 239 ------
NM_023001chr1421475 239 ------
NM_023039chr51307 ------
NM_023071chr122164 30 11134 ----
NM_023076chr1642422 2259 471 426 --12277 12688
NM_023079chr1751424 1409 1225 1165 574 1252 1632 --
NM_023105chr852061 1614 851 622 476 ------
NM_023106chr852061 1614 851 622 476 ------
NM_023110chr852061 1614 851 622 476 ------
NM_023111chr852061 1614 851 622 476 ------
NM_023925chr12139 ------
NM_023929chr852533 2046 1808 795 514 11731 --12093
NM_023943chr31203 1185 ----
NM_024007chr562871 1942 1200 1065 909 718 ----1338
NM_024016chr172743 92 2788 549 ----
NM_024019chr42810 199 21053 434 ----
NM_024037chr12858 277 ------
NM_024046chr331260 497 294 21035 977 ----
NM_024052chr1732250 2142 474 1289 ----
NM_024060chr112227 69 ------
NM_024076chr19--11562 ----
NM_024085chr21840 1300 ----
NM_024089chr132137 37 ------
NM_024090chr431833 1403 1209 11488 11868 --
NM_024095chr1291570 1347 1188 1075 990 966 949 521 38 ------
NM_024107chr173540 298 42 ------
NM_024122chrX--177 ----
NM_024293chr23533 296 141 ------
NM_024295chr811444 12001 1448 --
NM_024345chr9115343 4844 2350 2079 1852 1654 1535 705 313 225 195 --24069 1196 --
NM_024348chr91261 ------
NM_024411chr201565 ------
NM_024416chr921561 375 ------
NM_024424chr112279 184 ------
NM_024425chr112279 184 ------
NM_024426chr112279 184 ------
NM_024493chr62165 96 ------
NM_024496chr143772 712 665 ------
NM_024501chr22536 528 ------
NM_024511chr483555 3407 3111 3014 2885 2174 1070 398 1869 ----
NM_024513chr343560 2541 2511 869 43203 2895 2461 168 1263 --
NM_024524chr322833 2697 --12189 --
NM_024525chr12149 95 ------
NM_024529chr121065 44 --11170 1361
NM_024539chrX1501 ------
NM_024546chr1331140 1122 86 ------
NM_024551chr1252348 1027 917 835 378 12399 1143 1275
NM_024551chr1252348 1027 917 835 378 12399 1143 1275
NM_024556chr111445 1391 --1326
NM_024558chr142865 29 1696 ----
NM_024563chr521690 570 ------
NM_024574chr41182 ------
NM_024582chr421122 312 ------
NM_024594chr551918 1830 1640 1451 22 ------
NM_024602chr13664 589 580 ------
NM_024607chr8114211 3793 3631 3148 3049 1383 1062 809 492 438 334 --153 --
NM_024612chr17157 ------
NM_024613chr821287 95 2670 194 ----
NM_024631chr11147 2621 413 ----
NM_024632chr51280 ------
NM_024639chr632909 2175 315 1864 11002 --
NM_024645chr851574 1145 403 263 48 11462 ----
NM_024646chr183952 3938 3581 3446 2846 1116 890 440 23904 278 ----
NM_024665chr384260 4073 4060 3909 1728 1321 744 472 13641 ----
NM_024666chr1581622 1279 1204 677 536 442 255 60 ------
NM_024670chr1031629 508 432 --198 --
NM_024692chr251618 1334 1306 444 229 1153 1596 --
NM_024699chr81911 ------
NM_024700chr1--1920 ----
NM_024702chr173597 557 204 ------
NM_024705chr134808 358 350 316 3847 325 252 ----
NM_024707chr191126 --1218 --
NM_024721chr82738 410 ------
NM_024725chr112643 257 1165 ----
NM_024740chr1163923 3592 3310 2958 2591 134 21063 675 13761 --
NM_024749chr141768 1510 162 55 21522 49 ----
NM_024751chr4------1186
NM_024755chr154861 350 335 58 ------
NM_024757chr941119 815 738 372 ------
NM_024761chr984302 4213 3312 1087 692 668 550 512 44478 1835 932 283 1332 --
NM_024770chr2105764 5325 5151 4855 4588 2648 2025 1839 1727 1447 16481 11378 --
NM_024771chr1162332 1717 1711 1616 869 856 22054 314 --11690
NM_024786chr5141 1910 ----
NM_024787chr83877 722 145 164 ----
NM_024811chr1151234 760 659 523 147 11267 ----
NM_024812chr861734 1653 1633 837 185 111 21896 1582 ----
NM_024817chr1585636 5361 5146 5112 4499 2207 960 567 15752 11147 21359 1134
NM_024824chr1421089 679 21592 70 ----
NM_024828chr921305 1185 ------
NM_024834chr1011920 ------
NM_024863chrX256 36 ------
NM_024873chr42816 779 ------
NM_024887chr151591 858 562 375 38 --1424 11647
NM_024909chr62530 219 --11057 --
NM_024913chr731347 457 183 21636 653 ----
NM_024944chr211439 ------
NM_024947chr3169447 8977 7332 7184 6553 6133 5808 3130 2898 2668 1478 1427 1300 542 517 395 69624 9111 9072 2020 1145 153 17961 --
NM_024948chr101174 ------
NM_024953chr1242001 1993 1005 700 134 ----
NM_024971chr9196 ------
NM_024989chr248134 6226 5711 2425 ------
NM_024993chr2128 ------
NM_024997chr1641035 517 422 205 ------
NM_025054chr854208 2830 1499 1378 194 --23681 688 1860
NM_025073chr164627 4272 3893 1722 1292 558 11622 --21849 834
NM_025076chr23499 243 140 ------
NM_025134chr1652550 1942 1570 487 468 11739 ----
NM_025138chr1321048 916 ------
NM_025146chr321945 1673 ------
NM_025147chr21931 ------
NM_025160chr123916 3375 13259 --12613
NM_025179chr164654 3677 3442 3115 1574 766 23323 3223 11888 --
NM_025184chrX2846 27 ------
NM_025187chr161930 --1155 --
NM_025191chr131426 1385 102 32979 2355 666 ----
NM_025194chr1911168 --11249 --
NM_025202chr25408 295 234 226 22 21033 397 ----
NM_025221chr4148 ------
NM_025222chr342569 2367 1005 369 --1254 --
NM_025235chr1051453 768 730 164 63 1551 ----
NM_025237chr1721542 72 --1485 --
NM_030576chr1742120 746 410 28 1538 1146 --
NM_030583chr81399 ------
NM_030594chr1511291 ------
NM_030621chr1463464 2584 1684 1094 999 270 13487 12920 --
NM_030623chr251370 1297 567 76 67 ------
NM_030625chr1032538 356 292 1392 ----
NM_030627chr563609 3548 3482 3048 2820 1369 23231 941 14004 --
NM_030637chr141566 ------
NM_030640chr121769 ------
NM_030647chr765775 5556 3975 2144 1641 919 24090 716 --14876
NM_030648chr495211 4726 4634 2122 1977 1922 1597 1304 764 24819 594 ----
NM_030650chr224122 3011 --12892 --
NM_030653chr121665 ------
NM_030661chr721098 277 ------
NM_030664chr1031680 857 596 ------
NM_030667chr1221044 516 ------
NM_030668chr1221044 516 ------
NM_030669chr1221044 516 ------
NM_030670chr1252076 1722 1548 281 266 1796 11635 --
NM_030671chr1252076 1722 1548 281 266 1796 11635 --
NM_030674chr1285865 5854 4513 4310 3942 584 286 163 23982 1594 14327 1458
NM_030755chr1432743 2116 999 1569 ----
NM_030756chr101224 ------
NM_030758chr2211264 11041 ----
NM_030759chr101671 ------
NM_030761chr182642 2621 2035 1944 1749 1721 1081 302 ------
NM_030763chrX1906 ------
NM_030766chr121205 ------
NM_030773chr2031835 1579 1539 191 11677 --
NM_030780chr841583 364 273 207 ----1117
NM_030790chr161210 ------
NM_030799chr552126 2087 1690 506 208 ------
NM_030802chr172747 25 1675 ----
NM_030806chr1208916 8743 8615 7673 7473 7261 7191 7017 6451 6047 3626 3619 3541 2994 2625 2111 2066 1539 539 84 27038 5732 --17629
NM_030809chr1241882 970 504 37 32478 2219 1950 ----
NM_030810chr641418 1214 1177 1097 1168 ----
NM_030816chr123558 750 1648 ----
NM_030820chr61867 ------
NM_030881chr2252312 1754 1669 624 450 11834 ----
NM_030885chr311933 11442 11970 1200
NM_030916chr13949 650 136 ------
NM_030918chr165388 4399 4167 613 469 164 14105 1316 --
NM_030920chr131770 594 557 11590 ----
NM_030922chr152810 306 ------
NM_030935chr72346 80 ------
NM_030939chr61999 1920 ----
NM_030949chr631397 1203 1061 ------
NM_030952chr131333 1319 1075 1425 ----
NM_030954chr82765 193 ------
NM_030957chr192650 520 ------
NM_030958chr8--1103 ----
NM_030962chr111430 --1534 --
NM_030964chr553396 2924 2688 2422 805 --23642 29 13313
NM_030979chr132449 356 ------
NM_031157chr121431 ------
NM_031216chr1832137 1621 511 ------
NM_031243chr732280 1755 916 41795 1766 849 690 ----
NM_031266chr51173 ------
NM_031267chr72189 110 ------
NM_031268chr1685350 5260 4973 4824 4213 3667 2065 602 11126 13648 11324
NM_031283chr21786 1142 ----
NM_031296chr431960 816 693 12271 ----
NM_031314chr14143 12052 ----
NM_031362chr262647 2380 2082 1815 918 637 22698 1874 ----
NM_031365chr262783 2516 2218 1951 1054 773 22834 2010 ----
NM_031366chr262783 2516 2218 1951 1054 773 22834 2010 ----
NM_031371chr121599 475 11369 ----
NM_031371chr121599 475 11369 ----
NM_031372chr431415 491 311 ------
NM_031411chr541744 1518 633 316 --1183 12092
NM_031427chr1495422 5066 4952 4802 4589 1902 1637 1276 978 ------
NM_031431chr1331824 1382 665 1353 ----
NM_031435chr1243187 3149 2286 1361 12464 12538 --
NM_031438chr541966 773 551 318 ------
NM_031442chrX32527 2380 1020 --11011 --
NM_031445chr22931 856 22693 1076 ----
NM_031453chr1012436 ----11690
NM_031461chr8--31996 1686 258 22083 286 --
NM_031468chr776335 5649 2073 1556 1014 427 217 42580 1857 1693 797 ----
NM_031469chr654027 3708 1607 823 178 ------
NM_031483chr2083239 3166 2932 2868 2268 987 163 61 31259 685 578 ----
NM_031844chr143652 2692 2686 1166 21341 1172 --1253
NM_031845chr222724 65 13412 1249 1217
NM_031847chr222724 65 13412 1249 1217
NM_031849chr541744 1518 633 316 --1183 12092
NM_031857chr541744 1518 633 316 --1183 12092
NM_031860chr541744 1518 633 316 --1183 12092
NM_031890chr2252600 2273 781 266 60 1963 ----
NM_031891chr182348 303 --2390 151 --
NM_031892chrX3827 366 252 ------
NM_031915chr13--1222 ----
NM_031942chr251239 996 245 212 30 ------
NM_031989chr12--1123 ----
NM_031992chr721501 375 ------
NM_032012chr994837 4740 4731 1377 1345 1073 852 501 75 21535 659 14057 11008
NM_032028chr54636 576 108 55 ------
NM_032041chr832452 2046 291 12580 12129 --
NM_032042chr552274 2149 1105 845 293 1649 --11046
NM_032048chr18157 ------
NM_032102chr1153142 2422 2130 1173 128 12428 ----
NM_032124chr182430 318 ----11108
NM_032127chr111162 ------
NM_032128chr41835 1907 ----
NM_032138chr13131 1538 ----
NM_032144chr241391 694 609 224 ------
NM_032145chr631889 1633 1577 ------
NM_032147chr122382 290 ------
NM_032148chr122472 369 ------
NM_032153chr342551 1949 1798 661 1777 ----
NM_032156chr12139 ------
NM_032160chr1842750 1421 1175 1110 23320 2858 1391 --
NM_032168chr2191 ------
NM_032174chr171170 1152 1066 966 581 467 206 ------
NM_032177chr52434 351 ------
NM_032182chr1041405 581 349 167 ------
NM_032186chr11354 21260 1023 ----
NM_032189chr1374624 4585 3850 3268 1165 891 401 12012 1929 --
NM_032192chr172475 67 --1691 --
NM_032199chr1023637 3631 13185 ----
NM_032208chr233400 2873 394 --11204 --
NM_032217chr42554 92 --1454 --
NM_032228chr1133253 1293 1195 ------
NM_032229chr1321049 844 ------
NM_032233chr142741 125 ------
NM_032239chr421068 312 11414 ----
NM_032242chr342630 2549 1242 1051 --42290 2285 665 616 --
NM_032246chr1511157 ----21301 273
NM_032256chr121893 1253 ----
NM_032268chr1683246 2684 2587 2478 2414 2158 538 509 --12675 --
NM_032270chr1139 ------
NM_032271chr163301 172 122 ------
NM_032283chr171539 1383 1336 1241 1233 412 172 ------
NM_032288chr32581 86 ----12296
NM_032291chr121633 541 ------
NM_032294chr1711481 11815 ----
NM_032312chr21796 ------
NM_032315chr1122 ------
NM_032321chr243087 2784 2597 489 --22445 821 --
NM_032329chr244272 3100 1385 1058 13559 13449 --
NM_032352chr14--1949 ----
NM_032353chr17121 ------
NM_032373chr1044476 4428 4004 321 45237 3832 3599 416 --15266
NM_032375chr194849 284 277 141 1536 ----
NM_032380chr5176 ------
NM_032408chr74983 510 468 264 ------
NM_032427chr112626 413 ------
NM_032434chr211374 11490 ----
NM_032435chr142077 1931 1723 487 12094 1684 --
NM_032438chr62669 38 ------
NM_032439chr101314 11143 ----
NM_032440chr1021159 422 22016 231 ----
NM_032445chr1542188 831 722 611 --22172 34 --
NM_032446chr523805 2980 --1386 --
NM_032457chr42592 175 33923 1554 32 ----
NM_032458chrX53372 3269 3207 2338 212 1719 1649 --
NM_032466chr821083 568 21641 559 ----
NM_032468chr821083 568 21641 559 ----
NM_032482chr1931894 1845 592 --12643 1311
NM_032486chr1662577 2230 1654 1020 158 37 --12210 --
NM_032491chr12--194 1838 --
NM_032503chr63880 699 676 --1661 --
NM_032505chr33857 822 529 11853 --12570
NM_032507chr61218 ------
NM_032509chr832207 2085 1704 11022 22121 384 --
NM_032510chr1841952 600 417 330 22416 214 ----
NM_032521chr2023206 2448 22246 561 2955 905 --
NM_032538chr662770 2107 2033 1851 873 408 ------
NM_032539chrX1728 1279 ----
NM_032547chr421097 376 ------
NM_032552chr951913 1482 556 438 249 11746 ----
NM_032557chr41906 ------
NM_032558chr93980 564 438 11148 ----
NM_032560chr14------1801
NM_032564chr112201 58 ------
NM_032574chr2165 ------
NM_032575chr1621917 717 --21631 1514 1628
NM_032576chrY1103 ------
NM_032582chr17--11694 ----
NM_032590chr1231137 761 36 2246 55 ----
NM_032595chr171450 1326 ----
NM_032622chr4--1227 ----
NM_032626chr16------1279
NM_032632chr1441616 1242 744 456 ----11637
NM_032682chr373257 3153 2434 1084 623 476 196 1869 11208 12913
NM_032717chr41127 1111 ----
NM_032731chr1731336 439 44 1573 21486 529 --
NM_032737chr1921813 33 1411 ----
NM_032778chr343072 2670 2385 353 12277 ----
NM_032784chr62110 70 1226 --1674
NM_032796chrX2703 152 ------
NM_032802chr15--141 ----
NM_032808chr151180 1106 1840 --
NM_032811chr112699 172 21533 1445 1253 --
NM_032812chr102356 106 ------
NM_032813chr1321126 727 ------
NM_032828chr1993739 3064 1856 1669 1300 1278 1227 1104 805 34874 580 420 ----
NM_032829chr1221141 1038 ------
NM_032833chr132421 705 678 22597 617 1628 --
NM_032837chr1752134 1343 605 517 340 12046 ----
NM_032846chr1441513 527 498 408 11099 ----
NM_032859chr1341427 624 562 136 ------
NM_032866chr1543099 2914 2065 599 ----13067
NM_032869chr851944 1453 1344 693 538 --1563 --
NM_032871chr113700 665 503 --2739 642 --
NM_032873chr1123142 344 54123 3837 3528 2807 1439 ----
NM_032900chr1083560 3368 3358 2918 1573 1382 960 504 11109 ----
NM_032905chr102832 807 ------
NM_032906chr4----1164 --
NM_032926chrX188 ----1163
NM_032932chr17106288 6266 5866 5078 2572 2524 2003 1204 377 347 15468 ----
NM_032960chr121545 942 148 ----
NM_032961chr411228 1444 ----
NM_032968chrX74227 3286 3086 855 690 590 575 ------
NM_032969chrX74227 3286 3086 855 690 590 575 ------
NM_032973chrY84219 3281 3081 2684 855 690 590 575 ------
NM_032978chr1831207 884 52 1391 ----
NM_032979chr1831207 884 52 1391 ----
NM_032981chr1831207 884 52 1391 ----
NM_032998chr12367 80 1235 ----
NM_032999chr741030 1004 792 124 ----1989
NM_033000chr741030 1004 792 124 ----1989
NM_033001chr741030 1004 792 124 ----1989
NM_033014chr921561 375 ------
NM_033017chr761440 1327 1062 683 645 90 ------
NM_033020chr184763 1717 1400 1355 1128 610 492 263 ----22941 1455
NM_033023chr731097 879 79 --11154 1453
NM_033030chr21332 31143 1116 264 --1195
NM_033044chr11336 --11133 --
NM_033055chr14920 347 340 312 ------
NM_033071chr63631 543 120 ------
NM_033081chr20--1166 ----
NM_033082chr121180 ------
NM_033087chr921188 503 11143 ----
NM_033117chr91244 ------
NM_033121chr122448 296 125 11734 --
NM_033127chr1182 --1463 --
NM_033129chr2041649 1634 540 405 ----11663
NM_033133chr1783649 2966 2910 2707 2469 1365 930 463 --1345 --
NM_033138chr762143 1739 1531 1501 256 69 ------
NM_033139chr762143 1739 1531 1501 256 69 ------
NM_033140chr762143 1739 1531 1501 256 69 ------
NM_033143chr464227 4100 1784 1337 575 162 34179 3877 776 ----
NM_033157chr762143 1739 1531 1501 256 69 ------
NM_033158chr3138 ------
NM_033161chr921918 183 ----11362
NM_033181chr63789 624 100 23493 3116 --11471
NM_033207chr1062576 2173 2157 754 202 124 ------
NM_033211chr531852 1451 634 ------
NM_033215chrX1361 --1417 --
NM_033224chr787205 7094 6947 5948 5797 5188 1986 1097 1523 ----
NM_033225chr843206 220 177 154 11981 1102 --
NM_033227chr51540 ------
NM_033260chr62621 312 1202 ----
NM_033272chr2180 ------
NM_033281chr51345 146 ----
NM_033285chr883891 3614 1529 1323 1283 916 892 619 21583 91 ----
NM_033290chrX42875 1397 631 189 21423 1209 12626 --
NM_033300chr121247 530 ------
NM_033326chr1121708 860 12137 11846 --
NM_033340chr1041317 1247 1223 104 ------
NM_033375chr1741460 1249 433 318 ------
NM_033380chrX4966 208 197 90 ------
NM_033381chrX4966 208 197 90 ------
NM_033386chr227912 851 715 450 355 169 60 11103 ----
NM_033387chr94892 813 569 102 ------
NM_033389chr1764589 4538 3840 3392 3381 548 11735 --2829 614
NM_033393chr472754 2586 2433 1849 1811 675 505 --12729 --
NM_033394chr231499 1175 498 ------
NM_033401chr161376 ------
NM_033407chr11598 ------
NM_033425chr1163273 3097 2287 1385 254 248 23036 2776 ----
NM_033429chr1532975 2190 830 1721 1292 12593
NM_033449chr52541 194 --1587 --
NM_033495chrX2924 33 ------
NM_033503chr15103803 3737 3639 3618 3386 2941 2514 1208 469 272 ----13342
NM_033505chr276402 1964 1546 1234 1156 763 260 14189 ----
NM_033512chr892376 2226 2213 1082 695 539 290 178 68 --22992 365 --
NM_033535chr441135 1080 266 63 1354 ----
NM_033551chr553429 3292 2245 667 478 2342 190 11188 --
NM_033631chr163706 1133 1020 877 701 31 --21385 485 13892
NM_033644chr531703 1677 116 ------
NM_033645chr531703 1677 116 ------
NM_033655chr921072 93 ------
NM_033656chr2144756 4257 1653 390 15540 24530 4274 --
NM_044472chr13587 290 103 ------
NM_052818chr1351930 1904 1850 346 46 ------
NM_052832chr862634 752 736 720 109 34 1501 ----
NM_052834chr1832530 1889 64 22297 1826 --1213
NM_052840chr1521269 1116 ------
NM_052851chr1341978 884 481 375 ------
NM_052854chr111633 ------
NM_052864chr431961 469 45 1836 ----
NM_052879chr1232774 1476 988 ------
NM_052880chr2211376 11401 1352 11459
NM_052885chr1264604 3771 1885 1661 1575 1332 34912 4504 631 ----
NM_052898chr81459 1649 ----
NM_052900chr831569 470 323 11488 11481 --
NM_052904chr631079 98 40 ------
NM_052905chr231608 603 575 ------
NM_052906chr22104873 4707 4699 3581 3302 1835 1625 1422 284 263 ------
NM_052910chr1361575 1502 1392 1364 555 344 ------
NM_052911chr181942 ------
NM_052917chr282928 2910 2828 2460 925 826 396 264 32769 850 565 ----
NM_052918chr1053699 3174 704 541 344 --23146 407 --
NM_052927chr532086 1862 1678 21719 1583 ----
NM_052932chr1132504 1637 529 12064 ----
NM_052937chr842591 2289 550 399 31689 754 725 ----
NM_052951chr201170 ------
NM_052954chr2161754 832 410 205 160 62 ------
NM_052971chr52143 55 ------
NM_053016chr987760 7617 7194 6704 4927 3100 2223 471 26909 2536 ----
NM_053023chr1162733 1331 756 410 350 216 1728 12390 12653
NM_053024chr32420 298 --11100 --
NM_053056chr113921 545 407 --12189 --
NM_053064chr141496 22508 2398 ----
NM_053067chr9173 ------
NM_053281chrX----1366 --
NM_053283chr12----147 --
NM_054016chr131861 1725 600 ------
NM_054016chr131861 1725 600 ------
NM_054016chr131861 1725 600 ------
NM_054027chr532122 713 204 ------
NM_057169chr1242485 1154 1126 39 186 --13170
NM_057170chr1242485 1154 1126 39 186 --13170
NM_057175chr462620 2318 2021 1947 445 83 ------
NM_057178chr1732186 2166 460 --12820 --
NM_057749chr81890 ------
NM_058170chr141402 1311 1286 579 156 ----
NM_058172chr421143 144 --1542 --
NM_058237chr143914 353 287 ------
NM_058240chr1421457 381 21728 210 --11133
NM_058241chr251810 1646 863 133 29 32329 1962 243 11609 --
NM_058241chr251810 1646 863 133 29 32329 1962 243 11609 --
NM_078470chr1042701 1094 332 79 21912 680 1317 --
NM_078471chr173866 473 257 ------
NM_078476chr6--31745 617 205 ----
NM_080491chr1173930 2782 2413 347 316 195 104 11070 ----
NM_080546chr911622 --12135 --
NM_080552chr201109 --1618 --
NM_080597chr1831119 329 83 ------
NM_080599chr102390 169 ------
NM_080604chr63623 587 103 ------
NM_080629chr11399 ------
NM_080630chr11399 ------
NM_080654chr11298 77 1356 ----
NM_080664chr1452040 1976 328 224 216 21957 142 ----
NM_080669chr1763573 3150 1939 1805 1583 774 34943 4582 927 ----
NM_080671chr221551 459 12150 1830 11847
NM_080676chr2072649 2341 2161 1120 785 125 35 ------
NM_080678chr21607 ------
NM_080683chr43401 122 67 ----