TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4733-3p
miRNA Sequence: CCACCAGGUCUAGCAUUGGGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX33336 2364 1217 ------
NM_000061chrX122 ------
NM_000084chrX66466 4677 4486 2258 2188 1523 26362 5706 11379 11280
NM_000092chr264527 4480 3831 3658 1739 152 11429 ----
NM_000093chr922256 1797 ------
NM_000104chr23604 380 264 ------
NM_000109chrX1830 ------
NM_000138chr151420 ------
NM_000163chr522286 907 ------
NM_000176chr573853 3410 3314 2389 682 518 398 ------
NM_000192chr12----1397 --
NM_000208chr1974432 1527 1267 1036 849 362 55 ----14003
NM_000210chr212237 ------
NM_000216chrX33243 2629 823 1192 ----
NM_000217chr1224223 1491 ------
NM_000240chrX----22169 1430 --
NM_000248chr352935 2753 2723 1029 604 11967 ----
NM_000259chr1555804 5192 4241 2261 1704 ------
NM_000266chrX2350 211 ------
NM_000271chr181529 ------
NM_000276chrX31842 1545 221 --11458 --
NM_000280chr111251 ------
NM_000314chr101680 ------
NM_000317chr112341 265 ------
NM_000319chr122773 214 --1273 --
NM_000332chr656374 5937 2164 1159 166 ------
NM_000345chr411032 ------
NM_000362chr2221414 239 22639 731 11437 12321
NM_000368chr984204 3318 1817 1350 780 740 444 261 --13763 13673
NM_000378chr112267 240 ------
NM_000390chrX33198 2940 1172 13271 ----
NM_000391chr1121682 1399 ------
NM_000396chr1183 ------
NM_000399chr101127 --1860 --
NM_000408chr231289 625 150 --13093 --
NM_000411chr2132912 603 168 ------
NM_000429chr1041736 1294 1182 23 --2181 45 --
NM_000430chr1753337 3310 2898 880 367 ------
NM_000449chr121350 157 ------
NM_000461chr351756 1668 1584 1099 303 ----11683
NM_000462chr15196 ----11434
NM_000476chr921334 309 ------
NM_000478chr11706 ------
NM_000480chr1131203 610 316 1131 ----
NM_000503chr82734 442 ----1113
NM_000555chrX76847 5785 5753 5243 1756 701 93 37588 1913 1015 1618 --
NM_000594chr6--1698 ----
NM_000615chr1132965 2163 2040 --1381 11149
NM_000617chr1222303 1422 ------
NM_000633chr1844889 4675 4343 1011 --1612 --
NM_000682chr241704 1452 713 31 --11277 --
NM_000726chr2--11404 ----
NM_000756chr81444 ------
NM_000780chr8--1162 ----
NM_000801chr202374 58 11042 ----
NM_000814chr1523559 3541 23700 565 ----
NM_000817chr211015 1430 ----
NM_000818chr101375 ------
NM_000826chr421670 796 ------
NM_000833chr1611291 ------
NM_000834chr122148 94 --1322 1172
NM_000838chr621079 457 12519 ----
NM_000841chr6--1889 2728 126 --
NM_000857chr41462 ------
NM_000859chr52521 134 11245 ----
NM_000865chr62200 93 ------
NM_000868chrX32268 1622 781 ------
NM_000875chr1575969 5951 5630 5540 5017 4272 889 ----14805
NM_000882chr31339 ------
NM_000891chr1743522 3060 2409 291 ------
NM_000901chr442428 642 399 338 ------
NM_000902chr332855 2555 708 ------
NM_000919chr51553 ------
NM_000926chr1159388 7837 2621 1705 1306 27599 6844 ----
NM_000933chr20----1301 --
NM_000944chr432295 808 195 --11714 --
NM_000945chr2----11555 --
NM_000950chrX43564 3509 3046 637 ------
NM_000958chr511261 1835 ----
NM_000959chr133909 2892 2825 ------
NM_000962chr952802 1254 624 289 97 1396 12085 --
NM_000965chr32377 311 ------
NM_001001323chr1232288 2275 2087 13004 ----
NM_001001344chrX22446 834 ------
NM_001001419chr544702 1896 1006 937 13975 13955 --
NM_001001420chr544702 1896 1006 937 13975 13955 --
NM_001001433chr201422 1778 ----
NM_001001481chr823346 2743 ------
NM_001001484chr10----11816 12364
NM_001001549chr711052 173 11856 --
NM_001001550chr711052 173 11856 --
NM_001001555chr711052 173 11856 --
NM_001001701chr422223 1466 --21930 1763 --
NM_001001740chr1----1239 --
NM_001001740chr1----1239 --
NM_001001852chr221174 ----1128
NM_001001890chr2154042 3997 2669 1705 941 ------
NM_001001936chr101342 21158 396 --148
NM_001002257chr223447 3097 ------
NM_001002258chr222025 90 ------
NM_001002762chr10102849 2843 2715 2054 1880 1071 636 410 345 83 --22071 598 21794 127
NM_001002838chrX1563 ------
NM_001002860chr1463796 2877 1348 1292 1176 754 13939 ----
NM_001002909chr172632 422 1513 ----
NM_001002914chr1721227 1055 ----1996
NM_001003652chr18118581 6197 5780 5584 5419 5299 3428 2713 1652 1542 1375 16423 38335 6864 2542 --
NM_001003676chr1131051 932 293 ------
NM_001003677chr112607 488 --158 --
NM_001003688chr42342 175 ------
NM_001003696chr21125 1134 ----
NM_001003697chr21125 1134 ----
NM_001003698chr651547 1381 585 578 360 ------
NM_001003699chr651547 1381 585 578 360 ------
NM_001003701chr21125 1134 ----
NM_001003703chr21125 1134 ----
NM_001003722chr921107 283 ------
NM_001003760chr633594 882 161 --12824 --
NM_001003800chr952618 2446 1335 797 340 --13145 11279
NM_001003895chrY2256 127 ------
NM_001003940chr1543484 1389 1004 714 12876 --12521
NM_001003942chr1543484 1389 1004 714 12876 --12521
NM_001003943chr1543488 1393 1008 718 12880 --12525
NM_001004051chrX165 ------
NM_001004065chr963888 2526 883 397 246 31 1227 ----
NM_001004125chr91806 --1179 --
NM_001004128chr12475 45 ------
NM_001004317chr632978 1566 1011 ------
NM_001004329chr1221479 1144 ------
NM_001004342chr1106017 5882 5870 5039 3810 1740 1723 1603 1462 515 --11941 22213 969
NM_001004419chr1234152 1633 738 --24413 494 --
NM_001004722chr22305 94 ------
NM_001005353chr15515 469 454 356 64 ------
NM_001005353chr15515 469 454 356 64 ------
NM_001005386chr232381 893 137 ------
NM_001005404chr1794505 4362 3671 3179 3051 638 623 300 89 1153 11737 --
NM_001005463chr1012449 ------
NM_001005473chr546657 6511 5039 4282 16439 14945 15977
NM_001005505chr361427 1240 728 402 296 141 ------
NM_001005609chrX32821 1483 99 ------
NM_001005743chr1421148 895 11196 11088 --
NM_001005744chr1421148 895 11196 11088 --
NM_001005745chr1421148 895 11196 11088 --
NM_001005746chr2--11404 ----
NM_001005747chr2--11404 ----
NM_001005782chr21122 1184 ----
NM_001005845chr82711 28 ------
NM_001006115chr372573 1818 1728 775 380 230 116 --1269 --
NM_001006624chr151996 1980 1324 521 487 ----1730
NM_001006684chrX1127 ------
NM_001007024chr1773494 3481 3161 2906 2872 2689 48 --11551 --
NM_001007025chr1773494 3481 3161 2906 2872 2689 48 --11551 --
NM_001007027chr111193 ------
NM_001007156chr1521244 40 ------
NM_001007237chr121108 183 --11148 --
NM_001007246chr2121664 538 ------
NM_001007257chr11519 11007 ----
NM_001007553chr12912 265 158 1951 --
NM_001007565chr31133 ------
NM_001008225chr71474 ------
NM_001008239chr1843781 3049 2804 807 --11404 1271
NM_001008391chr112583 48 ------
NM_001008401chr1911380 ------
NM_001008407chr711658 1406 --1536
NM_001008495chr822035 694 ------
NM_001008528chr1721329 219 1235 ----
NM_001008539chr845102 4964 4507 307 ------
NM_001008541chr1021967 1737 ------
NM_001008541chr1021967 1737 ------
NM_001008660chr1111383 1246 ----
NM_001008701chr1982970 2733 2159 628 580 99 65 27 --12685 --
NM_001008707chr14164 ------
NM_001008726chr142628 307 --11497 --
NM_001008738chr532809 474 28 1689 ----
NM_001008925chr423028 242 ------
NM_001009552chr81584 ------
NM_001009554chr454034 2963 1419 1057 498 64628 3628 1685 1556 799 286 ----
NM_001009554chr454034 2963 1419 1057 498 64628 3628 1685 1556 799 286 ----
NM_001009555chr421416 268 ------
NM_001009566chr131473 1298 184 --21145 146 --
NM_001009958chr71169 ------
NM_001009959chr252397 2115 720 423 372 ------
NM_001009960chr722109 738 ------
NM_001009993chr293984 3667 3654 3435 3224 3169 1739 1640 63 13400 23062 678 --
NM_001010854chr141501 ------
NM_001010867chr196653 6332 6108 2671 2423 1936 1647 888 116 --16260 14167
NM_001010888chrX24312 1616 ------
NM_001010924chr1021227 1105 ------
NM_001010971chr11990 ------
NM_001010984chr131831 1709 75 ------
NM_001010989chr16--1178 ----
NM_001010990chr16--1178 ----
NM_001011513chr412500 12936 --11393
NM_001011537chr372311 2247 1609 808 642 405 377 --12083 --
NM_001011666chr754214 1815 583 245 225 --15106 --
NM_001011708chr222643 838 --2488 428 --
NM_001011713chr1411063 ------
NM_001011885chr1531595 1490 708 ------
NM_001012329chr132256 1939 353 --12246 1942
NM_001012393chr1163895 2051 1585 1510 1152 234 ------
NM_001012418chr634123 203 110 --11645 --
NM_001012420chr1512917 1593 ----
NM_001012423chr1512917 1593 ----
NM_001012426chr653277 2443 1159 735 207 ------
NM_001012427chr653277 2443 1159 735 207 ------
NM_001012456chr7--141 ----
NM_001012755chrX64888 4367 4005 3447 3337 49 --1708 --
NM_001012761chr51308 ------
NM_001012989chrX--2418 134 ----
NM_001013031chr1032825 1327 648 --13361 --
NM_001013399chr6----1843 --
NM_001013635chr121984 --11187 --
NM_001013699chr12--163 ----
NM_001014380chr1331856 676 27 --11976 13845
NM_001014434chr11680 --1140 --
NM_001014797chr1078123 7312 2692 2686 2038 1038 220 ------
NM_001015053chr1741509 597 573 374 ------
NM_001017365chr1157 ------
NM_001017366chr1157 ------
NM_001017367chr1157 ------
NM_001017368chr1742514 1133 438 237 22328 589 ----
NM_001017371chr22369 123 ------
NM_001017395chr343624 2977 2836 1074 ------
NM_001017523chr1221886 391 1434 ----
NM_001017920chr21101 ------
NM_001017923chr14181 --11253 --
NM_001017926chr831822 1273 184 ------
NM_001018050chr2242725 2438 2251 565 --23179 2620 11043
NM_001018052chr2242725 2438 2251 565 --23179 2620 11043
NM_001018067chr175302 2117 2027 1984 1702 1663 25 1789 24934 3777 --
NM_001018068chr175302 2117 2027 1984 1702 1663 25 1789 24934 3777 --
NM_001018069chr175302 2117 2027 1984 1702 1663 25 1789 24934 3777 --
NM_001018072chr1221886 391 1434 ----
NM_001018074chr573853 3410 3314 2389 682 518 398 ------
NM_001018075chr573853 3410 3314 2389 682 518 398 ------
NM_001018076chr573853 3410 3314 2389 682 518 398 ------
NM_001018077chr573853 3410 3314 2389 682 518 398 ------
NM_001020658chr121208 243 ------
NM_001020658chr121208 243 ------
NM_001023567chr1512309 1596 ----
NM_001024094chr573853 3410 3314 2389 682 518 398 ------
NM_001024226chr131069 378 208 ------
NM_001024227chr131069 378 208 ------
NM_001024228chr131069 378 208 ------
NM_001024660chr341313 1264 1105 427 ------
NM_001024808chr1252776 2704 969 601 496 --1460 11988
NM_001025076chr101787 13999 ----
NM_001025077chr1034873 2145 407 15357 1496 --
NM_001025079chr311179 13586 --1382
NM_001025105chr521155 301 1171 1124 --
NM_001025107chr132578 2102 1760 2542 132 ----
NM_001025107chr132578 2102 1760 2542 132 ----
NM_001025242chrX--11312 ----
NM_001025243chrX--11312 ----
NM_001025252chr822265 444 11000 ----
NM_001025253chr822265 444 11000 ----
NM_001025266chr344037 3276 237 60 --1884 --
NM_001025366chr631746 1310 462 --1588 --
NM_001025366chr631746 1310 462 --1588 --
NM_001025367chr631746 1310 462 --1588 --
NM_001025367chr631746 1310 462 --1588 --
NM_001025368chr631746 1310 462 --1588 --
NM_001025368chr631746 1310 462 --1588 --
NM_001025369chr631762 1326 478 --1604 --
NM_001025369chr631762 1326 478 --1604 --
NM_001025370chr631746 1310 462 --1588 --
NM_001025370chr631746 1310 462 --1588 --
NM_001025389chr1131203 610 316 1131 ----
NM_001025390chr1131203 610 316 1131 ----
NM_001025579chr172366 32 ------
NM_001025580chrX171 13623 --13976
NM_001025603chr121350 157 ------
NM_001029835chr71404 --194 --
NM_001029858chr612985 --1523 --
NM_001029875chr532503 2166 1890 --11002 --
NM_001031679chr1233206 2306 1193 ------
NM_001031680chr122023 140 11848 12495 --
NM_001031684chr261462 1219 1187 1088 975 525 ------
NM_001031692chr72333 49 1215 ----
NM_001031695chr2294388 4374 4045 1694 1612 1035 519 499 419 11152 ----
NM_001031710chr7192 174 ----
NM_001031711chr531604 1536 85 ------
NM_001031716chr21124 ------
NM_001031717chr31277 --189 --
NM_001031748chr121566 ------
NM_001031804chr1633426 2938 466 ------
NM_001032283chr12130 ------
NM_001032284chr12130 ------
NM_001032288chr2051295 1219 1212 520 296 --11002 --
NM_001032293chr17------1417
NM_001032363chr131881 1587 135 ------
NM_001032363chr131881 1587 135 ------
NM_001032393chrX1138 ------
NM_001033044chr131357 625 388 ------
NM_001033056chr131357 625 388 ------
NM_001033059chr642014 1990 1824 1608 --1661 --
NM_001033087chr2053139 2445 738 347 211 ------
NM_001033112chr5123 ------
NM_001033117chr353971 3382 1191 1089 560 --165 --
NM_001033506chr11150 ------
NM_001033518chr722211 1898 1266 ----
NM_001033519chr722211 1898 1266 ----
NM_001033520chr722211 1898 1266 ----
NM_001033557chr21456 ------
NM_001033564chr62660 70 164 11428 --
NM_001033667chr12283 214 1725 ----
NM_001033756chr631680 1244 396 --1522 --
NM_001033756chr631680 1244 396 --1522 --
NM_001033925chr1021718 630 1148 ----
NM_001034845chr41453 ------
NM_001035511chr132039 1647 46 2353 293 ----
NM_001035512chr142146 1754 1407 153 2460 400 ----
NM_001035513chr142146 1754 1407 153 2460 400 ----
NM_001037164chr72677 44 ------
NM_001037174chr2--22290 1538 ----
NM_001037290chr111646 ------
NM_001037533chr12780 610 1580 ----
NM_001037553chr2133933 1342 781 1115 11011 --
NM_001037954chr1143083 2482 176 36 12339 12473 --
NM_001038707chr132217 2157 499 ------
NM_001038707chr132217 2157 499 ------
NM_001039029chr1221989 1223 1355 ----
NM_001039199chr2074154 3412 1994 1663 1193 706 304 ------
NM_001039457chr11274 --197 --
NM_001039465chr142335 85 ------
NM_001039538chr223292 878 ------
NM_001039570chr2254096 3954 3373 1789 1314 --24257 4159 --
NM_001039571chr2254096 3954 3373 1789 1314 --24257 4159 --
NM_001039573chr171465 ------
NM_001039577chr164337 3058 983 412 103 36 --34226 3367 3200 --
NM_001039580chr434013 991 983 ------
NM_001039585chr134166 3149 3082 ------
NM_001039590chrX33495 2585 974 1563 --13212
NM_001039591chrX33495 2585 974 1563 --13212
NM_001039618chr112485 289 14440 ----
NM_001039690chr1652359 2039 1601 782 264 11993 32342 345 174 --
NM_001039693chr243806 3642 3283 1307 13939 ----
NM_001039762chr1021810 1500 ------
NM_001039770chr321630 123 --32152 1514 392 --
NM_001039840chrX55771 4799 4558 2084 283 --14153 14269
NM_001039960chr123501 118 56 --1158 --
NM_001040020chr721597 1445 --1107 --
NM_001040101chr431200 1014 632 ------
NM_001040110chr721342 1146 1197 ----
NM_001040142chr21161 12133 ----
NM_001040143chr21161 12133 ----
NM_001040144chr1652359 2039 1601 782 264 11993 32342 345 174 --
NM_001040146chr1652359 2039 1601 782 264 11993 32342 345 174 --
NM_001040152chr752006 1988 984 607 137 ------
NM_001040202chr421644 1017 ----122
NM_001040280chr621307 256 --1510 --
NM_001040284chr1644717 3946 1006 846 15546 --15041
NM_001040402chr432869 2775 131 1223 ----
NM_001040429chr1353447 2911 2812 2313 1162 ----172
NM_001040697chr111119 ------
NM_001040708chr82977 739 ------
NM_001040709chr152536 2343 837 433 111 ------
NM_001040712chr923538 383 1790 ----
NM_001040875chr812424 ------
NM_001040876chr42599 377 ------
NM_001042353chr202558 122 ------
NM_001042355chr1645030 4320 1479 619 ------
NM_001042357chr101116 11150 ----
NM_001042358chr101116 11150 ----
NM_001042360chr101116 11150 ----
NM_001042363chr101116 11150 ----
NM_001042371chr1631957 1872 1408 11529 ----
NM_001042389chr101116 11150 ----
NM_001042390chr101116 11150 ----
NM_001042392chr101116 11150 ----
NM_001042395chr101116 11150 ----
NM_001042399chr121394 143 ----
NM_001042404chr1195 ------
NM_001042406chr61942 ------
NM_001042412chr1645030 4320 1479 619 ------
NM_001042413chr973772 3605 2695 1417 1284 937 204 ------
NM_001042453chrX21443 447 --1639 --
NM_001042459chr3------1303
NM_001042539chr162964 228 132 --1177
NM_001042555chr122862 610 --11869 --
NM_001042599chr266725 6391 5835 5528 4875 71 ------
NM_001042601chr322936 394 --1239 --
NM_001042603chr1274410 4229 3245 1680 1471 475 313 11009 ----
NM_001042604chr364348 4172 3537 3194 3088 3015 ------
NM_001042683chr641358 1277 370 137 ------
NM_001042724chr19----1138 --
NM_001048183chr123516 879 --23694 437 --
NM_001071775chr1311952 ------
NM_001077628chr12238 202 ------
NM_001079874chr12650 321 ------
NM_001083620chr421669 795 ------
NM_001095chr1231940 1824 1739 11558 1625 --
NM_001111chr132578 2102 1760 2542 132 ----
NM_001121chr10----11603 --
NM_001144chr163972 548 245 ------
NM_001149chr101308 11301 ----
NM_001160chr1222798 1970 ------
NM_001167chrX35158 1014 453 ------
NM_001172chr141264 1157 ----
NM_001177chr1241993 1974 1776 1663 ------
NM_001186chr2142753 2148 1151 738 13269 ----
NM_001198chr611478 --11730 21665 47
NM_001204chr247422 6685 830 408 11160 ----
NM_001219chr731770 277 54 12156 ----
NM_001220chr7136 ------
NM_001222chr1041590 1412 689 395 ------
NM_001237chr42857 323 --1834 --
NM_001237chr42857 323 --1834 --
NM_001241chr232303 2039 1860 ------
NM_001241chr232303 2039 1860 ------
NM_001256chr1742358 2001 703 365 ------
NM_001257chr1631559 355 292 ------
NM_001261chr91433 1782 --1770
NM_001274chr111279 ----131
NM_001275chr14--1325 ----
NM_001293chr111358 --155 --
NM_001304chr1733374 3078 787 ----12469
NM_001310chr1242211 2062 1889 1120 ------
NM_001326chr112387 121 ------
NM_001351chr311578 11198 ----
NM_001357chr11265 ------
NM_001364chr1133881 3736 1332 33853 3831 3819 ----
NM_001365chr17155 ------
NM_001380chr101941 ------
NM_001383chr173284 185 55 --1278 --
NM_001387chr553201 3041 3015 1203 816 ------
NM_001396chr2132739 2186 326 ------
NM_001399chrX32821 1483 99 ------
NM_001401chr931569 1243 326 ------
NM_001408chr111593 ------
NM_001421chrX11581 11532 1142 1249
NM_001432chr433535 2608 44 --21566 282 --
NM_001438chr122327 1173 13276 ----
NM_001440chr832159 1984 96 --1721 11127
NM_001447chr521248 420 11211 ----
NM_001453chr61283 ------
NM_001463chr2--1834 ----
NM_001482chr151138 1245 ----
NM_001497chr952352 1883 1824 414 290 12496 12740 --
NM_001527chr622945 1687 --14819 --
NM_001530chr142118 39 ------
NM_001541chr111158 ------
NM_001542chr121108 183 --11148 --
NM_001543chr573491 3122 1505 602 555 269 134 1846 1965 --
NM_001569chrX--11312 ----
NM_001584chr111448 ------
NM_001587chrX31842 1545 221 --11458 --
NM_001604chr111251 ------
NM_001609chr1031368 810 425 12772 2145 30 --
NM_001616chr2----11172 --
NM_001620chr111588 ------
NM_001621chr731215 491 25 ------
NM_001621chr731215 491 25 ------
NM_001624chr651877 1727 1584 1243 648 ------
NM_001634chr642014 1990 1824 1608 --1661 --
NM_001649chrX32287 2206 2069 --22307 410 --
NM_001655chr1121927 1573 ------
NM_001658chr131069 378 208 ------
NM_001659chr1232714 2517 2392 1601 12349 --
NM_001660chr32184 81 --1557 --
NM_001663chr1421911 323 12517 ----
NM_001665chr11----158 --
NM_001668chr121542 861 ------
NM_001681chr121617 ------
NM_001682chr1232002 1989 1801 12718 --11015
NM_001685chr21125 1134 ----
NM_001689chr222025 90 ------
NM_001690chr332418 1830 252 ------
NM_001701chr921359 624 ------
NM_001742chr72660 162 ------
NM_001753chr721383 116 --157 --
NM_001754chr2154042 3997 2669 1705 941 ------
NM_001755chr1621885 1772 ------
NM_001759chr12124416 3835 3462 1891 1294 1125 1095 928 910 194 62 45 ------
NM_001777chr311179 13586 --1382
NM_001789chr311393 --11195 --
NM_001795chr1631557 382 231 1393 1403 --
NM_001806chr1941903 1161 367 189 ------
NM_001829chr42837 166 ------
NM_001845chr131441 ------
NM_001846chr132820 32 ------
NM_001851chr62738 485 ----145
NM_001854chr12278 202 --147 --
NM_001855chr91215 ------
NM_001858chr643638 1902 29 22 --2847 413 --
NM_001859chr931362 1095 383 --11347 --
NM_001865chr6127 ------
NM_001873chr41655 ------
NM_001892chr521155 301 1171 1124 --
NM_001893chr171361 ------
NM_001895chr2021239 771 ------
NM_001904chr32190 84 ------
NM_001918chr143097 2826 2066 1431 --38579 1766 1623 12612
NM_001938chr11609 1450 1101 --
NM_001939chrX63672 3135 1499 666 150 43 ------
NM_001945chr551409 1368 1247 1141 1052 ------
NM_001956chr11108 ----1157
NM_001964chr5----1771 --
NM_001969chr1443202 1580 1167 539 ------
NM_001970chr171390 ----1223
NM_001981chr132408 472 242 ------
NM_001991chr1722174 205 ------
NM_001995chr411360 ------
NM_002006chr4--21633 595 --12008
NM_002015chr1372975 2597 2469 2435 2394 1038 109 --33295 2141 316 --
NM_002018chr17------130
NM_002025chrX119243 9142 9044 8391 7883 6892 6830 6071 2039 1764 71 12378 --12761
NM_002048chr91917 --1147 --
NM_002065chr131357 625 388 ------
NM_002069chr711719 11831 ----
NM_002072chr9----2954 38 --
NM_002077chr92809 200 --11611 --
NM_002092chr424585 122 35045 3395 3272 --13982
NM_002103chr1911074 11027 ----
NM_002106chr41344 165 ----
NM_002126chr1764109 3411 3141 1318 416 134 1568 ----
NM_002128chr1332110 273 219 --1188 --
NM_002131chr621302 936 --1333 --
NM_002133chr221567 ------
NM_002136chr12----1491 --
NM_002137chr721999 1625 --12244 --
NM_002140chr92907 304 ------
NM_002141chr72279 217 1126 ----
NM_002148chr21674 ----1571
NM_002158chr233215 3068 1191 ------
NM_002160chr9--1112 ----
NM_002165chr201292 ------
NM_002207chr3148 ------
NM_002214chr733494 880 467 ------
NM_002222chr321291 436 ------
NM_002223chr121445 13192 11178 --
NM_002224chr61712 ----1576
NM_002230chr172961 182 ------
NM_002232chr1156 ------
NM_002241chr152863 2814 2060 59 31 42401 1153 564 371 ----
NM_002247chr10159 ------
NM_002254chr212068 --2464 82 --
NM_002267chr132564 522 1931 1266 --
NM_002268chr311283 ------
NM_002270chr534968 4467 1498 13817 ----
NM_002309chr2252611 1204 1135 1100 970 ------
NM_002336chr1264861 4785 4545 1184 758 635 ------
NM_002346chr82594 115 ------
NM_002355chr123873 511 470 --11384 --
NM_002356chr622599 2411 ------
NM_002359chr1753499 3181 1377 1203 289 33440 3239 1213 24176 3202 23768 1175
NM_002360chr752662 2183 1680 1047 695 1775 12109 --
NM_002372chr5153 ------
NM_002373chr15----1854 --
NM_002374chr223292 878 ------
NM_002387chr534605 3303 307 ------
NM_002397chr511399 ----11521
NM_002399chr1511038 ------
NM_002430chr2212478 ------
NM_002444chrX------11816
NM_002490chr221141 --1611 --
NM_002499chr1542289 2086 972 180 --1450 --
NM_002500chr21269 ------
NM_002501chr1933914 3863 27 --12796 --
NM_002508chr13642 495 65 ------
NM_002516chr19----192 --
NM_002520chr51204 ------
NM_002522chr1742832 1514 469 142 1290 ----
NM_002545chr1163895 2051 1585 1510 1152 234 ------
NM_002547chrX53876 1477 553 535 460 13286 13327 --
NM_002581chr924664 3824 ----11943
NM_002605chr152269 79 ------
NM_002613chr1674978 4574 4025 2030 1523 1306 604 --21390 328 --
NM_002646chr12287 37 ------
NM_002655chr834042 3594 1430 14225 ----
NM_002657chr2042700 1102 403 146 --1728 --
NM_002670chr31371 ------
NM_002698chr193341 329 129 --1119 162
NM_002699chr121222 546 ------
NM_002705chr16----3855 93 70 --
NM_002709chr233486 881 366 ------
NM_002711chr7--163 ----
NM_002715chr531082 894 818 ------
NM_002716chr1133403 2553 2383 --23134 2769 --
NM_002717chr8----1530 --
NM_002718chr342387 1899 1859 641 ------
NM_002729chr102141 114 ------
NM_002731chr152892 781 496 478 330 --12781 --
NM_002736chr711724 1525 ----
NM_002745chr2273604 3594 3359 924 297 146 77 2847 229 ----
NM_002752chr51451 ------
NM_002755chr151634 1288 ----
NM_002756chr172970 881 ------
NM_002758chr172411 42 ------
NM_002764chrX160 ------
NM_002787chr71594 ------
NM_002826chr13779 674 349 --1656 --
NM_002834chr1222775 2525 --13062 --
NM_002839chr923538 383 1790 ----
NM_002843chr1133126 2957 2843 --12435 13177
NM_002844chr61270 1954 ----
NM_002866chr191516 ------
NM_002868chr1232334 1654 876 ------
NM_002869chr111344 11387 1655 --
NM_002874chr91100 ------
NM_002890chr5--1157 1250 --
NM_002892chr14------1422
NM_002906chr113699 602 185 ------
NM_002922chr11578 ------
NM_002940chr42599 377 ------
NM_002941chr321464 1355 --1613 --
NM_002942chr3--1454 ----
NM_002943chr15--1129 ----
NM_002955chr651547 1381 585 578 360 ------
NM_002957chr993086 3053 2541 1303 1236 1106 758 521 458 13286 32964 1219 751 --
NM_002990chr1642265 2244 1744 146 ------
NM_003001chr142146 1754 1407 153 2460 400 ----
NM_003010chr1732219 940 121 ------
NM_003016chr1721445 792 --12030 --
NM_003017chr611171 --1100 --
NM_003034chr1268047 6085 5800 5288 3204 1208 32611 2555 244 ----
NM_003036chr121091 1084 ------
NM_003043chr321015 521 --14142 13074
NM_003045chr13103834 3533 3461 3197 1894 1823 1568 972 944 193 ------
NM_003046chr845102 4964 4507 307 ------
NM_003048chr232393 879 864 ----1322
NM_003051chr11793 11986 ----
NM_003070chr93851 325 24 ------
NM_003074chr372123 1950 1735 1692 1442 752 229 --1266 --
NM_003081chr202223 183 ------
NM_003088chr721081 952 --1469 --
NM_003095chr121381 ------
NM_003107chr632044 492 469 ------
NM_003108chr257219 1966 1102 531 213 36140 2483 572 ----
NM_003111chr22369 123 ------
NM_003113chr22587 211 --1184 --
NM_003128chr222209 417 --22229 1026 --
NM_003131chr6----12101 --
NM_003137chr61213 11900 ----
NM_003144chr632202 1785 882 ------
NM_003150chr1712092 11592 2921 375 11473
NM_003155chr832648 1719 85 12799 11779 --
NM_003161chr172604 429 11442 --1643
NM_003170chr172124 24 ------
NM_003178chr361899 1586 1544 615 163 93 ------
NM_003189chr152742 1058 979 889 566 ------
NM_003199chr1855125 4494 4418 1643 813 ------
NM_003216chr2273291 3080 2940 2300 2069 1248 207 --12185 --
NM_003221chr62725 384 11359 ----
NM_003236chr242455 2197 1133 297 ------
NM_003239chr142873 762 ------
NM_003246chr1531726 773 757 ------
NM_003247chr61430 1234 ----
NM_003250chr171326 ------
NM_003253chr2141783 1614 1368 132 ------
NM_003257chr151980 ------
NM_003262chr31565 11902 ----
NM_003274chr2152734 1895 930 410 224 12874 ----
NM_003286chr201367 ------
NM_003298chr365480 2442 1173 752 746 121 34230 2470 2286 12279 --
NM_003304chr331299 1150 255 ------
NM_003337chr51258 ------
NM_003339chr511202 ------
NM_003340chr421277 309 ------
NM_003342chr1743095 3083 2996 868 ------
NM_003344chr731121 1080 172 ------
NM_003348chr1231725 1116 278 2419 134 ----
NM_003349chr2051295 1219 1212 520 296 --11002 --
NM_003352chr21122 1184 ----
NM_003359chr42986 479 ------
NM_003376chr631746 1310 462 --1588 --
NM_003376chr631746 1310 462 --1588 --
NM_003380chr101293 ------
NM_003390chr112791 98 ------
NM_003392chr33880 462 69 ------
NM_003394chr122720 95 ------
NM_003400chr21877 ------
NM_003404chr2011842 ----11305
NM_003405chr221537 ------
NM_003406chr81726 --11525 --
NM_003409chr182211 137 1466 ----
NM_003410chrX22140 1891 ------
NM_003411chrY--11699 ----
NM_003412chr332803 1950 227 ------
NM_003413chrX21928 347 ------
NM_003442chr112816 752 ------
NM_003453chr131608 1635 ----
NM_003457chr17------1417
NM_003458chr333034 2568 2475 --13122 --
NM_003459chr21667 --1560 --
NM_003473chr103913 716 279 --121 --
NM_003477chr113255 85 23 ------
NM_003478chr1132397 2206 461 ------
NM_003482chr1221896 1734 --11858 --
NM_003498chr162954 22 11955 12265 --
NM_003507chr211332 ------
NM_003575chr731211 1105 165 ----1545
NM_003583chr1233477 3444 323 ------
NM_003591chr10153 ------
NM_003597chr241840 1532 564 400 ------
NM_003598chr191172 ------
NM_003603chr41495 ------
NM_003607chr113089 13747 14114 --
NM_003613chr152602 80 ------
NM_003615chr321608 1132 ------
NM_003620chr17163 ------
NM_003622chr1222640 2207 2597 193 ----
NM_003633chr532362 1885 207 ------
NM_003663chr333194 3034 997 --1787 --
NM_003664chr51414 ------
NM_003671chr923246 275 12624 ----
NM_003692chr92879 794 ------
NM_003713chr111124 ------
NM_003714chr532034 412 397 --1532 1204
NM_003716chr31333 ------
NM_003744chr1421148 895 11196 11088 --
NM_003750chr102318 28 ------
NM_003759chr463542 3346 3011 2776 1318 546 ------
NM_003763chr201422 1778 ----
NM_003766chr173504 455 209 ------
NM_003774chr1223207 542 ------
NM_003787chr18185 11565 ----
NM_003794chr32394 215 ------
NM_003796chr191632 ------
NM_003798chr91184 ------
NM_003800chr61552 ------
NM_003806chr12--164 ----
NM_003816chr81325 ------
NM_003822chr142957 2696 2015 1978 ------
NM_003825chr1521363 528 11377 ----
NM_003848chr31350 ------
NM_003858chr142685 241 ------
NM_003861chr1452279 2214 2185 1035 447 ------
NM_003870chr153762 328 223 ------
NM_003872chr232798 850 821 --12619 --
NM_003873chr1041788 840 548 242 1812 ----
NM_003883chr5149 ------
NM_003887chr211854 1369 11733 --
NM_003913chr61558 --1435 --
NM_003934chr921157 495 ------
NM_003939chr1083604 3421 3303 3160 3061 2941 2785 925 11560 22869 1160 --
NM_003941chr732530 2334 1758 ------
NM_003957chr1121009 687 --3767 273 247 --
NM_003958chr653542 2904 2832 2494 498 ------
NM_003966chr586972 2758 2096 1198 810 662 656 579 36465 5289 3097 17594 12595
NM_003968chr32176 170 ------
NM_003975chr11224 1259 --1109
NM_003982chr142248 42 ------
NM_003983chr1653199 1393 1276 335 290 --33563 1192 1097 --
NM_004006chrX1830 ------
NM_004007chrX1830 ------
NM_004009chrX1830 ------
NM_004010chrX1830 ------
NM_004011chrX1830 ------
NM_004012chrX1830 ------
NM_004013chrX1830 ------
NM_004014chrX1830 ------
NM_004015chrX1830 ------
NM_004016chrX1744 ------
NM_004017chrX1830 ------
NM_004018chrX1744 ------
NM_004020chrX1830 ------
NM_004021chrX1744 ------
NM_004022chrX1744 ------
NM_004023chrX1744 ------
NM_004041chr11180 1595 ----
NM_004047chr11274 --197 --
NM_004050chr1442190 519 490 91 ------
NM_004052chr10124 1713 ----
NM_004067chr721129 245 1964 ----
NM_004073chr1179 ------
NM_004075chr12140 ------
NM_004093chr1322709 2613 ----1189
NM_004124chr1442985 2523 2242 659 2975 859 --11298
NM_004132chr1021135 206 ------
NM_004133chr831965 1775 110 ------
NM_004156chr81584 ------
NM_004161chr2--11223 11088 --
NM_004165chr16147 ------
NM_004167chr171227 ------
NM_004171chr11128597 8389 8033 6790 6641 6484 6075 3705 2607 2348 1358 989 17282 28514 850 --
NM_004186chr32245 138 --1889 --
NM_004202chrY182 1223 ----
NM_004227chr733074 2678 2391 ------
NM_004229chrX22033 739 --1607 --
NM_004232chr18----12931 --
NM_004233chr621307 256 --1510 --
NM_004272chr52641 631 1621 ----
NM_004273chr1034269 1851 399 --11348 13289
NM_004274chr1431175 1059 101 1656 ----
NM_004280chr61304 ------
NM_004281chr101108 ------
NM_004288chr21985 --172 --
NM_004290chr521181 1170 ------
NM_004295chr172427 165 11327 1273 --
NM_004308chr1151702 673 460 422 34 ------
NM_004311chr1022568 461 --11076 --
NM_004321chr283390 3168 2752 1353 1182 705 661 222 --23200 1213 --
NM_004349chr8--11209 11083 --
NM_004350chr122023 140 11848 12495 --
NM_004370chr62671 360 ----1750
NM_004379chr21620 ------
NM_004380chr1632322 1967 190 1307 ----
NM_004392chr1332603 1812 931 11005 ----
NM_004393chr33894 658 160 22258 1937 21973 722 12012
NM_004397chr1154300 3262 3182 2722 2659 23660 152 ----
NM_004408chr9--1161 ----
NM_004420chr112513 205 --32168 2058 568 --
NM_004423chr352460 2020 646 285 89 12313 1347 --
NM_004426chr124580 457 166 64 ------
NM_004429chrX2568 559 --1969 --
NM_004430chr822198 1905 ------
NM_004434chr14164 ------
NM_004436chr11153 --1471 --
NM_004438chr242805 2750 1187 480 --2564 148 --
NM_004443chr3----1542 --
NM_004450chr141382 ------
NM_004454chr331945 1466 771 ------
NM_004466chr131792 ------
NM_004472chr51463 --164 --
NM_004474chr111040 ------
NM_004491chr1984128 3901 3428 3194 2994 1284 1259 1146 --32763 1093 948 --
NM_004497chr193619 584 201 176 ----
NM_004500chr141684 11371 ----
NM_004501chr123454 668 13678 21627 324 --
NM_004516chr192441 199 ------
NM_004520chr51788 ------
NM_004529chr941396 1166 956 474 11267 ----
NM_004560chr92908 280 1645 ----
NM_004561chr1131156 736 136 ------
NM_004566chr1052581 1932 1746 483 400 ------
NM_004575chr421563 1502 --11153 --
NM_004580chr151636 ------
NM_004586chrX45222 4340 4070 566 --13853 --
NM_004588chr1123908 3128 --43575 956 387 84 --
NM_004593chr32185 142 ------
NM_004595chrX1427 ------
NM_004598chr532788 619 375 ------
NM_004603chr711141 ------
NM_004606chrX123 ------
NM_004615chrX1314 ------
NM_004654chrY2933 497 ------
NM_004655chr1711355 123 ----
NM_004660chrY32132 938 927 ------
NM_004680chrY2256 127 ------
NM_004687chr171135 3620 258 190 2316 81 --
NM_004690chr62304 253 1496 ----
NM_004711chr2233537 855 448 23631 2355 23342 375 13124
NM_004713chr141643 ------
NM_004730chr531694 1605 534 --12162 --
NM_004734chr1332670 2098 963 ----22940 910
NM_004736chr132265 2089 187 ------
NM_004738chr204850 369 316 35 ----12468
NM_004742chr321626 472 --1376 --
NM_004745chr855763 2504 1819 1474 1229 12469 174 --
NM_004747chr103502 422 344 --1538 --
NM_004760chr732307 853 844 ------
NM_004774chr1742522 2455 537 198 12665 ----
NM_004776chr202709 487 11295 ----
NM_004788chr1132278 2113 76 1380 ----
NM_004796chr1441686 895 554 133 ------
NM_004798chr2032566 769 152 11173 --13357
NM_004815chr144149 3854 3666 1812 14214 ----
NM_004827chr431799 1758 247 ------
NM_004839chr152625 525 ------
NM_004842chr61105 1556 ----
NM_004849chr6185 ------
NM_004862chr1631597 1002 360 --31157 92 75 --
NM_004863chr1465320 3764 3443 1689 709 632 25201 3640 35248 3933 861 1794
NM_004866chr523854 3078 14898 ----
NM_004867chrX126 ------
NM_004871chr1773494 3481 3161 2906 2872 2689 48 --11551 --
NM_004902chr203706 652 585 ------
NM_004904chr754214 1815 583 245 225 --15106 --
NM_004921chr152288 2023 1742 1721 245 ------
NM_004924chr1921039 228 --1974 --
NM_004956chr754526 3688 3531 3010 728 11344 ----
NM_004976chr1163798 2042 1317 1071 393 176 --1289 --
NM_004985chr122321 272 ------
NM_004992chrX77129 5935 5863 2842 2836 1903 1513 11050 --15324
NM_004992chrX77129 5935 5863 2842 2836 1903 1513 11050 --15324
NM_004993chr141578 11303 11468 --
NM_004998chr151127 ----1276
NM_004999chr611621 1142 ----
NM_005011chr721342 1146 1197 ----
NM_005032chrX21072 773 ------
NM_005045chr71367 ----1110
NM_005056chr1284654 4473 3489 1924 1715 719 557 256 11253 ----
NM_005063chr1023341 3249 ------
NM_005067chr31883 1200 ----
NM_005068chr621302 1172 ------
NM_005076chr184199 3839 3651 3618 3464 2968 1036 716 11495 2836 695 --
NM_005079chr822265 444 11000 ----
NM_005095chr1----11570 --
NM_005105chr112065 11672 1798 --
NM_005113chr141460 ------
NM_005121chr1743621 3375 1368 1290 ------
NM_005156chr964926 4372 4135 1410 1233 1127 --11240 14388
NM_005157chr911792 ------
NM_005180chr10----11356 --
NM_005181chr83577 73 55 ------
NM_005188chr1157746 7601 6303 5426 3232 191 2965 645 --
NM_005190chr6----1843 --
NM_005197chr1454755 4412 3910 2431 1648 13862 16056 --
NM_005207chr2221394 1022 ------
NM_005215chr181657 ------
NM_005219chr521319 1125 ------
NM_005222chr71862 ------
NM_005229chrX1890 11183 ----
NM_005233chr332416 979 93 ------
NM_005235chr266725 6391 5835 5528 4875 71 ------
NM_005241chr3----1279 --
NM_005245chr4--1101 ----
NM_005261chr81252 ------
NM_005277chr441805 1260 542 41 ------
NM_005311chr711052 173 11856 --
NM_005327chr4----1253 --
NM_005328chr81660 ------
NM_005339chr433735 1059 384 ------
NM_005342chrX22454 292 ------
NM_005358chr1321550 162 1686 ----
NM_005359chr18116488 6333 6064 5709 5658 4807 4297 4112 2620 2487 2203 25040 1911 16278 --
NM_005375chr6----1736 --
NM_005378chr21785 1249 ----
NM_005385chr33769 758 752 ------
NM_005392chr931654 650 562 --11542 --
NM_005398chr102896 430 ------
NM_005402chr73625 383 337 ----2687 546
NM_005415chr22662 487 ------
NM_005430chr122839 765 --1987 --
NM_005431chr711624 11586 ----
NM_005435chr71522 --1181 --
NM_005436chr1034036 4009 3811 13427 ----
NM_005455chr151200 1173 184 173 78 ------
NM_005465chr111671 --21468 637 --
NM_005474chr1741509 597 573 374 ------
NM_005475chr1232863 1107 898 --21018 870 --
NM_005488chr222706 79 ------
NM_005494chr72654 475 ------
NM_005497chr1753920 3833 1366 955 94 --12451 --
NM_005502chr93795 711 659 ------
NM_005504chr1246500 4354 4320 201 11922 11296 --
NM_005506chr432518 2300 1039 1725 ----
NM_005512chr1161879 682 643 460 356 103 --21845 1248 --
NM_005517chr111053 137 ----
NM_005520chr51148 --1669 --
NM_005536chr8192 150 ----
NM_005539chr1011418 --11300 --
NM_005540chr1199 ------
NM_005562chr131205 1072 635 ------
NM_005563chr1----2791 267 --
NM_005578chr334749 4127 316 ------
NM_005585chr151379 ------
NM_005587chr151955 ------
NM_005594chr12126 ------
NM_005596chr946317 4934 1764 502 ----12323
NM_005598chr141658 1543 662 548 --21388 420 --
NM_005603chr18----1350 --
NM_005627chr62735 68 ------
NM_005638chrX31723 1199 497 ------
NM_005639chr12----1577 --
NM_005664chr15--1203 ----
NM_005665chr154717 3648 1923 1260 859 --13865 --
NM_005667chr21377 ------
NM_005678chr153770 397 177 ------
NM_005722chr232381 893 137 ------
NM_005724chr152549 114 ------
NM_005730chr1263002 2654 1246 993 987 818 --12268 --
NM_005736chr1021240 495 --11591 --
NM_005737chr232847 2826 952 1180 1719 --
NM_005738chr72677 44 ------
NM_005740chr224913 707 657 83 --1595 --
NM_005746chr732242 695 250 ------
NM_005748chr121601 --22340 498 --
NM_005749chr171116 ------
NM_005756chrX--1370 ----
NM_005759chr264629 4022 3858 3782 3754 3412 ------
NM_005766chr1331295 1153 77 ------
NM_005776chr142764 247 ------
NM_005779chr521061 322 1958 ----
NM_005786chr182375 122 --1234 --
NM_005789chr1741692 834 816 59 --11680 1503
NM_005795chr242749 1899 303 193 ------
NM_005819chr143034 2978 1077 329 ------
NM_005828chr1733672 3612 1914 --21050 690 --
NM_005832chr31211 ------
NM_005839chr12880 673 ------
NM_005840chrX47358 6219 5195 2717 --1159 --
NM_005842chr13------1223
NM_005853chr161607 ------
NM_005859chr521438 1259 ------
NM_005860chr1931604 1254 192 --127 --
NM_005862chr3--1189 ----
NM_005863chr1031124 1018 241 11237 ----
NM_005871chr101951 ------
NM_005872chr1----1191 --
NM_005880chr1631242 640 278 ------
NM_005898chr1122382 1159 --12509 --
NM_005899chr1731551 1290 1040 11172 ----
NM_005900chr42342 175 ------
NM_005901chr18118581 6197 5780 5584 5419 5299 3428 2713 1652 1542 1375 16423 38335 6864 2542 --
NM_005902chr1544144 4004 1251 254 ------
NM_005903chr544702 1896 1006 937 13975 13955 --
NM_005904chr1811432 ------
NM_005907chr641685 1299 462 67 ------
NM_005911chr251453 1346 1312 1285 1007 ------
NM_005917chr21138 ------
NM_005935chr464840 1993 1983 1927 1807 1668 ------
NM_005941chr811381 ------
NM_005955chr185568 4789 3967 2136 1003 874 762 569 --13726 15241
NM_005962chr1021967 1737 ------
NM_005962chr1021967 1737 ------
NM_005964chr171318 ------
NM_005966chr21628 12379 ----
NM_005969chr1121066 1046 1416 2772 312 --
NM_005990chr572648 2205 2197 805 714 423 286 --133 --
NM_006015chr111346 1956 11014 --
NM_006030chr361427 1240 728 402 296 141 ------
NM_006036chr222497 479 1270 ----
NM_006037chr253355 1832 1029 694 414 ------
NM_006040chr161222 --1891 --
NM_006047chr2032771 1258 120 12691 ----
NM_006054chr1131634 455 132 ------
NM_006064chrX2424 276 ------
NM_006070chr31133 ------
NM_006076chr763182 2957 2348 1283 897 606 22138 66 1454 --
NM_006079chr61259 ------
NM_006089chrX21813 1348 ------
NM_006095chr453315 2747 407 254 89 ------
NM_006100chr31395 ----1124
NM_006110chr16124 ------
NM_006113chr12650 321 ------
NM_006135chr11406 1279 ----
NM_006141chr1642659 1091 1000 936 ------
NM_006148chr1752437 2331 2056 438 215 --11045 12961
NM_006158chr811791 ------
NM_006166chr1221942 460 186 22210 629 --
NM_006167chr822146 1812 1151 ----
NM_006186chr21362 ------
NM_006191chr122317 183 ------
NM_006192chr2061066 938 864 752 356 321 ------
NM_006195chr91134 ------
NM_006203chr545511 1801 1446 243 ------
NM_006204chr101217 ------
NM_006206chr452262 2058 1907 1819 100 1304 ----
NM_006237chr1372293 2119 1896 1799 1570 885 877 ------
NM_006241chr332270 2000 1725 ------
NM_006243chr11950 ------
NM_006251chr513079 ------
NM_006256chr12925 890 ------
NM_006265chr841473 990 620 281 ------
NM_006267chr23723 442 202 ------
NM_006279chr11316 --1128 --
NM_006281chr8--1465 ----
NM_006281chr8--1465 ----
NM_006283chr874469 4256 3573 1971 1868 1690 743 ------
NM_006306chrX75066 2240 2171 1200 1156 838 106 ------
NM_006310chr1711229 ----1371
NM_006315chr433861 1011 938 --23883 3055 --
NM_006321chr32902 687 ------
NM_006329chr141540 1260 ----
NM_006345chr421388 446 ------
NM_006352chr122051 547 12060 ----
NM_006367chr121006 421 ------
NM_006371chr354493 3876 1983 1869 842 24649 4356 13637 --
NM_006375chrX1321 1414 11161 --
NM_006378chr931367 176 25 ------
NM_006379chr722096 672 ------
NM_006393chr1053196 1406 1154 529 509 --1228 --
NM_006401chr91183 ------
NM_006457chr412500 12936 --11393
NM_006460chr171635 ------
NM_006464chr232866 1639 276 1240 ----
NM_006474chr151996 1980 1324 521 487 ----1730
NM_006482chr1233477 3444 323 ------
NM_006496chr131647 1329 522 --11934 --
NM_006516chr121427 1124 ------
NM_006526chr2012209 --132 --
NM_006534chr2052642 2494 846 787 404 1494 ----
NM_006538chr233035 1003 888 --23753 82 --
NM_006546chr1766242 4329 4048 2581 2368 2136 --21897 1105 --
NM_006547chr722015 1810 1726 ----
NM_006549chr1242372 1847 771 127 --11939 --
NM_006561chr101787 13999 ----
NM_006599chr1657594 7339 6456 5929 5618 ------
NM_006609chr232220 2055 142 12464 ----
NM_006614chr343280 3113 2681 2623 12475 1351 1404
NM_006618chr161525 1312 1200 1014 627 531 11433 ----
NM_006621chr11739 ------
NM_006624chr1021927 1755 ------
NM_006625chr12434 96 ------
NM_006625chr12434 96 ------
NM_006625chr12434 96 ------
NM_006626chr922084 1834 --1843 --
NM_006628chr1543939 3871 1870 576 1190 --13022
NM_006629chr1842393 2140 1991 1969 ------
NM_006634chr2151 --169 --
NM_006646chr1321004 546 --1357 --
NM_006654chr122862 610 --11869 --
NM_006690chr2042021 1997 428 30 ----1762
NM_006698chr2041444 912 429 306 ------
NM_006699chr152683 2248 2124 852 638 ------
NM_006700chr12----1307 --
NM_006703chr61159 ------
NM_006705chr92347 21 ------
NM_006706chr5------1287
NM_006717chr922422 1335 32800 2309 758 ----
NM_006722chr352935 2753 2723 1029 604 11967 ----
NM_006726chr41961 ------
NM_006729chrX34853 4520 1068 --15162 --
NM_006734chr621035 215 ------
NM_006738chr1553856 1581 1340 795 493 --11508 24282 3578
NM_006749chr821265 43 1922 ----
NM_006754chr71115 ------
NM_006766chr821935 1070 ----1912
NM_006769chr11165 ------
NM_006775chr642520 2460 1066 953 1493 --12061
NM_006800chrX--2644 547 ----
NM_006805chr521419 277 --11608 --
NM_006806chr21123 ------
NM_006811chr2021005 630 ------
NM_006815chr12156 ------
NM_006818chr11110 ------
NM_006822chr172249 69 ------
NM_006824chr1183 ------
NM_006826chr221271 286 --1191 --
NM_006827chr1433314 2861 138 1506 ----
NM_006832chr142967 428 ------
NM_006852chr1722110 701 ------
NM_006856chr121825 ------
NM_006857chr22821 44 ------
NM_006875chrX189 2624 289 ----
NM_006885chr1633459 2793 852 --14027 --
NM_006888chr1432843 2453 182 --1595 --
NM_006897chr121199 ------
NM_006898chr24783 639 590 275 ------
NM_006916chr231097 479 172 ------
NM_006922chr2----12372 --
NM_006924chr1794184 4170 3938 3050 2912 2842 948 793 274 --14142 --
NM_006925chr142335 85 ------
NM_006931chr1222147 488 --11589 --
NM_006952chr321147 52 ------
NM_006991chr3----1150 --
NM_007006chr1623444 569 ------
NM_007011chr1566479 5300 5143 4224 2289 273 15729 12308 --
NM_007017chr51738 ------
NM_007031chr21--2473 28 ----
NM_007033chr122065 568 --11429 --
NM_007038chr2164664 4481 3816 1132 428 406 14015 --15289
NM_007039chr141219 ------
NM_007045chr62473 106 ------
NM_007046chr21374 ------
NM_007047chr662401 2393 2106 1758 1589 634 ----138
NM_007050chr2066409 5304 5142 2888 834 130 17005 ----
NM_007052chrX2126 63 ------
NM_007054chr532945 857 692 1200 ----
NM_007064chr341313 1264 1105 427 ------
NM_007067chr1741288 1179 1164 374 ------
NM_007106chr1332533 1953 1808 --12384 --
NM_007107chr322012 1845 11951 ----
NM_007124chr621992 1760 ------
NM_007129chr131402 ------
NM_007137chrX74971 4913 4855 3707 1731 1428 256 1429 --13724
NM_007158chr12912 265 158 1951 --
NM_007159chr31294 ------
NM_007166chr1111383 1246 ----
NM_007175chr842770 1386 976 580 ------
NM_007192chr1421010 328 ------
NM_007200chr1553856 1581 1340 795 493 --11508 24282 3578
NM_007202chr172711 61 ------
NM_007203chr963888 2526 883 397 246 31 1227 ----
NM_007207chr12840 69 --1937 --
NM_007212chr141681 1626 692 647 ------
NM_007217chr32368 302 ------
NM_007218chr81183 1194 ----
NM_007222chr831822 1273 184 ------
NM_007236chr1532095 1877 165 ----1745
NM_007238chr2064654 3873 3802 373 216 104 --13675 --
NM_007246chr42805 793 --1705 --
NM_007249chr1389263 8062 2736 2519 2464 1169 1118 730 21669 1229 18484 12800
NM_007275chr34882 317 305 203 ------
NM_007287chr332855 2555 708 ------
NM_007288chr332855 2555 708 ------
NM_007289chr332855 2555 708 ------
NM_007313chr911792 ------
NM_007345chr181394 21972 1824 ----
NM_007350chr1211508 14309 ----
NM_007358chr131573 1339 1307 ------
NM_007363chrX1996 ------
NM_007373chr1021227 588 ------
NM_007375chr1--1926 1865 --
NM_012081chr533374 2386 186 12337 11153 --
NM_012082chr81179 ----1901
NM_012083chr103979 511 435 ------
NM_012092chr231802 185 123 ------
NM_012095chr101604 --22931 1322 --
NM_012096chr3--23512 406 11211 --
NM_012097chr2--22290 1538 ----
NM_012104chr1153752 3514 1002 517 240 13786 ----
NM_012104chr1153752 3514 1002 517 240 13786 ----
NM_012110chr4----274 63 --
NM_012155chr191197 ------
NM_012156chr2082285 1305 1285 1175 773 416 296 30 --22464 2383 --
NM_012161chr411155 ------
NM_012199chr1104418 4107 4041 3774 3291 1758 1642 764 345 280 --14307 --
NM_012210chr931400 1054 62 ------
NM_012214chr254543 4083 2183 2162 2079 25884 1056 12245 --
NM_012215chr1041886 1838 1808 379 ------
NM_012223chr211198 ------
NM_012232chr1721421 249 --22118 760 12203
NM_012233chr241069 855 447 24 ------
NM_012234chr333554 2823 538 ------
NM_012238chr1011088 --1639 --
NM_012244chr1431811 133 63 11534 ----
NM_012247chr101355 ------
NM_012250chr1121061 1055 ------
NM_012252chr735306 3821 49 --1313 --
NM_012262chr124495 3380 1220 ----
NM_012272chr12192 --1166 --
NM_012279chr511332 ----11933
NM_012281chr722255 849 ------
NM_012288chr645691 5483 1700 1298 15651 53781 1074 541 483 34 --
NM_012293chr251726 916 513 283 132 --11520 --
NM_012301chr721859 1820 --1652 --
NM_012308chr1151737 981 601 532 378 ----12565
NM_012316chr163709 1822 1664 1305 625 66 11007 --22153 1440
NM_012319chr183836 828 357 ------
NM_012325chr2031612 1378 615 ------
NM_012329chr1721359 1264 ------
NM_012330chr102668 97 1698 ----
NM_012333chr111472 --1339 --
NM_012338chr71840 1498 ----
NM_012395chr742799 2257 888 390 ------
NM_012399chr2231752 750 583 ------
NM_012416chr91456 ----1201
NM_012433chr2--166 ----
NM_012458chr191374 ------
NM_013229chr1222798 1970 ------
NM_013231chr1484268 3788 3776 3599 3338 2978 1370 704 --1372 --
NM_013261chr433185 2812 345 ----1283
NM_013269chr1234079 1560 665 --24340 421 --
NM_013279chr1132230 943 532 1135 --1714
NM_013286chr383215 2580 2526 1526 1469 986 810 344 --13228 12403
NM_013333chr19------1363
NM_013341chr222643 838 --2488 428 --
NM_013354chr82531 67 ------
NM_013357chr8----1822 --
NM_013374chr383055 2989 2406 2364 859 826 538 87 ------
NM_013390chr941742 1696 1562 222 11194 1430 --
NM_013399chr1631773 1154 688 --2642 255 --
NM_013410chr15515 469 454 356 64 ------
NM_013423chrX1295 11254 ----
NM_013427chrX1295 11254 ----
NM_013433chr1951768 1636 742 243 91 ------
NM_013436chr22176 46 ------
NM_013447chr1942415 2356 1405 250 ------
NM_013450chr21875 ------
NM_013943chr122729 405 ------
NM_013995chrX32471 1636 1586 ------
NM_014021chr123400 218 --12756 13043
NM_014071chr201188 ------
NM_014112chr844910 4732 4003 585 14131 15442 --
NM_014117chr1642014 1956 1862 479 1561 ----
NM_014153chr161619 ------
NM_014154chr321572 1209 ------
NM_014155chr11106107 5680 5452 5341 2868 1858 1805 1406 1026 322 --1159 27134 6969
NM_014157chr1631305 1222 432 12922 33437 873 101 12802
NM_014186chr1122065 1695 --11660 --
NM_014212chr121976 ------
NM_014231chr122526 457 ------
NM_014232chr1721507 552 ------
NM_014232chr1721507 552 ------
NM_014233chr1731955 1623 1607 --31677 1511 517 --
NM_014240chr333817 2973 2796 1826 1755 --
NM_014243chr41790 ------
NM_014263chr1011275 ------
NM_014268chr1831359 1071 155 --1346 --
NM_014283chr11167 ------
NM_014299chr193885 600 268 1808 21891 702 --
NM_014302chr7--141 ----
NM_014309chr2294378 4364 4035 1684 1602 1025 509 489 409 11142 ----
NM_014323chr222920 222 --1310 --
NM_014325chr1241628 1451 626 68 ------
NM_014331chr457690 7553 5793 5145 4949 1100 ----
NM_014333chr1122353 969 ------
NM_014342chr112992 134 ------
NM_014350chr52327 195 1753 ----
NM_014361chr11141 ------
NM_014372chr121992 44 ------
NM_014392chr431200 1014 632 ------
NM_014393chr822076 346 ------
NM_014397chr9180 ----1557
NM_014415chr31217 ------
NM_014452chr61984 --1991 --
NM_014454chr61887 --1403 --
NM_014458chr131122 1043 929 ------
NM_014488chr111628 ------
NM_014496chrX1228 ------
NM_014554chr1252215 1847 1840 348 204 ------
NM_014574chr1421131 138 ----1109
NM_014584chr1421658 1635 ------
NM_014586chr2154716 4514 3478 1745 1059 11325 --11659
NM_014588chr20----1234 --
NM_014606chr421566 133 ------
NM_014614chr221401 121 11286 ----
NM_014616chr343371 3067 846 247 ------
NM_014630chr1533225 2929 497 12463 1244 --
NM_014636chr923539 3194 14258 159 22854 1633
NM_014646chr1833240 491 32 12477 1877 --
NM_014647chr1621655 421 ------
NM_014667chr31172 1350 12186 --
NM_014670chr231165 628 71 11325 ----
NM_014676chr121208 243 ------
NM_014678chr22133 ----169
NM_014682chr832332 1440 936 --1878 --
NM_014683chr1712117 1112 --1265
NM_014685chr16--1178 ----
NM_014707chr722060 513 ------
NM_014709chr21147 ------
NM_014711chr1611943 ------
NM_014715chr11--1897 ----
NM_014717chr192861 712 ------
NM_014723chr2012100 ------
NM_014730chr1265149 1958 1478 1162 1066 182 --24773 1356 --
NM_014730chr1265149 1958 1478 1162 1066 182 --24773 1356 --
NM_014739chr644177 3911 3266 2618 ------
NM_014741chr1161782 1448 1325 776 426 411 --1651 --
NM_014747chr1105061 4994 4621 4233 3787 1536 1374 1315 748 384 --34986 948 435 1243
NM_014751chr831871 1449 679 ------
NM_014755chr234074 1443 230 ------
NM_014759chr82272 171 --1197 11083
NM_014761chr161957 ------
NM_014765chr132511 2005 56 ------
NM_014779chr331159 298 62 --1267 --
NM_014784chr11165 ------
NM_014810chr163524 2262 1486 743 395 162 ------
NM_014812chr1195 ------
NM_014819chr552072 1773 780 711 482 ------
NM_014820chr311709 11452 1570 --
NM_014822chr42505 155 --157 --
NM_014824chr1121332 144 ------
NM_014826chr113089 13747 14114 --
NM_014828chr1462509 2497 2396 1933 743 87 ------
NM_014829chr522162 143 ------
NM_014830chr1282890 2731 1268 1030 922 543 284 104 12589 21419 869 --
NM_014849chr141253 1033 414 121 ----1373
NM_014850chr353971 3382 1191 1089 560 --165 --
NM_014864chr114323 1110 ----
NM_014868chr123819 734 33 ------
NM_014873chr184766 4174 3964 3782 3317 3073 2964 598 ------
NM_014888chr721597 1445 --1107 --
NM_014890chr3------1303
NM_014897chr1742163 865 452 360 ------
NM_014900chr221034 880 ------
NM_014903chr1221835 1537 --12345 --
NM_014904chr1043450 3025 1049 701 --1994 --
NM_014905chr2183 21606 606 ----
NM_014906chr172726 386 13901 --12569
NM_014912chr1043511 3297 2567 253 --12887 --
NM_014918chr1521363 356 ------
NM_014921chr1982970 2733 2159 628 580 99 65 27 --12685 --
NM_014924chr1432858 901 249 --12390 --
NM_014932chr3----1640 --
NM_014938chr122458 314 --12173 11584
NM_014944chr131473 1298 184 --21145 146 --
NM_014946chr223046 271 ------
NM_014949chr121016 310 1251 ----
NM_014951chr102641 530 --1852 --
NM_014952chr1531978 610 81 --11286 --
NM_014961chr4------1607
NM_014969chr12325 265 ------
NM_014978chr1021777 440 ------
NM_014989chr621927 1733 1222 ----
NM_014991chr422387 1327 1997 13135 --
NM_014994chr15----1264 --
NM_014996chr3--1177 ----
NM_015000chr1222948 470 ------
NM_015001chr1----1637 --
NM_015008chr343624 2977 2836 1074 ------
NM_015020chr1623163 320 23651 3148 ----
NM_015023chr111475 11497 ----
NM_015026chr1224198 380 1278 ----
NM_015027chr1621248 819 ------
NM_015032chr131468 1142 ----
NM_015035chr20126139 5739 5632 5202 5012 4808 4544 4413 2420 2333 2282 1604 14349 26279 2087 --
NM_015039chr184086 1661 1562 1358 387 348 309 272 --1954 --
NM_015042chr1544117 1192 763 352 --23310 872 --
NM_015044chr1653206 3076 2694 467 423 ------
NM_015045chr1011937 11743 ----
NM_015049chr24511 443 351 75 1975 13030 --
NM_015051chr922302 1138 ------
NM_015053chr162332 1905 1703 806 331 224 --12140 --
NM_015063chr192351 75 1255 ----
NM_015068chr751593 1486 981 858 840 ------
NM_015071chr576558 5726 4982 2103 1904 1169 151 11374 14211 --
NM_015075chrX----11525 --
NM_015076chr624533 1585 --1308 13613
NM_015080chr111306 --1646 --
NM_015092chr1654349 3340 3031 1129 26 ------
NM_015093chr61227 ----11234
NM_015094chr2263306 3241 1648 819 445 302 11193 ----
NM_015110chr91208 12255 11583 --
NM_015115chr432869 2775 131 1223 ----
NM_015116chr1311644 11564 ----
NM_015132chr741730 1421 212 23 ------
NM_015138chr1532502 2150 1799 --12550 11016
NM_015144chr1611210 1236 1199 --
NM_015149chr121906 624 1102 22111 1864 --
NM_015155chr1062885 2305 990 863 635 218 ------
NM_015156chr141850 --2829 27 --
NM_015157chr1131130 786 76 ------
NM_015161chr1631161 1103 1015 11068 ----
NM_015163chr1421770 262 1350 ----
NM_015170chr831492 219 105 ------
NM_015171chr16191 ------
NM_015172chr12490 224 ------
NM_015176chr11423 ------
NM_015191chr1121698 173 12747 11764 1358
NM_015196chr4192 ------
NM_015200chr41295 ------
NM_015206chr1522392 816 1466 23754 851 --
NM_015208chr1811310 139 ----
NM_015215chr132729 2026 1946 --12088 --
NM_015216chr5----11081 --
NM_015225chr92305 35 2676 386 1112 --
NM_015230chr4--31708 1295 1206 ----
NM_015231chr114598 213 200 180 --136 --
NM_015234chr611359 --11117 --
NM_015239chr9150 ------
NM_015247chr1645030 4320 1479 619 ------
NM_015250chr92748 468 --11447 --
NM_015254chr862823 1144 1046 537 485 355 1144 22937 593 1295
NM_015263chr152987 156 1885 ----
NM_015268chr3198 --1235 --
NM_015270chr1221908 1708 --12081 --
NM_015271chr432724 2630 1201 1114 ----
NM_015282chr22985 336 ------
NM_015285chr1811611 21741 533 1305 --
NM_015286chr1542401 1983 873 296 11933 ----
NM_015294chr172368 62 ------
NM_015299chr1473830 3682 3275 3121 972 533 114 --1990 --
NM_015310chr866628 3266 2888 1152 964 65 --17823 --
NM_015313chr1154770 3985 3144 1577 879 ------
NM_015317chr242854 2051 1118 387 ----12091
NM_015326chr162770 2308 765 545 292 167 --12560 --
NM_015329chr1932843 939 578 ------
NM_015335chr1222019 412 12059 --11786
NM_015338chr2041904 567 502 173 ------
NM_015339chr20--2236 25 ----
NM_015347chr1222184 185 ------
NM_015349chr621989 351 --1607 --
NM_015355chr17--11758 ----
NM_015361chr2165 ------
NM_015365chrX171 13623 --13976
NM_015375chr184205 4017 3362 1657 1495 620 492 113 13948 ----
NM_015443chr174990 953 482 259 ------
NM_015446chr1--21530 1216 ----
NM_015455chr533666 1563 216 ------
NM_015460chr311623 ------
NM_015472chr32400 156 ------
NM_015472chr32400 156 ------
NM_015477chr1531035 632 148 ------
NM_015497chr1521015 1008 ------
NM_015508chr331246 499 343 11105 ----
NM_015509chr1221649 660 ------
NM_015513chr3189 ------
NM_015514chr141423 ------
NM_015523chr112221 50 ------
NM_015534chr11324 ----2221 202
NM_015535chr232785 2772 431 ------
NM_015541chr32434 370 ------
NM_015559chr1831070 751 302 ------
NM_015564chr522822 2272 ------
NM_015568chr2054023 3636 960 296 239 --21590 1472 11270
NM_015569chr124336 4117 14319 ----
NM_015575chr252673 2665 1192 978 425 1183 ----
NM_015577chr521754 266 --11526 --
NM_015602chr111827 --1654 --
NM_015609chr162899 2804 2763 2052 1165 1139 1643 --12565
NM_015610chr722211 1898 1266 ----
NM_015626chr17--11116 ----
NM_015640chr175302 2117 2027 1984 1702 1663 25 1789 24934 3777 --
NM_015678chr13173 11226 ----
NM_015680chr21584 ----1235
NM_015686chrX21858 1678 ------
NM_015690chr21217 ------
NM_015691chrX32711 727 186 ------
NM_015840chr132578 2102 1760 2542 132 ----
NM_015841chr132578 2102 1760 2542 132 ----
NM_015850chr82544 401 22195 199 1732 --
NM_015866chr11519 11007 ----
NM_015878chr821431 52 ------
NM_015879chr1876752 6707 6494 5660 3363 1711 401 15274 --18469
NM_015886chr855452 5398 4346 4003 3588 13770 ----
NM_015888chr132507 2155 1195 ------
NM_015906chr164683 3993 1806 1402 340 327 ------
NM_015912chr842031 1801 1741 1708 1294 ----
NM_015916chr10141 ------
NM_015976chr11242 ------
NM_015980chr531622 615 199 ------
NM_015981chr542515 2334 1935 343 1645 23183 2693 --
NM_015995chr15105232 4501 4187 4141 3983 2046 1731 1315 883 383 --25025 913 15134
NM_016003chr722211 1898 1266 ----
NM_016009chr121527 522 14473 ----
NM_016018chr832743 2648 105 --1896 12192
NM_016025chr1621470 797 --11920 --
NM_016061chr221277 613 --11181 --
NM_016076chr142708 2491 2386 755 ------
NM_016083chr623074 81 --12516 --
NM_016107chr541255 1155 998 261 ------
NM_016121chr11429 11046 ----
NM_016122chr121394 143 ----
NM_016131chr232329 940 556 ------
NM_016152chr32377 311 ------
NM_016200chr71200 ------
NM_016219chr91455 --1189 --
NM_016227chr11167 ------
NM_016231chr1721683 1632 --11331 --
NM_016260chr242104 1202 1041 401 ------
NM_016263chr1943176 2720 2625 423 --11299 --
NM_016271chr18--1813 ----
NM_016277chr631426 550 176 ------
NM_016281chr1211006 ------
NM_016287chr121786 182 ------
NM_016308chr111534 ------
NM_016315chr221845 1245 ------
NM_016319chr121720 ------
NM_016322chr932714 2607 2340 1363 23255 859 --
NM_016377chr61105 1556 ----
NM_016396chr1541191 1073 374 129 ------
NM_016424chr1721298 643 ------
NM_016427chr18----1109 --
NM_016480chr5123 ------
NM_016485chr632202 1734 101 --1761 --
NM_016488chr1241926 1712 1483 1359 ------
NM_016522chr1121459 307 ------
NM_016525chr92861 632 ------
NM_016530chr1552946 1508 1077 480 452 ------
NM_016531chr433965 3237 2899 ------
NM_016542chrX21443 447 --1639 --
NM_016577chr344236 4056 3290 3264 --13478 --
NM_016578chr111234 ------
NM_016603chr521594 125 12123 ----
NM_016620chr111181 ------
NM_016621chr1174498 3598 3349 1694 1668 1488 1050 --43554 3295 1840 1567 1732
NM_016626chr18------1696
NM_016656chrX2424 276 ------
NM_016824chr10----11603 --
NM_016936chr1632159 1810 314 --199 --
NM_016946chr162928 1315 1299 1166 927 387 21110 478 ----
NM_017410chr1221120 317 --11083 --
NM_017412chr82370 257 ------
NM_017413chrX--1571 12467 --
NM_017420chr1412911 ------
NM_017423chr4------1413
NM_017450chr1721128 56 1141 --11018
NM_017544chrX2834 811 --1714 --
NM_017545chr20--1499 ----
NM_017546chr2190 ------
NM_017548chr331830 1461 871 ------
NM_017594chr91479 ------
NM_017599chr1221550 135 ------
NM_017610chr15150 --1632 --
NM_017626chr1041687 1681 1553 718 160 --1632
NM_017629chr131694 1500 598 --11283 --
NM_017632chr4134 1325 ----
NM_017633chr62594 133 32901 2500 1317 ----
NM_017634chr82341 272 --11288 --
NM_017637chr958915 8326 2474 940 364 18834 --11099
NM_017643chr1722932 2130 11222 ----
NM_017650chr785882 5205 5050 4339 3767 2020 1912 1364 --1351 --
NM_017658chr1444122 4047 3774 3761 13479 ----
NM_017664chr134996 674 359 43 ------
NM_017672chr1511161 ------
NM_017679chr174702 614 469 70 ------
NM_017681chrX1846 1754 ----
NM_017686chr13993 124 26 ------
NM_017693chr131550 ----11373
NM_017699chr3----143 --
NM_017704chr112670 290 ------
NM_017709chr164040 3932 3418 3407 1323 619 ------
NM_017714chr202969 179 ------
NM_017719chr322572 418 ------
NM_017730chr31103 ------
NM_017736chr1643102 2571 2389 1280 2969 618 ----
NM_017738chr941243 859 834 298 ------
NM_017742chr1841453 260 195 187 21290 360 ----
NM_017758chr1741079 452 205 143 11111 ----
NM_017778chr831005 997 140 ------
NM_017780chr82285 169 ------
NM_017786chr82191 112 ------
NM_017787chr1042712 2561 680 109 12242 --1367
NM_017789chr2----1176 --
NM_017811chr932399 2104 766 1917 ----
NM_017813chr835630 1182 78 --11478 --
NM_017848chrX53831 3217 3157 205 118 --13675 --
NM_017896chr2062820 2629 2152 1388 821 628 --13132 --
NM_017913chr91452 ------
NM_017921chr1762202 1927 1640 1482 506 427 --22106 452 --
NM_017945chr311388 ------
NM_017966chr1151359 1314 1209 457 100 ------
NM_017987chr101550 ------
NM_017988chr12----1333 --
NM_018009chr121164 ------
NM_018011chr13--1418 ----
NM_018027chr1032773 2566 829 22845 2071 1358 --
NM_018030chr18177 1170 ----
NM_018061chr11175 ------
NM_018078chr42700 126 ----1242
NM_018084chr212569 ------
NM_018098chr3------195
NM_018103chr11256 ------
NM_018121chr1042805 2084 805 455 ------
NM_018133chr331573 530 30 --11484 --
NM_018151chr21788 1328 ----
NM_018155chr333238 2525 1309 ------
NM_018171chr121827 ------
NM_018184chr32765 326 1622 11634 --
NM_018195chr1131866 1396 196 --1470 --
NM_018206chr161189 ------
NM_018211chr121676 1436 1670 ----
NM_018221chr21161 ------
NM_018227chr422427 2275 12590 ----
NM_018245chr10----1162 --
NM_018299chr823346 2743 ------
NM_018312chr1131827 1774 548 --31901 1859 1785 --
NM_018313chr332568 2521 355 ------
NM_018323chr4--1598 ----
NM_018325chr91402 ----1631
NM_018327chr2011353 ------
NM_018330chr1031239 341 309 ------
NM_018351chr1243828 1123 423 364 ------
NM_018362chr1123795 907 --13644 --
NM_018364chr152540 1279 675 553 477 1988 ----
NM_018371chr811503 1987 ----
NM_018374chr714946 1340 ----
NM_018375chr1451861 1400 1217 453 22 ------
NM_018416chr1212526 12533 ----
NM_018424chr921580 132 11730 ----
NM_018425chr1031855 881 40 --11061 --
NM_018436chr2------183
NM_018439chr182759 147 1645 1898 --
NM_018440chr867797 7001 5789 5557 2021 1615 ------
NM_018444chr831943 354 184 ------
NM_018482chr8--12209 ----
NM_018490chr1111732 1191 1108 --
NM_018566chr134655 4032 3654 ----11617
NM_018571chr22449 110 ------
NM_018638chr1254981 3838 1835 1254 576 ------
NM_018650chr131793 1707 375 ------
NM_018657chr32709 54 ------
NM_018660chr822913 2227 --11163 1598
NM_018697chr71123 --1240 --
NM_018708chr1931664 608 177 ------
NM_018710chr82102 50 11222 ----
NM_018712chr111140 ------
NM_018834chr52941 748 ------
NM_018836chr121210 828 3916 822 73 ----
NM_018841chr143644 3531 3488 221 ------
NM_018846chr7192 174 ----
NM_018898chr522359 193 11655 ----
NM_018899chr522359 193 11655 ----
NM_018900chr522359 193 11655 ----
NM_018901chr522359 193 11655 ----
NM_018902chr522359 193 11655 ----
NM_018903chr522359 193 11655 ----
NM_018904chr522359 193 11655 ----
NM_018905chr522359 193 11655 ----
NM_018906chr522359 193 11655 ----
NM_018907chr522359 193 11655 ----
NM_018908chr522359 193 11655 ----
NM_018909chr522359 193 11655 ----
NM_018910chr522359 193 11655 ----
NM_018911chr522359 193 11655 ----
NM_018945chr621434 1423 ------
NM_018948chr111160 ------
NM_018951chr7----1192 --
NM_018959chr192740 601 --1508 --
NM_018970chr732868 2095 1239 ------
NM_018972chr812424 ------
NM_018976chr1212639 ------
NM_018977chrX--1817 1354 --
NM_018983chr41108 ------
NM_018992chr1621254 427 --1339 --
NM_018999chr1054744 4329 4296 1547 895 ------
NM_019001chr364348 4172 3537 3194 3088 3015 ------
NM_019004chr722170 712 ------
NM_019036chr61942 ------
NM_019041chr662400 2287 2129 1925 888 877 1432 ----
NM_019066chr152325 127 --181 --
NM_019083chr1------1276
NM_019095chr20191 ------
NM_019098chr811753 ------
NM_019116chr1653643 3504 1308 1278 1222 ------
NM_019555chr31502 11654 ----
NM_019597chrX1138 ------
NM_019605chr11677 ------
NM_019843chr222138 121 ------
NM_019903chr10----11603 --
NM_020039chr1231940 1824 1739 11558 1625 --
NM_020116chr41119 ------
NM_020122chr264393 4267 3834 1947 1857 1690 25377 84 14840 --
NM_020123chr1021509 1026 ------
NM_020132chr2133933 1342 781 1115 11011 --
NM_020144chr722085 1897 1655 ----
NM_020150chr102405 210 1536 ----
NM_020159chr4--1273 147 --
NM_020177chr522876 267 ------
NM_020180chr182843 443 ------
NM_020184chr222070 1863 ----22366 738
NM_020185chr62414 50 --1397 --
NM_020193chr1131292 254 38 ------
NM_020194chr22614 476 ------
NM_020204chr11680 --1140 --
NM_020205chr143036 2980 2295 329 ------
NM_020235chr31292 ------
NM_020239chr132217 2157 499 ------
NM_020248chr132256 1939 353 --12246 1942
NM_020251chr11180 1595 ----
NM_020307chr3135 ------
NM_020309chr1911111 ------
NM_020310chr1731711 1034 195 22098 385 11757 --
NM_020337chr412899 ------
NM_020338chr1052836 841 712 507 416 ------
NM_020341chr2031517 675 115 ------
NM_020342chr21151 --1718 --
NM_020344chr9------1128
NM_020346chr1111495 ------
NM_020347chr341916 1740 927 191 ------
NM_020357chr311326 ------
NM_020383chr10------1267
NM_020429chr732049 394 172 11134 1968 --
NM_020432chr721430 271 ------
NM_020438chr931210 1017 325 ------
NM_020443chr145781 4816 2619 2499 --21431 158 14987
NM_020452chr131563 1339 564 ------
NM_020465chr1641914 1743 733 558 --21422 538 --
NM_020466chr634704 3290 700 1114 25011 436 1660
NM_020546chr542567 2227 330 157 ------
NM_020640chr3----1626 --
NM_020644chr111386 --1729 --
NM_020651chr2196 --1488 --
NM_020666chr5--1689 ----
NM_020673chr2067437 1448 1241 1235 845 401 42954 2195 2134 1433 11950 --
NM_020689chr2031529 1114 141 ------
NM_020699chr134805 4307 95 ----25074 4866
NM_020711chr252397 2115 720 423 372 ------
NM_020713chr2073105 2908 2698 2210 1980 1075 580 1419 32750 2266 284 1398
NM_020714chr1914606 14327 12909 --
NM_020717chrX44224 3771 1917 1567 ----14027
NM_020734chr1252906 2348 2274 2151 574 13253 ----
NM_020740chr171337 ------
NM_020742chrX2692 186 ------
NM_020752chr1032661 2014 218 ----12113
NM_020766chrX64547 3892 3538 2948 1578 646 12800 ----
NM_020769chrX3834 379 281 ------
NM_020772chr1736571 6351 5493 ----17542
NM_020794chr121051 230 ------
NM_020796chr552702 2126 2005 971 907 1186 ----
NM_020801chr542558 2093 1804 756 --11793 --
NM_020805chr181117 ------
NM_020819chr611211 1975 ----
NM_020824chr101796 ------
NM_020825chr1653694 2913 1532 973 599 --2522 365 --
NM_020850chr1652725 2374 1187 670 80 1402 --12675
NM_020856chr1911243 ------
NM_020859chr462780 1616 1281 811 366 106 ------
NM_020870chr422040 1533 11826 11368 --
NM_020922chrX1563 ------
NM_020948chr122933 40 13191 ----
NM_020960chr954867 4116 3521 1034 373 ------
NM_020962chr1532119 2028 607 ------
NM_020964chr1824435 3838 --13116 1733
NM_020981chr23632 524 173 196 ----
NM_020983chr1221908 1708 --12081 --
NM_020987chr101308 11301 ----
NM_020993chr1252776 2704 969 601 496 --1460 11988
NM_021003chr141555 ------
NM_021007chr21161 12133 ----
NM_021038chr323242 52 ------
NM_021069chr41495 ------
NM_021097chr212838 22463 2077 ----
NM_021100chr20------1298
NM_021116chr756744 6327 3079 2792 1963 27671 3392 12109 --
NM_021132chr1021245 1156 ------
NM_021136chr141602 ------
NM_021137chr1721998 364 --1382 11650
NM_021141chr23992 977 231 ------
NM_021159chr43557 432 294 ------
NM_021165chr12886 264 ------
NM_021168chr1651599 1171 285 230 213 1385 ----
NM_021177chr6--139 ----
NM_021183chrX1110 ------
NM_021190chr12942 151 ------
NM_021224chr91394 ------
NM_021239chr143578 195 171 ------
NM_021242chrX2965 251 ------
NM_021252chr102605 371 ------
NM_021259chr163748 259 73 11166 ----
NM_021629chr344699 4623 4029 747 13404 --1246
NM_021637chrX21344 1249 ------
NM_021643chr231865 612 124 11835 ----
NM_021647chr454034 2963 1419 1057 498 64628 3628 1685 1556 799 286 ----
NM_021728chr141388 ------
NM_021813chr624757 110 14370 ----
NM_021818chr14180 11303 ----
NM_021912chr1523559 3541 23700 565 ----
NM_021949chrX22741 1129 --11866 --
NM_021960chr142683 2677 2263 567 ------
NM_021961chr1186919 5436 5340 2904 2804 2226 628 211 --24821 2404 --
NM_021964chr354751 4324 1797 1078 727 12090 ----
NM_021988chr2051295 1219 1212 520 296 --11002 --
NM_022041chr1632697 2297 125 12068 ----
NM_022048chr1584620 1928 1879 1684 1517 809 351 260 ----11222
NM_022062chr1151772 1527 1312 698 372 ------
NM_022085chr621339 1009 1362 11106 --
NM_022105chr202589 192 1137 ----
NM_022114chr154287 3764 841 381 329 24430 1528 24084 1836 --
NM_022143chr721433 281 11095 ----
NM_022152chr21786 --2216 178 --
NM_022154chr41216 11286 ----
NM_022166chr1674888 4300 4159 1396 613 407 243 --11717 --
NM_022340chr342326 1469 741 391 13544 ----
NM_022366chr1123 ------
NM_022371chr12530 141 --1270 --
NM_022442chr2051295 1219 1212 520 296 --11002 --
NM_022457chr1----1239 --
NM_022459chr1346189 5177 2082 492 25800 440 24405 1893 --
NM_022462chr19123801 3644 3541 3078 2737 2673 2492 1484 1386 1304 1095 278 12475 ----
NM_022465chr1242862 2128 770 548 12193 ----
NM_022473chr1544300 3830 3721 2741 ----34157 1528 90
NM_022479chr72982 276 21397 1383 ----
NM_022483chr521799 1206 ------
NM_022484chr72982 559 ----11318
NM_022497chr331432 251 88 11526 ----
NM_022552chr21996 ------
NM_022566chr15----1474 --
NM_022574chr721633 788 1796 12201 --
NM_022648chr244052 3400 1403 713 --24547 777 --
NM_022650chr5--1157 1250 --
NM_022659chr81151 ------
NM_022719chr2233107 1524 752 --23295 1326 --
NM_022726chr611179 2647 610 11201 --
NM_022753chr142757 2185 1783 362 ------
NM_022763chr31149 1880 ----
NM_022771chr122705 84 --1802 --
NM_022780chr241448 1419 651 205 ------
NM_022781chr962758 1274 809 749 563 263 1429 ----
NM_022845chr1621839 1726 ------
NM_022893chr223092 1167 --12039 1970
NM_022898chr1464820 4601 4425 3499 1758 896 13299 13006 --
NM_022910chr1641914 1743 733 558 --21422 538 --
NM_022918chr1121471 1429 ------
NM_023000chr14------1422
NM_023001chr14------1422
NM_023009chr13716 558 183 --177 --
NM_023012chr122702 162 ------
NM_023016chr242793 2280 958 578 ------
NM_023034chr83223 167 158 ------
NM_023039chr5144 ------
NM_023076chr1642189 2169 2044 85 --22536 290 --
NM_023079chr1741899 1675 1536 731 ------
NM_023105chr82544 401 22195 199 1732 --
NM_023106chr82544 401 22195 199 1732 --
NM_023110chr82544 401 22195 199 1732 --
NM_023111chr82544 401 22195 199 1732 --
NM_023923chr123516 879 --23694 437 --
NM_023929chr832244 2187 1835 ------
NM_023940chr43808 663 96 ------
NM_024007chr5--12599 1836 --
NM_024019chr4----1367 --
NM_024034chr20----21016 21 --
NM_024052chr172972 424 --1370 --
NM_024060chr11----1216 --
NM_024061chr71169 ------
NM_024092chr1111215 --11058 --
NM_024111chr152585 217 ------
NM_024306chr163934 479 182 --1205 1224
NM_024324chr221156 ------
NM_024345chr986108 5797 2064 366 264 156 114 34 ------
NM_024421chr182432 165 ------
NM_024424chr112267 240 ------
NM_024425chr112267 240 ------
NM_024426chr112267 240 ------
NM_024496chr141288 ------
NM_024522chr141915 1821 1683 684 --21375 90 --
NM_024524chr32615 312 ------
NM_024527chr19------130
NM_024545chr23717 694 299 ------
NM_024551chr1232112 1868 348 --1655 --
NM_024551chr1232112 1868 348 --1655 --
NM_024554chr131131 625 155 1310 196 --
NM_024556chr112397 178 ------
NM_024558chr1421017 1000 ------
NM_024590chr421518 1304 --11539 1501
NM_024595chr13468 434 169 ------
NM_024665chr333804 1829 648 1803 ----
NM_024674chr122685 731 13104 12394 --
NM_024721chr821033 467 ------
NM_024742chr163342 230 184 --31589 1275 1250 --
NM_024744chr221686 677 136 1828 --
NM_024761chr924700 1679 14933 148 13996
NM_024766chr22439 388 ------
NM_024771chr1162307 2194 1840 1783 762 60 --32026 1739 987 --
NM_024784chr11163 ------
NM_024792chr1721123 432 ------
NM_024798chr1522731 2307 ------
NM_024834chr1021622 135 --11762 --
NM_024875chr1011524 ------
NM_024881chr1942778 967 875 575 42759 2562 1359 31 1661 --
NM_024887chr11237 ----2782 73
NM_024899chr18--1461 ----
NM_024917chrX2843 151 --1889 --
NM_024947chr3129288 9191 8908 8699 7347 7236 6158 5847 3810 2563 767 76 16842 23836 3380 --
NM_024949chr463845 941 556 351 236 85 ------
NM_024953chr1231921 411 77 ------
NM_024993chr221188 335 --1343 --
NM_025057chr142533 144 ------
NM_025073chr121870 522 --1551 --
NM_025076chr21668 ------
NM_025099chr1751276 894 355 153 146 ------
NM_025133chr21291 11020 ----
NM_025138chr131428 ------
NM_025146chr322766 593 1744 12695 --
NM_025147chr2--1915 ----
NM_025160chr141273 1037 513 71 23228 1538 ----
NM_025164chr112771 270 --11834 --
NM_025182chr921040 379 ------
NM_025187chr1631218 450 206 ------
NM_025195chr821924 444 ------
NM_025222chr342963 2920 820 401 --2763 200 --
NM_025248chr1763065 2883 2668 2008 984 172 11141 --11150
NM_025250chr752776 2488 2280 879 783 --1738 --
NM_025263chr63511 310 176 --21282 723 --
NM_030576chr1742658 2004 1806 654 11968 ----
NM_030621chr1422908 1404 1607 ----
NM_030625chr1031669 403 287 ------
NM_030627chr543512 3181 867 820 12664 ----
NM_030630chr17148 ------
NM_030634chr121923 1530 1279 11676 --
NM_030640chr123933 643 306 ------
NM_030647chr765777 5172 4001 2485 1798 1347 12454 34767 4237 192 --
NM_030648chr445071 2157 650 261 14175 14334 --
NM_030650chr233796 2877 398 13537 1894 --
NM_030660chr141578 11303 11468 --
NM_030664chr10----11816 12364
NM_030674chr1265620 4021 1601 1367 793 709 ------
NM_030780chr821693 285 ------
NM_030786chr11755 21271 770 11463 --
NM_030802chr17----3887 259 47 --
NM_030808chr171280 ------
NM_030809chr1282440 2242 1695 1532 633 597 469 435 --11552 --
NM_030810chr621339 1009 1362 11106 --
NM_030816chr153402 3154 3057 2979 944 ------
NM_030927chr1051524 1028 620 351 160 11281 11035 --
NM_030937chr121301 22 --31190 331 164 --
NM_030953chr51191 1325 ----
NM_030964chr583501 3360 2850 2561 2547 2438 1495 42 ------
NM_031157chr12----1491 --
NM_031216chr1821699 1583 ------
NM_031243chr721999 1625 --12244 --
NM_031262chr93850 450 247 ------
NM_031263chr92907 304 ------
NM_031268chr1674978 4574 4025 2030 1523 1306 604 --21390 328 --
NM_031314chr141684 11371 ----
NM_031372chr431387 1082 524 ------
NM_031411chr522359 193 11655 ----
NM_031424chr202558 122 ------
NM_031427chr1475863 5338 4905 4071 2166 1837 1317 35723 4562 888 11667 11982
NM_031439chr82356 301 1448 ----
NM_031442chrX63086 2176 2148 1292 1281 655 ------
NM_031443chr71404 --194 --
NM_031445chr263379 2860 1297 1061 298 83 ------
NM_031453chr1021959 332 ------
NM_031469chr623328 48 12948 --1539
NM_031483chr2033185 2784 407 1953 ----
NM_031844chr123454 668 13678 21627 324 --
NM_031845chr223292 878 ------
NM_031847chr223292 878 ------
NM_031849chr522359 193 11655 ----
NM_031857chr522359 193 11655 ----
NM_031858chr1731551 1290 1040 11172 ----
NM_031860chr522359 193 11655 ----
NM_031862chr1731551 1290 1040 11172 ----
NM_031899chr361077 301 240 206 195 104 ------
NM_031935chr11144 ------
NM_031938chr111646 ------
NM_031954chr1242558 1161 786 496 --1713 --
NM_032012chr944849 1255 396 216 14755 ----
NM_032028chr51144 ------
NM_032042chr512218 --11127 --
NM_032047chr332183 589 489 --1434 --
NM_032050chr222920 222 --1310 --
NM_032102chr11----11007 --
NM_032105chr1107149 7058 5570 5345 3129 2920 1975 1580 959 236 16011 25828 968 --
NM_032116chr1331856 676 27 --11976 13845
NM_032121chrX22728 340 --11089 --
NM_032144chr21194 --1507 --
NM_032186chr111181 ------
NM_032199chr1063372 3348 3238 2981 2437 1513 23610 202 13201 13429
NM_032221chr2022054 467 --1621 1275
NM_032236chr11701 ------
NM_032271chr163477 423 339 ------
NM_032288chr372311 2247 1609 808 642 405 377 --12083 --
NM_032295chr71250 ------
NM_032352chr141967 --11120 --
NM_032466chr8--1345 ----
NM_032471chr62364 83 1434 ----
NM_032482chr1921952 1816 --32308 817 413 11683
NM_032505chr331715 796 720 ------
NM_032536chr91468 ------
NM_032547chr421305 458 ------
NM_032550chr101342 21158 396 --148
NM_032552chr931908 1462 613 --11224 --
NM_032575chr1611874 ------
NM_032632chr141626 1123 ----
NM_032638chr321072 569 --1376 --
NM_032646chr1741360 618 376 40 1649 ----
NM_032689chr1921030 142 ------
NM_032711chr1753499 3181 1377 1203 289 33440 3239 1213 24176 3202 23768 1175
NM_032758chr223680 667 428 ------
NM_032804chr1031825 654 209 --12449 11681
NM_032810chr10141 ------
NM_032837chr1722069 777 ------
NM_032859chr1321075 800 32738 2574 628 ----
NM_032876chr1421382 470 ------
NM_032883chr20----1878 --
NM_032905chr1021190 218 ------
NM_032932chr17106416 5937 5616 4345 4293 4287 4183 3924 1867 1106 --35899 3992 2381 1972
NM_032993chr41108 ------
NM_032995chr221375 199 1149 1579 --
NM_033020chr164683 3993 1806 1402 340 327 ------
NM_033025chr193804 749 111 --1367 170
NM_033036chr11--1249 ----
NM_033058chr82838 92 1686 ----
NM_033081chr2011219 ------
NM_033082chr12160 ------
NM_033089chr20--1179 ----
NM_033132chr13--11670 ----
NM_033136chr541285 1158 740 239 ------
NM_033137chr541285 1158 740 239 ------
NM_033161chr961711 1611 1466 641 475 115 ------
NM_033181chr623074 81 --12516 --
NM_033211chr51332 --11408 --
NM_033224chr738014 7659 1963 ------
NM_033267chr52771 105 --142 --
NM_033274chr543079 2721 1302 533 1845 1783 --
NM_033281chr51171 ------
NM_033285chr821349 34 21295 993 ----
NM_033290chrX63781 3133 3112 2564 507 284 --12756 --
NM_033296chr43296 44 35 1667 ----
NM_033326chr1122507 1001 ------
NM_033331chr923246 275 12624 ----
NM_033360chr122442 393 ------
NM_033389chr1784382 4350 3246 3054 3006 1898 775 123 --14766 --
NM_033394chr211221 --153 --
NM_033425chr1143083 2482 176 36 12339 12473 --
NM_033449chr511667 ------
NM_033503chr1543484 1389 1004 714 12876 --12521
NM_033505chr256017 5781 4527 1220 750 11589 ----
NM_033512chr862997 2912 2480 1181 789 45 1701 ----
NM_033535chr411155 ------
NM_033631chr173708 2980 2812 2384 1495 1356 397 --22400 345 --
NM_033637chr1083604 3421 3303 3160 3061 2941 2785 925 11560 22869 1160 --
NM_044472chr12475 281 ------
NM_052834chr1811611 21741 533 1305 --
NM_052840chr1531487 1402 133 21236 231 ----
NM_052846chr2021257 853 --1493 --
NM_052855chr172484 106 --1197 --
NM_052869chr1741360 618 376 40 1649 ----
NM_052879chr1234015 3551 3374 ------
NM_052880chr22291 38 --11338 --
NM_052885chr1233399 1059 90 164 ----
NM_052886chr862119 1918 1885 1601 651 145 ------
NM_052898chr831878 1692 1468 ------
NM_052905chr231877 1187 336 ----11277
NM_052906chr2254835 3514 1822 1399 981 ----122
NM_052910chr1321832 1516 ------
NM_052911chr182736 368 ------
NM_052918chr1023024 847 --13560 --
NM_052925chr191741 ------
NM_052927chr5----12036 --
NM_052934chr132101 579 478 1229 ----
NM_052954chr212584 535 11697 ----
NM_052978chr1421690 1543 11380 1254 --
NM_053002chr341080 1046 958 287 ------
NM_053016chr977819 7273 6268 2012 1922 884 402 17746 ----
NM_053024chr31145 ------
NM_053025chr321713 1116 ------
NM_053026chr321713 1116 ------
NM_053027chr321713 1116 ------
NM_053028chr321713 1116 ------
NM_053031chr321713 1116 ------
NM_053032chr321713 1116 ------
NM_053056chr1143090 3001 973 669 ------
NM_053064chr1452348 2116 733 250 151 ------
NM_054016chr1--1273 ----
NM_054016chr1--1273 ----
NM_054016chr1--1273 ----
NM_057159chr931569 1243 326 ------
NM_057161chr6197 --1219 --
NM_057175chr432474 2243 646 ------
NM_057178chr1742514 1133 438 237 22328 589 ----
NM_058172chr431687 1623 1149 ------
NM_058241chr232203 1939 1760 ------
NM_058241chr232203 1939 1760 ------
NM_078485chr62738 485 ----145
NM_078629chrX--2644 547 ----
NM_078630chrX--2644 547 ----
NM_080391chr12458 55 ------
NM_080392chr12507 104 ------
NM_080546chr921656 1614 ------
NM_080591chr952802 1254 624 289 97 1396 12085 --
NM_080597chr18177 1170 ----
NM_080629chr12278 202 --147 --
NM_080630chr12278 202 --147 --
NM_080645chr62671 360 ----1750
NM_080664chr1432009 1593 35 ------
NM_080666chr142628 307 --11497 --
NM_080671chr232136 120 77 ------
NM_080676chr2053139 2445 738 347 211 ------
NM_080679chr61664 ------
NM_080680chr61664 ------
NM_080681chr61664 ------
NM_080717chr12----1397 --
NM_080737chrX21421 1212 ------
NM_080738chr131704 1612 748 --21854 1670 --
NM_080759chr1332603 1812 931 11005 ----
NM_080760chr1332603 1812 931 11005 ----
NM_080764chr2221140 195 11056 ----
NM_080792chr20----12035 21795 557
NM_080796chr202589 192 1137 ----
NM_080865chr32702 610 ----1121
NM_080867chr141649 33220 1934 1374 1592 --
NM_080872chr853937 2923 1436 1395 394 ------
NM_130387chr32930 54 ------
NM_130391chr923538 383 1790 ----
NM_130392chr923538 383 1790 ----
NM_130393chr923538 383 1790 ----
NM_130436chr2132739 2186 326 ------
NM_130438chr2133316 2763 903 ------
NM_130439chr1021967 1737 ------
NM_130439chr1021967 1737 ------
NM_130798chr1521363 528 11377 ----
NM_130808chr31390 1130 ----
NM_130811chr202223 183 ------
NM_130838chr15196 ----11434
NM_130839chr15196 ----11434
NM_130848chr53822 329 98 ------
NM_133170chr2066409 5304 5142 2888 834 130 17005 ----
NM_133171chr2041055 172 112 70 --1980 --
NM_133264chr1723159 885 1184 ----
NM_133329chr21111 ------
NM_133372chr532809 474 28 1689 ----
NM_133444chr192600 94 --31514 442 292 --
NM_133446chr10----133 --
NM_133477chr4----1511 --
NM_133486chrX----1389 --
NM_133631chr321464 1355 --1613 --
NM_133646chr265532 4537 4312 2133 1455 1253 ------
NM_134260chr15--1129 ----
NM_134261chr15--1129 ----
NM_134262chr15--1129 ----
NM_134265chr17--11116 ----
NM_134428chr9----1343 --
NM_134442chr21620 ------
NM_134447chr191632 ------
NM_138288chr1422131 1677 21852 699 ----
NM_138300chr131416 617 80 ----21114 636
NM_138338chr2242725 2438 2251 565 --23179 2620 11043
NM_138369chr5--139 ----
NM_138391chr12635 256 ------
NM_138396chr122897 761 1652 --1339
NM_138413chr1031018 906 230 --1985 --
NM_138415chr221409 ------
NM_138426chr712058 12165 ----
NM_138437chrX165 ------
NM_138457chr653277 2443 1159 735 207 ------
NM_138459chr673392 2480 702 661 653 631 375 13534 ----
NM_138468chr235153 4634 575 --15346 --
NM_138473chr1254811 3211 1642 509 226 --25100 3588 --
NM_138494chr722109 738 ------
NM_138571chr6135 ------
NM_138576chr1464820 4601 4425 3499 1758 896 13299 13006 --
NM_138621chr233035 1003 888 --23753 82 --
NM_138633chr61105 1556 ----
NM_138713chr1657594 7339 6456 5929 5618 ------
NM_138714chr1657594 7339 6456 5929 5618 ------
NM_138732chr111306 --1646 --
NM_138734chr111306 --1646 --
NM_138766chr51553 ------
NM_138811chr731128 773 155 ------
NM_138821chr51553 ------
NM_138822chr51553 ------
NM_138923chrX123 ------
NM_138970chr1441686 895 554 133 ------
NM_138971chr1153752 3514 1002 517 240 13786 ----
NM_138971chr1153752 3514 1002 517 240 13786 ----
NM_138972chr1153752 3514 1002 517 240 13786 ----
NM_138972chr1153752 3514 1002 517 240 13786 ----
NM_138973chr1153752 3514 1002 517 240 13786 ----
NM_138973chr1153752 3514 1002 517 240 13786 ----
NM_138992chr212923 178 ------
NM_139014chr641555 913 545 89 ------
NM_139015chr1241443 1240 1145 84 ------
NM_139045chr93851 325 24 ------
NM_139062chr172443 40 ------
NM_139070chr51451 ------
NM_139135chr111346 1956 11014 --
NM_139159chr192870 211 ------
NM_139168chr521585 450 ------
NM_139182chr4--31708 1295 1206 ----
NM_139201chr124157 118 44 25 ------
NM_139243chr4145 ------
NM_139276chr1712092 11592 2921 375 11473
NM_139279chr231096 542 23 --12640 --
NM_139283chr1242220 2164 2137 490 --12576 --
NM_139312chr1011275 ------
NM_139321chr2024266 3315 --12844 --
NM_139323chr2011842 ----11305
NM_144571chr436347 5249 854 ------
NM_144578chr1485160 4840 4333 1372 1119 945 610 488 ------
NM_144579chr272812 2756 2735 2606 2385 1809 455 --22583 2192 --
NM_144580chr1----1236 --
NM_144590chr101832 1657 1405 --
NM_144599chr1574657 3646 3598 3451 3415 338 130 14168 13931 --
NM_144632chr221876 793 ------
NM_144633chr33602 509 78 ------
NM_144642chr31408 ------
NM_144664chr111116 ------
NM_144703chr2011052 --1433 --
NM_144723chr51665 ------
NM_144728chr12840 69 --1937 --
NM_144729chr12840 69 --1937 --
NM_144767chr1553856 1581 1340 795 493 --11508 24282 3578
NM_144775chr1784707 3919 1392 1258 1071 441 264 106 24389 3262 21576 315 1231
NM_144778chr1312568 ------
NM_144963chr831995 1938 438 11807 ----
NM_144967chrX3889 742 185 ------
NM_145005chr92257 182 ------
NM_145049chr52739 121 ------
NM_145055chr1843781 3049 2804 807 --11404 1271
NM_145056chr191148 ------
NM_145109chr172970 881 ------
NM_145117chr1142178 1117 954 525 22451 974 ----
NM_145165chr14--22682 2428 1281 --
NM_145185chr1911724 --1690 --
NM_145203chr133300 239 123 1170 ----
NM_145259chr21568 --14381 --
NM_145307chr1024018 3252 11559 ----
NM_145313chr1041666 1319 532 436 ------
NM_145332chr62633 30 ------
NM_145333chr62633 30 ------
NM_145690chr81726 --11525 --
NM_145727chr62937 282 --2388 46 --
NM_145728chr1542401 1983 873 296 11933 ----
NM_145808chr732380 2063 921 22863 527 ----
NM_145859chr32368 302 ------
NM_145860chr32368 302 ------
NM_145861chr131704 1612 748 --21854 1670 --
NM_145891chr1611126 ------
NM_145892chr1611126 ------
NM_145893chr1611248 ------
NM_145899chr621302 936 --1333 --
NM_145901chr621302 936 --1333 --
NM_145902chr621302 936 --1333 --
NM_145903chr621302 936 --1333 --
NM_145904chr621302 936 --1333 --
NM_145905chr621302 936 --1333 --
NM_145909chr61216 ------
NM_147150chr963888 2526 883 397 246 31 1227 ----
NM_147156chr102325 138 11140 ----
NM_147166chr71602 ------
NM_147175chrX12140 ------
NM_147223chr231877 96 65 ------
NM_148174chr821431 52 ------
NM_148571chr172251 242 --1227 1296
NM_148894chr4----166 --
NM_152238chr11242 ------
NM_152247chr221237 ------
NM_152253chr2233623 1077 461 --2553 29 --
NM_152261chr1232121 1822 215 ------
NM_152265chr14511 285 253 219 ------
NM_152267chr2251867 1721 870 690 420 145 167 1716
NM_152272chr821372 1314 ------
NM_152277chr52657 531 11917 ----
NM_152380chr121492 1086 --11414 --
NM_152400chr431925 1832 707 ------
NM_152409chr533364 2520 64 22770 762 ----
NM_152414chr82347 278 ------
NM_152422chr91219 ------
NM_152423chrX21577 541 ------
NM_152448chr152512 452 ------
NM_152462chr171100 --1148 --
NM_152470chr1873367 2583 1332 1309 1141 536 142 ------
NM_152493chr14367 207 157 137 ------
NM_152519chr221960 806 ------
NM_152522chr2----1862 --
NM_152546chr521131 1063 ------
NM_152556chr722009 95 2981 557 1723 --
NM_152594chr1552220 1964 734 237 101 12006 ----
NM_152608chr122015 198 --1257 --
NM_152624chr596274 5150 4595 4496 1764 1540 1460 477 287 --46940 5297 5250 1924 --
NM_152629chr973772 3605 2695 1417 1284 937 204 ------
NM_152636chr1122284 554 --1189 --
NM_152641chr1222140 543 ------
NM_152653chr31496 ------
NM_152671chr21105 ------
NM_152678chr332543 2287 341 ------
NM_152682chr421140 80 11639 1313 --
NM_152688chr61268 ------
NM_152699chr342565 2447 591 316 12606 ----
NM_152716chr111624 ------
NM_152721chr181707 ------
NM_152756chr524100 3859 ------
NM_152758chr822242 617 --21908 645 --
NM_152787chrX42733 2677 2484 413 11460 ----
NM_152792chr23357 166 36 ------
NM_152793chr763914 3193 1490 1260 1096 235 --13399 --
NM_152835chr122623 670 2783 525 ----
NM_152838chr2032771 1258 120 12691 ----
NM_152857chr61966 ------
NM_152858chr61966 ------
NM_152890chr111221 --1521 --
NM_152910chr132368 48 ------
NM_152919chr1942415 2356 1405 250 ------
NM_152924chr1566479 5300 5143 4224 2289 273 15729 12308 --
NM_153029chr1634027 3215 1407 --23033 582 --
NM_153035chr12438 205 1908 ----
NM_153188chr534968 4467 1498 13817 ----
NM_153207chr1263131 3025 2984 1485 978 685 --14112 --
NM_153252chrX1115 ------
NM_153273chr372573 1818 1728 775 380 230 116 --1269 --
NM_153332chr82525 341 ------
NM_153333chrX1127 ------
NM_153367chr1022850 1588 --33433 1127 859 1687
NM_153371chr133825 780 320 22240 459 12115 --
NM_153453chr61324 ------
NM_153607chr552425 2305 2151 2137 1158 ------
NM_153620chr72621 212 --1572 --
NM_153634chr1221345 667 --166 --
NM_153686chr432401 2374 862 21823 416 ----
NM_153689chr221632 1523 1367 ----
NM_153715chr7----1192 --
NM_153756chr131657 1613 1502 ------
NM_153759chr21996 ------
NM_153810chr1055055 3647 769 395 147 --13126 --
NM_153812chr162165 2085 887 797 601 96 --1812 --
NM_153825chr421579 575 11589 ----
NM_153836chr23525 413 282 --125 --
NM_170665chr1234452 1813 1072 1109 11826 --
NM_170674chr1511038 ------
NM_170675chr151714 ------
NM_170676chr151714 ------
NM_170677chr1511038 ------
NM_170706chr184086 1661 1562 1358 387 348 309 272 --1954 --
NM_170711chr193916 777 629 --1684 --
NM_170719chr131428 ------
NM_171825chr542515 2334 1935 343 1645 23183 2693 --
NM_171998chrX2564 346 ------
NM_172020chr731609 1421 482 --1687 --
NM_172058chr82734 442 ----1113
NM_172059chr82734 442 ----1113
NM_172060chr82734 442 ----1113
NM_172069chr21744 12011 ----
NM_172070chr232129 1973 152 11938 ----
NM_172071chr146613 6511 2837 850 ------
NM_172078chr7136 ------
NM_172079chr7136 ------
NM_172080chr7136 ------
NM_172081chr7136 ------
NM_172082chr7136 ------
NM_172083chr7136 ------
NM_172084chr7136 ------
NM_172127chr41515 1727 1505 --
NM_172128chr41471 1683 1461 --
NM_172169chr1041590 1412 689 395 ------
NM_172170chr1041590 1412 689 395 ------
NM_172171chr1041590 1412 689 395 ------
NM_172173chr1041590 1412 689 395 ------
NM_172216chr1242372 1847 771 127 --11939 --
NM_172315chr1511038 ------
NM_172316chr1511038 ------
NM_172337chr141388 ------
NM_172344chr21111 ------
NM_173054chr71367 ----1110
NM_173078chrX1402 ------
NM_173156chr142032 660 578 268 ------
NM_173163chr161437 1457 ----
NM_173165chr161318 1338 ----
NM_173171chr21362 ------
NM_173172chr2----1257 --
NM_173173chr21362 ------
NM_173214chr1657594 7339 6456 5929 5618 ------
NM_173454chr152269 79 ------
NM_173468chr431254 478 241 ------
NM_173470chrX42799 1955 1026 299 ------
NM_173472chr31194 ----154
NM_173473chr104719 666 129 25 ------
NM_173510chr2222922 662 ------
NM_173511chr22490 84 --12849 --
NM_173552chr31338 ------
NM_173557chr181103 ------
NM_173562chr642551 791 248 225 --1496 --
NM_173576chr1022092 1834 ------
NM_173595chr1295270 5251 5038 4730 1365 1217 472 299 214 ------
NM_173602chr1273538 3194 2967 2627 1479 1277 753 ------
NM_173626chr17--1537 ----
NM_173662chr4147 ------
NM_173672chr622558 903 ------
NM_173683chr851566 1497 1282 1121 403 1530 11334 --
NM_173808chr144388 4192 4004 66 ------
NM_173822chr221434 855 ------
NM_173829chr545332 5307 5240 2400 --12458 --
NM_173872chr42769 98 ------
NM_174890chr10------1177
NM_174911chr893345 2839 1446 1436 1346 1160 1083 408 301 41393 1370 554 141 ----
NM_174916chr1532179 359 287 ------
NM_174921chr411066 ------
NM_174963chr11316 --1128 --
NM_174964chr11316 --1128 --
NM_174965chr11335 --1147 --
NM_174966chr11316 --1128 --
NM_174967chr11335 --1147 --
NM_174968chr11316 --1128 --
NM_174969chr11316 --1128 --
NM_174970chr11335 --1147 --
NM_174971chr11316 --1128 --
NM_174976chr1421991 161 --11984 --
NM_175061chr721744 1678 ------
NM_175566chr11141 ------
NM_175607chr32497 431 ------
NM_175610chr151980 ------
NM_175612chr32497 431 ------
NM_175624chr1226682 1551 12698 ----
NM_175625chr1226682 1551 12698 ----
NM_175629chr21996 ------
NM_175634chr8--11209 11083 --
NM_175635chr8--11209 11083 --
NM_175636chr8--11209 11083 --
NM_175733chr11--1165 --1334
NM_175736chr1277518 7001 6108 5342 2865 1404 396 11632 1183 --
NM_175748chr143602 485 305 11594 1842 --
NM_175854chr1342665 2282 2214 1016 ------
NM_175856chr53628 142 125 ------
NM_175866chr11339 1369 ----
NM_175884chr721139 930 ------
NM_176814chr7163 ------
NM_176863chr1741692 834 816 59 --11680 1503
NM_177414chr111124 ------
NM_177438chr1422908 1404 1607 ----
NM_177559chr2021239 771 ------
NM_177560chr2021239 771 ------
NM_177925chr121255 22660 158 ----
NM_177952chr141555 ------
NM_177985chr2--22290 1538 ----
NM_177990chr2031517 675 115 ------
NM_177995chr91219 ------
NM_177996chr2082285 1305 1285 1175 773 416 296 30 --22464 2383 --
NM_178151chrX76847 5785 5753 5243 1756 701 93 37588 1913 1015 1618 --
NM_178152chrX76847 5785 5753 5243 1756 701 93 37588 1913 1015 1618 --
NM_178153chrX76847 5785 5753 5243 1756 701 93 37588 1913 1015 1618 --
NM_178313chr22428 115 ------
NM_178426chr121642 961 ------
NM_178427chr121542 861 ------
NM_178585chr422387 1327 1997 13135 --
NM_181054chr142264 185 ------
NM_181332chrX2692 186 ------
NM_181349chr732049 394 172 11134 1968 --
NM_181351chr1132965 2163 2040 --1381 11149
NM_181353chr201549 ------
NM_181358chr123413 2785 11569 --13248
NM_181361chr31211 ------
NM_181442chr20--2236 25 ----
NM_181457chr2139 ------
NM_181486chr12----1397 --
NM_181491chr942589 2415 2189 955 --1873 --
NM_181659chr2052642 2494 846 787 404 1494 ----
NM_181659chr2052642 2494 846 787 404 1494 ----
NM_181670chr12--11422 ----
NM_181672chrX51890 767 642 521 269 ------
NM_181673chrX51890 767 642 521 269 ------
NM_181701chr961860 1668 1623 1607 151 112 1812 ----
NM_181702chr81252 ------
NM_181782chr612052 ------
NM_181787chr8----13109 --
NM_181794chr62364 83 1434 ----
NM_181795chr62364 83 1434 ----
NM_181836chr521788 1024 11940 --12436
NM_181838chr511202 ------
NM_181844chr1751592 1369 1333 699 277 ------
NM_181861chr1222798 1970 ------
NM_181868chr1222798 1970 ------
NM_181869chr1232883 2055 55 ------
NM_181886chr421277 309 ------
NM_181887chr421277 309 ------
NM_181888chr421277 309 ------
NM_181889chr421277 309 ------
NM_181890chr421277 309 ------
NM_181891chr421277 309 ------
NM_181892chr421324 356 ------
NM_181893chr421277 309 ------
NM_181897chr342387 1899 1859 641 ------
NM_182314chrX1321 1414 11161 --
NM_182493chr1654092 3297 1916 674 258 24255 4244 ----
NM_182501chr222456 818 22423 330 1713 13042
NM_182503chr665337 4831 3499 1687 1325 849 14344 ----
NM_182511chr1811251 --1960 --
NM_182515chr1946721 4431 2537 2156 24496 491 --14098
NM_182526chr1493140 2780 2576 2542 2004 1256 1233 1070 1029 167 ----
NM_182551chr223447 3097 ------
NM_182557chr1132170 1686 447 --11742 1867
NM_182603chr112922 93 ------
NM_182645chr61324 ------
NM_182697chr731121 1080 172 ------
NM_182700chr72516 397 --1611 --
NM_182715chr71115 ------
NM_182717chr1021336 998 ------
NM_182720chr1021336 998 ------
NM_182721chr1021336 998 ------
NM_182722chr1021336 998 ------
NM_182723chr1021336 998 ------
NM_182728chr1431811 133 63 11534 ----
NM_182758chr1522382 462 23145 878 --12575
NM_182763chr142672 2666 2252 556 ------
NM_182764chr2041055 172 112 70 --1980 --
NM_182765chr1021844 1631 ------
NM_182797chr20----1321 --
NM_182853chr1021336 998 ------
NM_182898chr754214 1815 583 245 225 --15106 --
NM_182899chr754214 1815 583 245 225 --15106 --
NM_182907chr611478 --11730 21665 47
NM_182920chr311289 11048 1584 --
NM_182948chr152892 781 496 478 330 --12781 --
NM_182964chr1142178 1117 954 525 22451 974 ----
NM_182972chr112151 ----1253
NM_182976chr11268 ------
NM_183004chr1443202 1580 1167 539 ------
NM_183011chr1021336 998 ------
NM_183012chr1021336 998 ------
NM_183013chr1021336 998 ------
NM_183057chr82216 202 ------
NM_183061chr3----1126 --
NM_183078chr653448 2810 2738 2400 404 ------
NM_183227chr631426 550 176 ------
NM_183234chr151636 ------
NM_183235chr151636 ------
NM_183236chr151636 ------
NM_183376chr1532438 2334 157 ------
NM_183393chr31333 ------
NM_183394chr31333 ------
NM_183397chr2074878 4097 4026 597 440 328 86 --23899 3182 --
NM_183398chr521181 1170 ------
NM_183399chr521181 1170 ------
NM_183400chr521181 1170 ------
NM_183401chr521181 1170 ------
NM_184234chr203706 652 585 ------
NM_194247chr254186 3048 2874 1401 850 ----13279
NM_194250chr22325 94 ------
NM_194286chr1246191 6154 5800 4106 --1612 183
NM_194291chr822629 2034 ------
NM_194314chr135171 3584 2074 ----11169
NM_194328chr962758 1274 809 749 563 263 1429 ----
NM_194329chr962758 1274 809 749 563 263 1429 ----
NM_194330chr962758 1274 809 749 563 263 1429 ----
NM_194332chr962758 1274 809 749 563 263 1429 ----
NM_194429chr62473 106 ------
NM_197941chr52616 409 --12081 12098
NM_197968chr131608 1635 ----
NM_198081chr652794 2402 2224 2217 2167 11865 ----
NM_198086chr1421382 470 ------
NM_198128chr18--1813 ----
NM_198158chr352935 2753 2723 1029 604 11967 ----
NM_198159chr352935 2753 2723 1029 604 11967 ----
NM_198177chr352935 2753 2723 1029 604 11967 ----
NM_198178chr352935 2753 2723 1029 604 11967 ----
NM_198195chr32176 170 ------
NM_198236chr11165 ------
NM_198243chr153792 354 232 --1969 --
NM_198256chr241597 1398 773 731 ------
NM_198261chr122702 162 ------
NM_198262chr122702 162 ------
NM_198268chr123413 2785 11569 --13248
NM_198269chr123413 2785 11569 --13248
NM_198270chrX21333 1298 1670 ----
NM_198273chr522710 198 ------
NM_198279chrX11207 ------
NM_198503chr11347 ------
NM_198504chr32876 791 1805 ----
NM_198513chr82700 394 ------
NM_198560chr343253 1472 1362 397 --33688 2669 2495 --
NM_198581chr245904 2642 2357 2104 --11049 --
NM_198715chr175974 5798 5781 5702 1650 1191 289 ------
NM_198793chr311175 13582 --1378
NM_198859chr385060 4321 3690 3201 1547 969 328 245 --13232 --
NM_198880chr31103 ------
NM_198896chr111344 11387 1655 --
NM_198900chr1277518 7001 6108 5342 2865 1404 396 11632 1183 --
NM_198902chr152549 114 ------
NM_198935chr2033244 2451 210 178 1193 --
NM_198956chr72516 397 --1611 --
NM_198991chr181278 ------
NM_199131chr1063423 3353 3271 2677 1140 1068 --22307 446 --
NM_199144chr2051295 1219 1212 520 296 --11002 --
NM_199185chr51204 ------
NM_199188chr1234015 3551 3374 ------
NM_199189chr52941 748 ------
NM_199190chr1234015 3551 3374 ------
NM_199203chr2051295 1219 1212 520 296 --11002 --
NM_199229chr231097 479 172 ------
NM_199245chr124932 863 310 124 --1319 --
NM_199262chr1752139 835 775 567 382 ------
NM_199290chr17126 ------
NM_199320chr41705 1912 12724 --
NM_199320chr41705 1912 12724 --
NM_199324chr432982 2652 763 --12952 --
NM_199330chr152625 525 ------
NM_199331chr152625 525 ------
NM_199332chr152625 525 ------
NM_199421chr141649 33220 1934 1374 1592 --
NM_199436chr223046 271 ------
NM_199454chr154287 3764 841 381 329 24430 1528 24084 1836 --
NM_199462chr184205 4017 3362 1657 1495 620 492 113 13948 ----
NM_201266chr232798 850 821 --12619 --
NM_201269chr111181 ------
NM_201279chr232798 850 821 --12619 --
NM_201428chr1131634 455 132 ------
NM_201429chr1131634 455 132 ------
NM_201430chr1131560 381 58 ------
NM_201567chr311393 --11195 --
NM_201568chr142032 660 578 268 ------
NM_201569chr142032 660 578 268 ------
NM_201591chr441805 1260 542 41 ------
NM_201592chr441805 1260 542 41 ------
NM_203349chr1511961 ------
NM_203350chr131095 79 68 ------
NM_203394chr1232410 2318 2209 12055 --12074
NM_203399chr1----2791 267 --
NM_203401chr1----2791 267 --
NM_203403chr9275 26 ------
NM_203446chr212562 432 ------
NM_203459chr132598 2391 2261 ------
NM_203464chr15515 469 454 356 64 ------
NM_203494chr152187 169 ------
NM_205768chr122051 547 12060 ----
NM_205842chr22176 46 ------
NM_205860chr142957 2696 2015 1978 ------
NM_205861chr11237 ----2782 73
NM_206594chr122327 1173 13276 ----
NM_206595chr122327 1173 13276 ----
NM_206852chr141602 ------
NM_206853chr634046 2966 732 13581 ----
NM_206854chr635307 4227 1993 14842 1140 --
NM_206855chr646272 5192 861 542 15807 11105 --
NM_206857chr141602 ------
NM_206866chr2142753 2148 1151 738 13269 ----
NM_206876chr233486 881 366 ------
NM_206907chr513079 ------
NM_206909chr866628 3266 2888 1152 964 65 --17823 --
NM_206914chr1221666 1501 --1130 --
NM_207012chr101604 --22931 1322 --
NM_207042chr11153 --1471 --
NM_207043chr122203 1818 11779 ----
NM_207044chr122203 1818 11779 ----
NM_207045chr11153 --1471 --
NM_207046chr11153 --1471 --
NM_207047chr122203 1818 11779 ----
NM_207121chr202558 122 ------
NM_207292chr323242 52 ------
NM_207293chr323242 52 ------
NM_207294chr323242 52 ------
NM_207295chr323242 52 ------
NM_207296chr323242 52 ------
NM_207297chr323267 77 ------
NM_207304chr1312455 ------
NM_207337chr121156 ------
NM_207349chr201508 ----1289
NM_207361chr1376174 4616 1620 1561 1122 778 75 3822 811 461 ----
NM_207411chr81911 13202 23116 2795 --
NM_207517chr1521461 505 11616 ----
NM_207577chr1132151 952 119 1685 12799 --
NM_207578chr11610 ------
NM_212460chr72677 44 ------
NM_212558chr964271 2849 480 459 136 110 13348 12620 --
NM_213589chr261439 1278 1157 495 468 94 ------
NM_213654chr321572 1209 ------