TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4733-5p
miRNA Sequence: AAUCCCAAUGCUAGACCCGGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr586432 6014 5999 5593 5226 4749 2499 1811 --45823 4905 1023 624 --
NM_000875chr1576487 5974 4941 4335 2553 2182 785 36690 2291 2258 34872 4535 173 14546
NM_001003652chr18107925 7372 7259 5513 3114 3037 2653 1921 1300 576 1838 15248 17713
NM_001034841chr16105512 5073 4588 4505 4430 4420 3909 3604 2157 1827 1832 34285 3967 1533 13808
NM_001042603chr1285140 5028 3762 1463 1443 1292 1075 22 --11756 1429
NM_001106chr3128158 7763 7529 6505 6363 6232 3900 3586 3437 2215 1962 609 17809 49647 6396 1977 321 --
NM_002092chr465070 4657 4418 4339 4283 1846 --1198 2753 74
NM_002264chr333748 3379 1873 --11066 24066 1476
NM_003722chr342691 1814 907 782 12519 21018 720 11807
NM_004035chr17114952 4786 4572 4437 4291 3761 3642 3332 1746 1618 1293 25077 4044 13475 --
NM_004726chrX105760 5596 5284 4929 2097 2018 1962 1719 1435 1105 34998 1027 833 1455 12248
NM_005901chr18107925 7372 7259 5513 3114 3037 2653 1921 1300 576 1838 15248 17713
NM_007292chr17114952 4786 4572 4437 4291 3761 3642 3332 1746 1618 1293 25077 4044 13475 --
NM_015313chr1163904 1849 1040 1017 722 128 --21895 821 14550
NM_015375chr184451 4076 3967 3507 3096 1908 731 448 ----15008
NM_017709chr173342 3176 3082 3050 1476 1285 330 --1414 13433
NM_020443chr1126348 6002 5867 5068 4884 4320 2711 1796 1780 257 208 197 --12394 --
NM_021964chr376294 5598 5315 5269 4947 2258 60 ----11055
NM_022048chr1576135 5318 4296 2442 1229 819 96 --55731 4558 2307 2238 570 --
NM_024551chr12102553 2494 2391 1968 1750 1663 1595 751 457 213 --32512 1574 254 12022
NM_024551chr12102553 2494 2391 1968 1750 1663 1595 751 457 213 --32512 1574 254 12022
NM_032932chr17126298 6234 4818 4524 4441 4309 1603 1575 1391 1120 858 418 --25392 805 14026
NM_033224chr777613 7414 6726 6500 5248 1809 820 --11466 25860 575
NM_138473chr1295108 4482 4432 3958 3863 3548 1744 1484 158 13264 33763 3643 685 --
NM_172071chr155081 2760 2087 1869 661 --11723 16528
NM_181489chr3126221 5948 5828 5406 5160 5045 4780 4309 2691 1041 870 381 24535 795 ----
NM_181521chr16137068 6858 5499 5047 4903 2586 1642 1115 1105 454 204 179 131 --34922 4682 1600 --
NM_182762chr785733 2500 2018 1845 1623 904 878 550 24274 1925 ----
NM_199462chr184451 4076 3967 3507 3096 1908 731 448 ----15008