TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4734
miRNA Sequence: GCUGCGGGCUGCGGUCAGGGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51924 ------
NM_000037chr872370 2210 2183 1991 1792 1677 120 --12251 12243
NM_000044chrX188 ------
NM_000053chr132564 491 1394 21796 145 --
NM_000068chr193532 399 52 --1151 11344
NM_000074chrX----1900 --
NM_000080chr173674 172 111 ------
NM_000081chr11249 ------
NM_000084chrX26454 6310 ------
NM_000088chr1711198 ------
NM_000090chr2--1323 ----
NM_000092chr224270 1005 12962 14246 --
NM_000114chr20------1874
NM_000125chr654178 3338 1172 1141 88 1662 1272 --
NM_000129chr61960 1121 1551 --
NM_000163chr51605 11953 ----
NM_000168chr733272 3232 810 ----13067
NM_000189chr21758 --1655 --
NM_000208chr1914604 ----1186
NM_000217chr122781 719 1745 ----
NM_000222chr421674 1325 ------
NM_000238chr7----1159 --
NM_000245chr7----22182 218 --
NM_000248chr322415 1039 ------
NM_000259chr1555008 4744 4728 1970 768 --25829 4609 --
NM_000260chr111435 --177 --
NM_000267chr1711221 --11334 --
NM_000278chr1081882 1805 1744 900 713 517 416 149 --21850 920 --
NM_000284chrX51690 1399 1244 780 382 --11915 11353
NM_000314chr1011044 ------
NM_000330chrX31972 119 55 ------
NM_000332chr61156 26135 1275 21570 365 --
NM_000337chr535056 1630 578 ------
NM_000347chr14----168 --
NM_000350chr11117 --125 --
NM_000362chr2212593 11357 ----
NM_000368chr964752 4252 3838 3621 979 474 --24114 233 --
NM_000387chr32586 164 ------
NM_000404chr31140 --1149 --
NM_000430chr1722996 2474 ------
NM_000435chr192976 124 ------
NM_000461chr31399 ----11273
NM_000462chr151659 ------
NM_000474chr71490 ------
NM_000478chr1--1277 ----
NM_000484chr211788 ------
NM_000486chr1233086 552 327 --3704 573 84 --
NM_000495chrX1363 ------
NM_000503chr831393 301 72 11782 ----
NM_000530chr111045 ------
NM_000555chrX37767 7666 1706 1662 17301 --
NM_000557chr20154 ------
NM_000575chr21940 ------
NM_000612chr1153203 3123 2877 1538 23 13305 2879 44 --
NM_000615chr1142028 1867 1039 911 --12734 --
NM_000617chr1221720 25 ------
NM_000618chr1246072 5321 4152 41 12160 ----
NM_000618chr1246072 5321 4152 41 12160 ----
NM_000619chr121382 ------
NM_000673chr4--1321 ----
NM_000681chr1031303 134 40 ------
NM_000682chr221411 760 ------
NM_000689chr9--1388 ----
NM_000704chr19129 ------
NM_000721chr142693 2481 1787 489 12591 ----
NM_000723chr171377 ------
NM_000724chr101219 ------
NM_000780chr8--149 ----
NM_000800chr53621 433 180 ------
NM_000801chr201928 ------
NM_000807chr4--1180 ----
NM_000813chr535277 4166 1077 ------
NM_000814chr1533930 1274 1260 ------
NM_000816chr51219 ------
NM_000826chr41441 ------
NM_000831chr195845 5656 5630 4810 4687 4618 1785 321 84 15589 12290 25033 330
NM_000833chr1611366 ------
NM_000845chr7--194 ----
NM_000868chrX11939 ------
NM_000872chr101538 147 ----
NM_000875chr1535530 4635 156 11804 21517 138 --
NM_000879chr5157 ------
NM_000883chr72636 285 ----1182
NM_000883chr72636 285 ----1182
NM_000924chr1221002 943 ------
NM_000933chr201347 1690 ----
NM_000944chr41425 12330 ----
NM_000961chr2011580 1869 ----
NM_000963chr12998 806 ------
NM_000964chr1731274 888 79 --11238 --
NM_000983chr1184 ------
NM_000989chr8129 ------
NM_001001132chr2111035 1157 ----
NM_001001323chr1212139 ------
NM_001001343chr521111 23 ------
NM_001001344chrX5606 550 514 102 94 11981 1563 --
NM_001001394chr21277 ------
NM_001001395chr1212677 ------
NM_001001481chr832621 962 825 ------
NM_001001521chr2----1108 --
NM_001001549chr752668 2270 1800 1110 982 ------
NM_001001550chr752668 2270 1800 1110 982 ------
NM_001001555chr752668 2270 1800 1110 982 ------
NM_001001557chr811530 176 ----
NM_001001740chr1151 ------
NM_001001740chr1151 ------
NM_001001877chrY124 ------
NM_001001890chr2143376 3182 500 168 --132 --
NM_001001924chr841492 149 115 53 ------
NM_001001925chr841492 149 115 53 ------
NM_001001931chr841492 149 115 53 ------
NM_001001933chr11158 ------
NM_001001995chrX168 ------
NM_001002254chrX2963 917 ------
NM_001002762chr1062739 1918 1044 835 614 59 ----12118
NM_001002838chrX2549 389 --11306 --
NM_001002860chr1454461 1687 1643 1054 745 ------
NM_001002909chr171277 ------
NM_001003396chr61113 ------
NM_001003397chr61113 ------
NM_001003682chr131215 157 33 --11353 --
NM_001003688chr41848 ------
NM_001003712chr12--13239 13876 --
NM_001003792chr31953 ------
NM_001003793chr31953 ------
NM_001003800chr941467 1214 400 26 --31437 1229 451 --
NM_001004127chr131913 ------
NM_001004356chr411505 177 11007 --
NM_001004358chr411505 177 11007 --
NM_001005158chr3----1106 --
NM_001005159chr3----1106 --
NM_001005386chr251827 1716 1681 490 30 ------
NM_001005404chr1743872 3393 1702 885 1768 --14276
NM_001005463chr1032141 1872 23 ------
NM_001005473chr565551 5502 4117 2408 776 356 ------
NM_001005609chrX23425 1305 1112 1582 --
NM_001005732chr21136 ------
NM_001005733chr21136 ------
NM_001005909chr3----1101 --
NM_001006115chr332693 343 42 ------
NM_001006617chr931158 1067 31 ------
NM_001006619chr931158 1067 31 ------
NM_001006620chr931158 1067 31 ------
NM_001006621chr931158 1067 31 ------
NM_001006636chr2--1103 ----
NM_001007097chr954722 4368 969 398 170 14519 11390 --
NM_001007226chr1731392 1227 989 ------
NM_001007227chr1731392 1227 989 ------
NM_001007228chr1731392 1227 989 ------
NM_001007229chr1731392 1227 989 ------
NM_001007230chr1731392 1227 989 ------
NM_001007255chr1141 ------
NM_001007271chr101404 1324 ----
NM_001007277chr112366 114 164 135 --
NM_001007471chr91286 ------
NM_001007553chr11807 ------
NM_001007794chr12303 39 ------
NM_001008388chr421030 111 ------
NM_001008407chr751711 1531 1357 615 596 11201 1680 11161
NM_001008408chr735953 3992 1581 --46433 5894 1734 1645 --
NM_001008410chr21716 --11618 --
NM_001008541chr101674 ------
NM_001008541chr101674 ------
NM_001008564chr131429 ------
NM_001008660chr11--11284 ----
NM_001008701chr1942627 640 550 440 --1724 --
NM_001008707chr14153 11324 ----
NM_001008738chr51319 ------
NM_001008938chr11----129 --
NM_001009554chr421155 357 --1153 --
NM_001009554chr421155 357 --1153 --
NM_001009566chr13320 273 243 11420 --1943
NM_001009958chr7163 ------
NM_001009993chr244561 3359 2873 69 13809 1337 14069
NM_001010911chr103974 231 160 --1282 --
NM_001010924chr101213 ------
NM_001010938chr32197 180 ------
NM_001011645chrX188 ------
NM_001011663chr10147 ------
NM_001011666chr726408 1406 ------
NM_001012264chr141654 ------
NM_001012393chr1123283 1895 21939 638 ----
NM_001012426chr653172 2417 927 891 778 --2879 358 --
NM_001012427chr653172 2417 927 891 778 --2879 358 --
NM_001012614chr41681 1104 ----
NM_001012643chr19127 ------
NM_001012661chr111160 ------
NM_001012732chr431062 982 872 1517 ----
NM_001012753chr19--1424 ----
NM_001012755chrX13148 13458 11048 --
NM_001012977chrX1991 ------
NM_001013031chr1053505 2800 1291 1030 717 ------
NM_001013251chr111160 ------
NM_001013415chr42993 63 ------
NM_001013438chr31709 1674 ----
NM_001013439chr31555 ------
NM_001013635chr121814 1486 ----
NM_001013690chr1252479 2001 598 31 22 ------
NM_001013693chr132842 1910 1151 1763 22683 1995 1177
NM_001013693chr132842 1910 1151 1763 22683 1995 1177
NM_001014283chr1352163 1668 416 177 48 21544 316 21741 1483 11749
NM_001014434chr12741 154 ------
NM_001014435chr161433 ------
NM_001014797chr1027936 7664 18238 11855 26709 1812
NM_001014831chr191308 --2594 524 --
NM_001014832chr191308 --2594 524 --
NM_001014834chr191308 --2594 524 --
NM_001014835chr191308 --2594 524 --
NM_001014839chr11832 1913 1322 --
NM_001014841chr11832 1913 1322 --
NM_001015045chr442379 917 231 99 1705 ----
NM_001015055chr22267 138 ------
NM_001015056chr22267 138 ------
NM_001015056chr22267 138 ------
NM_001015877chrX12081 ------
NM_001015887chr311524 ------
NM_001017371chr211268 ------
NM_001017395chr3--13633 ----
NM_001017405chr44850 587 92 41 1737 ----
NM_001017424chr121485 559 1713 ----
NM_001017425chr121485 559 1713 ----
NM_001017926chr83722 525 178 ------
NM_001017981chr22147 ------
NM_001018050chr2232768 2685 187 --21007 865 --
NM_001018052chr2232768 2685 187 --21007 865 --
NM_001018057chr112511 226 ----11025
NM_001018065chr954618 2159 1649 1494 38 21286 1155 ----
NM_001018066chr954618 2159 1649 1494 38 21286 1155 ----
NM_001018108chr151133 --11753 --
NM_001018111chr743855 3002 1043 303 ------
NM_001024024chr14--125 ----
NM_001024218chr14------2543 307
NM_001024226chr11949 ------
NM_001024227chr11949 ------
NM_001024228chr11949 ------
NM_001024372chr821951 25 ------
NM_001024401chr1641933 1134 699 94 ------
NM_001024463chr1511028 ------
NM_001024649chr541827 1180 979 49 ------
NM_001024809chr1731274 888 79 --11238 --
NM_001024912chr191157 ------
NM_001024947chr5185 --1260 --
NM_001024948chr153279 2640 2280 2269 1283 ------
NM_001025076chr1085653 5600 5170 4826 4364 2476 1534 1349 ------
NM_001025077chr1097011 6958 6528 6184 5722 2892 2707 1330 1131 ------
NM_001025079chr322991 1003 --12717 --
NM_001025266chr32512 127 1304 1701 --
NM_001025366chr611831 ------
NM_001025366chr611831 ------
NM_001025367chr611831 ------
NM_001025367chr611831 ------
NM_001025368chr611831 ------
NM_001025368chr611831 ------
NM_001025369chr611847 ------
NM_001025369chr611847 ------
NM_001025370chr611831 ------
NM_001025370chr611831 ------
NM_001025579chr172300 196 ------
NM_001025580chrX--21589 39 ----
NM_001025595chr411689 --1496 --
NM_001029859chr111933 1214 ----
NM_001029863chr6--1855 ----
NM_001029864chr2011648 --2347 325 --
NM_001029882chr1------1147
NM_001029882chr1------1147
NM_001029883chr221995 547 11122 ----
NM_001029896chrX--146 131 --
NM_001029989chr151951 ------
NM_001030001chr141401 ------
NM_001030007chr162375 250 ------
NM_001030055chr1413117 --14289 --
NM_001031684chr2--11520 ----
NM_001031717chr3126 ------
NM_001031720chr41165 ------
NM_001031740chr11649 --1137 --
NM_001031812chr511793 ------
NM_001032221chr931545 107 50 --11315 --
NM_001032288chr203512 470 411 ------
NM_001032296chr1342747 2381 2143 171 --12544 12181
NM_001033087chr2032801 2504 420 1166 ----
NM_001033112chr51754 ------
NM_001033117chr32295 162 ----1639
NM_001033504chr171601 ------
NM_001033506chr11157 ------
NM_001033551chr1782504 1315 927 810 797 205 101 45 12969 23322 671 23396 729
NM_001033561chr17151 ------
NM_001033566chr171162 ------
NM_001033568chr171162 ------
NM_001033602chr1322465 1990 1279 --11681
NM_001033677chr122164 124 ------
NM_001033756chr611765 ------
NM_001033756chr611765 ------
NM_001034837chr51765 ------
NM_001034838chr51765 ------
NM_001034845chr41164 1508 1316 --
NM_001034850chr51612 --1140 --
NM_001037164chr711553 ------
NM_001037290chr112767 221 ------
NM_001037331chr18--1237 ----
NM_001037494chr12153 ------
NM_001037495chr12153 ------
NM_001037582chr421423 279 ------
NM_001037637chr51149 ------
NM_001037872chr2------1617
NM_001037954chr111668 ------
NM_001038640chr151854 ------
NM_001038702chr522026 110 1940 ----
NM_001039350chr731313 429 307 --1226 --
NM_001039459chr72311 236 ------
NM_001039468chr11186 ------
NM_001039469chr11186 ------
NM_001039538chr223413 868 ------
NM_001039547chr316531 15035 ----
NM_001039583chr221140 ------
NM_001039584chr221140 ------
NM_001039590chrX11369 1147 1178 --
NM_001039591chrX11369 1147 1178 --
NM_001039618chr1122247 310 ------
NM_001039670chr12192 1693 136 --
NM_001039690chr1622370 2012 --22155 1917 --
NM_001039711chr12222 173 --1817 --
NM_001039712chr12222 173 --1817 --
NM_001039762chr1011698 ------
NM_001039802chr11120 ------
NM_001039840chrX51744 1063 940 501 353 ------
NM_001039937chr1313948 ------
NM_001040057chr71241 ------
NM_001040110chr71397 ------
NM_001040144chr1622370 2012 --22155 1917 --
NM_001040146chr1622370 2012 --22155 1917 --
NM_001040152chr724806 3492 ------
NM_001040153chr131769 ------
NM_001040214chr63350 67 55 ------
NM_001040260chr451166 837 129 82 34 ------
NM_001040261chr451166 837 129 82 34 ------
NM_001040272chr91875 --11871 --
NM_001040284chr16--15694 ----
NM_001040402chr41118 ------
NM_001040429chr131704 ------
NM_001040439chr1651444 1287 1214 941 524 --2118 69 11093
NM_001040441chr123793 1942 13973 13837 --
NM_001040446chr51237 ------
NM_001040451chr51473 ------
NM_001040452chr51473 ------
NM_001040624chr822709 423 ------
NM_001040625chr822709 423 ------
NM_001040626chr822709 423 ------
NM_001040627chr822709 423 ------
NM_001040628chr822709 423 ------
NM_001040629chr822709 423 ------
NM_001040630chr822709 423 ------
NM_001040667chr161136 ------
NM_001040708chr81778 ------
NM_001040712chr923153 359 ------
NM_001042355chr1643574 2036 1757 1307 15247 14553 12062
NM_001042388chr182804 342 ------
NM_001042412chr1643574 2036 1757 1307 15247 14553 12062
NM_001042413chr92822 23 12613 --1118
NM_001042430chr14------2380 132
NM_001042481chr1412623 ----11035
NM_001042492chr1711221 --11334 --
NM_001042494chr1543388 920 570 181 --12491 --
NM_001042495chr1543388 920 570 181 --12491 --
NM_001042496chr1543388 920 570 181 --12491 --
NM_001042497chr1543388 920 570 181 --12491 --
NM_001042498chrX165 --1408 --
NM_001042510chr8----172 --
NM_001042511chr8----172 --
NM_001042599chr247140 6037 5046 417 ------
NM_001042632chr2042321 1032 172 126 2751 154 5587 467 242 206 83 --
NM_001042633chr2042321 1032 172 126 2751 154 5587 467 242 206 83 --
NM_001042681chr142065 515 272 208 11690 ----
NM_001042682chr142065 515 272 208 11690 ----
NM_001042682chr142065 515 272 208 11690 ----
NM_001043318chr14101463 1224 1191 1082 505 363 319 292 237 186 --31008 785 35 1525
NM_001043351chr112096 ------
NM_001044722chr511793 ------
NM_001044723chr511793 ------
NM_001077628chr11537 ------
NM_001079874chr13284 63 26 12013 ----
NM_001083620chr41440 ------
NM_001095chr12----11254 --
NM_001096chr17123 ------
NM_001100108chr167881 7864 7007 5302 942 349 --38045 2113 2099 --
NM_001106chr358136 6248 2596 1128 1056 48512 8031 7411 3913 18006 --
NM_001113490chrX11130 21368 23 ----
NM_001117chr1812016 ------
NM_001122679chr51924 ------
NM_001126chr1178 ------
NM_001127chr22----182 --
NM_001128chr162375 250 ------
NM_001144chr16----1307 --
NM_001148chr4------1496
NM_001156chr102601 70 ------
NM_001167chrX35597 4383 948 ------
NM_001173chr1413117 --14289 --
NM_001174chrX3531 523 39 1694 2787 572 1479
NM_001189chr44911 708 80 35 ------
NM_001190chr19----136 --
NM_001204chr237376 397 119 ------
NM_001206chr92438 156 ------
NM_001207chr51149 ------
NM_001222chr1041674 1264 154 52 21435 696 11667 --
NM_001256chr1712405 ------
NM_001260chr13143 ------
NM_001268chr13144 ------
NM_001271chr1532653 2187 199 12839 --12126
NM_001273chr121223 ----1187
NM_001274chr11187 ------
NM_001298chr231303 217 63 ------
NM_001328chr41681 1104 ----
NM_001329chr101506 ------
NM_001331chr1111134 22728 275 ----
NM_001346chr341784 725 388 351 ------
NM_001356chrX1506 --197 --
NM_001364chr1123530 3344 1331 ----
NM_001365chr172540 178 ------
NM_001383chr173325 112 89 ------
NM_001386chr842207 2099 1923 637 1714 ----
NM_001390chr1822320 651 13217 ----
NM_001394chr82652 226 ------
NM_001399chrX23425 1305 1112 1582 --
NM_001401chr921582 1527 ------
NM_001404chr11130 ------
NM_001408chr121513 589 --1111 --
NM_001412chrX23072 456 11072 13174 --
NM_001417chr1221528 167 ------
NM_001420chr1923127 180 11198 22835 2535 --
NM_001448chrX--21727 690 ----
NM_001453chr61250 ------
NM_001458chr7--1751 ----
NM_001555chrX178 ------
NM_001616chr212723 ------
NM_001658chr11949 ------
NM_001662chr71144 ------
NM_001663chr1412631 ----12544
NM_001678chr1741782 1754 1666 312 ------
NM_001682chr1211853 ------
NM_001702chr81108 168 1155 --
NM_001704chr61562 ------
NM_001706chr32814 175 1765 ----
NM_001707chr71108 ------
NM_001716chr1121421 1161 --1575 --
NM_001731chr121345 --1357 --
NM_001742chr71581 ------
NM_001746chr541827 1180 979 49 ------
NM_001753chr711868 ------
NM_001754chr2143376 3182 500 168 --132 --
NM_001755chr161229 --1722 --
NM_001759chr1244693 4687 1875 321 13708 34708 4003 3678 1295
NM_001760chr61221 --1154 --
NM_001769chr121279 ------
NM_001777chr322991 1003 --12717 --
NM_001791chr11120 ------
NM_001800chr191102 --1225 --
NM_001834chr5----186 --
NM_001842chr9------268 38
NM_001895chr20----1242 --
NM_001903chr52719 594 ------
NM_001918chr118652 18844 27201 5841 --
NM_001921chr431062 982 872 1517 ----
NM_001933chr1411020 1394 11319 --
NM_001936chr731313 429 307 --1226 --
NM_001938chr1148 ------
NM_001945chr5--174 ----
NM_001949chr61475 1433 ----
NM_001954chr62824 137 ------
NM_001964chr51394 ------
NM_001987chr1234127 1056 784 24056 848 2663 345 13020
NM_001999chr5--152 ----
NM_002006chr445288 2157 1948 1178 ----14026
NM_002010chr131523 ------
NM_002015chr1313137 ------
NM_002024chrX1311 ------
NM_002025chrX78649 8302 6861 6089 3562 2855 2408 --11865 --
NM_002031chr61184 ------
NM_002037chr6173 ------
NM_002069chr7----1199 --
NM_002076chr1222895 35 123 ----
NM_002077chr921922 101 --1157 --
NM_002083chr14--1127 ----
NM_002084chr51856 --1299 --
NM_002085chr19181 ------
NM_002086chr17------12071
NM_002092chr434782 3794 3548 --24054 3602 --
NM_002094chr16122 150 ----
NM_002105chr1141007 422 202 124 --1802 --
NM_002126chr1722914 520 12627 13718 --
NM_002130chr511653 ------
NM_002131chr631186 307 182 ------
NM_002137chr711917 ------
NM_002140chr9186 ------
NM_002149chr22552 82 --1600 --
NM_002168chr15125 ------
NM_002203chr51142 --12943 --
NM_002204chr1721047 558 --1852 --
NM_002223chr12--13531 33949 3570 996 --
NM_002226chr141821 ------
NM_002227chr1151 ------
NM_002246chr22214 101 ------
NM_002247chr101281 ------
NM_002253chr431024 544 140 ------
NM_002264chr334350 1331 264 ------
NM_002267chr131286 ------
NM_002268chr31736 ------
NM_002270chr565454 5100 1161 1015 257 21 --1577 --
NM_002283chr12147 --1567 --
NM_002290chr631035 970 942 ------
NM_002293chr112500 12577 11805 --
NM_002296chr1134 ------
NM_002298chr131317 ----1634
NM_002356chr61890 ------
NM_002359chr1773918 3378 3273 1661 1648 1383 128 22608 797 ----
NM_002373chr15----1950 --
NM_002374chr223413 868 ------
NM_002375chr352210 1781 1534 819 139 21835 94 ----
NM_002383chr162866 290 ------
NM_002384chr183301 289 39 ----1192
NM_002387chr523356 46 13851 13142 --
NM_002397chr511479 --1516 --
NM_002401chr1752335 2043 1877 661 180 --12436 --
NM_002430chr2262572 2002 862 845 679 263 --1924 --
NM_002442chr123533 406 89 --2110 36 --
NM_002465chr12--139 ----
NM_002466chr20----198 --
NM_002473chr222954 916 --2403 70 --
NM_002481chr116876 ----27458 5233
NM_002499chr152297 237 ----1884
NM_002501chr19113693 3425 3387 3365 3341 3335 2965 2875 953 881 811 --1207 13066
NM_002522chr1733808 853 119 --12502 --
NM_002537chr152957 770 ------
NM_002545chr1123283 1895 21939 638 ----
NM_002547chrX33336 1585 560 13694 ----
NM_002553chr71417 ------
NM_002576chr1111214 ------
NM_002581chr911828 14893 ----
NM_002595chr121461 ------
NM_002607chr72478 37 --21015 488 --
NM_002609chr541688 1630 443 189 --21337 662 --
NM_002622chr5168 ------
NM_002628chr311147 ------
NM_002629chr102170 74 1122 ----
NM_002632chr14129 --1818 1314
NM_002636chr6179 ------
NM_002644chr1125 ------
NM_002645chr1122611 2403 ------
NM_002648chr611067 ------
NM_002655chr835245 5140 936 11762 ----
NM_002657chr2043044 2732 2376 222 11471 --1416
NM_002709chr21897 ------
NM_002714chr6144 ------
NM_002715chr51918 1292 ----
NM_002718chr322573 2140 ------
NM_002719chr143945 203 122 --1225 --
NM_002720chr16143 ------
NM_002726chr61111 ------
NM_002734chr171108 ------
NM_002737chr1785201 4223 2666 2177 1735 1570 1438 980 16566 42402 2394 1954 50 --
NM_002745chr2211377 --1553 --
NM_002748chr1511160 ------
NM_002749chr171117 ------
NM_002753chr41581 ------
NM_002828chr183356 176 75 ------
NM_002830chr2----176 --
NM_002839chr923153 359 ------
NM_002840chr11278 1406 ----
NM_002847chr721030 490 11283 2513 125 --
NM_002849chr12185 ------
NM_002855chr1122814 53 --11099 --
NM_002857chr121029 255 12381 ----
NM_002867chr1--1167 ----
NM_002868chr121830 --1960 --
NM_002869chr11171 ------
NM_002886chr323780 142 11042 12073 --
NM_002924chr12520 429 ------
NM_002942chr311283 ------
NM_002945chr171787 1327 ----
NM_002948chr31906 196 1339 --
NM_002950chr3139 ------
NM_002956chr122170 44 ------
NM_002971chr31276 ------
NM_002972chr222290 232 ------
NM_002998chr81196 1781 ----
NM_003010chr17171 --12441 --
NM_003016chr17--1167 ----
NM_003026chr91101 --11280 --
NM_003028chr933312 3282 1180 1719 1995 --
NM_003029chr1----11304 --
NM_003045chr1383324 3257 1187 849 413 308 173 121 --1148 13925
NM_003074chr32294 249 ------
NM_003076chr12------11225
NM_003106chr31955 ------
NM_003107chr651884 689 456 190 145 ------
NM_003108chr282843 2779 2748 2622 2320 2194 1598 703 21647 489 26051 2670 --
NM_003111chr211268 ------
NM_003128chr21502 12181 ----
NM_003137chr61527 ------
NM_003150chr17151 124 ----
NM_003155chr81611 12486 ----
NM_003156chr11--11314 ----
NM_003161chr172883 66 ------
NM_003164chr112534 484 ------
NM_003165chr931644 206 149 --11414 --
NM_003173chrX1381 ------
NM_003174chr101262 --1559 --
NM_003188chr6----1837 --
NM_003196chr11396 1250 ----
NM_003199chr1844927 4288 4252 4025 1142 15371 --
NM_003200chr1921813 1765 11501 ----
NM_003211chr12135 ------
NM_003216chr2263242 1094 646 562 127 35 1380 1613 --
NM_003221chr663266 3089 2550 1322 1123 1010 --1460 --
NM_003246chr15--11647 1694 --
NM_003257chr1511097 ------
NM_003270chrX11224 --1205 --
NM_003274chr2122888 2627 1483 ----
NM_003304chr3----11208 --
NM_003325chr222130 26 ------
NM_003337chr511555 1106 ----
NM_003339chr51528 ------
NM_003340chr4128 ------
NM_003342chr1722068 74 11009 ----
NM_003344chr711517 11426 21323 663 --
NM_003347chr2232343 704 67 --1843 --
NM_003349chr203512 470 411 ------
NM_003350chr81393 ------
NM_003370chr19137 ----1783
NM_003371chr921999 588 --11984 128
NM_003376chr611831 ------
NM_003376chr611831 ------
NM_003377chr11----122 --
NM_003380chr10194 ------
NM_003385chr2156 ------
NM_003387chr21222 12822 ----
NM_003392chr321551 1324 13017 ----
NM_003404chr2011573 ------
NM_003406chr811639 1530 ----
NM_003412chr341229 1130 884 113 ------
NM_003413chrX11517 ------
NM_003459chr22711 477 ------
NM_003468chr223253 541 --1115 --
NM_003470chr1621636 605 --1380 11710
NM_003473chr10--1286 --1198
NM_003482chr1222450 666 ------
NM_003483chr1232764 2676 66 ------
NM_003489chr2113397 --13448 --
NM_003498chr162699 631 12574 11847 --
NM_003558chr9170 ------
NM_003559chr1783848 3514 3316 2767 2444 1475 1323 139 --11359 --
NM_003562chr17------1370
NM_003563chr1731392 1227 989 ------
NM_003564chr11445 ------
NM_003574chr1824528 1217 ------
NM_003576chr1342747 2381 2143 171 --12544 12181
NM_003599chr6124 ------
NM_003607chr143733 3650 398 208 1969 11649 --
NM_003612chr153506 160 37 ------
NM_003613chr151254 ------
NM_003617chr121149 58 ------
NM_003618chr2190 ------
NM_003621chr11185 ----1104
NM_003629chr112594 ----11066
NM_003632chr171627 ------
NM_003663chr311083 ------
NM_003671chr923327 3288 11060 11076 --
NM_003672chr121430 557 ------
NM_003701chr132421 331 ------
NM_003709chr2------1101
NM_003714chr532572 2138 242 22017 426 12125 --
NM_003716chr3--1939 ----
NM_003728chr41122 ------
NM_003743chr2197 12249 ----
NM_003746chr12153 ------
NM_003749chr1321969 395 11927 ----
NM_003759chr4--11600 1921 --
NM_003760chr1------1103
NM_003762chr1--11315 ----
NM_003768chr121835 361 11486 ----
NM_003774chr1223095 2284 ------
NM_003791chr161112 ------
NM_003800chr612129 --11537 --
NM_003806chr12--1236 ----
NM_003821chr81146 ------
NM_003822chr123028 625 ------
NM_003850chr131224 ------
NM_003861chr1412656 ------
NM_003887chr242030 2024 1697 341 ------
NM_003888chr15134 ------
NM_003913chr61629 --1481 --
NM_003924chr41585 11074 1259 --
NM_003938chr1951106 723 281 54 21 ----133
NM_003941chr712262 ------
NM_003947chr3----127 --
NM_003954chr1711436 11451 2486 138 --
NM_003955chr1711128 ----1159
NM_003957chr113736 425 146 --2340 123 --
NM_003971chr171251 ------
NM_003972chr1021292 953 1239 ----
NM_003987chr1081882 1805 1744 900 713 517 416 149 --21850 920 --
NM_003988chr1081959 1882 1821 790 594 493 226 86 --11927 --
NM_003989chr1091818 1741 1680 888 836 649 453 352 85 --21786 856 --
NM_003990chr1091818 1741 1680 888 836 649 453 352 85 --21786 856 --
NM_003993chr1125 ------
NM_004034chr102601 70 ------
NM_004037chr12844 32 ------
NM_004050chr1422097 730 ------
NM_004067chr7--2980 124 ----
NM_004093chr1342572 2144 527 80 1307 1421 --
NM_004104chr172583 543 --1258 --
NM_004112chr1721163 31 ------
NM_004118chr20----130 --
NM_004124chr1412357 --1115 --
NM_004132chr101319 11071 11105 --
NM_004152chr19199 170 ----
NM_004162chr311073 ------
NM_004186chr31119 ------
NM_004200chr1142945 2811 2564 727 ----12125
NM_004202chrY------1291
NM_004211chr111171 ------
NM_004229chrX11784 ------
NM_004236chr151389 --1510 --
NM_004242chr61441 ------
NM_004276chr122164 124 ------
NM_004302chr1232714 283 126 --12412 --
NM_004311chr1052686 2528 1933 1203 1143 22114 2095 ----
NM_004321chr232535 2365 532 11292 --12391
NM_004331chr81270 ------
NM_004342chr732293 1627 372 ------
NM_004346chr411418 1105 ----
NM_004349chr8----1850 --
NM_004368chr192816 380 ------
NM_004370chr611514 22144 2006 ----
NM_004380chr16----12228 --
NM_004384chr511793 ------
NM_004386chr1912241 ------
NM_004393chr31423 --1336 184
NM_004395chr5388 81 47 ------
NM_004396chr171110 ------
NM_004405chr21887 --2126 112 --
NM_004414chr21----1380 --
NM_004420chr1122032 1903 1412 133 --
NM_004426chr122598 543 ------
NM_004430chr82672 321 ------
NM_004431chr12689 122 ------
NM_004434chr14153 11324 ----
NM_004436chr11496 1531 ----
NM_004438chr232870 1021 136 11108 11093 --
NM_004443chr31696 ------
NM_004451chr11------1596
NM_004454chr331681 921 324 ------
NM_004458chrX1451 ------
NM_004474chr12226 32 ----1160
NM_004475chr1711132 ------
NM_004494chr1180 11301 ----
NM_004501chr123942 2538 ------
NM_004504chr242899 2381 278 127 12689 ----
NM_004505chr1711347 ------
NM_004516chr1921045 126 ----1152
NM_004537chr12134 ------
NM_004543chr2129 --147 --
NM_004560chr92999 388 ------
NM_004583chr172516 176 ------
NM_004586chrX23458 89 ------
NM_004588chr1152599 1065 822 580 159 --12493 --
NM_004598chr521022 61 --1850 1944
NM_004602chr20----1533 11083
NM_004654chrY11330 ------
NM_004655chr1711158 ------
NM_004656chr32241 24 ------
NM_004663chr1531299 1273 182 ------
NM_004664chr121231 ------
NM_004667chr151230 ------
NM_004703chr172188 28 ------
NM_004709chrX11362 ------
NM_004711chr2233065 3036 1244 1643 43379 2822 2809 211 --
NM_004714chr191127 ------
NM_004723chr13828 425 242 ------
NM_004725chr101252 ------
NM_004730chr522107 450 12135 ----
NM_004734chr1333228 996 407 22439 524 12262 --
NM_004739chr111213 ------
NM_004742chr331813 1617 74 ------
NM_004744chr432977 2726 101 ------
NM_004745chr865043 4357 1597 492 126 117 --14629 16228
NM_004747chr10128 ----11477
NM_004758chr17----1232 --
NM_004762chr1742015 730 363 58 --1572 1765
NM_004768chr121009 36 ------
NM_004774chr1722001 1195 ------
NM_004781chr121699 1136 11220 ----
NM_004781chr121699 1136 11220 ----
NM_004798chr2023022 885 22367 73 ----
NM_004801chr21474 ------
NM_004808chr1053205 2936 2462 2150 1025 ------
NM_004822chr1742832 1093 1036 93 182 32668 555 457 --
NM_004838chr19155 ------
NM_004839chr151556 ------
NM_004841chr11340 ------
NM_004857chr1414615 ------
NM_004879chr111244 ------
NM_004884chr15----1210 11128
NM_004898chr412613 12001 ----
NM_004902chr201619 ------
NM_004904chr726408 1406 ------
NM_004911chr71522 ------
NM_004926chr143731 534 47 ------
NM_004932chr51123 ------
NM_004943chr1941009 991 338 133 --2757 477 --
NM_004947chr322343 349 --1286 --
NM_004952chr11127 ------
NM_004953chr3170 ------
NM_004954chr11186 ------
NM_004959chr931226 85 66 --1320 --
NM_004962chr10--2485 87 ----
NM_004966chr101862 ------
NM_004973chr61197 --11424 --
NM_004976chr1194660 3994 3770 3428 3414 1741 1038 870 84 --13792 24955 3920
NM_004979chrX2751 301 ------
NM_004984chr12129 ------
NM_004985chr1213195 14078 ----
NM_004991chr32290 95 ------
NM_004992chrX33240 2479 1321 1284 45967 5285 3174 2970 --
NM_004992chrX33240 2479 1321 1284 45967 5285 3174 2970 --
NM_005011chr71397 ------
NM_005012chr1--152 ----
NM_005028chr1041907 1469 747 604 ------
NM_005032chrX150 ------
NM_005052chr171248 ------
NM_005076chr144051 3421 173 28 --2959 934 --
NM_005087chr31555 ------
NM_005103chr11129 ------
NM_005104chr63684 141 34 ------
NM_005109chr321996 990 ------
NM_005110chr51581 ------
NM_005112chr43335 152 56 ----1403
NM_005116chr2052795 1754 596 295 30 --13971 1435
NM_005117chr111776 --153 --
NM_005119chr111311 ------
NM_005121chr172430 59 ------
NM_005124chr61294 ------
NM_005134chr182804 342 ------
NM_005135chr1543388 920 570 181 --12491 --
NM_005153chr161329 ------
NM_005156chr921862 576 ------
NM_005168chr211730 ------
NM_005180chr101303 ------
NM_005182chr161433 ------
NM_005187chr1621422 311 --11747 --
NM_005197chr1426082 338 ------
NM_005203chr101133 ------
NM_005206chr1711404 ------
NM_005219chr5--143 159 --
NM_005225chr20151 1322 1932 --
NM_005235chr247140 6037 5046 417 ------
NM_005241chr3----1105 --
NM_005271chr10--152 ----
NM_005277chr411565 ------
NM_005281chr11802 ------
NM_005311chr752668 2270 1800 1110 982 ------
NM_005316chr111311 --153 --
NM_005324chr1721908 1397 ------
NM_005334chrX21213 1082 --2679 644 --
NM_005336chr221868 317 --2858 133 --
NM_005342chrX21744 536 ------
NM_005349chr41147 ------
NM_005359chr18--26287 329 ----
NM_005386chr201889 ------
NM_005397chr743855 3002 1043 303 ------
NM_005398chr1021372 956 ------
NM_005400chr241006 483 432 426 ------
NM_005413chr21396 ------
NM_005418chr111486 ------
NM_005436chr1013121 2825 388 12626 --
NM_005438chr11------126
NM_005458chr942235 1683 750 551 2738 69 ----
NM_005461chr2061795 1598 766 651 153 96 ------
NM_005475chr1232899 2566 2156 ------
NM_005476chr91108 --11066 --
NM_005503chr151267 179 11136 --
NM_005505chr122749 156 ------
NM_005526chr8----1252 --
NM_005561chr132777 29 ------
NM_005569chr22----121 --
NM_005578chr323350 814 ------
NM_005581chr19143 1371 ----
NM_005584chr13192 ------
NM_005587chr152197 39 1218 ----
NM_005589chr142444 145 ------
NM_005596chr976391 5821 5035 2503 1098 343 335 14627 14991 --
NM_005599chr1----1229 --
NM_005600chr11195 ------
NM_005603chr181363 ------
NM_005619chr191276 --245 21 --
NM_005626chr1161 --1493 --
NM_005627chr61402 ----1318
NM_005629chrX31278 1166 342 11344 ----
NM_005639chr1211523 --11488 --
NM_005647chrX43042 1273 1226 139 11376 ----
NM_005662chr81322 ------
NM_005668chr52795 164 ------
NM_005669chr52681 338 --22220 272 --
NM_005682chr16--1103 11275 --
NM_005684chr11287 ------
NM_005687chr22335 160 ------
NM_005698chr11109 ------
NM_005704chr11222 --21070 251 1380
NM_005708chr13--1298 ----
NM_005716chr192523 494 ------
NM_005717chr11924 ------
NM_005719chr121197 ------
NM_005722chr251827 1716 1681 490 30 ------
NM_005731chr2--1152 ----
NM_005734chr111609 ------
NM_005736chr1031572 1562 1511 --1186 11505
NM_005737chr252147 1104 295 107 101 2737 701 1394 --
NM_005738chr711553 ------
NM_005740chr224773 752 634 300 --129 --
NM_005751chr71341 ------
NM_005766chr1331234 949 24 1888 ----
NM_005779chr543083 1117 352 186 ------
NM_005781chr32197 180 ------
NM_005786chr1811113 126 11077 --
NM_005806chr21149 1500 --11241
NM_005813chr222294 89 ------
NM_005822chr611816 ------
NM_005840chrX11770 --22982 128 --
NM_005851chr11--148 ----
NM_005853chr161504 ------
NM_005871chr10131 ------
NM_005875chr3----185 --
NM_005879chr3139 ------
NM_005882chr44850 587 92 41 1737 ----
NM_005884chr191308 --2594 524 --
NM_005896chr22585 525 ------
NM_005897chr111172 ------
NM_005900chr41848 ------
NM_005906chr6--139 ----
NM_005909chr544156 4124 860 222 ------
NM_005920chr162950 2806 1423 601 373 316 11116 12526 --
NM_005922chr61434 ------
NM_005933chr1122998 834 22777 1980 1621 --
NM_005934chr1941976 898 127 50 1888 193 --
NM_005938chrX11097 1547 ----
NM_005941chr843780 3577 2921 154 ----11619
NM_005943chr631650 1280 652 ------
NM_005955chr12801 603 1672 ----
NM_005962chr101674 ------
NM_005962chr101674 ------
NM_005964chr17------167
NM_005967chr122657 507 ------
NM_005994chr171119 --1874 1326
NM_005996chr1211110 ------
NM_006011chr1574137 3380 3118 2985 1269 1120 157 ------
NM_006015chr13962 835 520 ------
NM_006037chr284202 3258 3052 1792 1735 1279 873 287 ------
NM_006038chr201102 ------
NM_006049chr151394 ------
NM_006054chr1121440 106 ------
NM_006055chr221220 21 ------
NM_006067chr16----1713 --
NM_006077chr101727 157 1657 --
NM_006082chr12----125 --
NM_006090chr12303 39 ------
NM_006095chr424234 65 ------
NM_006113chr13284 63 26 12013 ----
NM_006129chr81571 --1118 --
NM_006133chr1132029 1529 151 1828 32249 1564 509 --
NM_006141chr1612164 12686 ----
NM_006145chr19----1377 --
NM_006186chr2----1197 --
NM_006198chr211235 ------
NM_006203chr524918 3444 15309 ----
NM_006206chr412440 ------
NM_006216chr2167 ------
NM_006237chr131112 ------
NM_006241chr3--12308 ----
NM_006243chr11885 ------
NM_006256chr11935 ------
NM_006259chr41130 ------
NM_006267chr231700 717 352 ------
NM_006277chr21143 ------
NM_006289chr9--1403 1151 --
NM_006293chr151178 ------
NM_006301chr12--1210 ----
NM_006306chrX45656 4198 4058 351 15307 15806 --
NM_006312chr121629 --2821 64 --
NM_006313chr1231641 527 461 ------
NM_006320chr4--11126 ----
NM_006322chr13194 --178 --
NM_006325chr122258 199 ------
NM_006334chr9127 ------
NM_006350chr5147 ------
NM_006352chr111432 ------
NM_006361chr1742006 1680 1337 1267 --21358 1325 --
NM_006367chr12891 200 ------
NM_006371chr354590 3869 3208 1949 1272 ----13305
NM_006374chr2----2175 107 --
NM_006386chr221495 --21909 905 --
NM_006389chr111179 1452 ----
NM_006440chr22176 ------
NM_006449chr211654 1874 ----
NM_006454chr482897 2694 2645 2626 2458 2089 563 209 12714 --12678
NM_006459chr103792 759 278 11706 2600 581 --
NM_006465chr1521676 1601 1488 22273 1800 --
NM_006483chr191127 ------
NM_006484chr191127 ------
NM_006500chr113509 174 118 ------
NM_006526chr20--1637 ----
NM_006532chr192789 251 --21621 472 21634 137
NM_006534chr201675 --1943 --
NM_006538chr241168 1090 636 72 14161 1435 --
NM_006540chr82271 209 ------
NM_006544chr1425385 543 --12018 --
NM_006546chr1724891 4634 14132 ----
NM_006548chr32629 248 --1460 --
NM_006549chr1242392 1977 535 24 12787 ----
NM_006559chr131216 1063 423 ------
NM_006561chr1085653 5600 5170 4826 4364 2476 1534 1349 ------
NM_006572chr1712806 11311 1328 --
NM_006599chr1678276 8251 8065 7751 6304 1164 396 --1974 --
NM_006618chr111413 ------
NM_006621chr1--1154 11555 --
NM_006624chr101555 ------
NM_006625chr1164 ------
NM_006625chr1164 ------
NM_006625chr1164 ------
NM_006628chr1514445 14380 ----
NM_006646chr131942 1327 21201 89 --
NM_006651chr461480 483 434 359 310 134 161 21249 212 127
NM_006667chrX2464 211 ------
NM_006670chr61509 ----1460
NM_006675chr1283173 2813 2725 2689 2110 854 225 101 12707 12736 --
NM_006690chr2021498 626 12135 ----
NM_006693chr71795 --1211 1109
NM_006703chr61469 ------
NM_006709chr6----175 --
NM_006711chr16--1162 ----
NM_006713chr5--1747 ----
NM_006722chr322415 1039 ------
NM_006724chr61434 ------
NM_006749chr8----1986 1509
NM_006750chr1632804 1077 121 13029 ----
NM_006756chr8189 ----11261
NM_006759chr2----1108 --
NM_006761chr171671 ------
NM_006763chr121847 448 ------
NM_006772chr61269 ------
NM_006800chrX1151 ------
NM_006802chr111129 --1839 --
NM_006803chr821667 1500 11589 22008 1923 --
NM_006805chr511451 ------
NM_006814chr201174 1193 ----
NM_006823chr81168 ------
NM_006839chr2173 ------
NM_006852chr1732505 810 643 ------
NM_006854chr711844 ------
NM_006876chr111577 ------
NM_006885chr161293 11168 ----
NM_006888chr1413537 --12300 --
NM_006896chr731065 436 148 2768 208 ----
NM_006901chr15------1167
NM_006902chr1163 ------
NM_006912chr1135 --166 --
NM_006914chr91115 ------
NM_006920chr211740 ------
NM_006924chr1714031 ------
NM_006927chr16296 80 --21392 750 --
NM_006936chr212164 36 --1409 --
NM_006943chr2073090 2551 1090 1020 299 241 104 23097 2643 13261 22717 168
NM_006950chrX1858 ------
NM_006990chr142038 1973 836 453 --179 --
NM_006999chr541693 1646 278 91 140 151 --
NM_007005chr92348 82 ------
NM_007007chr1224070 831 --23230 1009 --
NM_007011chr1535258 4567 1474 14610 ----
NM_007038chr2135944 1309 489 ------
NM_007042chr321948 62 1503 1204 --
NM_007045chr6--1131 ----
NM_007050chr2088015 7798 5356 5249 2832 734 582 473 16817 ----
NM_007067chr17--1165 ----
NM_007075chrX--146 131 --
NM_007078chr1032881 2868 437 11878 ----
NM_007084chr1341267 230 212 90 ------
NM_007097chr5----186 --
NM_007122chr11249 139 1163 --
NM_007125chrY------1338
NM_007146chr17--12887 ----
NM_007158chr11807 ------
NM_007166chr11--11284 ----
NM_007167chr13859 356 240 ------
NM_007174chr1231700 1628 40 --2575 227 --
NM_007175chr842655 2415 1072 847 1489 ----
NM_007185chr12387 78 ------
NM_007187chr131336 ------
NM_007189chr721482 99 --1593 --
NM_007192chr1431037 443 382 ------
NM_007195chr1812692 13608 ----
NM_007222chr83722 525 178 ------
NM_007232chr2041003 409 399 307 ------
NM_007235chr121195 ------
NM_007245chr16147 ------
NM_007246chr42858 241 ------
NM_007249chr1378289 6480 3099 2096 1457 1444 533 17502 ----
NM_007259chr11401 ------
NM_007276chr71965 ------
NM_007286chr542118 1935 1376 785 ------
NM_007331chr422645 58 ------
NM_007350chr1244333 950 412 110 ------
NM_007353chr73914 694 540 1685 1528 --
NM_007358chr1----11688 --
NM_007365chr131515 711 561 ------
NM_007368chr1321002 53 1187 ----
NM_007371chr91558 1210 1675 --
NM_007375chr11538 ------
NM_012069chrX2932 538 ------
NM_012081chr52609 164 ------
NM_012090chr111288 --1429 --
NM_012095chr1023246 672 ------
NM_012096chr3--1731 ----
NM_012102chr142065 515 272 208 11690 ----
NM_012105chr211256 ------
NM_012134chr111277 ------
NM_012141chr1313948 ------
NM_012154chr81560 1187 ----
NM_012156chr2023224 2796 1794 --12736
NM_012158chr1311137 ------
NM_012164chr937176 5796 1169 ------
NM_012166chr91635 --11105 --
NM_012193chr1133855 3598 782 1187 1338 --
NM_012199chr111495 23110 802 --1370
NM_012214chr236250 4224 2131 ------
NM_012234chr332737 2557 764 --11327 --
NM_012243chr1--1282 ----
NM_012247chr1011002 --1333 --
NM_012252chr744814 1319 927 155 ------
NM_012257chr71843 ------
NM_012259chr6--1513 ----
NM_012261chr202569 555 --1470 --
NM_012264chr2271578 1406 749 450 366 343 216 ------
NM_012264chr2271578 1406 749 450 366 343 216 ------
NM_012266chr91266 ------
NM_012279chr51660 ------
NM_012281chr7--192 1643 --
NM_012284chr122285 236 ------
NM_012288chr635319 4999 4883 21029 721 ----
NM_012293chr2--182 1431 --
NM_012294chr743400 3003 561 32 13307 12863 --
NM_012297chr412642 --12320 --
NM_012301chr721466 870 --1620 --
NM_012302chr12372 319 ------
NM_012306chr1273529 3511 2805 2761 2583 779 417 22949 2428 ----
NM_012307chr1821037 294 ------
NM_012326chr22805 117 ------
NM_012346chr191854 11225 21001 25 --
NM_012384chr2052144 1765 1661 82 56 1118 1376 --
NM_012399chr2211541 --11468 --
NM_012407chr221140 ------
NM_012410chr16121 ------
NM_012416chr92824 170 ------
NM_012425chr1032332 1936 865 ------
NM_012464chr411956 --1333 11156
NM_012479chr72932 44 ------
NM_013235chr5----1830 184
NM_013243chr152903 168 ------
NM_013253chr112511 226 ----11025
NM_013261chr411355 12975 ----
NM_013282chr191250 ----11189
NM_013306chr11138 --1605 --
NM_013316chr7--1395 1918 --
NM_013323chr173777 337 279 ------
NM_013354chr81388 ------
NM_013374chr32275 59 ------
NM_013386chr11250 ------
NM_013390chr91266 11443 1692 --
NM_013392chr22378 56 ------
NM_013396chr21--1162 ----
NM_013433chr1951546 1491 1403 545 524 --1775 --
NM_013437chr81137 ------
NM_013438chr91284 ------
NM_013448chr142503 117 ------
NM_013952chr232387 1598 914 --32130 969 776 --
NM_013953chr232387 1598 914 --32130 969 776 --
NM_013992chr232387 1598 914 --32130 969 776 --
NM_013993chr62824 137 ------
NM_013994chr62824 137 ------
NM_013995chrX----1361 --
NM_014008chrX2260 194 ------
NM_014015chr16281 40 --1306 --
NM_014021chr133326 2477 1269 ------
NM_014023chr1052303 2190 1079 847 822 ------
NM_014030chr1751075 1030 993 270 26 ------
NM_014071chr201135 ------
NM_014089chr131429 ------
NM_014106chr155812 653 400 129 90 ------
NM_014109chr8192 ------
NM_014112chr834780 4438 2034 ------
NM_014117chr1612616 --12706 --
NM_014141chr724726 4263 15142 ----
NM_014153chr16--188 ----
NM_014154chr311510 ------
NM_014155chr1132366 2203 1323 --15722 --
NM_014159chr31496 ----1139
NM_014191chr122760 42 ------
NM_014216chr1421453 1237 11209 ----
NM_014217chr121485 559 1713 ----
NM_014223chr1----1114 --
NM_014233chr1751793 1375 1343 445 188 11577 1540 --
NM_014240chr323334 934 21640 513 ----
NM_014271chrX150 ------
NM_014279chr93701 224 205 1849 --1610
NM_014280chr11832 ------
NM_014284chr11832 1913 1322 --
NM_014294chr811301 ------
NM_014319chr1221884 404 ------
NM_014323chr221798 1203 ----
NM_014325chr1222009 853 ------
NM_014333chr1122061 1139 ------
NM_014351chr222310 21 ------
NM_014368chr921936 103 ------
NM_014372chr1--1137 ----
NM_014390chr71536 ------
NM_014399chr7------1288
NM_014417chr191353 ------
NM_014423chr51221 ------
NM_014426chr20----1256 --
NM_014447chr411688 --1496 --
NM_014458chr12473 155 ------
NM_014470chr121669 ------
NM_014488chr11--1254 ----
NM_014491chr71795 ------
NM_014494chr162694 631 1242 22079 77 --
NM_014515chr12--180 ----
NM_014564chr92965 23 --1908 --
NM_014571chr132534 692 430 12788 1355 --
NM_014585chr2--168 ----
NM_014592chr51765 ------
NM_014593chr18131 ------
NM_014600chr231640 1433 500 --11096 --
NM_014612chr921394 247 --177 --
NM_014613chr52879 185 12668 ----
NM_014633chr112516 247 ------
NM_014636chr964155 3621 1026 670 277 218 --24206 985 --
NM_014646chr1842847 2819 2804 180 12156 1566 --
NM_014653chr122449 149 ------
NM_014659chr1511028 ------
NM_014665chr8103624 3532 3382 3247 2671 2508 1235 1069 188 165 13544 63320 3232 2797 2489 994 37 --
NM_014667chr341688 1642 1517 760 1718 12333 --
NM_014674chr311151 --23511 2490 --
NM_014680chr172152 23 --1557 --
NM_014682chr821621 640 ------
NM_014686chr192885 262 --11798 --
NM_014702chr623119 165 ------
NM_014713chr2--1436 ----
NM_014717chr19170 ------
NM_014723chr2042450 1168 905 385 --33237 1271 445 --
NM_014730chr1211886 --11031 --
NM_014730chr1211886 --11031 --
NM_014731chr201433 ------
NM_014732chr16145349 5139 4749 4533 4456 4211 1196 1100 841 734 457 387 91 22 65096 4093 1867 1612 1523 1082 45050 4110 1886 1309 24828 678
NM_014733chr5--11500 ----
NM_014742chr2021537 68 11259 ----
NM_014743chr43939 749 306 1552 ----
NM_014751chr8------11469
NM_014755chr273843 3640 3231 1276 754 658 572 ------
NM_014756chr11----129 --
NM_014757chr541919 1865 957 843 ------
NM_014762chr12925 412 --2865 688 --
NM_014770chr121100 ------
NM_014772chr18103364 2910 2581 614 544 466 451 440 371 187 13552 12744 --
NM_014781chr8----154 --
NM_014787chr1--276 29 --11047
NM_014788chr951972 841 326 230 39 ------
NM_014795chr22443 380 ------
NM_014800chr72311 236 ------
NM_014802chr121250 ------
NM_014810chr153086 1302 1212 865 754 ------
NM_014819chr51393 ------
NM_014826chr143733 3650 398 208 1969 11649 --
NM_014827chr111651 ------
NM_014830chr1223552 415 11220 23205 683 --
NM_014832chr1332115 1566 63 ------
NM_014839chr121944 33 --1596 --
NM_014850chr32295 162 ----1639
NM_014868chr122916 744 ------
NM_014869chr331348 530 92 ------
NM_014873chr134012 1277 32 ------
NM_014876chr2221808 1741 1414 ----
NM_014877chr1725623 4706 11797 15406 --
NM_014883chr442379 917 231 99 1705 ----
NM_014892chr61561 ------
NM_014901chr541670 174 161 116 --11411 --
NM_014903chr1212164 ------
NM_014912chr1012832 ------
NM_014917chr111008 1256 ----
NM_014918chr151322 ------
NM_014920chr623586 77 --12647 --
NM_014921chr1942627 640 550 440 --1724 --
NM_014926chr3--1241 ----
NM_014932chr311592 ------
NM_014935chr133336 138 118 ------
NM_014941chr22156 ------
NM_014944chr13320 273 243 11420 --1943
NM_014946chr2----1763 125
NM_014949chr11182 ------
NM_014951chr1012562 ------
NM_014969chr11170 1244 ----
NM_014977chr14123 --2453 429 --
NM_014988chr411886 1404 ----
NM_014989chr631812 1336 1327 ------
NM_014994chr1592061 1979 1480 842 716 611 460 350 53 --11999 --
NM_014999chr12--1146 --11653
NM_015001chr12853 47 ----1244
NM_015008chr3--13633 ----
NM_015017chr12825 298 ------
NM_015020chr1653058 2738 2610 532 182 ------
NM_015023chr131185 638 446 --11746 --
NM_015024chr811034 ------
NM_015025chr212216 ----1171
NM_015032chr1312659 ------
NM_015033chr952701 2357 2100 263 106 ------
NM_015035chr2034880 2239 845 ----1143
NM_015039chr143870 3142 1406 731 ----31537 1391 147
NM_015044chr1612995 22937 150 ----
NM_015045chr1021978 1652 ------
NM_015049chr2----1545 --
NM_015052chr711356 11167 ----
NM_015064chr1232431 1030 275 1210 21378 1275 --
NM_015068chr723658 1568 ------
NM_015069chr161630 2251 31 ----
NM_015075chrX62117 2060 1650 831 570 288 ------
NM_015078chr33437 187 44 1528 1241 2427 223
NM_015082chr522079 55 --1490 --
NM_015091chr14187 ------
NM_015092chr1621844 205 1329 1164 --
NM_015093chr611737 ------
NM_015094chr2264585 4377 1527 757 452 261 --33546 1293 249 --
NM_015100chr121994 1853 ------
NM_015102chr12178 92 --168 --
NM_015103chr32390 274 --1993 --
NM_015115chr41118 ------
NM_015125chr192418 199 ------
NM_015130chr411122 ------
NM_015133chr1651444 1287 1214 941 524 --2118 69 11093
NM_015138chr15244 31 --1864 --
NM_015144chr1633631 3536 749 ------
NM_015149chr122142 644 1563 ----
NM_015155chr1013039 23166 28 1613 1429
NM_015156chr1443510 1363 378 253 23987 979 1388 --
NM_015170chr83546 535 339 1669 ----
NM_015172chr1--11347 ----
NM_015178chr8169 --11964 1204
NM_015185chrX22609 2380 --1601 --
NM_015191chr1112111 22231 1736 1832 12077
NM_015193chr841221 1121 981 139 1462 2201 88 11286
NM_015199chr322444 2270 12696 ----
NM_015200chr41355 ------
NM_015205chr13114243 4107 4025 3862 3525 1941 1863 1578 1107 1101 146 1844 13788 --
NM_015206chr1523452 2890 1586 12754 --
NM_015213chr11----148 --
NM_015215chr14626 447 165 144 ------
NM_015233chr1322465 1990 1279 --11681
NM_015236chr411244 ------
NM_015245chr632408 1062 409 11824 2120 87 1171
NM_015247chr1643574 2036 1757 1307 15247 14553 12062
NM_015250chr9146 ------
NM_015263chr15----1392 --
NM_015265chr222243 2086 ------
NM_015270chr1242196 1676 688 484 --1794 --
NM_015271chr42897 229 13335 ----
NM_015272chr1611989 11714 11857 --
NM_015277chr1841448 1136 273 104 ------
NM_015288chr553750 2755 1101 600 242 ----12404
NM_015293chr6--123 ----
NM_015294chr172941 339 ------
NM_015299chr1443619 3548 3374 2560 12518 ----
NM_015310chr8107839 7066 6602 5719 2967 2444 1465 1063 813 788 26669 5911 27563 3062 17112
NM_015313chr1131345 1278 27 --11628 1941
NM_015317chr222263 2168 11926 ----
NM_015319chr121349 ------
NM_015326chr12701 229 ------
NM_015327chr141102 978 311 145 1472 122 --
NM_015328chr722753 1170 ------
NM_015332chr762820 2369 2269 1390 308 76 ----11347
NM_015335chr123161 122 45 12285 ----
NM_015338chr2031972 1194 243 ----11202
NM_015339chr202132 35 ------
NM_015346chr1411311 ------
NM_015349chr612499 --1599 --
NM_015355chr1711497 ------
NM_015358chr211263 ------
NM_015359chr842854 2251 1995 133 21124 949 ----
NM_015365chrX--21589 39 ----
NM_015375chr131414 507 352 ----13405
NM_015388chr61207 145 138 --
NM_015396chr331282 298 108 ------
NM_015397chr911471 --11222 --
NM_015419chrX2988 415 ------
NM_015435chr811320 ------
NM_015444chr31221 ------
NM_015447chr92810 255 ------
NM_015449chr1--126 ----
NM_015455chr511588 ------
NM_015461chr182726 520 ------
NM_015470chr22875 82 ------
NM_015472chr3186 ------
NM_015472chr3186 ------
NM_015475chr21723 1945 ----
NM_015481chr122820 767 ------
NM_015503chr162280 101 ------
NM_015520chr311978 --2394 304 --
NM_015544chr171601 ------
NM_015548chr6--1119 ----
NM_015550chr722574 2527 13130 ----
NM_015557chr132620 2221 1192 22542 1176 22847 400 --
NM_015568chr2053994 2634 1607 1397 1330 24161 3978 21447 668 --
NM_015576chr32854 80 ------
NM_015577chr511646 11661 1355 --
NM_015578chr19----11836 1366
NM_015601chr102819 373 --1643 --
NM_015609chr142940 2934 1120 695 --22883 2610 --
NM_015626chr1711100 ----11178
NM_015630chr221164 330 ------
NM_015635chr91801 2899 555 ----
NM_015651chr91913 --11579 --
NM_015676chr14172 ------
NM_015678chr131369 --11317 --
NM_015686chrX22000 875 --1364 --
NM_015834chr211918 ------
NM_015844chr183301 289 39 ----1192
NM_015846chr183301 289 39 ----1192
NM_015847chr183301 289 39 ----1192
NM_015850chr832095 1934 394 21774 1580 ----
NM_015852chr723468 1225 ------
NM_015874chr41147 ------
NM_015878chr821903 829 ------
NM_015881chr112511 226 ----11025
NM_015885chr11------1180
NM_015898chr1952513 1748 537 327 221 ------
NM_015920chr151638 ------
NM_015955chr2130 ------
NM_015975chrX1115 ------
NM_015981chr532413 1195 139 138 12282 --
NM_016019chr71352 ----11052
NM_016022chr12929 327 ------
NM_016037chr12831 324 ------
NM_016061chr22534 271 ------
NM_016062chr16127 ------
NM_016083chr633117 745 374 ------
NM_016096chr8----172 --
NM_016107chr5--1500 ----
NM_016131chr21773 ------
NM_016179chr13147 ------
NM_016201chr3----1684 --
NM_016206chr321832 634 ------
NM_016235chr1621140 249 11363 ----
NM_016243chr1135 --1140 --
NM_016256chr162185 64 ------
NM_016257chr142890 2796 2570 181 23302 704 ----
NM_016258chr1124 ------
NM_016260chr225031 1414 27459 7308 ----
NM_016271chr18134 ------
NM_016272chr2241072 495 421 164 11037 11746 --
NM_016279chr5167 ------
NM_016281chr122437 68 ------
NM_016289chr211520 ------
NM_016290chr5----1107 --
NM_016291chr3----1101 --
NM_016316chr2------1617
NM_016322chr933202 827 217 ------
NM_016329chr3----1106 --
NM_016340chr531098 1024 73 1185 11081 --
NM_016351chr71504 ------
NM_016374chr1----1517 --
NM_016374chr1----1517 --
NM_016396chr152621 266 ------
NM_016424chr171179 ------
NM_016441chr21591 ------
NM_016453chr31465 --127 --
NM_016472chr141485 ------
NM_016480chr51754 ------
NM_016485chr61908 ------
NM_016505chr11581 --1237 --
NM_016507chr172689 311 ------
NM_016513chr623586 77 --12647 --
NM_016522chr1111081 ------
NM_016525chr9--130 --157
NM_016530chr1533850 2816 24 ----13999
NM_016531chr413428 14019 1598 --
NM_016553chr191854 11225 21001 25 --
NM_016556chr172612 33 ------
NM_016559chr311003 ------
NM_016569chr1211110 ------
NM_016577chr344343 3235 3084 1420 11054 13561 --
NM_016587chr71965 ------
NM_016604chr51290 --11178 --
NM_016613chr41507 ------
NM_016621chr1154387 3730 3712 3607 662 --22859 308 --
NM_016626chr181498 ------
NM_016644chr51110 ------
NM_016733chr22----121 --
NM_016821chr31414 ------
NM_016823chr1711274 ------
NM_016827chr31718 ------
NM_016929chr61726 132 ----
NM_016952chr1142856 2826 1146 765 13652 11262 --
NM_017413chrX32226 869 107 --11861 --
NM_017415chr534395 1681 159 1598 11708 --
NM_017420chr1412873 1371 ----
NM_017423chr41180 ------
NM_017450chr1721482 487 --1300 --
NM_017452chr20----1533 11083
NM_017453chr20----1533 11083
NM_017454chr20----1533 11083
NM_017456chr1742015 730 363 58 --1572 1765
NM_017490chr11186 ------
NM_017491chr43335 152 56 ----1403
NM_017510chr5----1522 1622
NM_017548chr341906 1710 461 42 --22016 273 --
NM_017551chr102503 95 ------
NM_017559chr171287 ------
NM_017590chr2221665 192 11682 ----
NM_017594chr932914 2266 385 ------
NM_017599chr121407 ------
NM_017607chr19126 ------
NM_017610chr15157 ------
NM_017628chr444557 2107 1996 1240 11512 ----
NM_017629chr1--2642 586 --11960
NM_017632chr41450 ------
NM_017633chr61241 ------
NM_017637chr967914 6535 5787 1782 1396 409 19119 17112 18493
NM_017643chr17--1472 ----
NM_017668chr161553 --1137 --
NM_017672chr15134 ------
NM_017679chr172696 276 ------
NM_017680chr91729 ------
NM_017686chr11892 ------
NM_017721chr192369 318 ------
NM_017737chr111988 ------
NM_017742chr1811732 --1473 --
NM_017752chrX11992 ------
NM_017758chr172518 391 11346 --11068
NM_017762chr1522356 1006 1630 ----
NM_017769chr1412252 ------
NM_017770chr612715 12952 ----
NM_017778chr831322 1195 332 ------
NM_017784chr31974 ------
NM_017791chr142496 345 ------
NM_017799chr1411254 --11571 --
NM_017801chr3142 ------
NM_017824chr1022204 24 ------
NM_017830chr4169 ------
NM_017849chr241981 1048 60 49 ------
NM_017851chr151926 ------
NM_017893chr102516 372 ----1260
NM_017902chr1084393 4247 2238 1435 1122 487 420 253 --14467 --
NM_017921chr1772087 1682 1576 851 552 544 204 1861 12344 --
NM_017938chrX1537 ------
NM_017944chr111667 ------
NM_017953chr12396 46 1986 ----
NM_017994chr711085 --12878 --
NM_018014chr2----1161 1138
NM_018025chr19--1164 ----
NM_018027chr102238 197 1877 12127 --
NM_018086chr22589 531 ------
NM_018110chr16160 ------
NM_018124chr16194 ------
NM_018133chr3195 ------
NM_018135chr62172 32 ------
NM_018151chr22768 512 ------
NM_018154chr19----166 --
NM_018172chr116623 571 519 467 415 363 --31534 1115 1083 --
NM_018184chr311855 1576 ----
NM_018191chr13190 ------
NM_018192chr31983 ------
NM_018198chr161420 1364 1051 399 313 219 --1918 --
NM_018207chr121110 47 11144 ----
NM_018227chr421955 442 ------
NM_018234chr21716 --11618 --
NM_018243chr421063 28 ------
NM_018244chr20--1920 --184
NM_018254chr1124 ------
NM_018265chr121360 99 ------
NM_018270chr201332 1702 ----
NM_018299chr832621 962 825 ------
NM_018300chr191427 ------
NM_018307chr171162 ------
NM_018315chr42993 63 ------
NM_018322chr61931 ------
NM_018330chr101669 ------
NM_018334chr7160 ------
NM_018340chr1643834 3184 3169 1204 ------
NM_018364chr111579 ------
NM_018369chr51650 ------
NM_018373chr1426093 4187 ------
NM_018383chr2188 ------
NM_018403chr313457 13481 1630 --
NM_018416chr12--12400 ----
NM_018423chr121279 ------
NM_018444chr821949 215 11555 ----
NM_018445chr151133 ------
NM_018449chr91323 ------
NM_018469chr171172 ------
NM_018488chr172246 67 ------
NM_018490chr111460 ------
NM_018509chr1721604 234 1121 11676 --
NM_018566chr124599 1329 ------
NM_018640chr1212677 ------
NM_018644chr1151999 1374 640 320 305 --2393 356 --
NM_018667chr1682262 2031 613 413 398 390 382 44 --1558 --
NM_018683chr201634 11389 ----
NM_018704chr131725 709 424 ------
NM_018710chr811112 ------
NM_018711chr1211456 139 ----
NM_018717chr432658 837 123 12235 ----
NM_018718chr7--194 --1509
NM_018719chr71338 ------
NM_018834chr51879 ------
NM_018837chr20----1704 --
NM_018898chr532093 694 425 1127 ----
NM_018899chr532093 694 425 1127 ----
NM_018900chr532093 694 425 1127 ----
NM_018901chr532093 694 425 1127 ----
NM_018902chr532093 694 425 1127 ----
NM_018903chr532093 694 425 1127 ----
NM_018904chr532093 694 425 1127 ----
NM_018905chr532093 694 425 1127 ----
NM_018906chr532093 694 425 1127 ----
NM_018907chr532093 694 425 1127 ----
NM_018908chr532093 694 425 1127 ----
NM_018909chr532093 694 425 1127 ----
NM_018910chr532093 694 425 1127 ----
NM_018911chr532093 694 425 1127 ----
NM_018951chr7183 ------
NM_018970chr732460 1115 133 ------
NM_018977chrX2182 150 1742 1750 --
NM_018979chr1221662 602 ------
NM_018982chr1160 ------
NM_018994chr1--1536 ----
NM_018999chr1044827 4620 4398 835 --13374 --
NM_019000chr51612 --1140 --
NM_019049chr1--1512 ----
NM_019084chr101536 ------
NM_019087chr541642 1359 1109 248 ------
NM_019105chr6122 --1126 --
NM_019106chr2232471 2266 400 --12145 --
NM_019114chr912185 ------
NM_019116chr1613489 1983 22780 67 --
NM_019555chr321239 34 11615 ----
NM_019556chrX--1171 ----
NM_019593chr2022322 663 ------
NM_019595chr21143 ------
NM_019605chr11609 ------
NM_019843chr221148 ------
NM_019850chr22181 36 ------
NM_019859chr101569 178 ----
NM_019860chr101617 1126 ----
NM_020039chr12----11254 --
NM_020116chr43685 511 305 ------
NM_020122chr22728 575 24072 2124 14340 --
NM_020123chr1021402 595 ------
NM_020130chr8----1270 --
NM_020139chr41760 ------
NM_020144chr721684 183 ------
NM_020145chr93558 230 24 ------
NM_020148chr181579 22101 877 ----
NM_020163chr362092 2012 1849 939 466 288 --1424 --
NM_020182chr2033030 1127 1069 1750 --21435 803
NM_020193chr112148 97 ------
NM_020204chr12741 154 ------
NM_020205chr113128 1218 ----
NM_020226chr41107 --156 --
NM_020228chr1111611 ------
NM_020240chr522026 110 1940 ----
NM_020307chr3123 ------
NM_020309chr191832 1189 ----
NM_020310chr1742817 2063 1999 1970 1635 21007 800 --
NM_020336chr2042893 2770 1158 925 12966 ----
NM_020337chr42269 122 ------
NM_020342chr222474 172 --1624 --
NM_020360chr172490 104 ------
NM_020362chr1--1140 ----
NM_020381chr641877 1262 385 234 1241 ----
NM_020390chr312982 148 --14711
NM_020405chr1774398 3405 1783 1512 882 623 335 13609 11537 --
NM_020416chr41789 1119 ----
NM_020429chr722789 75 22760 2228 ----
NM_020433chr2031810 1788 540 ----11532
NM_020440chr132269 1213 244 23252 3240 12982 --
NM_020452chr131806 1383 613 --2665 441 --
NM_020456chr1312126 12155 ----
NM_020465chr1621710 148 ------
NM_020466chr644779 3791 1214 175 --13910 --
NM_020474chr1821549 112 ------
NM_020475chr872307 2147 2120 1928 1729 1614 57 --12188 12180
NM_020476chr872307 2147 2120 1928 1729 1614 57 --12188 12180
NM_020477chr872307 2147 2120 1928 1729 1614 57 --12188 12180
NM_020478chr872370 2210 2183 1991 1792 1677 120 --12251 12243
NM_020480chr872307 2147 2120 1928 1729 1614 57 --12188 12180
NM_020530chr22167 ------
NM_020640chr31329 ------
NM_020647chr8161 --11644 --
NM_020703chr11222 ------
NM_020704chr72947 525 1791 ----
NM_020734chr121843 ------
NM_020740chr17------1154
NM_020747chr51278 ------
NM_020748chr1711325 ------
NM_020749chr841492 149 115 53 ------
NM_020752chr101618 ------
NM_020760chr241865 1846 1388 502 ------
NM_020772chr1748208 1949 1300 34 ------
NM_020777chr432037 924 550 1374 1812 1413
NM_020791chr1721319 507 --1899 --
NM_020805chr181364 ------
NM_020806chr14------2543 307
NM_020808chr12984 956 ------
NM_020809chr11--22317 294 ----
NM_020810chr1442780 2590 787 661 --1434 --
NM_020820chr2041431 371 103 29 ------
NM_020832chr1--1264 1492 --
NM_020841chr12--13239 13876 --
NM_020845chr1242476 2157 1806 421 ------
NM_020850chr1633134 2368 643 --11234 --
NM_020856chr1931335 528 28 1113 ----
NM_020858chr151173 ----11577
NM_020861chr61909 ------
NM_020863chr8150 ----193
NM_020871chrX--12009 ----
NM_020888chr1--1315 1118 --
NM_020899chr1722511 2426 ------
NM_020918chr1022462 92 1246 --23100 197
NM_020921chr1412734 ------
NM_020922chrX2549 389 --11306 --
NM_020927chr1631769 839 121 ------
NM_020935chr233492 1621 200 ------
NM_020952chr91286 ------
NM_020964chr1843673 3155 3074 1213 14046 ----
NM_020971chr196739 619 536 155 79 48 1324 ----
NM_020972chr45858 703 192 111 68 --1172 --
NM_020974chr111105 --1489 --
NM_020977chr4------1496
NM_020980chr152692 614 ------
NM_020983chr1242196 1676 688 484 --1794 --
NM_021019chr12128 ------
NM_021033chr1333305 2385 116 176 ----
NM_021038chr313348 ------
NM_021064chr61578 1185 ----
NM_021072chr542472 1010 899 571 ----11761
NM_021083chrX13600 12658 ----
NM_021103chr2171 ------
NM_021109chrX----1309 --
NM_021109chrX----1309 --
NM_021120chrX2740 243 ------
NM_021155chr1921966 364 12651 11175 --
NM_021156chr201331 --164 --
NM_021159chr411157 11097 ----
NM_021183chrX22366 2182 --12549 --
NM_021189chr12704 89 ------
NM_021192chr22164 69 ------
NM_021224chr91442 ------
NM_021242chrX2278 238 ------
NM_021255chr14--11129 13405 12898
NM_021260chr142361 118 ------
NM_021267chr1971289 1025 997 885 532 354 284 1234 ----
NM_021627chr3190 ------
NM_021637chrX1428 ------
NM_021638chr433964 1610 1353 14306 34417 4058 3879 --
NM_021639chr11324 ------
NM_021647chr421155 357 --1153 --
NM_021648chr631765 1759 997 --12086 --
NM_021722chr72463 231 ------
NM_021723chr71504 ------
NM_021728chr141668 ------
NM_021738chr101262 --1559 --
NM_021784chr201175 ------
NM_021813chr655397 4074 3622 493 27 ------
NM_021911chr535277 4166 1077 ------
NM_021912chr1533930 1274 1260 ------
NM_021923chr411505 177 11007 --
NM_021943chr631573 857 107 --12019 --
NM_021946chrX--21096 91 ----
NM_021949chrX5901 845 809 397 389 12276 1858 --
NM_021954chr1321372 752 --1347 --
NM_021961chr1134649 2418 2113 46675 2891 2845 318 17383 --
NM_021964chr336456 4203 1655 ------
NM_021988chr203512 470 411 ------
NM_021999chr131672 ------
NM_022003chr1141058 921 806 205 ----11218
NM_022041chr1612288 12363 1781 --
NM_022048chr1534303 920 637 26008 414 22561 57 --
NM_022062chr111356 1383 ----
NM_022079chr102819 373 --1643 --
NM_022114chr173701 3695 3307 3133 784 607 349 1464 --24157 283
NM_022156chr171155 ------
NM_022166chr1686293 2529 2439 1824 1527 1321 662 218 22063 2034 --12505
NM_022169chr1121054 264 --133 --
NM_022170chr731127 586 440 --181 --
NM_022343chr91996 ------
NM_022351chr813311 ------
NM_022368chrX162 ------
NM_022437chr21140 ------
NM_022442chr203512 470 411 ------
NM_022457chr1151 ------
NM_022459chr1336216 777 421 ------
NM_022463chr171143 --11576 --
NM_022465chr12--12677 ----
NM_022469chr152802 2302 403 380 30 12159 ----
NM_022485chr31359 ------
NM_022491chr121135 11404 12476 --
NM_022571chr14144 ------
NM_022574chr711802 --176 188
NM_022648chr263010 1347 1187 1122 789 783 ------
NM_022658chr121884 ------
NM_022719chr2273338 3213 2382 1234 563 380 322 --33248 468 45 --
NM_022730chr2----188 --
NM_022776chr31156 ------
NM_022802chr101506 ------
NM_022832chr452525 2484 2339 884 68 ------
NM_022841chr15--1124 179 --
NM_022843chr13----11134 --
NM_022845chr161183 --1676 --
NM_022898chr1484447 4230 3938 1378 376 103 96 24 14116 1988 13953
NM_022910chr1621710 148 ------
NM_022912chr21145 --1683 --
NM_022977chrX1451 ------
NM_023009chr11294 ------
NM_023010chrX--1131 ----
NM_023035chr19181 ----2611 171
NM_023037chr13--11048 ----
NM_023071chr1221126 914 ------
NM_023079chr1751290 1181 741 229 114 ------
NM_023105chr832095 1934 394 21774 1580 ----
NM_023106chr832095 1934 394 21774 1580 ----
NM_023110chr832095 1934 394 21774 1580 ----
NM_023111chr832095 1934 394 21774 1580 ----
NM_024007chr5--1126 ----
NM_024034chr201155 ------
NM_024036chr111226 ------
NM_024046chr341324 1241 460 224 --1368 --
NM_024052chr1732423 274 122 ------
NM_024061chr7163 ------
NM_024085chr24847 779 410 312 ------
NM_024092chr1131187 795 133 11005 ----
NM_024107chr171343 --1704 --
NM_024117chr931158 1067 31 ------
NM_024293chr2126 --1689 --
NM_024306chr161390 1842 1126 --
NM_024315chr7------197
NM_024337chr51132 ------
NM_024408chr11702 --1345 --
NM_024511chr41826 ------
NM_024522chr18718 525 464 198 127 109 97 47 ------
NM_024523chr7--1945 ----
NM_024527chr193489 76 42 --1209 --
NM_024556chr111319 ------
NM_024582chr41211 ------
NM_024595chr11128 ------
NM_024599chr17--171 ----
NM_024607chr833018 1612 457 1535 14134 --
NM_024617chr9------1872
NM_024628chr311102 ------
NM_024639chr62765 123 1398 ----
NM_024643chr14------2352 104
NM_024645chr811160 ----11427
NM_024646chr122608 722 --11122 --
NM_024659chr2--1103 ----
NM_024665chr313662 13717 ----
NM_024674chr143076 2163 775 254 1555 ----
NM_024698chr111185 11044 ----
NM_024705chr133790 326 253 ------
NM_024713chr1521318 322 ------
NM_024721chr82591 74 1613 ----
NM_024740chr1143627 2832 979 69 ------
NM_024742chr1621294 169 1666 ----
NM_024745chr162911 714 ------
NM_024751chr43716 653 165 ------
NM_024770chr245953 5718 1936 659 16271 --26250 5664
NM_024798chr151159 22854 2392 12349 --
NM_024830chr531865 1794 36 11875 ----
NM_024834chr101579 11868 ----
NM_024845chr1651644 1113 620 426 138 ----149
NM_024871chr331118 500 72 --1466 --
NM_024911chr1----1191 --
NM_024927chr17----137 --
NM_024939chr162636 201 ------
NM_024956chr15--1185 --1173
NM_024963chr753841 2139 2132 2005 48 1543 25622 3931 --
NM_024971chr91286 ------
NM_025076chr2--1183 ----
NM_025133chr21945 ------
NM_025141chr152414 56 1542 ----
NM_025158chr51473 ------
NM_025160chr133348 3154 647 ------
NM_025176chr20------1135
NM_025184chrX1832 ------
NM_025191chr11252 ------
NM_025209chr10122 ------
NM_025235chr102810 475 ------
NM_025236chr62636 288 --145 --
NM_025237chr172112 51 11258 11386 --
NM_025248chr1762920 2722 2499 2408 2309 360 --22782 1049 11225
NM_025251chr82266 59 --3915 425 238 --
NM_025256chr6----175 --
NM_030576chr1752344 1886 1773 629 539 --2493 179 --
NM_030594chr15164 ------
NM_030621chr1454118 3968 3041 3023 2829 54171 3583 3390 2740 1043 1445 --
NM_030625chr1032577 2118 751 ------
NM_030627chr51275 13233 ----
NM_030629chr1611864 168 ----
NM_030647chr714091 25526 1061 16058 --
NM_030648chr444385 2168 739 141 11236 --14656
NM_030650chr233971 632 318 ------
NM_030780chr821680 153 ------
NM_030795chr81410 --1473 --
NM_030802chr17--1808 ----
NM_030805chr21155 --1245 --
NM_030806chr188620 8132 7630 7039 3117 2394 1731 447 --16884 38975 8560 1516
NM_030808chr172214 110 ------
NM_030809chr1221951 1581 ------
NM_030881chr221495 --21909 905 --
NM_030884chr352210 1781 1534 819 139 21835 94 ----
NM_030906chr111232 ------
NM_030915chr231788 637 468 21843 1656 --21764 137
NM_030918chr145294 3934 3403 1589 ----14365
NM_030937chr121287 1105 --1953 --
NM_030939chr6--1762 ----
NM_030940chr9125 166 ----
NM_030957chr19----2145 56 --
NM_030964chr52327 70 12471 ----
NM_031205chr122164 124 ------
NM_031216chr18------11754
NM_031243chr711917 ------
NM_031262chr9129 ------
NM_031263chr9186 ------
NM_031371chr1----1517 --
NM_031371chr1----1517 --
NM_031372chr411393 ------
NM_031411chr532093 694 425 1127 ----
NM_031417chr1951809 972 249 234 112 11047 1892 --
NM_031439chr811466 --1206 --
NM_031442chrX----1340 --
NM_031445chr222393 701 --1380 --
NM_031453chr101212 12078 ----
NM_031455chr1021670 1333 ----1279
NM_031461chr8----1778 --
NM_031483chr201627 22485 347 ----
NM_031844chr123942 2538 ------
NM_031845chr223413 868 ------
NM_031847chr223413 868 ------
NM_031849chr532093 694 425 1127 ----
NM_031857chr532093 694 425 1127 ----
NM_031860chr532093 694 425 1127 ----
NM_031922chr61495 ------
NM_031938chr112767 221 ------
NM_031992chr731127 586 440 --181 --
NM_032037chr192387 366 --129 --
NM_032041chr822709 423 ------
NM_032042chr552466 1047 677 364 47 ------
NM_032050chr221798 1203 ----
NM_032105chr117009 ----27591 5366
NM_032108chr192193 115 2706 396 --1128
NM_032154chr10147 ------
NM_032181chr2157 ------
NM_032193chr1151839 1428 666 587 534 ------
NM_032229chr13--126 ----
NM_032242chr352837 2722 2663 2232 111 23169 797 42978 2799 1092 508 --
NM_032268chr1663098 2922 2775 2470 1281 708 --12098 --
NM_032272chr82468 323 ------
NM_032281chr1923127 180 11198 22835 2535 --
NM_032287chr2264029 3114 1500 1024 818 30 11658 11032 --
NM_032294chr1731450 108 46 --187 --
NM_032353chr171433 --1327 --
NM_032354chr1721045 162 ----1292
NM_032360chr1122 ------
NM_032373chr1025418 37 ------
NM_032382chr162472 83 --1112 --
NM_032408chr71926 ------
NM_032430chr19----1131 --
NM_032440chr1022542 299 ------
NM_032452chr1431315 1282 537 ------
NM_032458chrX12411 ------
NM_032470chr6122 --1126 --
NM_032499chr15167 --1124 1547
NM_032505chr312099 --11098 --
NM_032509chr811855 ------
NM_032510chr1822099 1995 --1897 165
NM_032514chr20--1421 ----
NM_032552chr931696 423 129 --21385 446 1347
NM_032595chr171622 ----1306
NM_032622chr411468 ------
NM_032638chr361408 1363 624 471 224 193 ------
NM_032682chr333561 1459 337 1395 ----
NM_032689chr1921440 1297 11337 --1630
NM_032711chr1773918 3378 3273 1661 1648 1383 128 22608 797 ----
NM_032758chr22144 ------
NM_032765chr53921 858 678 ------
NM_032810chr101607 ------
NM_032826chr721745 469 --33318 697 98 --
NM_032833chr122348 268 ------
NM_032837chr1711514 --11807 --
NM_032842chr721364 179 ------
NM_032859chr131755 ------
NM_032867chr112455 85 ------
NM_032883chr20--1174 1213 --
NM_032892chr151134 ------
NM_032947chr521021 139 ------
NM_032961chr41426 ------
NM_032966chr1121421 1161 --1575 --
NM_032975chr1822320 651 13217 ----
NM_032980chr1822320 651 13217 ----
NM_032991chr411418 1105 ----
NM_032995chr231070 646 296 ------
NM_032998chr12222 173 --1817 --
NM_033012chr132421 331 ------
NM_033044chr111288 --1429 --
NM_033046chr22267 138 ------
NM_033058chr8129 ------
NM_033067chr11499 ------
NM_033071chr6--123 ----
NM_033081chr20----21469 421 --
NM_033088chr12130 80 ------
NM_033132chr1311788 ------
NM_033138chr732293 1627 372 ------
NM_033139chr732293 1627 372 ------
NM_033140chr732293 1627 372 ------
NM_033141chr1412136 --1180 1305
NM_033157chr732293 1627 372 ------
NM_033181chr633117 745 374 ------
NM_033211chr51613 ------
NM_033221chr941778 647 132 36 ------
NM_033222chr911336 ------
NM_033224chr777944 6431 3024 2944 2911 2428 220 2703 114 ----
NM_033225chr822538 107 1631 ----
NM_033226chr16187 ------
NM_033228chr51558 ------
NM_033259chr35321 264 252 185 121 1365 3291 108 42 --
NM_033274chr523146 608 150 11382 --
NM_033285chr832971 1448 832 --11094 --
NM_033310chr111257 ------
NM_033315chr1741871 1746 1723 1515 1500 2261 124 --
NM_033326chr11177 ----1279
NM_033331chr923327 3288 11060 11076 --
NM_033375chr1721288 122 ------
NM_033380chrX1363 ------
NM_033381chrX1363 ------
NM_033387chr952430 2269 1981 787 620 11730 --11973
NM_033389chr172830 506 --13708 --
NM_033406chr11--150 ----
NM_033420chr195989 815 443 252 51 1784 2959 41 --
NM_033425chr111668 ------
NM_033504chr1144 ------
NM_033632chr42993 63 ------
NM_033656chr2135468 5140 4267 ------
NM_052832chr812937 ------
NM_052840chr151290 --1193 --
NM_052843chr12425 403 --1359 --
NM_052867chr1321007 343 ------
NM_052875chr1112074 ------
NM_052896chr132542 2486 2142 1238 ----
NM_052897chr12181 ------
NM_052906chr2221044 131 11007 34757 3561 623 24849 468
NM_052910chr136566 527 339 146 99 58 22027 1532 ----
NM_052918chr1053704 2999 1490 1229 916 ------
NM_052935chr17----127 --
NM_052978chr141212 --11601 11443
NM_052998chr1----1136 --
NM_053001chr81146 --1158 --
NM_053024chr311469 ------
NM_053025chr3--1515 ----
NM_053026chr3--1515 ----
NM_053027chr3--1515 ----
NM_053028chr3--1515 ----
NM_053031chr3--1515 ----
NM_053032chr3--1515 ----
NM_053043chr735953 3992 1581 --46433 5894 1734 1645 --
NM_053067chr91284 ------
NM_054025chr1151999 1374 640 320 305 --2393 356 --
NM_054027chr54568 370 341 26 --11415 1646
NM_054033chr2134 ------
NM_057158chr82652 226 ------
NM_057159chr921582 1527 ------
NM_057175chr421747 977 ------
NM_058172chr4------1269
NM_058175chr214858 312 234 138 ------
NM_058243chr192282 122 ------
NM_078469chr101560 ------
NM_078474chr152414 56 1542 ----
NM_078629chrX1151 ------
NM_078630chrX1151 ------
NM_079421chr191102 --1225 --
NM_080415chr17167 ------
NM_080422chr18127 ------
NM_080423chr18127 ------
NM_080546chr922192 2154 ------
NM_080552chr202712 540 --1465 --
NM_080594chr16--1162 ----
NM_080616chr201291 ------
NM_080617chr20--1864 ----
NM_080621chr2011115 --180 --
NM_080632chrX--1131 ----
NM_080645chr611514 22144 2006 ----
NM_080654chr11----1145 --
NM_080676chr2032801 2504 420 1166 ----
NM_080677chr171153 ------
NM_080730chr12192 1693 136 --
NM_080731chr12192 1693 136 --
NM_080743chr622209 627 ------
NM_080798chr101133 ------
NM_080799chr101133 ------
NM_080800chr101133 ------
NM_080801chr101133 ------
NM_080802chr101133 ------
NM_080803chr101133 ------
NM_080804chr101133 ------
NM_080805chr101133 ------
NM_080806chr101133 ------
NM_080807chr101133 ------
NM_080808chr101133 ------
NM_080809chr101133 ------
NM_080810chr101133 ------
NM_080811chr101133 ------
NM_080812chr101133 ------
NM_080813chr101133 ------
NM_080814chr101133 ------
NM_080815chr101133 ------
NM_080829chr202744 71 ------
NM_080872chr824007 3329 1896 --13711
NM_080881chr5388 81 47 ------
NM_130385chr1122678 2649 ------
NM_130387chr31143 ------
NM_130391chr923153 359 ------
NM_130392chr923153 359 ------
NM_130393chr923153 359 ------
NM_130438chr211472 ------
NM_130439chr101674 ------
NM_130439chr101674 ------
NM_130440chr11278 1406 ----
NM_130442chr72311 236 ------
NM_130459chr93650 631 420 --21425 606 --
NM_130797chr731313 429 307 --1226 --
NM_130838chr151659 ------
NM_130839chr151659 ------
NM_130846chr12185 ------
NM_133170chr2088015 7798 5356 5249 2832 734 582 473 16817 ----
NM_133177chr11222 --21070 251 1380
NM_133178chr11222 --21070 251 1380
NM_133264chr1743670 713 222 84 13234 ----
NM_133265chrX11130 21368 23 ----
NM_133266chr1131196 795 315 ------
NM_133334chr485871 5801 4746 1756 1582 766 297 31 14722 ----
NM_133372chr51319 ------
NM_133373chr172880 641 ----156
NM_133433chr51840 ------
NM_133445chr911052 ------
NM_133446chr10122 ------
NM_133452chr19134 --1226 --
NM_133468chr732411 1615 76 ------
NM_133496chr11415 --11776 --
NM_133499chrX2928 32 ------
NM_133633chr22178 --11228 --
NM_133638chr5--1432 1458 --
NM_133647chr1543388 920 570 181 --12491 --
NM_133650chr6--123 ----
NM_134265chr1711100 ----11178
NM_134421chr22552 82 --1600 --
NM_138281chr17268 39 ------
NM_138285chr21164 --189 --
NM_138300chr131600 1154 466 ------
NM_138338chr2232768 2685 187 --21007 865 --
NM_138357chr10--1493 ----
NM_138360chr14144 1218 ----
NM_138375chr181852 1400 ----
NM_138430chr13--1386 267 54 --
NM_138457chr653172 2417 927 891 778 --2879 358 --
NM_138468chr255314 5255 5236 4260 88 1713 15246 --
NM_138473chr1243849 1856 1782 298 23495 1305 ----
NM_138569chr61121 ------
NM_138576chr1484447 4230 3938 1378 376 103 96 24 14116 1988 13953
NM_138612chr16----151 --
NM_138621chr241168 1090 636 72 14161 1435 --
NM_138632chr22--123 ----
NM_138635chr732759 2567 288 13049 ----
NM_138713chr1678276 8251 8065 7751 6304 1164 396 --1974 --
NM_138714chr1678276 8251 8065 7751 6304 1164 396 --1974 --
NM_138730chr61466 ------
NM_138735chr21474 ------
NM_138782chr52920 672 ------
NM_138927chr211692 ------
NM_138931chr32814 175 1765 ----
NM_138939chr3178 ------
NM_138940chr3178 ------
NM_138981chr41581 ------
NM_138991chr211256 ------
NM_138992chr211453 ------
NM_139032chr171117 ------
NM_139033chr171117 ------
NM_139034chr171117 ------
NM_139048chr3--1260 ----
NM_139057chr1541983 903 674 59 12111 ----
NM_139071chr12------11225
NM_139135chr13962 835 520 ------
NM_139156chr12844 32 ------
NM_139157chr111486 ------
NM_139207chr12134 ------
NM_139239chr191265 ------
NM_139246chr91827 21975 83 ----
NM_139276chr17151 124 ----
NM_139279chr21102 --21357 1261 --
NM_139280chr1731380 1028 387 ----11212
NM_139321chr2053120 2809 1691 140 62 --11193 --
NM_139323chr2011573 ------
NM_144579chr232865 1829 828 2680 64 183 --
NM_144586chr23884 473 29 1374 ----
NM_144591chr103463 115 96 ------
NM_144595chr131769 ------
NM_144599chr152988 186 ------
NM_144643chr4181 ------
NM_144664chr1112485 ------
NM_144723chr51305 ------
NM_144778chr131529 --1570 --
NM_144973chr1243648 1824 606 92 ------
NM_145008chr11132 ------
NM_145044chr311483 ------
NM_145049chr5------1955
NM_145113chr1411292 1126 ----
NM_145119chrX162 ------
NM_145159chr141821 ------
NM_145185chr1931639 1363 281 --1335 --
NM_145239chr168363 343 289 269 236 224 204 158 ------
NM_145253chr163699 683 670 ------
NM_145259chr246259 5990 877 613 ------
NM_145260chr24630 537 488 295 1288 ----
NM_145277chr11142 ------
NM_145284chrX1356 ------
NM_145307chr1034182 2982 1817 ----14272
NM_145320chr722574 2527 13130 ----
NM_145321chr722574 2527 13130 ----
NM_145322chr722574 2527 13130 ----
NM_145331chr6----1837 --
NM_145332chr6----1985 --
NM_145333chr6----1985 --
NM_145349chr173634 585 308 --11619 --
NM_145690chr811639 1530 ----
NM_145727chr631399 462 358 ------
NM_145730chr22----182 --
NM_145735chr133995 711 43 12224 ----
NM_145756chr182556 345 ------
NM_145798chr17----1582 --
NM_145799chrX33048 253 144 ----1242
NM_145805chr15246 35 1194 --128
NM_145808chr711126 ----11242
NM_145891chr1631568 414 217 ------
NM_145892chr1631568 414 217 ------
NM_145893chr1631690 536 339 ------
NM_145899chr631186 307 182 ------
NM_145901chr631186 307 182 ------
NM_145902chr631186 307 182 ------
NM_145903chr631186 307 182 ------
NM_145904chr631186 307 182 ------
NM_145905chr631186 307 182 ------
NM_145912chr2273603 3279 1652 1491 1214 1012 370 13739 43577 1510 1204 415 --
NM_147156chr1021342 259 ------
NM_147161chr121159 379 --11082 --
NM_147164chr9------268 38
NM_147171chr71341 ------
NM_147185chr71341 ------
NM_147193chr1--139 1266 --
NM_147202chr931944 1817 103 --12099 --
NM_147223chr21280 12432 ----
NM_147233chr2197 12249 ----
NM_147777chr11138 --1605 --
NM_148174chr821903 829 ------
NM_148894chr4----1775 --
NM_148898chr71795 ------
NM_148899chr71795 ------
NM_152219chr1731893 829 62 169 31913 1762 144 --
NM_152227chr20----1256 --
NM_152244chr173777 337 279 ------
NM_152253chr2293901 3721 3365 3197 3179 2799 454 173 40 ------
NM_152265chr121186 423 ------
NM_152272chr8----21055 278 --
NM_152330chr1412623 ----11035
NM_152344chr1721110 967 ------
NM_152346chr172742 441 --2912 275 --
NM_152371chr161914 1649 761 193 178 153 --11339 --
NM_152375chr1--2209 195 12511 --
NM_152380chr11202 --1567 --
NM_152429chr1011321 1488 ----
NM_152470chr1833321 3304 113 11193 13026 --
NM_152493chr131668 1333 566 1144 ----
NM_152538chr311524 ------
NM_152545chr4--1545 2180 109 144
NM_152546chr541095 222 177 115 ------
NM_152563chr116623 571 519 467 415 363 --31534 1115 1083 --
NM_152584chrY124 ------
NM_152607chr1----1125 --
NM_152608chr122064 55 ------
NM_152622chr51983 ------
NM_152629chr92822 23 12613 --1118
NM_152641chr1242299 2262 656 253 ------
NM_152694chrX1195 ------
NM_152716chr11146 ------
NM_152724chr1032332 1936 865 ------
NM_152734chr685290 5150 4599 3852 3513 1780 1436 338 1919 1192 14256
NM_152744chr773447 2987 2839 2238 796 655 202 --11096 --
NM_152753chr621885 759 ------
NM_152756chr523226 126 ------
NM_152780chrX144 ------
NM_152789chr71241 ------
NM_152855chr221313 ----1261
NM_152860chr121252 11010 ----
NM_152862chr2--1152 ----
NM_152888chr8128 ------
NM_152890chr1--152 ----
NM_152896chr9--1755 ----
NM_152903chr1321787 1765 22713 745 ----
NM_152914chr1741535 806 720 294 1236 13054 14363
NM_152924chr1535258 4567 1474 14610 ----
NM_153029chr1683724 3658 3357 3156 2702 932 868 525 13859 43825 3487 2730 560 --
NM_153035chr133213 722 195 --2371 173 --
NM_153047chr6173 ------
NM_153048chr6173 ------
NM_153188chr565454 5100 1161 1015 257 21 --1577 --
NM_153207chr1212642 11472 22607 46 --
NM_153211chr18145 ------
NM_153252chrX151 ------
NM_153261chr1631503 496 238 ------
NM_153273chr332693 343 42 ------
NM_153347chr11188 12489 165 --
NM_153350chr164617 516 270 106 ------
NM_153367chr1021213 1107 --21180 111 --
NM_153374chr151143 ------
NM_153450chr11----1690 --
NM_153487chr664842 4338 3779 3603 1733 129 23711 1702 --14025
NM_153498chr101112 ------
NM_153499chr1252490 2075 633 122 53 12885 ----
NM_153500chr1252490 2075 633 122 53 12885 ----
NM_153607chr512728 ------
NM_153616chr151173 ----11577
NM_153617chr151173 ----11577
NM_153618chr151173 ----11577
NM_153619chr1521411 1082 --1374 12815
NM_153620chr7----2184 159 --
NM_153649chr112096 ------
NM_153675chr201175 ------
NM_153685chr122414 296 --1182 --
NM_153712chr263763 1390 972 362 330 115 ------
NM_153715chr7183 ------
NM_153718chr191854 11225 21001 25 --
NM_153719chr191854 11225 21001 25 --
NM_153756chr131578 640 570 ------
NM_153757chr41435 ------
NM_170600chr9125 ------
NM_170606chr711348 ----1735
NM_170679chr5----1489 --
NM_170692chr11340 ------
NM_170696chr15134 ------
NM_170697chr15134 ------
NM_170706chr143870 3142 1406 731 ----31537 1391 147
NM_170721chr171961 --11103 --
NM_170754chr121349 ------
NM_170769chr62636 288 --145 --
NM_171825chr532413 1195 139 138 12282 --
NM_171998chrX2783 474 ------
NM_171999chr18--1548 ----
NM_172020chr711863 ------
NM_172057chr7----1159 --
NM_172058chr831393 301 72 11782 ----
NM_172059chr831393 301 72 11782 ----
NM_172060chr831393 301 72 11782 ----
NM_172071chr136434 4750 167 ----16581
NM_172127chr422049 1963 ------
NM_172128chr422005 1919 ------
NM_172169chr1041674 1264 154 52 21435 696 11667 --
NM_172170chr1041674 1264 154 52 21435 696 11667 --
NM_172171chr1041674 1264 154 52 21435 696 11667 --
NM_172173chr1041674 1264 154 52 21435 696 11667 --
NM_172206chr1731450 108 46 --187 --
NM_172216chr1242392 1977 535 24 12787 ----
NM_172226chr1252490 2075 633 122 53 12885 ----
NM_172337chr141668 ------
NM_172375chr14--1748 ----
NM_173074chr2124 ------
NM_173156chr131693 1609 168 --22211 84 --
NM_173163chr162200 134 ------
NM_173165chr16181 ------
NM_173171chr2----1197 --
NM_173172chr2127 --1505 --
NM_173173chr2----1197 --
NM_173214chr1678276 8251 8065 7751 6304 1164 396 --1974 --
NM_173354chr2111575 11684 11419 --
NM_173468chr422401 1816 1857 ----
NM_173475chr16----148 --
NM_173476chr164558 492 166 160 --31805 525 239 --
NM_173477chr1751873 1707 780 442 372 --21949 91 --
NM_173491chr52446 112 ------
NM_173495chrX12206 42067 1681 762 352 ----
NM_173576chr101553 ------
NM_173595chr1265188 5075 4783 3818 2059 653 14802 21432 448 15174
NM_173602chr123798 408 21 ----12697
NM_173674chr6146 ------
NM_173681chr771426 1305 846 757 742 219 169 ------
NM_173683chr821681 1602 ------
NM_173808chr12773 526 ------
NM_173814chr152103 37 ------
NM_173825chr352465 2131 1177 1154 782 22802 298 ----
NM_173829chr521415 589 1733 ----
NM_173833chr84238 134 50 32 --1590 --
NM_173848chr81883 ------
NM_173849chr143218 201 23 ------
NM_174934chr1133201 319 27 176 ----
NM_174937chr102287 104 ------
NM_175061chr711856 ------
NM_175610chr1511097 ------
NM_175634chr8----1850 --
NM_175635chr8----1850 --
NM_175636chr8----1850 --
NM_175834chr12127 ------
NM_175852chr11715 12273 ----
NM_175856chr51189 ------
NM_175866chr11566 ------
NM_175898chr155565 433 284 167 161 --4370 353 276 71 --
NM_175907chr18--1931 ----
NM_175931chr1621422 311 --11747 --
NM_177438chr1454118 3968 3041 3023 2829 54171 3583 3390 2740 1043 1445 --
NM_177441chr171343 --1704 --
NM_177536chr16--125 ----
NM_177551chr121185 --1255 --
NM_177559chr20----1242 --
NM_177560chr20----1242 --
NM_177951chr141891 1635 ----
NM_177996chr2023224 2796 1794 --12736
NM_178037chr1232431 1030 275 1210 21378 1275 --
NM_178038chr1232431 1030 275 1210 21378 1275 --
NM_178126chr1731882 1658 837 ------
NM_178138chr92965 23 --1908 --
NM_178140chr522505 2128 ------
NM_178151chrX37767 7666 1706 1662 17301 --
NM_178152chrX37767 7666 1706 1662 17301 --
NM_178153chrX37767 7666 1706 1662 17301 --
NM_178191chr14497 454 287 196 11469 ----
NM_178229chr11985 ----185
NM_178441chr142361 118 ------
NM_178548chr1--1563 ----
NM_178554chr342383 2299 772 275 22630 1363 13397 --
NM_178565chr83554 530 73 1292 ----
NM_178578chr201174 1193 ----
NM_178586chr143945 203 122 --1225 --
NM_178812chr81321 ------
NM_178818chr16--21642 634 11856 11617
NM_178835chr41338 1589 ----
NM_181054chr141107 ------
NM_181291chr141220 ------
NM_181349chr722789 75 22760 2228 ----
NM_181351chr1142028 1867 1039 911 --12734 --
NM_181354chr81650 ------
NM_181356chr62710 24 ------
NM_181358chr142965 1523 280 124 ------
NM_181442chr202132 35 ------
NM_181458chr2150 ------
NM_181504chr512892 1100 ----
NM_181509chr20--1421 ----
NM_181521chr1666078 2678 1612 955 848 168 26423 5415 16637 16398
NM_181523chr512892 1100 ----
NM_181524chr512892 1100 ----
NM_181659chr201675 --1943 --
NM_181659chr201675 --1943 --
NM_181671chr172120 77 ------
NM_181672chrX1159 1216 ----
NM_181673chrX1159 1216 ----
NM_181689chr201889 ------
NM_181701chr932320 1971 552 --41586 420 375 67 --
NM_181784chr262260 707 626 230 202 32 --1526 --
NM_181825chr222780 149 ------
NM_181836chr51254 ------
NM_181838chr51528 ------
NM_181839chr81168 ------
NM_181876chr41789 1119 ----
NM_181886chr4128 ------
NM_181887chr4128 ------
NM_181888chr4128 ------
NM_181889chr4128 ------
NM_181890chr4128 ------
NM_181891chr4128 ------
NM_181892chr4175 ------
NM_181893chr4128 ------
NM_181897chr322573 2140 ------
NM_182470chr151560 --1516 --
NM_182471chr151560 --1516 --
NM_182488chr131855 ------
NM_182511chr1831200 917 382 ------
NM_182526chr1452845 2644 480 354 150 ------
NM_182527chr2211898 11683 21712 741 170
NM_182546chr71119 ------
NM_182553chr111404 177 1387 --
NM_182557chr113456 420 303 --1540 --
NM_182580chr152448 2204 2094 1877 902 1129 ----
NM_182648chr142503 117 ------
NM_182697chr711517 11426 21323 663 --
NM_182700chr731495 749 268 ------
NM_182734chr20125 ------
NM_182797chr201367 1710 ----
NM_182830chr14--11962 ----
NM_182898chr726408 1406 ------
NM_182899chr726408 1406 ------
NM_182915chr21716 --11618 --
NM_182917chr3170 ------
NM_182920chr311106 ------
NM_182961chr6--123 ----
NM_182972chr11846 ------
NM_182975chr1--11135 ----
NM_183049chr4----1305 --
NM_183065chr1721045 162 ----1292
NM_183243chr72636 285 ----1182
NM_183243chr72636 285 ----1182
NM_183380chr6--1119 ----
NM_183393chr3--1939 ----
NM_183394chr3--1939 ----
NM_183419chr811320 ------
NM_183425chr2051449 673 281 275 234 --1243 --
NM_184231chr31465 --127 --
NM_184234chr201619 ------
NM_194247chr263341 2793 1716 1237 160 66 ------
NM_194248chr22925 666 ----1644
NM_194278chr14101463 1224 1191 1082 505 363 319 292 237 186 --31008 785 35 1525
NM_194282chr4--1413 12771 12803
NM_194313chr931311 657 90 --137 --
NM_194314chr114298 ------
NM_194322chr22925 666 ----1644
NM_194429chr6--1131 ----
NM_194434chr1824528 1217 ------
NM_194442chr1134 ------
NM_198128chr18134 ------
NM_198147chr173835 174 32 ------
NM_198158chr322415 1039 ------
NM_198159chr322415 1039 ------
NM_198177chr322415 1039 ------
NM_198178chr322415 1039 ------
NM_198216chr20141 ------
NM_198240chr122170 44 ------
NM_198241chr3170 ------
NM_198242chr3170 ------
NM_198243chr15--1889 1774 --
NM_198244chr3170 ------
NM_198268chr142965 1523 280 124 ------
NM_198269chr142965 1523 280 124 ------
NM_198270chrX23139 208 ------
NM_198316chr121349 ------
NM_198390chr1611864 168 ----
NM_198446chr1------1233
NM_198560chr353554 1539 386 247 128 33631 2872 630 11519 1307
NM_198567chr51110 ------
NM_198595chr433964 1610 1353 14306 34417 4058 3879 --
NM_198793chr322987 999 --12713 --
NM_198830chr17123 ------
NM_198859chr343514 3421 3388 1928 24170 3704 ----
NM_198896chr11171 ------
NM_198903chr51219 ------
NM_198904chr51219 ------
NM_198956chr731495 749 268 ------
NM_199005chr92765 123 1398 ----
NM_199129chr202443 289 ------
NM_199131chr1063052 3043 1126 946 607 424 1832 1633 --
NM_199144chr203512 470 411 ------
NM_199160chr921877 44 ------
NM_199168chr101179 --1499 --
NM_199169chr2033030 1127 1069 1750 --21435 803
NM_199170chr2033030 1127 1069 1750 --21435 803
NM_199171chr2033030 1127 1069 1750 --21435 803
NM_199181chr201207 --144 --
NM_199189chr51879 ------
NM_199203chr203512 470 411 ------
NM_199245chr121184 ------
NM_199262chr172298 292 11516 11978 --
NM_199265chr14128 ------
NM_199296chr14128 ------
NM_199324chr43969 242 90 1842 ----
NM_199330chr151556 ------
NM_199331chr151556 ------
NM_199332chr151556 ------
NM_199355chr161513 ------
NM_199436chr2----1763 125
NM_199437chr1111611 ------
NM_199438chr1111611 ------
NM_199439chr1111611 ------
NM_199454chr173701 3695 3307 3133 784 607 349 1464 --24157 283
NM_199462chr131414 507 352 ----13405
NM_199487chr20--1920 --184
NM_199511chr32682 42 ------
NM_199512chr32682 42 ------
NM_201413chr211788 ------
NM_201414chr211788 ------
NM_201428chr1121440 106 ------
NM_201429chr1121440 106 ------
NM_201430chr1121366 32 ------
NM_201434chr172516 176 ------
NM_201437chr8189 ----11261
NM_201520chr1741238 565 483 332 --1578 --
NM_201524chr16--1103 11275 --
NM_201525chr16--1103 11275 --
NM_201568chr131693 1609 168 --22211 84 --
NM_201569chr131693 1609 168 --22211 84 --
NM_201570chr101219 ------
NM_201571chr101219 ------
NM_201572chr101219 ------
NM_201575chr16121 ------
NM_201590chr101219 ------
NM_201591chr411565 ------
NM_201592chr411565 ------
NM_201593chr101219 ------
NM_201596chr101219 ------
NM_201597chr101219 ------
NM_201624chr12825 298 ------
NM_201995chr11--1693 ----
NM_201998chr11--1758 ----
NM_202004chr11142 ------
NM_202467chr192523 494 ------
NM_202468chr192523 494 ------
NM_202469chr192523 494 ------
NM_202470chr192523 494 ------
NM_202494chr192523 494 ------
NM_203283chr41147 ------
NM_203284chr41147 ------
NM_203327chr2052795 1754 596 295 30 --13971 1435
NM_203341chr11290 ------
NM_203346chr221868 317 --2858 133 --
NM_203351chr1752335 2043 1877 661 180 --12436 --
NM_203365chr22484 34 ------
NM_203404chr12844 32 ------
NM_203406chr51918 ------
NM_203411chr171240 ------
NM_203417chr21----1380 --
NM_203418chr21----1380 --
NM_203446chr2121977 423 ------
NM_203456chr1155 ------
NM_203459chr11503 12145 ----
NM_203504chr412642 --12320 --
NM_203505chr412642 --12320 --
NM_203506chr17------12071
NM_205768chr111432 ------
NM_205833chrX148 ------
NM_205860chr123028 625 ------
NM_206808chr13--148 ----
NM_206819chr12--149 ----
NM_206820chr12--149 ----
NM_206821chr12--149 ----
NM_206853chr62924 842 1819 ----
NM_206854chr622103 791 12080 1631 --
NM_206855chr611756 --11596 --
NM_206876chr21897 ------
NM_206900chr191276 --245 21 --
NM_206901chr191276 --245 21 --
NM_206909chr8107839 7066 6602 5719 2967 2444 1465 1063 813 788 26669 5911 27563 3062 17112
NM_206914chr1231588 863 115 ------
NM_206944chr91286 ------
NM_206945chr91286 ------
NM_206946chr91286 ------
NM_206947chr91286 ------
NM_207005chr11249 139 1163 --
NM_207012chr1023246 672 ------
NM_207042chr11496 1531 ----
NM_207045chr11496 1531 ----
NM_207046chr11496 1531 ----
NM_207111chr732538 540 246 12100 12526 1475
NM_207116chr732538 540 246 12100 12526 1475
NM_207171chr121994 1853 ------
NM_207292chr313348 ------
NM_207293chr313348 ------
NM_207294chr313348 ------
NM_207295chr313348 ------
NM_207296chr313348 ------
NM_207297chr313373 ------
NM_207304chr131416 --1457 --
NM_207372chr1022402 2324 ------
NM_207406chr432314 2184 746 1566 ----
NM_207429chr111111 12086 ----
NM_207442chr143934 139 123 --2329 275 --
NM_212460chr711553 ------
NM_212464chr1521546 209 21888 142 --1680
NM_212471chr171108 ------
NM_212472chr171108 ------
NM_213589chr244746 1272 735 724 11620 25280 2039 --
NM_213609chr3--1894 ----
NM_213618chr111486 ------
NM_213651chr11250 ------
NM_213652chr11142 ------
NM_213653chr11142 ------
NM_213654chr311510 ------
NM_213662chr171145 1118 ----