TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4737
miRNA Sequence: AUGCGAGGAUGCUGACAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr811663 1243 11614 --
NM_000055chr3--1352 ----
NM_000080chr172377 260 ------
NM_000081chr1----1249 --
NM_000093chr921923 36 ----1450
NM_000109chrX12126 ------
NM_000114chr201208 ------
NM_000115chr1322063 218 ------
NM_000138chr1522538 940 --11766 --
NM_000183chr21154 ------
NM_000217chr1221776 409 --34949 3757 3684 --
NM_000222chr421673 86 ------
NM_000233chr21737 ------
NM_000248chr332367 1084 26 ------
NM_000259chr1534879 4030 1872 ------
NM_000264chr922068 824 ------
NM_000267chr172167 72 ------
NM_000278chr1061991 919 880 818 586 470 --11792 --
NM_000280chr11--1898 ----
NM_000284chrX----11871 --
NM_000285chr19------144
NM_000299chr162831 2200 1782 760 69 31 ------
NM_000314chr1022906 2340 ------
NM_000325chr4135 ------
NM_000332chr6117191 7066 6933 6664 6007 5401 4987 4941 2362 2336 1526 12454 ----
NM_000337chr515056 16092 ----
NM_000346chr171174 1579 ----
NM_000353chr1631011 204 59 1256 ----
NM_000358chr5----1402 --
NM_000359chr141161 ------
NM_000362chr2233148 3011 2877 22353 107 ----
NM_000367chr632187 1433 258 ------
NM_000368chr944590 3589 592 30 --24251 232 --
NM_000408chr223265 801 11017 ----
NM_000430chr1722872 2557 ------
NM_000435chr192689 131 --1137 --
NM_000441chr731966 1861 1614 ------
NM_000461chr333274 1119 398 23666 2842 ----
NM_000462chr15--1742 ----
NM_000482chr11131 ------
NM_000489chrX1631 ------
NM_000496chr22--193 ----
NM_000503chr8171 ------
NM_000533chrX2713 146 ------
NM_000555chrX47766 6988 1608 1203 17804 ----
NM_000609chr1022908 2380 ------
NM_000618chr1225320 1772 ----24792 191
NM_000618chr1225320 1772 ----24792 191
NM_000671chr4----192 --
NM_000684chr102984 106 ------
NM_000686chrX1525 ------
NM_000687chr20140 ------
NM_000719chr1276548 6072 5621 5032 1079 399 260 ------
NM_000721chr11304 ------
NM_000723chr1721426 1198 ------
NM_000724chr1011405 ------
NM_000726chr211229 ------
NM_000795chr11169 ------
NM_000800chr51269 ------
NM_000801chr20----1204 --
NM_000811chr51540 ------
NM_000813chr515079 --11901 --
NM_000868chrX11799 ------
NM_000875chr1541927 1730 636 129 --26264 1993 --
NM_000891chr1721187 278 ------
NM_000899chr1231311 284 228 ------
NM_000901chr41548 ------
NM_000908chr51704 ------
NM_000912chr822593 1070 --11021 13543
NM_000921chr12----1135 --
NM_000922chr111146 ------
NM_000935chr32973 947 ------
NM_000944chr411667 ------
NM_000945chr2----11563 --
NM_000960chr191503 --1804 --
NM_000964chr173504 286 30 ------
NM_000965chr31395 ------
NM_000966chr121194 ------
NM_000984chr171448 ------
NM_001001132chr2121375 217 --11282 --
NM_001001323chr1212914 ------
NM_001001331chr352601 2534 2504 2346 487 11848 ----
NM_001001395chr1232676 2266 2004 ------
NM_001001436chr161123 ------
NM_001001481chr812630 --12432 --
NM_001001523chr121035 21 ------
NM_001001549chr731799 924 825 --12231 --
NM_001001550chr731799 924 825 --12231 --
NM_001001551chr93339 80 66 ------
NM_001001555chr731799 924 825 --12231 --
NM_001001557chr81222 --157 --
NM_001001664chr224036 140 --12904 --
NM_001001852chr221135 ------
NM_001001936chr101468 ------
NM_001001971chr10171 ------
NM_001002233chr8176 ------
NM_001002259chr121217 ------
NM_001002295chr1021080 61 ------
NM_001002811chr1--124 ----
NM_001002812chr1--124 ----
NM_001002812chr1--124 ----
NM_001002814chr8176 ------
NM_001002860chr1414291 14101 ----
NM_001002909chr171139 ----11843
NM_001003652chr1825739 2554 ------
NM_001003681chr2212026 ------
NM_001003683chr2122 ------
NM_001003688chr411154 --143 --
NM_001003760chr612391 ------
NM_001003794chr332575 2464 393 --12775 --
NM_001003800chr931436 389 270 12916 1400 11490
NM_001004105chr5131 ------
NM_001004304chr122860 546 ------
NM_001004313chr1712055 ------
NM_001004342chr155752 1975 962 547 450 15492 ----
NM_001004360chr211311 ------
NM_001004720chr221051 427 ------
NM_001004722chr221220 153 ------
NM_001005337chr162831 2200 1782 760 69 31 ------
NM_001005366chr12------1189
NM_001005404chr1733431 1261 111 ------
NM_001005476chr21675 ------
NM_001005505chr341171 1146 93 49 ------
NM_001005609chrX12849 ------
NM_001005746chr211229 ------
NM_001005747chr211229 ------
NM_001005781chr21387 ------
NM_001005782chr21836 ------
NM_001005849chr17----1400 --
NM_001005861chr3----1615 --
NM_001006115chr322715 700 --12607 --
NM_001006600chr5--22334 876 ----
NM_001006636chr22898 27 ------
NM_001006932chr673205 2670 2457 849 573 125 43 --1256 --
NM_001006946chr221295 220 ------
NM_001007098chr11277 ------
NM_001007156chr1521670 464 --1723 --
NM_001007226chr1721194 1159 ------
NM_001007227chr1721194 1159 ------
NM_001007228chr1721194 1159 ------
NM_001007229chr1721194 1159 ------
NM_001007230chr1721194 1159 ------
NM_001007255chr12232 41 ------
NM_001007257chr11273 1104 --1358
NM_001007271chr101399 ------
NM_001007279chr222323 109 ------
NM_001007553chr11148 ------
NM_001008225chr7143 ------
NM_001008239chr1832383 794 442 1891 ----
NM_001008392chr323296 994 ------
NM_001008408chr736267 5952 2533 ------
NM_001008529chr17--138 ----
NM_001009552chr81572 ------
NM_001009566chr11243 --21418 320 --
NM_001009993chr233214 923 76 ------
NM_001010854chr141167 ------
NM_001010861chr112168 ------
NM_001010917chr1022184 638 --21815 51 11541
NM_001010924chr102904 777 ------
NM_001010942chr1231267 851 442 ------
NM_001011546chr20--1558 ----
NM_001011705chr131275 ------
NM_001012420chr1522029 1992 1216 ----
NM_001012423chr1512029 1216 ----
NM_001012761chr552734 2394 876 712 474 ------
NM_001012968chrX2554 63 ------
NM_001012974chr6155 ------
NM_001012989chrX167 ------
NM_001013031chr1042980 2223 1290 1019 --1689 --
NM_001013437chr181118 ------
NM_001013690chr1221772 337 ------
NM_001013693chr122139 905 ------
NM_001013693chr122139 905 ------
NM_001013743chr11121 ------
NM_001013843chr151221 ------
NM_001014431chr14155 ------
NM_001014432chr14155 ------
NM_001014797chr1048236 7305 1440 666 12219 25850 1840 --
NM_001015053chr1721532 114 ------
NM_001015877chrX23094 2080 ------
NM_001015881chrX1885 ------
NM_001015887chr341836 1352 1284 454 ------
NM_001017368chr17176 ------
NM_001017395chr323511 2723 ------
NM_001017396chr231751 829 58 ------
NM_001017405chr41745 ------
NM_001017415chr11325 ------
NM_001017416chr11325 ------
NM_001017926chr8------11688
NM_001017969chr9--1168 ----
NM_001017979chr41286 1734 ----
NM_001017995chr574627 4099 3937 3062 2957 878 39 ------
NM_001018005chr15135 ------
NM_001018037chr911320 ------
NM_001018050chr2232903 2137 1265 --12779 1336
NM_001018052chr2232903 2137 1265 --12779 1336
NM_001018108chr15270 36 --11752 --
NM_001020658chr111353 ------
NM_001020658chr111353 ------
NM_001023567chr152636 329 ------
NM_001023587chr3128 ------
NM_001024218chr141564 1237 ----
NM_001024401chr1651993 1972 970 453 89 ----11914
NM_001024455chrX1976 1158 ----
NM_001024457chr21558 ------
NM_001024593chr101374 174 ----
NM_001024649chr532473 947 179 ------
NM_001024660chr31138 ------
NM_001024666chrX1478 ------
NM_001024680chr211333 ------
NM_001024809chr173504 286 30 ------
NM_001024858chr1462016 1978 906 196 158 74 ------
NM_001024937chr171654 ------
NM_001024947chr5------1286
NM_001024948chr113354 --12640 --
NM_001025076chr1025674 2155 --11844 --
NM_001025079chr312648 --11125 --
NM_001025105chr511118 ------
NM_001025108chr233808 1255 1036 11170 ----
NM_001025266chr343945 3872 3741 3159 ------
NM_001025579chr172809 295 --146 --
NM_001025580chrX1323 --13500 --
NM_001025595chr41117 ------
NM_001025616chr431535 1482 719 --1354 --
NM_001029839chr321442 404 1598 11032 --
NM_001029840chr321442 404 1598 11032 --
NM_001029859chr112957 73 ------
NM_001029864chr2022112 319 ------
NM_001029882chr11518 ------
NM_001029882chr11518 ------
NM_001029989chr151926 ------
NM_001030007chr1653545 2524 1539 776 652 --12484 --
NM_001031702chr32681 120 ------
NM_001031801chr221121 --161 --
NM_001032280chr61652 ----11496
NM_001033044chr11409 ------
NM_001033056chr11409 ------
NM_001033059chr61191 ------
NM_001033081chr12511 161 ------
NM_001033082chr12511 161 ------
NM_001033085chr2--132 ----
NM_001033087chr2032666 2039 1005 13110 ----
NM_001033112chr52727 134 ------
NM_001033551chr1754087 3522 3321 841 45 --11059 --
NM_001033561chr171343 ------
NM_001034845chr41230 ------
NM_001037163chr7164 ------
NM_001037317chr112168 ------
NM_001037331chr18------1363
NM_001037334chr1832200 390 252 ------
NM_001037494chr12194 ------
NM_001037495chr12194 ------
NM_001037639chr3138 ------
NM_001039199chr2014880 --13337 --
NM_001039350chr721423 604 ------
NM_001039360chr181266 ------
NM_001039538chr2--12823 ----
NM_001039547chr327835 7594 26142 5161 ----
NM_001039577chr143871 1317 845 637 ------
NM_001039583chr221431 --1140 --
NM_001039584chr221431 --1140 --
NM_001039670chr121600 --135 --
NM_001039840chrX35885 353 129 --14175 --
NM_001039888chr12317 100 ------
NM_001039905chr153257 205 26 ------
NM_001040056chr164693 683 75 29 ------
NM_001040057chr7----1455 --
NM_001040101chr421162 406 137 1432 --
NM_001040110chr721283 722 1657 ----
NM_001040134chr1931427 1413 305 ------
NM_001040135chr72228 122 --1787 --
NM_001040142chr211750 ------
NM_001040143chr211750 ------
NM_001040152chr754995 4267 1870 1708 854 171 ----
NM_001040181chr31965 ------
NM_001040182chr31965 ------
NM_001040183chr31965 ------
NM_001040199chr31965 ------
NM_001040200chr31965 ------
NM_001040284chr1612093 1869 ----
NM_001040402chr432290 117 101 ------
NM_001040429chr1343215 2970 2866 2204 --1502 --
NM_001040439chr1611354 ------
NM_001040441chr143692 2164 885 134 --14039 --
NM_001040446chr542400 1761 867 536 12001 ----
NM_001040633chr71189 ------
NM_001042355chr1624563 524 ------
NM_001042412chr1624563 524 ------
NM_001042413chr922595 432 ------
NM_001042425chr61652 ----11496
NM_001042459chr3199 ------
NM_001042475chr6193 ------
NM_001042492chr172167 72 ------
NM_001042493chr6--1391 ----
NM_001042517chr131986 ------
NM_001042537chrX----11876 12399
NM_001042543chr4--11160 ----
NM_001042555chr121410 ----11547
NM_001042599chr227105 4836 ----11249
NM_001042604chr324722 4034 --1262 --
NM_001042632chr2041932 1666 663 44 ------
NM_001042633chr2041932 1666 663 44 ------
NM_001042646chr32454 142 ------
NM_001042663chr131226 1053 223 ------
NM_001042664chr131226 1053 223 ------
NM_001042665chr131226 1053 223 ------
NM_001042669chr431535 1482 719 --1354 --
NM_001042728chr121194 ------
NM_001042749chrX--11422 ----
NM_001042750chrX--11422 ----
NM_001042751chrX--11422 ----
NM_001043318chr1451379 1324 1119 696 105 --1229 --
NM_001044305chr631569 1055 48 1269 ----
NM_001044385chr212567 --13541 --
NM_001077628chr1151 ------
NM_001079874chr112090 ------
NM_001099678chr324195 1004 16294 ----
NM_001100108chr157007 6742 5630 5108 501 ------
NM_001106chr387641 7229 3375 2867 2100 1377 1256 1107 ------
NM_001113490chrX21270 875 ------
NM_001116chr1632102 2094 512 ------
NM_001117chr1822142 2073 ------
NM_001122631chr113659 556 546 ------
NM_001128chr1653545 2524 1539 776 652 --12484 --
NM_001153chr21197 1733 ----
NM_001167chrX22103 1207 ----15598
NM_001177chr1212312 ------
NM_001204chr237515 7376 225 ----16954
NM_001206chr91757 --1438 --
NM_001222chr102731 518 --151 --
NM_001241chr211866 ------
NM_001241chr211866 ------
NM_001261chr92204 58 ------
NM_001280chr192176 64 ------
NM_001283chr71534 ------
NM_001304chr171975 12691 ----
NM_001310chr1222446 747 ------
NM_001331chr113970 617 85 ------
NM_001346chr322025 167 22478 374 --12603
NM_001352chr19144 ------
NM_001356chrX2528 96 ------
NM_001364chr1114532 ------
NM_001382chr11188 ------
NM_001383chr171258 ------
NM_001386chr841988 1638 878 317 ------
NM_001387chr522901 2211 ------
NM_001396chr2111732 ------
NM_001399chrX12849 ------
NM_001401chr9--21528 247 ----
NM_001402chr611938 ------
NM_001408chr131269 579 149 ------
NM_001418chr111573 ------
NM_001418chr111573 ------
NM_001419chr1933512 1317 923 ----23717 1788
NM_001420chr1963081 2630 2150 1174 624 398 ------
NM_001427chr711749 ------
NM_001429chr22----1313 --
NM_001430chr21405 --21855 475 --
NM_001438chr111415 ------
NM_001449chrX1844 ------
NM_001453chr621642 388 ------
NM_001463chr2153 ------
NM_001493chrX1513 1716 ----
NM_001554chr11125 ------
NM_001584chr1111063 ------
NM_001604chr11--1898 ----
NM_001616chr222857 2629 ----1218
NM_001620chr111124 ------
NM_001634chr61191 ------
NM_001635chr71427 ------
NM_001659chr1232677 550 140 ------
NM_001665chr111390 ------
NM_001668chr11747 ------
NM_001670chr221127 ------
NM_001681chr121562 ------
NM_001682chr1212628 ------
NM_001683chr352601 2534 2504 2346 487 11848 ----
NM_001686chr12135 ------
NM_001688chr1--1315 ----
NM_001694chr161161 ------
NM_001731chr121355 ------
NM_001743chr21444 ------
NM_001746chr532473 947 179 ------
NM_001753chr7--11179 ----
NM_001755chr1621732 720 ------
NM_001759chr1244702 4162 2091 1088 ------
NM_001773chr111324 ------
NM_001777chr312648 --11125 --
NM_001783chr191326 ------
NM_001797chr161226 ------
NM_001834chr5185 ------
NM_001892chr511118 ------
NM_001895chr2011174 ------
NM_001904chr32697 337 ------
NM_001936chr721423 604 ------
NM_001939chrX33632 3574 1475 --1325 --
NM_001946chr12122 ------
NM_001964chr52793 328 ------
NM_001965chr21361 --195 --
NM_001970chr171460 ------
NM_001977chr4--1142 ----
NM_001987chr122483 141 ------
NM_001995chr411326 ------
NM_001999chr5--11527 ----
NM_002024chrX1400 --21588 1437 --
NM_002039chr42682 263 ------
NM_002040chr21--1981 ----
NM_002045chr31292 ------
NM_002051chr1021080 61 ------
NM_002065chr11409 ------
NM_002069chr7179 ------
NM_002074chr111564 ------
NM_002076chr1243195 2626 1293 162 ------
NM_002086chr1712151 --12069 --
NM_002089chr41237 ------
NM_002092chr443828 3793 3285 939 ------
NM_002126chr1732697 1008 304 ------
NM_002139chrX1197 ------
NM_002140chr91346 ------
NM_002146chr1721271 919 ------
NM_002147chr172334 117 ------
NM_002149chr2--166 ----
NM_002167chr11112 ------
NM_002193chr221382 1222 ------
NM_002196chr203382 106 39 ------
NM_002196chr203382 106 39 ------
NM_002202chr52871 420 ------
NM_002204chr172851 320 ------
NM_002226chr141885 --1646 1822
NM_002246chr21157 ------
NM_002249chr11417 ------
NM_002254chr242321 940 229 165 ------
NM_002264chr323429 136 --24999 1841 --
NM_002265chr171474 ------
NM_002266chr171213 ------
NM_002268chr321477 446 ------
NM_002275chr17129 ------
NM_002285chr233808 1255 1036 11170 ----
NM_002293chr132703 971 754 ------
NM_002350chr811262 ------
NM_002356chr622233 291 ------
NM_002374chr2--12823 ----
NM_002382chr14--21295 898 ----
NM_002387chr51268 ------
NM_002397chr532077 794 38 ------
NM_002401chr1722474 1776 ------
NM_002406chr5132 ------
NM_002429chr1211024 --1129 --
NM_002436chrX164 ------
NM_002444chrX21439 1330 ------
NM_002457chr111124 ------
NM_002465chr12--151 ----
NM_002479chr12269 28 ------
NM_002500chr21818 ------
NM_002501chr1933009 968 842 ------
NM_002507chr1711914 11779 ----
NM_002509chr202280 23 ------
NM_002522chr1732738 2593 35 ------
NM_002546chr81252 ------
NM_002547chrX43238 3097 1651 1424 --1125 --
NM_002576chr11193 ------
NM_002578chrX2424 374 ------
NM_002579chr1931427 1413 305 ------
NM_002586chr61241 1359 ----
NM_002588chr511281 --11687 --
NM_002590chr131457 ------
NM_002605chr1511185 1896 ----
NM_002608chr2231350 558 98 ------
NM_002613chr1654281 3784 1313 262 28 --25383 128 --
NM_002628chr3----1467 --
NM_002636chr61157 ------
NM_002641chrX2194 70 ------
NM_002646chr151742 1622 1420 842 410 ------
NM_002653chr51662 190 1402 --
NM_002655chr8--14629 --11239
NM_002657chr2083602 3138 2469 2443 1512 1486 619 516 11423 ----
NM_002660chr204971 400 232 106 ------
NM_002687chr142498 406 ------
NM_002697chr11101 ------
NM_002698chr1942745 348 230 68 ------
NM_002705chr163714 122 86 ------
NM_002707chr21341 ------
NM_002709chr21848 ------
NM_002714chr62870 50 ------
NM_002717chr83654 509 246 ------
NM_002718chr31396 ------
NM_002730chr19--11197 1107 --
NM_002742chr14----176 --
NM_002745chr22----11377 --
NM_002748chr151313 ------
NM_002752chr51128 ------
NM_002753chr42533 30 ------
NM_002756chr173756 697 357 ------
NM_002779chr101537 ------
NM_002819chr1921488 165 ------
NM_002827chr2011307 --1491 --
NM_002830chr2175 ------
NM_002844chr631328 1002 990 ------
NM_002845chr182236 160 ------
NM_002869chr111385 ------
NM_002886chr314884 11239 ----
NM_002897chr21495 ------
NM_002904chr61193 ------
NM_002906chr1131922 377 94 ------
NM_002911chr1911577 --1391 1419
NM_002924chr11519 ------
NM_002941chr31219 ------
NM_002942chr311282 ------
NM_002945chr173860 746 138 ------
NM_002956chr12144 ------
NM_002958chr3----1615 --
NM_002959chr144068 3780 3681 3414 ------
NM_002968chr162202 72 ------
NM_002971chr31127 ------
NM_002973chr121158 ------
NM_002996chr1621500 530 ------
NM_002997chr221295 220 ------
NM_002998chr8--1816 ----
NM_003010chr171442 ------
NM_003011chr91314 --1627 --
NM_003012chr81140 ------
NM_003016chr17----11788 --
NM_003020chr151300 ------
NM_003022chrX1467 ------
NM_003028chr933719 3466 1214 ------
NM_003030chr331293 354 135 ------
NM_003042chr31699 11422 ----
NM_003043chr314159 ----1873
NM_003047chr1177 ------
NM_003069chrX1272 ------
NM_003074chr31344 ------
NM_003076chr1211223 ------
NM_003077chr17163 ------
NM_003088chr71109 ------
NM_003108chr247032 2590 2153 1598 --22031 1137 --
NM_003128chr242179 1969 1778 882 ------
NM_003131chr63592 409 267 ------
NM_003161chr171797 1400 --1241
NM_003164chr111159 ------
NM_003173chrX41200 1193 1083 99 ------
NM_003189chr122184 388 ------
NM_003199chr1814024 1418 ----
NM_003211chr12----11438 --
NM_003214chr61463 --2501 271 --
NM_003220chr61652 ----11496
NM_003221chr652889 2780 829 658 458 --13418 13204
NM_003236chr222397 1021 ------
NM_003246chr151124 ------
NM_003250chr171179 ------
NM_003253chr211106 ------
NM_003255chr1721963 768 ------
NM_003262chr313394 --15185 --
NM_003270chrX1204 ------
NM_003272chr11198 ------
NM_003281chr145120 3635 1225 844 ----11430
NM_003290chr19196 ------
NM_003304chr311206 170 ----
NM_003319chr2--147 ----
NM_003323chr19142 ------
NM_003325chr22149 ------
NM_003336chrX1132 1220 ----
NM_003339chr511592 ------
NM_003342chr1712810 ------
NM_003348chr1211525 11582 ----
NM_003352chr21836 ------
NM_003358chr91148 ------
NM_003368chr11325 ------
NM_003371chr93636 447 26 12145 ----
NM_003374chr5----1610 --
NM_003385chr21343 ------
NM_003387chr241813 466 387 284 ------
NM_003403chr14----1282 --
NM_003405chr22165 ------
NM_003406chr811603 ------
NM_003410chrX1308 ------
NM_003411chrY1694 ------
NM_003412chr331961 1109 945 ----12481
NM_003430chr191104 ------
NM_003458chr363367 2623 2557 1613 969 834 --13062 --
NM_003466chr2----12436 --
NM_003470chr1621554 586 --11536 --
NM_003473chr1011050 1272 ----
NM_003478chr112368 232 13357 ----
NM_003482chr1212450 ------
NM_003485chr142130 85 ------
NM_003487chr17178 ------
NM_003488chr171930 ----1191
NM_003489chr211952 ------
NM_003502chr16----178 --
NM_003507chr21228 21664 43 ----
NM_003557chr12364 68 ------
NM_003559chr1733659 1091 533 ------
NM_003563chr1721194 1159 ------
NM_003581chr221051 427 ------
NM_003583chr1222697 834 ------
NM_003586chr16----159 --
NM_003590chr221077 559 11539 145 --
NM_003602chr7------1447
NM_003603chr42451 350 ------
NM_003607chr143672 799 81 26 14087 ----
NM_003612chr15192 --1548 --
NM_003620chr171807 ------
NM_003621chr111102 ------
NM_003628chr21675 ------
NM_003633chr51333 ------
NM_003642chr2--132 ----
NM_003644chr1755221 4661 4352 4001 295 ------
NM_003654chr111540 ------
NM_003655chr17187 ------
NM_003660chr193731 112 85 --1166 --
NM_003692chr91127 ------
NM_003693chr171589 ------
NM_003704chr4172 --1533 --
NM_003709chr2----199 --
NM_003714chr52568 382 --1253 --
NM_003718chr71135 ------
NM_003735chr511281 --11687 --
NM_003736chr511281 --11687 --
NM_003746chr12194 ------
NM_003749chr13193 ------
NM_003760chr12100 70 ------
NM_003787chr182672 468 ------
NM_003792chr9------1161
NM_003829chr91200 ------
NM_003861chr1411062 ------
NM_003873chr1022138 624 ------
NM_003885chr1731045 283 185 12391 12025 --
NM_003887chr2------11946
NM_003888chr1521204 399 ------
NM_003908chr2011098 ----1144
NM_003924chr411211 --2258 240 --
NM_003927chr181726 11039 ----
NM_003932chr2221759 27 ------
NM_003934chr911099 ------
NM_003938chr192231 70 ------
NM_003957chr113838 435 134 --1339 --
NM_003958chr612606 --12714 --
NM_003980chr621097 1017 1583 ----
NM_003987chr1061991 919 880 818 586 470 --11792 --
NM_003988chr1052068 957 895 663 547 --11869 --
NM_003989chr1061927 855 816 754 522 406 --11728 --
NM_003990chr1061927 855 816 754 522 406 --11728 --
NM_003992chr151272 ------
NM_003994chr1231311 284 228 ------
NM_004006chrX12126 ------
NM_004007chrX12126 ------
NM_004009chrX12126 ------
NM_004010chrX12126 ------
NM_004011chrX12126 ------
NM_004012chrX12126 ------
NM_004013chrX12126 ------
NM_004014chrX12126 ------
NM_004015chrX12126 ------
NM_004017chrX12126 ------
NM_004020chrX12126 ------
NM_004036chr24659 466 267 246 ------
NM_004037chr11116 ------
NM_004052chr10--153 ----
NM_004055chr1152000 1848 644 376 210 ------
NM_004077chr1211052 ------
NM_004089chrX1885 ------
NM_004093chr1312690 ------
NM_004096chr1031609 801 239 ------
NM_004098chr102508 245 ------
NM_004103chr83735 120 65 ------
NM_004124chr141968 ------
NM_004156chr81572 ------
NM_004162chr311117 ------
NM_004171chr1146016 2810 500 427 --11375 --
NM_004185chr1----166 --
NM_004225chr821330 130 ------
NM_004227chr743123 3045 2228 159 ------
NM_004232chr1823842 25 23694 985 ----
NM_004235chr91751 ------
NM_004238chr21126 ------
NM_004239chr14--1111 ----
NM_004263chr221556 1500 ------
NM_004274chr141748 ------
NM_004279chr71319 ------
NM_004302chr12----12289 --
NM_004309chr171428 ------
NM_004311chr1032764 643 578 --1419 --
NM_004316chr121436 ------
NM_004321chr252400 2167 1239 208 57 11100 ----
NM_004331chr812458 1373 ----
NM_004346chr411418 ------
NM_004370chr611868 11577 ----
NM_004380chr1621676 619 ------
NM_004389chr22265 93 ------
NM_004392chr13------11649
NM_004393chr331820 335 257 11631 ----
NM_004395chr5287 29 ------
NM_004397chr1121674 1167 --11420 --
NM_004405chr22408 322 ------
NM_004409chr191616 ----1746
NM_004411chr71671 ------
NM_004419chr10--1147 1276 --
NM_004423chr31140 --12720 --
NM_004429chrX41170 329 320 83 --11212 --
NM_004430chr852188 1710 517 354 131 --1213 --
NM_004432chr91613 ------
NM_004438chr262241 1116 1091 1020 788 93 ------
NM_004440chr611675 ------
NM_004441chr311293 ------
NM_004451chr111264 ----1229
NM_004454chr321680 1475 --11550 --
NM_004455chr121094 354 ------
NM_004459chr171647 ------
NM_004496chr141292 ------
NM_004498chr151272 ------
NM_004504chr2166 ------
NM_004506chr61164 ------
NM_004516chr19--11062 ----
NM_004529chr92535 507 ------
NM_004571chr2122472 580 ------
NM_004586chrX23590 162 --1871 --
NM_004603chr73833 361 306 ------
NM_004615chrX2804 626 ------
NM_004657chr2170 ------
NM_004660chrY195 ------
NM_004690chr61657 ------
NM_004703chr1732367 1785 284 ------
NM_004709chrX11724 ------
NM_004714chr192337 327 ------
NM_004721chr3--1357 ----
NM_004723chr12987 119 ------
NM_004730chr521492 449 ------
NM_004732chr171293 1244 163 --
NM_004736chr12765 492 ------
NM_004742chr3295 73 ------
NM_004745chr876199 5523 1558 1154 178 110 27 --25460 492 --
NM_004760chr71362 11926 ----
NM_004772chr531161 360 126 ------
NM_004779chr511217 ------
NM_004781chr141719 1548 548 510 ------
NM_004781chr141719 1548 548 510 ------
NM_004786chr18170 ------
NM_004788chr111204 ------
NM_004789chr91119 ------
NM_004798chr202298 283 ------
NM_004801chr21527 ------
NM_004805chr22927 80 ------
NM_004816chr9--1600 1258 --
NM_004824chr61434 11209 ----
NM_004831chr192431 37 ------
NM_004836chr21101 ------
NM_004840chrX--12031 --1415
NM_004842chr641528 321 153 76 --11157 --
NM_004845chrX3586 292 256 ------
NM_004849chr61112 1463 ----
NM_004860chr17136 ------
NM_004865chr61167 ------
NM_004866chr524319 1160 --1202 --
NM_004884chr152552 245 ------
NM_004886chr19134 ------
NM_004898chr4----12612 --
NM_004922chr10--1733 ----
NM_004925chr91170 ------
NM_004930chr12207 84 ------
NM_004936chr91621 ------
NM_004939chr21124 ------
NM_004947chr31109 --12053 --
NM_004953chr31342 ------
NM_004960chr16160 ------
NM_004961chrX2142 61 ------
NM_004973chr611587 ------
NM_004976chr1144178 3917 3886 3605 --13246 1469
NM_004977chr191520 --1539 150
NM_004985chr1213153 ------
NM_004992chrX77830 6917 6789 6762 5701 3091 2294 --15966 --
NM_004992chrX77830 6917 6789 6762 5701 3091 2294 --15966 --
NM_004995chr1441312 1079 339 121 ------
NM_005011chr721283 722 1657 ----
NM_005020chr7143 ------
NM_005032chrX149 ------
NM_005045chr7168 ------
NM_005056chr1215163 --11215 --
NM_005060chr121035 21 ------
NM_005065chr1435141 4403 63 --1736 --
NM_005066chr1172 ------
NM_005078chr1511320 ------
NM_005096chrX11028 ------
NM_005097chr10--193 ----
NM_005103chr112224 24 ------
NM_005110chr51736 ------
NM_005112chr41144 --1972 --
NM_005116chr2083262 1548 471 422 306 211 179 56 13832 22849 971 --
NM_005137chr2242340 2263 436 133 ------
NM_005151chr1832200 390 252 ------
NM_005154chr151428 ------
NM_005163chr14155 ------
NM_005168chr21323 1635 ----
NM_005180chr101504 ------
NM_005184chr1941215 1162 225 52 ------
NM_005191chr321263 107 ------
NM_005197chr1425200 511 --15073 --
NM_005207chr2233549 639 601 ------
NM_005215chr181586 ------
NM_005222chr71300 ------
NM_005230chr12----1395 --
NM_005235chr227105 4836 ----11249
NM_005249chr14------1758
NM_005277chr4--11926 ----
NM_005311chr731799 924 825 --12231 --
NM_005312chr941969 1867 975 665 --12480 --
NM_005316chr111157 ------
NM_005324chr1711972 11950 1686 --
NM_005329chr1621958 250 22199 1482 12047 --
NM_005339chr454054 1025 709 629 447 23693 818 ----
NM_005342chrX32227 1907 448 1778 ----
NM_005359chr1836411 1720 140 1606 15327 --
NM_005370chr19127 ------
NM_005382chr81402 ------
NM_005386chr203888 711 110 ------
NM_005387chr111143 ------
NM_005398chr1011132 --11106 --
NM_005406chr181143 1481 ----
NM_005418chr11----135 --
NM_005430chr121925 ------
NM_005433chr181462 ------
NM_005436chr1033132 2675 259 1613 ----
NM_005440chr1743323 1165 510 474 ------
NM_005443chr41133 ------
NM_005458chr912420 1291 --12236
NM_005461chr2021765 30 ------
NM_005474chr1721532 114 ------
NM_005479chr10----21444 306 --
NM_005487chr2212026 ------
NM_005503chr1511147 ------
NM_005513chr31206 --11468 --
NM_005537chr131700 ------
NM_005539chr101140 ------
NM_005561chr132736 135 ------
NM_005565chr51463 ------
NM_005585chr151448 ------
NM_005587chr151355 11004 ----
NM_005593chr121137 ------
NM_005595chr11273 ----1920
NM_005596chr921491 1321 ------
NM_005598chr141703 1588 676 275 --11177 --
NM_005599chr12259 228 ------
NM_005614chr72822 767 ------
NM_005618chr61100 ------
NM_005627chr61636 1627 ----
NM_005634chrX3626 546 456 ------
NM_005639chr12--1475 ----
NM_005652chr1631144 317 113 ------
NM_005660chrX133 ------
NM_005668chr52889 685 ------
NM_005688chr32116 93 ------
NM_005704chr11736 --11069 --
NM_005731chr2--1170 ----
NM_005736chr101353 --21572 1562 --
NM_005742chr21762 ------
NM_005748chr1213283 ------
NM_005754chr52340 271 ------
NM_005759chr224404 605 ------
NM_005776chr142542 268 ------
NM_005801chr17--1689 --143
NM_005808chr323296 994 ------
NM_005822chr61730 ------
NM_005826chr11209 ------
NM_005833chr91165 ------
NM_005840chrX57331 7216 5910 2614 1576 ------
NM_005841chr41930 ------
NM_005842chr13--1296 ----
NM_005863chr10--172 1399 --
NM_005882chr41745 ------
NM_005892chr173386 304 107 ------
NM_005896chr21546 ------
NM_005898chr1131993 1253 260 --1233 --
NM_005899chr17183 ------
NM_005900chr411154 --143 --
NM_005901chr1825739 2554 ------
NM_005904chr1821072 152 ------
NM_005910chr1721641 635 13993 22608 109 13452
NM_005911chr21563 ------
NM_005920chr142624 1199 1045 196 ------
NM_005924chr73437 373 284 --1887 --
NM_005933chr1122790 2134 ------
NM_005934chr1971706 898 514 303 122 83 61 --11975 --
NM_005943chr611351 ------
NM_005955chr174568 3974 1492 793 753 473 364 --24941 1579 --
NM_005966chr2------11722
NM_005996chr122628 486 ------
NM_006007chr954228 3289 2865 1760 1014 ------
NM_006015chr131048 519 501 --1365 --
NM_006016chr632173 1623 1471 12037 ----
NM_006030chr341171 1146 93 49 ------
NM_006047chr201541 --13164 13373
NM_006048chr11448 ------
NM_006058chr53565 83 38 ------
NM_006080chr722350 962 ------
NM_006089chrX11339 ----11488
NM_006091chr1531217 659 628 ------
NM_006094chr8--12179 ----
NM_006095chr41125 24052 3497 ----
NM_006099chr12782 25 ------
NM_006106chr11------13201
NM_006113chr112090 ------
NM_006141chr1632758 1013 737 ------
NM_006156chr141177 ------
NM_006158chr831584 1352 198 ------
NM_006186chr211000 ------
NM_006194chr1421253 187 ------
NM_006195chr931401 518 406 11050 ----
NM_006206chr4--1203 12294 --
NM_006237chr1321651 132 ------
NM_006243chr111006 ------
NM_006244chr114469 413 203 103 ------
NM_006258chr103351 283 29 ------
NM_006265chr8--11285 ----
NM_006267chr2----1172 --
NM_006270chr19160 --154 --
NM_006282chr2044443 3322 2954 1313 ------
NM_006312chr122820 159 ------
NM_006328chr111188 ------
NM_006352chr111505 ------
NM_006359chrX----11876 12399
NM_006361chr1711748 12007 ----
NM_006364chr1411170 --1288 --
NM_006366chr621115 159 ------
NM_006369chr1146 --1139 --
NM_006373chr17178 --21089 992 --
NM_006379chr711623 ------
NM_006380chr1743298 2823 531 152 ------
NM_006386chr2231907 299 80 ------
NM_006420chr2033344 3126 680 ------
NM_006421chr8--1150 ----
NM_006439chr41195 ------
NM_006449chr221621 1504 ------
NM_006469chr1----11134 --
NM_006471chr18167 ------
NM_006482chr1222697 834 ------
NM_006483chr192337 327 ------
NM_006484chr192337 327 ------
NM_006486chr221223 ------
NM_006500chr113838 281 113 ------
NM_006526chr2031408 720 392 ------
NM_006529chr4--11151 ----
NM_006534chr2031201 941 329 13355 ----
NM_006540chr81209 ------
NM_006548chr311335 ------
NM_006549chr12----21870 24 --
NM_006561chr1025674 2155 --11844 --
NM_006562chr101235 ------
NM_006565chr1611029 ------
NM_006589chr1181 ------
NM_006599chr16--18252 ----
NM_006603chrX--11422 ----
NM_006614chr31874 ------
NM_006618chr121383 299 ------
NM_006621chr111642 --12018 --
NM_006628chr1534526 1824 1332 ------
NM_006646chr1312948 --12541 --
NM_006654chr121410 ----11547
NM_006670chr6--1564 ----
NM_006675chr1293345 3264 2912 2136 1305 1241 1144 781 476 ------
NM_006698chr202544 272 --198 --
NM_006699chr1----1353 11975
NM_006706chr5144 ------
NM_006711chr16121 ------
NM_006717chr922412 2110 ------
NM_006722chr332367 1084 26 ------
NM_006726chr4--11087 ----
NM_006727chr5------1345
NM_006729chrX25550 1963 15628 ----
NM_006738chr1523741 976 --21538 1014 1280
NM_006761chr171746 ------
NM_006772chr621233 246 ------
NM_006775chr613012 ------
NM_006777chrX12244 --1680 --
NM_006790chr51160 ------
NM_006795chr1131505 1207 114 --11578 --
NM_006807chr1721256 285 ------
NM_006815chr12--11251 ----
NM_006839chr2172 ------
NM_006852chr1732569 2378 323 ------
NM_006854chr721958 430 ------
NM_006857chr22161 80 ------
NM_006861chr121277 11824 ----
NM_006870chr20--1558 ----
NM_006873chr232624 2595 2423 ------
NM_006874chr41428 ------
NM_006876chr111543 ------
NM_006884chr331293 354 135 ------
NM_006887chr25749 524 78 72 64 --1654 --
NM_006888chr1421310 1038 170 ----
NM_006899chr202298 110 ----127
NM_006901chr15178 ------
NM_006908chr711258 --1110 --
NM_006915chrX22476 237 ------
NM_006924chr1723886 141 21131 590 ----
NM_006937chr17----1400 --
NM_006939chr141892 ------
NM_006940chr1231602 1585 639 ------
NM_006950chrX2883 805 ------
NM_006951chr101721 ------
NM_006981chr922876 185 ------
NM_007011chr1556462 6355 4842 2669 1840 16265 ----
NM_007013chr8132 ------
NM_007014chr1621756 134 ------
NM_007015chr131275 ------
NM_007030chr551146 929 855 267 241 15131 162 --
NM_007033chr11799 ------
NM_007039chr142267 233 ------
NM_007045chr6----1113 --
NM_007051chr1--1128 ----
NM_007064chr31138 ------
NM_007067chr171320 ------
NM_007084chr133559 416 211 ------
NM_007097chr5185 ------
NM_007124chr6----1431 --
NM_007146chr1712029 ------
NM_007158chr11148 ------
NM_007159chr3--1222 ----
NM_007200chr1523741 976 --21538 1014 1280
NM_007221chr11372 ------
NM_007222chr8------11688
NM_007236chr1522134 22 ------
NM_007238chr2044135 3358 1295 368 ----11434
NM_007256chr1141671 1386 1283 1225 ------
NM_007283chr332575 2464 393 --12775 --
NM_007320chr191308 ------
NM_007349chr71332 ------
NM_007351chr4169 ------
NM_007358chr11580 ------
NM_007365chr12147 33 ------
NM_007375chr112463 ------
NM_012069chrX2895 134 12121 ----
NM_012074chr142964 119 ------
NM_012081chr513203 ----12519
NM_012090chr111183 ------
NM_012095chr1033277 1330 667 ------
NM_012096chr31312 ------
NM_012110chr4157 ------
NM_012120chr622554 701 ------
NM_012156chr2032182 506 343 13074 1204 --
NM_012164chr946261 6233 5203 1897 17177 ----
NM_012214chr246161 4607 2563 531 ------
NM_012223chr211053 ------
NM_012224chr411114 ------
NM_012232chr17257 33 ------
NM_012233chr211142 1840 ----
NM_012234chr331351 170 75 22880 1452 ----
NM_012252chr71154 ------
NM_012257chr71856 ------
NM_012282chrX143 ------
NM_012288chr634906 3727 2174 2376 130 --14132
NM_012290chr2----11328 --
NM_012297chr411877 ------
NM_012300chr542078 1580 856 766 ------
NM_012302chr1----2928 147 --
NM_012307chr18123 ------
NM_012308chr1132440 2288 1639 ------
NM_012309chr1133283 512 292 13506 123 --
NM_012316chr134457 1285 999 ------
NM_012333chr11603 --11528 --
NM_012399chr2231823 1523 114 ------
NM_012402chr1111356 --1495 --
NM_012407chr221431 --1140 --
NM_012410chr161448 ------
NM_012416chr91169 ------
NM_012425chr102865 760 ------
NM_012473chr22129 ------
NM_012479chr72998 535 ------
NM_013246chr112667 22 ------
NM_013261chr423660 2287 ------
NM_013281chr20--11174 --1267
NM_013283chr51138 1328 ----
NM_013300chr121243 ------
NM_013309chr1512658 ------
NM_013316chr71912 ------
NM_013368chr192410 151 ------
NM_013372chr1533269 2241 458 ------
NM_013377chr122276 72 ------
NM_013381chr121272 1232 ----
NM_013382chr143904 729 243 --11976 --
NM_013390chr9----11091 --
NM_013396chr21156 ------
NM_013438chr9----11587 --
NM_013449chr122542 130 ------
NM_013450chr211062 ------
NM_013951chr2----12436 --
NM_013960chr8153 ------
NM_014011chr212525 ------
NM_014014chr22439 158 ------
NM_014016chr31253 ------
NM_014023chr1022252 150 --1474 --
NM_014030chr173822 470 293 ------
NM_014038chr7--198 ----
NM_014048chr1614204 24894 4503 ----
NM_014109chr81476 ------
NM_014112chr812033 ------
NM_014155chr1111100 --12693 --
NM_014178chr14----1573 --
NM_014191chr12--143 1726 --
NM_014250chr2212026 ------
NM_014253chrX21700 558 ------
NM_014265chr81781 ------
NM_014281chr8126 ------
NM_014283chr11348 ------
NM_014288chr11114 ------
NM_014292chr22177 --11642 --
NM_014293chr2263989 3525 2605 1320 1070 31 --11160 --
NM_014315chr14----133 --
NM_014319chr1211419 ------
NM_014333chr1112742 ------
NM_014351chr2241467 1353 183 83 ------
NM_014363chr1311038 ------
NM_014392chr421162 406 137 1432 --
NM_014393chr822312 303 ------
NM_014405chr1732284 1708 1489 ------
NM_014423chr534531 744 119 ------
NM_014447chr41117 ------
NM_014470chr121644 ------
NM_014494chr1622067 664 1353 ----
NM_014562chr22338 94 ------
NM_014564chr91313 ------
NM_014575chr3----1412 --
NM_014607chr21200 ------
NM_014613chr542700 2269 2072 410 ------
NM_014614chr2--11300 ----
NM_014615chr1623326 961 ------
NM_014620chr12--1755 ----
NM_014621chr2184 ------
NM_014636chr91879 13092 33796 1444 670 --
NM_014647chr1612164 ------
NM_014665chr882781 2652 2294 1014 885 698 662 128 ------
NM_014667chr311682 1706 ----
NM_014676chr111353 ------
NM_014682chr81851 11876 ----
NM_014686chr1942482 2416 2368 660 ------
NM_014689chr21125 ------
NM_014702chr613277 ------
NM_014705chr7--11730 ----
NM_014709chr21178 ------
NM_014721chr6----25308 1414 --
NM_014726chr171102 ------
NM_014729chr822112 1647 ------
NM_014730chr1234542 998 205 ------
NM_014730chr1234542 998 205 ------
NM_014735chrX1140 --1325 --
NM_014736chr151951 ------
NM_014755chr233743 937 88 ----1500
NM_014765chr122468 695 ------
NM_014766chr723402 2841 ------
NM_014772chr1852738 2723 927 681 440 --1371 --
NM_014774chr112883 --12085 --
NM_014787chr1174 --1235 --
NM_014795chr21443 ------
NM_014810chr121274 604 13087 ----
NM_014819chr51893 ------
NM_014824chr111356 ------
NM_014826chr143672 799 81 26 14087 ----
NM_014864chr11947 --2488 360 --
NM_014876chr2241855 1557 83 25 ------
NM_014884chr19151 ------
NM_014890chr3199 ------
NM_014901chr531785 1400 105 --22001 1410 --
NM_014903chr1212415 ------
NM_014905chr21220 ------
NM_014912chr1011333 ------
NM_014913chr1821374 1172 ------
NM_014924chr141360 ------
NM_014925chr12----1225 --
NM_014926chr3173 --1239 --
NM_014935chr131061 494 320 13892 --13066
NM_014938chr1221946 210 ------
NM_014944chr11243 --21418 320 --
NM_014946chr22642 209 12837 ----
NM_014961chr411372 1589 ----
NM_014969chr11942 ------
NM_014974chr1041415 1370 1287 1253 1664 ----
NM_014978chr102723 247 ------
NM_014990chr1411096 ------
NM_014991chr432079 967 314 ------
NM_014992chr141611 ----181
NM_014999chr1221651 261 ------
NM_015008chr323511 2723 ------
NM_015009chr32642 65 ------
NM_015020chr1611291 ------
NM_015025chr232116 1759 891 ------
NM_015026chr121168 ------
NM_015033chr952721 984 557 206 190 12331 ----
NM_015035chr2035771 4879 1109 12050 1141 --
NM_015039chr1190 ------
NM_015042chr151842 ------
NM_015044chr1622756 879 ------
NM_015049chr21544 ------
NM_015057chr131653 ------
NM_015062chr101208 ------
NM_015068chr753847 3119 1493 722 560 ------
NM_015074chr144957 3718 3650 1914 ------
NM_015075chrX31824 1644 386 ------
NM_015080chr111199 ------
NM_015090chr172404 1851 1516 706 584 273 263 12359 ----
NM_015092chr1633708 3286 1733 ------
NM_015094chr2284167 3545 2978 1635 1232 1128 291 36 14378 ----
NM_015099chr173174 154 40 ------
NM_015115chr432290 117 101 ------
NM_015116chr1311463 --1460 184
NM_015125chr191513 ------
NM_015132chr7--11702 ----
NM_015133chr1611354 ------
NM_015134chr172661 43 ------
NM_015143chr4----11027 11436
NM_015144chr1633285 3228 1398 23537 750 ----
NM_015147chr212118 ----183
NM_015149chr122142 425 ------
NM_015150chr31326 ------
NM_015155chr1022233 99 --23146 474 --
NM_015157chr1141068 792 469 170 ------
NM_015161chr161306 ------
NM_015176chr121246 709 ------
NM_015192chr2052767 2365 652 528 275 ------
NM_015202chr16--11713 11075 --
NM_015206chr152718 68 --23029 621 --
NM_015215chr123004 915 ------
NM_015221chr103467 290 28 ------
NM_015247chr1624563 524 ------
NM_015265chr2----1324 --
NM_015271chr434083 2950 37 1544 ----
NM_015275chr1211533 ------
NM_015277chr18149 ------
NM_015278chr632940 393 372 13315 ----
NM_015286chr152396 313 ------
NM_015288chr553871 3312 3202 646 406 --11101 11334
NM_015294chr17--128 ----
NM_015296chr13----1406 --
NM_015305chr1431895 190 127 ------
NM_015308chr111551 ------
NM_015310chr836319 5652 2208 --12967 --
NM_015315chr533277 1183 653 ------
NM_015317chr222381 1091 ------
NM_015320chr221004 717 ------
NM_015321chr1994526 4271 3661 3250 2998 1750 675 282 80 1112 ----
NM_015326chr121990 119 ------
NM_015328chr742773 2072 2022 1120 ------
NM_015332chr75706 506 453 369 26 --1157 12821
NM_015336chr1221635 686 ------
NM_015339chr20--1656 ----
NM_015345chr612771 ------
NM_015346chr1411690 ------
NM_015349chr612499 ------
NM_015356chr8162 ------
NM_015365chrX1323 --13500 --
NM_015386chr16137 ------
NM_015393chr4--13514 1241 --
NM_015404chr9183 1428 1596 --
NM_015415chr11251 ------
NM_015426chr32587 153 ------
NM_015429chr311025 ------
NM_015441chr11338 ------
NM_015443chr171971 11491 ----
NM_015447chr92621 255 142 ----
NM_015460chr311545 1479 --11797
NM_015461chr18------1544
NM_015481chr122799 759 --1819 --
NM_015488chr211473 ------
NM_015509chr1211435 ----1432
NM_015520chr312555 ------
NM_015523chr111103 ------
NM_015530chr21262 ------
NM_015548chr61732 ------
NM_015569chr124412 1728 ------
NM_015570chr72735 241 ------
NM_015577chr5--11315 ----
NM_015578chr1911574 --1725 --
NM_015584chr171336 ------
NM_015589chr14------1165
NM_015601chr101112 ------
NM_015609chr13768 138 122 --11059 --
NM_015646chr1231267 851 442 ------
NM_015651chr951475 913 763 372 351 ------
NM_015652chr101171 ------
NM_015657chr21677 ------
NM_015675chr191561 ------
NM_015678chr1321316 531 ------
NM_015680chr2188 ------
NM_015686chrX32324 2140 511 ------
NM_015716chr171654 ------
NM_015719chr192609 123 ------
NM_015834chr211917 ------
NM_015866chr11273 1104 --1358
NM_015872chr151337 1170 1109 371 107 --11378 --
NM_015892chr1021656 457 ------
NM_015902chr81144 ------
NM_015912chr81305 11638 ----
NM_015981chr522376 1982 ----11196
NM_016021chr622065 1144 ------
NM_016037chr11800 ------
NM_016045chr201418 ------
NM_016076chr132614 2050 309 1226 1835 --
NM_016083chr623332 1185 ------
NM_016126chr1121 ------
NM_016132chr1523353 1343 ------
NM_016147chr111850 ------
NM_016152chr31395 ------
NM_016162chr121320 ------
NM_016192chr2----1104 --
NM_016195chr10156 ------
NM_016203chr71189 ------
NM_016205chr42936 398 ------
NM_016206chr327617 2709 ------
NM_016227chr11348 ------
NM_016230chr6----1402 --
NM_016231chr171466 ------
NM_016257chr123296 2950 ------
NM_016258chr11126 ------
NM_016260chr216537 14762 ----
NM_016272chr22----1495 --
NM_016289chr22437 179 --1737 --
NM_016308chr122002 454 1380 ----
NM_016377chr641528 321 153 76 --11157 --
NM_016395chr1541871 1814 1575 178 ------
NM_016396chr1511878 1837 ----
NM_016399chr121201 130 ----
NM_016424chr17----1534 --
NM_016436chr201572 --161 --
NM_016470chr20--1122 ----
NM_016480chr52727 134 ------
NM_016505chr12702 113 ------
NM_016507chr173848 834 141 ------
NM_016531chr444118 3851 3567 395 --1467 --
NM_016538chr171314 --1156 --
NM_016547chr12593 448 --1211 --
NM_016559chr3----21128 332 --
NM_016569chr122628 486 ------
NM_016574chr11169 ------
NM_016577chr364349 3305 2773 1776 623 38 --14279 --
NM_016582chr11125 ------
NM_016586chr141141 ------
NM_016605chr521684 143 ------
NM_016607chrX1221 ------
NM_016620chr11376 ------
NM_016621chr1154162 4031 2853 804 612 --11126 --
NM_016626chr181619 145 ----
NM_016631chr212842 757 ------
NM_016653chr2----11077 --
NM_016830chr12178 ------
NM_016834chr1721641 635 13993 22608 109 13452
NM_016835chr1721641 635 13993 22608 109 13452
NM_016836chr21495 ------
NM_016839chr21495 ------
NM_016841chr1721641 635 13993 22608 109 13452
NM_016936chr162876 182 --1223 --
NM_016946chr111263 ------
NM_017409chr121563 ------
NM_017413chrX----1107 --
NM_017415chr511343 --11568 --
NM_017420chr1423215 997 --12714 --
NM_017423chr412048 ------
NM_017447chr2144169 3681 1329 579 11160 ----
NM_017450chr172486 84 ------
NM_017488chr221450 1369 ------
NM_017491chr41144 --1972 --
NM_017514chrX2325 174 ------
NM_017540chr523084 2080 --12348 --
NM_017544chrX----1721 --
NM_017548chr311710 ----1427
NM_017551chr102457 95 ------
NM_017553chr15195 ----1366
NM_017569chr13145 ------
NM_017573chr19127 ------
NM_017580chr1011565 ------
NM_017594chr921125 574 --13320 --
NM_017599chr1231832 1382 393 ------
NM_017610chr1531474 828 301 ------
NM_017633chr6--2959 606 13687 --
NM_017637chr948750 8725 3020 2870 19104 15922 --
NM_017643chr1712537 ------
NM_017658chr1411480 14449 --11868
NM_017668chr163793 710 257 --153 --
NM_017680chr92842 729 ------
NM_017694chr221505 834 ------
NM_017714chr201118 ------
NM_017715chr72496 36 ------
NM_017737chr122063 399 ------
NM_017744chr121681 928 --1441 --
NM_017748chr171791 ------
NM_017758chr1711509 --1390 --
NM_017811chr92986 219 ------
NM_017813chr825555 1235 11586 ----
NM_017824chr1022662 883 11753 ----
NM_017848chrX33252 3137 1772 11856 11799 --
NM_017902chr1064832 4175 3814 2062 2004 203 ------
NM_017925chr911302 --11919 --
NM_017933chr211010 1663 ----
NM_017934chr6183 ------
NM_017938chrX32218 646 265 ------
NM_017949chr17124 ----1205
NM_017987chr1022081 507 ------
NM_017994chr72535 51 ------
NM_018010chr31362 11535 ----
NM_018013chr612589 ------
NM_018027chr102559 101 12718 ----
NM_018028chr191170 ------
NM_018031chr31581 ------
NM_018053chr11568 --1737 --
NM_018061chr12225 89 11707 --11673
NM_018078chr41837 ------
NM_018105chr81909 ------
NM_018110chr1631236 876 132 ------
NM_018113chr121396 ------
NM_018121chr1012339 12433 ----
NM_018144chr101263 ------
NM_018150chr1290 25 ------
NM_018155chr343378 1293 1031 724 ------
NM_018157chr1232997 2685 94 ------
NM_018179chr121233 ------
NM_018181chr1831358 622 145 ----11789
NM_018184chr312022 ------
NM_018221chr2132 ------
NM_018243chr433448 1225 1101 --1543 --
NM_018245chr102365 28 ------
NM_018270chr20--1826 ----
NM_018299chr812630 --12432 --
NM_018322chr611156 --1931 --
NM_018362chr1113401 ------
NM_018364chr123177 2673 ------
NM_018375chr1421192 100 ------
NM_018482chr811912 --11669 --
NM_018489chr112345 1681 ----
NM_018534chr2182 ------
NM_018553chr1731555 100 47 ------
NM_018571chr22180 48 ------
NM_018584chr11424 1466 1840 --
NM_018622chr3138 ------
NM_018640chr1232676 2266 2004 ------
NM_018667chr163612 448 381 --2398 37 --
NM_018684chrX2972 87 ------
NM_018695chr5--22334 876 ----
NM_018698chrX11927 ------
NM_018699chr4------1226
NM_018708chr192587 397 --11072 --
NM_018710chr811111 ------
NM_018713chr11103 ------
NM_018715chr13534 489 36 ----1876
NM_018717chr42939 917 ------
NM_018719chr721193 1126 ------
NM_018834chr51274 ------
NM_018837chr20----1703 --
NM_018841chr1124 ------
NM_018890chr711258 --1110 --
NM_018898chr51353 ------
NM_018899chr51353 ------
NM_018900chr51353 ------
NM_018901chr51353 ------
NM_018902chr51353 ------
NM_018903chr51353 ------
NM_018904chr51353 ------
NM_018905chr51353 ------
NM_018906chr51353 ------
NM_018907chr51353 ------
NM_018908chr51353 ------
NM_018909chr51353 ------
NM_018910chr51353 ------
NM_018911chr51353 ------
NM_018912chr511281 --11687 --
NM_018913chr511281 --11687 --
NM_018914chr511281 --11687 --
NM_018915chr511281 --11687 --
NM_018916chr511281 --11687 --
NM_018917chr511281 --11687 --
NM_018918chr511281 --11687 --
NM_018919chr511281 --11687 --
NM_018920chr511281 --11687 --
NM_018921chr511281 --11687 --
NM_018922chr511281 --11687 --
NM_018923chr511281 --11687 --
NM_018924chr511281 --11687 --
NM_018925chr511281 --11687 --
NM_018926chr511281 --11687 --
NM_018927chr511281 --11687 --
NM_018928chr511281 --11687 --
NM_018929chr511281 --11687 --
NM_018959chr192578 480 ------
NM_018976chr121119 ------
NM_019001chr324722 4034 --1262 --
NM_019006chr151102 ------
NM_019027chr4--1222 ----
NM_019046chr101747 ------
NM_019066chr15121 ------
NM_019094chr1253783 2661 1465 1169 67 191 ----
NM_019105chr62124 21 ------
NM_019116chr1683488 3337 3330 3209 3105 2328 557 210 12908 ----
NM_019556chrX1437 ------
NM_019593chr2012244 1152 1805 --
NM_019605chr11298 156 ----
NM_019606chr7140 ------
NM_019845chr22782 159 ------
NM_019884chr191418 ------
NM_019885chr222505 125 11958 ----
NM_019895chr31965 ------
NM_020066chr12345 117 21031 712 ----
NM_020144chr711604 ------
NM_020148chr1812819 ------
NM_020150chr1011817 --1638 --
NM_020178chr171215 ------
NM_020180chr1831350 1343 41 ------
NM_020182chr20--21224 189 12297 --
NM_020193chr111301 ------
NM_020309chr19----1832 --
NM_020310chr1721929 517 ------
NM_020336chr2043748 3050 2770 1142 --13466 --
NM_020338chr1013199 13557 ----
NM_020342chr21104 ------
NM_020346chr112580 216 192 ----
NM_020354chr101319 ------
NM_020362chr11847 ------
NM_020373chr121436 ------
NM_020403chr13--11801 ----
NM_020425chr6--1391 ----
NM_020440chr122957 1042 11117 12084 --
NM_020444chr52995 41 ------
NM_020445chr72228 122 --1787 --
NM_020449chrX1583 ------
NM_020452chr121350 99 12125 ----
NM_020466chr643451 3258 3244 3149 --13155 --
NM_020473chrX2194 70 ------
NM_020474chr1831414 1289 345 ------
NM_020475chr811600 1180 11551 --
NM_020476chr811600 1180 11551 --
NM_020477chr811600 1180 11551 --
NM_020478chr811663 1243 11614 --
NM_020480chr811600 1180 11551 --
NM_020482chr6------1223
NM_020526chr12638 141 11733 ----
NM_020546chr521946 191 ------
NM_020631chr131226 1053 223 ------
NM_020640chr31328 ------
NM_020644chr11--1793 ----
NM_020654chr31100 ------
NM_020655chr1621377 326 ------
NM_020661chr12------11669
NM_020699chr134579 3816 1143 15417 ----
NM_020708chr20101004 751 743 715 590 481 386 257 231 59 ------
NM_020717chrX24316 1924 --1395 --
NM_020728chr712524 ------
NM_020734chr121324 175 ----
NM_020740chr171152 ------
NM_020747chr51278 ------
NM_020748chr1711864 ------
NM_020750chr62388 82 ------
NM_020764chr1621013 890 ------
NM_020772chr1727099 6938 --16451 --
NM_020795chr173771 562 547 ------
NM_020796chr512832 11144 11168 --
NM_020806chr141564 1237 ----
NM_020807chr161178 --292 64 --
NM_020809chr1112216 ------
NM_020810chr141714 ------
NM_020845chr1232203 973 597 ------
NM_020850chr1632771 2368 877 ------
NM_020854chr1821053 107 1321 ----
NM_020858chr152417 409 ------
NM_020859chr41361 12807 ----
NM_020860chr4--2362 344 ----
NM_020868chr211311 ------
NM_020873chr3--1837 ----
NM_020925chr111280 ------
NM_020927chr161959 ----1288
NM_020940chr1022325 729 22491 2234 ----
NM_020943chr21220 ------
NM_020951chr1911662 ------
NM_020962chr152688 649 ------
NM_021004chr14--1362 ----
NM_021007chr211750 ------
NM_021033chr132985 83 ------
NM_021035chr20132 ------
NM_021044chr121309 --1156 --
NM_021069chr42451 350 ------
NM_021072chr511817 ------
NM_021088chr231751 829 58 ------
NM_021090chr2234957 3767 1835 ------
NM_021097chr232760 2413 1002 12259 ----
NM_021103chr21244 ------
NM_021106chr92481 309 ------
NM_021110chr8--1758 ----
NM_021116chr788766 8598 8190 3611 3570 2190 2179 1922 ------
NM_021135chr673205 2670 2457 849 573 125 43 --1256 --
NM_021140chrX--189 ----
NM_021149chr1621144 28 ------
NM_021174chr8166 ------
NM_021183chrX----1456 --
NM_021190chr1----11073 --
NM_021198chr211075 --1405 --
NM_021229chr12--11210 ----
NM_021240chr91168 --1472 --
NM_021252chr10125 --191 --
NM_021260chr14----1347 21090 200
NM_021629chr314781 ------
NM_021639chr11595 ------
NM_021643chr21263 ------
NM_021728chr141938 ------
NM_021729chr111310 ------
NM_021783chrX2522 36 ------
NM_021813chr631829 860 208 24631 1731 1824 --
NM_021871chr4----144 --
NM_021911chr515079 --11901 --
NM_021914chr14--12381 1268 --
NM_021940chr631569 1055 48 1269 ----
NM_021964chr326351 292 11014 --16457
NM_021973chr4----1112 --
NM_021977chr622955 1410 --169 33174 577 55
NM_021984chrX2142 61 ------
NM_021987chrX2142 61 ------
NM_021990chrX2142 61 ------
NM_022048chr1534086 2375 2250 --15246 --
NM_022066chr173905 740 293 --1391 --
NM_022073chr142330 119 ------
NM_022075chr12974 136 ------
NM_022079chr101112 ------
NM_022107chr6129 ------
NM_022114chr11824 1529 44155 3847 3133 281 --
NM_022123chr142569 116 ------
NM_022166chr1662438 2412 1471 1335 1271 466 --11320 24800 1528
NM_022346chr41343 ------
NM_022463chr1721478 1169 1271 ----
NM_022465chr121589 ------
NM_022470chr311220 ------
NM_022484chr71102 ------
NM_022494chr101328 ------
NM_022497chr332936 2453 549 ------
NM_022552chr22960 175 --1411 --
NM_022553chr62153 104 ------
NM_022566chr15----1597 --
NM_022571chr14144 ------
NM_022572chr211473 ------
NM_022574chr742042 1414 870 651 ------
NM_022652chr12122 ------
NM_022658chr122257 148 ------
NM_022719chr2252741 2381 1501 309 200 12572 13465 --
NM_022726chr61473 ------
NM_022735chr11341 --11716 --
NM_022737chr1931036 138 90 ------
NM_022744chr162954 388 ------
NM_022758chr613075 --12390 --
NM_022763chr3----12964 --
NM_022841chr1512308 --1670 --
NM_022843chr13--11176 ----
NM_022845chr1621686 674 ------
NM_022898chr1413862 21218 377 12990 --
NM_022901chr911406 ------
NM_022912chr2--1548 ----
NM_023012chr12191 ------
NM_023067chr3----1236 --
NM_023925chr121217 ------
NM_023929chr8--184 ----
NM_024007chr5------1158
NM_024016chr171265 1176 ----
NM_024019chr41160 ------
NM_024046chr351205 1199 867 408 101 ------
NM_024052chr171122 ------
NM_024054chr71339 ------
NM_024060chr111309 1233 ----
NM_024085chr23888 853 699 ------
NM_024294chr613075 --12390 --
NM_024306chr161333 ----1870
NM_024315chr71308 1149 ----
NM_024328chr142685 181 ------
NM_024329chr131348 263 83 ------
NM_024337chr51132 ------
NM_024345chr934518 4285 1297 1590 11218 --
NM_024422chr1821706 374 ------
NM_024429chr71189 ------
NM_024494chr1----166 --
NM_024501chr2--1693 ----
NM_024522chr12501 31 --1197 11894
NM_024524chr322665 2223 ------
NM_024546chr131894 ------
NM_024565chr531363 1220 522 ------
NM_024567chr8198 ------
NM_024607chr821689 231 13019 1393 --
NM_024631chr111227 1588 ----
NM_024640chr11679 --1181 --
NM_024659chr22898 27 ------
NM_024665chr333682 3661 450 ------
NM_024692chr211440 ------
NM_024755chr151221 ------
NM_024770chr265689 5679 2226 1773 1126 659 12254 15662 --
NM_024786chr5----1244 192
NM_024804chr11313 ------
NM_024811chr112491 45 1787 ----
NM_024835chr17--1362 ----
NM_024841chr113950 637 255 ------
NM_024887chr122047 698 11382 ----
NM_024899chr181728 ------
NM_024915chr821814 776 ------
NM_024923chr32317 44 --11360 --
NM_024949chr41834 --14300 --
NM_024954chr10------1206
NM_024969chr21900 ------
NM_025054chr81760 12883 ----
NM_025058chr11562 ------
NM_025076chr2----1195 --
NM_025083chr15----11788 --
NM_025109chr17149 ------
NM_025134chr161194 ------
NM_025146chr321707 26 ------
NM_025151chr8176 ------
NM_025160chr12532 164 13571 ----
NM_025164chr11--12056 ----
NM_025191chr11960 ------
NM_025208chr111145 ------
NM_025224chr2032247 102 34 ------
NM_025237chr171405 --21058 399 --
NM_025251chr83413 372 250 ------
NM_030594chr151451 ----1406
NM_030621chr1443041 2975 1507 644 ------
NM_030625chr1031979 825 722 ------
NM_030627chr523252 2524 ------
NM_030629chr16----11864 --
NM_030634chr121000 612 ------
NM_030647chr71648 15369 15524 --
NM_030648chr474797 4302 2029 1960 738 408 140 1499 14654 1199
NM_030661chr721409 159 ------
NM_030665chr1711245 ------
NM_030674chr12--14798 ----
NM_030751chr10163 ------
NM_030751chr10163 ------
NM_030762chr121680 11959 ----
NM_030766chr122313 29 ------
NM_030795chr8171 ------
NM_030799chr521889 612 ----1286
NM_030806chr188912 7941 7687 7593 3025 1054 475 446 2665 168 ----
NM_030808chr172723 209 ------
NM_030816chr1--13109 ----
NM_030819chr163179 144 21 ------
NM_030881chr2231907 299 80 ------
NM_030914chr9195 1960 ----
NM_030918chr134797 1808 1332 ------
NM_030923chr21160 ------
NM_030934chr1--21829 1452 ----
NM_030935chr7145 ------
NM_030938chr172750 442 1254 ----
NM_030962chr1131060 218 137 ------
NM_030964chr543472 2503 630 108 ------
NM_030981chr1111040 ------
NM_031216chr1811923 --11752 --
NM_031262chr91289 ------
NM_031263chr91346 ------
NM_031267chr71135 ------
NM_031268chr1654281 3784 1313 262 28 --25383 128 --
NM_031297chr9138 ------
NM_031305chr431535 1482 719 --1354 --
NM_031309chr85874 634 521 162 64 --1640 --
NM_031372chr4151 ------
NM_031411chr51353 ------
NM_031417chr192518 241 ------
NM_031418chr111469 --12387 --
NM_031442chrX22695 2025 ------
NM_031453chr103163 118 24 ------
NM_031477chr161355 ------
NM_031483chr202570 211 ------
NM_031845chr2--12823 ----
NM_031847chr2--12823 ----
NM_031849chr51353 ------
NM_031857chr51353 ------
NM_031858chr17183 ------
NM_031860chr51353 ------
NM_031862chr17183 ------
NM_031886chr1912087 ------
NM_031889chr421433 1366 2334 266 ----
NM_031890chr2222676 345 1829 12623 --
NM_031899chr321018 94 ------
NM_031964chr17171 ------
NM_031990chr1921488 165 ------
NM_031991chr1921488 165 ------
NM_032025chr341814 1267 658 189 ------
NM_032042chr512796 ------
NM_032088chr511281 --11687 --
NM_032092chr511281 --11687 --
NM_032109chr591190 1144 581 574 451 410 338 135 114 ------
NM_032124chr181180 ----11098
NM_032146chr31115 ------
NM_032153chr33106 61 32 ------
NM_032156chr121217 ------
NM_032181chr21327 ------
NM_032182chr101373 ------
NM_032186chr11376 ------
NM_032189chr13103683 1108 1055 1039 1010 997 981 947 584 82 15056 14399 13910
NM_032192chr172546 97 ------
NM_032199chr10----1258 --
NM_032228chr11--11422 ----
NM_032229chr132292 24 --1224 --
NM_032281chr1963081 2630 2150 1174 624 398 ------
NM_032305chr1121 ------
NM_032375chr194753 718 334 109 ------
NM_032403chr511281 --11687 --
NM_032410chr81474 ------
NM_032429chr101584 ------
NM_032430chr191124 ------
NM_032431chr1121096 48 ------
NM_032440chr102285 76 ------
NM_032445chr15123 ------
NM_032452chr1441538 1367 369 153 ------
NM_032457chr41208 ------
NM_032458chrX33424 2410 154 ------
NM_032470chr62124 21 ------
NM_032482chr1932568 772 53 --1650 --
NM_032491chr121448 ------
NM_032499chr151184 ------
NM_032538chr631989 431 237 ------
NM_032539chrX1193 --1550 --
NM_032550chr101468 ------
NM_032557chr4----1770 --
NM_032569chr161311 ------
NM_032590chr12------1361
NM_032594chr14--185 ----
NM_032626chr161121 1346 ----
NM_032632chr1421926 1649 ------
NM_032682chr323253 2793 --12876 --
NM_032689chr191337 ------
NM_032750chr33583 172 56 --1654 --
NM_032765chr51969 1922 1798 --
NM_032826chr713397 ------
NM_032900chr10190 ------
NM_032905chr1021061 314 ------
NM_032932chr1726482 477 --25712 5207 --
NM_032947chr51115 ------
NM_032949chr131457 ------
NM_032982chr732501 741 533 --1653 --
NM_032991chr411418 ------
NM_032995chr231655 1368 1208 ------
NM_033016chr2231350 558 98 ------
NM_033030chr2155 ------
NM_033044chr111183 ------
NM_033089chr202375 308 ------
NM_033116chr141101 ------
NM_033121chr122271 97 ------
NM_033129chr202372 79 --121 --
NM_033133chr1723077 1140 ------
NM_033135chr111145 ------
NM_033141chr1441687 818 285 112 12137 11573 --
NM_033161chr911622 ------
NM_033181chr623332 1185 ------
NM_033224chr712530 --2701 332 --
NM_033244chr156349 332 120 105 90 75 --21089 844 --
NM_033272chr21294 ------
NM_033285chr833652 3179 184 --1832 --
NM_033305chr911320 ------
NM_033315chr1722209 194 ------
NM_033401chr164414 372 160 109 ------
NM_033429chr151553 --1772 --
NM_033430chr422811 302 ------
NM_033437chr422811 302 ------
NM_033495chrX1955 ------
NM_033505chr226639 2549 --14138 --
NM_033512chr8----12742 --
NM_033551chr533277 1183 653 ------
NM_033631chr143923 3203 1393 1087 ------
NM_033644chr542078 1580 856 766 ------
NM_033645chr542078 1580 856 766 ------
NM_033656chr2125735 3653 --12175 --
NM_052868chr1123 ------
NM_052875chr1121715 289 1112 ----
NM_052896chr12157 123 ------
NM_052898chr8--11667 ----
NM_052900chr8----11457 --
NM_052906chr2244890 4409 3549 3531 --14062 --
NM_052910chr1351381 1351 527 303 146 ------
NM_052918chr1043179 2422 1489 1218 --1888 --
NM_052927chr5--2213 150 ----
NM_052978chr1411374 --1583 --
NM_053016chr925856 112 --56226 5656 2377 1060 118 --
NM_053043chr736267 5952 2533 ------
NM_054027chr51857 ------
NM_054033chr21420 ------
NM_057089chr71332 ------
NM_057159chr9--21528 247 ----
NM_057178chr17176 ------
NM_058170chr1--11012 ----
NM_058172chr41161 ------
NM_058175chr212751 189 --1266 1859
NM_058241chr211766 ------
NM_058241chr211766 ------
NM_078480chr8126 ------
NM_079834chr1951665 1587 1429 577 537 ------
NM_080415chr172929 638 ------
NM_080546chr9--12193 ----
NM_080594chr16121 ------
NM_080645chr611868 11577 ----
NM_080654chr111128 ------
NM_080676chr2032666 2039 1005 13110 ----
NM_080723chr611323 ------
NM_080730chr121600 --135 --
NM_080731chr121600 --135 --
NM_080738chr131965 1945 1712 ------
NM_080759chr13------11649
NM_080760chr13------11649
NM_080792chr201776 12290 ----
NM_080881chr5287 29 ------
NM_130436chr2111732 ------
NM_130438chr2112309 ------
NM_130466chr121467 ------
NM_130795chr92481 309 ------
NM_130797chr721423 604 ------
NM_130838chr15--1742 ----
NM_130839chr15--1742 ----
NM_133171chr201271 ------
NM_133177chr11736 --11069 --
NM_133178chr11736 --11069 --
NM_133265chrX21270 875 ------
NM_133328chr192648 547 ------
NM_133329chr2123 ------
NM_133369chr51943 ------
NM_133378chr2--147 ----
NM_133432chr2--147 ----
NM_133433chr51172 ------
NM_133437chr2--147 ----
NM_133445chr922921 144 ------
NM_133478chr2----145 --
NM_133486chrX1101 ------
NM_133496chr152836 2751 1326 906 704 ----1565
NM_133499chrX2953 875 ------
NM_133631chr31219 ------
NM_133634chr2131675 1197 1173 --1472 --
NM_134421chr2--166 ----
NM_134427chr92481 309 ------
NM_138270chrX1631 ------
NM_138285chr21164 ------
NM_138338chr2232903 2137 1265 --12779 1336
NM_138357chr101313 ----11458
NM_138360chr14------145
NM_138375chr18----1852 --
NM_138394chr21102 ------
NM_138411chr191113 ------
NM_138426chr7--1198 ----
NM_138473chr1221107 697 ------
NM_138576chr1413862 21218 377 12990 --
NM_138633chr641528 321 153 76 --11157 --
NM_138635chr713047 --1218 --
NM_138638chr14--12381 1268 --
NM_138689chr11----161 --
NM_138713chr16--18252 ----
NM_138714chr16--18252 ----
NM_138727chr121681 928 --1441 --
NM_138728chr121681 928 --1441 --
NM_138731chr1413805 12657 ----
NM_138732chr111199 ------
NM_138734chr111199 ------
NM_138735chr21527 ------
NM_138774chr194871 771 602 34 --1735 --
NM_138782chr5--1644 ----
NM_138799chr211648 ------
NM_138959chr132489 1407 302 ------
NM_138967chr1551692 632 566 542 262 ------
NM_138981chr42533 30 ------
NM_138994chr164414 372 160 109 ------
NM_139015chr1211219 ------
NM_139035chrX1272 ------
NM_139057chr1522795 2601 ------
NM_139068chr51259 ------
NM_139069chr51259 ------
NM_139070chr51128 ------
NM_139071chr1211223 ------
NM_139076chr4189 ------
NM_139131chr111143 ------
NM_139135chr131048 519 501 --1365 --
NM_139156chr11116 ------
NM_139157chr11----135 --
NM_139168chr511914 ------
NM_139169chr10----1185 --
NM_139215chr17178 ------
NM_139283chr122994 966 ------
NM_139316chr71427 ------
NM_139321chr2022604 487 ------
NM_144488chr92481 309 ------
NM_144489chr92481 309 ------
NM_144571chr4----16974 --
NM_144578chr141122 ------
NM_144580chr12281 249 ------
NM_144583chr221675 251 ------
NM_144586chr23858 431 48 ------
NM_144593chr12128 ------
NM_144633chr31530 11183 ----
NM_144641chr321168 240 --1400 --
NM_144653chr9148 ------
NM_144660chr101161 ------
NM_144664chr1112011 ------
NM_144672chr16--1185 ----
NM_144691chr19169 ------
NM_144710chr21344 --11502 --
NM_144767chr1523741 976 --21538 1014 1280
NM_144949chr212525 ------
NM_144967chrX1249 ------
NM_144973chr1221838 35 --14023 --
NM_144982chr121601 ------
NM_145055chr1832383 794 442 1891 ----
NM_145065chr112437 260 ------
NM_145109chr173756 697 357 ------
NM_145112chr14--21295 898 ----
NM_145113chr14--21567 1170 ----
NM_145117chr1152282 2241 1332 1251 1148 ------
NM_145159chr141885 --1646 1822
NM_145165chr1411943 --1666 --
NM_145185chr1942000 1857 612 371 ------
NM_145203chr131885 ----1965
NM_145206chr1022521 771 1851 ----
NM_145251chr14--1279 ----
NM_145259chr227096 4443 ------
NM_145260chr21561 ------
NM_145279chr121807 725 ------
NM_145285chr102509 96 ------
NM_145659chr16----178 --
NM_145690chr811603 ------
NM_145728chr152396 313 ------
NM_145798chr172783 226 ------
NM_145800chrX1778 ------
NM_145802chrX1727 ------
NM_145805chr152392 94 --135 --
NM_145808chr712158 --12564 --
NM_145861chr131965 1945 1712 ------
NM_145912chr2254100 3958 3944 3908 308 --11203 14538
NM_147193chr12290 50 ------
NM_147202chr912315 --2635 126 --
NM_148571chr1721650 388 ------
NM_148894chr4--11076 ----
NM_152240chr311220 ------
NM_152247chr222701 273 ------
NM_152261chr1212036 ------
NM_152263chr175914 5786 5105 2447 1257 1159 71 --15230 --
NM_152265chr1----11421 --
NM_152271chr81192 ------
NM_152280chr122205 615 --12820 --
NM_152283chr51863 ------
NM_152289chr1931573 1180 534 ------
NM_152344chr171983 ------
NM_152374chr121692 1177 11110 ----
NM_152375chr12386 276 --12425 --
NM_152388chr212567 --13541 --
NM_152409chr5----13260 --
NM_152414chr82105 88 --11503 --
NM_152424chrX44047 3871 1647 1232 --14086 --
NM_152470chr1822861 502 --166 --
NM_152538chr341836 1352 1284 454 ------
NM_152545chr4182 ------
NM_152609chr111197 ------
NM_152622chr51899 ------
NM_152629chr922595 432 ------
NM_152641chr1212599 ------
NM_152652chr161197 ------
NM_152713chr11----130 --
NM_152723chr111883 ------
NM_152724chr102865 760 ------
NM_152739chr71181 ------
NM_152744chr753040 2756 1095 1044 197 ------
NM_152756chr51630 1931 ----
NM_152758chr8--1146 ----
NM_152787chrX11084 1848 ----
NM_152789chr7----1455 --
NM_152835chr122401 326 ------
NM_152838chr201541 --13164 13373
NM_152857chr61211 ------
NM_152858chr61211 ------
NM_152860chr1211094 --1162 --
NM_152862chr2--1170 ----
NM_152924chr1556462 6355 4842 2669 1840 16265 ----
NM_152988chr1921554 148 --1275 --
NM_152989chr1231602 1585 639 ------
NM_153020chr6--11486 ----
NM_153029chr1674084 4000 3932 3551 3493 3390 3166 --24142 2702 --
NM_153050chr2234957 3767 1835 ------
NM_153051chr2234957 3767 1835 ------
NM_153183chrX--1862 ----
NM_153235chr61649 ------
NM_153261chr161400 ------
NM_153262chr1------1721
NM_153266chr113851 831 722 ------
NM_153267chr91374 ------
NM_153273chr322715 700 --12607 --
NM_153334chr22----141 --
NM_153350chr163665 263 87 ------
NM_153367chr1063763 3496 3305 2426 1351 545 --2930 110 --
NM_153371chr13128 ------
NM_153426chr4135 ------
NM_153427chr4135 ------
NM_153453chr61416 ------
NM_153464chr19--1655 ----
NM_153487chr684733 4322 3964 3444 3066 360 204 32 ------
NM_153498chr10--1247 195 --
NM_153499chr12----21968 122 --
NM_153500chr12----21968 122 --
NM_153607chr522478 882 12267 ----
NM_153616chr152417 409 ------
NM_153617chr152417 409 ------
NM_153618chr152417 409 ------
NM_153620chr71335 ------
NM_153631chr721409 159 ------
NM_153632chr721409 159 ------
NM_153633chr12--1755 ----
NM_153685chr12----2253 124 --
NM_153689chr211741 ------
NM_153757chr41434 ------
NM_153759chr22960 175 --1411 --
NM_153809chr91601 ------
NM_153827chr171654 ------
NM_170662chr32492 106 ------
NM_170663chr171654 ------
NM_170664chr16--1185 ----
NM_170665chr1244397 3525 1808 1663 1878 ----
NM_170679chr511178 1366 ----
NM_170696chr1521204 399 ------
NM_170697chr1521204 399 ------
NM_170706chr1190 ------
NM_170710chr41718 ------
NM_170711chr192754 656 ------
NM_170751chr61434 11209 ----
NM_170752chr61434 11209 ----
NM_170782chr11417 ------
NM_171825chr522376 1982 ----11196
NM_172020chr741691 1285 811 779 --1542 --
NM_172058chr8171 ------
NM_172059chr8171 ------
NM_172060chr8171 ------
NM_172070chr2----11423 --
NM_172071chr136738 2931 1833 ------
NM_172169chr102731 518 --151 --
NM_172170chr102731 518 --151 --
NM_172171chr102731 518 --151 --
NM_172173chr102731 518 --151 --
NM_172201chr211108 ------
NM_172216chr12----21870 24 --
NM_172226chr12----21968 122 --
NM_172230chr1121096 48 ------
NM_172337chr141938 ------
NM_172344chr2123 ------
NM_173054chr7168 ------
NM_173076chr21677 ------
NM_173078chrX1385 ------
NM_173156chr132071 167 111 ------
NM_173171chr211000 ------
NM_173172chr211308 ------
NM_173173chr211000 ------
NM_173174chr83735 120 65 ------
NM_173175chr83735 120 65 ------
NM_173176chr83735 120 65 ------
NM_173198chr922876 185 ------
NM_173199chr9158 ------
NM_173200chr922876 185 ------
NM_173201chr162268 198 ------
NM_173214chr16--18252 ----
NM_173359chr311396 --1129 --
NM_173454chr1511185 1896 ----
NM_173469chr1511555 ------
NM_173475chr162437 295 ------
NM_173492chr9181 ------
NM_173500chr15--1109 ----
NM_173508chr11148 ------
NM_173515chr6150 ------
NM_173517chr71163 ------
NM_173552chr32381 121 ------
NM_173576chr101260 ------
NM_173582chr11--1344 24575 4106 --
NM_173595chr1244548 4532 1532 767 ------
NM_173624chr17162 ------
NM_173642chr137757 2526 716 --16337 --
NM_173647chr221090 897 ------
NM_173683chr8--163 ----
NM_173694chrX--12454 ----
NM_173849chr14391 76 50 ------
NM_173854chr122318 587 ------
NM_174856chr202298 110 ----127
NM_174916chr151686 1859 1435 --
NM_175061chr711832 1612 ----
NM_175607chr31454 ------
NM_175612chr31454 ------
NM_175629chr22960 175 --1411 --
NM_175733chr1112193 ------
NM_175736chr1267654 6259 5987 5420 2652 1914 ----27439 5483
NM_175747chr62919 397 ------
NM_175847chr1921488 165 ------
NM_175852chr121899 225 1133 12856 1189
NM_175854chr131128 ------
NM_175861chr1234303 1580 68 ------
NM_175898chr1551330 368 362 79 69 ------
NM_175900chr16140 ------
NM_176823chr133759 1344 879 ------
NM_176871chr823123 2461 ------
NM_177424chr1--1328 ----
NM_177438chr1443041 2975 1507 644 ------
NM_177559chr2011174 ------
NM_177560chr2011174 ------
NM_177947chrX1221 ------
NM_177948chrX1221 ------
NM_177968chr21591 ------
NM_177976chr31115 ------
NM_177983chr21341 ------
NM_177996chr2032182 506 343 13074 1204 --
NM_178010chr1231602 1585 639 ------
NM_178026chr20----1513 --
NM_178138chr91313 ------
NM_178151chrX47766 6988 1608 1203 17804 ----
NM_178152chrX47766 6988 1608 1203 17804 ----
NM_178153chrX47766 6988 1608 1203 17804 ----
NM_178427chr11747 ------
NM_178441chr14----1347 21090 200
NM_178450chr51468 ------
NM_178454chr11653 ------
NM_178500chr172708 135 --3752 696 673 --
NM_178554chr332628 1212 295 12929 11188 --
NM_178557chr431723 331 221 ------
NM_178584chr21344 --11502 --
NM_178585chr432079 967 314 ------
NM_178820chr19--122 ----
NM_178860chr17276 49 ------
NM_178864chr113660 588 239 ------
NM_181050chr16----178 --
NM_181265chr41718 ------
NM_181442chr20--1656 ----
NM_181458chr2----149 --
NM_181505chr172546 97 ------
NM_181521chr1625508 35 --35413 5304 1871 --
NM_181571chr101260 --1795 --
NM_181659chr2031201 941 329 13355 ----
NM_181659chr2031201 941 329 13355 ----
NM_181670chr12268 34 --125 --
NM_181689chr203888 711 110 ------
NM_181715chr1----1358 --
NM_181746chr12974 136 ------
NM_181762chrX1132 1220 ----
NM_181777chrX1132 1220 ----
NM_181784chr23447 256 230 ------
NM_181832chr2222661 390 --135 --
NM_181836chr51253 --1276 --
NM_181838chr511592 ------
NM_181897chr31396 ------
NM_182485chr41879 1524 ----
NM_182511chr1811302 ------
NM_182526chr1412098 1447 21182 828 --
NM_182540chrX1659 ------
NM_182557chr1121692 413 ------
NM_182580chr122547 102 ------
NM_182641chr171647 ------
NM_182643chr8--12179 ----
NM_182645chr61416 ------
NM_182646chr41879 1524 ----
NM_182688chr2122022 1920 1111 ----
NM_182691chr721421 1317 ------
NM_182692chr721421 1317 ------
NM_182706chr8162 ------
NM_182717chr1011064 --11200 --
NM_182718chr101260 --1795 --
NM_182719chr101260 --1795 --
NM_182720chr1011064 --11200 --
NM_182721chr1011064 --11200 --
NM_182722chr1011064 --11200 --
NM_182723chr1011064 --11200 --
NM_182724chr101260 --1795 --
NM_182725chr101260 --1795 --
NM_182734chr2053014 2612 899 775 522 ------
NM_182757chr642958 959 93 79 ------
NM_182762chr735378 4328 2197 ------
NM_182764chr201271 ------
NM_182767chr1211475 1812 ----
NM_182769chr101260 --1795 --
NM_182770chr101260 --1795 --
NM_182771chr101260 --1795 --
NM_182772chr101260 --1795 --
NM_182796chr51138 1328 ----
NM_182811chr204971 400 232 106 ------
NM_182830chr141865 ------
NM_182850chr101260 --1795 --
NM_182853chr1011064 --11200 --
NM_182895chr22----141 --
NM_182917chr31342 ------
NM_182943chr32973 947 ------
NM_182964chr1152282 2241 1332 1251 1148 ------
NM_183011chr1011064 --11200 --
NM_183012chr1011064 --11200 --
NM_183013chr1011064 --11200 --
NM_183060chr101260 --1795 --
NM_183078chr612512 --12620 --
NM_183079chr2021253 995 ------
NM_183380chr61732 ------
NM_183415chr121467 ------
NM_183425chr2031128 165 81 --2586 563 --
NM_194247chr223455 551 ------
NM_194248chr21902 ------
NM_194250chr2--1439 ----
NM_194278chr1451379 1324 1119 696 105 --1229 --
NM_194282chr432778 1174 968 ------
NM_194291chr822991 1971 ------
NM_194301chr141924 ------
NM_194317chr212416 --11820 --
NM_194322chr21902 ------
NM_194429chr6----1113 --
NM_197941chr522053 1177 ----196
NM_197970chr2155 ------
NM_198057chrX1885 ------
NM_198074chr12469 265 --1452 --
NM_198123chr8----11457 --
NM_198124chr8----11457 --
NM_198148chr10--11037 ----
NM_198158chr332367 1084 26 ------
NM_198159chr332367 1084 26 ------
NM_198177chr332367 1084 26 ------
NM_198178chr332367 1084 26 ------
NM_198215chr10171 ------
NM_198217chr131700 ------
NM_198218chr131700 ------
NM_198219chr131700 ------
NM_198240chr12144 ------
NM_198241chr31342 ------
NM_198242chr31342 ------
NM_198243chr15----166 --
NM_198244chr31342 ------
NM_198261chr12191 ------
NM_198262chr12191 ------
NM_198264chr1181 ------
NM_198270chrX13263 ----12293
NM_198282chr5----1113 --
NM_198321chr523084 2080 --12348 --
NM_198324chr1211052 ------
NM_198390chr16----11864 --
NM_198391chr20--11174 --1267
NM_198395chr52340 271 ------
NM_198401chr821479 317 ------
NM_198490chr352731 2461 2321 833 43 --11199 --
NM_198503chr122306 41 ------
NM_198513chr831869 1566 1396 ------
NM_198527chr151401 ------
NM_198563chr31138 ------
NM_198597chr10--1733 ----
NM_198679chr941969 1867 975 665 --12480 --
NM_198681chr131226 1053 223 ------
NM_198793chr312644 --11121 --
NM_198829chr711258 --1110 --
NM_198859chr331522 505 62 ------
NM_198896chr111385 ------
NM_198900chr1267654 6259 5987 5420 2652 1914 ----27439 5483
NM_198935chr2022241 634 11157 ----
NM_198993chr1731713 50 33 --11559 --
NM_199040chr1253783 2661 1465 1169 67 191 ----
NM_199141chr191245 --1947 --
NM_199169chr20--21224 189 12297 --
NM_199170chr20--21224 189 12297 --
NM_199171chr20--21224 189 12297 --
NM_199183chr3130 ------
NM_199189chr51274 ------
NM_199205chr8166 ------
NM_199324chr422875 1005 ------
NM_199327chr41930 ------
NM_199355chr161428 1514 ----
NM_199424chr1621756 134 ------
NM_199436chr22642 209 12837 ----
NM_199454chr11824 1529 44155 3847 3133 281 --
NM_199478chrX2713 146 ------
NM_201267chr2182 ------
NM_201269chr11376 ------
NM_201403chr121807 725 ------
NM_201432chr1755221 4661 4352 4001 295 ------
NM_201433chr1755221 4661 4352 4001 295 ------
NM_201568chr132071 167 111 ------
NM_201569chr132071 167 111 ------
NM_201570chr1011405 ------
NM_201571chr1011405 ------
NM_201572chr1011405 ------
NM_201575chr161448 ------
NM_201590chr1011405 ------
NM_201591chr4--11926 ----
NM_201592chr4--11926 ----
NM_201593chr1011405 ------
NM_201596chr1011405 ------
NM_201597chr1011405 ------
NM_201599chrX11028 ------
NM_201999chr41428 ------
NM_203304chr191275 ------
NM_203316chr11188 ------
NM_203327chr2083262 1548 471 422 306 211 179 56 13832 22849 971 --
NM_203344chr192410 151 ------
NM_203351chr1722474 1776 ------
NM_203390chr8--1174 137 --
NM_203404chr11116 ------
NM_203454chr111039 11223 ----
NM_203487chr13--11801 ----
NM_203504chr411877 ------
NM_203505chr411877 ------
NM_203506chr1712151 --12069 --
NM_205768chr111505 ------
NM_205861chr122047 698 11382 ----
NM_206594chr111415 ------
NM_206595chr111415 ------
NM_206819chr12--161 ----
NM_206820chr12--161 ----
NM_206821chr12--161 ----
NM_206853chr632905 2557 114 ------
NM_206854chr634166 3818 1375 ------
NM_206855chr635131 4783 2340 ------
NM_206876chr21848 ------
NM_206909chr836319 5652 2208 --12967 --
NM_207009chr102342 188 ------
NM_207012chr1033277 1330 667 ------
NM_207111chr731813 1053 609 --1246 --
NM_207116chr731813 1053 609 --1246 --
NM_207123chr42682 263 ------
NM_207303chr1032899 2531 1502 ------
NM_207305chr9148 --1179 --
NM_207317chr51162 ------
NM_207325chr19--11973 11300 --
NM_207343chr111447 ------
NM_207371chr10--11180 ----
NM_207406chr435991 2121 1885 --12314 --
NM_207518chr19--11197 1107 --
NM_213589chr255338 5278 3809 1739 1263 ----14273
NM_213594chr121448 ------
NM_213606chr102617 228 ------
NM_213609chr31105 ------
NM_213618chr11----135 --
NM_213662chr1721861 558 --11649 --