TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4740-3p
miRNA Sequence: GCCCGAGAGGAUCCGUCCCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51944 ------
NM_000037chr82824 187 11730 --135
NM_000051chr1143295 2260 1147 225 ------
NM_000053chr1331848 243 209 ------
NM_000081chr121152 678 ------
NM_000138chr1521960 731 ------
NM_000210chr242293 1812 1675 572 ------
NM_000217chr1214586 14638 --14689
NM_000262chr2221148 183 11561 ----
NM_000264chr921161 904 13026 ----
NM_000314chr101496 --12169 --
NM_000332chr646744 4527 1158 1035 ------
NM_000555chrX45146 4972 2278 1872 15715 17688 --
NM_000599chr223930 727 ------
NM_000611chr1147006 2613 1167 732 16106 --1269
NM_000615chr1122891 1146 ------
NM_000618chr1275358 4855 4182 2286 1244 444 360 ------
NM_000618chr1275358 4855 4182 2286 1244 444 360 ------
NM_000719chr1232660 1675 754 ------
NM_000723chr1731590 326 137 --1565 --
NM_000814chr1533719 2651 553 --13770 --
NM_000827chr542500 2092 38 25 ------
NM_000829chr11----1235 --
NM_000831chr185837 4727 2051 1981 1463 1353 183 95 11650 ----
NM_000872chr10------177
NM_000875chr1535950 5394 2181 --11780 --
NM_000912chr8--136 ----
NM_000959chr133908 2891 1107 ------
NM_000960chr19140 1528 ----
NM_001001323chr1222735 2287 ----12319
NM_001001436chr161560 1153 ----
NM_001001549chr731017 286 280 ------
NM_001001550chr731017 286 280 ------
NM_001001555chr731017 286 280 ------
NM_001001557chr821393 711 ------
NM_001001665chr243229 3176 3067 2246 12738 12515 --
NM_001001995chrX121 ------
NM_001002032chr171225 --178 --
NM_001002033chr172325 86 --1178 --
NM_001002257chr233446 935 239 ------
NM_001002811chr131529 105 48 1135 31458 983 566 --
NM_001002812chr131529 105 48 1135 31458 983 566 --
NM_001002812chr131529 105 48 1135 31458 983 566 --
NM_001002814chr833160 548 464 32432 1217 1185 ----
NM_001002909chr1731959 631 59 ------
NM_001002919chr21442 ------
NM_001003406chr2233010 1323 954 ------
NM_001003681chr222689 300 1246 ----
NM_001003800chr933265 1350 830 ------
NM_001005158chr31405 --1136 --
NM_001005159chr31405 --1136 --
NM_001005271chr171104 ----1920
NM_001005273chr171104 ----1920
NM_001005386chr2--1419 1145 11729
NM_001005404chr1734239 3639 1587 12904 11134 --
NM_001005505chr321667 1480 1154 ----
NM_001005609chrX33646 2939 724 --1420 --
NM_001006115chr32959 842 22187 1118 22589 450 --
NM_001006610chr162874 93 ------
NM_001007024chr1744322 3173 696 519 11516 ----
NM_001007025chr1744322 3173 696 519 11516 ----
NM_001007156chr151627 --11497 --
NM_001008495chr811723 ------
NM_001008541chr1042275 1736 1441 462 ------
NM_001008541chr1042275 1736 1441 462 ------
NM_001008701chr1963128 2928 2732 1897 693 627 ------
NM_001008744chr141574 1291 --1363
NM_001009552chr81123 ----1469
NM_001009899chr345594 4587 2177 2040 --12523 --
NM_001009993chr264329 3983 3156 3060 2852 636 14013 13280 --
NM_001010861chr122544 2505 ------
NM_001011537chr332181 2081 1456 ------
NM_001011666chr736291 6066 582 1213 ----
NM_001011713chr1421068 1062 --11144 --
NM_001012393chr1124137 85 ----11262
NM_001013031chr1022540 337 ------
NM_001013438chr31958 ------
NM_001013439chr31804 ------
NM_001014797chr1027497 2037 27514 1029 12960 16869
NM_001014809chr41770 ------
NM_001017368chr1752719 295 250 236 180 ----1786
NM_001017395chr32481 211 1243 22687 1235 --
NM_001017440chr736886 5957 315 37781 5197 3181 12801 --
NM_001017989chr193122 62 24 ------
NM_001017995chr574679 4009 3477 3039 1947 169 159 ----1663
NM_001018008chr152470 23 ------
NM_001018054chr121046 902 ------
NM_001018065chr945411 5302 4784 2334 --1538 --
NM_001018066chr945411 5302 4784 2334 --1538 --
NM_001024455chrX32427 733 233 12607 12534 --
NM_001024649chr532025 740 330 1760 ----
NM_001024808chr1261985 741 506 495 271 224 --190 --
NM_001024948chr111167 ------
NM_001025076chr1035937 2239 1556 15645 ----
NM_001025077chr1037295 2914 193 17003 24912 1229 --
NM_001025233chr122794 752 1558 1427 --
NM_001025266chr374110 4036 3779 1646 882 360 313 --13258 13689
NM_001025366chr621309 249 ----139
NM_001025366chr621309 249 ----139
NM_001025367chr621309 249 ----139
NM_001025367chr621309 249 ----139
NM_001025368chr621309 249 ----139
NM_001025368chr621309 249 ----139
NM_001025369chr621325 265 ----155
NM_001025369chr621325 265 ----155
NM_001025370chr621309 249 ----139
NM_001025370chr621309 249 ----139
NM_001025580chrX33973 3031 70 ------
NM_001029859chr1122298 61 12167 1569 --
NM_001030006chr1722352 2239 ----22652 1988
NM_001030055chr1413749 1510 1840 14617
NM_001032221chr92453 362 ------
NM_001032296chr1322706 467 ------
NM_001032380chr1011892 --1116 --
NM_001032999chr2064752 4442 1428 853 498 52 13895 ----
NM_001033081chr131546 271 168 --21806 495 --
NM_001033082chr131546 271 168 --21806 495 --
NM_001033117chr324027 1428 13634 ----
NM_001033551chr1733606 3442 1233 --23225 1341 12818
NM_001034837chr5------1102
NM_001034838chr5------1102
NM_001034841chr1634438 3603 1773 --34480 1826 1253 --
NM_001034915chr83560 501 354 ------
NM_001037132chr72743 618 ------
NM_001037133chr72743 618 ------
NM_001037174chr21778 --11409 --
NM_001037317chr122544 2505 ------
NM_001037331chr18------1384
NM_001037339chr1----1552 1313
NM_001037340chr1----1552 1313
NM_001037341chr1----1552 1313
NM_001037341chr1----1552 1313
NM_001039479chr1472262 1887 1760 1590 1559 847 634 --22192 2082 --
NM_001039538chr223383 50 ------
NM_001039585chr144165 3148 1364 84 ------
NM_001039690chr1651684 1623 949 701 172 --3963 769 355 --
NM_001039709chr2064752 4442 1428 853 498 52 13895 ----
NM_001039762chr1022256 1680 ------
NM_001040144chr1651684 1623 949 701 172 --3963 769 355 --
NM_001040146chr1651684 1623 949 701 172 --3963 769 355 --
NM_001040152chr724341 1616 ------
NM_001040157chr442731 933 751 420 ------
NM_001040424chr2142708 1879 1873 22 1317 12902 --
NM_001040446chr52773 331 1136 ----
NM_001040712chr913191 ------
NM_001042357chr102173 115 ------
NM_001042358chr102173 115 ------
NM_001042360chr102173 115 ------
NM_001042361chr102204 146 ------
NM_001042363chr102173 115 ------
NM_001042364chr102204 146 ------
NM_001042365chr102204 146 ------
NM_001042387chr102204 146 ------
NM_001042388chr18----190 1795
NM_001042389chr102173 115 ------
NM_001042390chr102173 115 ------
NM_001042392chr102173 115 ------
NM_001042393chr102204 146 ------
NM_001042395chr102173 115 ------
NM_001042396chr102204 146 ------
NM_001042397chr102204 146 ------
NM_001042404chr11110 --1601 --
NM_001042465chr1041001 374 338 22 ------
NM_001042466chr1041001 374 338 22 ------
NM_001042517chr131731 1834 ----
NM_001042537chrX22246 2160 1412 ----
NM_001042595chr193419 330 110 ------
NM_001042599chr223107 1491 ----17723
NM_001042603chr1214028 --35139 885 761 15028
NM_001042604chr323536 3193 ----1918
NM_001042681chr122410 2086 --2280 45 --
NM_001042682chr122410 2086 --2280 45 --
NM_001042682chr122410 2086 --2280 45 --
NM_001043318chr1432671 948 159 21070 733 12696 --
NM_001044305chr621519 1440 ------
NM_001092chr1721736 427 1260 ----
NM_001106chr397187 3899 3436 2320 2254 2109 1018 873 688 11976 11843 --
NM_001116chr1652337 1228 1201 748 402 ----1285
NM_001122679chr51944 ------
NM_001167chrX45574 1523 1461 775 14192 ----
NM_001173chr1413749 1510 1840 14617
NM_001186chr2112752 12888 ----
NM_001222chr101302 21553 573 ----
NM_001256chr1741136 702 626 364 ------
NM_001271chr151185 ----1567
NM_001280chr191123 ------
NM_001282chr1722352 2239 ----22652 1988
NM_001313chr41770 ------
NM_001332chr521587 315 ------
NM_001346chr342251 2206 2118 543 1150 1623 --
NM_001356chrX21650 408 --11940 --
NM_001364chr1143880 3002 2911 1445 --12954 --
NM_001396chr2131134 507 325 ------
NM_001399chrX33646 2939 724 --1420 --
NM_001417chr1231450 779 465 ------
NM_001420chr1952873 1165 364 299 262 12602 12571 --
NM_001438chr122784 2383 11335 ----
NM_001453chr621625 282 ------
NM_001491chr622133 653 ----12738
NM_001493chrX2542 176 1144 ----
NM_001543chr52963 649 11841 11666 --
NM_001659chr1222391 345 ----1296
NM_001662chr71348 ------
NM_001664chr31775 ------
NM_001678chr1731736 1457 520 ------
NM_001682chr1232449 2001 1012 ----12033
NM_001693chr831122 459 73 ------
NM_001718chr621247 389 ------
NM_001746chr532025 740 330 1760 ----
NM_001759chr1234967 4634 3213 12080 ----
NM_001781chr12------1130
NM_001798chr1231017 132 73 ------
NM_001843chr12--1169 ----
NM_001845chr1311090 ------
NM_001859chr932891 1584 949 13737 13444 --
NM_001901chr611004 ------
NM_001954chr63743 691 294 ------
NM_001969chr1433436 1390 396 11179 --13319
NM_001987chr1233261 703 551 2977 966 1714 --
NM_001995chr421420 132 ------
NM_002009chr1522613 1102 ----11822
NM_002024chrX1563 --11673 --
NM_002025chrX28443 1494 --18887 --
NM_002026chr21730 ------
NM_002062chr62484 316 11079 --11474
NM_002092chr444590 3979 1799 64 172 ----
NM_002126chr1743465 2581 1601 946 ------
NM_002130chr51449 1163 ----
NM_002207chr3198 ------
NM_002232chr11458 ------
NM_002264chr334063 3378 1442 ------
NM_002270chr535153 594 50 14409 ----
NM_002293chr121767 893 12097 ----
NM_002319chr72673 401 ------
NM_002353chr12233 43 ------
NM_002356chr622297 899 ------
NM_002359chr1763765 3200 3169 1537 1495 1454 ------
NM_002373chr1531034 992 134 ------
NM_002374chr223383 50 ------
NM_002427chr1121105 896 ------
NM_002430chr223957 324 315 ------
NM_002480chr121109 ------
NM_002481chr157496 6599 6322 6101 1689 16224 ----
NM_002486chr932278 768 387 11825 ----
NM_002501chr1943674 2655 678 255 21356 1152 ----
NM_002545chr1124137 85 ----11262
NM_002569chr153485 143 42 ----180
NM_002572chr111343 ----1297
NM_002581chr9--2825 462 14865 --
NM_002588chr521493 476 1137 ----
NM_002591chr201619 --1491 --
NM_002600chr1----1552 1313
NM_002613chr1625175 2093 ------
NM_002655chr844642 4457 1429 504 ------
NM_002698chr1922864 2239 ------
NM_002699chr131451 582 321 ------
NM_002714chr62787 141 --11050 --
NM_002730chr191465 ------
NM_002745chr2244265 3603 582 98 --12957 --
NM_002755chr151223 ----1361
NM_002778chr1041001 374 338 22 ------
NM_002815chr17158 1195 ----
NM_002834chr1233097 3060 1525 21613 1398 ----
NM_002839chr913191 ------
NM_002843chr1143274 3174 2151 423 12446 ----
NM_002850chr1921010 781 ------
NM_002868chr1222285 221 --12142 --
NM_002874chr932059 563 79 11743 ----
NM_002906chr1111493 ------
NM_002959chr123727 724 ------
NM_002994chr411756 --1497 --
NM_003010chr1732334 1536 421 ------
NM_003012chr832686 682 35 --1800 --
NM_003029chr141225 1121 522 482 ----168
NM_003031chr162874 93 ------
NM_003051chr11616 ----1669
NM_003074chr3----184 11764
NM_003076chr1241465 1125 443 92 --1549 --
NM_003108chr245054 2691 2063 30 21915 56 ----
NM_003130chr71423 ----11123
NM_003150chr1721991 1470 1763 ----
NM_003155chr822496 2039 ------
NM_003156chr111159 --1369 --
NM_003161chr1733589 1209 640 ------
NM_003168chr174843 825 741 734 ------
NM_003199chr1824916 1739 ------
NM_003200chr1972025 1523 1477 962 910 857 295 11908 11633 --
NM_003221chr632955 1042 598 --11653 --
NM_003236chr21179 1768 ----
NM_003274chr2111016 1571 ----
NM_003275chr9------11143
NM_003281chr145411 3330 1816 439 33484 500 447 ----
NM_003298chr312277 ----15900
NM_003342chr1722995 716 12302 ----
NM_003344chr751109 691 446 397 171 ------
NM_003348chr1221505 1115 ------
NM_003356chr1121019 900 1807 --11078
NM_003371chr9--21438 492 --2680 39
NM_003376chr621309 249 ----139
NM_003376chr621309 249 ----139
NM_003388chr731690 779 383 22061 1920 ----
NM_003392chr311596 ----1483
NM_003394chr123719 650 94 ----1513
NM_003412chr321223 420 ------
NM_003478chr112460 50 ------
NM_003489chr2122197 564 ------
NM_003507chr211331 ----1646
NM_003559chr1773701 3224 2921 2509 1276 763 314 ------
NM_003566chr1252380 859 558 184 74 --1647 --
NM_003574chr182713 440 ----13737
NM_003576chr1322706 467 ------
NM_003590chr233018 1130 30 1232 11513 --
NM_003597chr23802 285 105 1172 ----
NM_003618chr21966 --1402 --
NM_003629chr163121 2792 2690 2580 2517 2245 22506 521 ----
NM_003644chr1744431 1856 754 21 11307 15863 16056
NM_003648chr242461 2077 1712 778 ------
NM_003713chr131291 1161 1123 --11099 --
NM_003722chr312489 ----11805
NM_003735chr521493 476 1137 ----
NM_003736chr521493 476 1137 ----
NM_003766chr17180 ------
NM_003825chr15185 ------
NM_003831chr1821807 315 ------
NM_003872chr232386 2091 1226 ------
NM_003885chr1721953 1078 ------
NM_003902chr11765 ------
NM_003924chr421311 1128 --2654 365 --
NM_003966chr557592 4803 2757 2538 526 22202 1299 17103 --
NM_004040chr21518 ------
NM_004093chr1321037 452 ------
NM_004136chr1532380 2263 832 ------
NM_004156chr81123 ----1469
NM_004172chr511807 ------
NM_004210chr1012139 11859 140 11828
NM_004225chr821404 1254 ------
NM_004232chr181774 --3935 551 173 --
NM_004242chr6------143
NM_004263chr241676 1538 410 169 --1291 --
NM_004293chr923617 2691 ----1105
NM_004302chr1232792 1871 393 1335 1982 11076
NM_004370chr621391 870 ------
NM_004380chr1631665 953 39 --12441 1481
NM_004386chr1952293 2019 1707 552 189 ------
NM_004397chr1124299 3515 ------
NM_004417chr5--1196 ----
NM_004420chr112698 566 ------
NM_004423chr3----1825 --
NM_004428chr11789 --173 --
NM_004430chr832520 771 631 ------
NM_004433chr131802 443 201 11383 ----
NM_004437chr133074 2301 1366 33285 2864 365 12441 --
NM_004443chr3272 64 ------
NM_004449chr2121223 1053 ----1157
NM_004540chr21------196
NM_004543chr2159 ------
NM_004560chr93907 413 25 --1717 --
NM_004630chr1131144 866 207 1174 --1808
NM_004631chr121046 902 ------
NM_004655chr1731019 246 59 1151 ----
NM_004660chrY21594 539 1642 ----
NM_004723chr1163 ----1131
NM_004725chr101481 ----1562
NM_004726chrX33736 3589 1895 ----25284 1105
NM_004737chr221102 ------
NM_004745chr845860 5789 2411 553 --16206 --
NM_004747chr101308 ------
NM_004772chr511118 ------
NM_004792chr2135 ------
NM_004807chr21755 --22172 32 12480
NM_004824chr621338 1062 1516 ----
NM_004840chrX1188 --12150 --
NM_004845chrX33859 3029 1129 11575 --1149
NM_004859chr1732910 2719 239 --12623 --
NM_004871chr1744322 3173 696 519 11516 ----
NM_004884chr1521728 1553 11676 1134 11657
NM_004904chr736291 6066 582 1213 ----
NM_004961chrX1412 ------
NM_004978chr121449 107 162 11106 --
NM_004979chrX2317 93 --21064 928 --
NM_004991chr3157 ------
NM_004992chrX78205 7839 6061 3198 2958 1428 400 ------
NM_004992chrX78205 7839 6061 3198 2958 1428 400 ------
NM_005010chr72743 618 ------
NM_005045chr72398 366 ------
NM_005056chr1214272 --35383 1129 1005 15272
NM_005087chr31804 ------
NM_005093chr2064752 4442 1428 853 498 52 13895 ----
NM_005114chr4------1637
NM_005116chr2083862 1770 1650 1490 1321 845 688 672 ----13167
NM_005121chr1721367 146 ------
NM_005126chr3--1448 --1607
NM_005134chr18----190 1795
NM_005156chr924473 812 ------
NM_005157chr921858 1791 --11890 1523
NM_005178chr19124 1114 ----
NM_005188chr1167002 6302 5051 2398 1801 643 17102 ----
NM_005197chr1424291 4269 --11535 13960
NM_005224chr19----2638 602 --
NM_005235chr223107 1491 ----17723
NM_005277chr41405 ------
NM_005311chr731017 286 280 ------
NM_005349chr4------196
NM_005359chr1836029 5902 2486 14779 11120 --
NM_005375chr61166 153 ----
NM_005387chr112527 443 ------
NM_005402chr721321 382 --1269 --
NM_005413chr21368 ------
NM_005436chr1044035 3734 3669 974 ------
NM_005453chr6------135
NM_005465chr1------11480
NM_005487chr222689 300 1246 ----
NM_005497chr1745722 5123 2462 568 25636 5300 ----
NM_005506chr422044 1038 1467 ----
NM_005519chr10----1176 --
NM_005520chr52667 147 ------
NM_005552chr141170 ------
NM_005561chr133937 868 759 ------
NM_005578chr345080 4376 3876 513 ----14113
NM_005596chr924493 658 ----15749
NM_005597chr19184 ----1268
NM_005604chr622008 667 ------
NM_005618chr61531 ------
NM_005668chr513441 1383 11774 --
NM_005669chr511782 ----22279 1696
NM_005722chr2--1419 1145 11729
NM_005723chr4------150
NM_005734chr111114 ------
NM_005737chr22560 492 ------
NM_005742chr21300 ----141
NM_005746chr722570 694 ------
NM_005754chr52828 80 ------
NM_005779chr52931 923 12373 ----
NM_005802chr91250 ------
NM_005828chr1744462 3922 1913 1458 13129 11485 --
NM_005840chrX35875 5194 2265 ------
NM_005852chr171104 ----1920
NM_005895chr1233632 2659 232 14150 --14075
NM_005898chr1143011 2507 2381 938 ------
NM_005910chr1743519 3246 2971 1566 1166 23427 3093 11036
NM_005933chr1132892 1172 1047 --1772 --
NM_005935chr455077 4839 4140 1667 889 131 13633 --
NM_005955chr155238 3966 1912 816 774 ------
NM_005962chr1042275 1736 1441 462 ------
NM_005962chr1042275 1736 1441 462 ------
NM_005964chr1721383 73 ------
NM_005986chr1332387 672 216 ------
NM_006007chr911043 13214 11066 --
NM_006030chr321667 1480 1154 ----
NM_006037chr254700 3220 3142 1802 105 ------
NM_006038chr20----151 --
NM_006054chr1121633 1249 ------
NM_006086chr16----1258 --
NM_006095chr41406 ----13187
NM_006141chr1612051 ----1400
NM_006148chr1742016 699 437 214 12891 12045 12037
NM_006224chr173706 407 90 ------
NM_006237chr131252 ------
NM_006315chr443881 3014 949 45 11411 ----
NM_006350chr51271 ------
NM_006359chrX22246 2160 1412 ----
NM_006371chr333691 1665 30 --1302 --
NM_006375chrX11699 124 11692 --
NM_006454chr452741 2594 2566 1130 929 --1592 --
NM_006459chr10----11933 --
NM_006464chr231432 1192 763 11304 11482 --
NM_006544chr1421308 337 15403 ----
NM_006546chr1745038 973 432 219 26389 4868 ----
NM_006561chr1035937 2239 1556 15645 ----
NM_006729chrX45160 4196 3777 3691 ----13424
NM_006766chr812255 ------
NM_006805chr531320 150 119 ------
NM_006826chr22423 180 ------
NM_006852chr172935 186 1995 ----
NM_006885chr1624025 3333 ------
NM_006887chr22465 190 ------
NM_006888chr1422851 2194 ------
NM_006914chr92451 265 ------
NM_006924chr1754169 4140 3747 3049 2969 ------
NM_006931chr1221587 297 11870 ----
NM_006946chr111565 ------
NM_007011chr1534798 4243 147 25555 470 ----
NM_007050chr2066824 6505 2887 2017 797 331 15321 2996 448 --
NM_007067chr171193 --11247 --
NM_007114chr3------12791
NM_007174chr1231946 1899 755 --1893 --
NM_007249chr1338482 1360 1117 --18792 --
NM_007308chr41174 ------
NM_007313chr921858 1791 --11890 1523
NM_007363chrX1411 --1823 1906
NM_012069chrX11887 --11004 12463
NM_012097chr21778 --11409 --
NM_012102chr122410 2086 --2280 45 --
NM_012155chr19------149
NM_012193chr1164443 3992 3514 1961 985 712 --25197 1593 --
NM_012199chr132857 1140 1023 11837 ----
NM_012214chr225730 4542 11432 24077 2154 --
NM_012232chr1742174 2041 1683 68 21498 830 ----
NM_012261chr201183 ----1535
NM_012262chr124184 3930 --11251 --
NM_012281chr7------11859
NM_012288chr685435 5387 3732 3534 1699 523 166 32 11529 ----
NM_012296chr1173392 2717 1519 1229 758 512 204 ------
NM_012297chr432475 420 25 ------
NM_012316chr135366 4866 1234 24785 2179 1439 --
NM_012328chr73917 486 266 ------
NM_012329chr1721358 453 153 ----
NM_012337chr1134 ------
NM_012384chr2062245 2207 2043 1593 586 94 1463 --1235
NM_012405chr132789 2710 26 ------
NM_012410chr16153 ------
NM_013230chrY1499 ----1570
NM_013262chr611130 11476 ----
NM_013377chr12153 ------
NM_013382chr1411501 2761 510 1231 --
NM_013446chr721310 958 11212 ----
NM_013943chr112728 --11285 --
NM_013952chr232593 2045 411 --1668 --
NM_013953chr232593 2045 411 --1668 --
NM_013992chr232593 2045 411 --1668 --
NM_013993chr63743 691 294 ------
NM_013994chr63743 691 294 ------
NM_014155chr1167131 5125 1841 157 148 55 ------
NM_014178chr14--175 ----
NM_014238chr1711426 21616 1145 ----
NM_014250chr222689 300 1246 ----
NM_014252chr13167 ----1106
NM_014282chr91435 ------
NM_014283chr11166 --11273 --
NM_014325chr121797 21519 54 ----
NM_014331chr456991 6093 5144 2339 22 ------
NM_014333chr111376 1137 ----
NM_014342chr11----1429 1116
NM_014405chr171342 1312 ----
NM_014409chr1----1713 --
NM_014423chr523940 1958 1431 --11266
NM_014517chr31532 ----183
NM_014592chr5------1102
NM_014630chr1533902 853 242 11387 ----
NM_014636chr923538 1108 --23757 232 --
NM_014649chr19175 --125 --
NM_014665chr863585 2681 1374 799 714 504 ----12316
NM_014683chr1721717 523 --12039 --
NM_014705chr721984 1953 1530 ----
NM_014730chr1253794 1830 1595 1354 672 13562 11737 24436 3390
NM_014730chr1253794 1830 1595 1354 672 13562 11737 24436 3390
NM_014747chr194852 4654 4560 4470 4322 2079 1700 1524 747 14738 11684 --
NM_014757chr5----11948 11999
NM_014772chr1842751 2199 1306 390 ----11208
NM_014779chr3----1850 --
NM_014812chr11110 --1601 --
NM_014819chr532126 1953 481 ------
NM_014827chr11161 ----11369
NM_014836chr1011892 --1116 --
NM_014840chr123389 375 60 --11039 --
NM_014850chr324027 1428 13634 ----
NM_014872chr92606 227 11838 --1190
NM_014873chr133824 3665 2963 ------
NM_014876chr2231953 1880 637 --11917 --
NM_014877chr1747682 6152 5969 5919 --16600 --
NM_014921chr1963128 2928 2732 1897 693 627 ------
NM_014926chr31725 ------
NM_014934chr1323068 786 23075 556 ----
NM_014938chr1272489 2171 977 774 538 262 101 ------
NM_014952chr1531818 1279 48 11581 1128 --
NM_014974chr1021671 650 ------
NM_014977chr14------2357 190
NM_015001chr11635 1656 ----
NM_015005chr1431722 1673 631 ------
NM_015008chr32481 211 1243 22687 1235 --
NM_015023chr11175 ------
NM_015025chr2----12013 --
NM_015035chr2066432 6277 5880 5201 2281 1068 --16540 --
NM_015042chr1543196 1191 1046 971 13934 ----
NM_015050chr641337 1075 1033 910 ------
NM_015051chr922872 1168 22169 447 ----
NM_015064chr121451 2976 196 22851 1310 --
NM_015068chr723193 468 ------
NM_015071chr555725 4339 2102 1958 1407 ------
NM_015086chr1231056 499 45 11339 --1430
NM_015107chrX22475 1566 --164 1127
NM_015138chr1542548 2501 1961 964 --1240 --
NM_015176chr121420 422 ------
NM_015184chr3--1101 ----
NM_015185chrX22332 71 12051 ----
NM_015206chr1523752 2532 ----12541
NM_015208chr1812685 13979 --13514
NM_015215chr152780 2728 2086 1945 243 ------
NM_015239chr92123 49 ------
NM_015254chr842971 2496 2074 1092 ----11946
NM_015270chr1242138 1931 1784 228 ------
NM_015288chr533282 876 865 ------
NM_015313chr111878 ----14548
NM_015317chr212257 --12468 --
NM_015326chr132586 2376 81 --1858 --
NM_015332chr743202 1429 1411 67 ------
NM_015353chr1732163 1009 970 --22630 301 --
NM_015359chr832687 2071 313 ------
NM_015365chrX33973 3031 70 ------
NM_015382chr141705 ------
NM_015423chr1121497 362 ------
NM_015455chr523665 1168 13036 ----
NM_015458chr845168 4895 1641 1350 --137 --
NM_015461chr181258 ------
NM_015514chr142446 422 ------
NM_015554chr15--12118 --1522
NM_015602chr131826 714 652 ------
NM_015605chr102204 146 ------
NM_015686chrX42443 1961 972 965 ------
NM_015695chr62493 276 ----11794
NM_015874chr4------196
NM_015981chr543181 2486 2009 1048 --1316 --
NM_016009chr11423 13529 ----
NM_016022chr13792 763 715 ------
NM_016025chr1631918 642 97 ------
NM_016057chr121867 --21090 102 1817
NM_016073chr15172 --1165 --
NM_016131chr211706 ----12274
NM_016132chr1511384 --22683 1046 --
NM_016162chr122578 50 1771 ----
NM_016185chr172325 86 --1178 --
NM_016201chr32823 563 ----1516
NM_016217chr633551 2399 397 ------
NM_016224chr631917 766 49 1880 ----
NM_016227chr11166 --11273 --
NM_016258chr11314 ------
NM_016308chr121541 1533 ------
NM_016329chr31405 --1136 --
NM_016357chr12--1808 --11037
NM_016424chr1721851 446 ------
NM_016436chr2022403 520 12322 --1225
NM_016463chr5172 ------
NM_016526chr1122077 780 1538 22415 380 --
NM_016531chr413236 --1990 --
NM_016621chr1154497 3795 1565 1196 1049 --23774 350 --
NM_016734chr931997 574 467 11646 ----
NM_016834chr1743519 3246 2971 1566 1166 23427 3093 11036
NM_016835chr1743519 3246 2971 1566 1166 23427 3093 11036
NM_016841chr1743519 3246 2971 1566 1166 23427 3093 11036
NM_016929chr641406 997 508 231 ----13248
NM_017447chr2111427 14381 ----
NM_017522chr121046 902 ------
NM_017548chr311829 --1749 --
NM_017582chr1--21423 522 ----
NM_017596chr123472 1823 13695 11310 --
NM_017610chr1521583 630 ------
NM_017617chr931352 1181 46 ------
NM_017637chr948605 8325 363 88 --17356 13689
NM_017643chr1722931 2454 ------
NM_017670chr114832 801 731 299 ------
NM_017778chr81197 ------
NM_017780chr82284 168 ------
NM_017787chr1051861 898 444 364 172 12090 ----
NM_017790chr9----2460 50 --
NM_017805chr19------1135
NM_017811chr922117 1068 ------
NM_017824chr1022427 160 ------
NM_017848chrX23698 1820 --11302 13167
NM_017933chr211432 ----1466
NM_017944chr112524 484 11902 ----
NM_017982chr141237 255 59 39 ------
NM_017987chr102549 99 ------
NM_017994chr722710 2658 ----12499
NM_018045chr122096 887 ----12248
NM_018061chr131178 534 445 ------
NM_018062chr2121 ------
NM_018121chr104804 778 464 454 ------
NM_018155chr332253 695 176 ----12606
NM_018287chr10----2472 416 --
NM_018313chr342149 354 338 332 ------
NM_018314chr11--1471 ----
NM_018319chr141574 1291 --1363
NM_018388chrX1358 11013 ----
NM_018439chr182460 146 ------
NM_018452chr6_random43531 3301 3270 2670 --22444 518 --
NM_018462chr3------1811
NM_018469chr1741135 602 503 59 ------
NM_018569chr421554 1439 ------
NM_018638chr1224118 700 --14013 12182
NM_018667chr162453 90 11006 ----
NM_018689chr1532449 533 53 --21741 255 12598
NM_018708chr1921367 597 ------
NM_018712chr1121166 139 ------
NM_018912chr521493 476 1137 ----
NM_018913chr521493 476 1137 ----
NM_018914chr521493 476 1137 ----
NM_018915chr521493 476 1137 ----
NM_018916chr521493 476 1137 ----
NM_018917chr521493 476 1137 ----
NM_018918chr521493 476 1137 ----
NM_018919chr521493 476 1137 ----
NM_018920chr521493 476 1137 ----
NM_018921chr521493 476 1137 ----
NM_018922chr521493 476 1137 ----
NM_018923chr521493 476 1137 ----
NM_018924chr521493 476 1137 ----
NM_018925chr521493 476 1137 ----
NM_018926chr521493 476 1137 ----
NM_018927chr521493 476 1137 ----
NM_018928chr521493 476 1137 ----
NM_018929chr521493 476 1137 ----
NM_018976chr1212638 --22440 229 --
NM_019001chr323536 3193 ----1918
NM_019114chr92970 61 --12314 --
NM_019116chr1623361 1307 --1707 12343
NM_019555chr3--122 ----
NM_019610chr132149 1859 1560 1592 ----
NM_019613chr1721172 859 11075 153 --
NM_019857chrX2636 527 --1696 11511
NM_019859chr10------21006 108
NM_019885chr24965 613 399 351 --1791 --
NM_020119chr753773 3480 2516 1233 318 ------
NM_020122chr214266 24870 3664 172 --
NM_020205chr112294 1885 22967 361 --
NM_020228chr1111631 ------
NM_020338chr1083072 2964 2835 2657 977 792 704 241 --1582 --
NM_020374chr1221975 1395 1297 ----
NM_020443chr156176 5800 2610 940 156 22393 1704 ----
NM_020456chr1311696 12326 ----
NM_020466chr625009 657 1472 ----
NM_020475chr82761 124 11667 ----
NM_020476chr82761 124 11667 ----
NM_020477chr82761 124 11667 ----
NM_020478chr82824 187 11730 --135
NM_020480chr82761 124 11667 ----
NM_020640chr31150 11469 ----
NM_020672chr12567 158 --123 --
NM_020673chr2057521 6029 2840 2150 1240 --12392 --
NM_020713chr2063048 2907 2189 890 710 282 ------
NM_020718chr161848 ----21657 757
NM_020766chrX33891 3537 2885 ------
NM_020792chr322633 746 ------
NM_020794chr11305 ------
NM_020803chr4----11923 --
NM_020805chr18----1388 --
NM_020826chr1153531 2326 882 811 28 ------
NM_020836chr141538 ------
NM_020871chrX11700 ------
NM_020899chr1741730 1724 275 120 189 ----
NM_020956chr1944311 3116 1409 1027 --34379 3024 360 --
NM_020983chr1242138 1931 1784 228 ------
NM_020993chr1261985 741 506 495 271 224 --190 --
NM_021012chr1732300 423 383 1950 12024 --
NM_021020chr833215 2746 1282 ------
NM_021072chr52517 349 ------
NM_021079chr1733258 2130 634 ------
NM_021090chr2224221 1348 --31805 1381 742 11087
NM_021096chr2233010 1323 954 ------
NM_021097chr222907 1923 1961 ----
NM_021100chr202295 184 1707 1212 --
NM_021116chr776002 3492 3383 2073 2053 1801 1266 --27291 6184 --
NM_021155chr1931873 1121 635 --12573 --
NM_021222chr111432 ------
NM_021242chrX1322 1381 ----
NM_021255chr1452636 1253 936 319 284 ------
NM_021637chrX11343 --198 --
NM_021638chr473382 1515 1266 1170 930 814 513 ------
NM_021643chr231591 271 123 11252 ----
NM_021813chr621844 1330 13725 ----
NM_021912chr1533719 2651 553 --13770 --
NM_021940chr621519 1440 ------
NM_021945chr661392 1313 1304 1129 672 45 ----12437
NM_021961chr1137096 6978 5334 1281 16997 12280
NM_021962chr1721736 427 1260 ----
NM_021964chr312190 25338 2258 --15269
NM_021984chrX1412 ------
NM_021987chrX1412 ------
NM_021990chrX1412 ------
NM_021991chr171650 ----1151
NM_022003chr11--11138 --1508
NM_022048chr1536195 1228 568 --14460 --
NM_022143chr7--11062 --1223
NM_022166chr1655337 1856 1733 702 598 ------
NM_022459chr1332502 1891 1661 ------
NM_022477chr20------21637 1592
NM_022491chr1243080 2615 530 487 --13563 --
NM_022659chr81123 ----1204
NM_022728chr71639 ------
NM_022735chr11220 ----11761
NM_022758chr633100 1180 843 22724 292 1757 --
NM_023079chr1751674 1563 1544 730 407 ------
NM_024294chr633100 1180 843 22724 292 1757 --
NM_024524chr31803 ------
NM_024545chr22693 206 ------
NM_024551chr121653 11573 12190 21968 253
NM_024551chr121653 11573 12190 21968 253
NM_024595chr1--31149 924 863 1412 --
NM_024639chr61572 12749 ----
NM_024721chr811829 ------
NM_024771chr1122193 985 12390 --1694
NM_024785chr221452 508 ----183
NM_024830chr542222 1686 845 139 12182 ----
NM_024911chr13716 332 126 ------
NM_024928chr10------1141
NM_024993chr221187 341 ------
NM_025054chr82976 544 ------
NM_025077chr1------1226
NM_025160chr112877 164 ----
NM_025179chr124564 4287 14119 13034 --
NM_025182chr92215 186 ------
NM_025222chr33648 416 198 12426 1545 --
NM_025250chr763031 2978 2217 878 736 205 21216 984 --12062
NM_030594chr151957 ------
NM_030634chr122140 1922 12028 ----
NM_030650chr243881 1210 892 67 --11554 --
NM_030674chr1255619 4643 4099 768 607 ----12026
NM_030885chr31147 ------
NM_030920chr132006 1689 1452 1835 ----
NM_030927chr1031596 1352 1033 ------
NM_030938chr171897 11152 ----
NM_030963chr61192 ------
NM_030964chr522602 2437 1589 32983 722 544 --
NM_031208chr162755 186 1959 ----
NM_031268chr1625175 2093 ------
NM_031418chr11--11013 ----
NM_031445chr233389 2796 2439 ------
NM_031468chr736886 5957 315 37781 5197 3181 12801 --
NM_031483chr202469 406 22958 315 ----
NM_031845chr223383 50 ------
NM_031847chr223383 50 ------
NM_032013chr20------21637 1592
NM_032088chr521493 476 1137 ----
NM_032092chr521493 476 1137 ----
NM_032102chr1121005 41 ------
NM_032124chr1821233 1200 --11119 --
NM_032153chr332079 1001 525 21704 1054 ----
NM_032160chr1834021 3676 3420 ------
NM_032175chr521300 586 ------
NM_032182chr10------11045
NM_032199chr1033555 3038 2653 ------
NM_032229chr13----11139 1779
NM_032239chr431326 509 324 ----1453
NM_032268chr1633167 2105 1124 2949 96 11998 --
NM_032281chr1952873 1165 364 299 262 12602 12571 --
NM_032288chr332181 2081 1456 ------
NM_032291chr111201 21323 108 ----
NM_032294chr173603 465 236 1621 1200 --
NM_032316chr342497 2251 1594 575 2862 417 11638 --
NM_032403chr521493 476 1137 ----
NM_032421chr731690 779 383 22061 1920 ----
NM_032501chr2011226 --11280 126
NM_032538chr632839 1061 703 22690 2166 ----
NM_032575chr1631956 1684 1477 ------
NM_032682chr352278 1200 1013 998 677 1257 ----
NM_032711chr1763765 3200 3169 1537 1495 1454 ------
NM_032777chr821542 60 ----11223
NM_032808chr152728 317 ------
NM_032813chr131907 ------
NM_032826chr744757 4270 1885 333 1919 ----
NM_032832chr621353 23 ----11443
NM_032859chr1311074 ----1181
NM_032900chr1013625 12970 1638 --
NM_032961chr42126 86 ------
NM_033161chr941610 1340 716 58 11836 ----
NM_033211chr521543 180 ------
NM_033224chr716997 25248 573 ----
NM_033300chr121046 902 ------
NM_033420chr1971143 1107 1037 1006 897 804 133 ------
NM_033430chr422984 322 ------
NM_033437chr422984 322 ------
NM_033626chrX11737 --1171 --
NM_033631chr163822 3262 1426 1407 1238 335 23236 836 ----
NM_052827chr1231017 132 73 ------
NM_052879chr1233313 2582 769 ------
NM_052885chr1234723 3901 1271 ------
NM_052898chr8--11600 1270 --
NM_052906chr2263323 1930 1682 1124 691 93 23739 707 ----
NM_052907chr1224241 1681 ------
NM_052918chr1022739 536 ------
NM_053016chr957774 7454 6192 3014 2151 26764 3164 ----
NM_053025chr321712 1690 ------
NM_053026chr321712 1690 ------
NM_053027chr321712 1690 ------
NM_053028chr321712 1690 ------
NM_053031chr321712 1690 ------
NM_053032chr321712 1690 ------
NM_053064chr1432909 2347 373 ------
NM_053279chr852225 677 558 407 44 --11960 --
NM_054016chr111594 ------
NM_054016chr111594 ------
NM_054016chr111594 ------
NM_057178chr1752719 295 250 236 180 ----1786
NM_078471chr173913 455 250 11120 ----
NM_080491chr1173392 2717 1519 1229 758 512 204 ------
NM_080552chr201143 197 ----
NM_080625chr201412 139 ----
NM_080645chr621391 870 ------
NM_080792chr2052069 2033 1476 900 671 11667 ----
NM_130391chr913191 ------
NM_130392chr913191 ------
NM_130393chr913191 ------
NM_130436chr2131134 507 325 ------
NM_130438chr2131084 902 159 ------
NM_130439chr1042275 1736 1441 462 ------
NM_130439chr1042275 1736 1441 462 ------
NM_130798chr15185 ------
NM_133170chr2066824 6505 2887 2017 797 331 15321 2996 448 --
NM_133264chr1712602 --21438 295 13786
NM_133433chr52334 252 ------
NM_133452chr192805 101 ------
NM_133634chr2131646 1475 239 --1572 --
NM_133638chr5133 ----11254
NM_133642chr221102 ------
NM_138292chr1143295 2260 1147 225 ------
NM_138335chr42671 175 ------
NM_138423chr1522109 475 --11897 --
NM_138473chr1265098 4686 3987 1017 910 589 13642 11385 --
NM_138477chr153356 265 25 ------
NM_138730chr6------168
NM_138799chr2--12003 11538 --
NM_139014chr632210 1554 1532 ------
NM_139071chr1241465 1125 443 92 --1549 --
NM_139131chr112527 443 ------
NM_139159chr192831 210 --2240 188 --
NM_139239chr19----1298 --
NM_139276chr1721991 1470 1763 ----
NM_139321chr2012842 23404 1159 --1331
NM_144571chr445850 5233 4924 2604 ------
NM_144579chr212633 1844 --12140
NM_144632chr222437 1918 ------
NM_144671chr1261672 1565 1324 1268 795 626 ------
NM_144973chr1234935 761 461 23324 972 ----
NM_145025chr63365 279 155 ------
NM_145117chr111953 --12846 22518 290
NM_145206chr1021078 809 12123 ----
NM_145649chr622133 653 ----12738
NM_145655chr622133 653 ----12738
NM_147156chr10------1369
NM_148571chr172277 250 ----1322
NM_152265chr131126 456 152 ------
NM_152342chr16150 ------
NM_152424chrX73160 3118 3084 1790 1387 777 545 11734 ----
NM_152437chr1212233 --1936 --
NM_152440chr1221020 384 ------
NM_152546chr511062 --1259 --
NM_152594chr151147 1423 ----
NM_152624chr567466 6938 5248 4894 2532 1715 15492 --11254
NM_152793chr734032 3691 234 ------
NM_152860chr1241487 150 108 50 ------
NM_152879chr242461 2077 1712 778 ------
NM_152902chr121803 1357 ------
NM_152924chr1534798 4243 147 25555 470 ----
NM_153013chr521723 539 ------
NM_153050chr2224221 1348 --31805 1381 742 11087
NM_153051chr2224221 1348 --31805 1381 742 11087
NM_153188chr535153 594 50 14409 ----
NM_153273chr32959 842 22187 1118 22589 450 --
NM_153350chr164359 338 242 94 ----11289
NM_153360chr201542 1388 ----
NM_153450chr111665 3679 145 76 --169
NM_153487chr643903 3859 1722 1175 24573 3246 1729 13528
NM_153607chr51852 ------
NM_153705chr111595 11649 1249 12662
NM_170751chr621338 1062 1516 ----
NM_170752chr621338 1062 1516 ----
NM_171825chr543181 2486 2009 1048 --1316 --
NM_172071chr136612 2617 2260 26526 1722 ----
NM_172169chr101302 21553 573 ----
NM_172170chr101302 21553 573 ----
NM_172171chr101302 21553 573 ----
NM_172173chr101302 21553 573 ----
NM_172206chr173603 465 236 1621 1200 --
NM_172373chr1321095 1016 ------
NM_173054chr72398 366 ------
NM_173519chr811716 ------
NM_173595chr1255231 3918 3456 298 168 11146 ----
NM_173642chr158913 3382 2993 1712 337 43307 2858 2745 1196 --18676
NM_173825chr322602 974 22451 1905 ----
NM_173833chr851430 1360 1209 75 24 --1666 --
NM_174921chr4------1870
NM_175038chr12--1169 ----
NM_175624chr1276775 6405 6185 3076 2848 2405 1158 35403 2994 2355 ----
NM_175625chr1276775 6405 6185 3076 2848 2405 1158 35403 2994 2355 ----
NM_175709chr2252725 1950 935 522 45 --12550 --
NM_175736chr1266458 2856 2544 2275 2106 740 ------
NM_175748chr1451823 1639 840 463 56 --1547 --
NM_175859chrX2636 527 --1696 11511
NM_176815chr31144 ----11874
NM_176871chr833116 998 554 12664 ----
NM_177414chr131291 1161 1123 --11099 --
NM_177549chr2031076 901 421 ------
NM_177974chr1522109 475 --11897 --
NM_177985chr21778 --11409 --
NM_178037chr121451 2976 196 22851 1310 --
NM_178038chr121451 2976 196 22851 1310 --
NM_178126chr1741912 1843 827 498 12151 ----
NM_178151chrX45146 4972 2278 1872 15715 17688 --
NM_178152chrX45146 4972 2278 1872 15715 17688 --
NM_178153chrX45146 4972 2278 1872 15715 17688 --
NM_178493chr17--1100 ----
NM_178554chr343195 1118 938 507 ------
NM_178815chr1031113 479 403 ------
NM_181351chr1122891 1146 ------
NM_181784chr241953 788 437 385 ------
NM_182314chrX11699 124 11692 --
NM_182503chr625053 1686 --23976 1593 --
NM_182551chr233446 935 239 ------
NM_182557chr1142169 1754 446 224 11564 ----
NM_182685chr11789 --173 --
NM_182697chr751109 691 446 397 171 ------
NM_182700chr7----21545 55 --
NM_182757chr633452 2970 2828 ------
NM_182898chr736291 6066 582 1213 ----
NM_182899chr736291 6066 582 1213 ----
NM_182918chr2121223 1053 ----1157
NM_182964chr111953 --12846 22518 290
NM_182970chr2064251 4200 3229 2770 1592 147 ------
NM_183004chr1433436 1390 396 11179 --13319
NM_194278chr1432671 948 159 21070 733 12696 --
NM_194286chr1231600 768 80 11223 21387 1186 --
NM_194434chr182713 440 ----13737
NM_198081chr642883 2459 2216 1916 1757 ----
NM_198225chr1011892 --1116 --
NM_198395chr52828 80 ------
NM_198440chr224636 572 335 258 12410 ----
NM_198560chr343446 2722 893 265 1200 ----
NM_198595chr473382 1515 1266 1170 930 814 513 ------
NM_198859chr333689 890 178 11825 13440 --
NM_198900chr1266458 2856 2544 2275 2106 740 ------
NM_198901chr71423 ----11123
NM_198956chr7----21545 55 --
NM_198968chr1323068 786 23075 556 ----
NM_199188chr1233313 2582 769 ------
NM_199190chr1233313 2582 769 ------
NM_199229chr231723 1524 478 21582 1126 ----
NM_199245chr1232203 1776 253 2761 130 ----
NM_199437chr1111631 ------
NM_199438chr1111631 ------
NM_199439chr1111631 ------
NM_199461chr1033560 1259 354 13589 ----
NM_201266chr232386 2091 1226 ------
NM_201279chr232386 2091 1226 ------
NM_201280chr621625 1335 ----1583
NM_201428chr1121633 1249 ------
NM_201429chr1121633 1249 ------
NM_201430chr1121559 1175 ------
NM_201432chr1744431 1856 754 21 11307 15863 16056
NM_201433chr1744431 1856 754 21 11307 15863 16056
NM_201575chr16153 ------
NM_201591chr41405 ------
NM_201592chr41405 ------
NM_201995chr111715 ------
NM_201998chr111780 ------
NM_203283chr4------196
NM_203284chr4------196
NM_203318chr173913 455 250 11120 ----
NM_203327chr2083862 1770 1650 1490 1321 845 688 672 ----13167
NM_203329chr1147006 2613 1167 732 16106 --1269
NM_203330chr1147006 2613 1167 732 16106 --1269
NM_203331chr1147006 2613 1167 732 16106 --1269
NM_203342chr133074 2301 1366 33285 2864 365 12441 --
NM_203343chr133074 2301 1366 33285 2864 365 12441 --
NM_203364chr111137 1867 ----
NM_203446chr2121103 431 ------
NM_203504chr432475 420 25 ------
NM_203505chr432475 420 25 ------
NM_206594chr122784 2383 11335 ----
NM_206595chr122784 2383 11335 ----
NM_206853chr62731 507 ------
NM_206854chr621992 1768 ------
NM_206855chr613914 ------
NM_206866chr2112752 12888 ----
NM_207337chr122454 155 1388 ----
NM_207406chr445063 2467 2098 472 ----16001
NM_207518chr191465 ------
NM_212474chr21730 ------
NM_212475chr21730 ------
NM_212476chr21730 ------
NM_212478chr21730 ------
NM_212482chr21730 ------
NM_213606chr101452 1521 ----