TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4747-3p
miRNA Sequence: AAGGCCCGGGCUUUCCUCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--1300 ----
NM_000037chr852343 1797 918 461 353 --11957 --
NM_000044chrX1160 ------
NM_000068chr1961541 590 422 359 325 206 1513 1584 --
NM_000069chr1--127 ----
NM_000076chr11169 ------
NM_000084chrX66257 5608 5554 5240 5183 443 ------
NM_000088chr171389 1335 ----
NM_000092chr223701 396 13461 ----
NM_000094chr3150 ------
NM_000110chr11785 ------
NM_000112chr533991 1960 1648 14284 ----
NM_000210chr221663 478 1194 1575 --
NM_000212chr175697 522 509 175 153 ------
NM_000214chr20143 ------
NM_000232chr421281 1090 ------
NM_000238chr72279 56 ------
NM_000240chrX187 ------
NM_000252chrX--1320 ----
NM_000264chr942549 1012 281 240 ------
NM_000266chrX1313 ------
NM_000296chr163290 149 25 ------
NM_000304chr17--1958 ----
NM_000314chr1042979 2659 2252 851 ------
NM_000319chr12196 2343 81 ----
NM_000321chr1311610 11596 ----
NM_000330chrX3648 505 51 ------
NM_000332chr662514 1748 673 473 424 271 --14544 --
NM_000333chr32143 119 ------
NM_000335chr351953 1512 316 120 92 ------
NM_000340chr311025 ------
NM_000349chr841191 435 358 282 ------
NM_000353chr162974 101 ------
NM_000368chr933284 897 93 ------
NM_000399chr101122 ------
NM_000430chr1733419 2978 415 11121 ----
NM_000434chr6172 --161 --
NM_000435chr191170 133 ----
NM_000448chr1132757 99 65 ------
NM_000449chr12496 195 ------
NM_000450chr1----185 --
NM_000462chr1511722 ------
NM_000484chr211677 ------
NM_000520chr151466 ------
NM_000546chr173957 794 78 ------
NM_000555chrX57681 6201 3156 2280 183 ------
NM_000587chr52377 272 11240 ----
NM_000598chr721533 1371 ------
NM_000599chr243818 3545 3059 2889 ------
NM_000609chr103925 118 69 --1524 --
NM_000615chr1132896 2025 1837 ------
NM_000618chr1235671 5317 446 ------
NM_000618chr1235671 5317 446 ------
NM_000626chr173375 335 175 ------
NM_000678chr206642 564 260 249 65 36 1885 ----
NM_000681chr1021116 250 ------
NM_000719chr1266558 5519 2096 597 533 271 --123 --
NM_000720chr31456 ------
NM_000724chr10--185 ----
NM_000726chr211018 ------
NM_000739chr71290 ------
NM_000794chr5164 ------
NM_000800chr51241 ------
NM_000801chr201684 ------
NM_000806chr511517 ------
NM_000827chr522463 40 12235 ----
NM_000831chr1156077 5982 5937 5920 5903 5776 5706 4822 4251 1691 1522 1350 186 124 92 ------
NM_000836chr193904 264 224 --1877 --
NM_000838chr652586 2426 624 378 101 --1963 --
NM_000844chr3--1191 ----
NM_000870chr531317 398 146 ------
NM_000875chr1565261 2193 1913 1155 900 237 ------
NM_000891chr1722857 1065 ------
NM_000899chr1233102 592 269 ------
NM_000924chr1231236 962 327 ------
NM_000935chr31130 ------
NM_000945chr2--1763 ----
NM_000950chrX23617 230 ------
NM_000958chr511204 ------
NM_000964chr1761372 1259 1148 283 262 178 ----11248
NM_000966chr123893 209 39 ------
NM_000983chr13453 368 126 ------
NM_001001323chr121346 --12601 --
NM_001001331chr311677 21985 232 ----
NM_001001342chr1011224 ------
NM_001001396chr133136 2942 1252 ------
NM_001001433chr2042895 2615 647 57 ------
NM_001001549chr72844 288 ------
NM_001001550chr72844 288 ------
NM_001001555chr72844 288 ------
NM_001001557chr83644 518 42 ------
NM_001001560chr224744 625 234 212 ------
NM_001001664chr232987 1318 819 ------
NM_001001890chr2194160 3984 3295 1514 1094 105 98 35 26 13925 164 --
NM_001001974chr1012136 ------
NM_001001995chrX11802 ------
NM_001002032chr17288 81 --1592 --
NM_001002295chr101244 ------
NM_001002838chrX11819 ------
NM_001003406chr22113155 3095 3014 3007 2733 2187 1166 365 354 347 140 ------
NM_001003678chr11188 ------
NM_001003681chr2221304 312 ------
NM_001003682chr131347 1293 444 ------
NM_001003694chr31503 ------
NM_001003800chr943735 1407 931 893 12929 ----
NM_001003940chr1563726 3186 2965 496 483 208 ------
NM_001003942chr1563726 3186 2965 496 483 208 ------
NM_001003943chr1563730 3190 2969 500 487 212 ------
NM_001004065chr943413 3072 2810 1006 ------
NM_001004106chr52239 180 ------
NM_001004127chr131907 ------
NM_001004304chr1253268 2689 2163 1097 1011 12724 ----
NM_001004317chr633160 1558 733 ------
NM_001004419chr121856 ------
NM_001004720chr221031 33 ------
NM_001004722chr221200 202 ------
NM_001005271chr175915 793 259 106 71 ------
NM_001005273chr175915 793 259 106 71 ------
NM_001005375chrY11438 11464 ----
NM_001005404chr1731180 635 108 21803 804 ----
NM_001005408chr173435 43 36 ------
NM_001005417chr14598 278 177 123 ------
NM_001005463chr1011884 ------
NM_001005473chr525145 4673 ----11436
NM_001005609chrX43692 2942 2484 643 ------
NM_001005611chrX4474 447 206 27 ------
NM_001005743chr1411083 ------
NM_001005744chr1411083 ------
NM_001005745chr1411083 ------
NM_001005746chr211018 ------
NM_001005747chr211018 ------
NM_001005914chr3------1163
NM_001005920chr163944 407 257 ------
NM_001006115chr3102398 2362 2256 1844 1017 968 908 770 455 274 ------
NM_001006605chr11848 ------
NM_001006605chr11848 ------
NM_001006610chr161414 ------
NM_001006626chr71290 ------
NM_001006627chr71290 ------
NM_001006628chr71290 ------
NM_001006629chr71290 ------
NM_001006630chr71290 ------
NM_001006631chr71290 ------
NM_001006632chr71290 ------
NM_001006938chrX2607 586 ------
NM_001007024chr1733382 3152 1364 ------
NM_001007025chr1733382 3152 1364 ------
NM_001007098chr11351 ------
NM_001007156chr1571758 1362 1286 1212 754 419 50 ------
NM_001007226chr1721375 1148 ------
NM_001007227chr1721375 1148 ------
NM_001007228chr1721375 1148 ------
NM_001007229chr1721375 1148 ------
NM_001007230chr1721375 1148 ------
NM_001007243chr841191 435 358 282 ------
NM_001007246chr2111925 ------
NM_001007257chr111437 ------
NM_001007271chr101293 ------
NM_001007279chr225586 156 92 76 50 --198 --
NM_001007471chr92328 159 ------
NM_001007533chr172221 70 1228 ----
NM_001007553chr11992 ------
NM_001007794chr11220 ------
NM_001008220chr572559 2475 1537 752 733 410 137 ------
NM_001008222chrX41164 458 242 234 ------
NM_001008407chr731273 494 285 --11715 --
NM_001008495chr8--21618 884 ----
NM_001008541chr1022139 45 ------
NM_001008541chr1022139 45 ------
NM_001008701chr19102729 2543 1102 1004 837 807 357 170 134 103 --32931 1900 1015 --
NM_001008726chr1411193 ------
NM_001008925chr423121 344 ------
NM_001009185chr51642 ------
NM_001009899chr345903 5045 4522 776 ------
NM_001009944chr163290 149 25 ------
NM_001009993chr244170 3684 3515 2997 --14064 --
NM_001010846chr164451 4198 4075 1557 1281 26 ------
NM_001010854chr142126 63 ------
NM_001010861chr112678 ------
NM_001010867chr1176372 6357 6134 6052 5569 4763 2578 1756 1687 1132 1112 509 419 266 71 51 44 21257 919 2439 342 --
NM_001010917chr1081928 765 728 435 253 225 161 47 11780 1144 --
NM_001010923chr611639 ------
NM_001010926chr1----1100 --
NM_001010942chr1211264 ------
NM_001010971chr11925 ------
NM_001011546chr20188 ------
NM_001011645chrX1160 ------
NM_001012300chr122120 25 ------
NM_001012329chr172107 1760 1748 827 721 519 65 1871 ----
NM_001012393chr112252 88 ------
NM_001012415chr95676 572 365 112 64 ------
NM_001012420chr1521861 175 1821 ----
NM_001012423chr1521861 175 1821 ----
NM_001012426chr673372 3219 2701 2517 1294 816 131 1368 ----
NM_001012427chr673372 3219 2701 2517 1294 816 131 1368 ----
NM_001012614chr42149 118 ------
NM_001012755chrX23349 1373 ------
NM_001012977chrX11081 ------
NM_001013398chr721533 1371 ------
NM_001013437chr181110 ------
NM_001013635chr1231001 973 32 ------
NM_001013661chr12357 21 ------
NM_001013690chr1251991 1960 1863 294 133 21556 677 ----
NM_001013693chr182469 2183 1875 1183 1061 832 424 311 --11969 --
NM_001013693chr182469 2183 1875 1183 1061 832 424 311 --11969 --
NM_001014435chr16150 ------
NM_001014794chr111176 ------
NM_001014795chr111176 ------
NM_001014797chr1097528 7279 7179 5221 5135 2872 2668 1671 1035 16468 ----
NM_001015045chr42945 696 1905 ----
NM_001015048chr1442977 2689 2598 804 ------
NM_001015049chr1442977 2689 2598 804 ------
NM_001015053chr1741322 286 103 27 11152 ----
NM_001015881chrX31004 355 274 1217 ----
NM_001017424chr111665 1368 ----
NM_001017425chr111665 1368 ----
NM_001017440chr747602 6658 5790 486 ------
NM_001017523chr1221829 107 ------
NM_001017923chr14161 ------
NM_001017924chr10136 ------
NM_001017926chr8--1553 ----
NM_001017928chr3----194 --
NM_001017979chr4155 1574 ----
NM_001017992chr5--125 ----
NM_001018050chr2282722 2652 2416 2311 1338 1254 1149 221 ------
NM_001018052chr2282722 2652 2416 2311 1338 1254 1149 221 ------
NM_001018072chr1221829 107 ------
NM_001018108chr1551963 1481 819 185 139 ------
NM_001018111chr763917 2573 1296 920 651 138 1738 ----
NM_001023567chr151175 ------
NM_001023587chr31140 ------
NM_001024372chr821821 1588 ------
NM_001024809chr1761372 1259 1148 283 262 178 ----11248
NM_001024858chr14112064 975 732 635 603 559 436 255 174 129 116 ------
NM_001024937chr17293 68 1270 ----
NM_001024947chr5132 ------
NM_001024948chr122419 2231 ------
NM_001025076chr1025092 2438 ------
NM_001025077chr1036450 4878 1005 ------
NM_001025108chr212915 11445 12743 --
NM_001025205chr31143 ------
NM_001025252chr813055 --13189 --
NM_001025253chr813055 --13189 --
NM_001025579chr1741068 919 240 166 ------
NM_001025580chrX44243 676 588 29 ------
NM_001025596chr11135 ------
NM_001025603chr12496 195 ------
NM_001025778chr191261 ------
NM_001029998chr411385 ------
NM_001030006chr171258 ------
NM_001030007chr1623177 299 ------
NM_001031680chr131954 673 66 ------
NM_001031690chr732384 277 269 ------
NM_001031695chr2235176 1418 1402 --12141 --
NM_001031696chr192236 37 ------
NM_001031702chr3126 ------
NM_001031717chr33894 716 172 ------
NM_001031740chr14494 480 351 50 ------
NM_001032282chr81166 1105 ----
NM_001032288chr2041300 1122 438 369 11156 ----
NM_001033026chr194584 265 120 41 ------
NM_001033045chr21163 ------
NM_001033049chr2132066 1783 322 ------
NM_001033057chr311911 ------
NM_001033081chr131829 442 275 ------
NM_001033082chr131829 442 275 ------
NM_001033117chr374297 3879 3866 3397 1587 1550 1450 ------
NM_001033506chr111386 ------
NM_001033507chr121651 1423 --11247 --
NM_001033551chr17173456 3421 3388 3229 2949 2933 1488 1343 1235 896 573 558 486 443 422 236 35 ------
NM_001033557chr21395 ------
NM_001033561chr171285 ------
NM_001033925chr1021821 1803 ------
NM_001034025chr122296 213 1151 ----
NM_001035chr1--1955 ----
NM_001035235chr53198 137 101 ------
NM_001035254chr952007 1901 453 389 267 ------
NM_001037317chr112678 ------
NM_001037332chr532121 799 156 ------
NM_001037333chr532121 799 156 ------
NM_001038493chr241180 379 104 22 ------
NM_001039350chr741677 1506 675 490 ------
NM_001039479chr1442084 1762 1614 849 ------
NM_001039547chr347748 5815 5716 1804 ------
NM_001039569chr212841 13261 ----
NM_001039574chr12983 172 ------
NM_001039583chr221537 ------
NM_001039584chr221537 ------
NM_001039590chrX33054 2627 1202 ------
NM_001039591chrX33054 2627 1202 ------
NM_001039618chr1155589 5107 2155 1463 424 ------
NM_001039690chr16102150 2073 951 939 729 703 615 531 445 419 ------
NM_001039762chr10----11638 --
NM_001039916chr121120 ------
NM_001039917chr121120 ------
NM_001039918chr121120 ------
NM_001039919chr121120 ------
NM_001039920chr121120 ------
NM_001039933chr173375 335 175 ------
NM_001039960chr122496 30 ------
NM_001040056chr163651 301 200 ------
NM_001040110chr721152 702 --1758 --
NM_001040144chr16102150 2073 951 939 729 703 615 531 445 419 ------
NM_001040146chr16102150 2073 951 939 729 703 615 531 445 419 ------
NM_001040152chr743510 3216 252 22 ------
NM_001040159chr41404 ------
NM_001040167chr741055 881 343 252 ------
NM_001040172chr531317 398 146 ------
NM_001040173chr531317 398 146 ------
NM_001040429chr13--11134 ----
NM_001040619chr14634 589 375 84 ------
NM_001040708chr811014 ------
NM_001040709chr142321 2017 1907 265 11001 ----
NM_001040712chr922987 2331 ------
NM_001042357chr10188 ------
NM_001042358chr10188 ------
NM_001042360chr10188 ------
NM_001042363chr10188 ------
NM_001042389chr10188 ------
NM_001042390chr10188 ------
NM_001042392chr10188 ------
NM_001042395chr10188 ------
NM_001042413chr923995 111 ------
NM_001042573chr176726 613 580 407 143 38 12096 1235 --
NM_001042632chr2041944 948 546 326 --1180 --
NM_001042633chr2041944 948 546 326 --1180 --
NM_001042728chr123893 209 39 ------
NM_001043318chr1443174 1612 490 38 --1965 --
NM_001043351chr121804 1586 ------
NM_001077628chr1126 ------
NM_001080418chr17575 534 487 191 135 87 31 ------
NM_001084chr73228 85 53 ------
NM_001095chr1231655 730 398 ------
NM_001096chr173535 301 105 ------
NM_001099678chr334734 3909 1868 ------
NM_001106chr387497 6245 3431 3288 3071 2946 2864 1678 48959 7536 3055 2182 16162 --
NM_001113490chrX1938 ------
NM_001122631chr11164 ------
NM_001122679chr5--1300 ----
NM_001128chr1623177 299 ------
NM_001144chr162895 501 --197 --
NM_001146chr811668 --1246 --
NM_001174chrX4772 702 689 235 ------
NM_001191chr2031176 941 132 ------
NM_001199chr8169 ------
NM_001206chr91453 ------
NM_001221chr4295 28 ------
NM_001222chr1031645 789 72 ------
NM_001241chr212032 ------
NM_001241chr212032 ------
NM_001259chr736351 6293 2062 12247 1381 --
NM_001260chr13183 ------
NM_001263chr4--1476 ----
NM_001265chr132257 173 ------
NM_001271chr1542220 814 728 187 ------
NM_001273chr122413 81 ------
NM_001282chr171258 ------
NM_001292chr151962 ------
NM_001295chr33272 175 157 ------
NM_001304chr1733250 2458 563 ------
NM_001319chr1921103 917 ------
NM_001328chr42149 118 ------
NM_001331chr1142614 2151 2042 1933 129 ----
NM_001332chr521510 317 ------
NM_001351chr311509 21438 676 ----
NM_001356chrX1515 ------
NM_001364chr1123568 1782 --1264 --
NM_001365chr173547 218 49 1669 ----
NM_001383chr173231 167 118 ------
NM_001396chr211778 ------
NM_001397chr172355 1073 1019 950 819 545 272 --12254 --
NM_001399chrX43692 2942 2484 643 ------
NM_001407chr31574 ------
NM_001408chr151252 1201 510 454 145 ------
NM_001409chr152165 548 445 262 90 ------
NM_001417chr1221628 299 ------
NM_001418chr111498 ------
NM_001418chr111498 ------
NM_001419chr1963095 621 605 579 564 532 ------
NM_001420chr1932877 428 176 1761 ----
NM_001423chr1221986 502 ------
NM_001438chr123465 2787 --12956 --
NM_001448chrX--11692 ----
NM_001453chr611639 ------
NM_001454chr174619 355 329 105 ------
NM_001460chr13213 145 93 13134 ----
NM_001485chr2122 2177 153 ----
NM_001494chr101634 ------
NM_001500chr62311 102 ------
NM_001523chr19398 63 32 ------
NM_001567chr113682 502 471 ------
NM_001650chr1812544 ------
NM_001654chrX1452 ------
NM_001655chr1111957 ------
NM_001661chr17141 ------
NM_001662chr71344 ------
NM_001664chr31403 ------
NM_001668chr121732 452 ------
NM_001670chr222326 44 ------
NM_001679chr31268 ------
NM_001682chr12160 --12315 --
NM_001683chr311677 21985 232 ----
NM_001684chr132853 2659 969 ------
NM_001703chr11255 ------
NM_001706chr32431 156 ------
NM_001707chr71127 ------
NM_001730chr1311254 ------
NM_001730chr1311254 ------
NM_001754chr2194160 3984 3295 1514 1094 105 98 35 26 13925 164 --
NM_001755chr1621961 717 ------
NM_001759chr1274872 4126 4022 3655 3217 1642 775 ------
NM_001760chr61264 ------
NM_001810chr205741 730 520 331 162 ------
NM_001829chr4----1901 --
NM_001834chr5140 ------
NM_001842chr92216 148 --1155 --
NM_001859chr921242 1219 13900 ----
NM_001896chr16----121 --
NM_001903chr51738 ------
NM_001936chr741677 1506 675 490 ------
NM_001956chr13502 104 70 ------
NM_001962chr5143 1173 ----
NM_001964chr51374 ------
NM_001967chr31233 ------
NM_001977chr4--1529 ----
NM_001995chr421323 1284 ------
NM_002009chr1522387 1104 ------
NM_002015chr131438 ------
NM_002051chr101244 ------
NM_002070chr32922 28 ------
NM_002072chr91962 ------
NM_002082chr52202 143 ------
NM_002086chr1731908 1579 118 ------
NM_002088chr192486 372 ------
NM_002095chr8170 ------
NM_002114chr61449 ------
NM_002128chr1312320 ------
NM_002137chr7125 11788 ----
NM_002147chr172881 742 ------
NM_002160chr91162 ------
NM_002167chr11102 ------
NM_002168chr15154 ------
NM_002189chr103465 153 92 ------
NM_002199chr4133 ------
NM_002221chr162041 833 488 428 175 34 11080 ----
NM_002247chr1022274 531 ------
NM_002264chr324438 4206 ------
NM_002265chr171459 ------
NM_002267chr1312128 12436 ----
NM_002270chr524405 506 ------
NM_002274chr171239 ------
NM_002283chr123768 152 22 ------
NM_002285chr212915 11445 12743 --
NM_002296chr11103 1496 ----
NM_002309chr22122977 2673 2628 2299 2205 1982 1201 1010 751 517 447 65 11192 ----
NM_002332chr122672 246 ------
NM_002347chr8124 ------
NM_002356chr622354 1817 ------
NM_002359chr17104240 4148 3782 3652 2986 1451 569 415 346 160 12767 2506 26 --
NM_002373chr1541217 1111 518 315 ------
NM_002375chr3101910 1810 1689 1639 1511 676 360 231 210 202 ------
NM_002390chr1732074 1985 392 ------
NM_002398chr21158 ------
NM_002401chr17112471 2296 2195 2179 1985 1960 1790 1668 811 341 286 1818 ----
NM_002406chr52262 23 ------
NM_002419chr11--1394 ----
NM_002442chr1241604 1316 594 151 ------
NM_002473chr224897 555 507 248 ------
NM_002499chr1522082 255 12131 11697 --
NM_002500chr21363 ------
NM_002501chr19103707 1445 1432 1310 1027 925 894 432 252 210 --12969 --
NM_002506chr1148 ------
NM_002507chr1761939 1775 1337 1308 686 305 11249 ----
NM_002519chr1111325 ------
NM_002522chr1772890 2601 2407 1222 961 865 768 12902 ----
NM_002537chr153845 702 682 1963 ----
NM_002539chr21287 ------
NM_002545chr112252 88 ------
NM_002569chr1551089 1076 444 168 145 ------
NM_002581chr944868 4801 3949 1037 13857 ----
NM_002586chr651555 1072 499 206 186 ------
NM_002599chr1161004 743 391 247 146 88 ------
NM_002601chr21335 ------
NM_002608chr2231576 357 332 --1184 --
NM_002609chr51745 1510 181 --
NM_002612chr7--142 ----
NM_002623chr201230 ------
NM_002628chr311083 ------
NM_002634chr175866 624 276 39 30 ------
NM_002636chr61152 ------
NM_002651chr13332 311 209 --1883 --
NM_002653chr53808 322 24 --1723 --
NM_002655chr844716 4253 1888 798 ------
NM_002667chr61200 ------
NM_002698chr19102861 2735 2672 2508 2433 2028 1051 911 820 125 1862 ----
NM_002699chr12454 314 --1543 --
NM_002714chr641046 803 789 371 ------
NM_002716chr1143190 2999 2940 1340 ------
NM_002718chr33615 445 364 ------
NM_002745chr2214430 ------
NM_002746chr164482 216 132 31 ------
NM_002751chr224842 809 384 40 1227 ----
NM_002752chr5155 ------
NM_002755chr152595 63 ------
NM_002758chr172489 166 ------
NM_002779chr107533 493 370 155 95 81 70 1434 ----
NM_002786chr111200 ------
NM_002821chr67727 705 517 321 217 145 93 ------
NM_002827chr2051603 1350 564 501 118 1285 ----
NM_002839chr922987 2331 ------
NM_002840chr141170 1062 566 413 ------
NM_002844chr61872 ------
NM_002858chr11276 ------
NM_002859chr1251593 1386 392 382 194 11533 ----
NM_002867chr12535 466 ------
NM_002868chr1232282 2144 218 12220 ----
NM_002881chr211420 ------
NM_002886chr344972 4184 4172 1178 ------
NM_002897chr21725 ------
NM_002899chr3149 ------
NM_002911chr1931559 1442 514 --11318 --
NM_002912chr61695 ------
NM_002941chr311147 ------
NM_002942chr311056 ------
NM_002945chr171622 ------
NM_002956chr12127 ------
NM_002959chr153098 2994 2883 1422 276 ------
NM_002972chr221239 ------
NM_002977chr222801 1328 ------
NM_003016chr171162 --11784 --
NM_003030chr3--1242 1757 --
NM_003034chr1221417 102 ------
NM_003039chr1141 ------
NM_003045chr1384862 4267 3765 1342 775 702 616 188 --13278 --
NM_003047chr161313 1211 1026 563 293 131 ------
NM_003069chrX2598 25 ------
NM_003070chr91216 1297 ----
NM_003076chr123316 145 49 ------
NM_003098chr202119 59 --1338 --
NM_003105chr111115 ------
NM_003118chr542034 740 417 400 ------
NM_003128chr21995 ------
NM_003131chr681762 1479 1460 857 550 500 167 93 11786 ----
NM_003137chr642016 1414 472 427 ------
NM_003139chr112657 126 --1229 --
NM_003156chr1131265 371 125 1508 ----
NM_003161chr17----1880 --
NM_003173chrX4531 374 96 38 ------
NM_003185chr201958 ------
NM_003188chr61535 ------
NM_003189chr163204 3113 822 611 563 61 --1749 --
NM_003200chr1961917 1737 1720 1525 959 914 --2826 81 --
NM_003204chr1731199 679 140 31225 1107 504 ----
NM_003216chr22103295 3161 2893 2479 2353 1090 836 609 596 573 ------
NM_003221chr631253 1045 638 12959 ----
NM_003222chr202899 333 ------
NM_003223chr162237 117 ------
NM_003236chr253033 1359 1291 370 145 ------
NM_003246chr15171 ------
NM_003253chr2131559 268 241 ------
NM_003255chr1751052 984 361 239 171 --1923 --
NM_003286chr201961 ------
NM_003325chr221179 ------
NM_003339chr51601 ------
NM_003342chr1722018 41 ------
NM_003345chr161191 ------
NM_003349chr2041300 1122 438 369 11156 ----
NM_003356chr1111016 ------
NM_003369chr1142110 2059 594 175 12008 1214 --
NM_003370chr193775 535 487 ------
NM_003387chr232150 1898 849 ------
NM_003390chr111343 ------
NM_003392chr3----13012 --
NM_003407chr191489 ------
NM_003458chr321313 489 ------
NM_003463chr61751 2475 48 ----
NM_003468chr22592 315 ------
NM_003470chr1641592 1360 660 562 ------
NM_003482chr1252196 1854 476 450 298 --21877 361 --
NM_003483chr1222384 2112 ------
NM_003485chr142349 64 --156 --
NM_003488chr17151 ------
NM_003557chr131530 1256 196 ------
NM_003559chr1732875 2634 122 ------
NM_003563chr1721375 1148 ------
NM_003564chr12641 262 ------
NM_003566chr12--1188 ----
NM_003575chr721093 292 ------
NM_003581chr221031 33 ------
NM_003583chr1233561 3365 2386 ------
NM_003586chr162484 41 --1140 --
NM_003590chr2--13902 ----
NM_003593chr17171 ------
NM_003601chr4----159 --
NM_003607chr153945 2736 1262 1186 391 ------
NM_003624chr1941176 980 511 121 ------
NM_003629chr133123 3114 2450 --22949 2795 --
NM_003633chr552392 2135 2072 544 366 11827 ----
NM_003644chr17116049 5712 5493 4441 2293 2094 993 962 905 382 101 ------
NM_003654chr111262 ------
NM_003655chr17277 66 ------
NM_003656chr3142 ------
NM_003660chr193566 513 180 ------
NM_003663chr3--13146 ----
NM_003670chr33435 398 295 ------
NM_003673chr17146 ------
NM_003679chr112442 --1817 --
NM_003685chr192167 71 ------
NM_003701chr131870 ------
NM_003707chr3182 ------
NM_003709chr2--1402 ----
NM_003714chr572648 2537 1984 565 378 359 188 ------
NM_003718chr71131 ------
NM_003725chr121404 ------
NM_003740chr6121761 1462 754 655 647 625 600 516 372 321 181 132 ------
NM_003744chr1411083 ------
NM_003763chr2042895 2615 647 57 ------
NM_003774chr1213181 11179 ----
NM_003780chr14598 278 177 123 ------
NM_003791chr161140 ------
NM_003800chr611576 ------
NM_003829chr9----1101 --
NM_003885chr173611 341 105 ----1535
NM_003893chr103454 399 189 ------
NM_003906chr21127 ------
NM_003913chr633961 1647 457 ------
NM_003924chr42414 254 1130 ----
NM_003930chr71694 ------
NM_003936chr251172 1159 1125 1051 286 ------
NM_003947chr31175 11076 ----
NM_003953chr1--1398 ----
NM_003958chr643618 3492 3448 493 ------
NM_003982chr141245 ------
NM_003994chr1233102 592 269 ------
NM_004024chr14543 498 284 84 ------
NM_004028chr1812544 ------
NM_004040chr2--11116 1275 --
NM_004050chr1422187 1721 ------
NM_004055chr11112177 2146 2022 1934 1570 1486 1474 857 834 640 61 ------
NM_004067chr71217 ------
NM_004068chr31143 ------
NM_004080chr7146 ------
NM_004081chrY11438 11464 ----
NM_004089chrX31004 355 274 1217 ----
NM_004093chr131454 ------
NM_004094chr1432147 1215 270 ------
NM_004097chr25840 785 235 134 66 1905 ----
NM_004103chr82682 83 ------
NM_004112chr1721473 629 1200 11749 --
NM_004117chr62529 55 ------
NM_004124chr141680 ------
NM_004153chr13219 61 31 ------
NM_004157chr31853 ------
NM_004161chr211404 ------
NM_004162chr341027 800 382 300 ------
NM_004171chr1139266 3700 3081 17695 ----
NM_004185chr11265 ------
NM_004193chr102383 77 ------
NM_004202chrY1277 ------
NM_004215chr81454 ------
NM_004225chr811218 ------
NM_004227chr722544 776 ------
NM_004228chr19166 ------
NM_004235chr91202 ------
NM_004240chr19150 ------
NM_004286chr2292554 2546 942 936 908 835 757 541 262 --12290 --
NM_004302chr1222320 924 ------
NM_004309chr173931 870 440 ------
NM_004311chr1021959 330 ------
NM_004321chr283359 3305 2986 2903 2343 2262 594 113 --12563 --
NM_004326chr11395 ------
NM_004331chr81260 ------
NM_004343chr191484 ------
NM_004349chr81192 1953 ----
NM_004350chr131954 673 66 ------
NM_004370chr61137 ------
NM_004379chr21414 ------
NM_004380chr1622357 1926 --12151 --
NM_004386chr1922255 2016 ------
NM_004393chr392072 1920 908 834 779 771 691 138 41 ------
NM_004395chr53786 670 161 ------
NM_004405chr22330 172 --1250 --
NM_004409chr193178 143 113 ------
NM_004416chr122941 843 ------
NM_004418chr22402 76 ------
NM_004420chr1152152 2042 1865 694 638 ------
NM_004422chr172448 24 ------
NM_004423chr352032 1071 912 827 803 ------
NM_004428chr11152 ------
NM_004429chrX51137 1105 1038 499 161 ------
NM_004431chr14538 194 140 80 ------
NM_004433chr12719 675 ------
NM_004436chr1158 ------
NM_004437chr143468 2803 979 844 22261 1224 ----
NM_004438chr252587 2581 680 587 477 1175 ----
NM_004441chr31994 ------
NM_004442chr141209 663 310 117 11626 ----
NM_004443chr31759 ------
NM_004450chr14136 ------
NM_004451chr113533 261 84 ------
NM_004457chr21404 ------
NM_004458chrX1456 ------
NM_004459chr17--11936 ----
NM_004463chrX2177 139 ------
NM_004472chr51187 ------
NM_004474chr15813 374 275 180 112 ------
NM_004481chr152275 959 814 534 226 ------
NM_004491chr1964103 3601 3425 1557 870 187 ------
NM_004494chr151055 1027 435 426 308 ------
NM_004502chr172468 402 ------
NM_004513chr1553595 1326 585 118 75 ------
NM_004514chr172457 331 ------
NM_004515chr1167 ------
NM_004517chr111176 ------
NM_004560chr93385 214 119 --1416 --
NM_004576chr5175 ------
NM_004577chr71501 ------
NM_004586chrX11283 ------
NM_004588chr1183279 3005 926 624 434 401 219 125 14051 22849 2730 --
NM_004598chr511071 ------
NM_004602chr202177 99 ------
NM_004603chr74936 326 149 36 ------
NM_004609chr201389 ------
NM_004626chr112282 72 ------
NM_004630chr1141137 868 294 150 ------
NM_004634chr31503 ------
NM_004636chr3------1163
NM_004647chr192243 129 ------
NM_004655chr171144 ------
NM_004656chr351054 494 480 471 418 1799 ----
NM_004667chr151219 ------
NM_004687chr171234 ------
NM_004694chr17155 ------
NM_004703chr171750 ------
NM_004730chr531831 814 677 ------
NM_004737chr222935 322 ------
NM_004742chr31419 ------
NM_004755chr141433 ------
NM_004758chr174855 812 299 79 ------
NM_004762chr1761759 1728 711 580 567 34 ------
NM_004772chr51248 ------
NM_004774chr1723015 1248 ------
NM_004776chr2012026 183 12389 --
NM_004783chr163478 456 239 ------
NM_004785chr164334 314 177 55 ------
NM_004791chr13142 ------
NM_004807chr272185 2174 2031 757 422 251 177 --22127 2048 --
NM_004815chr123778 88 ------
NM_004822chr17203981 3648 3606 3267 2547 2524 2518 1478 1314 1304 1133 1113 1072 821 702 600 558 309 240 100 --21521 1082 --
NM_004838chr193147 71 46 ------
NM_004841chr12758 230 ------
NM_004857chr14--11824 ----
NM_004859chr1722912 242 12585 ----
NM_004871chr1733382 3152 1364 ------
NM_004873chr1442977 2689 2598 804 ------
NM_004888chr91403 ------
NM_004926chr141437 ------
NM_004952chr13921 124 42 192 ----
NM_004953chr31171 ------
NM_004956chr724437 132 ------
NM_004965chr211582 ------
NM_004968chr72571 538 ------
NM_004985chr123956 461 266 ------
NM_004992chrX117827 7587 6474 6428 5716 5392 3329 3038 2960 1940 1599 11927 ----
NM_004992chrX117827 7587 6474 6428 5716 5392 3329 3038 2960 1940 1599 11927 ----
NM_004994chr201130 ------
NM_005011chr721152 702 --1758 --
NM_005017chr31251 ------
NM_005022chr17189 ------
NM_005028chr10----12202 --
NM_005029chr10199 ------
NM_005045chr71871 ------
NM_005052chr173280 233 115 ------
NM_005055chr112148 23 ------
NM_005056chr1265388 3754 3696 3638 3580 1540 11009 ----
NM_005063chr1063357 3095 3046 1471 1305 1068 ------
NM_005076chr164091 4048 1307 1180 842 827 23968 2896 ----
NM_005077chr9139 ------
NM_005078chr1541749 408 180 101 --1726 --
NM_005079chr813055 --13189 --
NM_005094chr93637 619 101 ------
NM_005095chr13818 676 588 ------
NM_005116chr2054064 2778 1783 710 370 --23820 1305 --
NM_005121chr1723387 3366 1109 ----
NM_005137chr22102156 2122 2079 886 812 492 459 322 206 129 1355 11889 --
NM_005180chr101322 ------
NM_005182chr16150 ------
NM_005194chr201403 --1437 --
NM_005197chr1444271 2358 1924 1655 ------
NM_005202chr151406 914 729 670 288 ------
NM_005219chr561650 1433 1136 437 361 306 ------
NM_005229chrX1849 ------
NM_005230chr12160 ------
NM_005238chr111247 13079 ----
NM_005239chr2122028 1262 ------
NM_005240chr11544 ------
NM_005252chr142290 149 ------
NM_005273chr74243 113 104 21 ------
NM_005277chr411689 ------
NM_005281chr1167 ------
NM_005311chr72844 288 ------
NM_005312chr962129 2107 988 733 658 205 ------
NM_005329chr1632174 1967 442 ------
NM_005337chr121333 ------
NM_005339chr4--24122 982 ----
NM_005354chr19148 ------
NM_005359chr1855376 5241 5160 4890 4198 --16156 --
NM_005368chr223437 59 34 ------
NM_005380chr131126 356 51 --11250 1401
NM_005388chr92488 302 ------
NM_005392chr94720 545 319 104 1426 ----
NM_005397chr763917 2573 1296 920 651 138 1738 ----
NM_005399chr153762 3545 3293 3129 418 13411 14098 --
NM_005417chr2061926 1436 438 279 160 67 --21932 737 --
NM_005418chr113740 645 555 ------
NM_005433chr1832231 2163 545 ------
NM_005436chr1012649 1179 ----
NM_005437chr10194 ------
NM_005458chr931505 61 26 ------
NM_005465chr121967 761 ------
NM_005474chr1741322 286 103 27 11152 ----
NM_005475chr1212933 ------
NM_005477chr1562516 1944 1744 1583 874 289 21817 501 ----
NM_005477chr1562516 1944 1744 1583 874 289 21817 501 ----
NM_005487chr2221304 312 ------
NM_005494chr71600 ------
NM_005497chr1736131 4923 1636 ------
NM_005498chr195315 257 82 35 22 ------
NM_005502chr9--1751 ----
NM_005505chr123609 370 44 ------
NM_005523chr73310 282 32 ------
NM_005539chr1041398 479 344 291 ------
NM_005542chr71109 ------
NM_005550chr164245 229 33 21 ------
NM_005578chr333738 3589 209 ------
NM_005586chr62628 210 1515 ----
NM_005595chr11203 ------
NM_005596chr936212 6058 2130 ------
NM_005603chr18--11282 1346 --
NM_005614chr7----1905 --
NM_005618chr6------1535
NM_005647chrX63120 2503 1123 950 626 596 ------
NM_005652chr161178 ------
NM_005655chr81166 1105 ----
NM_005665chr12863 62 ------
NM_005668chr524105 2894 14251 ----
NM_005678chr153803 789 394 ------
NM_005688chr321011 63 ------
NM_005730chr12113412 3382 3350 2754 2591 2415 1408 1162 1093 848 814 ------
NM_005736chr1031463 1257 160 ------
NM_005737chr21607 ------
NM_005740chr223235 106 34 ------
NM_005742chr21586 ------
NM_005759chr221418 1384 14382 ----
NM_005780chr13249 39 ------
NM_005819chr163031 2619 2507 2402 1026 807 ------
NM_005826chr11206 ------
NM_005828chr17104871 4215 4091 4075 3794 3534 1652 755 609 34 ------
NM_005840chrX47481 4735 2781 111 ------
NM_005852chr175915 793 259 106 71 ------
NM_005871chr1021017 36 ------
NM_005880chr161472 ------
NM_005881chr164311 111 66 40 ------
NM_005883chr19132650 2313 2227 1951 1178 780 746 533 469 361 348 106 68 --32887 454 355 --
NM_005909chr533965 1667 757 ------
NM_005911chr221277 178 ------
NM_005920chr193651 2766 2573 938 734 680 529 473 78 11100 ----
NM_005928chr152177 42 ----1582
NM_005933chr112331 116 ------
NM_005934chr19112319 2280 2172 2040 856 649 528 339 230 202 21 ------
NM_005935chr425081 3628 ------
NM_005937chr1763615 3356 1138 1017 400 313 13466 ----
NM_005938chrX21182 121 ------
NM_005941chr822812 900 ------
NM_005943chr641437 606 262 183 187 ----
NM_005955chr185235 4805 4677 3390 3350 790 594 373 ------
NM_005962chr1022139 45 ------
NM_005962chr1022139 45 ------
NM_005964chr173543 326 59 ------
NM_005967chr122632 156 ------
NM_005990chr552308 1809 411 46 37 ------
NM_005994chr174877 174 156 43 ------
NM_005996chr122306 81 ------
NM_006026chr35455 419 329 139 35 ------
NM_006034chr1192332 1565 712 272 222 184 140 56 38 ------
NM_006035chr1431191 1067 72 ------
NM_006037chr264547 4115 3578 3214 554 282 ------
NM_006047chr2013241 ------
NM_006048chr11320 ------
NM_006079chr61550 ------
NM_006089chrX21539 1249 ------
NM_006090chr11220 ------
NM_006095chr421003 271 ------
NM_006110chr16128 ------
NM_006129chr81528 ------
NM_006133chr11122321 2282 2187 2142 1725 1634 931 633 564 541 269 27 --12266 --
NM_006135chr11105 ------
NM_006136chr721359 1199 ------
NM_006145chr194872 271 249 110 1761 ----
NM_006148chr1772881 2674 1148 536 293 244 175 ------
NM_006160chr172182 115 --1503 --
NM_006161chr51468 ------
NM_006166chr1212541 ------
NM_006172chr1174 137 ----
NM_006176chr111734 ------
NM_006195chr911084 ------
NM_006201chrX3863 845 471 ------
NM_006203chr525298 4836 ------
NM_006224chr1711646 ------
NM_006237chr1332283 904 62 ------
NM_006245chr621049 1006 ------
NM_006256chr12530 405 12063 ----
NM_006259chr41364 ------
NM_006268chr111285 ------
NM_006293chr153988 345 234 ------
NM_006320chr42219 29 ------
NM_006325chr121150 ------
NM_006328chr111132 ------
NM_006336chr961493 1179 1055 563 531 80 --11250 --
NM_006337chr122120 25 ------
NM_006338chr13145 129 71 ------
NM_006369chr11353 1370 ----
NM_006379chr71359 ------
NM_006383chr152528 170 127 ----
NM_006400chr122301 241 ------
NM_006401chr91387 ------
NM_006411chr62842 68 ------
NM_006420chr2012530 ------
NM_006421chr82945 250 ------
NM_006449chr231902 1763 72 ------
NM_006458chr11280 64 ------
NM_006469chr121326 637 ------
NM_006482chr1233561 3365 2386 ------
NM_006494chr192779 606 ------
NM_006521chrX1259 11371 ----
NM_006526chr2011876 11337 ----
NM_006540chr8138 ------
NM_006544chr14--14393 ----
NM_006546chr1765357 5253 4294 4187 763 107 ------
NM_006548chr321631 242 ------
NM_006560chr11135 ------
NM_006561chr1025092 2438 ------
NM_006565chr161939 ------
NM_006570chr9198 ------
NM_006584chr171126 ------
NM_006591chr1111741 ------
NM_006599chr1617714 ------
NM_006609chr212349 ------
NM_006614chr313047 ------
NM_006618chr131530 1404 1018 ------
NM_006644chr131446 ------
NM_006646chr1331107 881 150 22007 1913 ----
NM_006650chr572559 2475 1537 752 733 410 137 ------
NM_006651chr461416 1305 1110 1063 418 355 ------
NM_006662chr162321 120 ------
NM_006690chr2071932 1900 1878 1504 651 590 62 --11468 --
NM_006693chr72815 309 1595 ----
NM_006694chr1128 ------
NM_006696chr53115 72 65 ------
NM_006698chr2021344 384 ------
NM_006703chr61175 ------
NM_006717chr922958 2371 ------
NM_006734chr61212 11100 ----
NM_006741chr1221004 993 ------
NM_006754chr7--1217 ----
NM_006762chr131238 162 93 --1215 --
NM_006766chr822607 987 ------
NM_006775chr612945 ------
NM_006777chrX12259 ------
NM_006795chr1181394 1368 1319 1225 992 552 531 163 ------
NM_006802chr12914 834 ------
NM_006804chr173519 213 26 ------
NM_006805chr521737 1236 ------
NM_006806chr211107 ------
NM_006807chr172500 263 ------
NM_006815chr122965 901 ------
NM_006816chr53249 32 21 ------
NM_006826chr211240 ------
NM_006852chr1742587 2489 2247 991 11810 ----
NM_006854chr711948 ------
NM_006856chr123760 193 148 ------
NM_006861chr1261858 1728 1694 1599 552 533 ------
NM_006870chr20188 ------
NM_006876chr113619 573 540 ------
NM_006884chr3--1242 1757 --
NM_006888chr1412771 ------
NM_006892chr2011252 1314 ----
NM_006892chr2011252 1314 ----
NM_006899chr201138 ------
NM_006901chr151158 ------
NM_006906chr114268 242 84 77 ------
NM_006908chr711314 ------
NM_006920chr211858 ------
NM_006924chr1713956 ------
NM_006927chr1651457 775 641 583 273 --42229 445 358 152 --
NM_006931chr1211953 ------
NM_006936chr212191 23 ------
NM_006940chr1221728 1495 ------
NM_006941chr224856 413 313 136 ------
NM_006950chrX149 ------
NM_006990chr172102 2034 1950 867 793 530 327 12125 ----
NM_006991chr3----1146 --
NM_007001chr9143 ------
NM_007011chr1576328 6302 6195 5927 1697 1608 671 ------
NM_007034chr11143 ------
NM_007038chr2111736 1240 15864 --
NM_007039chr1421575 230 ------
NM_007042chr33888 259 162 ------
NM_007050chr20167377 6612 6326 6310 6020 5496 2777 2489 2326 2054 1260 794 629 590 490 172 16592 22020 999 --
NM_007069chr11149 ------
NM_007078chr101489 ------
NM_007097chr5140 ------
NM_007122chr13583 232 26 ------
NM_007124chr61326 ------
NM_007144chr1741220 328 279 62 1877 ----
NM_007146chr1722492 2232 ------
NM_007158chr11992 ------
NM_007173chr11134 1833 ----
NM_007174chr1241980 1935 889 732 ------
NM_007185chr13393 353 93 ------
NM_007189chr72579 22 --1570 --
NM_007197chr12--1853 ----
NM_007203chr943413 3072 2810 1006 ------
NM_007213chrX1268 ------
NM_007221chr12390 77 ------
NM_007222chr8--1553 ----
NM_007236chr152610 575 ------
NM_007245chr163824 668 104 ------
NM_007249chr1338795 6342 2769 --1208 --
NM_007275chr31148 1347 ----
NM_007276chr72788 54 ------
NM_007278chr17130 ------
NM_007308chr41215 ------
NM_007322chr192511 121 ------
NM_007327chr93881 430 274 --1949 --
NM_007359chr171102 11180 ----
NM_012074chr142741 325 ------
NM_012081chr523692 2938 13007 ----
NM_012090chr11495 ------
NM_012095chr1012967 ------
NM_012099chr19154 1822 1226 --
NM_012134chr141637 1395 1220 428 ------
NM_012154chr82628 307 --1798 --
NM_012156chr2073136 3109 3055 2704 2556 1302 65 ------
NM_012164chr925768 176 --1764 --
NM_012193chr1155173 4963 3951 3516 425 ------
NM_012199chr133315 2889 423 13920 ----
NM_012200chr11158 ------
NM_012215chr1031615 1437 223 1270 ----
NM_012223chr211059 ------
NM_012232chr1722171 2138 --1756 --
NM_012234chr31815 ------
NM_012249chr21504 ------
NM_012264chr2241636 662 655 184 ------
NM_012264chr2241636 662 655 184 ------
NM_012268chr192236 37 ------
NM_012286chrX--1113 ----
NM_012294chr763479 3248 2787 2544 2517 1382 --13394 --
NM_012296chr1173441 2925 2515 1196 789 748 175 ------
NM_012297chr4--11934 ----
NM_012298chr32211 23 1142 ----
NM_012300chr51453 ------
NM_012301chr71226 ------
NM_012307chr181807 ------
NM_012308chr114937 335 293 85 11596 ----
NM_012309chr1183968 3873 3192 1465 904 557 303 167 ------
NM_012323chr2231137 465 139 ------
NM_012325chr201275 ------
NM_012396chr13555 470 262 1535 ----
NM_012402chr114383 220 172 130 1978 ----
NM_012405chr163667 3578 3249 2791 760 30 ------
NM_012407chr221537 ------
NM_012428chr151216 ------
NM_012432chr1156 ------
NM_012446chr51168 ------
NM_012448chr1722460 1953 ------
NM_012458chr193516 463 416 192 ----
NM_012465chr1032637 2328 826 ------
NM_012473chr222750 290 1252 ----
NM_012478chr17172 ------
NM_012479chr721925 666 ------
NM_013235chr51824 ------
NM_013261chr413129 --13667 --
NM_013269chr121783 ------
NM_013279chr1182123 1955 1936 1728 1693 763 623 224 --12289 --
NM_013282chr19--186 ----
NM_013283chr51732 ------
NM_013312chr19178 ------
NM_013313chr2243501 2914 1245 854 ------
NM_013323chr1741209 903 851 42 ------
NM_013365chr224744 625 234 212 ------
NM_013390chr91331 11775 ----
NM_013400chr721014 151 ------
NM_013401chr115842 818 751 293 85 --1183 --
NM_013411chr111976 12382 ----
NM_013433chr1971956 1671 1414 1305 620 457 296 --11965 --
NM_013443chr971133 1080 983 973 236 158 124 ------
NM_013446chr731208 955 139 ------
NM_013952chr252590 2126 2047 850 439 ------
NM_013953chr252590 2126 2047 850 439 ------
NM_013992chr252590 2126 2047 850 439 ------
NM_013995chrX12357 ------
NM_014001chr1731058 1038 352 ------
NM_014010chr93571 494 76 1109 ----
NM_014021chr123184 964 ------
NM_014023chr1021836 944 --1926 --
NM_014030chr172267 59 ------
NM_014079chr33691 357 211 ------
NM_014117chr161841 ------
NM_014155chr111152 ------
NM_014157chr1673525 3300 1430 969 505 142 73 1333 ----
NM_014159chr3170 1239 ----
NM_014170chr31323 ------
NM_014190chr451627 1529 1469 508 268 ------
NM_014216chr1461486 1344 663 609 405 56 ------
NM_014217chr111665 1368 ----
NM_014232chr17136 11407 ----
NM_014232chr17136 11407 ----
NM_014243chr412065 ------
NM_014250chr2221304 312 ------
NM_014253chrX1385 ------
NM_014271chrX1134 ----1670
NM_014283chr121405 486 ------
NM_014289chrX1266 ------
NM_014292chr2271487 1406 1336 545 533 440 26 --11419 --
NM_014298chr16--1210 ----
NM_014299chr1961843 1816 1737 1398 815 135 1823 21970 1684 --
NM_014309chr2235166 1408 1392 --12131 --
NM_014319chr12--1522 ----
NM_014326chr1561399 1284 1241 240 126 39 ------
NM_014338chr223840 97 56 ------
NM_014351chr2221230 529 --1910 --
NM_014352chr1131416 360 157 ------
NM_014374chr721014 151 ------
NM_014376chr532121 799 156 ------
NM_014382chr321257 387 ------
NM_014423chr512176 ------
NM_014432chr61201 ------
NM_014445chr322429 1514 1344 ----
NM_014470chr122310 127 1319 ----
NM_014488chr112151 49 ------
NM_014494chr1622314 689 ------
NM_014502chr113383 263 29 ------
NM_014515chr121232 ------
NM_014521chr211750 ------
NM_014554chr1212139 11456 ----
NM_014574chr14152 ------
NM_014577chr221758 --124 --
NM_014604chr173225 176 97 ------
NM_014614chr231058 478 447 ------
NM_014646chr18112816 2052 1052 1025 883 753 538 443 283 215 29 ------
NM_014661chr10133828 3748 3329 3315 3234 3057 2853 691 657 386 128 98 71 12890 ----
NM_014663chr121009 993 ------
NM_014665chr8113287 3038 2676 1427 1376 1065 827 506 356 221 59 1122 ----
NM_014666chr51412 ------
NM_014667chr332228 2179 1716 ------
NM_014670chr21117 ------
NM_014680chr172244 77 ------
NM_014682chr812199 21697 1506 ----
NM_014686chr1922413 247 ------
NM_014690chr732384 277 269 ------
NM_014701chr1523147 407 ------
NM_014711chr1621771 1364 ------
NM_014712chr161388 ------
NM_014726chr1741356 935 529 343 ------
NM_014729chr821644 1572 ------
NM_014730chr1285139 4972 4528 3943 2059 1833 995 684 ------
NM_014730chr1285139 4972 4528 3943 2059 1833 995 684 ------
NM_014747chr1145486 5280 4876 4734 4656 4650 4482 4473 3756 1779 1704 1688 1365 850 34548 4409 685 11223 --
NM_014752chr1121751 323 ------
NM_014755chr224095 2608 13262 ----
NM_014761chr161820 ------
NM_014762chr132087 1738 683 --1283 --
NM_014765chr112715 ------
NM_014766chr7--21454 1118 ----
NM_014767chr10103251 2684 2383 2291 1471 1396 1347 960 637 595 11137 ----
NM_014770chr122302 39 1257 ----
NM_014771chr162852 110 ------
NM_014772chr1873532 3525 3395 2227 2203 1015 436 --13254 --
NM_014776chr1222793 2060 --12174 --
NM_014779chr31283 ------
NM_014786chr114841 817 805 297 ------
NM_014797chr633100 2415 1057 1581 ----
NM_014798chr1741672 1179 749 567 1561 ----
NM_014802chr121207 ------
NM_014810chr121196 48 ------
NM_014819chr51708 ------
NM_014826chr153945 2736 1262 1186 391 ------
NM_014828chr14182 11711 ----
NM_014840chr1242755 1317 749 216 ------
NM_014847chr1143 ------
NM_014850chr374297 3879 3866 3397 1587 1550 1450 ------
NM_014851chr15780 635 596 444 250 1521 21913 25 --
NM_014859chr1741086 936 545 45 ------
NM_014869chr32949 88 --1491 --
NM_014871chr121500 1122 ----
NM_014872chr922121 858 12011 ----
NM_014876chr2261955 1597 1554 409 394 75 ------
NM_014877chr1756154 5607 5395 2160 1759 17687 ----
NM_014883chr42945 696 1905 ----
NM_014891chr741670 521 133 37 ------
NM_014901chr531905 1827 666 --1258 --
NM_014903chr122764 460 ------
NM_014904chr1053774 3512 3490 1093 218 ------
NM_014909chr1483803 2916 2863 1040 914 907 791 785 1191 12422 --
NM_014912chr102513 131 176 ----
NM_014921chr19102729 2543 1102 1004 837 807 357 170 134 103 --32931 1900 1015 --
NM_014923chr131224 1528 ----
NM_014924chr1442229 329 321 315 ------
NM_014931chr194619 610 586 73 ------
NM_014934chr1323071 1181 ------
NM_014935chr1103289 3115 3054 2900 2714 1184 1126 531 258 251 ------
NM_014938chr1282394 2327 1823 768 541 370 174 105 12297 1327 --
NM_014939chr1811263 11378 ----
NM_014945chr511977 1588 ----
NM_014952chr1551815 1743 1369 1281 288 --1704 --
NM_014974chr1011158 ------
NM_014977chr141101 ------
NM_014988chr432710 989 90 ------
NM_014989chr611641 ------
NM_014991chr412075 ------
NM_014996chr31123 ------
NM_015000chr12--1436 ----
NM_015020chr1633106 175 169 ------
NM_015023chr131740 1608 1375 ------
NM_015027chr1611820 ------
NM_015033chr962516 391 331 314 232 183 --12563 --
NM_015035chr2056685 4328 4063 1585 1164 ------
NM_015039chr123219 1573 ------
NM_015042chr1573359 3235 3170 2739 2705 1170 41 ------
NM_015051chr952955 2876 2667 2230 1128 ------
NM_015075chrX52171 1462 882 497 314 ------
NM_015080chr112907 84 ------
NM_015082chr542475 940 432 25 ------
NM_015090chr1136131 5323 5081 5070 4737 4074 3980 2365 1978 1762 646 555 126 --25416 4223 --
NM_015091chr14--1806 ----
NM_015092chr16--23573 114 --13535
NM_015094chr22124266 3728 3658 3429 3303 3137 3029 1679 695 575 288 266 ------
NM_015100chr121711 1525 165 ----
NM_015107chrX32333 848 594 ------
NM_015136chr32129 91 ------
NM_015138chr1532592 243 226 2675 573 ----
NM_015144chr1633499 3187 964 ------
NM_015150chr33354 336 302 ------
NM_015176chr111423 ------
NM_015186chr91381 ------
NM_015187chr41255 ------
NM_015191chr1131993 808 144 1981 ----
NM_015192chr2012446 ------
NM_015199chr322225 2218 ------
NM_015205chr1343994 1123 1032 641 ------
NM_015215chr1--1505 ----
NM_015225chr9----1580 --
NM_015229chr173790 730 470 ------
NM_015236chr411169 ------
NM_015239chr91125 ------
NM_015245chr672716 2443 2338 2020 1783 999 149 ------
NM_015250chr922037 237 ------
NM_015252chr21787 ------
NM_015254chr8122968 2498 2213 2203 2160 2047 1128 826 616 323 200 156 12669 ----
NM_015256chr51642 ------
NM_015260chr1931543 1433 176 ------
NM_015267chr122827 743 ------
NM_015270chr1232289 2174 1958 ------
NM_015272chr1621617 1600 ------
NM_015278chr612532 1419 ----
NM_015282chr242920 2518 2471 1986 --12606 --
NM_015284chr151341 756 257 153 94 150 1404 --
NM_015292chr123666 289 210 --1147 --
NM_015293chr6152 ------
NM_015305chr1431770 1401 408 ------
NM_015313chr1164428 4138 3906 3311 3159 680 ------
NM_015314chr71122 ------
NM_015315chr541013 494 442 23 ------
NM_015318chr1911680 --1588 --
NM_015326chr152138 1964 723 638 604 32464 1939 1177 ----
NM_015332chr763543 3448 3245 2828 2431 915 11362 ----
NM_015343chr171107 ------
NM_015347chr1231836 1042 79 ------
NM_015349chr622855 646 ------
NM_015355chr17----11602 --
NM_015365chrX44243 676 588 29 ------
NM_015378chr172856 2723 2343 2079 2028 646 353 ------
NM_015382chr14--1237 ----
NM_015393chr433566 2474 232 22801 2527 ----
NM_015401chr125795 333 270 215 85 1177 ----
NM_015436chr422940 163 ------
NM_015441chr11334 1152 ----
NM_015443chr171360 ------
NM_015446chr111132 ------
NM_015455chr523707 3635 ------
NM_015461chr181260 ------
NM_015464chr71327 ------
NM_015472chr3150 ------
NM_015472chr3150 ------
NM_015477chr151109 156 ----
NM_015481chr123992 172 63 ------
NM_015483chr7----1711 --
NM_015508chr321367 339 ------
NM_015526chr1911344 ------
NM_015528chr172166 130 ------
NM_015537chr961061 913 876 850 743 66 --11116 --
NM_015557chr1133526 3361 2985 2535 2214 1204 1098 1051 1037 956 790 185 62 ------
NM_015567chr132996 253 1438 ----
NM_015568chr2084222 3948 3909 1674 1432 1239 1080 273 23551 429 ----
NM_015570chr7----1623 --
NM_015575chr222466 850 ------
NM_015576chr31686 ------
NM_015589chr14152 ------
NM_015609chr172943 2832 2473 2168 2119 1116 764 1962 ----
NM_015638chr203574 170 32 ------
NM_015646chr1211264 ------
NM_015686chrX61854 1717 1576 856 708 187 1267 11621 --
NM_015691chrX62031 774 738 722 640 183 ------
NM_015704chr22137 ------
NM_015716chr17293 68 1270 ----
NM_015833chr2132066 1783 322 ------
NM_015850chr83962 131 69 ------
NM_015866chr111437 ------
NM_015872chr141614 558 355 90 --11181 --
NM_015892chr1032158 454 30 ------
NM_015898chr1981825 1680 1648 574 519 429 356 283 ------
NM_015902chr8--1224 ----
NM_015906chr11562 11271 ----
NM_015913chr11539 ------
NM_015964chr16--162 ----
NM_015995chr1595116 2119 1709 997 981 864 648 549 422 11719 15180 --
NM_016022chr12418 76 ------
NM_016032chrX41164 458 242 234 ------
NM_016037chr11244 ------
NM_016061chr21383 ------
NM_016131chr212247 ------
NM_016140chr16--162 ----
NM_016227chr121405 486 ------
NM_016235chr1631036 971 360 ------
NM_016250chr143710 616 82 ------
NM_016252chr21700 ------
NM_016270chr194328 133 107 41 ------
NM_016272chr2252102 1846 763 584 532 ------
NM_016275chr31709 ------
NM_016281chr121777 ------
NM_016284chr161944 ------
NM_016289chr221599 200 ------
NM_016290chr5149 ------
NM_016357chr12122 1399 ----
NM_016358chr54366 197 183 128 --1376 --
NM_016373chr16173 ------
NM_016376chr1722795 677 22886 245 ----
NM_016396chr1512167 ------
NM_016422chr1113087 ------
NM_016424chr1721466 67 ------
NM_016440chr191261 ------
NM_016451chr11--151 ----
NM_016453chr3159 ------
NM_016506chr112161 70 ------
NM_016507chr1722115 2077 ------
NM_016531chr41199 ------
NM_016532chr173975 862 378 ------
NM_016539chr195374 340 328 173 27 ------
NM_016547chr13635 501 225 --1647 --
NM_016569chr122306 81 ------
NM_016570chr121509 ------
NM_016575chr122380 73 ------
NM_016587chr72788 54 ------
NM_016596chr125795 333 270 215 85 1177 ----
NM_016603chr5--1900 ----
NM_016604chr51283 ------
NM_016605chr521792 298 12394 ----
NM_016621chr1193969 3435 3246 3065 2811 1492 792 609 453 ------
NM_016622chr231946 1931 676 12116 ----
NM_016623chr82256 220 ------
NM_016628chr101135 ------
NM_016836chr21725 ------
NM_016839chr21725 ------
NM_016950chr41404 ------
NM_017420chr141529 ------
NM_017423chr41335 ------
NM_017449chr141209 663 310 117 11626 ----
NM_017452chr202177 99 ------
NM_017453chr202177 99 ------
NM_017454chr202177 99 ------
NM_017455chr151216 ------
NM_017456chr1761759 1728 711 580 567 34 ------
NM_017457chr19166 ------
NM_017510chr52617 215 1564 ----
NM_017514chrX5672 662 182 90 28 ------
NM_017550chr194247 241 160 57 --1101 --
NM_017559chr172111 103 1264 ----
NM_017572chr19122 ------
NM_017593chr41357 ------
NM_017594chr922473 2351 ------
NM_017596chr194393 4208 3713 3474 1770 1659 1504 1077 320 ------
NM_017602chrX--1691 ----
NM_017610chr151284 --11922 --
NM_017626chr1021706 1353 ------
NM_017637chr938624 8608 7713 ------
NM_017640chr61306 ------
NM_017641chr12--11172 ----
NM_017651chr611566 --1621 --
NM_017660chr1953023 1300 405 244 29 11087 ----
NM_017664chr13--1181 ----
NM_017670chr113805 733 571 1637 ----
NM_017686chr111064 ------
NM_017694chr221437 718 ------
NM_017703chr191387 ------
NM_017709chr11962 1164 ----
NM_017730chr32289 276 ------
NM_017740chr1661712 1469 1341 1265 260 58 ------
NM_017742chr1811775 ------
NM_017749chr112688 367 1241 ----
NM_017762chr1522025 921 ------
NM_017763chr1721021 51 ------
NM_017772chr651655 1309 1230 303 216 ------
NM_017789chr23749 650 549 1561 ----
NM_017790chr9--1117 ----
NM_017799chr1441796 1493 1393 1327 ------
NM_017801chr322580 946 22003 1854 ----
NM_017805chr19--1168 146 --
NM_017824chr101611 ------
NM_017849chr252615 2316 1190 1023 975 ------
NM_017873chr982491 2158 2111 2001 1062 647 259 85 ------
NM_017893chr1021184 58 ------
NM_017910chr21254 ------
NM_017933chr221496 348 ------
NM_017944chr1121987 163 ------
NM_017994chr752848 2453 1195 844 72 ------
NM_018018chr121692 ------
NM_018028chr1911195 --169 --
NM_018032chr163934 233 62 ------
NM_018045chr132381 986 855 11072 ----
NM_018061chr111175 11729 ----
NM_018063chr101342 ------
NM_018067chr12484 106 ------
NM_018084chr222408 30 ------
NM_018085chr137452 6940 36 17354 ----
NM_018092chr161629 ------
NM_018095chr112161 70 ------
NM_018113chr122442 362 ------
NM_018128chr1711135 ------
NM_018133chr322084 1539 ------
NM_018156chr172856 2723 2343 2079 2028 646 353 ------
NM_018157chr1222520 2360 11111 ----
NM_018167chr14--1347 ----
NM_018171chr121824 ------
NM_018178chr11149 ------
NM_018181chr1821518 474 ------
NM_018184chr332158 1585 337 12112 ----
NM_018193chr152521 35 ------
NM_018198chr141392 1083 949 343 --11400 --
NM_018202chr1----1971 --
NM_018208chr121126 776 11017 ----
NM_018223chr122905 119 ------
NM_018240chr12716 199 ------
NM_018254chr112009 ------
NM_018275chr7173 ------
NM_018293chr312564 ------
NM_018320chr1161198 1157 1095 1046 196 113 ------
NM_018330chr101644 ------
NM_018364chr11219 ------
NM_018367chr112284 166 ------
NM_018371chr81154 ------
NM_018373chr1456105 4679 4310 2207 2039 ------
NM_018403chr333662 3064 568 --1425 --
NM_018419chr20121 ------
NM_018429chr5--11028 ----
NM_018440chr825248 2800 ------
NM_018462chr3--1110 ----
NM_018486chrX1408 ------
NM_018489chr111795 ------
NM_018557chr221344 1087 ------
NM_018667chr16102438 1983 1800 782 689 609 547 169 58 22 --22337 456 --
NM_018688chr84762 332 311 233 ------
NM_018689chr1562253 1970 1905 1076 773 136 ------
NM_018715chr122030 510 21880 544 ----
NM_018718chr72718 344 ------
NM_018719chr711161 --11279 --
NM_018890chr711314 ------
NM_018898chr512221 ------
NM_018899chr512221 ------
NM_018900chr512221 ------
NM_018901chr512221 ------
NM_018902chr512221 ------
NM_018903chr512221 ------
NM_018904chr512221 ------
NM_018905chr512221 ------
NM_018906chr512221 ------
NM_018907chr512221 ------
NM_018908chr512221 ------
NM_018909chr512221 ------
NM_018910chr512221 ------
NM_018911chr512221 ------
NM_018945chr622291 324 ------
NM_018951chr71133 ------
NM_018976chr1242436 1869 976 965 ------
NM_019006chr151255 ------
NM_019022chr181751 12806 ----
NM_019044chr254477 3903 3725 1156 559 ------
NM_019046chr102831 237 ------
NM_019050chr421796 558 ------
NM_019058chr101728 ------
NM_019084chr1012462 1344 ----
NM_019106chr2223248 526 ------
NM_019114chr932415 2383 1995 --164 --
NM_019556chrX1552 ------
NM_019593chr20196 --12017 --
NM_019594chr941621 1421 561 270 ------
NM_019610chr111504 ------
NM_019613chr174881 93 86 78 ------
NM_019843chr22186 ------
NM_019845chr22722 328 ------
NM_019885chr272271 2174 2125 1187 889 804 164 1916 12502 --
NM_020039chr1231655 730 398 ------
NM_020122chr235007 4836 734 ------
NM_020148chr1842995 974 102 68 ------
NM_020159chr4--11736 ----
NM_020177chr512707 12197 ----
NM_020180chr1841314 440 388 64 ------
NM_020182chr2042915 2498 1086 21 --1777 --
NM_020184chr24840 219 52 40 ------
NM_020199chr511155 ------
NM_020205chr112801 ------
NM_020211chr154999 963 505 29 ------
NM_020248chr172107 1760 1748 827 721 519 65 1871 ----
NM_020309chr191279 1903 ----
NM_020310chr1772060 975 868 833 809 583 514 --11996 --
NM_020336chr2043564 2713 2682 2628 ------
NM_020342chr21183 ------
NM_020357chr31641 ------
NM_020362chr12234 132 ------
NM_020416chr422011 152 --11080 --
NM_020420chrY11438 11464 ----
NM_020438chr92515 203 11276 ----
NM_020443chr1126951 6839 6350 6104 5494 5298 4334 2384 2112 1631 316 276 11055 ----
NM_020463chr211279 ------
NM_020475chr852280 1734 855 398 290 --11894 --
NM_020476chr852280 1734 855 398 290 --11894 --
NM_020477chr852280 1734 855 398 290 --11894 --
NM_020478chr852343 1797 918 461 353 --11957 --
NM_020480chr852280 1734 855 398 290 --11894 --
NM_020530chr225901 312 283 249 85 ------
NM_020638chr121287 ------
NM_020640chr32207 190 ------
NM_020672chr12224 48 ------
NM_020692chr146958 946 866 820 446 226 1337 ----
NM_020698chr1243092 2212 2203 659 ------
NM_020699chr164546 4383 4155 3846 3723 2084 --11868 --
NM_020708chr2051990 1904 322 227 24 ------
NM_020713chr20123128 3050 2658 2458 2365 2207 2014 1124 901 892 359 279 22089 1201 12849 --
NM_020715chr14------190
NM_020724chr432564 797 628 --1734 --
NM_020728chr712220 1647 ----
NM_020734chr1213158 13168 ----
NM_020747chr51290 ------
NM_020755chr6--1252 ----
NM_020764chr165315 250 211 142 37 --1887 --
NM_020769chrX1830 ------
NM_020772chr1726338 2457 ------
NM_020774chr1834696 2483 872 ------
NM_020778chr1534890 860 22 --1235 --
NM_020794chr1--11576 ----
NM_020795chr1751849 1545 1538 1482 200 11582 ----
NM_020796chr522518 172 ------
NM_020804chr672410 2257 2047 1988 1742 702 202 ------
NM_020807chr164644 625 612 50 ------
NM_020808chr11391 1304 ----
NM_020812chr191127 --147 --
NM_020820chr2041008 529 204 25 ------
NM_020830chr21386 11286 ----
NM_020839chr32576 359 ------
NM_020845chr12112486 2427 1798 936 712 328 185 134 117 96 26 --2722 177 --
NM_020850chr1632852 1241 674 ------
NM_020859chr453610 3375 2898 1473 414 23194 1305 ----
NM_020860chr42358 115 ------
NM_020871chrX12034 ------
NM_020899chr172547 469 ------
NM_020922chrX11819 ------
NM_020939chr661241 960 593 363 139 32 ------
NM_020940chr1012895 ------
NM_020946chr941505 1334 639 294 ------
NM_020948chr1--1636 ----
NM_020949chr3--1182 ----
NM_020952chr92328 159 ------
NM_020956chr19124333 4327 4313 4307 4218 4153 2892 1399 921 714 293 25 ------
NM_020962chr1521554 370 ------
NM_020972chr44723 285 184 35 ------
NM_020983chr1232289 2174 1958 ------
NM_020988chr16----21250 449 --
NM_021003chr141804 ------
NM_021019chr121206 ------
NM_021025chr52153 74 ------
NM_021033chr1322320 1379 11111 ----
NM_021035chr2021048 926 ------
NM_021061chr813863 ------
NM_021064chr62395 363 ------
NM_021081chr20123 ------
NM_021090chr2244954 1808 894 777 ------
NM_021096chr22113155 3095 3014 3007 2733 2187 1166 365 354 347 140 ------
NM_021106chr93704 192 41 ------
NM_021116chr758111 6765 2185 1716 1680 17751 16820 18891
NM_021132chr102232 35 ------
NM_021133chr1174 ------
NM_021145chr71976 ------
NM_021184chr62489 39 ------
NM_021192chr22323 308 ------
NM_021198chr241047 916 317 96 11323 ----
NM_021202chr2051940 1242 1018 71 53 1886 ----
NM_021229chr121133 ------
NM_021249chr1411260 ------
NM_021255chr1432822 605 548 ------
NM_021569chr93881 430 274 --1949 --
NM_021602chr173375 335 175 ------
NM_021622chr1012136 ------
NM_021630chr83314 143 36 1273 ----
NM_021648chr63561 403 193 ------
NM_021649chr5--1688 ----
NM_021728chr141155 1167 ----
NM_021783chrX4718 607 88 22 ------
NM_021806chrX2429 24 ------
NM_021813chr615372 --11853 --
NM_021831chr21284 ------
NM_021905chr671737 1429 1395 524 258 133 126 ------
NM_021907chr21225 ------
NM_021914chr141113 ------
NM_021943chr632007 1792 839 ------
NM_021945chr6103235 3105 2730 2721 1258 1125 1081 1057 168 32 ------
NM_021946chrX41411 1248 1202 339 ------
NM_021961chr1146896 5191 2609 2395 ------
NM_021964chr326131 5357 ------
NM_021966chr143171 129 43 ------
NM_021977chr643529 3287 828 521 13059 ----
NM_021988chr2041300 1122 438 369 11156 ----
NM_021991chr175680 331 320 198 142 ------
NM_021999chr131117 ------
NM_022039chr102112 28 ------
NM_022041chr162774 104 ------
NM_022042chr44802 439 285 249 ------
NM_022054chr142782 186 ------
NM_022060chr1441260 916 470 358 ------
NM_022114chr173240 1340 1289 1139 1056 1038 922 ------
NM_022130chr511339 ------
NM_022153chr1082313 1374 1029 845 770 606 379 37 ------
NM_022166chr1684842 2418 2074 802 642 114 68 22 14616 ----
NM_022169chr111451 ------
NM_022170chr731423 466 181 ------
NM_022307chr72571 538 ------
NM_022340chr363666 2420 1198 332 37 28 1665 11216 --
NM_022353chr22175 57 ------
NM_022373chr7133 ------
NM_022374chr2178 ------
NM_022442chr2041300 1122 438 369 11156 ----
NM_022455chr52245 215 ------
NM_022459chr1345710 1663 1657 501 16265 ----
NM_022465chr1242423 2110 1173 1165 ------
NM_022477chr2011645 ------
NM_022497chr351428 1219 574 294 171 1564 ----
NM_022552chr221074 167 ------
NM_022574chr732037 1697 508 ------
NM_022648chr2114111 3420 2964 1824 1800 1461 1336 1293 857 102 43 11471 ----
NM_022659chr81126 ------
NM_022719chr22153696 3543 3472 3019 2913 2850 1321 964 839 579 552 346 319 197 100 ------
NM_022733chr11351 ------
NM_022748chr742156 1123 955 579 1566 ----
NM_022750chr7158 ------
NM_022753chr112623 ------
NM_022756chr131118 1048 190 11333 ----
NM_022758chr663184 2686 2248 2233 2225 2009 ------
NM_022768chr11136 ------
NM_022780chr21190 ------
NM_022781chr932997 2926 2384 ------
NM_022822chr114664 241 176 72 ------
NM_022841chr151533 1565 ----
NM_022843chr1321427 1012 ------
NM_022845chr1621915 671 ------
NM_022898chr1444732 4292 3484 2965 ------
NM_022917chr93301 219 112 ------
NM_022977chrX1456 ------
NM_023004chr22156 ------
NM_023008chr193769 587 24 ------
NM_023035chr192808 153 ------
NM_023037chr131129 ------
NM_023067chr32914 111 ------
NM_023076chr1632518 373 286 ------
NM_023079chr1771586 1541 1350 482 274 208 166 11659 ----
NM_023105chr83962 131 69 ------
NM_023106chr83962 131 69 ------
NM_023110chr83962 131 69 ------
NM_023111chr83962 131 69 ------
NM_023929chr81494 ------
NM_024015chr172799 93 --1425 --
NM_024016chr17149 --1122 --
NM_024019chr41196 ------
NM_024046chr341254 929 840 64 ------
NM_024050chr192628 395 ------
NM_024060chr111275 1253 ----
NM_024077chr9165 1789 ----
NM_024085chr25797 744 717 391 160 1192 ----
NM_024090chr421894 1623 ------
NM_024107chr172793 75 ------
NM_024294chr663184 2686 2248 2233 2225 2009 ------
NM_024328chr142208 60 140 ----
NM_024493chr6194 ------
NM_024494chr11265 ------
NM_024523chr711032 ------
NM_024525chr11496 ------
NM_024554chr131475 1426 131 ------
NM_024567chr81130 ------
NM_024569chr1--1475 ----
NM_024599chr174608 267 120 46 ------
NM_024617chr91824 ------
NM_024627chr2294927 4224 3957 3941 3728 3146 1066 1049 397 ------
NM_024631chr112163 127 ------
NM_024646chr11202 12621 ----
NM_024665chr3--14356 ----
NM_024667chr1271703 1430 1418 1118 592 476 111 --11558 --
NM_024675chr16143 ------
NM_024676chr161124 1100 936 891 383 343 ------
NM_024704chr204316 137 131 54 --193 --
NM_024722chr172396 389 ------
NM_024740chr1123545 433 ------
NM_024742chr1661595 1579 1509 1449 1208 577 ------
NM_024759chr82704 629 ------
NM_024769chr11145 ------
NM_024787chr84747 699 389 141 ------
NM_024808chr13--1146 ----
NM_024812chr821715 1482 ------
NM_024814chr71125 ------
NM_024828chr921585 83 ------
NM_024850chr51314 ------
NM_024859chrX3809 777 278 1944 1853 --
NM_024877chr1941109 337 283 179 ------
NM_024887chr132141 1794 768 ------
NM_024923chr351311 1094 1065 1033 30 ------
NM_024927chr17145 ------
NM_024946chr1611106 ------
NM_024953chr12--1316 ----
NM_024954chr102556 460 --2480 201 --
NM_024969chr2----1329 --
NM_024971chr92328 159 ------
NM_024989chr222709 2647 --17341 --
NM_025027chr192946 486 ------
NM_025054chr8164 ------
NM_025083chr1571878 1304 372 353 327 268 198 ------
NM_025126chr123574 224 213 ------
NM_025160chr111638 ------
NM_025179chr154355 4136 4011 1046 954 11308 ----
NM_025182chr9128 ------
NM_025187chr1631170 899 63 ------
NM_025212chr41129 ------
NM_025222chr352578 884 684 650 462 ------
NM_025224chr2091739 857 793 735 574 346 334 159 66 ------
NM_025248chr1783241 2584 2405 1261 1015 981 735 627 2941 523 ----
NM_025250chr7142968 2662 2484 2326 2040 1868 1167 1064 839 701 605 207 188 75 12402 ----
NM_025251chr851156 944 368 332 269 ------
NM_030567chr5257 23 ------
NM_030629chr162382 267 --1574 --
NM_030630chr173581 104 44 ------
NM_030634chr12485 112 12154 ----
NM_030640chr122623 568 1736 ----
NM_030647chr745396 4385 263 250 ------
NM_030648chr434400 1949 1942 ------
NM_030650chr243663 3543 2640 669 22676 1531 ----
NM_030661chr731301 1118 647 ------
NM_030674chr1264874 4101 3977 3580 2221 1271 ------
NM_030753chr172265 243 ------
NM_030762chr1231346 707 377 ------
NM_030766chr123281 203 100 ------
NM_030806chr1119358 9283 9182 8645 7937 7381 7228 6982 6745 5709 1488 --11418 --
NM_030808chr174982 833 154 80 ------
NM_030809chr123500 258 119 ------
NM_030884chr3101910 1810 1689 1639 1511 676 360 231 210 202 ------
NM_030885chr321449 677 1152 ----
NM_030913chr11515 ------
NM_030914chr92948 66 ------
NM_030918chr185228 4393 4381 4208 2019 1849 1104 72 ------
NM_030957chr193252 62 38 ------
NM_030962chr112240 108 ------
NM_030965chr11555 ------
NM_031216chr1831915 1643 1426 ------
NM_031231chr202469 113 ------
NM_031232chr202469 113 ------
NM_031243chr7125 11788 ----
NM_031267chr71131 ------
NM_031299chr122149 38 ------
NM_031300chr52299 244 --123 --
NM_031309chr8132251 2208 2197 2094 1852 1692 773 683 607 420 299 159 97 --1491 --
NM_031411chr512221 ------
NM_031417chr1962525 2519 2497 2325 1878 130 ------
NM_031442chrX--1274 ----
NM_031444chr2262460 961 897 824 537 56 ----1699
NM_031468chr747602 6658 5790 486 ------
NM_031478chr162644 270 ------
NM_031483chr2012276 --1472 --
NM_031492chr11140 ------
NM_031849chr512221 ------
NM_031857chr512221 ------
NM_031860chr512221 ------
NM_031890chr2292853 2386 2201 1935 1076 1065 915 630 327 21019 90 ----
NM_031936chr11108 ------
NM_031937chr223256 242 32 ------
NM_031953chr4--180 ----
NM_031992chr731423 466 181 ------
NM_032013chr2011645 ------
NM_032017chr1101920 1830 1786 1775 1653 1564 1305 338 102 77 --11893 --
NM_032023chr102925 450 ------
NM_032052chr223373 242 214 ------
NM_032127chr11141 ------
NM_032144chr211155 ------
NM_032169chr31547 ------
NM_032182chr1021413 566 ------
NM_032193chr1151536 1510 459 392 143 ------
NM_032199chr1022754 266 ------
NM_032221chr201169 ------
NM_032236chr11962 ------
NM_032246chr1511207 ------
NM_032268chr1621071 287 12694 ----
NM_032271chr1651379 1336 1302 508 282 ------
NM_032272chr84398 343 319 79 ------
NM_032281chr1932877 428 176 1761 ----
NM_032316chr362420 1850 657 627 125 59 1157 ----
NM_032317chr721338 401 11657 ----
NM_032320chr11--1531 ----
NM_032325chr1131469 362 58 ------
NM_032329chr284005 3773 1641 1527 798 538 398 287 ------
NM_032345chr12157 ------
NM_032353chr17148 --1475 --
NM_032370chr19249 25 ------
NM_032375chr193216 73 26 ------
NM_032420chr54908 611 231 71 ------
NM_032434chr211386 ------
NM_032442chr173435 43 36 ------
NM_032446chr513655 ------
NM_032447chr192163 22 1394 ----
NM_032452chr142503 273 ------
NM_032505chr31951 ------
NM_032509chr821832 943 12185 ----
NM_032514chr201173 ------
NM_032521chr2032645 511 213 1716 ----
NM_032538chr662491 2253 2083 1979 871 221 --12836 --
NM_032547chr421275 562 ------
NM_032552chr981375 1317 768 629 567 390 313 42 ------
NM_032560chr141373 ------
NM_032569chr1651314 1260 1223 508 73 ------
NM_032580chr172517 121 129 ----
NM_032581chr7178 ------
NM_032590chr12268 33 ------
NM_032595chr1751466 1457 1142 606 431 ------
NM_032596chr91117 ------
NM_032603chr2149 ------
NM_032645chr112148 23 ------
NM_032646chr1731354 574 184 ------
NM_032682chr321195 664 ------
NM_032701chr193624 516 38 ------
NM_032711chr17104240 4148 3782 3652 2986 1451 569 415 346 160 12767 2506 26 --
NM_032737chr1972399 1749 1719 582 528 296 135 --1162 --
NM_032741chr62842 68 ------
NM_032781chr114268 242 84 77 ------
NM_032786chr122497 225 ------
NM_032789chr81126 ------
NM_032800chr132561 2202 525 ------
NM_032801chr112723 335 ------
NM_032808chr153888 619 52 ------
NM_032827chr251061 1040 830 782 37 ------
NM_032840chr1251136 803 285 204 50 ------
NM_032842chr71408 ------
NM_032871chr1161768 1696 696 584 343 325 21951 755 ----
NM_032918chr121116 ------
NM_032932chr17106364 6317 6155 5957 5394 4886 2144 1878 1765 1014 --21704 84 --
NM_033012chr131870 ------
NM_033016chr2231576 357 332 --1184 --
NM_033018chrX3863 845 471 ------
NM_033020chr11562 11271 ----
NM_033044chr11495 ------
NM_033071chr6152 ------
NM_033102chr13932 85 31 ------
NM_033102chr13932 85 31 ------
NM_033129chr2061796 1616 1521 1447 802 52 ------
NM_033132chr131192 ----1117
NM_033133chr1793250 2461 2344 2324 1137 974 812 486 258 ------
NM_033136chr51422 ------
NM_033137chr51422 ------
NM_033147chr21225 ------
NM_033148chr21225 ------
NM_033198chr172218 81 --1241 --
NM_033201chr16124 --1156 --
NM_033211chr511331 ------
NM_033224chr777939 7814 7128 6686 6136 5145 2559 ------
NM_033225chr81172 ------
NM_033226chr161187 ------
NM_033259chr34248 60 31 24 ------
NM_033260chr63654 612 61 ------
NM_033278chr11280 64 ------
NM_033290chrX32850 2693 2670 1355 1187 --
NM_033315chr1742138 1852 338 21 ------
NM_033326chr1111898 ------
NM_033343chr11292 ------
NM_033360chr1231077 582 387 ------
NM_033375chr1761476 1437 1319 1298 202 192 ------
NM_033386chr223416 365 173 ------
NM_033387chr932231 1872 1812 --12175 --
NM_033389chr172956 559 ------
NM_033401chr161106 ------
NM_033420chr1971120 906 801 400 387 183 87 --1218 1486
NM_033421chr2031288 554 292 ------
NM_033429chr1531169 791 31 ------
NM_033503chr1563726 3186 2965 496 483 208 ------
NM_033512chr872671 1980 1077 906 688 508 394 1973 ----
NM_033542chr202146 37 11619 ----
NM_033551chr541013 494 442 23 ------
NM_033631chr172672 1125 1050 859 550 496 135 ------
NM_033644chr51453 ------
NM_033645chr51453 ------
NM_052818chr1312176 ------
NM_052845chr1242756 1118 743 226 ------
NM_052854chr112586 174 --1507 --
NM_052855chr172101 55 ------
NM_052869chr1731354 574 184 ------
NM_052880chr2261287 1182 923 907 382 278 ------
NM_052896chr121858 313 ------
NM_052897chr122854 647 ------
NM_052898chr811765 11273 ----
NM_052905chr211821 ------
NM_052906chr22164923 4744 4681 3539 3408 3348 3325 1932 1732 1562 1537 1161 792 357 348 48 24367 4011 ----
NM_052910chr133881 320 161 ------
NM_052943chr14363 126 55 34 1176 ----
NM_052978chr142462 175 ------
NM_052996chr1641487 437 353 98 ------
NM_053001chr81301 ------
NM_053016chr936210 5151 2959 ------
NM_053024chr311405 ------
NM_053025chr31372 ------
NM_053026chr31372 ------
NM_053027chr31372 ------
NM_053028chr31372 ------
NM_053031chr31372 ------
NM_053032chr31372 ------
NM_053064chr1422052 33 ------
NM_053279chr862717 1962 854 403 92 41 12499 ----
NM_054035chr175779 620 609 204 30 ------
NM_057169chr1222793 2060 --12174 --
NM_057170chr1222793 2060 --12174 --
NM_057175chr422503 443 ------
NM_058164chr193133 37 21 ------
NM_058167chr171007 869 793 349 229 206 165 --11025 --
NM_058241chr211932 ------
NM_058241chr211932 ------
NM_078487chr93837 192 161 ------
NM_080415chr17177 ------
NM_080476chr202279 58 ------
NM_080489chr202299 34 ------
NM_080491chr1173441 2925 2515 1196 789 748 175 ------
NM_080544chr311193 11028 1363 --
NM_080546chr92925 565 11521 ----
NM_080645chr61137 ------
NM_080666chr1411193 ------
NM_080670chr53784 674 643 ------
NM_080678chr21217 ------
NM_080686chr6133 ------
NM_080881chr53786 670 161 ------
NM_100264chr101135 ------
NM_100486chr101135 ------
NM_130391chr922987 2331 ------
NM_130392chr922987 2331 ------
NM_130393chr922987 2331 ------
NM_130434chr151988 1153 ----
NM_130436chr211778 ------
NM_130438chr2111355 1183 ----
NM_130439chr1022139 45 ------
NM_130439chr1022139 45 ------
NM_130440chr141170 1062 566 413 ------
NM_130459chr931627 1244 1057 ------
NM_130468chr154768 293 103 96 ------
NM_130469chr142669 189 ------
NM_130766chr173975 862 378 ------
NM_130795chr93704 192 41 ------
NM_130797chr741677 1506 675 490 ------
NM_130809chr51554 ------
NM_130838chr1511722 ------
NM_130839chr1511722 ------
NM_133170chr20167377 6612 6326 6310 6020 5496 2777 2489 2326 2054 1260 794 629 590 490 172 16592 22020 999 --
NM_133171chr203972 243 46 ------
NM_133264chr1731342 912 539 12627 ----
NM_133265chrX1938 ------
NM_133369chr54865 767 362 256 ------
NM_133452chr1961113 1092 1050 858 749 31 --1840 --
NM_133457chr761359 1174 1090 247 167 134 ------
NM_133467chr14424 408 363 81 ------
NM_133476chr121120 ------
NM_133489chr123289 124 51 ------
NM_133499chrX1119 ------
NM_133631chr311147 ------
NM_133639chr152317 94 --170 --
NM_133642chr222935 322 ------
NM_133650chr6152 ------
NM_134268chr174948 920 882 813 ------
NM_134427chr93704 192 41 ------
NM_134428chr9--155 ----
NM_134442chr21414 ------
NM_138300chr171714 1217 1209 1162 1108 646 453 ------
NM_138338chr2282722 2652 2416 2311 1338 1254 1149 221 ------
NM_138353chr192275 168 ------
NM_138357chr10--1204 ----
NM_138370chr22662 50 ------
NM_138415chr2241332 1227 586 284 --1550 --
NM_138444chr1323033 3027 ------
NM_138457chr673372 3219 2701 2517 1294 816 131 1368 ----
NM_138473chr1254751 4190 1189 1065 33 ------
NM_138479chr161923 1676 1507 1318 752 302 11301 ----
NM_138485chr31323 ------
NM_138576chr1444732 4292 3484 2965 ------
NM_138578chr2031176 941 132 ------
NM_138619chr1731058 1038 352 ------
NM_138638chr141113 ------
NM_138713chr1617714 ------
NM_138714chr1617714 ------
NM_138732chr112907 84 ------
NM_138734chr112907 84 ------
NM_138795chr141563 637 432 274 ------
NM_138927chr212956 93 ------
NM_138931chr32431 156 ------
NM_138961chr11137 ------
NM_138994chr161106 ------
NM_139014chr631840 1526 788 ------
NM_139035chrX2598 25 ------
NM_139045chr91216 1297 ----
NM_139068chr51186 ------
NM_139069chr51186 ------
NM_139070chr5155 ------
NM_139071chr123316 145 49 ------
NM_139125chr341569 1542 235 23 ------
NM_139136chr121413 ------
NM_139157chr113740 645 555 ------
NM_139159chr194914 329 242 90 ------
NM_139280chr1741356 1126 1076 498 ------
NM_139283chr1222581 1847 1534 ----
NM_144488chr93704 192 41 ------
NM_144489chr93704 192 41 ------
NM_144568chr142264 92 ------
NM_144571chr425957 5593 ------
NM_144578chr1425028 4963 11015 ----
NM_144581chr14124 ------
NM_144584chr1131 ------
NM_144605chr16130 ------
NM_144633chr321025 273 ------
NM_144635chr331155 237 216 ------
NM_144664chr1112163 ------
NM_144967chrX1134 ------
NM_144973chr1211469 1936 1395 --
NM_145008chr113726 258 173 ------
NM_145025chr61152 ------
NM_145063chr62178 54 ------
NM_145071chr32282 74 ------
NM_145166chr392838 2684 2373 1847 1100 562 345 324 34 --197 --
NM_145185chr1991926 1910 1717 1656 1595 521 511 491 291 ----1168
NM_145239chr162844 55 ------
NM_145271chr16167 ------
NM_145296chr193679 107 32 ------
NM_145313chr1061300 1277 1220 1065 584 433 ------
NM_145331chr61535 ------
NM_145350chr173539 312 132 1558 ----
NM_145351chr1761679 947 734 705 161 114 11698 ----
NM_145644chr2--1358 ----
NM_145714chr162289 133 ------
NM_145733chr2211037 ------
NM_145799chrX32582 88 50 ------
NM_145800chrX1962 ------
NM_145804chr1131236 361 33 ------
NM_145891chr161195 1453 11462 --
NM_145892chr161195 1453 11462 --
NM_145893chr162317 58 1575 11584 --
NM_145912chr22164638 4574 4490 3905 3627 3594 3419 3265 1784 1675 1642 1272 674 500 289 207 --11745 --
NM_147150chr943413 3072 2810 1006 ------
NM_147161chr11225 ------
NM_147164chr92216 148 --1155 --
NM_147168chr91117 ------
NM_147189chr82239 32 ------
NM_147202chr962414 2329 665 466 366 204 ------
NM_147223chr221661 604 ------
NM_147686chr62294 46 ------
NM_148414chr161372 ------
NM_148415chr162312 156 ------
NM_148416chr162289 133 ------
NM_148976chr111200 ------
NM_152222chr1161768 1696 696 584 343 325 21951 755 ----
NM_152230chr10133 ------
NM_152233chr1411260 ------
NM_152244chr1741209 903 851 42 ------
NM_152271chr81816 ------
NM_152280chr12745 268 12832 ----
NM_152309chr103644 201 153 ------
NM_152341chr1611240 11018 ----
NM_152408chr5125 ------
NM_152409chr51100 ------
NM_152410chr61133 ------
NM_152424chrX51382 1321 752 115 34 24358 558 ----
NM_152441chr121138 ------
NM_152450chr1511731 1141 ----
NM_152462chr171289 ------
NM_152470chr1873324 3080 2856 2656 806 395 328 1770 ----
NM_152523chr21287 ------
NM_152529chr21163 ------
NM_152553chr61177 ------
NM_152556chr722310 717 ------
NM_152557chr711303 1481 ----
NM_152570chr9--1125 ----
NM_152586chr10159 ------
NM_152624chr531718 1209 636 14745 ----
NM_152629chr923995 111 ------
NM_152678chr31281 ------
NM_152699chr322348 114 ------
NM_152713chr111160 ------
NM_152721chr181277 ------
NM_152742chr73457 215 68 ------
NM_152745chr71316 ------
NM_152748chr72213 76 ------
NM_152787chrX22956 964 ------
NM_152835chr1--1658 ----
NM_152838chr2013241 ------
NM_152855chr222332 303 ------
NM_152857chr611003 ------
NM_152858chr611003 ------
NM_152860chr121147 ------
NM_152878chr2231137 465 139 ------
NM_152903chr132761 447 ------
NM_152924chr1576328 6302 6195 5927 1697 1608 671 ------
NM_152989chr1221728 1495 ------
NM_152995chr41277 1729 ----
NM_153029chr1643607 1232 815 792 11545 ----
NM_153050chr2244954 1808 894 777 ------
NM_153051chr2244954 1808 894 777 ------
NM_153188chr524405 506 ------
NM_153207chr121710 ------
NM_153211chr18190 ------
NM_153270chrX177 ------
NM_153273chr3102398 2362 2256 1844 1017 968 908 770 455 274 ------
NM_153321chr17--1958 ----
NM_153322chr17--1958 ----
NM_153347chr1152449 2392 2379 868 648 ------
NM_153350chr163490 366 215 --1510 --
NM_153360chr2041217 1177 1001 210 --1545 --
NM_153367chr1073862 2694 1482 807 247 225 128 --1240 13740
NM_153487chr694002 3341 1848 1831 966 830 731 725 126 11096 ----
NM_153499chr1252080 1988 1942 716 32 ------
NM_153500chr1252080 1988 1942 716 32 ------
NM_153607chr51478 ------
NM_153620chr751641 1165 626 358 258 --11487 --
NM_153631chr731301 1118 647 ------
NM_153632chr731301 1118 647 ------
NM_153649chr121804 1586 ------
NM_153715chr71133 ------
NM_153748chr121413 ------
NM_153756chr151863 1779 1385 369 284 ------
NM_153759chr221074 167 ------
NM_153827chr17293 68 1270 ----
NM_170607chr1741374 1362 560 74 11178 ----
NM_170663chr17293 68 1270 ----
NM_170675chr151454 ------
NM_170676chr151454 ------
NM_170692chr12758 230 ------
NM_170706chr123219 1573 ------
NM_170707chr12306 95 ------
NM_170708chr12306 95 ------
NM_170711chr19140 ------
NM_171998chrX1207 ------
NM_172057chr72279 56 ------
NM_172071chr11306 17185 ----
NM_172127chr41106 ------
NM_172128chr4162 ------
NM_172169chr1031645 789 72 ------
NM_172170chr1031645 789 72 ------
NM_172171chr1031645 789 72 ------
NM_172173chr1031645 789 72 ------
NM_172200chr103465 153 92 ------
NM_172217chr1553595 1326 585 118 75 ------
NM_172226chr1252080 1988 1942 716 32 ------
NM_172337chr141155 1167 ----
NM_172349chr52245 215 ------
NM_173054chr71871 ------
NM_173084chr31630 132 ----
NM_173172chr2164 ------
NM_173174chr82682 83 ------
NM_173175chr82682 83 ------
NM_173176chr82682 83 ------
NM_173201chr161195 ------
NM_173214chr1617714 ------
NM_173468chr42438 119 ------
NM_173476chr16101926 1770 1751 1556 1550 925 628 592 517 369 --1914 --
NM_173502chr162150 136 ------
NM_173511chr212874 ------
NM_173515chr6--1643 ----
NM_173527chr142570 214 ------
NM_173564chr71584 2730 176 ----
NM_173587chr116455 213 204 179 108 29 ------
NM_173595chr12125233 3996 3910 3720 3490 3453 1976 1600 1214 642 558 182 ------
NM_173602chr1223559 27 ------
NM_173642chr147994 7916 3370 641 28948 6541 17894 --
NM_173667chr53532 475 223 ------
NM_173797chr511092 1365 ----
NM_173809chr1011224 ------
NM_173822chr211467 ------
NM_173832chr853725 2442 871 662 26 --11387 22787 2708
NM_173872chr4----1833 --
NM_174856chr201138 ------
NM_174911chr852636 638 394 121 101 ------
NM_174916chr1521710 102 ------
NM_174934chr11102959 2828 2680 1130 1053 824 795 331 297 216 ------
NM_174937chr101135 ------
NM_175058chr1131172 468 267 ------
NM_175077chr202386 39 ------
NM_175624chr1236549 2823 2612 14909 24718 2278 --
NM_175625chr1236549 2823 2612 14909 24718 2278 --
NM_175629chr221074 167 ------
NM_175630chr22714 329 --1257 --
NM_175634chr81192 1953 ----
NM_175635chr81192 1953 ----
NM_175636chr81192 1953 ----
NM_175709chr22112399 2321 2182 2165 2021 1878 947 882 740 412 42 ------
NM_175748chr1431888 759 551 --1821 --
NM_175848chr2011252 1314 ----
NM_175848chr2011252 1314 ----
NM_175849chr2011252 1314 ----
NM_175849chr2011252 1314 ----
NM_175850chr2011252 1314 ----
NM_175850chr2011252 1314 ----
NM_175854chr1332089 2013 1946 ------
NM_176801chr451627 1529 1469 508 268 ------
NM_176871chr8113342 3258 3252 2912 2768 2605 1341 995 799 486 46 ------
NM_177398chr121651 1423 --11247 --
NM_177399chr121651 1423 --11247 --
NM_177441chr172793 75 ------
NM_177952chr141804 ------
NM_177996chr2073136 3109 3055 2704 2556 1302 65 ------
NM_177999chr973054 2721 2674 2564 1210 822 648 ------
NM_178010chr1221728 1495 ------
NM_178026chr204569 509 389 23 ------
NM_178151chrX57681 6201 3156 2280 183 ------
NM_178152chrX57681 6201 3156 2280 183 ------
NM_178153chrX57681 6201 3156 2280 183 ------
NM_178167chr163345 311 62 ------
NM_178313chr211507 ------
NM_178426chr121832 552 ------
NM_178427chr121732 452 ------
NM_178450chr5--1110 ----
NM_178500chr174756 652 146 31 ------
NM_178554chr323579 882 --12621 --
NM_178568chr1731467 1339 1235 --11356 --
NM_178585chr412075 ------
NM_178819chr82114 47 ------
NM_178830chr192299 122 ------
NM_178839chr2282 60 ------
NM_178863chr161446 ------
NM_178864chr111640 ------
NM_180976chr621049 1006 ------
NM_180977chr621049 1006 ------
NM_181077chr151175 1824 ----
NM_181351chr1132896 2025 1837 ------
NM_181358chr112625 ------
NM_181509chr201173 ------
NM_181521chr1666935 6367 2504 2005 1484 163 11819 ----
NM_181552chr76316 226 123 95 47 37 ------
NM_181656chr17142 1819 ----
NM_181674chr5175 ------
NM_181675chr5175 ------
NM_181676chr5175 ------
NM_181677chr5175 ------
NM_181678chr5175 ------
NM_181701chr922071 380 --1109 --
NM_181704chr2111165 ------
NM_181711chr126562 544 528 510 454 137 ------
NM_181712chr121991 1281 --1212 --
NM_181715chr11301 ------
NM_181832chr2263709 3687 3627 3174 2746 1146 --12518 --
NM_181838chr51601 ------
NM_181843chr111286 ------
NM_181876chr422011 152 --11080 --
NM_181897chr33615 445 364 ------
NM_182484chr2111165 ------
NM_182485chr411410 ------
NM_182493chr1644961 3980 1745 1512 15306 ----
NM_182498chr191282 ------
NM_182526chr1472997 2800 2586 2066 642 468 22 ------
NM_182540chrX2169 131 ------
NM_182557chr1162210 2014 1914 1846 1683 123 ------
NM_182565chr172279 172 ------
NM_182641chr17--11936 ----
NM_182646chr411410 ------
NM_182685chr11152 ------
NM_182700chr73607 211 57 11550 2410 281 --
NM_182715chr7--1217 ----
NM_182744chr131126 356 51 --11250 1401
NM_182764chr203972 243 46 ------
NM_182796chr51732 ------
NM_182830chr14--1701 ----
NM_182917chr31171 ------
NM_182925chr531334 563 378 ------
NM_182943chr31130 ------
NM_182961chr6152 ------
NM_182970chr20114161 3190 3183 2713 2641 2610 1650 1364 1188 677 149 23269 1468 ----
NM_182975chr111169 ------
NM_183078chr643524 3398 3354 399 ------
NM_183360chr21225 ------
NM_183361chr21225 ------
NM_184231chr3159 ------
NM_194259chr161191 ------
NM_194260chr161191 ------
NM_194261chr161191 ------
NM_194271chr123574 224 213 ------
NM_194278chr1443174 1612 490 38 --1965 --
NM_194282chr413006 ------
NM_194291chr822625 1992 ------
NM_194314chr114177 ------
NM_194315chr171007 869 793 349 229 206 165 --11025 --
NM_194328chr932997 2926 2384 ------
NM_194329chr932997 2926 2384 ------
NM_194330chr932997 2926 2384 ------
NM_194332chr932997 2926 2384 ------
NM_194442chr11103 1496 ----
NM_194452chr1161198 1157 1095 1046 196 113 ------
NM_194453chr1161198 1157 1095 1046 196 113 ------
NM_194457chr171007 869 793 349 229 206 165 --11025 --
NM_194458chr171007 869 793 349 229 206 165 --11025 --
NM_194460chr195439 430 186 149 33 ------
NM_197941chr512589 --1518 --
NM_198042chr82418 140 1377 1102 --
NM_198056chr351953 1512 316 120 92 ------
NM_198057chrX31004 355 274 1217 ----
NM_198120chr81454 ------
NM_198181chr151274 ------
NM_198186chr93571 494 76 1109 ----
NM_198187chr93571 494 76 1109 ----
NM_198204chr1741374 1362 560 74 11178 ----
NM_198205chr1741374 1362 560 74 11178 ----
NM_198240chr12127 ------
NM_198241chr31171 ------
NM_198242chr31171 ------
NM_198244chr31171 ------
NM_198268chr112625 ------
NM_198269chr112625 ------
NM_198270chrX12449 ------
NM_198291chr2061926 1436 438 279 160 67 --21932 737 --
NM_198336chr7121 ------
NM_198390chr162382 267 --1574 --
NM_198446chr11180 ------
NM_198513chr81506 1639 ----
NM_198560chr393659 3157 3068 2970 1442 1396 1165 739 268 1207 ----
NM_198563chr32426 380 ------
NM_198679chr962129 2107 988 733 658 205 ------
NM_198686chr1442608 786 724 218 ------
NM_198700chr11135 ------
NM_198829chr711314 ------
NM_198830chr173535 301 105 ------
NM_198859chr334977 4152 1777 ------
NM_198880chr32289 276 ------
NM_198956chr73607 211 57 11550 2410 281 --
NM_198968chr1323071 1181 ------
NM_198993chr1751710 1703 1667 1602 463 1421 ----
NM_199054chr1961896 1439 1425 655 271 91 --11727 --
NM_199141chr194759 392 311 280 ------
NM_199144chr2041300 1122 438 369 11156 ----
NM_199168chr10195 --1152 --
NM_199169chr2042915 2498 1086 21 --1777 --
NM_199170chr2042915 2498 1086 21 --1777 --
NM_199171chr2042915 2498 1086 21 --1777 --
NM_199181chr202112 53 ------
NM_199192chr2--135 ----
NM_199193chr2--135 ----
NM_199203chr2041300 1122 438 369 11156 ----
NM_199320chr41964 ------
NM_199320chr41964 ------
NM_199355chr16--139 ----
NM_199368chr203574 170 32 ------
NM_199454chr173240 1340 1289 1139 1056 1038 922 ------
NM_201280chr61624 ------
NM_201412chr161168 ------
NM_201413chr211677 ------
NM_201414chr211677 ------
NM_201432chr17116049 5712 5493 4441 2293 2094 993 962 905 382 101 ------
NM_201433chr17116049 5712 5493 4441 2293 2094 993 962 905 382 101 ------
NM_201520chr1751602 1563 573 486 196 ------
NM_201521chr61147 ------
NM_201522chr61147 ------
NM_201523chr61147 ------
NM_201535chr143710 616 82 ------
NM_201536chr143710 616 82 ------
NM_201537chr143710 616 82 ------
NM_201538chr143710 616 82 ------
NM_201539chr143710 616 82 ------
NM_201540chr143710 616 82 ------
NM_201541chr143710 616 82 ------
NM_201542chr11108 ------
NM_201548chr22986 379 ------
NM_201570chr10--185 ----
NM_201571chr10--185 ----
NM_201572chr10--185 ----
NM_201590chr10--185 ----
NM_201591chr411689 ------
NM_201592chr411689 ------
NM_201593chr10--185 ----
NM_201596chr10--185 ----
NM_201597chr10--185 ----
NM_201630chr13145 129 71 ------
NM_201995chr112708 224 ------
NM_201998chr112773 289 ------
NM_203301chr141203 ------
NM_203305chr952007 1901 453 389 267 ------
NM_203327chr2054064 2778 1783 710 370 --23820 1305 --
NM_203342chr143468 2803 979 844 22261 1224 ----
NM_203343chr143468 2803 979 844 22261 1224 ----
NM_203351chr17112471 2296 2195 2179 1985 1960 1790 1668 811 341 286 1818 ----
NM_203372chr21404 ------
NM_203377chr223437 59 34 ------
NM_203378chr223437 59 34 ------
NM_203394chr122719 94 ------
NM_203434chr92495 98 ------
NM_203446chr211451 ------
NM_203504chr4--11934 ----
NM_203505chr4--11934 ----
NM_203506chr1731908 1579 118 ------
NM_205861chr132141 1794 768 ------
NM_206594chr123465 2787 --12956 --
NM_206595chr123465 2787 --12956 --
NM_206853chr613396 12588 ----
NM_206854chr614657 13849 ----
NM_206855chr615622 14814 ----
NM_206944chr92328 159 ------
NM_206945chr92328 159 ------
NM_206946chr92328 159 ------
NM_206947chr92328 159 ------
NM_207005chr13583 232 26 ------
NM_207012chr1012967 ------
NM_207042chr1158 ------
NM_207045chr1158 ------
NM_207046chr1158 ------
NM_207113chr721321 56 ------
NM_207171chr121711 1525 165 ----
NM_207303chr10----148 --
NM_207362chr21189 ------
NM_207371chr1021303 1164 11491 ----
NM_207380chr1573126 3080 2656 1130 754 562 389 1287 ----
NM_207391chr1921197 71 2851 517 ----
NM_207429chr1122329 429 ------
NM_207442chr143345 168 110 ------
NM_207445chr151215 ------
NM_207645chr111543 ------
NM_212464chr1531963 393 118 --1836 --
NM_213606chr1012672 ------
NM_213613chr44802 439 285 249 ------
NM_213618chr113740 645 555 ------