TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4747-5p
miRNA Sequence: AGGGAAGGAGGCUUGGUCUUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr17----266 40 --
NM_000021chr1441045 900 142 130 1695 ----
NM_000024chr54507 436 414 131 ----1374
NM_000033chrX----2943 123 --
NM_000034chr16----1167 --
NM_000037chr851966 1915 1746 789 464 21824 431 12190 --
NM_000038chr531640 1580 281 12084 11585 --
NM_000044chrX245 22 ------
NM_000046chr572214 1187 748 664 632 448 27 22787 2524 3702 243 108 --
NM_000051chr1141223 753 702 25 21201 672 12212 13229
NM_000061chrX132 ------
NM_000063chr6--1281 1234 --
NM_000074chrX4688 656 640 610 3779 677 359 ----
NM_000075chr12145 --1229 1188
NM_000080chr173605 277 227 123 192 --
NM_000081chr1--1286 ----
NM_000084chrX86917 5856 5808 5368 1771 826 818 128 32538 1901 1761 25829 2218 12100
NM_000088chr1741288 368 358 320 31267 1147 1118 147 1407
NM_000089chr72707 96 --1193 --
NM_000090chr22359 161 ------
NM_000092chr294467 3958 3153 3074 2840 882 596 119 106 43616 2877 61 43 11486 --
NM_000093chr972127 1906 1746 967 950 413 104 --21633 541 --
NM_000109chrX31066 848 591 21925 931 ----
NM_000129chr631178 440 217 1482 ----
NM_000138chr1572378 2360 1994 1847 376 303 66 1202 ----
NM_000141chr1041316 1052 1034 182 1943 1307 --
NM_000142chr421579 1384 1513 --1506
NM_000163chr51891 31942 1886 139 ----
NM_000167chrX41323 694 686 337 ------
NM_000168chr772830 2429 2371 2329 2299 2171 201 --12240 22067 973
NM_000176chr533456 1372 1196 13388 --1634
NM_000178chr20127 1136 2358 125 --
NM_000188chr102484 41 1696 ----
NM_000192chr125981 569 363 322 310 ------
NM_000202chrX103296 3132 2612 2488 2455 1562 1478 874 232 42 42523 2461 2440 1157 42672 2635 2449 2415 --
NM_000208chr19104535 4327 4118 3518 3174 1887 1875 1750 394 49 1729 1761 --
NM_000210chr222349 773 ------
NM_000212chr1731897 360 290 --1545 --
NM_000216chrX63823 3518 1433 789 482 315 ----13874
NM_000217chr1294961 4187 3984 3819 3453 3352 2030 640 316 13662 35227 3788 2062 24178 3360
NM_000221chr22226 210 --160 --
NM_000222chr441595 1589 1381 305 --11501 21682 296
NM_000232chr422672 2194 21155 156 ----
NM_000248chr332691 355 39 --12394 --
NM_000252chrX3996 605 146 1473 ----
NM_000258chr3----1244 --
NM_000259chr1595439 5039 5033 4673 4017 4004 2483 2077 906 35744 2475 1939 25022 4888 35045 4627 4161
NM_000264chr953360 3332 791 575 243 33306 2877 64 22077 900 --
NM_000266chrX2252 205 ------
NM_000267chr1793475 2748 2589 1121 899 882 385 374 105 22393 2142 32935 79 63 13292
NM_000268chr22103682 3176 2605 2454 2365 1264 1255 784 253 36 42322 1016 919 512 43473 979 816 128 --
NM_000271chr181221 ------
NM_000276chrX22133 1957 32172 784 355 31711 1506 436 --
NM_000280chr111687 ------
NM_000281chr10128 1320 ----
NM_000284chrX31712 1499 282 11564 ----
NM_000286chr171659 190 1307 --
NM_000303chr1661452 1424 1110 587 308 234 ------
NM_000304chr1711038 --1386 --
NM_000310chr151239 994 987 116 46 --1500 --
NM_000314chr1043009 913 737 587 --1281 --
NM_000319chr123404 267 122 11036 2990 369 --
NM_000321chr1341277 454 350 260 ----179
NM_000332chr6127050 6127 5671 5554 5483 5470 4619 2868 2428 2304 1963 661 15802 46168 5916 5676 289 --
NM_000333chr32391 165 1105 1403 --
NM_000334chr1721904 1895 1675 21943 1808 --
NM_000335chr331769 846 733 12197 2654 96 --
NM_000340chr331399 1151 469 ------
NM_000345chr431049 182 126 ------
NM_000346chr1741919 1589 1223 143 --11964 --
NM_000353chr1631081 267 145 ------
NM_000362chr22123125 2882 2268 1277 1214 843 817 399 370 196 50 29 170 53421 1423 1292 412 38 --
NM_000365chr122328 138 --3112 75 27 --
NM_000367chr611454 12282 12180 --
NM_000368chr9124812 4312 4239 4100 1905 1405 914 715 517 456 286 79 21038 621 74693 4366 4357 1910 376 291 196 --
NM_000369chr1411398 31936 1362 342 ----
NM_000386chr17228 21 --1564 --
NM_000390chrX--1937 ----
NM_000391chr1151495 1308 524 506 388 2597 432 41665 1579 1146 1112 21670 455
NM_000394chr214431 417 91 81 ----2113 105
NM_000399chr101330 1171 189 1150
NM_000404chr31136 ------
NM_000411chr2132529 2453 1308 22972 2030 1671 --
NM_000412chr31266 ------
NM_000414chr51219 ------
NM_000424chr12126 2267 226 ----
NM_000425chrX1588 --1171 1124
NM_000430chr1722508 101 13433 13096 --
NM_000435chr1910867 288 277 265 259 247 179 104 75 59 1110 180 --
NM_000439chr572272 1561 766 739 724 221 43 12060 11565 1814
NM_000441chr732354 1432 51 ------
NM_000447chr11103 ------
NM_000448chr1162668 2005 434 389 68 44 22709 2139 --12223
NM_000449chr131058 536 63 41358 1104 1046 79 11017 --
NM_000450chr13683 268 96 --1214 --
NM_000451chrX61931 1882 1858 1769 313 96 --1460 --
NM_000452chr1351968 1685 1517 803 730 11771 21311 584 --
NM_000458chr173916 815 194 ------
NM_000461chr352965 1295 1154 1093 584 14362 11711 23630 792
NM_000462chr1521286 170 21806 1687 11292 --
NM_000474chr7----1527 --
NM_000478chr11171 2748 50 ----
NM_000484chr2121052 431 ------
NM_000488chr1--129 ----
NM_000489chrX83065 3001 2477 777 705 264 172 123 12918 13045 --
NM_000493chr6----1151 --
NM_000500chr63371 154 118 --1432 1482
NM_000503chr831716 1327 347 ------
NM_000505chr5----123 --
NM_000522chr72414 217 1912 ----
NM_000530chr1--11093 1268 --
NM_000533chrX21611 23 3750 335 257 21831 760 --
NM_000538chr131575 1216 ----
NM_000544chr6_cox_hap1103284 2745 2444 1290 1004 998 917 372 282 73 33305 3125 29 21188 492 43244 2476 746 482
NM_000554chr1973285 3157 2878 1088 123 64 45 1413 23315 162 --
NM_000555chrX167651 6974 6791 6327 5900 5819 5811 5604 3085 2776 2708 2699 2405 916 340 278 36979 6669 5582 15660 --
NM_000557chr202419 22 --151 --
NM_000587chr531103 981 98 --2266 118 --
NM_000594chr61636 ----125
NM_000598chr71493 2249 207 11508 --
NM_000599chr2104050 3358 2993 1678 1415 1169 1086 1022 830 607 23190 497 33466 3295 22 13247
NM_000602chr721015 503 --11179 --
NM_000611chr11117114 6327 5019 4769 2174 1495 1100 1074 647 254 22 45902 5627 5251 4794 14727 --
NM_000615chr1142802 1080 892 565 --12900 --
NM_000618chr1296346 6163 5961 5834 5812 1825 1065 803 130 44700 4679 2619 2027 25639 4945 --
NM_000618chr1296346 6163 5961 5834 5812 1825 1065 803 130 44700 4679 2619 2027 25639 4945 --
NM_000620chr1292135 2021 1953 1907 1893 504 406 140 126 12041 31988 1877 65 --
NM_000621chr131990 ------
NM_000627chr2----1677 --
NM_000633chr1885226 5042 4910 4824 4340 3418 1669 1212 1377 --11264
NM_000680chr8155 --159 --
NM_000681chr1021139 402 3905 274 243 11175 --
NM_000684chr1031247 316 277 2509 39 1434 --
NM_000685chr31173 1685 1765 --
NM_000685chr31173 1685 1765 --
NM_000693chr1541574 1272 462 252 --31429 92 22 --
NM_000700chr91196 ------
NM_000719chr12126276 5329 5001 4765 2631 2345 2174 2033 1908 1279 845 308 35781 5273 4448 76321 5927 4419 2378 2358 2141 2136 26564 791
NM_000721chr162683 2525 1891 524 299 33 --52655 2330 1988 1737 1674 1313
NM_000723chr176503 448 308 253 237 113 --31287 492 366 1433
NM_000724chr1021383 596 ------
NM_000725chr121788 --1259 1332
NM_000726chr211061 21052 316 ----
NM_000738chr111985 2165 113 1133 --
NM_000756chr8--1435 ----
NM_000773chr10--1121 ----
NM_000788chr44554 352 330 304 11062 --1981
NM_000793chr1484629 4536 4203 3977 3920 3649 3366 1452 35033 4280 3340 ----
NM_000794chr5--1128 --1917
NM_000795chr1151118 932 908 893 734 135 4937 917 321 311 1761
NM_000800chr521389 358 11346 1423 1670
NM_000801chr202707 190 2800 783 11065 11010
NM_000806chr521546 1282 ------
NM_000811chr51283 196 ----
NM_000812chr43383 314 35 ------
NM_000813chr545374 4643 1630 369 12081 ----
NM_000814chr1573913 3396 3253 2721 1364 955 559 13028 ----
NM_000817chr241140 985 294 42 ------
NM_000818chr10275 31 1477 ----
NM_000824chr42387 57 ------
NM_000826chr4--197 ----
NM_000828chrX51405 816 591 462 135 31489 840 728 ----
NM_000833chr1641270 1122 556 171 11012 ----
NM_000834chr1261297 1262 908 315 212 111 21055 405 ----
NM_000837chr82364 85 --1526 --
NM_000838chr632007 1756 1015 2967 852 2562 237 --
NM_000842chr112680 516 ------
NM_000844chr31112 21062 94 1243 --
NM_000855chr111276 --1338 --
NM_000864chr11794 --1953 --
NM_000868chrX32524 284 264 22619 842 2293 273 --
NM_000870chr54998 630 383 110 31162 240 224 --11339
NM_000872chr1051444 1005 555 145 71 2489 312 11416 --
NM_000875chr15176416 6003 5956 5873 4781 4748 2676 2606 1853 1405 1396 1342 954 845 517 329 151 24616 2221 32156 1726 316 --
NM_000876chr61448 --21231 173 --
NM_000880chr8--2304 94 ----
NM_000883chr7----2625 484 1122
NM_000883chr7----2625 484 1122
NM_000891chr1763335 3266 3256 2948 920 321 23633 3601 1993 --
NM_000894chr19121 181 ----
NM_000899chr1241681 1543 813 608 33773 3507 1434 ----
NM_000901chr4138 ------
NM_000902chr372821 2453 2077 1972 1210 664 483 --12035 12899
NM_000908chr52517 188 ------
NM_000917chr102876 677 ------
NM_000919chr5----157 --
NM_000922chr1111047 2423 164 ----
NM_000924chr1221198 309 21354 321 21128 1087 --
NM_000933chr2011443 ------
NM_000935chr341133 1067 1020 954 ------
NM_000944chr432375 1779 1555 21657 679 ----
NM_000945chr221704 42 1659 11387 11318
NM_000949chr53778 625 119 1962 ----
NM_000950chrX53376 3271 3204 2313 1166 12419 ----
NM_000956chr141284 ------
NM_000958chr53998 854 482 ------
NM_000962chr982304 2064 2018 2000 1040 926 826 181 --11921 12284
NM_000963chr131634 760 377 ------
NM_000964chr1721181 58 21376 944 21336 127 --
NM_000965chr32995 383 --1955 --
NM_000966chr124932 755 424 115 1300 3883 339 174 --
NM_000983chr141307 1014 371 129 1530 ----
NM_001001132chr213541 275 135 --21335 298 --
NM_001001323chr1222369 788 ------
NM_001001331chr382479 2292 1930 1835 1078 899 163 58 1253 31910 1905 268 --
NM_001001342chr1041061 1018 979 178 31300 1044 220 ----
NM_001001395chr1212234 --12558 12663
NM_001001396chr1153849 3825 3742 3734 3680 3543 3110 3069 2978 2911 1754 1582 1071 860 822 1768 73664 3318 1691 1458 946 870 866 33882 3428 1784
NM_001001419chr5114789 4683 4303 3841 3556 3461 3353 1975 1625 404 386 11963 13500 --
NM_001001420chr5114789 4683 4303 3841 3556 3461 3353 1975 1625 404 386 11963 13500 --
NM_001001433chr2023050 1070 12389 22555 153 12829
NM_001001438chr211262 ------
NM_001001481chr863151 2821 2782 895 327 124 13421 ----
NM_001001484chr1052423 625 498 360 119 --1147 --
NM_001001502chr51108 --189 --
NM_001001549chr752616 2569 2150 1792 408 12207 11907 1604
NM_001001550chr752616 2569 2150 1792 408 12207 11907 1604
NM_001001555chr752616 2569 2150 1792 408 12207 11907 1604
NM_001001557chr821679 1586 --22179 1520 1172
NM_001001560chr224611 534 158 125 ------
NM_001001664chr233619 2647 361 --12560 --
NM_001001684chr1752351 1793 1785 811 327 1226 ----
NM_001001701chr442268 2135 1494 634 22309 1488 1127 --
NM_001001787chr12196 184 ------
NM_001001890chr21123477 3101 3062 2999 2978 2942 2838 2828 2798 2786 1109 976 --14247 --
NM_001001938chr983980 3552 3348 3188 1564 1287 436 314 33801 3119 1441 --23078 2615
NM_001001995chrX31805 549 160 21589 681 ----
NM_001002026chr352288 1763 1641 608 336 21512 372 21716 931 12067
NM_001002233chr861824 1725 1586 692 671 604 32156 2002 540 ----
NM_001002243chr21300 --152 --
NM_001002252chr12387 64 29 2298 229 ----
NM_001002257chr273162 2871 2762 2483 726 471 60 --11113 --
NM_001002269chr91162 ------
NM_001002295chr102448 53 --1825 --
NM_001002762chr1092589 2574 2519 2258 2147 938 831 520 377 ------
NM_001002838chrX41675 523 101 77 1322 ----
NM_001002843chr152845 337 ------
NM_001002860chr1454048 3365 688 551 400 --11681 --
NM_001002909chr1741650 1488 771 343 12073 --32120 1389 434
NM_001002919chr21127 ------
NM_001003406chr2273216 2959 2933 2853 1200 189 49 21304 1227 42874 2652 2648 2257 --
NM_001003652chr18138303 7643 7384 6832 6130 5336 3217 2710 2451 2364 1086 938 454 38041 7200 6846 27402 2226 1727
NM_001003681chr2252022 1635 1568 1487 482 11389 11574 --
NM_001003688chr411122 ------
NM_001003694chr33596 566 43 --1571 1578
NM_001003698chr631666 1491 1236 --31670 1635 1364 --
NM_001003699chr631666 1491 1236 --31670 1635 1364 --
NM_001003712chr1221531 1402 11586 ----
NM_001003760chr643232 2600 672 526 32891 2525 1114 ----
NM_001003792chr331134 447 417 ------
NM_001003793chr331134 447 417 ------
NM_001003794chr372830 2811 2298 1911 1882 1027 663 169 82479 1198 1002 746 680 540 441 380 12022
NM_001003800chr993399 3135 2986 1509 1327 1221 1177 861 573 2776 182 23291 3287 11141
NM_001003805chr14----166 --
NM_001003810chr41584 1620 1255 --
NM_001003891chr223246 112 83 ------
NM_001003940chr15123637 3350 2823 2394 2384 1512 1428 1246 1173 1030 427 173 2566 500 53854 2980 2760 2507 1252 --
NM_001003942chr15123637 3350 2823 2394 2384 1512 1428 1246 1173 1030 427 173 2566 500 53854 2980 2760 2507 1252 --
NM_001003943chr15123641 3354 2827 2398 2388 1516 1432 1250 1177 1034 431 177 2570 504 53858 2984 2764 2511 1256 --
NM_001004065chr963348 3305 2931 2559 556 424 23645 439 ----
NM_001004106chr53676 222 81 --1848 1952
NM_001004127chr132691 368 ------
NM_001004317chr664429 3741 1638 908 624 25 11350 ----
NM_001004329chr121378 ------
NM_001004342chr1185797 5352 5020 4761 4566 4504 2101 1872 1313 980 814 792 768 730 700 680 643 275 44170 2226 1433 1249 105828 1614 1409 845 833 781 773 746 742 714 --
NM_001004354chr91918 1220 4814 767 762 59 --
NM_001004356chr4----21546 1048 --
NM_001004358chr4----21546 1048 --
NM_001004360chr241701 1676 1432 584 11412 ----
NM_001004419chr1244355 4333 4253 4159 24071 1332 11533 --
NM_001004441chr521374 1123 ------
NM_001005217chr42454 74 165 ----
NM_001005266chr154494 487 208 190 ------
NM_001005267chr154494 487 208 190 ------
NM_001005268chr154494 487 208 190 ------
NM_001005269chr154494 487 208 190 ------
NM_001005271chr1761166 1078 1043 353 262 195 1304 2274 93 21081 198
NM_001005273chr1761166 1078 1043 353 262 195 1304 2274 93 21081 198
NM_001005335chr19150 ------
NM_001005340chr7--1745 1858 --
NM_001005366chr122767 750 --1883 --
NM_001005375chrY51788 1396 1380 1307 477 11183 ----
NM_001005386chr22513 204 1287 ----
NM_001005404chr1784287 4264 3659 3503 3373 3011 1075 222 162 31585 1336 970 14267
NM_001005463chr1052433 2188 1846 859 731 ----11048
NM_001005473chr5125842 5672 5640 5416 5188 5137 5003 2301 2285 1474 1105 363 65699 4923 4335 2294 198 85 26496 2306 25987 4837
NM_001005502chr12114421 4098 3442 2030 1962 1846 1234 1159 967 573 118 14296 33432 2045 1701 --
NM_001005505chr341248 517 242 54 --1327 21633 57
NM_001005609chrX83444 3352 3139 3026 2377 1075 790 240 62568 2450 2418 1423 604 176 33848 1404 36 --
NM_001005732chr211629 ------
NM_001005733chr211586 ------
NM_001005741chr11392 --1157 --
NM_001005742chr11392 --1157 --
NM_001005746chr211061 21052 316 ----
NM_001005747chr211061 21052 316 ----
NM_001005753chr232063 1700 1675 11862 1661 2776 666
NM_001005781chr21487 ------
NM_001005782chr22936 28 1328 ----
NM_001005785chrY51788 1396 1380 1307 477 11183 ----
NM_001005786chrY51788 1396 1380 1307 477 11183 ----
NM_001005845chr841563 472 401 167 21712 41 ----
NM_001005849chr172561 134 --1141 --
NM_001005861chr32722 112 ------
NM_001005910chr31498 ------
NM_001005911chr31498 ------
NM_001005920chr1621088 995 1730 1723 --
NM_001006115chr392755 2637 2586 2250 2171 1747 916 831 406 1459 21126 31 --
NM_001006600chr511507 21684 542 ----
NM_001006605chr131127 993 907 21179 822 1111 --
NM_001006605chr131127 993 907 21179 822 1111 --
NM_001006634chr161143 ------
NM_001006636chr2--2821 56 ----
NM_001006641chr931779 1577 334 1532 11330 11197
NM_001006642chr931779 1577 334 1532 11330 11197
NM_001006643chr931779 1577 334 1532 11330 11197
NM_001006665chr15804 765 546 292 189 160 2172 166 --
NM_001006933chrX----158 --
NM_001006946chr241226 612 179 59 ----21393 234
NM_001007023chr1484629 4536 4203 3977 3920 3649 3366 1452 35033 4280 3340 ----
NM_001007067chr84340 241 119 48 --184 --
NM_001007068chr84340 241 119 48 --184 --
NM_001007069chr84340 241 119 48 --184 --
NM_001007070chr84340 241 119 48 --184 --
NM_001007097chr964075 4022 1721 1164 322 265 34532 3640 3557 13157 11959
NM_001007098chr11114 ------
NM_001007102chr611465 11136 ----
NM_001007156chr155748 678 672 228 168 11582 2399 199 --
NM_001007214chr121631 117 ------
NM_001007226chr1741423 1028 1012 497 ------
NM_001007227chr1741423 1028 1012 497 ------
NM_001007228chr1741423 1028 1012 497 ------
NM_001007229chr1741423 1028 1012 497 ------
NM_001007230chr1741423 1028 1012 497 ------
NM_001007237chr142459 589 461 54 1814 ----
NM_001007246chr2121582 174 11441 11194 --
NM_001007250chr1133 1663 ----
NM_001007257chr131410 1030 465 ------
NM_001007259chr21126 ------
NM_001007267chr21133 ------
NM_001007277chr1141118 777 446 182 --1251 --
NM_001007466chr655027 4790 1964 1483 1326 44968 1897 1807 1477 --21136 1109
NM_001007471chr9171 --177 1567
NM_001007553chr121113 444 --1145 --
NM_001007559chr1831873 697 90 11434 ----
NM_001007793chr101197 148 ----
NM_001007794chr1--1642 ----
NM_001008220chr573820 3784 2663 941 552 140 123 --2592 233 13787
NM_001008222chrX51184 1167 1058 559 299 ------
NM_001008223chr122541 119 --2511 36 --
NM_001008239chr18103715 3296 2527 2355 1192 1017 565 147 45 38 1594 2300 216 --
NM_001008272chr32110 82 --191 --
NM_001008273chr32110 82 --191 --
NM_001008388chr44410 209 107 92 ------
NM_001008392chr3103389 2879 2819 2710 2622 1345 947 386 344 302 12640 23576 1160 1953
NM_001008393chr472801 2781 2745 2647 2472 2281 779 1563 22602 1812 --
NM_001008408chr795935 5516 4642 4130 4040 4021 1520 1502 1023 45608 680 469 441 --15592
NM_001008410chr272309 2079 1613 686 530 433 419 --1801 41936 857 848 755
NM_001008495chr82505 360 1439 11516 --
NM_001008541chr1011773 --22256 389 --
NM_001008541chr1011773 --22256 389 --
NM_001008564chr131121 ------
NM_001008660chr1141441 1410 977 114 ------
NM_001008701chr1952901 2476 1229 1061 332 1202 132866 2839 2829 2754 2493 2285 2025 1197 1182 889 872 848 615 --
NM_001008711chr811414 134 ----
NM_001008726chr1441729 1650 1528 53 ------
NM_001008738chr542425 2389 1057 89 22359 1092 ----
NM_001008744chr1431500 240 85 1121 ----
NM_001008801chr19128 11442 ----
NM_001008925chr463272 2802 2401 1147 863 237 12646 ----
NM_001008938chr114389 371 323 172 ------
NM_001009184chr82364 85 --1526 --
NM_001009552chr81501 ------
NM_001009554chr493972 3890 1870 1829 1583 1503 534 294 174 1434 23425 1758 --
NM_001009554chr493972 3890 1870 1829 1583 1503 534 294 174 1434 23425 1758 --
NM_001009555chr431736 1089 710 21331 1098 1507 11247
NM_001009566chr111412 ------
NM_001009571chr741715 1706 1570 1488 11198 ----
NM_001009598chr12168 44 ------
NM_001009814chr13--195 ----
NM_001009880chr22104811 4545 3999 3587 3331 1804 1216 910 886 190 --14312 --
NM_001009899chr385948 5838 4434 4405 4269 4209 1979 687 45201 4983 2437 2305 35738 5349 5022 --
NM_001009923chr201578 ----1144
NM_001009955chr12528 158 ----1161
NM_001009955chr12528 158 ----1161
NM_001009993chr254362 3103 1569 1463 1034 11606 23191 2838 --
NM_001010000chr1873166 2816 2546 1198 837 743 240 33171 816 299 --11225
NM_001010846chr174079 3873 3835 3225 2992 245 115 --24275 3878 1893
NM_001010852chr61145 ------
NM_001010853chr632529 917 509 ------
NM_001010861chr13713 372 152 1821 ----
NM_001010862chrX73104 2684 2602 2151 1100 534 93 172 --13113
NM_001010888chrX63797 3579 3284 1580 1408 1253 13201 24493 4103 --
NM_001010891chr556504 6438 5635 5054 4986 --16442 --
NM_001010895chr9149 21977 183 ----
NM_001010898chr153712 2676 1167 1002 852 33538 692 294 43346 2426 1179 774 23217 1170
NM_001010924chr102249 52 --1994 --
NM_001010942chr121110 1178 ----
NM_001011553chr72754 398 --1223 --
NM_001011645chrX245 22 ------
NM_001011666chr7135999 5689 5052 4733 2444 2096 1574 1436 680 661 611 489 56 12358 26359 4514 45957 5590 1264 492
NM_001011705chr132286 270 ------
NM_001011708chr242764 2020 1123 794 --21160 1077 --
NM_001011713chr14--11005 ----
NM_001012264chr146957 764 734 691 605 83 1193 4769 669 238 87 --
NM_001012267chr921713 542 11456 ----
NM_001012393chr11135004 4184 3911 2045 1722 1495 1395 1348 947 887 626 291 38 24576 4339 33211 281 276 13218
NM_001012398chr16133 ------
NM_001012415chr92729 216 1617 ----
NM_001012426chr692863 2126 1351 1246 1003 466 459 441 45 --41330 1173 948 921 12997
NM_001012427chr692863 2126 1351 1246 1003 466 459 441 45 --41330 1173 948 921 12997
NM_001012512chr181208 ------
NM_001012513chr181219 ------
NM_001012642chr1581749 1733 1699 1691 1409 752 505 155 --132 --
NM_001012732chr43265 146 66 --11092 11052
NM_001012751chr1011577 21585 508 1710 --
NM_001012755chrX175075 4670 4570 4385 3567 3247 3228 3145 2039 1638 1497 1180 1142 1086 1058 772 44 31041 503 446 24390 1121 11009
NM_001012968chrX32422 397 385 21760 349 2331 327 --
NM_001012977chrX51173 1161 986 484 285 1168 4523 203 198 153 --
NM_001012989chrX3268 55 33 ------
NM_001013031chr104815 480 403 248 41106 866 668 466 1697 --
NM_001013398chr71493 2249 207 11508 --
NM_001013399chr621160 421 11128 ----
NM_001013415chr421430 312 --157 --
NM_001013438chr311014 ------
NM_001013439chr31860 ------
NM_001013615chr121057 419 ----1794
NM_001013635chr1251181 1116 1054 1012 454 --2288 27 21172 297
NM_001013690chr1231636 1600 579 11581 42369 2121 570 361 11625
NM_001013693chr142474 2279 258 90 12775 32240 429 235 --
NM_001013693chr142474 2279 258 90 12775 32240 429 235 --
NM_001014434chr1135 1826 1644 --
NM_001014435chr16186 143 1509 --
NM_001014442chr13127 ------
NM_001014797chr10157913 7603 7444 7235 7199 5477 3150 3022 2767 2341 2292 2181 2100 819 436 21147 984 37739 7207 5585 --
NM_001014809chr41294 --1135 1253
NM_001014839chr161036 948 840 821 104 64 ------
NM_001014841chr161036 948 840 821 104 64 ------
NM_001015045chr46784 656 571 356 288 116 --1549 1532
NM_001015053chr1731270 1228 1049 1214 51233 1118 567 518 423 11125
NM_001015508chr83699 241 191 --1708 --
NM_001015877chrX31139 522 481 1666 ----
NM_001015881chrX2514 456 21193 58 1901 --
NM_001015882chr91788 --1155 --
NM_001015887chr351553 1519 621 201 96 11405 ----
NM_001017368chr1772494 2337 2214 1838 1001 780 306 41125 886 286 164 1852 12010
NM_001017371chr211086 ------
NM_001017395chr343281 3076 2487 811 13011 13140 --
NM_001017405chr43688 354 334 --165 --
NM_001017424chr131577 1212 47 --31501 530 279 --
NM_001017425chr131577 1212 47 --31501 530 279 --
NM_001017440chr7187613 7388 7346 6516 6251 2508 2156 2146 1961 1866 1613 1522 1515 1092 848 732 507 69 47960 7396 2650 490 62818 2493 1916 1737 1061 511 13242
NM_001017523chr1241800 1615 1319 26 31921 163 38 11737 --
NM_001017916chr1721405 174 11587 31701 759 601 --
NM_001017917chr1721405 174 11587 31701 759 601 --
NM_001017920chr21126 ------
NM_001017923chr14130 21411 623 ----
NM_001017926chr831763 1729 1682 ------
NM_001017962chr102876 677 ------
NM_001017963chr141940 1798 ----
NM_001017973chr5----126 --
NM_001017974chr5----126 --
NM_001017977chr12261 117 ------
NM_001017981chr22----3571 245 40 --
NM_001017992chr521336 34 1109 ----
NM_001017995chr5134815 4498 4263 4230 4130 3793 3736 3677 3130 3049 1875 1419 654 11935 33376 2953 556 11625
NM_001017999chr142095 1888 374 368 --12274 --
NM_001017999chr142095 1888 374 368 --12274 --
NM_001018000chr142095 1888 374 368 --12274 --
NM_001018000chr142095 1888 374 368 --12274 --
NM_001018001chr142095 1888 374 368 --12274 --
NM_001018004chr153548 530 204 ------
NM_001018006chr153548 530 204 ------
NM_001018007chr153548 530 204 ------
NM_001018020chr153548 530 204 ------
NM_001018025chrX1334 ------
NM_001018050chr2243015 2701 2548 2403 --42565 2353 2134 252 32739 2665 1154
NM_001018052chr2243015 2701 2548 2403 --42565 2353 2134 252 32739 2665 1154
NM_001018054chr111235 ------
NM_001018056chr9193 ------
NM_001018064chr93793 307 283 2844 221 1780 129
NM_001018065chr9135853 5736 5295 5039 4992 4727 3740 1374 863 620 573 471 417 55910 5329 4898 2261 373 65300 4614 3959 3955 1670 422 1171
NM_001018066chr9135853 5736 5295 5039 4992 4727 3740 1374 863 620 573 471 417 55910 5329 4898 2261 373 65300 4614 3959 3955 1670 422 1171
NM_001018072chr1241800 1615 1319 26 31921 163 38 11737 --
NM_001018074chr533456 1372 1196 13388 --1634
NM_001018075chr533456 1372 1196 13388 --1634
NM_001018076chr533456 1372 1196 13388 --1634
NM_001018077chr533456 1372 1196 13388 --1634
NM_001018108chr15112032 1819 1564 862 784 734 726 654 596 335 154 --2905 158 2338 217
NM_001018111chr773527 3392 2839 2674 1404 431 149 1587 31125 1056 557 13530
NM_001020658chr121364 440 --11412 --
NM_001020658chr121364 440 --11412 --
NM_001020818chr1951734 186 139 108 81 --61879 532 214 196 191 92 1145
NM_001020819chr1951734 186 139 108 81 --61879 532 214 196 191 92 1145
NM_001020820chr1951734 186 139 108 81 --61879 532 214 196 191 92 1145
NM_001020821chr1951734 186 139 108 81 --61879 532 214 196 191 92 1145
NM_001023567chr1521906 458 --2878 574 --
NM_001023587chr31849 --21180 46 --
NM_001024094chr533456 1372 1196 13388 --1634
NM_001024218chr143649 231 86 ------
NM_001024401chr1652881 2111 1893 590 400 12551 12812 --
NM_001024455chrX112447 2433 2062 2045 1900 1068 969 949 833 322 38 12343 22452 764 12458
NM_001024460chr63983 445 267 11020 ----
NM_001024463chr151128 --1400 --
NM_001024647chr12137464 6676 6538 6079 6058 5069 4676 2492 1954 1058 961 371 110 46501 5604 5097 421 1375 26063 5590
NM_001024649chr542480 858 780 35 ----21979 1047
NM_001024666chrX2647 180 --1540 --
NM_001024668chr12----2793 666 --
NM_001024680chr221467 1366 11458 11411 --
NM_001024808chr12112748 2490 2447 2360 2320 1100 891 820 404 319 309 2384 164 22364 2018 --
NM_001024809chr1721181 58 21376 944 21336 127 --
NM_001024847chr341625 611 227 94 --1909 11663
NM_001024934chr61205 ----1559
NM_001024935chr61205 ----1559
NM_001024936chr61205 ----1559
NM_001024937chr173246 183 63 1202 4694 608 516 81 1253
NM_001024947chr51351 11005 --11119
NM_001024948chr11707 22855 2489 ----
NM_001025068chr321553 488 --1142 --
NM_001025069chr321553 488 --1142 --
NM_001025076chr10114921 4265 2385 2366 2211 2009 1713 1530 1441 1107 393 15190 54978 4802 4271 2442 2256 22012 1112
NM_001025077chr10126279 5623 4992 4775 2888 2799 2465 1751 1399 1387 967 163 26548 551 56336 6160 5629 1160 1127 12470
NM_001025079chr373133 2712 2676 2655 2526 1511 304 --31136 1106 905 1662
NM_001025081chr1861249 1182 1158 1031 453 223 --2477 247 --
NM_001025090chr1861249 1182 1158 1031 453 223 --2477 247 --
NM_001025092chr1861249 1182 1158 1031 453 223 --2477 247 --
NM_001025101chr1861249 1182 1158 1031 453 223 --2477 247 --
NM_001025105chr521378 1227 ------
NM_001025108chr2104181 3289 3182 3140 3039 1221 1193 881 629 228 1954 1644 1710
NM_001025201chr21527 1548 ----
NM_001025205chr3----2291 113 1297
NM_001025232chr121143 159 ----
NM_001025233chr123909 846 624 11035 ----
NM_001025266chr374884 3655 3360 1607 1401 488 156 34687 4515 3968 44324 3560 500 494 21957 1247
NM_001025579chr1731175 866 293 --1819 --
NM_001025580chrX134096 4036 3629 3479 3257 3166 2703 801 375 356 345 328 67 31389 615 49 54119 1702 396 383 364 --
NM_001025595chr421597 138 --11560 --
NM_001025596chr111126 ------
NM_001025603chr131058 536 63 41358 1104 1046 79 11017 --
NM_001025616chr451889 1205 697 621 423 11650 ----
NM_001025777chr221379 379 --1514 --
NM_001025780chr9135 --11374 --
NM_001029858chr652947 2151 2118 698 619 ----12997
NM_001029863chr651008 997 991 431 307 --12626 --
NM_001029875chr562658 2220 1169 1115 552 116 32807 1199 1185 11924 --
NM_001029882chr11210 ------
NM_001029882chr11210 ------
NM_001029989chr151358 1614 ----
NM_001029998chr441314 459 369 236 1914 1286 --
NM_001030001chr141327 ------
NM_001030006chr1772346 2155 1983 640 600 261 178 22618 2294 2779 774 1648
NM_001030007chr16133717 3630 2980 2834 2714 1113 855 772 760 393 256 239 232 23088 1186 22544 1283 --
NM_001030055chr141833 ------
NM_001030059chr10------1303
NM_001030272chr112498 420 ------
NM_001030273chr112498 420 ------
NM_001030287chr12291 88 --1871 1164
NM_001031677chr54485 428 345 66 ------
NM_001031679chr1243358 2725 555 300 12527 23152 1246 12497
NM_001031690chr7102828 2731 2100 1223 1125 834 819 412 376 26 1436 52775 2339 2251 2069 2039 12258
NM_001031695chr22165146 4930 4720 4078 3933 3905 3643 1642 1243 1220 949 826 814 620 607 596 45110 4504 1563 1286 65206 5201 5075 3915 3475 1871 14004
NM_001031702chr33771 370 245 ------
NM_001031723chr41314 ------
NM_001031738chr23454 204 116 159 ----
NM_001031804chr16114214 3641 3263 2993 2762 1144 802 777 636 595 445 11149 34166 3519 3463 1582
NM_001032221chr931650 1394 592 21446 58 21846 302 1595
NM_001032279chr112363 283 ------
NM_001032280chr621521 1061 --2454 94 --
NM_001032282chr8--21184 508 ----
NM_001032288chr2021074 549 21330 1235 3379 34 28 --
NM_001032289chrX----3333 71 51 --
NM_001032296chr1352845 707 465 215 44 --32801 2724 2174 2966 915
NM_001032380chr1021307 128 ------
NM_001032393chrX4776 715 495 147 ------
NM_001032394chr652638 2470 2033 1116 308 ----1749
NM_001032395chr652505 2337 1900 983 175 ----1616
NM_001033025chr151255 1215 530 504 55 --21248 1230 --
NM_001033026chr191158 --3432 90 51 --
NM_001033047chr462081 1860 429 244 75 65 11775 12245 --
NM_001033049chr2142301 1786 325 250 --1932 21587 1520
NM_001033059chr642007 1552 649 549 192 ----
NM_001033081chr141912 1594 714 197 1244 1611 --
NM_001033082chr141912 1594 714 197 1244 1611 --
NM_001033087chr2042501 2262 706 675 11254 11018 1681
NM_001033088chr153342 326 167 ------
NM_001033117chr3154484 4281 4040 3961 3886 1866 1688 1611 1592 1445 1318 813 690 316 290 23459 83 44698 4557 3547 1323 --
NM_001033506chr11----125 --
NM_001033507chr121488 421 1314 ----
NM_001033518chr7122619 2315 2020 2000 1084 1006 893 784 679 630 597 539 3923 571 340 22282 1089 --
NM_001033519chr7122619 2315 2020 2000 1084 1006 893 784 679 630 597 539 3923 571 340 22282 1089 --
NM_001033520chr7122619 2315 2020 2000 1084 1006 893 784 679 630 597 539 3923 571 340 22282 1089 --
NM_001033551chr1774057 3740 3430 2835 583 326 300 --33623 3365 3191 33714 1436 401
NM_001033557chr211297 ------
NM_001033561chr174898 805 796 296 --1315 --
NM_001033566chr172695 665 ------
NM_001033568chr172695 665 ------
NM_001033576chr1772371 1751 1743 775 598 208 161 32743 2563 2298 ----
NM_001033578chr832167 2032 300 ------
NM_001033602chr1352429 2367 1829 570 35 31031 654 507 --12359
NM_001033659chr1721502 1094 --11455 --
NM_001033723chr872479 2465 1990 765 742 483 122 --22609 950 --
NM_001033859chr17----266 40 --
NM_001033910chr152008 1748 1580 1560 638 ------
NM_001033925chr1011745 11756 1446 --
NM_001034025chr122879 63 1350 --1916
NM_001034850chr531305 426 132 ------
NM_001034915chr831336 472 447 1551 ----
NM_001034954chr1022006 1100 1778 1263 12455
NM_001034955chr1022006 1100 1778 1263 12455
NM_001034956chr1022006 1100 1778 1263 12455
NM_001034957chr1022006 1100 1778 1263 12455
NM_001035235chr54461 223 72 54 ------
NM_001035254chr942460 1822 828 589 --51727 961 735 556 78 1749
NM_001035260chr101212 1340 ----
NM_001035267chr121282 ------
NM_001035511chr192111 1875 1862 1766 1758 1405 720 216 80 --42139 2135 1885 1445 --
NM_001035512chr192218 1982 1969 1873 1865 1512 827 323 187 130 42246 2242 1992 1552 --
NM_001035513chr192218 1982 1969 1873 1865 1512 827 323 187 130 42246 2242 1992 1552 --
NM_001035521chr23794 736 666 1785 187 --
NM_001035534chr951375 1049 461 305 47 --3493 343 297 --
NM_001037131chr24441 404 371 107 ------
NM_001037132chr732226 2037 650 ------
NM_001037133chr732226 2037 650 ------
NM_001037164chr71200 ------
NM_001037317chr13713 372 152 1821 ----
NM_001037339chr14674 628 540 117 1372 21204 632 --
NM_001037340chr14674 628 540 117 1372 21204 632 --
NM_001037341chr14674 628 540 117 1372 21204 632 --
NM_001037341chr14674 628 540 117 1372 21204 632 --
NM_001037535chrX2523 56 ------
NM_001037536chrX2523 56 ------
NM_001037540chrX2523 56 ------
NM_001037872chr21531 ------
NM_001037954chr1143271 2375 2237 125 ------
NM_001038640chr152869 644 --1256 --
NM_001038702chr521883 962 --12784 22409 2183
NM_001038707chr141725 820 646 118 2748 636 32242 459 450 --
NM_001038707chr141725 820 646 118 2748 636 32242 459 450 --
NM_001039029chr1221857 783 1364 1330 --
NM_001039091chrX3393 281 148 1177 ----
NM_001039199chr2093838 3786 3202 3160 3151 3057 1790 1176 40 21010 682 11855 --
NM_001039350chr74684 500 79 64 --31129 689 173 --
NM_001039355chr143742 325 84 --122 137
NM_001039366chr223438 391 92 ------
NM_001039459chr741139 742 294 28 1227 4881 463 328 324 --
NM_001039465chr141214 ------
NM_001039479chr1452279 1851 1555 860 809 21702 473 1628 1448
NM_001039538chr232793 817 299 --13063 1749
NM_001039547chr3138007 7142 7009 6913 5004 2923 2915 2608 1699 1215 587 294 180 36649 3002 2984 37147 6192 1652 35964 2018 746
NM_001039550chr21180 1725 155 --
NM_001039570chr2284181 4154 3530 3491 3369 401 93 79 1697 44386 4114 3827 1308 14438
NM_001039571chr2284181 4154 3530 3491 3369 401 93 79 1697 44386 4114 3827 1308 14438
NM_001039574chr12819 330 ------
NM_001039577chr194426 4391 3927 2874 1711 1340 1334 944 279 31166 1148 738 33985 3074 777 --
NM_001039590chrX22941 1028 33454 3222 2517 13836 --
NM_001039591chrX22941 1028 33454 3222 2517 13836 --
NM_001039618chr1165013 4752 4632 2225 306 39 --25852 235 --
NM_001039690chr1611584 --52165 2063 1516 255 151 1335
NM_001039711chr151052 827 204 193 86 1784 1895 --
NM_001039712chr151052 827 204 193 86 1784 1895 --
NM_001039771chr142435 337 1991 1885 1193
NM_001039772chr11164 1154 ----
NM_001039802chr13892 425 21 1548 1176 21320 1312
NM_001039840chrX45946 1058 959 127 --11674 1890
NM_001039877chr193815 246 211 1289 3761 180 149 --
NM_001039916chr1231019 136 89 ------
NM_001039917chr1231019 136 89 ------
NM_001039918chr1231019 136 89 ------
NM_001039919chr1231019 136 89 ------
NM_001039920chr1231019 136 89 ------
NM_001039937chr1353704 3297 2737 2650 287 ----13197
NM_001039960chr1231259 257 250 31384 400 303 21319 1314 --
NM_001040002chr1731065 204 82 1297 3481 117 87 --
NM_001040020chr741499 1363 522 225 ----1528
NM_001040057chr72449 206 ------
NM_001040100chr341053 140 115 82 ------
NM_001040113chr162878 39 1801 1827 1793
NM_001040118chr11149 --2545 497 --
NM_001040134chr1941069 393 257 132 11484 ----
NM_001040135chr71783 --1209 --
NM_001040142chr21951 ------
NM_001040143chr21951 ------
NM_001040144chr1611584 --52165 2063 1516 255 151 1335
NM_001040146chr1611584 --52165 2063 1516 255 151 1335
NM_001040151chr11124388 4260 3927 3661 3025 2997 2930 1641 1453 967 821 110 53444 3383 3232 2909 1599 23994 3145 13935
NM_001040152chr745057 3799 342 94 21439 1207 ----
NM_001040153chr13--1367 199 --
NM_001040158chr53426 166 99 ------
NM_001040159chr42301 79 11379 ----
NM_001040172chr54998 630 383 110 31162 240 224 --11339
NM_001040173chr54998 630 383 110 31162 240 224 --11339
NM_001040181chr32731 64 --2979 961 --
NM_001040182chr32731 64 --2979 961 --
NM_001040183chr32731 64 --2979 961 --
NM_001040199chr32731 64 --2979 961 --
NM_001040200chr32731 64 --2979 961 --
NM_001040214chr63619 274 37 ------
NM_001040260chr471179 1003 895 833 733 420 193 1746 ----
NM_001040261chr471179 1003 895 833 733 420 193 1746 ----
NM_001040272chr971867 1661 459 405 284 127 101 1838 11453 --
NM_001040273chr1072002 1940 1842 1311 649 464 358 --22056 2050 11890
NM_001040284chr1695589 5176 5081 4690 4037 1062 953 932 28 35670 967 132 ----
NM_001040402chr442569 2458 110 96 ------
NM_001040409chr2--1334 ----
NM_001040429chr1343508 2529 1208 1202 1160 --12297
NM_001040439chr1631308 1159 235 --1541 --
NM_001040441chr174140 4018 3726 1935 1621 1561 52 --35119 3956 1278 --
NM_001040446chr552091 2065 1107 684 602 --22095 814 --
NM_001040450chr1512126 --1381 --
NM_001040453chr1512126 --1381 --
NM_001040455chr113979 841 272 1257 ----
NM_001040458chr541685 608 477 110 1273 1694 --
NM_001040619chr13538 225 128 --11321 1614
NM_001040624chr842039 1860 536 510 --32344 2069 134 12351
NM_001040625chr842039 1860 536 510 --32344 2069 134 12351
NM_001040626chr842039 1860 536 510 --32344 2069 134 12351
NM_001040627chr842039 1860 536 510 --32344 2069 134 12351
NM_001040628chr842039 1860 536 510 --32344 2069 134 12351
NM_001040629chr842039 1860 536 510 --32344 2069 134 12351
NM_001040630chr842039 1860 536 510 --32344 2069 134 12351
NM_001040633chr71127 ------
NM_001040697chr111507 ------
NM_001040708chr811017 --11029 --
NM_001040709chr19897 833 817 549 538 366 191 77 71 32135 777 181 52439 971 914 645 426 --
NM_001040712chr943178 2525 988 92 32739 1039 393 --1431
NM_001042353chr202548 406 1475 2380 376 --
NM_001042355chr1694930 4594 4549 4306 4068 3835 1192 1035 504 25198 5138 24574 2146 15307
NM_001042361chr101458 1257 --1619
NM_001042364chr101458 1257 --1619
NM_001042365chr101458 1257 --1619
NM_001042387chr101458 1257 --1619
NM_001042388chr183273 266 25 --1107 --
NM_001042393chr101458 1257 --1619
NM_001042396chr101458 1257 --1619
NM_001042397chr101458 1257 --1619
NM_001042404chr131322 521 174 --1285 --
NM_001042412chr1694930 4594 4549 4306 4068 3835 1192 1035 504 25198 5138 24574 2146 15307
NM_001042413chr9102685 2572 2534 1586 1136 1101 1090 1000 521 285 23191 557 1850 --
NM_001042425chr621521 1061 --2454 94 --
NM_001042437chr22730 62 4880 681 246 155 --1840
NM_001042476chr1661801 1635 734 439 366 84 11859 11998 --
NM_001042481chr1432567 671 492 ------
NM_001042486chr2021526 468 --21217 414 --
NM_001042492chr1793475 2748 2589 1121 899 882 385 374 105 22393 2142 32935 79 63 13292
NM_001042494chr1553639 3448 1249 900 754 12406 11003 --
NM_001042495chr1553639 3448 1249 900 754 12406 11003 --
NM_001042496chr1553639 3448 1249 900 754 12406 11003 --
NM_001042497chr1553639 3448 1249 900 754 12406 11003 --
NM_001042498chrX----2208 188 --
NM_001042506chrX61183 1172 1107 986 484 285 1168 51157 523 203 198 153 --
NM_001042510chr821406 429 2677 358 ----
NM_001042511chr821406 429 2677 358 ----
NM_001042537chrX52024 1659 1604 679 582 1834 1489 --
NM_001042539chr165986 944 903 272 162 1256 11068 --
NM_001042543chr4--11014 ----
NM_001042555chr1254132 3552 3516 1211 312 23191 3128 14773 14146
NM_001042599chr2157588 7023 6443 6327 5563 5511 5364 3037 2806 2603 2445 1584 349 79 49 56790 5739 1913 1526 114 67620 7616 6187 5766 5473 538 16738
NM_001042601chr332334 661 622 ------
NM_001042603chr1284846 4658 1788 1545 1394 1339 458 144 --14769 15337
NM_001042604chr374318 4145 3833 3752 3080 1384 33 33466 1722 39 24328 3756 --
NM_001042610chr1641381 1199 576 215 31395 1108 1073 21403 1285 --
NM_001042632chr2041981 1902 1671 510 --1121 --
NM_001042633chr2041981 1902 1671 510 --1121 --
NM_001042669chr451889 1205 697 621 423 11650 ----
NM_001042681chr182282 2145 2042 1982 990 876 569 268 --12084 --
NM_001042682chr182282 2145 2042 1982 990 876 569 268 --12084 --
NM_001042682chr182282 2145 2042 1982 990 876 569 268 --12084 --
NM_001042683chr621731 1151 --1718 --
NM_001042724chr191757 1523 1566 --
NM_001042728chr124932 755 424 115 1300 3883 339 174 --
NM_001042729chr13401 228 68 1544 1469 --
NM_001042747chr13401 228 68 1544 1469 --
NM_001042749chrX2758 625 ------
NM_001042750chrX2758 625 ------
NM_001042751chrX2758 625 ------
NM_001042762chr72832 356 2916 179 ----
NM_001043318chr1483440 3196 1264 968 808 794 703 576 23538 1273 21488 502 --
NM_001044305chr621282 1083 1225 11391 --
NM_001046chr55849 466 430 338 220 12320 ----
NM_001048183chr1103494 3432 3419 618 503 468 450 250 219 47 23773 87 42890 1134 319 51 13631
NM_001049chr1462422 2226 453 332 309 301 11599 3951 631 270 --
NM_001068chr3159 ------
NM_001071775chr13----11477 --
NM_001074chr4194 ------
NM_001080418chr12578 545 --1166 1548
NM_001083620chr4--197 ----
NM_001087chr2--2402 122 1323 1329
NM_001092chr174489 474 421 364 --1845 21891 495
NM_001095chr1251686 1498 1271 466 118 --51724 1720 1518 1491 706 1369
NM_001096chr173842 304 47 ------
NM_001100108chr1127764 5269 2971 2426 2207 1562 1207 834 807 749 705 671 48330 6630 6444 3007 77876 6754 2198 1427 1423 1102 1096 --
NM_001106chr3129708 7561 6272 6061 3790 3382 3302 2960 2397 2248 1723 332 37478 7305 730 47992 2201 496 461 --
NM_001113490chrX83470 3374 2789 2479 2274 769 572 55 32448 1177 581 ----
NM_001116chr1642865 2143 1960 181 32603 378 78 42165 2044 615 197 12292
NM_001117chr1852068 2004 1588 830 739 --11841 1548
NM_001119chr451495 1359 1259 1007 388 --1336 --
NM_001121chr1031364 1314 629 --1297 --
NM_001123chr102693 55 ------
NM_001126chr11938 1688 ----
NM_001127chr223984 73 30 ------
NM_001128chr16133717 3630 2980 2834 2714 1113 855 772 760 393 256 239 232 23088 1186 22544 1283 --
NM_001130chr191199 1181 1334 2889 639
NM_001131chr61368 --1339 --
NM_001135chr151727 1270 1757 1283
NM_001140chr173238 222 198 1100 4227 214 207 203 --
NM_001144chr162198 166 ------
NM_001146chr831940 1575 107 11952 ----
NM_001148chr451941 1501 529 320 225 11814 ----
NM_001149chr1011207 ------
NM_001156chr10--1508 ----
NM_001160chr1212667 1169 1876 --
NM_001167chrX86676 4851 4662 2534 1972 1940 1438 1173 44892 4606 4563 1339 ----
NM_001173chr141833 ------
NM_001174chrX31966 428 309 --11577 --
NM_001178chr112498 420 ------
NM_001183chrX187 2232 95 --2600 56
NM_001189chr43943 780 333 ----1896
NM_001191chr203944 442 379 --2477 41 --
NM_001198chr652225 1640 958 750 122 --12243 22191 311
NM_001200chr201800 21086 109 ----
NM_001201chr422726 63 43624 1274 1198 955 13612 23751 911
NM_001202chr141111 ------
NM_001204chr2117382 6745 6340 5369 4800 2441 2089 1323 1298 778 577 41798 1188 892 558 12204 24791 1846
NM_001206chr932865 2058 908 12349 22199 1192 --
NM_001217chr191100 ------
NM_001219chr731742 1566 640 1906 11396 --
NM_001222chr1011417 --11657 --
NM_001232chr111033 2837 132 2867 109 1891
NM_001233chr732390 2221 2133 22205 359 ----
NM_001237chr4----1355 --
NM_001237chr4----1355 --
NM_001238chr191118 ------
NM_001241chr21170 ------
NM_001241chr21170 ------
NM_001256chr1722502 746 12156 --11035
NM_001257chr1661411 1184 561 441 223 186 ------
NM_001259chr7166358 6231 5986 5854 5498 5140 4822 4708 4519 1312 1226 998 917 775 143 111 24187 579 12203 --
NM_001268chr13268 39 ----133
NM_001270chr511028 1132 ----
NM_001271chr1572990 2782 2293 2223 1093 306 162 31279 739 684 11109 --
NM_001273chr122114 69 --3182 100 45 --
NM_001274chr112143 123 165 ----
NM_001275chr142403 271 --1276 --
NM_001277chr111893 --2908 692 --
NM_001278chr102337 70 ------
NM_001282chr1772346 2155 1983 640 600 261 178 22618 2294 2779 774 1648
NM_001283chr75680 604 430 124 62 1198 1189 --
NM_001284chr52503 385 ------
NM_001290chr42851 204 ------
NM_001293chr112388 63 ------
NM_001294chr19----188 --
NM_001304chr1773812 3510 2732 2487 2436 1198 170 22363 1462 1175 22496 1534
NM_001310chr1242058 1239 791 402 52672 2488 1233 1063 350 12339 12345
NM_001313chr41294 --1135 1253
NM_001331chr11102211 2186 1731 1121 1110 1033 923 500 299 171 32630 1749 152 --32232 2021 1739
NM_001343chr56594 539 466 320 304 268 11540 ----
NM_001346chr362510 1913 1040 567 334 119 12754 1669 11916
NM_001351chr351770 1370 1354 1281 378 1730 ----
NM_001364chr11144467 4444 4370 3872 3706 3339 3309 3289 3244 3131 1441 1087 936 919 63782 3760 2938 1921 1827 1550 24175 3233 23194 393
NM_001365chr174761 557 125 110 1502 ----
NM_001383chr172253 181 ------
NM_001386chr852013 740 349 208 73 --31601 1579 78 --
NM_001387chr562898 2122 1235 891 787 674 12914 1738 22872 1215
NM_001388chr172707 453 1204 ----
NM_001389chr211440 ----1447
NM_001395chrX2994 321 ------
NM_001396chr2121036 957 12713 11103 --
NM_001397chr172590 2307 2257 1844 1038 503 112 --11969 --
NM_001399chrX83444 3352 3139 3026 2377 1075 790 240 62568 2450 2418 1423 604 176 33848 1404 36 --
NM_001401chr941344 500 385 220 ------
NM_001402chr631964 1629 429 ----11664
NM_001406chr17131671 1476 1382 1360 1241 556 468 439 416 390 362 186 39 21149 1129 31649 1163 408 11247
NM_001407chr341679 1505 1481 563 --2420 384 --
NM_001408chr131495 1382 1052 2413 394 41264 356 43 38 1363
NM_001412chrX43706 2596 1411 1189 23393 2957 --13709
NM_001417chr1251774 1745 1302 1201 117 --21466 1217 --
NM_001418chr112293 143 ------
NM_001418chr112293 143 ------
NM_001419chr1964009 3883 3842 3613 3098 1862 --43520 3145 1748 933 --
NM_001421chrX61682 1636 1448 1373 1359 326 --11366 --
NM_001422chr112205 91 ------
NM_001423chr121451 --11591 --
NM_001426chr25641 613 591 571 495 ------
NM_001427chr73789 772 742 11541 6821 808 804 757 750 725 --
NM_001429chr223904 406 231 ------
NM_001431chr631218 808 442 1884 1164 --
NM_001438chr183646 852 524 476 464 336 320 209 33002 508 221 8491 486 481 469 446 441 434 382 124
NM_001439chr151255 1215 530 504 55 --21248 1230 --
NM_001448chrX21545 383 --11441 --
NM_001449chrX31056 489 121 --2510 101 --
NM_001451chr1631237 352 80 --2976 189 --
NM_001460chr173473 3251 3036 2989 2665 405 149 22966 2563 --1397
NM_001461chr13214 192 140 ------
NM_001463chr23813 174 167 137 ----
NM_001482chr15--2726 329 ----
NM_001489chr91111 ------
NM_001493chrX2228 75 --3736 687 184 --
NM_001494chr101148 ------
NM_001495chr871033 934 905 893 401 312 156 1118 1921 --
NM_001497chr921112 498 1141 --12216
NM_001518chr731153 356 104 ----1927
NM_001521chr23794 736 666 1785 187 --
NM_001527chr633688 3152 287 34729 4142 1849 ----
NM_001530chr142365 141 ------
NM_001533chr19150 ------
NM_001542chr142459 589 461 54 1814 ----
NM_001543chr5114441 4216 3576 2964 1808 1602 701 636 469 448 266 13423 34826 4722 1873 21948 1923
NM_001546chr611242 --11247 --
NM_001554chr1----1437 --
NM_001555chrX127 ------
NM_001560chrX62550 1971 1746 1707 954 307 22419 51 --12129
NM_001584chr1121020 986 11105 ----
NM_001587chrX22133 1957 32172 784 355 31711 1506 436 --
NM_001604chr111687 ------
NM_001609chr1054134 3671 3659 3593 2918 34113 3467 3399 --11779
NM_001614chr171482 ------
NM_001614chr171482 ------
NM_001616chr242580 2534 829 823 23130 834 ----
NM_001617chr251232 958 478 401 268 21223 425 3969 56 51 --
NM_001619chr113233 107 64 1404 2973 268 --
NM_001621chr722536 523 1839 ----
NM_001621chr722536 523 1839 ----
NM_001634chr642007 1552 649 549 192 ----
NM_001635chr72876 435 ------
NM_001650chr1893470 2696 2562 1522 1085 613 553 263 59 --1352 1683
NM_001655chr1111479 179 51887 1881 1540 1534 1530 --
NM_001659chr12122561 2434 2208 2094 2016 1996 1088 1069 756 745 591 381 --72668 2539 2082 889 400 361 79 11686
NM_001660chr32645 512 1237 ----
NM_001662chr71255 --191 --
NM_001663chr141178 2898 835 2551 541 --
NM_001668chr121520 683 --62267 1525 257 132 106 101 11974
NM_001670chr221629 ------
NM_001674chr12291 88 --1871 1164
NM_001677chr12834 822 ----122
NM_001678chr1791729 1626 1358 636 558 450 268 203 190 31233 662 149 51699 1404 1327 1192 727 21207 193
NM_001682chr1222083 502 ------
NM_001683chr382479 2292 1930 1835 1078 899 163 58 1253 31910 1905 268 --
NM_001684chr1163566 3542 3459 3451 3397 3260 2827 2786 2695 2628 1684 1471 1299 788 577 539 1485 73381 3035 1408 1175 663 587 583 33599 3145 1501
NM_001690chr362501 2104 1694 542 212 141 11653 1313 --
NM_001693chr831139 804 442 --11045 --
NM_001694chr162401 152 ------
NM_001695chr822732 281 --24221 118 --
NM_001696chr223438 391 92 ------
NM_001701chr921473 1280 1248 21356 56 --
NM_001703chr1----1185 --
NM_001704chr6--1154 ----
NM_001706chr31231 ----140
NM_001707chr73361 168 122 ------
NM_001709chr1122351 1864 --1859 --
NM_001711chrX51029 769 747 683 673 11078 ----
NM_001717chr151445 21480 263 --1195
NM_001718chr621311 959 1277 ----
NM_001720chr161727 869 796 645 635 140 --1874 137
NM_001722chr82504 152 --1187 --
NM_001730chr1311514 ------
NM_001730chr1311514 ------
NM_001731chr123920 746 187 ------
NM_001742chr711395 11216 ----
NM_001743chr21150 ------
NM_001746chr542480 858 780 35 ----21979 1047
NM_001748chr12941 296 131 11008 --
NM_001754chr21123477 3101 3062 2999 2978 2942 2838 2828 2798 2786 1109 976 --14247 --
NM_001755chr1631815 624 348 ------
NM_001759chr1284508 3998 3760 1871 1414 1261 1044 713 --33574 1158 1063 --
NM_001760chr65916 735 391 373 241 ----1244
NM_001762chr7--1109 ----
NM_001768chr261187 1058 475 449 330 88 --267 45 --
NM_001773chr141228 1182 1167 104 11429 41321 477 83 60 --
NM_001777chr373133 2712 2676 2655 2526 1511 304 --31136 1106 905 1662
NM_001781chr124852 623 140 90 ------
NM_001782chr9--1246 --160
NM_001783chr196251 153 105 94 85 68 1386 --1254
NM_001788chr72754 398 --1223 --
NM_001790chr54377 368 349 74 2289 271 ----
NM_001791chr13892 425 21 1548 1176 21320 1312
NM_001798chr122733 124 --2242 234 1296
NM_001810chr205770 661 564 220 125 2607 547 --1773
NM_001822chr21527 1548 ----
NM_001823chr14--139 ----
NM_001826chr1188 2410 54 ----
NM_001829chr42618 226 ------
NM_001830chrX53206 3160 1343 1100 339 --22909 1365 13509
NM_001839chr12661 166 190 ----
NM_001842chr91538 --1197 --
NM_001844chr12--160 ----
NM_001854chr121109 550 ------
NM_001858chr654990 4121 3347 3189 831 24156 195 ----
NM_001859chr973421 3002 2993 852 393 347 88 --33071 3007 269 13265
NM_001862chr2----181 --
NM_001874chr12114421 4098 3442 2030 1962 1846 1234 1159 967 573 118 14296 33432 2045 1701 --
NM_001882chr5193 ------
NM_001884chr52564 501 ------
NM_001885chr11144 ------
NM_001891chr4124 ----1344
NM_001892chr521378 1227 ------
NM_001895chr203996 779 425 2452 364 11019 --
NM_001901chr611054 ------
NM_001903chr51727 1919 ----
NM_001904chr31304 ------
NM_001915chr1721405 174 11587 31701 759 601 --
NM_001921chr43265 146 66 --11092 11052
NM_001923chr111609 --2471 102 --
NM_001932chr17----1652 --
NM_001933chr1441013 317 279 56 --1986 --
NM_001935chr21922 ------
NM_001936chr74684 500 79 64 --31129 689 173 --
NM_001938chr121548 44 ------
NM_001945chr541354 1048 275 247 --11100 --
NM_001949chr652089 1145 618 399 92 22098 1204 3427 316 309 186
NM_001951chr84555 501 408 128 ------
NM_001954chr63618 522 216 1591 4208 183 175 93 1222
NM_001956chr1192 --1447 --
NM_001962chr51235 ----1453
NM_001964chr531197 185 173 --1191 --
NM_001971chr12------129
NM_001973chr11366 ------
NM_001975chr126791 544 244 226 185 119 1218 ----
NM_001977chr441697 1403 375 217 11432 ----
NM_001978chr84866 722 172 57 1913 1110 1995
NM_001981chr131735 317 43 11501 ----
NM_001982chr123201 108 69 1368 1315 2247 208
NM_001995chr461165 975 580 546 285 50 2223 142 --1524
NM_001999chr51116 11251 ----
NM_002006chr475433 1844 1752 814 663 525 447 45487 4960 1129 729 34154 1503 556 --
NM_002009chr1521059 84 2871 71 11805 --
NM_002010chr131187 ------
NM_002013chr141201 ------
NM_002015chr1352323 2189 1321 1178 151 ------
NM_002017chr111171 --21412 1238 --
NM_002023chr13506 178 134 31301 448 290 11475 --
NM_002024chrX21785 880 1684 ----
NM_002025chrX118753 8046 8037 7706 7557 6972 6586 6308 6243 1150 1076 57390 6995 3537 2263 1052 68784 8437 8350 7565 1155 644 23406 2521
NM_002026chr221013 156 --11033 --
NM_002037chr61318 ------
NM_002039chr41130 1317 ----
NM_002040chr2141027 957 849 394 ------
NM_002045chr32346 125 171 194 1128
NM_002048chr91183 1122 11066 --
NM_002051chr102448 53 --1825 --
NM_002054chr21410 ------
NM_002060chr11197 --1170 1488
NM_002063chrX2235 28 1970 ----
NM_002069chr731686 1174 174 ------
NM_002072chr96939 793 785 755 371 360 1408 133 --
NM_002074chr151619 1609 1516 1155 231 ----11663
NM_002076chr1273161 2841 1116 887 876 223 159 1723 21095 785 --
NM_002077chr972066 1915 1793 1531 1517 609 152 1846 1509 --
NM_002080chr16134 ------
NM_002082chr53639 185 44 --1811 1915
NM_002084chr53851 537 330 --1104 --
NM_002086chr1782058 2044 1912 1884 1790 613 530 497 --22034 249 21853 1668
NM_002091chr181208 ------
NM_002092chr444803 4119 1267 638 1423 13758 --
NM_002094chr162356 331 --173 --
NM_002103chr196992 930 815 752 731 202 1263 1714 1933
NM_002107chr1162 ------
NM_002111chr4123512 3263 3198 3138 2902 2804 2445 2429 1468 1193 280 229 1553 23558 540 23223 2787
NM_002114chr6----169 --
NM_002126chr1784186 3764 3590 3394 790 547 378 82 11082 1992 --
NM_002130chr51197 ------
NM_002135chr121414 1404 1365 2379 124
NM_002137chr72964 319 ------
NM_002138chr41584 1620 1255 --
NM_002139chrX2567 447 1258 2612 606 --
NM_002141chr72586 51 ------
NM_002145chr172148 25 ------
NM_002146chr173503 180 116 --2149 144 1513
NM_002147chr175944 921 247 228 154 --1306 --
NM_002148chr21659 --1608 --
NM_002149chr22498 210 ------
NM_002156chr21374 ------
NM_002158chr232320 433 306 13696 12872 1740
NM_002165chr20--1299 ----
NM_002167chr1----1144 --
NM_002168chr151106 ------
NM_002182chr342031 1917 265 162 12687 2730 339 --
NM_002187chr511138 ------
NM_002192chr72618 450 ------
NM_002193chr24611 563 403 60 11865 ----
NM_002199chr42667 165 ------
NM_002202chr52772 28 ------
NM_002203chr552833 2631 1322 825 618 13952 22594 927 --
NM_002204chr1731355 1310 231 41373 1001 361 237 ----
NM_002205chr121370 1771 1942 --
NM_002207chr33202 86 61 ------
NM_002220chr152328 247 ----1366
NM_002221chr172869 2662 2230 1160 1094 551 58 12525 32961 2248 42 22668 710
NM_002223chr1233436 1535 31 13224 23859 649 --
NM_002225chr15144 ----174
NM_002226chr142686 340 --1745 --
NM_002227chr12385 188 --146 --
NM_002230chr17101014 985 891 825 744 401 216 166 137 63 --1992 --
NM_002232chr151252 849 430 381 214 ----1993
NM_002234chr121125 1173 1135 --
NM_002240chr21149 --125 --
NM_002241chr1113145 2266 1233 965 940 933 816 789 606 197 48 12089 21017 945 32032 404 191
NM_002247chr1052239 1572 433 90 50 --2908 81 --
NM_002249chr1----1451 --
NM_002250chr19----134 --
NM_002252chr21111 1462 136 --
NM_002253chr42995 205 177 ----
NM_002254chr242274 1570 1443 407 1649 ----
NM_002264chr3154570 4464 4230 4209 4135 3334 3121 1440 1296 1258 1019 763 567 485 197 44800 1161 903 93 ----
NM_002265chr17--1307 1856 --
NM_002267chr1332071 2047 254 ----127
NM_002268chr32761 755 --11622 1764
NM_002270chr555097 5060 1668 1408 1399 65462 4602 4211 3886 3442 493 34254 2175 573 11853
NM_002271chr1341820 1570 835 781 2575 538 156 --
NM_002274chr173353 311 254 ------
NM_002283chr124803 774 762 25 --1519 --
NM_002285chr2104181 3289 3182 3140 3039 1221 1193 881 629 228 1954 1644 1710
NM_002293chr192618 2161 2079 1937 1776 1733 1110 497 217 --1248 --
NM_002309chr2263002 2875 2594 847 726 714 11967 63010 2249 2243 2054 1130 230 13015
NM_002310chr5155819 5793 5569 5499 5444 5418 4677 2404 2398 2191 2126 1815 1360 1031 456 --45612 2256 1881 1840 --
NM_002319chr7----5746 327 308 38 32 --
NM_002333chr1951182 1005 438 253 85 ------
NM_002334chr1141604 1513 685 406 1341 3798 315 38 --
NM_002336chr1254961 4820 1690 1231 939 22037 1500 ----
NM_002351chrX1554 ------
NM_002353chr14231 182 110 76 --1126 --
NM_002355chr1241109 1033 568 28 2147 121 1166 --
NM_002356chr632825 2358 251 1864 ----
NM_002359chr17133822 3469 3044 2913 2890 2825 2759 2731 1613 1253 933 123 106 23827 2952 63891 3514 2832 1130 117 84 --
NM_002373chr1511321 21273 490 21225 479 --
NM_002374chr232793 817 299 --13063 1749
NM_002375chr382242 2059 1827 1709 1514 681 182 25 --51606 538 292 225 74 --
NM_002382chr1441308 1059 941 59 --21063 182 11041
NM_002383chr167809 767 726 374 367 349 95 2329 79 1891 --
NM_002384chr181394 --1211 --
NM_002385chr1861249 1182 1158 1031 453 223 --2477 247 --
NM_002387chr5104568 3430 3131 1476 1266 921 873 689 422 209 14498 13589 --
NM_002390chr1731876 205 103 ------
NM_002395chr62197 49 1480 ----
NM_002397chr51780 --11940 --
NM_002398chr211086 ------
NM_002399chr1521073 1019 ------
NM_002401chr1752359 1868 413 143 83 ------
NM_002403chr1179 ----1281
NM_002404chr173688 374 239 --127 --
NM_002406chr55833 747 395 371 93 --2413 354 --
NM_002430chr2261934 1748 728 709 351 259 --51738 1728 993 61 38 12114
NM_002442chr1271725 1591 1567 1328 1279 1185 436 11127 1452 --
NM_002444chrX71664 1313 465 269 229 222 177 1289 21436 1360 --
NM_002457chr11--1130 ----
NM_002465chr122233 34 1202 ----
NM_002466chr202270 108 ------
NM_002473chr226994 454 198 181 150 90 ----160
NM_002479chr12534 307 --1146 1234
NM_002480chr121502 ------
NM_002481chr1237852 7493 7452 7269 7226 6673 6640 6571 6464 6454 6144 5925 5579 3075 2818 2746 1957 981 915 712 304 186 77 26978 5136 77563 5354 5197 4970 4887 717 688 --
NM_002486chr93757 705 100 1184 ----
NM_002499chr1552313 1634 871 692 215 --2915 175 --
NM_002500chr22864 422 ----1425
NM_002501chr1994128 3928 3871 3127 2902 2553 1575 617 378 --73207 1214 901 868 571 353 182 1456
NM_002505chr62541 70 11272 11510 2396 354
NM_002508chr131679 178 143 21271 305 21618 360 127
NM_002509chr205694 682 628 608 221 ------
NM_002515chr1421542 440 --21740 1639 --
NM_002516chr19153 --2266 232 --
NM_002518chr21397 11170 ----
NM_002519chr1131301 1231 571 1162 11103 --
NM_002520chr5----1104 --
NM_002522chr17102928 2394 1497 1377 1368 510 387 205 89 78 --12525 2880 836
NM_002524chr14957 263 132 72 ----1848
NM_002537chr153794 437 379 ------
NM_002542chr32210 59 --141 --
NM_002545chr11135004 4184 3911 2045 1722 1495 1395 1348 947 887 626 291 38 24576 4339 33211 281 276 13218
NM_002546chr81237 ------
NM_002547chrX102899 1643 1436 1290 1041 924 761 357 350 339 --23984 657 2117 43
NM_002553chr71397 ------
NM_002556chr1171968 1771 1526 1339 863 756 96 11456 41985 1784 1623 1530 21789 822
NM_002568chr81310 ------
NM_002570chr152367 229 1876 159 --
NM_002572chr112349 37 --175 --
NM_002576chr114291 103 88 38 ----11187
NM_002577chr3113725 3504 3123 2948 2574 1539 1516 892 808 792 195 1781 31626 1492 904 13715
NM_002579chr1941069 393 257 132 11484 ----
NM_002581chr985156 5062 3766 3683 2151 1446 977 605 35570 4729 1231 --1435
NM_002585chr11260 --1136 --
NM_002586chr651645 1298 1288 1162 1099 11104 2400 395 --
NM_002588chr5111718 1681 1666 1406 1390 1300 717 541 501 322 57 1647 2390 175 --
NM_002589chr4151 ------
NM_002594chr2011620 --21640 309 122
NM_002599chr1141123 1056 112 21 --2363 141 1288
NM_002600chr14674 628 540 117 1372 21204 632 --
NM_002601chr21196 1182 ----
NM_002605chr154467 318 153 85 11203 ----
NM_002607chr71244 --145 --
NM_002608chr22101579 1538 1524 1374 1358 1273 262 172 142 94 11244 31517 1510 339 11494
NM_002609chr531712 119 84 21918 268 ----
NM_002610chr252894 2824 2362 1249 391 ------
NM_002612chr721359 59 ------
NM_002613chr16144687 4670 4452 4394 3930 3353 3256 2116 2104 1942 1919 1291 1259 536 --11414 11157
NM_002616chr172114 48 ------
NM_002620chr4171 ------
NM_002622chr53217 82 24 2297 163 2631 621 --
NM_002623chr202801 69 ------
NM_002628chr33449 441 385 --11143 --
NM_002633chr13471 453 382 --1401 --
NM_002634chr172934 718 1192 171 1860
NM_002636chr61389 145 166 1429
NM_002641chrX21828 601 ------
NM_002643chr21167 ------
NM_002646chr182177 1738 865 797 724 666 498 183 32156 2149 1809 ----
NM_002648chr661198 972 511 449 428 73 1242 1980 1934
NM_002649chr72280 143 11141 1624 --
NM_002651chr15886 866 837 314 212 1349 1650 --
NM_002655chr864488 4256 1734 1233 844 745 24407 3915 21619 1153 --
NM_002657chr20133654 3580 2509 1367 1338 1300 1291 1144 851 801 777 400 287 23646 1547 63184 2864 2514 2475 979 314 12651
NM_002670chr341540 1334 1250 435 --11461 --
NM_002687chr1421152 335 --21207 71 --
NM_002693chr151151 ------
NM_002697chr1196 ------
NM_002698chr1922349 1141 1797 52604 2314 2295 2276 1013 --
NM_002699chr141365 1078 598 497 --31372 1254 529 21259 1093
NM_002706chr21580 ------
NM_002709chr263534 2393 1279 878 507 443 13209 13201 13592
NM_002710chr121737 --1122 --
NM_002711chr71613 ------
NM_002713chr14412 275 262 252 189 1885 --
NM_002714chr64971 361 98 91 2777 58 1939 2974 299
NM_002715chr52914 443 ------
NM_002716chr1163625 3507 3501 3449 721 193 11433 13113 --
NM_002717chr8133 ----1105
NM_002718chr352693 2568 619 238 213 1818 22323 892 --
NM_002719chr1442350 2120 1682 71 22280 181 21758 617 --
NM_002720chr163241 66 33 ------
NM_002725chr183635 3244 1111 659 481 251 241 92 --34263 1759 299 21310 1298
NM_002726chr63508 169 90 ----153
NM_002730chr1961357 1265 1249 924 907 235 --4974 460 247 240 --
NM_002731chr132799 276 237 --1659 12962
NM_002734chr1772213 1982 1535 655 238 114 74 --11525 11538
NM_002742chr142716 661 ------
NM_002745chr22114457 4022 3600 3209 2948 2761 1691 1322 1046 505 387 161 ----
NM_002746chr161426 --1188 --
NM_002747chr184667 562 507 232 --21504 82 --
NM_002752chr51400 ------
NM_002753chr41298 ------
NM_002764chrX6887 803 750 645 213 54 --1681 --
NM_002765chrX3393 281 148 1177 ----
NM_002772chr21--3528 390 42 ----
NM_002775chr103213 150 31 1457 ----
NM_002790chr1125 ------
NM_002819chr1931107 1020 327 --31166 546 352 --
NM_002821chr65546 307 249 236 163 --3565 557 154 --
NM_002822chr1221808 1230 ------
NM_002824chr12--1399 --1147
NM_002827chr2051480 1371 418 202 156 ------
NM_002829chr92926 269 1877 --133
NM_002833chr1541202 500 410 321 --51426 371 366 152 38 1630
NM_002834chr1283417 2971 1477 1149 1142 1105 1003 972 1204 ----
NM_002839chr943178 2525 988 92 32739 1039 393 --1431
NM_002840chr161377 1151 667 387 370 226 1297 1518 --
NM_002841chr31469 ------
NM_002843chr1182544 2422 745 737 701 641 493 255 --11116 --
NM_002844chr621270 372 ------
NM_002845chr18132 3472 249 89 ----
NM_002847chr741504 1091 1000 283 ----11335
NM_002848chr1221312 1234 --1945 --
NM_002849chr12182 ------
NM_002850chr191794 11216 21056 242 --
NM_002859chr1271712 1358 1212 1158 665 550 333 11820 21337 31 11255
NM_002866chr193452 38 29 --3230 48 21 --
NM_002868chr12122403 2170 2160 1981 1908 1845 1660 912 805 773 744 249 32314 2245 2063 72264 2234 2105 1988 1931 1818 370 11994
NM_002869chr1171768 1762 1705 1484 452 98 25 22069 1782 ----
NM_002871chr171366 1262 1241 640 277 231 94 1166 11370 --
NM_002874chr92885 652 --1891 --
NM_002880chr37680 658 566 258 161 124 74 ------
NM_002886chr3125174 4975 4668 3549 1872 1863 1828 1303 1253 1142 544 269 21132 1093 14599 14825
NM_002890chr51265 ------
NM_002892chr1421316 606 ----123
NM_002895chr201639 1912 1837 --
NM_002906chr111373 21632 1520 1441 1385
NM_002912chr61792 1306 ----
NM_002918chr193780 763 303 ------
NM_002924chr13234 209 161 --1589 --
NM_002926chr431173 1022 129 ----1327
NM_002941chr3------1209
NM_002942chr31178 ------
NM_002945chr172856 131 1723 1590 --
NM_002953chr15804 765 546 292 189 160 2172 166 --
NM_002955chr631666 1491 1236 --31670 1635 1364 --
NM_002956chr1221271 1212 --1945 --
NM_002958chr32722 112 ------
NM_002959chr194129 3489 3332 2859 1110 966 954 894 614 33062 679 91 14148 24174 1116
NM_002968chr16----197 --
NM_002970chrX158 ------
NM_002971chr341019 742 348 74 ------
NM_002973chr12145 ------
NM_002977chr231203 958 714 22452 344 21270 988 --
NM_002994chr421221 142 2658 35 11515 --
NM_002997chr241226 612 179 59 ----21393 234
NM_003001chr192218 1982 1969 1873 1865 1512 827 323 187 130 42246 2242 1992 1552 --
NM_003009chr191264 --1102 1316
NM_003010chr1741817 1808 934 467 21960 1848 ----
NM_003011chr94585 385 214 97 --2242 29 --
NM_003012chr872981 1217 1203 1139 1114 628 409 22782 1068 31144 612 159 --
NM_003016chr1761855 1849 1577 781 770 276 ------
NM_003017chr6--11235 11375 --
NM_003026chr911112 1916 2952 465 31081 958 427
NM_003028chr9103596 3005 2924 2711 2635 2605 2513 2502 2372 283 1408 22357 987 13769
NM_003029chr151320 1019 519 345 21 --2277 253 146
NM_003030chr351745 1406 1361 113 75 ------
NM_003034chr1287225 7031 6327 6019 5268 5087 720 632 27984 2580 2725 519 16265
NM_003036chr111158 --2997 992 --
NM_003042chr341713 618 470 84 1835 1414 1542
NM_003043chr374001 3246 2869 1565 1179 511 33 --43755 3750 3056 909 --
NM_003045chr1374916 4584 4212 3281 3060 422 260 54982 4525 3157 1543 610 43695 554 363 336 11533
NM_003047chr131061 273 44 --31244 1092 84 --
NM_003051chr141960 1949 1546 1295 --11703 --
NM_003060chr541201 1072 1034 508 --2399 189 --
NM_003068chr82840 274 2408 318 --1206
NM_003070chr91857 --2744 42 --
NM_003071chr331500 1435 294 11950 --11905
NM_003072chr191131 ------
NM_003074chr351918 1871 1655 1406 1398 1108 1733 11885
NM_003076chr1291694 1679 1432 1414 1322 1183 1036 609 202 31525 1160 189 41421 479 475 399 --
NM_003079chr172391 172 1983 --2371 325
NM_003081chr201977 2196 151 ----
NM_003085chr51108 --189 --
NM_003088chr73879 713 114 --2888 70 --
NM_003091chr201211 ------
NM_003099chr15106052 5470 2617 1957 1505 1136 775 767 753 529 35992 5243 4098 46061 5920 5075 116 15944
NM_003106chr31938 1836 ----
NM_003107chr662607 2219 1057 893 673 372 1927 2453 210 --
NM_003108chr2107029 6368 6071 5644 2660 2266 1875 1844 1767 1037 36553 4410 335 25580 280 11821
NM_003111chr211086 ------
NM_003112chr711152 1277 ----
NM_003128chr232873 2407 1132 11949 129 --
NM_003131chr682205 2107 1959 1755 665 505 345 205 --42112 821 652 254 11970
NM_003137chr682085 2022 2000 1532 619 484 95 73 --3735 274 52 2907 280
NM_003139chr113615 138 49 1679 2720 36 1240
NM_003142chr21229 ------
NM_003144chr62351 325 21398 589 ----
NM_003146chr11----1262 136
NM_003149chr331623 1102 530 21398 497 1305 11213
NM_003150chr1772183 2044 1923 941 569 391 322 --11850 --
NM_003152chr1731173 786 22 ------
NM_003155chr882808 2529 2418 2118 2075 556 274 258 12095 12424 --
NM_003156chr111399 1996 41146 72 63 40 11158
NM_003161chr1752880 1392 1261 636 363 32396 2195 251 11143 --
NM_003164chr112436 113 1419 1377 --
NM_003165chr931749 1493 691 21545 157 21945 401 1694
NM_003170chr171573 --1549 --
NM_003173chrX21226 1047 --21241 187 --
NM_003174chr102663 286 1204 ----
NM_003178chr332156 1872 1482 11802 1448 --
NM_003179chrX21382 1199 --41360 1207 1123 246 21385 69
NM_003180chr193330 125 98 ------
NM_003181chr61130 --1165 --
NM_003184chr81264 --123 --
NM_003185chr202991 463 11233 4525 473 468 242 --
NM_003188chr61832 ------
NM_003189chr173215 2154 554 334 255 248 121 --22843 2834 2695 276
NM_003194chr63371 142 37 ------
NM_003199chr1845635 1097 88 49 34516 894 307 1808 --
NM_003200chr1922034 917 11611 12023 --
NM_003202chr521198 61 --1569 --
NM_003204chr1721455 102 1121 1243 --
NM_003216chr2273210 2080 1334 978 920 657 505 53215 2500 1297 851 415 23137 2085 22114 943
NM_003217chr1281751 1654 619 584 249 199 42 34 --41658 1301 388 384 3622 326 22
NM_003220chr621521 1061 --2454 94 --
NM_003221chr6153844 3762 3637 3459 3428 3382 3345 2894 2861 2645 1648 1484 1344 802 304 23196 1049 43433 2846 525 310 --
NM_003223chr162622 28 --1552 --
NM_003224chr204857 270 259 147 --1950 1237
NM_003234chr352432 957 734 561 276 12347 2692 436 1459
NM_003236chr263044 2787 1294 1018 778 550 22869 2592 11299 1108
NM_003242chr341625 611 227 94 --1909 11663
NM_003243chr131194 1054 254 ------
NM_003244chr181125 1343 1286 --
NM_003246chr155662 220 107 96 57 ------
NM_003247chr621527 85 ------
NM_003250chr171322 1391 3148 143 49 --
NM_003253chr2141544 474 379 42 21312 1291 2563 468 --
NM_003255chr1772567 2368 2053 1827 1648 433 280 --3838 148 81 --
NM_003257chr15--1351 ----
NM_003262chr374048 3770 3702 3655 3613 3462 1579 35039 3678 275 13669 --
NM_003269chr62498 357 --11008 --
NM_003270chrX2993 256 --1792 --
NM_003274chr2172769 2025 1846 560 519 406 71 131 11815 --
NM_003275chr931482 535 378 ------
NM_003285chr12368 346 --6558 542 534 530 526 522 --
NM_003286chr2011107 21098 786 1437 --
NM_003289chr92192 36 ----150
NM_003290chr19161 --1187 --
NM_003298chr3116013 5818 5196 4946 4828 4793 4146 3814 2188 1208 40 24608 1057 25261 179 34503 3947 1047
NM_003299chr12----1103 --
NM_003300chr141329 ------
NM_003304chr31190 21483 1027 ----
NM_003309chr661749 1646 506 185 88 47 ------
NM_003314chr51177 --1292 --
NM_003317chr142182 48 ------
NM_003320chr11104131 3646 3535 2769 2754 2743 1522 1327 829 98 1235 33574 3569 2774 --
NM_003324chr1221398 1055 --269 28 1915
NM_003334chrX2154 54 ------
NM_003336chrX3927 152 128 ------
NM_003339chr551504 1497 1404 650 110 ------
NM_003340chr42444 178 ------
NM_003342chr1782717 2567 2535 1100 852 825 484 395 13125 22540 964 --
NM_003344chr721559 1091 --1510 --
NM_003345chr164496 428 196 132 ------
NM_003348chr1261705 1209 1147 268 53 33 --1405 11419
NM_003349chr2021074 549 21330 1235 3379 34 28 --
NM_003350chr8141 ------
NM_003352chr22936 28 1328 ----
NM_003369chr1152617 2581 2496 582 529 --1684 --
NM_003370chr193737 161 28 --5589 575 230 63 34 --
NM_003372chrX1325 ------
NM_003373chr1061760 735 626 389 368 353 41441 1416 635 472 41494 611 500 496 11499
NM_003374chr54775 582 199 159 ------
NM_003380chr10189 ------
NM_003381chr63803 687 276 140 ----
NM_003383chr9193 ------
NM_003385chr22796 272 1925 ----
NM_003387chr292799 2419 2323 1880 1810 1152 947 941 84 1297 --12107
NM_003390chr11----3803 730 311 1243
NM_003392chr344056 3156 1310 102 23418 3391 21020 516 --
NM_003394chr123667 596 80 2640 283 1177 --
NM_003403chr14143 --123 --
NM_003404chr2031758 1361 591 --1702 --
NM_003405chr222573 61 --128 --
NM_003406chr841744 1621 1594 1496 1140 21735 1483 --
NM_003407chr193577 562 221 ------
NM_003410chrX32285 2068 399 22433 2002 ----
NM_003411chrY31822 1582 582 11350 ----
NM_003412chr332675 983 190 --11115 12713
NM_003413chrX2791 247 --1254 --
NM_003418chr3----1241 --
NM_003420chr33260 81 44 --2799 731 --
NM_003427chr61490 ------
NM_003439chr762767 727 597 186 132 29 11399 ----
NM_003442chr111335 1551 ----
NM_003453chr13195 ------
NM_003458chr3123963 3853 3836 3372 2922 2628 1319 1302 952 943 721 407 2370 265 63846 3818 3812 3734 3196 3052 12804
NM_003463chr653132 2749 2652 2634 896 1920 1258 1986
NM_003466chr252345 2303 888 851 437 --22012 857 12490
NM_003468chr273027 2806 1567 1395 496 223 173 ----12955
NM_003470chr1671650 1617 1559 1334 1163 501 156 --41731 1723 530 355 --
NM_003471chr322345 656 ------
NM_003473chr102232 181 ------
NM_003474chr1042265 1612 1542 791 1959 21985 1640 --
NM_003478chr1163121 3080 2831 2738 2373 1211 ------
NM_003482chr1282758 2488 2473 1995 921 529 199 51 1990 21118 925 --
NM_003483chr1252194 2063 1051 623 196 2796 100 ----
NM_003485chr1471241 1095 945 895 352 280 81 11271 2888 874 11103
NM_003487chr172178 74 --1199 --
NM_003489chr2143444 1172 1115 1051 ------
NM_003490chr22164 1787 --170
NM_003505chr791279 1211 774 742 660 608 594 562 387 ------
NM_003532chr6--141 ----
NM_003559chr17133833 3435 2989 2903 2756 2501 2408 1355 991 927 597 486 224 21483 1202 43192 2745 2734 607 --
NM_003563chr1741423 1028 1012 497 ------
NM_003564chr13427 233 109 1562 3537 238 198 --
NM_003566chr121488 22692 212 ----
NM_003567chr1142 ------
NM_003574chr1854126 3922 3884 3821 1213 --25133 1978 --
NM_003576chr1352845 707 465 215 44 --32801 2724 2174 2966 915
NM_003583chr1242399 1340 852 402 13026 ----
NM_003590chr232628 1500 342 2656 446 23702 2708 12725
NM_003603chr41225 ------
NM_003607chr183850 3467 1373 1011 964 394 204 70 32785 1149 941 ----
NM_003613chr151646 ------
NM_003615chr363956 3719 3698 3003 971 475 ------
NM_003617chr1144640 4557 4288 3808 3636 3518 3106 3099 1626 1484 1146 1050 211 192 285 65 44551 671 553 197 14246
NM_003620chr171720 --1774 --
NM_003629chr172941 2488 1101 1091 1045 807 437 --23471 816 --
NM_003631chr102329 140 ------
NM_003632chr174758 358 288 225 ----1213
NM_003633chr521594 329 11869 21023 636 --
NM_003634chr224840 793 240 188 --4872 197 33 27 --
NM_003635chr102189 41 1160 ----
NM_003637chr181496 490 417 402 391 358 338 233 11535 ----
NM_003644chr17216379 6021 5715 5671 5594 4904 4815 4688 4481 4414 2180 2169 2064 1354 1270 1201 1192 1164 750 499 353 44037 811 600 513 96154 4347 4292 4189 4175 2146 2122 1255 737 21485 788
NM_003648chr282637 1869 1718 864 745 528 394 144 21937 635 --1130
NM_003651chr121489 ------
NM_003654chr112499 143 --1117 --
NM_003655chr173585 535 199 --1238 --
NM_003656chr31168 --165 --
NM_003659chr21315 ------
NM_003660chr193631 257 42 1676 1637 --
NM_003663chr332547 2498 581 ------
NM_003664chr53357 91 70 --1182 --
NM_003670chr341092 983 300 32 3946 439 49 21392 37 --
NM_003671chr9113131 2993 2753 2674 2297 2271 1205 948 851 818 555 23496 2931 32923 1070 923 --
NM_003672chr141923 504 110 33 11738 1682 --
NM_003673chr17----152 --
NM_003680chr14678 569 249 25 ----1503
NM_003685chr192949 227 --3805 800 380 --
NM_003692chr91318 ------
NM_003701chr131809 ------
NM_003711chr52215 84 ------
NM_003713chr161369 1304 1242 1201 1174 155 ------
NM_003714chr542368 1096 1002 29 22969 270 12682 --
NM_003716chr3--21032 953 ----
NM_003718chr71546 ------
NM_003721chr191139 ----1118
NM_003732chr53288 207 71 ------
NM_003735chr5111718 1681 1666 1406 1390 1300 717 541 501 322 57 1647 2390 175 --
NM_003736chr5111718 1681 1666 1406 1390 1300 717 541 501 322 57 1647 2390 175 --
NM_003740chr641725 1637 144 41 ----1137
NM_003743chr241600 923 870 517 --21612 579 --
NM_003749chr1352313 1594 934 835 305 --1189 --
NM_003750chr102816 750 ------
NM_003758chr1521276 68 --21125 72 1606
NM_003758chr1521276 68 --21125 72 1606
NM_003759chr493508 3370 3231 3145 3072 2841 2611 1103 279 21486 818 12848 1583
NM_003761chr22305 87 --279 32 --
NM_003763chr2023050 1070 12389 22555 153 12829
NM_003766chr17--1172 1243 --
NM_003768chr161683 1635 1573 733 309 244 --41559 593 314 54 11546
NM_003774chr1242357 1232 784 738 11269 ----
NM_003779chr12337 310 ------
NM_003783chr1--1191 ----
NM_003787chr1811146 2627 68 1618 --
NM_003790chr11221 ------
NM_003794chr32867 366 1720 ----
NM_003795chr62486 200 ------
NM_003797chr111171 ------
NM_003800chr652364 2052 1947 1827 1808 --21845 920 12212
NM_003812chr21271 ------
NM_003816chr821177 86 11326 ----
NM_003819chr11250 2295 70 ----
NM_003822chr131973 1169 494 13146 --12026
NM_003827chr195492 462 90 83 31 --1575 193
NM_003829chr91161 ------
NM_003831chr183450 417 126 11124 ----
NM_003840chr842133 1989 1685 30 11672 32068 2055 1872 --
NM_003842chr862409 2283 1899 1834 1716 703 --132 11914
NM_003850chr131243 ------
NM_003861chr14112900 2571 2325 2141 2029 1050 858 591 576 242 146 32346 2116 912 22852 367 12877
NM_003862chr5--1339 ----
NM_003864chr41167 ------
NM_003870chr1562047 540 239 219 70 59 --12006 --
NM_003872chr241224 1193 874 834 ----1479
NM_003873chr1011833 ----11839
NM_003877chr124929 896 305 206 ----1212
NM_003885chr173858 766 113 12346 22654 1905 1116
NM_003887chr251925 1513 802 792 337 1232 1906 --
NM_003888chr1591442 1323 1303 1232 422 386 362 340 279 31335 1264 1238 11307 --
NM_003893chr101345 1323 1417 --
NM_003895chr2121579 644 ----1185
NM_003896chr22730 62 4880 681 246 155 --1840
NM_003902chr12723 595 ------
NM_003909chr852776 2402 967 923 690 12699 12013 --
NM_003913chr664171 4050 2666 1676 1051 466 --11637 14214
NM_003919chr7175 ------
NM_003922chr15----129 --
NM_003924chr41230 --1200 --
NM_003927chr183775 446 321 1368 134 --
NM_003931chr61205 ----1559
NM_003932chr2221804 1530 --11366 199
NM_003939chr10123990 3646 3426 3144 2721 1496 1392 901 889 404 290 117 53715 2696 2679 656 314 33821 1382 634 23319 3281
NM_003941chr722304 2008 ------
NM_003947chr351082 304 239 202 101 ------
NM_003948chr43231 146 114 12368 ----
NM_003949chr1791915 1895 1700 1683 1381 1361 615 449 270 21706 250 --41918 1600 1384 1264
NM_003951chrX259 39 1286 ----
NM_003953chr182613 2514 1857 1105 953 874 825 308 12567 32634 2464 2363 --
NM_003954chr1731220 1165 278 --21195 46 --
NM_003955chr172296 225 1370 ----
NM_003956chr102452 47 ------
NM_003958chr683892 3659 3560 3070 2780 2637 1496 159 13536 4743 520 515 511 --
NM_003966chr5217705 7690 7300 7267 7216 7073 6303 6017 4791 3068 2961 2803 2738 2715 2703 2691 2564 2335 2092 2053 408 35542 2748 498 35324 2696 889 11230
NM_003968chr3----1150 --
NM_003971chr173418 248 58 ------
NM_003980chr631370 1049 253 --167 --
NM_003981chr153918 268 34 ------
NM_003983chr16124393 4326 4298 4250 4046 3993 3842 3290 3224 1617 472 453 14150 54144 3689 2715 1604 1239 --
NM_003994chr1241681 1543 813 608 33773 3507 1434 ----
NM_003998chr42580 156 ------
NM_004006chrX31066 848 591 21925 931 ----
NM_004007chrX31066 848 591 21925 931 ----
NM_004009chrX31066 848 591 21925 931 ----
NM_004010chrX31066 848 591 21925 931 ----
NM_004011chrX31066 848 591 21925 931 ----
NM_004012chrX31066 848 591 21925 931 ----
NM_004013chrX31066 848 591 21925 931 ----
NM_004014chrX31066 848 591 21925 931 ----
NM_004015chrX31066 848 591 21925 931 ----
NM_004016chrX3980 762 505 21839 845 ----
NM_004017chrX31066 848 591 21925 931 ----
NM_004018chrX3980 762 505 21839 845 ----
NM_004020chrX31066 848 591 21925 931 ----
NM_004021chrX3980 762 505 21839 845 ----
NM_004022chrX3980 762 505 21839 845 ----
NM_004023chrX3980 762 505 21839 845 ----
NM_004024chr12447 128 --11230 1523
NM_004028chr1893470 2696 2562 1522 1085 613 553 263 59 --1352 1683
NM_004034chr10--1508 ----
NM_004035chr1785185 4981 4874 4867 1096 413 404 249 24648 3749 13936 --
NM_004036chr23646 551 235 --177 --
NM_004037chr14867 657 289 101 --3614 354 344 --
NM_004067chr721414 1155 ------
NM_004068chr3----2291 113 1297
NM_004071chr2--1273 ----
NM_004077chr1251232 843 418 373 175 --21107 196 --
NM_004080chr73967 440 287 ------
NM_004081chrY51788 1396 1380 1307 477 11183 ----
NM_004082chr21111 --1232 --
NM_004083chr12148 ----151
NM_004085chrX--1303 1515 --
NM_004087chr311398 21545 618 21335 66 --
NM_004089chrX2514 456 21193 58 1901 --
NM_004090chr1783019 2740 2672 1217 738 490 293 246 12797 2369 157 12821
NM_004093chr1342380 1977 1315 415 12360 --131
NM_004094chr1452090 554 435 311 49 ------
NM_004096chr1071653 1533 1443 641 296 187 137 1696 21538 548 21678 210
NM_004097chr22744 717 --2362 206 --
NM_004098chr1031180 974 518 --1936 --
NM_004099chr93775 403 24 --11689 22089 1622
NM_004100chr632571 2539 1003 1380 --12546
NM_004102chr12492 78 ----1590
NM_004103chr86799 742 720 698 86 32 --2731 116 --
NM_004111chr11--1233 ----
NM_004112chr1741214 694 453 435 2340 261 21334 440 --
NM_004113chr361825 1720 1588 150 72 22 --350 45 39 155
NM_004114chrX3986 927 155 ------
NM_004115chr131138 ------
NM_004117chr621626 870 1146 2415 59 --
NM_004124chr1412724 22463 2187 13044 --
NM_004134chr53611 584 63 ------
NM_004136chr1543024 2906 709 25 1815 1333 --
NM_004156chr81501 ------
NM_004157chr3246 24 --2893 335 --
NM_004161chr241035 459 279 260 1406 1990 --
NM_004162chr3--141 11125 11130
NM_004171chr11179249 9226 9029 8213 7814 7771 6787 6576 6513 6302 6072 3174 1704 1681 1166 556 291 89098 6321 6027 3441 3326 2469 1181 331 12491 --
NM_004185chr11223 --179 --
NM_004187chrX21240 212 11289 51007 463 450 435 361 1440
NM_004193chr102401 47 2364 36 ----
NM_004199chr5----126 --
NM_004200chr11102886 2819 2585 2339 2226 2156 1238 1129 1089 244 42294 1199 1037 993 62065 1207 1183 1054 921 789 1926
NM_004202chrY2566 173 ------
NM_004205chr111182 --230 23 --
NM_004209chr1641170 881 843 84 --1288 --
NM_004210chr1042126 2003 1867 37 --61350 769 572 391 314 87 --
NM_004225chr821328 1005 1300 ----
NM_004227chr742653 2103 1955 950 --1303 --
NM_004229chrX41838 1638 1526 1517 11564 11614 --
NM_004231chr73265 207 69 --129 --
NM_004232chr1821513 849 ------
NM_004235chr92580 72 ------
NM_004236chr151424 ------
NM_004238chr21103 ------
NM_004252chr172153 117 --166 --
NM_004254chr113357 281 108 --2260 21 --
NM_004263chr281635 1518 1484 1403 695 520 501 241 --11609 --
NM_004268chr115892 499 486 363 302 ----1956
NM_004272chr51587 ------
NM_004277chr61551 11624 ----
NM_004279chr72701 538 1738 --22113 1741
NM_004288chr22929 814 1843 ----
NM_004290chr571158 1033 374 300 106 49 40 ------
NM_004293chr92624 119 13003 13460 13466
NM_004301chr3--1268 128 --
NM_004302chr1262572 2541 2305 2284 2255 750 12463 32120 763 476 --
NM_004304chr22286 23 ------
NM_004308chr1191893 1789 1464 634 612 559 322 262 55 1204 31449 298 30 1637
NM_004311chr1072975 2939 2755 2321 2255 2135 897 --62954 2949 2944 2732 2728 2550 --
NM_004319chr1102726 2538 2465 2421 2394 2238 1259 863 848 293 22009 560 52524 2438 2308 706 650 --
NM_004323chr962065 1966 848 817 648 199 32481 798 268 32346 2342 2200 --
NM_004326chr14977 908 834 355 --51148 1143 1011 846 802 1998
NM_004329chr101148 ------
NM_004331chr841790 864 479 457 12029 ----
NM_004339chr2161761 1592 740 189 123 32 1271 ----
NM_004342chr711700 --12290 --
NM_004344chrX2504 95 ------
NM_004349chr8--11114 --11024
NM_004354chr41123 ------
NM_004356chr112456 160 ------
NM_004359chr191492 ------
NM_004364chr191214 1924 41199 1123 381 163 --
NM_004370chr651827 1487 1459 802 649 1822 ----
NM_004371chr12960 69 1191 2622 83 1232
NM_004379chr22654 197 11282 ----
NM_004380chr1651995 1015 915 724 25 ------
NM_004385chr5155 --165 --
NM_004391chr342035 1694 1446 1419 11807 31899 1887 805 --
NM_004392chr1352256 1895 1832 1643 105 1584 ----
NM_004393chr352339 2085 1968 1815 1627 --11828 --
NM_004395chr53526 227 147 --3696 540 274 --
NM_004397chr1193756 3481 3223 1360 1353 938 599 535 399 12811 12999 --
NM_004399chr124809 663 364 295 1267 2299 38 --
NM_004405chr21380 1817 2319 286 --
NM_004408chr91178 ----136
NM_004411chr7--2753 175 ----
NM_004414chr213622 485 361 --11176 1625
NM_004422chr171320 --1168 --
NM_004423chr392522 2347 2241 2140 2066 2008 1695 393 378 32527 916 249 --11017
NM_004426chr1241573 1411 1316 115 --11285 11618
NM_004427chr161138 458 444 288 254 173 11039 2410 406 1783
NM_004429chrX41334 250 147 60 --1209 1339
NM_004430chr8102195 1755 1044 810 696 621 380 164 136 30 11001 4976 960 954 207 11072
NM_004431chr12532 112 --3332 321 203 --
NM_004432chr962196 2163 2091 1839 393 255 ------
NM_004433chr141576 669 628 405 11711 2312 59 --
NM_004436chr1138 --2145 82 --
NM_004437chr1113143 2409 2398 2345 2297 2271 1078 1042 983 633 487 13472 22416 36 --
NM_004438chr233202 2138 1017 --1857 --
NM_004440chr61109 21776 1726 ----
NM_004441chr33465 419 387 1101 1450 --
NM_004443chr31145 --1257 --
NM_004446chr1--167 ----
NM_004450chr141322 ------
NM_004454chr321930 658 1666 12239 --
NM_004456chr7------1172
NM_004457chr221080 199 1119 ----
NM_004458chrX51654 1053 772 470 218 42083 1819 1691 381 ----
NM_004459chr1761969 1544 1526 1512 1339 1260 ----11547
NM_004468chr12607 113 1543 --129
NM_004469chrX2464 138 180 ----
NM_004474chr16956 688 650 405 381 287 11034 2693 390 --
NM_004475chr1771195 1128 959 875 835 187 154 1480 1277 --
NM_004480chr141274 ------
NM_004481chr192470 2455 2411 1817 1729 817 528 256 89 --1234 12161
NM_004482chr23760 657 355 1699 ----
NM_004492chr151240 ----1230
NM_004494chr161068 1016 492 273 240 97 21185 136 2971 342 1100
NM_004496chr142408 309 11102 3318 289 151 --
NM_004497chr19171 --2684 607 --
NM_004499chr51132 ------
NM_004500chr1431905 367 185 ----1137
NM_004501chr132652 1549 1249 33589 3511 3304 21255 846 --
NM_004504chr262843 2826 2759 2005 501 184 12137 ----
NM_004514chr1721165 437 --22086 516 --
NM_004519chr82191 161 ------
NM_004525chr22617 112 ----11317
NM_004527chr1731065 204 82 1297 3481 117 87 --
NM_004529chr921414 234 1552 ----
NM_004535chr2021437 96 --11725 --
NM_004537chr1231087 55 48 ------
NM_004555chr161545 2165 49 ----
NM_004566chr1062535 2459 2211 790 627 95 1970 2938 853 --
NM_004573chr152777 94 3666 232 219 148 --
NM_004575chr411198 --2582 34 --
NM_004576chr51103 ------
NM_004583chr175490 286 266 258 182 1252 ----
NM_004586chrX95136 4514 4452 3662 2171 1874 1241 160 151 34434 3379 2145 1671 --
NM_004588chr11103672 3607 3244 3093 3057 2733 1631 404 182 92 33812 3101 737 22643 835 13613
NM_004598chr582677 1179 1049 869 633 485 421 99 32501 556 53 21054 266 --
NM_004602chr202564 338 1481 --1373
NM_004603chr721099 342 1940 2303 138 --
NM_004606chrX1308 --263 33 --
NM_004612chr954576 4200 826 191 112 24343 150 --1217
NM_004615chrX3786 751 179 ------
NM_004619chr152008 1748 1580 1560 638 ------
NM_004620chr111148 --151 --
NM_004626chr111478 1544 ----
NM_004630chr1151055 958 892 371 350 --21038 946 --
NM_004631chr111235 ------
NM_004634chr33596 566 43 --1571 1578
NM_004637chr361284 1162 1116 1000 891 83 --1442 11241
NM_004639chr6----123 --
NM_004643chr142740 289 --1637 --
NM_004645chr173744 537 277 1549 ----
NM_004651chrX3358 79 61 --1269 --
NM_004654chrY4994 474 405 23 ------
NM_004655chr171392 1303 21207 991 --
NM_004656chr35938 285 247 154 75 184 162 --
NM_004660chrY21574 233 ------
NM_004663chr1521167 412 146 ----
NM_004667chr151615 1224 ----
NM_004673chr151492 1158 993 517 478 21590 572 ----
NM_004674chr81163 1609 ----
NM_004684chr4--129 ----
NM_004686chr831779 1716 308 --2439 350 --
NM_004687chr1722003 516 ------
NM_004690chr61608 ------
NM_004705chr111189 1626 ----
NM_004709chrX--21149 107 ----
NM_004716chr114919 784 712 134 --2801 742 2331 40
NM_004717chr751384 489 479 433 373 ------
NM_004723chr13923 857 235 ------
NM_004725chr1021418 174 11269 11075 --
NM_004726chrX105516 5168 4629 2223 1737 1677 1359 1226 735 567 24259 4171 --14093
NM_004731chr1231325 1280 283 ----11427
NM_004733chr31153 ------
NM_004734chr1332282 264 166 22901 2377 ----
NM_004736chr152130 1857 1417 456 129 --154 184
NM_004739chr113668 536 478 --2541 71 --
NM_004742chr351566 1256 456 184 43 --1621 11321
NM_004745chr8126920 6599 6255 6177 6136 4904 4624 4512 4429 1944 1479 588 46674 4298 4283 2021 31484 42 22 --
NM_004747chr102306 266 ------
NM_004748chr1564096 3570 2866 1359 1331 1244 ------
NM_004753chr1--1279 ----
NM_004762chr172518 53 --1230 --
NM_004774chr1743130 2744 899 339 --22850 985 --
NM_004775chr1811975 2818 657 1165 --
NM_004779chr56917 888 528 490 215 72 --2511 495 --
NM_004781chr12389 244 11110 ----
NM_004781chr12389 244 11110 ----
NM_004784chr41125 ------
NM_004785chr161490 --2442 430 --
NM_004794chrX151 ------
NM_004796chr1422251 329 12452 1333 --
NM_004798chr20103410 3008 2578 1325 627 377 330 303 288 44 23217 822 53533 928 690 316 292 12553
NM_004801chr23590 418 79 --11444 --
NM_004805chr231412 909 228 11224 --160
NM_004808chr1032544 2323 2285 22844 1071 ----
NM_004815chr154428 4376 4060 3990 3887 14853 44380 3892 1569 283 14361
NM_004818chr121246 182 ----
NM_004821chr53612 558 321 --2656 626 --
NM_004822chr1793911 3729 3070 1390 1252 540 525 303 283 13704 32786 1602 1497 33832 1336 105
NM_004824chr631147 1017 393 ------
NM_004831chr194810 778 723 168 1329 2783 752 --
NM_004834chr273070 3044 2987 2891 2866 2702 1346 --42734 2688 306 152 12531
NM_004835chr31173 1685 1765 --
NM_004835chr31173 1685 1765 --
NM_004849chr641680 1338 507 193 ------
NM_004850chr23244 152 47 21133 522 ----
NM_004856chr152392 78 --1160 --
NM_004859chr1731940 609 252 2530 64 1767 --
NM_004860chr17----2233 28 --
NM_004863chr14105019 4593 3923 3735 3628 3338 3320 1247 650 438 2717 450 1189 --
NM_004866chr543533 3471 409 152 ------
NM_004869chr1811712 ------
NM_004872chr1------1302
NM_004874chr82472 119 ------
NM_004879chr115996 655 344 324 60 --1129 1333
NM_004884chr1531651 659 622 --31576 1571 226 1575
NM_004887chr51117 --31002 886 296 --
NM_004893chr53426 166 99 ------
NM_004896chr101127 1255 ----
NM_004897chr101931 1266 ----
NM_004898chr472916 2293 2281 2274 2081 1949 627 22549 2168 1649 --
NM_004899chr23459 395 151 ------
NM_004904chr7135999 5689 5052 4733 2444 2096 1574 1436 680 661 611 489 56 12358 26359 4514 45957 5590 1264 492
NM_004907chr194965 304 293 239 ------
NM_004915chr214849 320 197 183 ------
NM_004922chr104901 791 662 143 2419 258 --1667
NM_004926chr1441506 680 558 70 --2516 129 --
NM_004929chr821412 291 ------
NM_004930chr13590 273 51 --292 80 --
NM_004932chr531477 662 90 ------
NM_004934chr5137 ------
NM_004936chr932608 348 167 32043 1916 53 ----
NM_004938chr931043 996 98 --171 --
NM_004947chr3112597 2581 2095 2082 1720 722 552 426 278 249 207 11820 32588 2000 846 1872
NM_004952chr13847 700 690 --4722 669 303 162 --
NM_004956chr753462 3041 3017 2889 441 --23568 3148 --
NM_004962chr10158 --148 --
NM_004965chr21143 ------
NM_004969chr10150 ------
NM_004972chr91743 ------
NM_004973chr6----21600 1333 --
NM_004977chr19----2568 77 --
NM_004978chr191482 1282 1116 507 476 418 385 220 45 --1180 --
NM_004979chrX61073 1050 1008 810 187 103 --1830 154
NM_004981chr221112 --1153 --
NM_004985chr1231802 464 415 ----1556
NM_004992chrX287659 7460 6416 6353 6312 6166 5871 5719 5318 3125 3075 3069 2814 2619 2567 2522 2291 2235 1816 1567 1508 1257 1227 1220 1203 934 92 62 47406 3374 1538 946 116983 6977 6807 6785 5925 3005 1799 1305 1273 1268 341 67888 7798 6537 6009 3099 1291
NM_004992chrX287659 7460 6416 6353 6312 6166 5871 5719 5318 3125 3075 3069 2814 2619 2567 2522 2291 2235 1816 1567 1508 1257 1227 1220 1203 934 92 62 47406 3374 1538 946 116983 6977 6807 6785 5925 3005 1799 1305 1273 1268 341 67888 7798 6537 6009 3099 1291
NM_004993chr143459 438 180 2594 37 ----
NM_004998chr151105 1944 2954 135 --
NM_004999chr663653 3172 1600 1383 1299 1243 11334 13695 --
NM_005010chr732226 2037 650 ------
NM_005012chr11123 ------
NM_005016chr12130 ------
NM_005020chr73567 178 75 1600 2531 161 --
NM_005022chr17----152 --
NM_005023chr5------11428
NM_005026chr151444 1307 791 327 274 1332 ----
NM_005028chr1021903 825 1183 ----
NM_005030chr16----1269 --
NM_005032chrX1720 2399 285 --1190
NM_005045chr72886 29 ----2155 130
NM_005055chr11126 ------
NM_005056chr1285090 4902 2032 1789 1638 1583 702 388 --25013 194 15581
NM_005063chr10123762 3435 3089 2450 1420 1130 991 953 671 384 339 201 12682 1266 --
NM_005065chr1465237 4882 4873 2028 1901 1643 24540 1451 32033 1856 971 25118 4082
NM_005066chr11764 ------
NM_005077chr92365 338 ------
NM_005078chr1521170 327 --21154 1145 1503
NM_005080chr223740 654 230 --3831 353 278 --
NM_005086chr1251290 610 495 406 338 ----21719 420
NM_005087chr31860 ------
NM_005088chrX2811 111 ------
NM_005095chr152212 1834 1552 895 642 --1806 1665
NM_005096chrX71250 1018 1012 856 448 286 170 11105 51084 439 416 143 120 --
NM_005097chr101106 ------
NM_005099chr13520 514 24 ------
NM_005105chr151910 769 693 370 177 --11532 --
NM_005110chr56669 641 527 248 144 34 ------
NM_005112chr4----2858 775 --
NM_005114chr42436 30 ------
NM_005116chr20104353 4099 3844 3239 1470 1337 1002 966 341 320 --24191 684 12900
NM_005119chr121093 403 --11207 --
NM_005121chr1783016 2997 2735 2387 1528 1337 530 439 183 11522 --
NM_005124chr61137 ------
NM_005126chr332208 1587 689 ------
NM_005128chr212702 511 ------
NM_005133chr112363 283 ------
NM_005134chr183273 266 25 --1107 --
NM_005135chr1553639 3448 1249 900 754 12406 11003 --
NM_005153chr162750 66 ------
NM_005156chr974742 4730 4558 4074 3701 3368 198 24576 4104 23795 1929 --
NM_005159chr1541720 599 64 27 22136 2008 177 --
NM_005161chr11122202 2120 1562 1454 1378 795 694 430 389 371 363 329 11591 31509 804 481 --
NM_005168chr2--11523 1585 11377
NM_005180chr101543 --11218 --
NM_005182chr16186 143 1509 --
NM_005184chr19111347 1280 1157 1146 1120 1096 245 232 213 178 50 11412 ----
NM_005186chr11----4561 509 477 104 --
NM_005187chr1631435 1290 372 ------
NM_005188chr11267879 7751 7689 7533 7194 7027 6897 6808 6651 5970 5930 5584 5489 5457 3129 3079 2924 2726 2462 2259 1918 1683 1361 640 602 345 55276 3012 2856 1755 1144 117868 7365 6455 5744 5550 2832 1374 1369 1290 631 616 35789 2904 2741
NM_005189chr1742393 2324 876 155 --22146 41 --
NM_005190chr621160 421 11128 ----
NM_005197chr14146195 6157 5470 5081 4946 4172 4081 3820 2452 2237 1735 1583 1468 305 24548 3788 25277 4379 --
NM_005202chr161968 1802 1615 900 886 626 --1200 1350
NM_005203chr101163 ------
NM_005206chr172930 411 176 1902 --
NM_005219chr551749 1660 624 489 466 11396 31121 584 365 --
NM_005220chr171315 --41129 962 132 113 11452
NM_005229chrX71230 1037 929 397 356 200 29 1881 ----
NM_005232chr7------188
NM_005233chr32587 171 12004 1970 --
NM_005234chr192313 107 ------
NM_005235chr2157588 7023 6443 6327 5563 5511 5364 3037 2806 2603 2445 1584 349 79 49 56790 5739 1913 1526 114 67620 7616 6187 5766 5473 538 16738
NM_005238chr1152890 2575 2481 1396 40 22807 2349 12869 1252
NM_005240chr13802 560 547 1576 ----
NM_005241chr331351 984 296 --1882 --
NM_005245chr41656 1209 ----
NM_005248chr13401 228 68 1544 1469 --
NM_005252chr142198 84 ------
NM_005256chr11152 ------
NM_005257chr181882 1144 21268 1175 --
NM_005259chr2148 129 ----
NM_005261chr81102 1346 ----
NM_005263chr13498 371 98 1107 1961 1325
NM_005271chr10291 21 1299 ----
NM_005274chr1--127 ----
NM_005275chr6124 --1118 --
NM_005276chr1221435 586 1112 21183 632 11750
NM_005276chr1221435 586 1112 21183 632 11750
NM_005277chr431601 1416 663 3322 171 100 ----
NM_005281chr11301 174 1656 --
NM_005291chr24822 799 765 302 --3331 308 75 --
NM_005311chr752616 2569 2150 1792 408 12207 11907 1604
NM_005312chr992658 2579 1817 1026 540 533 526 311 171 --42141 1863 964 182 --
NM_005313chr152874 38 11126 ----
NM_005324chr1712039 1240 11898 --
NM_005329chr1632066 1717 1576 11664 ----
NM_005333chrX2768 65 2923 212 1793 --
NM_005334chrX6482 454 411 240 136 31 11498 31655 487 244 1593
NM_005335chr34396 369 175 117 2301 36 1374 --
NM_005336chr272169 1797 904 432 404 341 113 --42001 1736 1458 121 1411
NM_005339chr494351 4307 4142 4067 3256 1679 1614 1594 1031 11519 11165 --
NM_005342chrX42653 2121 1105 863 22853 2180 ----
NM_005346chr61255 ------
NM_005348chr141940 1798 ----
NM_005349chr42567 486 ------
NM_005354chr19----2534 253 --
NM_005359chr18156522 5346 5235 4830 4614 4553 4482 4369 4304 4289 1951 1467 1445 1394 745 16346 16025 --
NM_005375chr61807 ------
NM_005378chr22758 325 ------
NM_005380chr12492 260 21302 516 1858 --
NM_005381chr2185 --121 --
NM_005385chr342710 2106 1070 897 12505 12141 --
NM_005386chr201734 --1588 1199
NM_005388chr941666 1604 557 477 ------
NM_005389chr62673 26 --1679 --
NM_005392chr92114 24 11819 31189 1183 489 --
NM_005397chr773527 3392 2839 2674 1404 431 149 1587 31125 1056 557 13530
NM_005398chr102481 262 11458 1270 --
NM_005399chr172798 2766 1752 1447 1098 1084 577 21429 868 --22804 1586
NM_005400chr262973 2666 479 452 419 95 22651 961 12361 --
NM_005401chr12230 189 ------
NM_005402chr721866 332 11545 11744 --
NM_005407chr1461505 1283 422 288 273 201 11533 21580 315 --
NM_005409chr431098 367 197 ------
NM_005413chr23361 89 80 --394 52 32 --
NM_005415chr21746 --1234 --
NM_005417chr2041750 1723 649 27 --2368 137 1421
NM_005429chr41124 ------
NM_005430chr127947 900 849 819 812 385 149 --1655 --
NM_005433chr1852751 2569 320 310 159 12168 ----
NM_005435chr74570 225 164 86 ----1111
NM_005436chr1063833 2506 1636 868 862 73 12524 2656 77 --
NM_005437chr105419 389 225 117 29 11128 --11343
NM_005438chr111115 1249 158 --
NM_005439chr124495 388 185 156 --2508 170 --
NM_005442chr32432 104 ------
NM_005443chr41465 3497 477 106 ----
NM_005445chr101267 ------
NM_005453chr62475 106 --2226 222 --
NM_005455chr131612 744 223 1383 --11511
NM_005458chr91247 21671 951 31800 533 463 --
NM_005461chr2021269 285 --11477 --
NM_005465chr152042 822 356 147 103 --1795 --
NM_005466chr14198 --1494 --
NM_005474chr1731270 1228 1049 1214 51233 1118 567 518 423 11125
NM_005475chr1282993 2608 2495 2409 984 812 149 83 --22754 88 1781
NM_005476chr93392 297 152 --2166 28 11010
NM_005487chr2252022 1635 1568 1487 482 11389 11574 --
NM_005493chr62780 308 1136 ----
NM_005494chr71663 ------
NM_005501chr1741168 1123 394 44 41186 814 174 50 ----
NM_005502chr933020 455 51 ------
NM_005504chr1285691 4984 4272 1682 1663 1277 778 548 21068 604 24369 4285 1619
NM_005505chr123842 380 78 --2333 278 --
NM_005507chr111451 --2173 76 2334 204
NM_005509chr53430 399 324 ------
NM_005512chr1141555 1521 816 131 11997 2746 168 --
NM_005515chr73621 185 57 ------
NM_005517chr141325 556 354 249 1460 1226 1362
NM_005522chr731371 286 108 2348 89 ----
NM_005523chr721095 1027 2596 485 ----
NM_005524chr32325 50 ------
NM_005536chr8138 ------
NM_005537chr132783 131 ------
NM_005541chr231188 1059 1024 2997 104 ----
NM_005542chr71194 1277 ----
NM_005544chr22914 118 ------
NM_005546chr532222 1752 550 12242 1246 --
NM_005552chr142168 82 --187 --
NM_005562chr131336 677 191 1424 ----
NM_005563chr12620 83 --1837 139
NM_005565chr5----1134 --
NM_005566chr111433 1371 ----
NM_005573chr51602 ----172
NM_005578chr3104824 4777 4761 3777 3741 3414 2062 1919 1147 486 34833 889 462 24804 4786 --
NM_005581chr192104 97 --3134 130 91 --
NM_005584chr132573 110 1233 --140
NM_005587chr151275 ------
NM_005595chr13877 303 286 ------
NM_005596chr954913 1800 1784 994 848 22203 1443 189 --
NM_005599chr131310 1044 526 11038 ----
NM_005602chr33228 166 156 1839 21145 853 --
NM_005604chr652173 1966 705 410 123 --163 --
NM_005605chr82295 213 ------
NM_005607chr8156 1883 1867 --
NM_005610chr1--147 ----
NM_005611chr163920 204 158 11284 ----
NM_005613chr142065 1799 1696 1623 21600 1482 12134 --
NM_005625chr84340 241 119 48 --184 --
NM_005626chr11150 --1182 --
NM_005627chr61212 --1942 --
NM_005637chr1831873 697 90 11434 ----
NM_005638chrX41654 1418 506 76 2689 122 ----
NM_005639chr1231707 1554 84 ------
NM_005644chr11366 --2358 351 --
NM_005647chrX83225 2610 2264 866 770 638 599 433 --21144 764 22909 673
NM_005650chr221170 ------
NM_005653chr12----137 --
NM_005655chr8--21184 508 ----
NM_005656chr2151480 1462 1153 291 63 ----1307
NM_005662chr81116 ------
NM_005665chr114787 11832 23861 1474 --
NM_005668chr51579 13850 --13027
NM_005669chr53959 389 23 22064 1758 --143
NM_005678chr152944 806 --1128 --
NM_005682chr1611271 ------
NM_005686chr121450 1425 --31079 175 29 --
NM_005688chr341022 484 404 98 ------
NM_005697chr155218 183 60 46 31 --1223 --
NM_005704chr141029 747 170 151 --1700 --
NM_005707chr153388 317 139 142 1439 --
NM_005708chr13--1158 ----
NM_005715chr642617 1966 1004 802 --2266 213 1707
NM_005717chr13476 224 117 ------
NM_005722chr22513 204 1287 ----
NM_005725chr12668 641 22066 1874 ----
NM_005730chr1263203 2949 2937 1180 1083 493 53499 2960 2595 1358 327 53458 1135 683 506 422 23671 47
NM_005734chr111282 ------
NM_005736chr10----11539 --
NM_005737chr242862 2691 1987 787 42810 2719 467 385 22896 1833 12373
NM_005738chr71200 ------
NM_005746chr732524 2335 127 1427 ----
NM_005748chr1233116 2978 2913 23381 2322 ----
NM_005754chr54804 489 323 172 --1178 --
NM_005756chrX--21290 983 11031 --
NM_005759chr263800 3590 3023 1271 452 444 33289 1800 48 --14170
NM_005766chr1371169 1014 546 418 281 55 37 31224 354 118 ----
NM_005776chr141537 1585 ----
NM_005779chr533423 2418 853 32606 1266 733 ----
NM_005786chr184973 831 425 90 --1888 --
NM_005789chr17102173 2064 1802 1539 1494 1337 732 464 435 343 31897 1421 520 61951 1947 1915 1517 1510 208 --
NM_005795chr242119 818 760 38 12972 ----
NM_005801chr173753 612 58 --163 --
NM_005808chr3103389 2879 2819 2710 2622 1345 947 386 344 302 12640 23576 1160 1953
NM_005813chr241998 1929 688 585 22020 305 1997 --
NM_005814chr151243 540 283 129 57 --3940 935 70 1528
NM_005819chr1143435 3193 3147 2935 2639 2622 2316 1360 1273 1213 1090 1035 810 286 1469 1390 13067
NM_005822chr631829 1694 53 11846 1119 --
NM_005828chr17135018 3967 3908 3778 3754 3668 1784 1678 1100 721 636 574 248 14031 104750 4591 4587 4151 3881 3730 3529 2027 1968 241 14280
NM_005832chr32977 256 ------
NM_005834chrX132 ------
NM_005839chr11803 ------
NM_005840chrX186561 6471 6459 6048 2892 2685 2447 2097 1829 1712 1295 1095 920 618 599 581 573 442 --54699 589 529 480 462 --
NM_005842chr131533 ------
NM_005843chr22457 89 ------
NM_005851chr113292 104 61 --1317 1283
NM_005852chr1761166 1078 1043 353 262 195 1304 2274 93 21081 198
NM_005857chr131214 570 368 --21443 1438 --
NM_005859chr521353 342 ------
NM_005864chr143681 160 126 --3281 117 111 --
NM_005870chr1331043 190 66 ------
NM_005871chr101882 21022 281 ----
NM_005876chr22743 699 1704 ----
NM_005880chr1621589 246 21233 38 --11646
NM_005882chr43688 354 334 --165 --
NM_005883chr1952217 2165 1933 1181 1061 --32943 2420 295 --
NM_005885chr531563 1263 58 177 129 --
NM_005895chr1273233 2820 1298 1086 1068 998 401 --22824 1073 --
NM_005896chr21809 ------
NM_005898chr1142128 1065 417 97 12886 ----
NM_005900chr411122 ------
NM_005901chr18138303 7643 7384 6832 6130 5336 3217 2710 2451 2364 1086 938 454 38041 7200 6846 27402 2226 1727
NM_005902chr15104613 4595 4253 3708 2865 1819 1682 1273 1071 479 43767 3282 2921 1434 33023 2891 1080 --
NM_005903chr5114789 4683 4303 3841 3556 3461 3353 1975 1625 404 386 11963 13500 --
NM_005904chr181144 --1979 --
NM_005909chr5114258 3973 3905 3527 3519 3407 3322 3253 2913 2828 1175 24036 3465 22925 1292 --
NM_005910chr1763220 3045 3004 907 865 314 1210 33686 1531 1507 33549 1251 1126
NM_005911chr221416 1031 --2483 343 184
NM_005920chr1123706 3594 3053 2899 2754 2434 2419 2373 1177 1162 978 102 13157 53318 2716 1267 835 67 22722 2514
NM_005922chr63315 141 103 ------
NM_005924chr71981 1838 ----
NM_005927chr51313 --2923 468 11170
NM_005928chr152509 27 262 36 --1157
NM_005933chr11132912 2759 2478 2352 2227 1945 1854 1081 728 696 674 504 378 --52763 2420 2245 1950 733 32797 759 381
NM_005934chr1982577 2446 2016 1966 1825 942 365 145 --12078 11789
NM_005935chr455277 4350 3925 3266 1768 55186 3721 3699 816 694 --1236
NM_005937chr17103926 3598 3528 3415 3338 2584 2577 1458 1291 1106 1465 51113 1044 675 206 201 23962 2627
NM_005938chrX11078 --41289 1261 1088 276 --
NM_005941chr843594 892 355 128 33547 861 828 1254 --
NM_005943chr671358 1322 1242 1152 1143 211 193 ----11124
NM_005955chr194343 4056 3985 3393 2165 1378 905 885 124 34681 3656 1935 43872 2178 1488 759 21201 422
NM_005962chr1011773 --22256 389 --
NM_005962chr1011773 --22256 389 --
NM_005964chr1721391 998 --31052 1045 101 --
NM_005966chr242404 1976 1655 952 ----11662
NM_005967chr122556 272 --2114 103 --
NM_005984chr222439 357 ----1101
NM_005985chr202567 21 --153 2206 87
NM_005986chr1352080 1774 1104 730 376 12861 32692 1797 174 --
NM_005996chr1231536 1129 1107 11235 1103 --
NM_005997chr13128 68 31 ------
NM_006007chr964469 4135 2793 1765 950 515 12959 1520 --
NM_006011chr15144156 4047 3926 3677 3323 3190 3039 2963 2828 2797 1354 1209 1141 1027 33703 3431 1317 33589 3018 2834 13196
NM_006015chr13198 166 126 ----1356
NM_006022chr131314 1966 --1306
NM_006030chr341248 517 242 54 --1327 21633 57
NM_006032chr141188 ------
NM_006034chr1172460 2374 2036 690 466 378 65 --4417 264 148 144 --
NM_006035chr1461195 1130 1076 408 390 313 ------
NM_006036chr261918 1819 578 426 295 129 ------
NM_006037chr2114108 3759 3524 3246 3125 3001 1918 1828 1683 1649 150 14844 169 --
NM_006038chr2092219 1824 1613 1455 863 711 705 561 48 21372 687 --1518
NM_006039chr1741047 951 360 218 1421 ----
NM_006040chr1641067 566 532 452 ----11246
NM_006047chr2052752 2516 1316 1201 633 ------
NM_006048chr131212 421 186 --2498 435 --
NM_006051chr5----2211 102 --
NM_006054chr1151436 1420 1012 486 340 --2451 150 --
NM_006055chr23408 158 41 2225 82 --22450 969
NM_006062chr25937 362 317 235 58 2772 89 31151 1079 109 --
NM_006064chrX2305 111 ------
NM_006067chr161773 --1934 136
NM_006068chr4------1282
NM_006071chr221247 1576 ----
NM_006079chr6----1289 --
NM_006080chr72930 170 12805 ----
NM_006090chr1--1642 ----
NM_006091chr1591401 1387 1292 563 553 493 366 251 64 31553 1409 672 41750 1627 634 225 1570
NM_006095chr432841 1580 1178 44031 3959 1776 636 21786 474 --
NM_006106chr1173473 3021 2895 2504 995 420 153 11004 12631 --
NM_006108chr114785 730 217 156 22307 881 ----
NM_006129chr82531 185 1385 ----
NM_006135chr131093 1042 393 11253 1492 11096
NM_006136chr74540 467 368 234 --11172 --
NM_006141chr1622450 1088 ------
NM_006143chr12--195 ----
NM_006145chr19164 ----139
NM_006147chr13448 406 21 --126 --
NM_006148chr17102902 2443 2266 1955 960 766 716 196 156 129 --22649 779 12213
NM_006153chr32244 213 ------
NM_006157chr111273 ------
NM_006158chr831581 1325 570 ------
NM_006160chr175626 394 255 190 22 --21575 209 --
NM_006161chr5----2236 27 --
NM_006166chr1232550 789 129 ------
NM_006167chr842171 1682 941 854 1843 2946 44 --
NM_006176chr116686 299 286 272 234 74 --1600 --
NM_006177chr1441013 899 689 99 1847 --1748
NM_006178chr1741496 1395 1059 256 --1160 1233
NM_006180chr93793 307 283 2844 221 1780 129
NM_006185chr11----3553 181 88 1479
NM_006187chr1253000 2415 2173 374 262 22721 308 2917 398 --
NM_006191chr124714 641 154 84 1204 --149
NM_006195chr951397 1362 1264 990 514 ------
NM_006196chr2131 ------
NM_006197chr851581 456 246 222 216 ------
NM_006201chrX2438 79 --21097 852 1857
NM_006202chr1951400 618 461 409 156 1349 51831 1648 797 376 162 --
NM_006203chr575118 4839 3981 3919 1617 1271 504 35397 2121 909 11970 13793
NM_006206chr442472 713 448 25 22324 1039 ----
NM_006216chr21447 --163 --
NM_006224chr1742522 870 499 431 12377 32138 1915 1616 12324
NM_006226chr21439 ------
NM_006228chr82314 118 --1178 --
NM_006237chr1372303 2143 855 697 547 141 65 --1130 --
NM_006238chr6142032 1862 1820 1783 1684 1353 761 413 339 308 286 264 197 180 11974 21420 292 --
NM_006241chr352421 2391 1525 821 619 ----1833
NM_006243chr13895 735 362 1426 --1764
NM_006245chr62342 176 --1861 --
NM_006246chr141518 1210 ----
NM_006251chr573349 3171 2419 1165 613 484 453 23196 747 13185 --
NM_006252chr167460 6544 2640 1478 790 663 37498 2562 386 16175 26429 5442
NM_006254chr31158 ------
NM_006256chr132380 2267 1712 32775 2396 649 ----
NM_006258chr102431 244 1559 ----
NM_006265chr831388 467 130 1445 ----
NM_006267chr281840 1697 1614 1176 611 601 520 349 --2583 579 --
NM_006268chr113976 867 353 --21105 77 --
NM_006275chr2052380 1729 195 62 41 --12484 --
NM_006277chr21178 ----1181
NM_006279chr13934 569 300 ------
NM_006282chr20104718 4685 4638 4249 3409 3391 1518 1261 743 316 14731 23425 1538 --
NM_006283chr8124891 3567 3260 3173 3015 1496 1371 1128 554 361 242 46 23245 1076 14371 24608 323
NM_006288chr1131139 949 61 21110 1093 1267 11032
NM_006290chr631580 1223 548 21735 1710 21685 568 --
NM_006292chr11149 ------
NM_006293chr154865 837 662 174 --1754 --
NM_006301chr121507 --1237 --
NM_006306chrX135923 5914 5881 4976 4936 4782 4699 4580 4553 4363 3948 893 738 14728 31528 265 82 14612
NM_006310chr1741277 1156 971 883 --11164 --
NM_006313chr1231223 593 35 ------
NM_006315chr441506 1349 619 297 43701 1447 576 325 34218 1000 857 1421
NM_006317chr52785 604 ------
NM_006320chr43304 288 56 --1293 --
NM_006321chr341647 234 164 86 21525 502 21860 1630 --
NM_006328chr113627 581 232 --2137 96 --
NM_006330chr81616 21028 66 ----
NM_006334chr91313 ----1316
NM_006335chr11329 ------
NM_006336chr941231 402 273 86 11152 11424 11429
NM_006341chr1--1206 ----
NM_006343chr2192 1484 ----
NM_006345chr42490 327 ------
NM_006350chr51320 ------
NM_006352chr131946 1557 335 ------
NM_006354chr33328 262 62 --1138 --
NM_006357chr2--147 ----
NM_006359chrX52024 1659 1604 679 582 1834 1489 --
NM_006364chr141818 --1909 --
NM_006367chr14963 824 779 110 ----1700
NM_006369chr13400 358 130 --1310 --
NM_006372chr61105 ------
NM_006373chr1761241 982 554 355 254 165 --1269 11116
NM_006375chrX41578 389 227 219 21745 465 11481 --
NM_006377chr931165 1056 900 11102 ----
NM_006378chr961339 1027 575 465 351 290 ------
NM_006379chr71724 --1346 --
NM_006380chr1754278 3560 3280 405 33 11633 12744 --
NM_006386chr2282231 1979 1674 637 612 285 127 62 22269 792 ----
NM_006387chr1931104 916 460 --2422 56 --
NM_006389chr116518 500 435 381 175 113 --61060 895 539 408 399 41 --
NM_006390chr1231487 667 363 21377 1341 1156 11505
NM_006393chr1053659 3221 864 747 276 --23980 117 --
NM_006400chr12175 ------
NM_006401chr9----1163 --
NM_006405chr14272 38 ------
NM_006407chr321118 557 ------
NM_006409chr71229 ------
NM_006411chr65902 874 348 93 41 1336 ----
NM_006416chr6--1533 ----
NM_006422chr12162 --122 --
NM_006434chr1022006 1100 1778 1263 12455
NM_006439chr41216 ------
NM_006449chr221943 1733 22041 1954 21528 1483 --
NM_006454chr452074 1985 1944 868 188 11035 --21079 555
NM_006464chr2124054 3769 2969 2916 1758 1742 1611 1551 1478 1383 1118 769 24494 964 42942 1620 1616 1605 11667
NM_006465chr15122141 1978 1698 851 841 598 508 421 391 377 356 269 11942 32002 801 482 1778
NM_006472chr13834 503 55 1129 11118 --
NM_006478chr22165 --138 --
NM_006480chr5----1108 --
NM_006482chr1242399 1340 852 402 13026 ----
NM_006488chr22226 210 --160 --
NM_006489chr1421542 440 --21740 1639 --
NM_006496chr13566 337 330 ------
NM_006497chr172795 281 --4657 652 567 563 --
NM_006500chr112129 63 --126 --
NM_006509chr19--1381 2273 101 --
NM_006517chrX82158 2072 1540 611 580 213 39 28 1519 2626 586 131
NM_006519chr6125 ------
NM_006520chrX21730 458 ----160
NM_006521chrX2940 76 --31103 509 192 132
NM_006527chr41243 ------
NM_006532chr191191 21944 828 1574 --
NM_006534chr2053207 2805 2284 207 197 --32389 2128 1176 --
NM_006538chr2104077 3615 3493 3472 3165 2619 2577 728 311 165 --1535 11017
NM_006540chr82404 189 ------
NM_006544chr1456121 5344 5127 1406 210 25392 2135 15245 --
NM_006546chr17166275 6069 5948 5794 5215 5119 4664 4643 4557 4383 4307 2149 1556 766 747 421 45780 5686 2441 2186 76621 6517 5957 5939 4389 4349 4213 --
NM_006547chr721870 275 ------
NM_006548chr351516 1489 1348 1200 46 ------
NM_006549chr12152969 2940 2846 2661 2595 2579 2466 2340 2308 2055 2039 1985 1827 1169 484 12435 12562 --
NM_006555chr741961 1721 620 602 ----11724
NM_006557chr91377 21769 604 1487 --
NM_006558chr81323 ------
NM_006559chr11132 ------
NM_006560chr111126 ------
NM_006561chr10114921 4265 2385 2366 2211 2009 1713 1530 1441 1107 393 15190 54978 4802 4271 2442 2256 22012 1112
NM_006565chr163438 76 32 3830 363 341 ----
NM_006566chr182390 358 1469 --1338
NM_006572chr1732187 742 605 1310 --12618
NM_006577chr21953 1343 ----
NM_006578chr1561638 1575 1326 1289 1263 556 11388 21549 419 --
NM_006584chr17126 ------
NM_006587chr431265 654 54 11172 ----
NM_006589chr11561 --1133 --
NM_006593chr24752 668 314 64 1746 1626 --
NM_006595chr1121351 438 --31916 1911 1905 --
NM_006599chr16178051 7576 7414 7395 7290 6401 5151 5135 2576 1776 1757 1701 1679 1152 1080 1042 392 37185 2506 1393 27563 5730 15868
NM_006601chr12146 1236 ----
NM_006603chrX2758 625 ------
NM_006609chr242157 1950 1928 199 --157 --
NM_006614chr362849 2677 2421 1310 1295 44 13675 12255 --
NM_006618chr141483 1320 1152 527 ------
NM_006621chr141665 1632 1597 480 11345 3600 334 92 --
NM_006624chr1021682 850 2578 96 1855 --
NM_006628chr1574649 4350 4219 1280 1175 1022 81 13984 ----
NM_006636chr2--1334 ----
NM_006646chr1362184 2052 1062 994 402 262 --21239 746 --
NM_006650chr573820 3784 2663 941 552 140 123 --2592 233 13787
NM_006651chr431298 1068 247 --1555 --
NM_006654chr1254132 3552 3516 1211 312 23191 3128 14773 14146
NM_006660chr15140 ------
NM_006662chr162324 130 2135 29 1124 --
NM_006670chr61141 ------
NM_006690chr2052283 1994 1971 539 222 --21985 51 --
NM_006694chr15361 282 270 258 116 ------
NM_006698chr2031294 558 434 123 1391 1396
NM_006700chr124780 599 575 230 --1740 --
NM_006706chr51742 2622 298 ----
NM_006708chr651083 991 304 280 129 ----1136
NM_006709chr62120 104 ------
NM_006717chr952532 2286 1056 305 198 178 11142 --
NM_006721chr102693 55 ------
NM_006722chr332691 355 39 --12394 --
NM_006724chr63315 141 103 ------
NM_006726chr411135 1327 2915 825 --
NM_006727chr51158 ------
NM_006729chrX105373 4896 4823 4813 4472 4439 4065 3435 2146 1342 42199 1165 1054 661 --11043
NM_006732chr1921838 501 --31544 817 661 --
NM_006734chr621230 346 139 ----
NM_006735chr7165 --1113 --
NM_006736chr251190 603 526 509 129 21735 102 31509 615 611 --
NM_006742chr1681780 1336 1317 755 664 588 337 135 --41494 615 438 421 21412 1280
NM_006744chr10----2172 90 --
NM_006746chrX2523 56 ------
NM_006750chr16207999 7852 7821 7520 7328 7044 7027 6069 5188 3181 3174 3099 3065 1803 680 673 518 462 370 167 45470 4949 820 606 11749 2431 111
NM_006751chr21333 1827 ----
NM_006754chr71279 21129 890 1160 --
NM_006756chr81159 1965 1147 --
NM_006761chr171699 --2725 705 --
NM_006764chr31449 ------
NM_006766chr872652 1932 1795 603 461 370 163 --32624 656 444 --
NM_006769chr11131 --1152 --
NM_006772chr641577 1546 1532 1205 11618 71450 1446 1406 674 560 34 25 1206
NM_006775chr622055 2000 1412 --12011
NM_006777chrX52871 2690 2436 1086 1056 --1354 --
NM_006778chr61390 --21496 186 --
NM_006788chr1861874 1457 569 464 127 112 1118 2829 474 1740
NM_006793chr10------128
NM_006795chr1131407 1086 462 11372 61384 1118 1114 563 521 466 --
NM_006800chrX2622 569 ------
NM_006802chr13397 287 44 --1373 --
NM_006805chr531515 1278 666 148 31447 1075 104 --
NM_006807chr173840 357 266 1362 ----
NM_006811chr202924 833 1180 1988 --
NM_006814chr2092139 2132 2091 970 877 572 523 247 32 3513 401 272 1831 --
NM_006819chr111337 --2386 23 --
NM_006823chr84866 312 252 181 --1533 --
NM_006825chr121999 172 1959 --
NM_006826chr241249 1104 434 24 --1187 --
NM_006827chr1473197 2846 2260 2237 966 782 346 --23035 2868 --
NM_006838chr122218 190 --2398 224 11713
NM_006842chr11--1141 ----
NM_006851chr1232803 405 381 --12750 --
NM_006852chr17102729 2631 2564 2531 2480 2466 2361 1922 723 589 22866 139 11142 22681 2456
NM_006854chr752028 1840 1556 1530 414 1758 ----
NM_006856chr1231034 887 420 1371 --2766 266
NM_006861chr123694 345 150 21503 737 41387 569 544 201 --
NM_006873chr273063 2678 1328 1132 730 711 443 32929 365 245 --12788
NM_006874chr411215 ----11222
NM_006875chrX1883 1262 1213 1192
NM_006884chr351745 1406 1361 113 75 ------
NM_006885chr16103520 3509 3111 2819 2758 1567 1512 1357 1328 1098 1157 11103 --
NM_006887chr2----1461 --
NM_006888chr14103543 3069 3031 2698 2445 2253 997 737 146 26 --12561 --
NM_006896chr7--11139 1830 --
NM_006898chr2--1821 2225 99 --
NM_006906chr11199 1170 --1774
NM_006908chr751192 1101 981 324 256 11068 ----
NM_006914chr941449 1429 1167 599 ------
NM_006915chrX41652 722 348 38 2992 496 --141
NM_006922chr2--1766 ----
NM_006924chr1743764 3755 2964 1209 --32806 989 698 --
NM_006925chr141214 ------
NM_006930chr551984 1848 1780 1700 641 ------
NM_006931chr122824 117 11408 21579 428 --
NM_006937chr172561 134 --1141 --
NM_006940chr1251597 1246 636 552 485 --21403 563 --
NM_006947chr451451 1313 1279 484 150 1321 ----
NM_006950chrX2729 296 1689 3360 316 43 --
NM_006965chr1851149 1102 301 267 97 ------
NM_006981chr972828 2640 2393 754 515 501 457 --2740 98 12154
NM_006987chr1731053 160 28 1322 51307 1227 1180 1125 173 --
NM_006988chr2121127 782 ------
NM_006990chr1131875 1790 1779 1621 634 401 359 330 244 161 52 36 26 11966 2449 128 142
NM_006996chr111694 1699 ----
NM_006997chr101125 ------
NM_006999chr531394 397 242 --1595 1232
NM_007005chr92137 30 21074 153 ----
NM_007007chr1244728 3884 3249 26 14138 24331 2950 --
NM_007011chr15135786 5359 4579 4529 4240 2674 2150 1998 578 437 357 303 163 105077 5040 5000 4962 4922 4883 2680 2110 1398 492 55492 4537 4533 2655 1889 --
NM_007013chr82412 136 ------
NM_007015chr132286 270 ------
NM_007026chr171468 181 1473 --
NM_007027chr32407 138 1424 ----
NM_007030chr584636 4148 3469 961 742 688 520 378 --23248 513 --
NM_007034chr11883 ------
NM_007036chr51822 ------
NM_007038chr2176053 4869 4198 3829 2237 2186 504 24290 1282 13844 --
NM_007039chr1442051 1679 1564 658 31830 1723 1622 21553 82 --
NM_007040chr195989 274 251 160 43 2391 268 2888 164 --
NM_007042chr332542 2314 1943 32298 783 462 --2446 288
NM_007045chr61544 1177 ----
NM_007050chr20176804 6329 5749 5630 5603 5046 3230 3113 2350 2321 2023 1616 1527 1504 744 216 163 23137 1347 66617 5346 2823 1451 618 384 11162
NM_007052chrX1230 ------
NM_007054chr553633 3516 3435 3195 85 --23605 640 --
NM_007067chr1741357 1154 1107 1055 1605 11533 21281 417
NM_007068chr222427 356 1100 ----
NM_007073chr643268 2952 1128 216 23791 3369 13783 13630
NM_007078chr102584 492 ----1304
NM_007084chr1331485 1234 412 ----1359
NM_007107chr322310 811 1433 ----
NM_007111chr132874 159 ------
NM_007114chr322780 1069 ------
NM_007122chr1----2587 77 --
NM_007124chr651882 1766 1600 410 218 ------
NM_007125chrY2364 117 ------
NM_007129chr133655 370 209 --1854 1319
NM_007144chr173949 48 22 2372 100 188 --
NM_007145chr1921149 79 ------
NM_007146chr1752667 2637 2186 1101 378 ------
NM_007158chr121113 444 --1145 --
NM_007159chr3185 1687 ----
NM_007166chr1141441 1410 977 114 ------
NM_007170chr13784 273 84 --2789 341 2916 190
NM_007172chr2272283 2030 1123 424 330 191 80 --12292 1319
NM_007174chr124924 780 693 418 1829 31715 785 629 11681
NM_007175chr852301 2220 356 151 103 1739 2506 91 --
NM_007185chr14432 314 289 197 154 ----
NM_007189chr71206 --41379 583 564 560 --
NM_007191chr122156 58 ------
NM_007192chr1481045 1007 440 291 280 274 86 33 ------
NM_007195chr1883620 3461 3438 3196 2949 2570 2346 818 13272 1917 13133
NM_007202chr172603 56 --2772 610 --
NM_007203chr963348 3305 2931 2559 556 424 23645 439 ----
NM_007204chr11414 1131 ----
NM_007207chr11793 --1604 1799
NM_007212chr18908 830 626 542 417 256 212 153 ------
NM_007214chr631246 1099 203 ------
NM_007217chr3--131 ----
NM_007220chrX124878 4522 4210 4203 3990 3843 3772 3686 3179 1656 1527 557 --14815 34213 3995 3507
NM_007221chr12427 321 ------
NM_007222chr831763 1729 1682 ------
NM_007224chr123635 137 108 ----168
NM_007232chr201361 1329 1166 --
NM_007236chr1562393 657 444 436 253 63 1430 2374 98 --
NM_007238chr2074722 4613 4106 3656 3327 1342 317 24838 4120 14084 24759 75
NM_007245chr161130 ----2843 367
NM_007246chr4186 ------
NM_007249chr13129289 8083 7879 7731 7461 2820 2672 2596 2503 2079 1028 849 38972 7966 1324 26804 5756 47517 6980 6671 6629
NM_007270chr761437 1382 1190 1120 1090 283 1505 ----
NM_007275chr34451 437 395 329 --1441 --
NM_007276chr72779 218 ------
NM_007278chr173353 300 62 --1340 --
NM_007281chr4--142 ----
NM_007283chr372830 2811 2298 1911 1882 1027 663 169 82479 1198 1002 746 680 540 441 380 12022
NM_007286chr532115 1488 816 11942 21316 213 3619 293 235
NM_007287chr372821 2453 2077 1972 1210 664 483 --12035 12899
NM_007288chr372821 2453 2077 1972 1210 664 483 --12035 12899
NM_007289chr372821 2453 2077 1972 1210 664 483 --12035 12899
NM_007292chr1785185 4981 4874 4867 1096 413 404 249 24648 3749 13936 --
NM_007308chr42182 126 ------
NM_007325chrX51405 816 591 462 135 31489 840 728 ----
NM_007345chr18--12135 11678 --
NM_007349chr72110 80 ------
NM_007350chr1264459 4395 3552 1620 1337 958 23191 1447 11732 --
NM_007357chr11153 --1423 1569
NM_007358chr131819 1655 1515 1730 11683 --
NM_007359chr17101405 1338 1257 1228 1206 1130 1092 1081 605 536 --3577 366 164 --
NM_007372chr172885 575 ------
NM_007373chr1061778 1765 1218 1154 681 380 ------
NM_007374chr142548 147 ------
NM_007375chr122592 1782 ----11882
NM_009585chr31173 1685 1765 --
NM_009585chr31173 1685 1765 --
NM_012062chr122810 622 1210 ----
NM_012064chr1231175 1121 207 --2338 212 --
NM_012069chrX1130 --2623 229 12567
NM_012074chr1461078 954 821 240 129 108 ------
NM_012081chr533344 2328 160 1695 ----
NM_012083chr1051109 975 852 835 240 1542 ----
NM_012089chr1--11218 ----
NM_012095chr1063514 2796 2440 1416 1110 401 32719 2183 1086 32671 2287 2195 --
NM_012102chr182282 2145 2042 1982 990 876 569 268 --12084 --
NM_012104chr1183539 2672 1442 1427 1380 1032 998 432 33368 2417 1162 43081 2688 2462 1021 23226 1222
NM_012104chr1183539 2672 1442 1427 1380 1032 998 432 33368 2417 1162 43081 2688 2462 1021 23226 1222
NM_012110chr4--245 28 ----
NM_012117chr12182 ------
NM_012120chr642876 2411 2048 953 ------
NM_012134chr141583 1264 1228 181 1175 ----
NM_012137chr182860 2160 2138 2054 939 539 489 442 1654 32165 1909 555 --
NM_012141chr1353704 3297 2737 2650 287 ----13197
NM_012156chr2083354 3065 2754 2496 2484 2329 779 462 12435 73347 2836 1271 740 733 656 355 --
NM_012158chr1321609 1463 11509 ----
NM_012160chr61196 ------
NM_012161chr411178 ------
NM_012164chr9116508 6021 5690 4730 2859 2039 1794 1144 806 549 446 --15395 16286
NM_012175chr111224 ------
NM_012177chr62445 131 1476 ----
NM_012180chr41535 ------
NM_012183chr11165 1240 1140 --
NM_012188chr52931 901 ------
NM_012189chr182473 138 ----1486
NM_012193chr11175286 5192 5150 4899 4728 4631 4373 3455 3349 3334 1877 1865 1553 1531 682 674 332 ------
NM_012197chr92266 56 ------
NM_012199chr1154611 4520 4340 4052 4011 3828 3636 3598 2951 2934 938 824 749 669 132 21648 43 74078 3954 2955 2922 1527 1439 782 21307 1056
NM_012210chr931130 477 45 31005 353 183 150 1391
NM_012215chr1031334 374 226 ------
NM_012218chr1962239 2223 1926 1060 591 30 ------
NM_012219chr373205 2726 2631 2513 2393 1198 1142 1568 22675 388 22891 187
NM_012223chr22247 174 ------
NM_012232chr1762051 2033 2026 1885 49 40 11444 51914 1892 1621 1455 321 --
NM_012234chr373027 2727 1385 1069 599 438 406 ----11184
NM_012238chr1031705 1472 697 ------
NM_012242chr102528 132 ------
NM_012244chr1451656 1504 1162 510 496 --41477 1316 344 33 21369 1165
NM_012247chr102750 50 --1649 --
NM_012249chr243223 3100 1364 1007 --12524 --
NM_012250chr113145 86 50 ----11108
NM_012252chr764501 3349 1518 458 420 397 33746 2121 1871 13718 13476
NM_012255chr20129 1169 ----
NM_012257chr71230 ------
NM_012278chrX1150 ------
NM_012279chr561801 1593 1361 517 325 51 31753 1570 279 41584 742 497 270 --
NM_012281chr712015 21763 801 ----
NM_012287chr343789 1247 552 442 11692 --11553
NM_012288chr6175067 4979 4931 4681 4246 3950 3932 3668 3589 2040 2008 1228 862 305 183 172 156 64791 4745 4090 1864 769 357 84669 3491 2227 2029 1827 1256 1240 87 24970 3759
NM_012294chr753397 3053 1433 1151 76 23793 1426 --13891
NM_012296chr11103927 3494 3426 3016 2678 2640 847 395 292 83 --43431 3375 2488 158 22963 55
NM_012297chr472083 1855 1836 1678 901 823 165 ------
NM_012298chr33708 667 101 --2218 154 --
NM_012300chr531659 589 212 --31813 922 247 11818
NM_012301chr71676 ----11414
NM_012302chr121097 1086 21013 304 ----
NM_012304chr572474 2260 2178 1694 897 790 109 21759 240 22478 327 11697
NM_012306chr1263064 3049 1009 839 547 235 23332 2380 43558 3543 3125 1036 --
NM_012307chr183810 681 355 1176 ----
NM_012308chr1141990 1923 1765 39 22494 643 2584 138 1873
NM_012309chr1174954 4239 1393 1168 907 598 401 13210 33799 1399 443 --
NM_012311chr102644 584 ------
NM_012316chr1143878 3793 3687 1992 1966 1676 1640 1282 1099 1083 859 401 376 243 2821 606 63558 1921 1681 975 380 154 15409
NM_012322chr71108 171 ----
NM_012326chr2136 2764 272 179 --
NM_012327chr1811092 31584 329 277 ----
NM_012328chr741323 549 199 42 --11232 --
NM_012329chr17--11058 21044 359 1393
NM_012330chr1031692 1533 376 --1381 --
NM_012333chr141193 651 612 573 ------
NM_012334chr563891 3423 2883 529 439 365 --1358 13426
NM_012340chr202179 169 ------
NM_012384chr2052373 1863 1783 1772 786 22032 514 --12278
NM_012392chr1----142 --
NM_012395chr721164 310 13122 22808 2333 --
NM_012398chr1932370 1135 734 --1786 --
NM_012399chr22--21530 130 ----
NM_012414chr1------1525
NM_012416chr92183 123 --1246 --
NM_012417chr172603 119 ------
NM_012420chr1041712 775 371 36 12158 ----
NM_012423chr19--1307 145 --
NM_012425chr1031008 420 28 2649 142 139 --
NM_012428chr15193 ------
NM_012432chr1259 26 ------
NM_012434chr62386 69 --1610 --
NM_012444chr202328 128 ------
NM_012448chr1762159 2057 2041 944 910 85 --22552 541 --
NM_012453chr781423 1415 1334 1251 477 223 92 73 41519 1404 431 138 ----
NM_012456chr11------145
NM_012461chr143585 558 251 --2478 50 --
NM_012463chr1231754 1560 149 ------
NM_012464chr432005 1029 900 1517 --22363 2231
NM_012470chr71168 ------
NM_012473chr225507 244 232 216 62 --177 --
NM_012479chr721750 786 161 11929 1109
NM_012482chr11114 ------
NM_012486chr11103 ------
NM_013227chr151727 1270 1757 1283
NM_013229chr1212667 1169 1876 --
NM_013230chrY2586 35 ------
NM_013231chr1443433 1532 1143 700 --33863 3437 1027 --
NM_013233chr221251 400 ------
NM_013236chr2211117 21263 392 --1480
NM_013243chr1531125 309 164 ------
NM_013245chr165723 646 573 253 224 1218 ----
NM_013246chr113714 703 682 --1120 1717
NM_013255chr7188655 7824 7605 7544 6967 6923 6871 6805 5834 5482 3522 2146 2118 2074 2062 1572 431 153 37571 1878 231 16971 36874 3514 437
NM_013257chr832167 2032 300 ------
NM_013259chr32110 82 --191 --
NM_013261chr453425 3242 1352 1173 916 --164 --
NM_013269chr1244282 4260 4180 4086 23998 1259 11460 --
NM_013275chr164746 611 196 154 ------
NM_013277chr12--3931 244 25 2175 171 --
NM_013281chr2021190 581 11199 ----
NM_013293chr7174 194 ----
NM_013316chr7----1798 186
NM_013334chr3--138 ----
NM_013336chr34578 538 443 340 ----2601 303
NM_013341chr242764 2020 1123 794 --21160 1077 --
NM_013353chr1189 --170 --
NM_013354chr85379 358 318 135 109 --199 --
NM_013357chr82867 705 1747 --1204
NM_013365chr224611 534 158 125 ------
NM_013368chr193465 200 183 --129 --
NM_013374chr32848 802 12218 12032 --
NM_013377chr122604 181 ------
NM_013382chr1472143 2077 2058 1912 1629 1602 664 141 11768 11605
NM_013390chr941499 1387 1161 175 1258 --11167
NM_013396chr211337 1319 2271 62 --
NM_013400chr72992 762 --1968 --
NM_013403chr193815 246 211 1289 3761 180 149 --
NM_013411chr172479 1847 1749 1092 998 848 698 --1605 1780
NM_013423chrX1928 1110 ----
NM_013427chrX1928 1110 ----
NM_013433chr1951945 1775 1332 533 476 31868 1470 1285 41930 1876 1346 141 --
NM_013434chr221740 585 --11722 1250
NM_013434chr221740 585 --11722 1250
NM_013436chr2--1569 ----
NM_013437chr81236 ------
NM_013438chr911295 --11605 --
NM_013444chrX5999 987 343 183 171 1780 5278 256 252 215 210 1992
NM_013446chr71185 21445 148 1163 1999
NM_013448chr141648 ------
NM_013449chr12172716 2374 2260 2005 1990 1101 820 811 709 657 643 540 336 322 225 172 47 42994 2931 1132 558 42133 832 532 181 1845
NM_013450chr221047 32 --1354 --
NM_013951chr252345 2303 888 851 437 --22012 857 12490
NM_013952chr252422 2380 965 928 514 --22089 934 12567
NM_013953chr252422 2380 965 928 514 --22089 934 12567
NM_013958chr81144 ------
NM_013959chr81144 ------
NM_013960chr85609 569 257 193 148 --1518 --
NM_013961chr81144 ------
NM_013962chr81144 ------
NM_013989chr1484629 4536 4203 3977 3920 3649 3366 1452 35033 4280 3340 ----
NM_013992chr252422 2380 965 928 514 --22089 934 12567
NM_013993chr63618 522 216 1591 4208 183 175 93 1222
NM_013994chr63618 522 216 1591 4208 183 175 93 1222
NM_013995chrX2881 356 12533 ----
NM_013999chr1731102 241 119 1334 3518 154 124 --
NM_014000chr1061760 735 626 389 368 353 41441 1416 635 472 41494 611 500 496 11499
NM_014001chr1731321 457 314 11464 11357 --
NM_014007chr92836 255 ----1791
NM_014010chr92555 507 ------
NM_014011chr21409 --1481 --
NM_014016chr31349 177 ----
NM_014021chr132954 137 129 23032 2222 11318 11207
NM_014030chr1731138 858 298 --2830 746 --
NM_014034chr64969 405 259 58 11552 11130 --
NM_014042chr11----1221 --
NM_014043chr31251 ------
NM_014057chr921523 1319 2582 436 1365 --
NM_014059chr133272 120 23 ----1346
NM_014079chr32165 119 1726 2332 267 --
NM_014089chr131121 ------
NM_014106chr15--12130 ----
NM_014110chr14412 275 262 252 189 1885 --
NM_014112chr854738 4701 4378 529 133 24765 4328 ----
NM_014117chr1672363 2321 2241 1782 844 764 93 21973 749 22269 2246 --
NM_014141chr774196 3500 3452 1534 1352 431 209 23635 1241 ----
NM_014145chr201578 ----1144
NM_014149chr71593 2697 202 --1676
NM_014153chr161730 ------
NM_014155chr11116650 5973 5675 5629 5374 2116 1073 616 547 403 143 46609 6381 5511 990 26877 5717 12783
NM_014157chr16113321 3176 3002 1433 1383 1343 1219 972 864 686 61 21288 794 41348 1271 626 544 21250 278
NM_014159chr3174 ------
NM_014166chr131808 --1820 --
NM_014181chr21857 31913 1160 780 ----
NM_014182chr122724 127 1292 172 1130
NM_014183chr201261 ------
NM_014186chr112601 578 21463 758 32162 2117 729 --
NM_014188chr12269 37 --2302 60 --
NM_014189chr451495 1359 1259 1007 388 --1336 --
NM_014190chr461847 1711 1611 1359 740 320 21159 106 1688 --
NM_014191chr122845 68 ------
NM_014211chr531487 1419 1148 21542 1530 11449 --
NM_014212chr12189 2840 826 2615 387 1948
NM_014216chr141442 --21607 480 --
NM_014217chr131577 1212 47 --31501 530 279 --
NM_014231chr1251895 1481 472 117 83 32029 1605 1547 41953 1587 1583 477 --
NM_014232chr1761633 1492 653 498 410 359 --8403 399 382 349 283 278 274 241 1627
NM_014232chr1761633 1492 653 498 410 359 --8403 399 382 349 283 278 274 241 1627
NM_014233chr1722174 1893 21782 1362 21729 1526 1418
NM_014234chr61171 ------
NM_014240chr363089 1241 1157 1140 414 408 12869 1146 --
NM_014243chr421538 765 159 ----
NM_014245chr31898 ----1227
NM_014248chr22----156 --
NM_014250chr2252022 1635 1568 1487 482 11389 11574 --
NM_014252chr131125 ------
NM_014253chrX3632 426 132 11663 1538 --
NM_014264chr41104 ------
NM_014267chr111239 1786 ----
NM_014268chr1821444 1140 21275 290 11337 1306
NM_014270chr19170 ------
NM_014271chrX2621 589 ------
NM_014275chr5--1811 2782 567 1665
NM_014280chr12589 72 2597 268 4262 203 49 31 --
NM_014282chr93493 163 109 21227 191 ----
NM_014283chr131369 1268 323 1204 --1356
NM_014284chr161036 948 840 821 104 64 ------
NM_014289chrX21181 121 1448 11257 --
NM_014293chr22163996 3682 3406 3308 3161 2747 2723 1384 1356 1108 1013 657 577 567 420 132 33472 3448 496 21047 97 23164 660
NM_014294chr811362 ------
NM_014299chr1971802 1772 1451 712 650 432 83 3738 594 580 1265 153
NM_014305chr131217 ------
NM_014309chr22165136 4920 4710 4068 3923 3895 3633 1632 1233 1210 939 816 804 610 597 586 45100 4494 1553 1276 65196 5191 5065 3905 3465 1861 13994
NM_014316chr1661801 1635 734 439 366 84 11859 11998 --
NM_014319chr1221641 69 2656 445 ----
NM_014323chr221392 --1146 1415
NM_014331chr496197 5843 5160 5065 4926 2503 2346 2232 502 16378 22102 2098 --
NM_014332chrX1154 2328 316 ----
NM_014333chr1152661 1002 579 335 328 21022 239 1441 11005
NM_014335chr152988 52 ------
NM_014342chr1141383 1321 1264 1148 ------
NM_014344chr113698 176 151 --1839 --
NM_014345chr62951 172 --3935 177 165 1954
NM_014352chr1131014 270 68 --1250 --
NM_014365chr123661 554 50 ------
NM_014368chr962106 1793 1621 1612 399 371 1270 21344 162 1353
NM_014374chr72992 762 --1968 --
NM_014382chr331339 1148 288 ------
NM_014393chr892308 2298 1713 946 754 731 313 231 219 ------
NM_014397chr931197 219 62 --21422 1321 --
NM_014399chr74991 268 172 26 ------
NM_014400chr194456 71 38 23 162 ----
NM_014410chr181344 1325 ----
NM_014415chr3--11470 ----
NM_014418chr1411417 1388 21889 1306 --
NM_014421chr4--31756 1393 311 ----
NM_014423chr534721 3757 1002 12036 12106 --
NM_014431chr1051596 1145 429 359 120 ------
NM_014437chr1----2596 59 --
NM_014445chr331582 1548 119 ------
NM_014447chr421596 138 --11559 --
NM_014452chr621091 310 1383 1183 1895
NM_014456chr101321 1516 ----
NM_014458chr121103 880 --31279 1272 254 --
NM_014460chr2211177 11739 3588 584 476 --
NM_014469chr111294 ------
NM_014470chr12138 1594 1639 --
NM_014488chr111103 ------
NM_014491chr71891 ------
NM_014494chr1692301 2072 2050 1909 798 745 390 307 133 1712 --11850
NM_014496chrX2279 252 ------
NM_014498chr31325 ------
NM_014504chr782175 1777 1382 1348 770 379 276 251 21904 1515 ----
NM_014515chr1221049 31 ------
NM_014517chr361630 1618 1232 529 374 135 ----11267
NM_014552chr231136 595 561 ------
NM_014554chr1232250 2146 1448 11431 72294 2016 1675 694 564 551 163 --
NM_014562chr25629 562 307 269 100 ------
NM_014570chr221184 --1211 --
NM_014573chr1741562 493 283 167 ----11836
NM_014574chr1411360 ------
NM_014577chr221117 ------
NM_014586chr21164552 4061 3813 3611 3564 3397 3284 1683 1528 1203 918 472 315 280 266 237 44504 4149 619 274 1242 --
NM_014587chr1641527 1252 267 204 --11188 --
NM_014591chr102374 347 3893 429 81 41282 920 235 75 --
NM_014604chr171572 --3156 151 147 --
NM_014606chr451118 1043 976 374 27 2395 333 41258 1030 464 384 --
NM_014607chr241395 827 618 444 --1514 --
NM_014608chr15142 ------
NM_014612chr911182 --199 11222
NM_014614chr211320 4589 407 184 165 ----
NM_014615chr1672789 2505 2343 2275 1277 589 526 33656 2920 2738 23161 263 --
NM_014616chr333518 3058 1061 --142 --
NM_014620chr121125 ------
NM_014630chr15123799 3501 3433 2810 2676 1217 1107 982 555 542 269 50 32685 1020 900 73854 3276 3201 3071 1041 751 422 1974
NM_014634chr2273578 3514 3290 2725 2593 641 626 1440 52661 2414 119 49 31 --
NM_014641chr62523 21 ------
NM_014646chr1862945 2831 2056 2036 487 289 13019 32999 2490 95 1149
NM_014647chr1632154 712 194 ----12157
NM_014659chr151128 --1400 --
NM_014660chr71131 1954 1366 --
NM_014661chr1093936 3751 3640 3295 2451 1544 551 428 113 21538 1398 3824 502 297 --
NM_014663chr111056 1144 ----
NM_014666chr5190 ------
NM_014667chr331895 748 251 12315 32350 1900 1677 --
NM_014670chr21296 186 ----
NM_014671chr751613 577 507 116 44 --1145 1510
NM_014674chr3133843 3667 3505 3463 3322 3293 2923 2836 1603 1242 639 614 461 22656 1504 23182 3175 --
NM_014676chr121364 440 --11412 --
NM_014677chr811033 --11016 --
NM_014679chr112989 435 173 --1442
NM_014682chr84896 547 537 141 ------
NM_014683chr1742194 1893 1656 577 --1208 1697
NM_014686chr192820 692 22251 1853 --1695
NM_014690chr7102828 2731 2100 1223 1125 834 819 412 376 26 1436 52775 2339 2251 2069 2039 12258
NM_014701chr1543255 3237 1353 1000 12680 11212 --
NM_014702chr693274 3240 3192 2953 2565 2461 523 161 92 21100 120 13106 --
NM_014705chr731903 1863 765 ------
NM_014707chr742288 2272 2260 1709 --2479 475 --
NM_014709chr2--1196 ----
NM_014711chr16136 11960 1428 --
NM_014720chr102734 113 1375 ----
NM_014721chr697491 7226 7068 6312 5763 5357 4707 1282 60 22176 1941 2882 776 --
NM_014723chr2042794 2766 881 427 12947 52706 2622 711 698 73 22964 2080
NM_014726chr1751224 1095 296 186 153 ----1980
NM_014727chr191244 ------
NM_014729chr821575 215 124 ----
NM_014730chr12205223 5189 4962 4855 4767 4680 4672 4061 3952 3732 3420 3378 3327 1489 1474 1321 893 812 567 551 65051 3879 1904 1512 1023 760 53743 3539 1311 276 236 14328
NM_014730chr12205223 5189 4962 4855 4767 4680 4672 4061 3952 3732 3420 3378 3327 1489 1474 1321 893 812 567 551 65051 3879 1904 1512 1023 760 53743 3539 1311 276 236 14328
NM_014731chr2071800 1534 1352 1224 343 277 83 ----11803
NM_014733chr531478 1461 635 1588 1805 --
NM_014735chrX62048 1819 1665 764 513 280 ----1767
NM_014739chr673337 2881 2731 2662 1538 1095 331 --24010 336 --
NM_014743chr482831 2460 2305 2040 2009 610 468 320 1195 --12878
NM_014746chr264056 4002 3043 2814 1751 553 23368 699 33978 1548 822 --
NM_014747chr1185674 5471 5383 5284 5120 4886 4610 4003 3982 3976 3958 3732 3688 3651 1234 1226 724 589 45556 4418 1586 1327 24438 4116 --
NM_014751chr83761 395 243 ------
NM_014752chr1121942 445 ------
NM_014754chr84890 829 789 353 1160 --1714
NM_014755chr293651 3249 3046 1691 1667 1526 1451 1282 1105 23213 1437 54122 3829 2875 1299 1286 --
NM_014756chr114389 371 323 172 ------
NM_014757chr582362 2045 1643 1540 931 914 839 618 1703 31635 949 748 11646
NM_014761chr1641140 988 747 150 1177 11057 --
NM_014764chr121506 2356 56 --1466
NM_014766chr773476 2971 1264 1254 755 176 24 43195 2737 628 40 2398 196 1596
NM_014767chr1083095 2512 2247 1399 1350 1331 1283 317 13333 53554 2732 2649 1260 488 --
NM_014770chr122498 156 1125 11101 --
NM_014771chr162885 287 1815 --1691
NM_014772chr1843535 3434 2552 1456 33601 2405 1279 43011 2733 2216 272 --
NM_014774chr192841 2825 2559 2319 2288 2080 1278 839 280 12145 1865 --
NM_014776chr1272960 2727 2048 1987 1243 1219 949 32937 2866 578 22642 2622 --
NM_014779chr3--171 --1346
NM_014782chrX1114 ------
NM_014786chr113973 885 190 ----1420
NM_014795chr221345 481 2504 26 ----
NM_014798chr1731781 1508 736 1402 31401 1278 583 --
NM_014800chr741139 742 294 28 1227 4881 463 328 324 --
NM_014803chr1032882 2299 364 52577 2563 2098 1041 299 ----
NM_014807chr112339 56 --4715 658 591 68 --
NM_014810chr193412 3393 3155 2929 2636 1383 541 181 52 11287 22607 888 --
NM_014812chr131322 521 174 --1285 --
NM_014819chr52144 55 21929 1553 ----
NM_014820chr341909 1903 1788 1662 ----1600
NM_014822chr4152 1121 ----
NM_014824chr1121529 597 ------
NM_014826chr183850 3467 1373 1011 964 394 204 70 32785 1149 941 ----
NM_014827chr1----21474 253 --
NM_014830chr12113841 3753 3541 3418 3404 2877 2652 2622 2615 2401 790 --33668 3430 303 --
NM_014836chr1021307 128 ------
NM_014838chr2212701 --22428 166 22239 625
NM_014839chr182317 2013 1980 1772 880 602 384 316 21830 1602 11821 11788
NM_014840chr1272729 2544 2441 2292 1261 1146 837 ------
NM_014841chr62967 127 1403 ----
NM_014847chr12377 217 147 ----
NM_014849chr141186 1172 336 307 1233 5888 344 278 62 58 --
NM_014850chr3154484 4281 4040 3961 3886 1866 1688 1611 1592 1445 1318 813 690 316 290 23459 83 44698 4557 3547 1323 --
NM_014859chr1741339 563 201 107 11266 --1992
NM_014864chr194090 3689 3604 1495 1438 1162 1042 856 368 --23659 3654 33665 881 216
NM_014868chr123230 187 56 --125 --
NM_014869chr341325 996 211 53 --1986 11297
NM_014871chr122571 203 173 ----
NM_014872chr951676 861 732 365 223 --11931 --
NM_014873chr154665 3751 1839 1187 595 33266 1457 680 21608 474 --
NM_014875chr11741 1752 1941 --
NM_014876chr2252123 1527 297 115 91 31727 691 380 ----
NM_014877chr1797367 7193 5620 2554 1706 1439 1421 908 901 47057 2581 2446 2051 --16779
NM_014880chr232107 2043 321 --1715 --
NM_014883chr46784 656 571 356 288 116 --1549 1532
NM_014887chr131717 ----1644
NM_014888chr741499 1363 522 225 ----1528
NM_014892chr61133 ------
NM_014897chr1773099 3079 3070 2160 2084 1100 337 ------
NM_014902chr2021526 468 --21217 414 --
NM_014903chr1212072 --22112 365 --
NM_014905chr231374 715 278 1690 ----
NM_014906chr1733369 1016 1002 --13373 2296 258
NM_014909chr1483655 3164 2900 2567 2477 992 526 373 13378 53942 3901 3141 2675 2416 23360 2570
NM_014912chr10----22881 2604 --
NM_014913chr1811181 1289 1420 --
NM_014914chr24441 404 371 107 ------
NM_014918chr1521299 1068 1512 ----
NM_014920chr653736 3240 2531 2417 511 130 22541 52 13485
NM_014921chr1952901 2476 1229 1061 332 1202 132866 2839 2829 2754 2493 2285 2025 1197 1182 889 872 848 615 --
NM_014923chr1332277 1623 267 22301 1902 21714 240 --
NM_014924chr1431969 983 48 22240 1100 1615 --
NM_014925chr124763 681 207 175 2778 240 1685 --
NM_014926chr321151 117 ------
NM_014932chr321607 709 1679 --11377
NM_014933chr41381 ------
NM_014936chr672795 2725 2342 2129 2101 717 300 1461 ----
NM_014939chr1841567 1354 1283 610 ------
NM_014944chr111412 ------
NM_014945chr5101889 1862 1338 1299 1284 1236 622 350 330 298 22009 1226 31241 696 691 --
NM_014946chr242389 1905 1084 819 22767 2637 ----
NM_014947chr12844 41 12398 ----
NM_014949chr12672 138 ------
NM_014950chr142599 110 ------
NM_014952chr1581372 583 549 471 447 374 276 235 31984 713 556 12025 --
NM_014962chr2032542 950 873 ----1276
NM_014964chr1762058 1917 1537 974 174 126 ------
NM_014969chr12738 186 2457 428 ----
NM_014974chr103708 536 522 1151 --11550
NM_014977chr141157 1219 --1470
NM_014978chr1031293 378 31 2413 235 ----
NM_014982chr14103751 3616 3275 2139 1928 1783 1374 1135 894 34 1807 2669 664 --
NM_014988chr442587 2068 858 815 21763 94 --12186
NM_014989chr651717 1293 733 561 395 ------
NM_014990chr142275 238 21358 375 --1437
NM_014991chr442292 861 700 606 --146 --
NM_014992chr142681 251 --1291 --
NM_014994chr1582324 2213 782 660 516 466 198 178 12040 31954 836 764 1136
NM_014997chr772581 2253 1125 1108 250 190 139 --1255 1180
NM_015000chr1232219 460 264 12411 11142 --
NM_015001chr13925 268 165 3937 908 36 ----
NM_015002chr124660 417 167 44 ------
NM_015008chr343281 3076 2487 811 13011 13140 --
NM_015020chr1683701 3523 3505 2606 2367 1131 789 605 63598 3557 3300 2387 1252 1191 33351 1387 1219 --
NM_015023chr191565 1554 1521 1423 1148 676 309 115 90 21716 1455 31432 1213 1126 21437 679
NM_015024chr841403 1334 973 147 --11375 --
NM_015025chr252425 2197 2049 1057 1006 --22031 888 --
NM_015026chr1274586 4467 4442 3292 1484 1218 955 11073 24541 4478 --
NM_015027chr1641765 1238 794 228 11785 ----
NM_015032chr133807 703 516 ------
NM_015033chr962676 940 811 582 503 349 --32693 309 35 1900
NM_015039chr173537 3514 3414 901 588 194 105 13572 34112 3139 1522 1439
NM_015042chr15134295 4279 3680 3636 3441 3431 2804 1432 1080 878 851 607 196 33215 2709 1504 54261 3718 3641 2878 856 1881
NM_015044chr1663259 3203 3146 2237 804 508 12555 12675 22865 774
NM_015045chr1021505 1424 11436 ----
NM_015049chr253093 2740 1156 611 496 11124 ----
NM_015051chr962958 2849 1263 979 859 29 12887 ----
NM_015052chr761212 1101 507 195 169 70 --275 51 --
NM_015053chr14390 114 31 25 --2312 82 12239
NM_015057chr131183 ------
NM_015060chr7--1194 ----
NM_015063chr1931142 192 86 11271 51344 499 388 186 128 --
NM_015064chr1283110 2728 2334 1444 1320 575 543 448 33257 923 166 11037 --
NM_015068chr743909 2651 1476 1244 2291 59 ----
NM_015069chr161243 ------
NM_015071chr565272 4490 2313 1476 1069 904 45204 4965 2088 622 22291 2286 --
NM_015072chr141394 ------
NM_015074chr1114597 4288 3789 3714 3418 3149 1910 1742 560 356 119 13387 ----
NM_015075chrX71960 1595 1570 843 357 196 140 --21901 99 --
NM_015076chr6104474 4225 3523 2824 1815 957 909 316 239 200 13812 1214 --
NM_015079chr15123030 2774 2403 2309 2271 1307 884 740 727 712 119 31 2790 244 2235 124 --
NM_015080chr112391 117 11014 1174 --
NM_015082chr562394 2107 2091 876 787 482 1512 1678 --
NM_015086chr1261587 1064 616 88 79 66 --1556 --
NM_015087chr1312670 32234 2054 471 12252 --
NM_015090chr1136034 5792 5164 5085 4711 4226 2353 1788 1239 1129 656 580 384 35912 1154 355 45892 4742 4722 4717 35931 4261 2188
NM_015092chr16104584 4468 4360 4133 4006 3817 3528 3194 1840 990 13911 ----
NM_015093chr63523 321 23 ------
NM_015097chr31689 31867 294 111 11474 --
NM_015100chr161714 1645 624 608 362 154 11338 4803 748 629 613 --
NM_015101chr142887 2002 1911 1860 21130 202 21889 1885 12008
NM_015102chr1198 --124 --
NM_015107chrX72372 1883 1827 1516 637 463 164 --62448 1521 579 208 176 47 --
NM_015115chr442569 2458 110 96 ------
NM_015125chr191373 --2522 155 --
NM_015132chr731688 1280 276 21756 154 11574 --
NM_015133chr1631308 1159 235 --1541 --
NM_015137chr832550 2527 1715 ------
NM_015138chr1562673 1010 820 792 503 475 32413 940 813 266 58 1823
NM_015143chr421131 33 1327 --11277
NM_015144chr1643255 2545 2513 853 23264 823 1658 --
NM_015155chr101975 1669 12329 --
NM_015156chr1463516 3427 2993 634 576 444 2324 195 23631 857 1642
NM_015157chr111779 1409 21004 447 11114
NM_015161chr162581 285 21462 515 ----
NM_015170chr82615 565 11730 ----
NM_015171chr162109 61 ----1353
NM_015172chr121287 595 11188 ----
NM_015173chr431586 1366 407 1106 1218 --
NM_015176chr131309 1165 164 ----11473
NM_015178chr851082 1060 711 328 66 1427 ----
NM_015185chrX52740 2450 2386 554 514 42373 2204 846 529 1316 --
NM_015191chr112827 167 22657 2026 11047 --
NM_015192chr2032988 1104 92 1247 ----
NM_015194chr1771816 1678 1668 1546 1349 1327 172 11480 1145 21360 619
NM_015199chr372577 2312 2289 2171 2071 1958 617 12089 --11832
NM_015200chr441990 1769 709 154 --1242 --
NM_015202chr16--21155 1052 --11534
NM_015206chr1563615 3050 1220 613 504 433 21073 321 22614 2610 --
NM_015208chr1832751 941 505 43719 2895 1505 782 ----
NM_015209chr142095 1888 374 368 --12274 --
NM_015213chr11--166 ----
NM_015215chr143211 2126 746 307 1314 --1336
NM_015216chr5--31293 1247 443 11088 1484
NM_015225chr93438 252 189 22339 564 ----
NM_015226chr1683453 2882 1368 1358 1242 919 872 326 --42777 1174 695 590 --
NM_015229chr172865 106 --1885 --
NM_015230chr421798 1592 ------
NM_015233chr1352429 2367 1829 570 35 31031 654 507 --12359
NM_015235chr1021875 107 ----31988 840 781
NM_015236chr42979 217 --2983 228 --
NM_015238chr51734 ------
NM_015239chr9--162 ----
NM_015242chr11149 --2545 497 --
NM_015245chr692259 2129 2038 2024 1751 1115 611 589 580 --32575 2296 2064 --
NM_015246chr161169 1234 ----
NM_015247chr1694930 4594 4549 4306 4068 3835 1192 1035 504 25198 5138 24574 2146 15307
NM_015250chr951701 1437 1288 377 249 --41593 1589 61 55 --
NM_015252chr22604 323 150 --1164
NM_015254chr862982 2866 2491 2072 1090 496 33199 3177 2754 32933 405 98 --
NM_015260chr1921094 471 --11552 --
NM_015261chr112158 89 1389 ----
NM_015263chr151360 ------
NM_015264chr22104811 4545 3999 3587 3331 1804 1216 910 886 190 --14312 --
NM_015265chr222497 2119 22141 667 --12067
NM_015267chr121598 --31344 50 46 --
NM_015268chr32507 91 ------
NM_015271chr462859 1680 1373 872 861 617 1122 ----
NM_015272chr1631985 1692 514 ----2246 194
NM_015277chr1841680 1147 306 190 ----1193
NM_015282chr292581 2557 2486 2035 1230 655 455 408 141 11021 22687 63 --
NM_015284chr182026 1896 1720 1352 1311 276 262 89 42075 1346 598 414 42102 2090 2085 1674 22029 1573
NM_015288chr5113478 3000 2476 2459 2353 1317 996 967 852 206 173 --52835 2597 1152 860 856 12806
NM_015289chr1571925 1882 1828 1727 1516 606 571 --21930 1804 --
NM_015291chr173025 2412 2280 815 276 230 143 11144 1410 1510
NM_015292chr124292 205 122 36 --1271 --
NM_015294chr1711084 ------
NM_015296chr131401 1185 ----
NM_015299chr1483792 3780 3445 3286 2886 1480 986 62 23555 222 33815 3729 3292 13367
NM_015305chr1451980 1552 387 371 28 31616 210 140 31288 268 118 --
NM_015310chr8137467 7223 6870 6719 5889 2798 2677 2490 2111 1711 1264 983 880 26990 6191 42736 2731 1715 274 1989
NM_015313chr11114075 3430 3343 3326 3188 3087 1623 791 710 683 602 33636 2946 1287 33541 3472 3242 --
NM_015314chr722174 173 ------
NM_015315chr563150 2939 2782 2683 2434 572 13391 72945 2174 2168 2108 996 862 200 1747
NM_015317chr232370 2339 1113 12519 --12129
NM_015320chr25409 378 357 174 62 --31016 89 37 --
NM_015326chr162809 2707 2297 2068 2028 201 32785 742 66 22481 2374 21818 185
NM_015327chr141245 975 508 370 11215 2480 258 1869
NM_015328chr7142615 2561 2461 2321 1222 1189 876 866 778 637 618 600 505 92 11023 22684 420 --
NM_015329chr1962919 2104 2058 1811 902 92 22075 533 4970 923 765 96 --
NM_015335chr1242158 1913 1847 195 --139 1138
NM_015336chr1222445 914 ------
NM_015338chr2061851 1559 1375 689 390 170 --1124 --
NM_015339chr2011009 179 2300 192 --
NM_015344chr82865 36 1680 11926 21767 132
NM_015346chr1471630 1429 605 340 170 99 78 11225 51610 1568 527 390 150 1532
NM_015349chr662705 2257 2070 1952 649 545 12131 --12116
NM_015359chr872839 2749 2707 2210 2170 824 526 ----22587 490
NM_015361chr21889 ------
NM_015365chrX134096 4036 3629 3479 3257 3166 2703 801 375 356 345 328 67 31389 615 49 54119 1702 396 383 364 --
NM_015374chr2241034 474 202 64 1236 1210 --
NM_015378chr173018 2989 2710 2673 2146 1956 1946 12315 12764 --
NM_015381chr2251761 1364 1331 783 124 11349 11403 11863
NM_015382chr14--1289 ----
NM_015385chr1022006 1100 1778 1263 12455
NM_015387chr21720 1684 21925 460 21503 714
NM_015388chr6----3267 263 34 --
NM_015393chr443597 2888 2397 166 32561 2381 1129 1280 --
NM_015396chr341378 1278 1080 81 11056 ----
NM_015397chr941514 778 687 194 1739 ----
NM_015401chr1221023 692 --1781 1438
NM_015404chr92563 525 ----158
NM_015416chr12----2793 666 --
NM_015426chr31581 ------
NM_015429chr321074 22 1389 11059 --
NM_015435chr831341 1329 1025 ------
NM_015436chr463091 2621 2220 966 682 56 12465 ----
NM_015439chr62324 87 ------
NM_015443chr172380 214 --21029 570 --
NM_015444chr31110 --2258 55 --
NM_015446chr111576 ------
NM_015455chr574101 3892 3662 1530 1166 922 387 11080 ----
NM_015457chr111706 --4233 228 72 68 --
NM_015458chr865135 4350 1821 1587 1514 33 33753 1863 1223 ----
NM_015460chr342082 1533 724 291 11325 1584 --
NM_015461chr181611 ------
NM_015464chr71158 1331 ----
NM_015465chr51660 --1486 --
NM_015475chr21218 --1405 --
NM_015477chr152983 94 1220 ----
NM_015481chr1221010 764 --4812 314 224 111 11018
NM_015488chr251688 1634 1489 1346 348 1526 41506 1374 406 301 176
NM_015496chr81205 ------
NM_015497chr151458 --1241 11116
NM_015503chr162615 457 ------
NM_015509chr1261538 1354 1280 1149 438 134 --21154 442 --
NM_015514chr145534 428 229 148 101 --1433 --
NM_015527chr164736 698 683 526 --2598 41 --
NM_015534chr14885 803 215 127 ----197
NM_015542chr102961 250 11044 ----
NM_015548chr61793 --128 --
NM_015549chr141236 2461 205 164 --
NM_015550chr7123551 3509 3107 2983 2970 2847 2835 2714 2634 2248 613 52 1821 22275 1138 --
NM_015554chr1562766 2701 1990 950 502 150 11046 12627 1754
NM_015560chr332350 2303 98 22633 2494 ----
NM_015564chr553069 2642 2576 2404 552 53405 3323 3252 2546 1157 ----
NM_015565chr211810 --1119 11629
NM_015569chr144668 1929 618 491 34706 4328 402 24598 2952 --
NM_015570chr731830 1762 696 --1119 --
NM_015575chr272994 2807 2325 2258 855 650 397 1805 ----
NM_015576chr312258 ----12261
NM_015577chr551637 1321 369 150 123 1552 --1130
NM_015589chr141114 ------
NM_015605chr101458 1257 --1619
NM_015609chr192650 2575 2489 2317 1922 1903 1051 866 465 42505 2172 1086 482 22447 188 2873 198
NM_015610chr7122619 2315 2020 2000 1084 1006 893 784 679 630 597 539 3923 571 340 22282 1089 --
NM_015626chr1711157 ------
NM_015627chr171620 1376 679 520 452 422 403 --31381 692 379 11179
NM_015630chr2----11132 --
NM_015634chr102403 51 1421 1447 --
NM_015635chr951899 1831 877 339 191 ------
NM_015638chr20----4669 578 471 236 --
NM_015642chr31310 1217 ----
NM_015645chr112313 297 ------
NM_015646chr121110 1178 ----
NM_015649chr192375 120 ------
NM_015652chr103484 458 96 --1182 --
NM_015670chr171107 197 180 160
NM_015678chr1311457 ------
NM_015680chr24591 573 548 539 1609 ----
NM_015686chrX32221 2088 1990 --32381 1763 402 11923
NM_015689chr7271 26 ------
NM_015691chrX12846 11974 ----
NM_015704chr22--1129 ----
NM_015711chr193695 683 651 1270 2148 22 --
NM_015716chr173246 183 63 1202 4694 608 516 81 1253
NM_015719chr192737 523 --1148 1155
NM_015726chr171868 1687 1394 1365 645 573 453 11704 164 1579
NM_015831chr72378 340 --1104 1169
NM_015833chr2142301 1786 325 250 --1932 21587 1520
NM_015834chr212912 397 ----2198 131
NM_015844chr181394 --1211 --
NM_015846chr181394 --1211 --
NM_015847chr181394 --1211 --
NM_015850chr842443 2264 1797 340 --31732 135 98 --
NM_015866chr131410 1030 465 ------
NM_015872chr161460 1452 1387 1184 1107 435 --61774 1707 1393 1334 451 130 21726 1161
NM_015874chr42567 486 ------
NM_015878chr811777 ------
NM_015879chr18138269 7970 7425 6650 6258 6234 6216 5627 5217 3305 2717 2466 1425 47032 3081 1489 1222 22810 502 28278 2343
NM_015888chr133250 516 73 ------
NM_015889chr223246 112 83 ------
NM_015892chr1072470 2195 2161 2147 2112 438 351 --11676 --
NM_015897chr19124 ------
NM_015904chr21693 --3284 251 240 --
NM_015906chr174273 3644 3260 1867 1471 882 745 21157 762 ----
NM_015912chr852096 1939 1686 942 717 22531 1750 ----
NM_015913chr16588 566 510 270 221 213 2574 546 1659 --
NM_015941chr8--1123 ----
NM_015948chr6--163 ----
NM_015949chr721006 304 ------
NM_015955chr22502 131 --1159 --
NM_015975chrX3549 524 277 11198 11229 --
NM_015981chr582564 2520 1210 1190 637 549 427 245 32036 1224 871 32499 584 464 --
NM_015982chr173425 345 97 ----1100
NM_015984chr11160 1386 --1222
NM_015986chr171288 1301 ----
NM_015987chr121117 182 153 --
NM_015994chr14--1662 ----
NM_015995chr1595379 5241 4755 1712 1275 1242 814 495 247 --74046 3447 1497 1492 1348 293 56 15216
NM_015999chr1--2174 36 ----
NM_016002chr1151 ------
NM_016003chr7122619 2315 2020 2000 1084 1006 893 784 679 630 597 539 3923 571 340 22282 1089 --
NM_016006chr32192 176 ------
NM_016009chr174726 4254 3810 3318 1935 136 84 --13113 --
NM_016018chr842858 2674 2418 2031 1466 ----
NM_016019chr71384 2336 37 ----
NM_016021chr682995 2164 2073 1904 765 711 463 299 --11894 --
NM_016022chr11771 --2319 104 --
NM_016026chr143565 282 117 ------
NM_016032chrX51184 1167 1058 559 299 ------
NM_016037chr13867 320 171 ----11117
NM_016039chr14--124 ----
NM_016040chr142577 1716 734 86 ------
NM_016041chr171310 ------
NM_016057chr1231121 1056 523 --21151 1103 1171
NM_016059chr61183 2723 359 ----
NM_016061chr241543 1107 553 142 129 ----
NM_016071chr7131 297 71 ----
NM_016072chr1222325 2196 12183 ----
NM_016076chr153017 2260 2227 878 600 22792 2444 ----
NM_016079chr232063 1700 1675 11862 1661 2776 666
NM_016083chr633342 2792 1217 ------
NM_016090chr111185 ------
NM_016096chr821406 429 2677 358 ----
NM_016107chr531049 455 275 1238 ----
NM_016120chrX2491 148 1350 ----
NM_016131chr251975 946 793 758 742 ------
NM_016132chr1521268 350 13336 1879 --
NM_016133chr231548 1343 109 ------
NM_016139chr71276 ------
NM_016147chr114944 872 453 207 2360 323 2240 234 11083
NM_016151chr161348 --2364 106 --
NM_016152chr32995 383 --1955 --
NM_016156chr1162216 1970 1777 1757 1742 460 --22268 2250 --
NM_016169chr1093262 3249 3012 2811 2791 2471 1248 1179 498 2731 417 42643 2637 2477 2331 --
NM_016170chr2----2571 197 --
NM_016192chr2------1252
NM_016194chr1561638 1575 1326 1289 1263 556 11388 21549 419 --
NM_016201chr342304 2002 656 511 22175 724 22160 104 1587
NM_016203chr71127 ------
NM_016205chr431185 1038 116 ------
NM_016206chr3138635 8583 8109 7275 7267 7211 5673 2176 2081 1914 1506 612 150 48419 8053 6926 2235 13359 17247
NM_016211chr41381 ------
NM_016217chr643042 392 380 95 1840 ----
NM_016223chr11157 ------
NM_016226chr125479 376 354 160 131 ------
NM_016227chr131369 1268 323 1204 --1356
NM_016231chr1711223 2573 44 ----
NM_016233chr14875 418 207 151 ----1286
NM_016235chr1611358 --11042 --
NM_016240chr821333 520 1649 21535 1519 11492
NM_016248chr13103999 3581 3225 1404 1284 1245 1084 634 624 552 23295 3249 1486 --
NM_016252chr21639 1946 ----
NM_016255chr632789 971 429 32294 1091 918 ----
NM_016256chr16145 --1419 --
NM_016257chr1113171 2441 2411 2331 1368 1022 678 501 466 448 437 21405 1391 23256 141 13064
NM_016258chr11773 1796 ----
NM_016260chr2106588 6308 5971 5935 5641 5072 2461 1371 1143 564 37588 2554 2354 25558 80 --
NM_016262chr6155 ------
NM_016272chr2281944 1907 1860 883 787 680 574 310 31825 1793 110 42432 771 527 361 12459
NM_016279chr5176 ------
NM_016281chr121880 --2983 184 1990
NM_016284chr16289 80 ----1100
NM_016287chr1102062 2047 1928 1801 1717 1651 1613 1605 323 233 11619 ----
NM_016298chr342868 91 43 30 12036 12679 22685 2518
NM_016308chr131769 367 289 ------
NM_016315chr221452 222 1356 ----
NM_016316chr21531 ------
NM_016319chr12178 --1155 --
NM_016322chr983136 2927 2639 796 579 378 241 35 1384 --12803
NM_016333chr162194 60 --1139 --
NM_016338chr52970 31 --1975 1855
NM_016339chr1791635 1550 1248 574 407 381 340 307 108 11614 41622 1269 257 93 --
NM_016353chr832007 1912 270 170 --11915
NM_016357chr123917 827 141 ------
NM_016376chr1753261 3065 369 323 104 23204 2688 14220 13375
NM_016395chr1541253 133 126 65 ------
NM_016396chr1512488 22984 2518 12062 12172
NM_016406chr12358 93 ------
NM_016410chr91101 170 ----
NM_016418chr22113742 3236 2665 2514 2425 1324 1315 844 313 96 46 52382 2335 1076 979 572 43533 1039 876 188 --
NM_016422chr1162819 2773 2430 674 173 107 22388 165 --1731
NM_016424chr1721521 725 ------
NM_016436chr2042015 1943 783 418 1814 1933 --
NM_016441chr21692 ------
NM_016453chr31248 --122 --
NM_016454chr152332 55 ------
NM_016456chr14599 328 103 80 --2136 87 --
NM_016472chr141480 --1938 --
NM_016484chrX1555 --2601 442 --
NM_016486chr12183 140 ------
NM_016506chr112524 40 --1130 --
NM_016507chr1783096 2270 2044 1167 754 596 552 48 12197 2683 35 --
NM_016513chr653736 3240 2531 2417 511 130 22541 52 13485
NM_016519chr42167 93 144 ----
NM_016522chr1131540 1091 423 31474 1286 241 ----
NM_016525chr93795 604 223 ----2713 262
NM_016530chr1553858 1504 1324 719 53 --31023 313 45 1747
NM_016531chr431117 519 259 --13628 --
NM_016532chr17--11043 --160
NM_016536chr191338 ------
NM_016544chr283798 3771 2837 1166 1159 1150 1131 354 23558 3518 31173 717 51 188
NM_016545chr12626 337 --2300 69 --
NM_016557chr3--1945 151 --
NM_016559chr3--21398 277 21464 1447 --
NM_016569chr1231536 1129 1107 11235 1103 --
NM_016574chr1151118 932 908 893 734 135 4937 917 321 311 1761
NM_016577chr344367 3285 3016 1281 74033 1596 1355 597 71 56 25 64380 971 709 703 436 401 --
NM_016587chr72779 218 ------
NM_016588chr61728 ------
NM_016596chr1221023 692 --1781 1438
NM_016603chr531911 542 305 1571 ----
NM_016604chr52326 286 11071 ----
NM_016605chr562059 1898 1876 950 932 141 22765 2172 --1234
NM_016607chrX31482 298 85 1661 ----
NM_016614chr62774 57 ------
NM_016620chr121439 973 ------
NM_016621chr1193868 3767 3603 3478 3127 2878 655 456 177 21642 1294 94322 4291 3483 3153 3137 1688 1533 722 718 --
NM_016623chr83211 130 116 ------
NM_016626chr181430 21170 83 ----
NM_016628chr103639 590 570 ------
NM_016645chr153342 326 167 ------
NM_016652chr2031811 1509 1282 21633 383 ----
NM_016656chrX2305 111 ------
NM_016818chr214849 320 197 183 ------
NM_016819chr34517 366 137 38 --1348 --
NM_016824chr1031364 1314 629 --1297 --
NM_016834chr1763220 3045 3004 907 865 314 1210 33686 1531 1507 33549 1251 1126
NM_016835chr1763220 3045 3004 907 865 314 1210 33686 1531 1507 33549 1251 1126
NM_016841chr1763220 3045 3004 907 865 314 1210 33686 1531 1507 33549 1251 1126
NM_016848chr91108 ------
NM_016929chr674320 4108 3991 3276 1518 431 229 33357 3344 1065 21454 979 31845 1616 338
NM_016936chr1652067 1762 410 139 87 11499 31802 1798 1490 --
NM_016940chr211446 157 ----
NM_016946chr152934 2578 496 401 289 32790 1269 528 41385 1312 948 194 --
NM_016950chr42301 79 11379 ----
NM_016952chr1173574 3181 2885 823 740 276 196 24021 2730 24040 208 13000
NM_016953chr285938 5070 4430 3793 3755 1636 422 230 36025 5376 4162 --15943
NM_017409chr122784 143 --237 27 --
NM_017410chr1231107 872 465 1504 1420 21114 925
NM_017412chr8--1431 11401 --
NM_017413chrX122531 1809 1010 967 853 678 646 395 281 228 156 72 1142 62164 2047 1821 1814 356 352 --
NM_017415chr543134 2955 1809 406 54564 1731 1330 953 677 21285 1227 --
NM_017420chr1433112 2787 2459 180 ----
NM_017423chr421579 831 --1493 --
NM_017425chr11276 57 ------
NM_017432chr191440 ------
NM_017437chr1452373 2339 2318 969 36 1552 ----
NM_017447chr2123981 3712 33146 585 217 13833 --
NM_017450chr1721309 498 21070 987 21444 50 --
NM_017452chr202564 338 1481 --1373
NM_017453chr202564 338 1481 --1373
NM_017454chr202564 338 1481 --1373
NM_017455chr15193 ------
NM_017456chr172518 53 --1230 --
NM_017459chr1179 ----1281
NM_017481chr11--148 ----
NM_017483chr251232 958 478 401 268 21223 425 3969 56 51 --
NM_017488chr241567 1293 603 251 11558 41304 391 386 298 --
NM_017491chr4----2858 775 --
NM_017510chr5--1678 ----
NM_017519chr6------1312
NM_017522chr111235 ------
NM_017525chr111224 ------
NM_017548chr341902 1758 591 24 11916 ----
NM_017550chr195842 824 338 120 75 1861 21009 87 --
NM_017551chr1021835 325 12560 ----
NM_017553chr1531285 396 23 ------
NM_017558chr161402 1408 ----
NM_017575chr1771592 1220 1036 644 428 299 127 --31182 630 341 --
NM_017577chr321163 193 ------
NM_017580chr1072357 2039 1961 906 693 406 252 --11496 --
NM_017582chr1----21504 21 --
NM_017590chr2282680 2651 2385 2260 1782 1643 603 148 12107 41637 540 390 230 --
NM_017596chr1133454 3214 1791 1283 984 960 892 832 121 115 54 47 38 24085 1564 74241 4203 1490 1298 132 126 64 1727
NM_017602chrX5139 124 97 82 70 ------
NM_017610chr1531865 747 647 --147 --
NM_017617chr92565 30 --1457 136
NM_017622chr173537 501 122 1262 ----
NM_017626chr1061427 1412 1357 1096 588 227 --1364 --
NM_017629chr131380 1259 759 11521 11296 11764
NM_017633chr633314 834 203 13047 1208 13173
NM_017635chr112476 205 1287 ----
NM_017637chr9188895 8737 8706 8462 7716 7213 7096 6604 5959 5746 3541 3157 3016 1573 1509 1145 369 210 39211 6088 2158 27108 6287 16182
NM_017640chr64593 231 95 24 183 2598 575 --
NM_017643chr1753026 2752 1184 849 798 11897 ----
NM_017644chr344836 4583 1101 132 14019 24889 174 11048
NM_017649chr1021040 948 --2496 467 21002 144
NM_017650chr775897 5005 4464 1518 861 261 55 44747 4091 1409 1013 13866 11136
NM_017657chr21300 --152 --
NM_017658chr1463947 3131 2881 1753 564 261 13060 1361 --
NM_017660chr1973073 2374 2330 2293 760 443 250 --21230 235 22904 477
NM_017661chr152845 337 ------
NM_017664chr13--1668 140 --
NM_017666chrX22030 1764 2687 526 --1607
NM_017668chr163105 97 82 --2699 47 --
NM_017672chr152865 66 ------
NM_017679chr174553 546 464 95 --3559 168 113 --
NM_017686chr14810 769 364 45 ------
NM_017693chr131215 ------
NM_017697chr83550 472 447 ------
NM_017709chr173569 3017 1579 1313 1092 455 73 43370 967 908 255 33530 1586 1096 --
NM_017714chr201258 1939 ----
NM_017715chr72274 184 1246 1481 1663
NM_017719chr342500 693 378 33 --1821 2192 126
NM_017721chr191333 ------
NM_017724chr31280 ------
NM_017728chr1762810 1142 687 292 221 166 13077 12017 --
NM_017730chr31120 ------
NM_017737chr12615 346 11564 ----
NM_017738chr941046 896 865 267 --1936 --
NM_017739chr11205 --2524 62 --
NM_017740chr1631408 1344 1179 ------
NM_017742chr181439 1405 11865 --
NM_017744chr13742 244 217 --12209 --
NM_017749chr114929 704 356 204 ------
NM_017753chr9142 11020 ----
NM_017754chr6134737 4666 4472 4391 4318 4279 3233 1163 1144 1138 1027 642 351 3437 298 153 33968 1463 719 31313 921 865
NM_017758chr1721001 539 21475 498 4962 957 951 430 --
NM_017761chr111560 ------
NM_017776chrX21145 618 ------
NM_017778chr831291 1191 501 ----11220
NM_017779chr152575 2001 1806 780 729 22609 2561 12725 --
NM_017784chr311152 125 ----
NM_017787chr103645 266 189 12678 32454 2317 133 1821
NM_017789chr23777 694 215 ------
NM_017790chr92253 45 ------
NM_017791chr1421187 598 11691 1311 --
NM_017798chr2021187 121 ------
NM_017799chr1411828 ------
NM_017801chr332245 1029 949 --12204 --
NM_017811chr9133160 3079 2773 2705 2505 2499 2293 2138 1170 1135 798 564 233 1748 32778 2714 569 1969
NM_017813chr8125412 5255 5068 4904 3626 2028 1122 1013 944 769 735 149 11433 25724 5348 --
NM_017816chr4145 ------
NM_017822chr12--2282 178 ----
NM_017848chrX84188 4176 3804 3671 1812 1244 505 146 34163 1269 1132 1152 14455
NM_017849chr273095 2871 879 537 320 117 22 12653 102045 2029 979 947 935 472 468 215 128 79 --
NM_017873chr942079 792 450 190 12656 32946 1964 210 --
NM_017893chr1041481 1027 346 29 --2537 114 --
NM_017895chr201182 --149 --
NM_017902chr10124774 4720 4473 4401 4383 4337 4207 4059 4018 1207 823 378 54414 4155 4001 3981 3830 44550 1573 634 226 25451 1828
NM_017906chr62102 77 ------
NM_017907chr11128 ----1326
NM_017910chr22323 273 ------
NM_017911chr2231240 1103 41 ----11182
NM_017915chr121299 1395 ----
NM_017919chr9165170 5020 4845 4044 3901 2100 2078 2050 1822 1559 1171 1142 1088 614 582 347 --13923 1855
NM_017921chr1741838 1691 1679 483 1158 41711 729 362 48 --
NM_017922chr141110 ------
NM_017933chr2--1270 --11329
NM_017934chr6180 ------
NM_017938chrX--1447 3557 553 412 --
NM_017943chr14--1814 ----
NM_017944chr1163021 2995 2078 627 269 23 ------
NM_017954chr741715 1706 1570 1488 11198 ----
NM_017955chr1421165 1107 ----1859
NM_017974chr251161 1056 920 389 279 11182 --11127
NM_017987chr101479 1713 2792 170 --
NM_017994chr742857 2748 2729 805 12535 12874 --
NM_017998chr91884 11376 ----
NM_018003chr1532416 2105 401 ------
NM_018008chr31259 --226 22 --
NM_018010chr311567 21623 433 31571 1128 1123 --
NM_018013chr693025 2942 2735 2702 2255 2110 995 252 133 32611 2177 785 1230 13031
NM_018014chr231319 289 146 ------
NM_018026chr1151073 1020 328 264 218 1531 91091 1005 350 305 224 209 164 99 25 21350 1268
NM_018027chr1041280 1055 867 365 --22250 2044 --
NM_018028chr193988 522 72 --51025 911 891 280 275 11235
NM_018030chr18172 ------
NM_018032chr16--1623 146 --
NM_018037chr13479 261 51 --1266 --
NM_018043chr1151351 1047 537 153 76 1522 1173 --
NM_018045chr192714 2645 2630 2491 2453 2057 792 340 30 --22340 2336 12375
NM_018048chr1221810 784 1775 12058 --
NM_018054chr161143 ------
NM_018061chr121186 61 ------
NM_018062chr22417 405 ------
NM_018063chr103317 310 54 ------
NM_018064chr6194 ------
NM_018067chr11422 --1227 --
NM_018070chr12528 158 ----1161
NM_018071chr144262 117 106 35 --3764 602 194 1274
NM_018079chr24499 430 191 138 1583 ----
NM_018084chr222613 2328 2690 681 ----
NM_018085chr1117866 7721 7043 6876 6429 5583 2452 952 692 552 31 37414 6534 89 35373 819 626 1531
NM_018086chr241813 1683 1506 1327 21747 1365 --183
NM_018092chr1631328 1224 414 ------
NM_018095chr112524 40 --1130 --
NM_018103chr1--144 ----
NM_018107chr145811 728 721 284 64 11036 1748 3890 712 295
NM_018110chr1611136 2523 487 1298 1931
NM_018111chr19--184 ----
NM_018119chr161226 ------
NM_018120chr811470 ------
NM_018121chr1073126 2428 2211 2190 448 218 54 ------
NM_018128chr172985 358 ------
NM_018133chr321948 1463 21993 1732 ----
NM_018149chr17--194 ----
NM_018150chr12810 611 --1903 1813
NM_018155chr363163 2695 2317 732 459 174 13186 ----
NM_018156chr173018 2989 2710 2673 2146 1956 1946 12315 12764 --
NM_018157chr1253037 2925 2873 2503 373 13274 33168 2497 348 --
NM_018159chrX31380 413 126 --1149 --
NM_018172chr1141381 1337 1091 201 ----11356
NM_018178chr14801 558 152 28 ----12038
NM_018182chr1772041 1926 1770 1724 746 319 311 1452 31685 796 420 2699 537
NM_018184chr331852 761 29 12001 --193
NM_018191chr132834 231 11849 ----
NM_018195chr1141953 612 553 483 --21781 1776 --
NM_018198chr121403 592 2477 242 41497 1268 980 967 --
NM_018200chr1581938 1912 1819 1789 1034 716 562 454 22339 199 21943 721 12182
NM_018206chr163520 88 68 1112 1483 130
NM_018208chr141103 902 470 293 1957 21130 437 --
NM_018211chr121835 629 1116 22152 408 11842
NM_018214chr64331 116 66 35 ------
NM_018222chr1131747 1179 269 --2536 248 --
NM_018225chr965345 4675 4501 940 737 166 21872 1524 45356 5351 3408 932 21847 956
NM_018227chr421231 769 12709 11245 13084
NM_018234chr272309 2079 1613 686 530 433 419 --1801 41936 857 848 755
NM_018240chr14861 697 325 110 --3702 209 97 --
NM_018243chr483366 1613 1365 1343 1327 1114 1098 961 23266 356 23371 114 --
NM_018244chr2041148 1051 494 477 1312 --1897
NM_018247chr662149 1912 742 675 427 151 ------
NM_018254chr12551 216 ------
NM_018286chr173869 813 146 ------
NM_018287chr101334 1362 ----
NM_018293chr342857 2675 473 86 12193 ----
NM_018299chr863151 2821 2782 895 327 124 13421 ----
NM_018307chr172695 665 ------
NM_018313chr322037 1887 ----22470 1990
NM_018314chr111659 ------
NM_018315chr421430 312 --157 --
NM_018319chr1431500 240 85 1121 ----
NM_018320chr113949 862 409 ----1344
NM_018325chr911317 ----11387
NM_018327chr2041887 1857 316 214 11639 2435 92 --
NM_018351chr12144434 4336 4232 4113 4045 3922 3681 3314 2868 1843 1704 1631 1066 725 23469 3372 34522 4177 4074 44324 3981 3792 3686
NM_018362chr112878 860 12505 ----
NM_018364chr163655 3464 2818 2628 784 329 1822 23240 3069 --
NM_018367chr1151572 702 371 332 216 ------
NM_018371chr83642 549 39 ------
NM_018374chr794517 2055 1927 1767 1694 1620 1525 1407 272 --21412 236 --
NM_018375chr1431834 1262 79 ------
NM_018381chr192776 607 --2678 325 1714
NM_018383chr221906 719 ------
NM_018387chr91129 ------
NM_018388chrX31274 1252 56 133 ----
NM_018398chr31285 ------
NM_018400chr11124388 4260 3927 3661 3025 2997 2930 1641 1453 967 821 110 53444 3383 3232 2909 1599 23994 3145 13935
NM_018403chr321552 399 11573 21057 911 --
NM_018409chr463092 2931 2396 947 722 296 12341 12184 --
NM_018416chr12132494 2290 2227 2031 1957 1778 1032 1014 566 387 197 191 176 41988 1867 965 952 41947 1663 202 85 --
NM_018419chr202438 36 ------
NM_018423chr121124 ----182
NM_018424chr981841 1707 617 598 449 428 401 22 ----1497
NM_018426chr6----1100 --
NM_018427chr1621287 494 --11038 --
NM_018433chr2--1219 ----
NM_018439chr1872367 2175 2039 1050 799 739 504 22578 948 ----
NM_018440chr8138456 8204 7131 6675 5619 5606 5470 2452 768 673 442 405 396 35658 1562 964 17154 --
NM_018442chr12261 117 ------
NM_018444chr832146 1516 387 ------
NM_018448chr1231250 1083 151 ------
NM_018452chr6_random52425 1362 910 411 243 21072 196 --13728
NM_018462chr32602 349 --184 --
NM_018471chr22572 160 172 ----
NM_018482chr832338 2065 1732 ------
NM_018489chr141499 1470 536 218 2503 374 ----
NM_018490chr11125 ------
NM_018509chr1761515 1450 687 670 603 380 ------
NM_018553chr1761843 1211 1168 591 488 225 2412 368 11698 1228
NM_018566chr174327 3294 3279 1951 1370 993 791 11288 12053 13444
NM_018569chr431283 1094 200 ------
NM_018571chr21602 --1474 --
NM_018584chr121146 834 --21156 1151 --
NM_018593chr62573 511 --161 --
NM_018638chr1275367 4066 3543 3463 2253 2211 1939 ------
NM_018640chr1212234 --12558 12663
NM_018644chr1171846 1669 1395 722 538 115 48 --1735 --
NM_018646chr7124 ----1362
NM_018649chr10--1210 ----
NM_018650chr11356 ------
NM_018652chr152869 644 --1256 --
NM_018660chr8103021 2375 2295 1027 999 787 591 396 359 210 31920 1903 294 42237 2008 868 530 12449
NM_018683chr2041631 302 261 202 11675 31521 417 170 --
NM_018684chrX2955 400 --31231 1058 231 11109
NM_018685chr711028 ------
NM_018686chr122328 40 ------
NM_018688chr83853 297 144 --1757 163
NM_018695chr511507 21684 542 ----
NM_018700chr52313 182 21492 213 ----
NM_018710chr8--11003 1881 --
NM_018711chr12--11502 ----
NM_018712chr1121463 953 ------
NM_018713chr1--1438 1976 1192
NM_018715chr192161 2007 1754 1737 1455 893 598 318 208 22034 191 1520 1353
NM_018717chr432094 944 728 ------
NM_018718chr771961 1927 1683 1517 440 132 36 164 11801 --
NM_018840chr201335 ------
NM_018841chr141517 1042 597 164 33360 1567 33 33470 1082 1027 13086
NM_018847chr941910 1441 704 51 ------
NM_018890chr751192 1101 981 324 256 11068 ----
NM_018896chr17129 ------
NM_018898chr52879 258 22288 286 ----
NM_018899chr52879 258 22288 286 ----
NM_018900chr52879 258 22288 286 ----
NM_018901chr52879 258 22288 286 ----
NM_018902chr52879 258 22288 286 ----
NM_018903chr52879 258 22288 286 ----
NM_018904chr52879 258 22288 286 ----
NM_018905chr52879 258 22288 286 ----
NM_018906chr52879 258 22288 286 ----
NM_018907chr52879 258 22288 286 ----
NM_018908chr52879 258 22288 286 ----
NM_018909chr52879 258 22288 286 ----
NM_018910chr52879 258 22288 286 ----
NM_018911chr52879 258 22288 286 --</