TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4753-3p
miRNA Sequence: UUCUCUUUCUUUAGCCUUGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr11155 21385 174 --31675 633 460
NM_000109chrX178 11683 1726 31667 976 144
NM_000192chr1221460 1044 290 56 975 71 63 61 50 48 46 44 42 21417 66
NM_000217chr1274826 4076 3495 3292 1831 1315 839 --44751 3573 242 240 34151 3415 1344
NM_000259chr1565244 4952 4201 1887 1350 271 54794 4533 423 289 255 34349 1306 1304 21960 96
NM_000332chr6106561 5609 2341 1939 1788 1287 919 843 704 160 76875 6786 6724 2505 1471 1453 340 45775 4713 1459 1322 14456
NM_000337chr586142 6103 5329 5109 5000 4005 1961 1565 55721 4455 1746 1727 848 22397 1389 25151 1434
NM_000368chr9144798 4600 4176 4141 3605 3549 3098 1925 1580 1386 1257 1086 1005 819 24161 3044 24440 1454 21860 1511
NM_000376chr1252409 1076 821 609 600 32965 955 349 32752 2487 1110 33076 2881 2478
NM_000555chrX77792 7537 6555 2239 763 675 212 67383 6396 5992 2881 1132 636 36759 6538 6294 --
NM_000599chr2114466 3726 3692 3345 3261 2965 1646 1596 1494 719 320 53749 1537 294 269 108 21715 323 34011 3704 326
NM_000610chr1182745 2240 2061 1167 859 763 650 535 11133 42590 2126 1156 781 --
NM_000618chr1286235 4244 1702 1323 1124 933 757 25 11072 55722 5007 4364 1684 1651 45010 4130 1673 1654
NM_000618chr1286235 4244 1702 1323 1124 933 757 25 11072 55722 5007 4364 1684 1651 45010 4130 1673 1654
NM_000719chr12176389 5813 5455 5437 5313 4936 4805 4516 4128 2696 2121 1965 1157 1140 950 812 440 75843 5724 5691 5572 4896 2431 1490 36612 5734 2571 25698 1789
NM_000793chr1485077 4876 4819 1817 828 764 672 390 33670 1347 900 14105 24952 713
NM_000809chr498946 8757 7575 2984 2630 1934 1348 1331 1228 1264 27874 2274 --
NM_000813chr584787 4386 1329 1312 1237 1212 869 652 21609 1129 2916 871 13819
NM_000831chr1155690 4993 4774 4718 4675 4201 3951 3828 2414 1731 1668 1133 1079 1036 785 32156 650 645 157 45191 2316 1511 625
NM_000861chr352144 2099 2019 944 394 12214 62544 2247 292 290 288 192 2766 295
NM_000899chr1263594 3357 1655 1517 726 681 2912 302 2902 471 12881
NM_001001344chrX72083 2012 1605 320 291 263 243 41010 994 272 251 11615 2917 300
NM_001001389chr1182745 2240 2061 1167 859 763 650 535 11133 42590 2126 1156 781 --
NM_001001390chr1182745 2240 2061 1167 859 763 650 535 11133 42590 2126 1156 781 --
NM_001001391chr1182745 2240 2061 1167 859 763 650 535 11133 42590 2126 1156 781 --
NM_001001392chr1182791 2286 2107 1213 905 809 696 581 11179 42636 2172 1202 827 --
NM_001001433chr2062960 2497 2401 2247 2078 1965 22524 2261 1743 22783 291
NM_001001484chr1041925 1617 1569 1548 1474 21805 1658 21972 820
NM_001001557chr891734 1576 1466 1370 636 626 382 252 79 21796 154 11427 21890 442
NM_001001665chr263310 2994 2917 568 552 454 42890 2754 2557 1211 23163 3057 --
NM_001001709chr962473 851 528 343 323 234 11797 2633 300 12201
NM_001003652chr1877854 7602 6720 3129 2426 1416 105 1223 11884 47037 2039 217 108
NM_001003698chr62740 100 11519 18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102 --
NM_001003699chr62740 100 11519 18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102 --
NM_001003712chr1274088 3577 2870 1517 1079 586 120 --33381 989 588 11375
NM_001004065chr972690 1553 1140 1132 679 535 377 53189 2678 2662 2576 687 43194 1439 1099 1089 31110 1092 211
NM_001005404chr177878 863 783 386 378 351 73 43269 1398 1270 990 54110 4013 3794 3090 3072 21404 512
NM_001005473chr5135950 4953 4548 2185 1780 1072 1052 1032 1013 972 960 948 135 31915 665 108 66479 6477 6071 5818 1886 729 11205
NM_001005502chr1284615 4161 4105 4007 3246 891 832 786 53774 1475 842 593 130 ----
NM_001007023chr1485077 4876 4819 1817 828 764 672 390 33670 1347 900 14105 24952 713
NM_001007466chr6155063 4694 4301 4106 3330 1373 950 733 628 340 237 141 129 116 98 --23171 120 --
NM_001008408chr7106157 5816 5234 4387 1911 1486 1392 1185 433 59 24207 1317 21913 1401 14848
NM_001008539chr895035 4907 4674 3749 3409 3304 1169 912 804 33278 2007 1182 43306 1155 555 405 --
NM_001009899chr385308 5042 4742 4365 2536 2364 1987 1805 26100 86 15961 14117
NM_001009993chr244240 3955 1361 612 --43958 3454 826 255 21108 908
NM_001010846chr154286 4117 3293 1485 131 21790 725 24120 3296 24233 4154
NM_001010888chrX124064 3902 3393 2912 1871 1742 1684 1476 1421 1366 1143 773 13789 13051 23537 1146
NM_001010986chrX72005 1859 1753 1739 1610 966 958 1854 1902 12111
NM_001011513chr483861 3494 2724 1583 1344 1210 906 701 33889 40 25 51449 1447 1445 1443 181 21452 1125
NM_001011666chr796540 6381 6101 5899 5451 5082 942 833 32 25944 4576 21219 183 76373 4924 4381 2488 2212 1946 1222
NM_001012393chr1173166 1913 1679 1452 1233 1171 706 44363 4358 4038 1418 44749 4556 4273 3514 23696 747
NM_001013659chr1995434 4991 4026 3905 3433 3289 1997 1965 882 34426 3712 364 11743 45204 3948 1828 1502
NM_001014797chr10208193 8109 8018 7341 6916 6876 6845 6686 6117 6065 6011 5911 5542 5532 5416 5076 5048 2867 2491 141 46664 6550 564 527 16934 23298 811
NM_001017440chr7268229 7311 7299 7152 7037 6985 6818 6721 6447 6221 6123 5797 5445 2955 2439 2377 2136 1898 1137 726 479 453 419 358 350 200 66951 5453 5101 3186 2566 1291 76906 5447 5301 2596 2594 2405 360 11108
NM_001017535chr1252409 1076 821 609 600 32965 955 349 32752 2487 1110 33076 2881 2478
NM_001018065chr9125876 5593 4681 4630 4406 4127 4082 4008 3770 3746 1248 50 177 21746 1020 25151 1976
NM_001018066chr9125876 5593 4681 4630 4406 4127 4082 4008 3770 3746 1248 50 177 21746 1020 25151 1976
NM_001024455chrX52713 938 851 208 172 62507 903 894 879 586 448 22544 1084 11778
NM_001024647chr12137220 7113 6658 6426 5883 5609 4716 2533 1677 1338 743 733 89 35841 5549 5324 1854 21663 902
NM_001025077chr1066469 5814 1254 940 506 117 56803 5943 5462 2116 523 1119 22988 319
NM_001025233chr1252763 2549 2319 2081 212 --52193 349 224 216 214 12055
NM_001030007chr16113701 3571 3364 3269 3198 2614 1020 693 382 331 58 2962 117 1561 23367 2773
NM_001030288chr1685164 3363 2173 2128 2091 2079 1812 1176 34857 1789 745 24962 4658 21969 1954
NM_001031695chr22115403 4822 4727 3505 1909 1652 1437 1397 454 344 332 64313 3541 3488 1013 579 101 65460 4445 3665 1667 1000 352 15463
NM_001031804chr1633675 1760 1558 23974 3709 1957 22720 1378
NM_001034841chr1675359 4941 1322 1315 1299 1196 239 11107 23354 1073 21784 742
NM_001037165chr7208754 8679 8196 8183 7629 7520 7457 6655 6276 3234 2835 2820 2738 2622 2510 2006 1649 1089 724 523 22098 95 66280 6278 2680 2612 1336 637 --
NM_001037290chr116989 825 299 109 103 93 ------
NM_001039395chr952346 2077 1884 895 38 1597 2850 530 2261 28
NM_001039590chrX43346 2659 2573 2451 33860 2689 2527 --21545 1310
NM_001039591chrX43346 2659 2573 2451 33860 2689 2527 --21545 1310
NM_001039937chr1313534 43644 3459 3239 2745 13815 24103 3527
NM_001040001chr621564 292 41746 319 314 78 21697 1413 31368 1316 86
NM_001040152chr744285 3391 1772 781 --34493 3969 3945 44496 4227 4115 3257
NM_001040429chr1352962 2451 2352 2231 285 1296 43328 2594 272 258 2261 244
NM_001040712chr932426 1269 467 33141 280 214 --32561 1083 341
NM_001042599chr296964 5656 3013 2053 1697 1197 955 936 29 42425 2264 946 244 22558 823 1189
NM_001042601chr342402 2372 2230 1224 33091 1012 926 22578 1185 22567 2155
NM_001042604chr344838 3848 3048 1456 1498 24079 3217 34642 1887 1459
NM_001044385chr253992 3799 2981 2597 854 43966 1085 980 389 41525 1198 729 695 31407 540 217
NM_001044387chr1963457 1533 415 327 272 215 23708 3197 73957 3955 3953 3951 3949 3947 3945 1975
NM_001044388chr1963457 1533 415 327 272 215 23708 3197 73957 3955 3953 3951 3949 3947 3945 1975
NM_001100108chr1107729 7158 6561 6453 5483 2365 2053 2027 1328 195 45601 2169 2043 461 38310 2709 1580 27747 2826
NM_001106chr3158742 8365 7863 7494 6815 6297 6237 3921 3515 3358 2889 2725 2015 1827 294 78903 8220 6999 6068 3724 1073 471 ----
NM_001128chr16113701 3571 3364 3269 3198 2614 1020 693 382 331 58 2962 117 1561 23367 2773
NM_001204chr277631 6721 6115 5265 2268 849 722 77307 6679 5012 4719 3050 1690 655 27720 4760 26118 852
NM_001259chr786270 5002 4022 2433 1944 1928 708 453 34198 1916 265 35097 5082 2056 1684
NM_001364chr11134287 3745 3378 2976 1757 1749 1606 1539 1312 1277 277 180 34 11323 33747 1383 1315 21318 1074
NM_001419chr1931851 683 49 14021 11933 44590 3538 1499 1413
NM_001420chr1962696 2280 2021 876 571 90 11985 14923 92 74 72 70 68 66 64 62 54 52 50 48 46 3613 77 57
NM_001438chr142894 1452 1426 565 23261 1127 53590 668 666 568 550 3933 671 46
NM_001491chr632633 764 69 42518 2063 51 32 --21779 344
NM_001609chr1063460 3212 3181 2811 1670 196 21521 1239 33642 3337 1429 12891
NM_001650chr18153793 3149 2880 2707 2633 2624 2596 2535 1659 1636 1484 1183 518 457 165 --23078 787 22783 460
NM_001668chr192225 2216 1489 672 662 529 396 385 311 1402 21568 531 --
NM_001695chr864207 4062 3291 3109 1195 981 64112 4018 1720 1381 1227 514 --34026 995 271
NM_001759chr1295211 5068 4100 3444 1147 863 492 473 344 54493 3923 3683 220 154 41450 28 26 24 14337
NM_001830chrX53799 3254 2746 2481 402 11062 23527 753 23697 2552
NM_001874chr1284615 4161 4105 4007 3246 891 832 786 53774 1475 842 593 130 ----
NM_001918chr1157740 7575 7489 7435 7423 6021 5945 3612 3281 3225 3215 2143 1830 1185 42 87413 7379 3012 2546 1982 1812 1175 485 38726 7653 2789 1861
NM_001987chr1294216 3856 3226 3210 3191 2896 871 151 95 --1596 23469 475
NM_002025chrX148235 7756 6869 6448 6211 6100 3036 2918 2728 2648 1337 872 685 402 28540 2358 --26623 1996
NM_002137chr752379 680 557 170 43 21693 796 12138 22036 697
NM_002214chr7105606 3567 2257 1772 1558 892 526 356 290 86 14577 --22137 341
NM_002223chr1263536 3407 3249 2740 2652 794 33197 2486 1168 2692 297 22969 503
NM_002336chr1254732 3496 3086 1737 620 33973 1824 1526 --24650 386
NM_002359chr1784334 3595 3144 2699 2624 790 475 324 12637 2730 311 3869 733 327
NM_002515chr14------31908 1881 1467
NM_002522chr1753968 3242 1383 927 683 33621 3452 1392 33284 3110 1456 23744 3604
NM_002545chr1173166 1913 1679 1452 1233 1171 706 44363 4358 4038 1418 44749 4556 4273 3514 23696 747
NM_002547chrX143398 3279 3008 2615 2599 1637 1547 1318 382 315 254 162 104 56 33657 1533 470 21716 818 13761
NM_002577chr331151 1115 519 43837 3820 608 153 --31171 1080 708
NM_002581chr974689 4348 1367 1344 1288 1055 628 31690 1634 986 64531 4529 3563 1884 406 404 24185 3437
NM_002607chr7----8275 273 271 263 261 259 257 173 2278 266
NM_002698chr1982857 2838 2551 2160 2099 2074 415 358 11097 22483 2481 52842 1849 904 782 484
NM_002737chr17136571 6474 5976 4654 4554 4252 2563 2501 2493 2484 2134 711 447 --32467 2286 1319 14333
NM_002837chr1243962 1448 1311 406 14507 23036 420 24110 3973
NM_002839chr932426 1269 467 33141 280 214 --32561 1083 341
NM_002886chr3104648 4314 3347 3234 1361 1161 795 522 512 371 21781 379 --24402 3798
NM_002955chr62740 100 11519 18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102 --
NM_003030chr35748 634 565 489 285 2438 424 1287 21763 432
NM_003034chr1297785 6956 6270 5863 5839 5669 5176 123 67 67452 7260 6195 5422 5248 1606 46137 5788 5786 5054 27447 6140
NM_003043chr3104098 3695 1450 933 877 814 630 598 585 545 43972 3553 2685 1550 33107 670 633 11439
NM_003046chr895035 4907 4674 3749 3409 3304 1169 912 804 33278 2007 1182 43306 1155 555 405 --
NM_003099chr15115320 4971 4779 4740 4230 4201 4190 4161 1067 687 622 65187 4840 1994 1986 651 199 16139 14846
NM_003107chr6131956 1761 1706 949 702 621 503 440 356 259 167 88 41 21964 47 22063 1708 2106 99
NM_003108chr256447 6317 5043 2302 2090 55798 2233 1702 556 143 45916 5854 2240 595 26939 992
NM_003123chr1685164 3363 2173 2128 2091 2079 1812 1176 34857 1789 745 24962 4658 21969 1954
NM_003236chr2123468 3067 3005 2874 2841 2755 2510 1098 949 942 460 406 32847 1310 504 63218 3216 3214 3212 2176 254 22800 1163
NM_003326chr192703 2600 2462 2264 741 601 435 427 91 1419 1743 --
NM_003607chr194245 3906 3344 1154 1031 676 621 581 409 22746 720 51551 1519 711 709 623 --
NM_003644chr17116606 6552 6313 5513 5000 4611 2494 1406 1397 120 111 --36171 6107 5002 --
NM_003722chr341923 1696 255 138 11936 12535 21981 130
NM_003759chr474256 4073 3944 3243 2995 1349 1154 1125 22962 1140 14076
NM_003763chr2062960 2497 2401 2247 2078 1965 22524 2261 1743 22783 291
NM_003822chr132475 1188 1177 1768 141 22084 1040
NM_003916chrX31422 1022 187 --1220 2443 162
NM_003939chr10103584 3570 2629 1433 1262 1034 780 725 544 425 21276 916 53495 2604 2602 1435 1264 13574
NM_003966chr546279 1184 831 322 27749 5448 12078 66126 5735 5728 4979 3028 2104
NM_003994chr1263594 3357 1655 1517 726 681 2912 302 2902 471 12881
NM_004006chrX178 11683 1726 31667 976 144
NM_004007chrX178 11683 1726 31667 976 144
NM_004009chrX178 11683 1726 31667 976 144
NM_004010chrX178 11683 1726 31667 976 144
NM_004011chrX178 11683 1726 31667 976 144
NM_004012chrX178 11683 1726 31667 976 144
NM_004013chrX178 11683 1726 31667 976 144
NM_004014chrX178 11683 1726 31667 976 144
NM_004015chrX178 11683 1726 31667 976 144
NM_004016chrX--11597 1640 31581 890 58
NM_004017chrX178 11683 1726 31667 976 144
NM_004018chrX--11597 1640 31581 890 58
NM_004020chrX178 11683 1726 31667 976 144
NM_004021chrX--11597 1640 31581 890 58
NM_004022chrX--11597 1640 31581 890 58
NM_004023chrX--11597 1640 31581 890 58
NM_004028chr18153793 3149 2880 2707 2633 2624 2596 2535 1659 1636 1484 1183 518 457 165 --23078 787 22783 460
NM_004050chr1482516 2452 2184 2177 228 173 128 45 42410 2270 2090 716 22483 2159 2648 543
NM_004098chr102301 269 --181164 339 337 335 333 331 329 327 325 323 321 313 311 303 291 254 120 48 5342 316 306 286 280
NM_004136chr1583032 2993 2984 2931 2256 2082 563 238 ----22987 874
NM_004170chr941544 1195 744 255 1203 1586 31867 316 81
NM_004171chr1199173 6923 6730 5935 3335 1899 1740 777 445 13145 22276 600 --
NM_004232chr1853263 1533 1339 126 47 --32573 2571 2569 32576 1126 200
NM_004293chr943583 3102 2937 1163 32727 835 264 23331 2667 22842 518
NM_004349chr83838 366 138 --1248 2452 141
NM_004397chr11124093 3922 3787 3397 3164 3090 1211 1178 806 433 272 123 34155 299 158 23092 1287 1322
NM_004464chr453746 3362 3145 2739 1468 --23049 1067 23801 773
NM_004586chrX65022 4663 3503 1896 744 81 23298 1673 33531 2160 968 25005 1967
NM_004612chr944272 3876 3083 341 24674 1744 23829 3287 24175 1033
NM_004726chrX65403 5370 4686 4249 1314 1035 24112 758 15405 24604 4275
NM_004745chr8116891 6072 5915 5821 5294 4878 4703 4492 2815 1495 747 25470 1175 46234 6232 4775 1182 --
NM_004748chr1572793 2729 1342 1018 768 740 375 43315 938 906 91 1491 13186
NM_004796chr1421772 676 1650 32079 1998 678 31711 1551 968
NM_004798chr2073463 1411 1016 1008 955 911 76 62828 2452 1334 267 114 51 21413 1208 --
NM_004823chr1911212 --81546 1544 1542 1540 1538 1476 1474 1454 51549 1533 1501 1479 1457
NM_004845chrX53764 3699 3620 3308 183 23570 139 44194 2654 286 118 21235 788
NM_004904chr796540 6381 6101 5899 5451 5082 942 833 32 25944 4576 21219 183 76373 4924 4381 2488 2212 1946 1222
NM_004992chrX168538 8155 8040 7565 6323 6234 5736 5248 2594 2259 1470 1463 911 753 712 490 45612 2849 2579 920 25792 2984 --
NM_004992chrX168538 8155 8040 7565 6323 6234 5736 5248 2594 2259 1470 1463 911 753 712 490 45612 2849 2579 920 25792 2984 --
NM_004999chr6113751 3614 3346 3124 3010 2993 1793 1183 1159 624 590 14019 --33787 3329 325
NM_005065chr1465081 1688 1673 1272 667 105 24397 3836 34558 3980 584 14458
NM_005156chr965174 3919 2114 2043 1667 146 1304 13756 15217
NM_005188chr11108304 7999 7298 6680 6330 6323 6158 5603 3239 1241 37973 7395 1019 1245 11517
NM_005197chr1475806 4955 4106 3766 2307 1964 58 22473 1816 65954 2346 871 869 865 207 45970 2213 1285 874
NM_005219chr531549 1464 194 --71717 1715 1713 1711 1709 1707 1466 11291
NM_005222chr74333 102 89 80 --2313 311 4682 336 316 49
NM_005235chr296964 5656 3013 2053 1697 1197 955 936 29 42425 2264 946 244 22558 823 1189
NM_005257chr1841140 302 162 149 2182 170 2304 133 --
NM_005338chr773802 3174 961 934 688 306 273 33762 3633 3435 103744 3742 3740 3738 3736 3440 1451 1317 952 870 23747 403
NM_005399chr184311 3954 1548 1508 1484 1243 1202 1027 44223 3682 3051 35 24201 1074 13691
NM_005497chr1784063 2440 2366 2310 1380 1360 592 390 2547 169 1537 45413 2060 1187 175
NM_005578chr364219 3613 1174 1092 657 445 1476 44319 4317 3583 1371 14322
NM_005596chr996105 5891 5225 5131 4897 3933 2022 904 304 --24533 1202 1178
NM_005604chr641689 649 277 268 --72094 1987 313 305 303 301 299 21702 473
NM_005665chr164029 3599 3006 1765 1312 38 11679 --44804 4324 3300 3217
NM_005840chrX117644 7477 7366 6931 6747 5648 4776 4732 2020 1731 1234 47236 6998 6337 772 106390 6388 6386 6384 6382 6380 6366 6364 6342 5757 36535 6369 6030
NM_005901chr1877854 7602 6720 3129 2426 1416 105 1223 11884 47037 2039 217 108
NM_005902chr15144114 3751 3545 3478 3097 2871 1826 1790 1780 1561 1418 1209 1118 419 33804 1600 1176 34313 1260 794 --
NM_005909chr561260 595 437 376 347 339 53888 2664 493 417 185 11470 468 422 384 382 380 349 327 325 323 321 2461 387
NM_005910chr1783901 2891 2559 1498 762 377 331 48 21312 41 23418 342 32905 2640 780
NM_005935chr464866 4361 4032 3891 1070 449 55291 5142 4431 900 347 43460 3426 1690 837 --
NM_005941chr873228 3073 2722 2549 1547 1492 473 22611 304 --23377 466
NM_006060chr7114082 3918 3721 3135 3037 2973 1640 1134 772 435 364 23851 585 --21398 332
NM_006080chr742497 2163 2004 803 22951 1062 --22725 339
NM_006203chr5105603 5285 5169 5053 4832 4373 2182 2126 680 290 25199 3934 --23948 834
NM_006226chr231425 399 242 --8301 299 297 295 293 291 283 281 2304 286
NM_006252chr176194 6121 5973 5577 2482 2299 1711 12206 16124 27548 6000
NM_006306chrX115789 5754 5584 4592 4173 4142 3592 3575 439 413 217 24680 148 22314 652 25298 2352
NM_006315chr474068 3231 2794 1530 1289 879 138 --24388 533 22891 141
NM_006371chr374699 3696 1768 1718 1623 1411 892 25083 1761 44182 2120 1457 1164 24830 123
NM_006457chr483861 3494 2724 1583 1344 1210 906 701 33889 40 25 51449 1447 1445 1443 181 21452 1125
NM_006489chr14------31908 1881 1467
NM_006546chr17136368 6331 6269 2589 2357 2165 1966 1946 1504 686 631 357 293 44476 4322 2242 558 25741 4067 25402 1773
NM_006548chr32709 609 --21581 1579 31584 550 416
NM_006599chr16107707 3304 3211 2909 2802 2790 1305 988 658 147 11851 11866 --
NM_006609chr251967 1049 1014 823 117 --3260 94 92 22455 390
NM_006620chr694804 4390 3723 3559 3516 3463 1955 1015 116 34710 3861 3246 34071 3465 3311 1119
NM_006729chrX64045 1753 1667 477 445 298 34803 1914 505 35465 3648 733 21477 378
NM_006750chr16106963 6377 5806 5672 1790 1028 928 553 157 22 25514 1611 11688 26498 5675
NM_006851chr1242532 2500 819 537 32642 2165 2128 2802 503 12378
NM_006884chr35748 634 565 489 285 2438 424 1287 21763 432
NM_006885chr1643932 3695 1204 771 --23699 3597 21662 1591
NM_006924chr1783584 3558 3119 1778 1771 1690 448 378 ----23322 2720
NM_007030chr583867 3832 3762 3622 3237 1700 830 308 24808 3795 14820 24865 3962
NM_007050chr20187627 6932 6298 6169 6121 6099 5858 5702 2837 2557 2267 2220 2201 1479 1384 853 554 401 67846 6995 6518 6258 5445 1237 42287 2097 1066 772 26990 122
NM_007137chrX74548 4300 4146 1870 1824 1740 1081 12189 51826 1512 1444 326 190 31515 842 195
NM_007153chr19114420 3623 3373 3303 2955 2780 1350 942 822 492 467 44242 409 224 55 54103 3306 754 752 494 13192
NM_007197chr126961 849 817 807 711 185 2366 218 --2650 113
NM_007203chr972690 1553 1140 1132 679 535 377 53189 2678 2662 2576 687 43194 1439 1099 1089 31110 1092 211
NM_007249chr13113144 2881 2703 2410 2290 1245 922 783 542 237 97 37348 2587 1001 69152 7587 7433 7117 6238 1082 38338 2834 1315
NM_007350chr12114244 4229 4005 3811 3546 3375 3006 1633 901 814 442 23665 924 --21308 828
NM_012069chrX92307 2289 2202 2132 1695 1682 1653 964 494 12427 22602 831 32292 1717 335
NM_012104chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_012104chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_012141chr1313534 43644 3459 3239 2745 13815 24103 3527
NM_012164chr9107225 5640 5134 4993 2602 2161 1842 1614 1272 734 26743 1381 --27416 1012
NM_012199chr164094 4029 3398 3186 268 86 23421 3412 44220 4173 3446 1242 11245
NM_012214chr295523 4754 4733 4211 4188 4098 4067 1330 1134 35194 2225 1448 25122 4489 25125 4498
NM_012395chr741348 1176 861 77 22914 96 12566 23322 1150
NM_012431chr783468 2970 2885 2824 2356 2342 2331 1151 33586 2317 1373 22762 99 33144 2363 2345
NM_012448chr1742110 2020 583 168 4769 614 419 402 41787 775 533 413 --
NM_012465chr1053287 1287 1064 607 415 1190 22761 2413 23415 2299
NM_013231chr1474019 3931 3014 2916 1517 871 386 1417 33640 3112 1565 1885
NM_013372chr15123393 3289 2689 1330 1294 1233 1194 1164 405 385 298 219 22059 804 32346 962 659 53093 2273 2069 1276 1248
NM_013989chr1485077 4876 4819 1817 828 764 672 390 33670 1347 900 14105 24952 713
NM_014048chr1664674 4575 4298 4234 1375 305 24559 3866 --24980 3748
NM_014112chr873825 3497 3421 3388 1808 357 291 44175 3653 1215 474 34604 3423 331 --
NM_014155chr11105943 5641 2572 2557 1676 628 591 453 202 32 46808 2620 2580 2292 27478 5751 2514 178
NM_014243chr431661 669 515 --41625 1389 358 286 1637
NM_014309chr22115393 4812 4717 3495 1899 1642 1427 1387 444 334 322 64303 3531 3478 1003 569 91 65450 4435 3655 1657 990 342 15453
NM_014331chr467341 7194 5532 2322 605 113 55457 1534 902 466 267 37428 7178 1251 1461
NM_014368chr942031 1653 772 720 11602 31381 741 693 2751 567
NM_014586chr2194615 4496 4438 4202 3935 3495 1558 1383 756 44656 3825 593 410 2961 606 --
NM_014613chr5102918 2861 2837 2730 1130 1064 721 601 451 92 22190 462 194 197
NM_014647chr1651939 1764 1739 1627 838 --32198 1418 756 21942 507
NM_014653chr1242172 1902 1864 835 31584 1413 171 141925 1923 1921 1913 1893 1876 1874 1872 1870 1868 1866 1395 1369 837 --
NM_014721chr697212 6364 6206 4662 4649 2009 505 384 242 1806 25480 2591 2445 414
NM_014730chr12134746 4703 4523 4467 4417 4209 4094 3920 3889 3863 2089 1533 160 1851 43972 856 144 134 1109
NM_014730chr12134746 4703 4523 4467 4417 4209 4094 3920 3889 3863 2089 1533 160 1851 43972 856 144 134 1109
NM_014746chr294244 3932 3889 3848 3422 2697 1017 601 325 23739 427 13727 11294
NM_014747chr1175480 5366 4666 4405 4179 4145 4085 3947 3873 3529 2149 2093 1776 1002 967 835 304 25766 4525 65579 5577 5575 4303 4026 1980 --
NM_014803chr1092854 2622 2183 1152 909 883 579 433 145 2711 465 22569 2284 12289
NM_014826chr194245 3906 3344 1154 1031 676 621 581 409 22746 720 51551 1519 711 709 623 --
NM_014840chr1282789 2712 2680 1367 990 550 367 320 11330 33086 761 166 33089 764 590
NM_014873chr174745 4482 4359 3879 3795 1515 1120 43510 1595 306 270 --11927
NM_014893chrY42318 922 561 132 --2763 58 2662 71
NM_014899chr533034 1263 971 32514 897 873 --2868 178
NM_014904chr1063895 3659 3086 1124 804 129 33468 2663 1142 42470 84 41 39 23228 44
NM_014909chr14143769 3600 3388 3134 2845 2630 1589 1550 1502 1217 1203 609 123 111 --23321 1273 23772 507
NM_014912chr1063244 2665 1375 1065 416 46 --22781 56 12694
NM_014931chr193295 254 232 1193 2286 256 2259 246
NM_014935chr1123447 3330 3051 2906 2616 2384 1397 1387 841 827 785 623 1428 182550 767 765 763 761 759 757 755 753 751 749 747 745 743 733 731 729 727 11087
NM_015026chr1254420 3571 3311 2905 347 --44422 4059 4057 3197 1484
NM_015035chr20156644 6390 6357 6295 6251 5617 5315 5121 4993 4570 2497 2255 1717 575 61 1882 32630 1573 1424 26010 5456
NM_015051chr963190 2950 2898 2714 2456 580 13163 33387 2445 425 1815
NM_015064chr1293202 2356 1338 1177 829 786 678 598 356 33584 882 877 13189 31232 864 419
NM_015068chr753137 1136 970 923 624 21204 1142 33345 2821 2797 33348 3079 2967
NM_015071chr5125932 5518 5366 5197 4873 1982 1823 1803 1797 1024 530 225 55414 4079 3947 2351 245 32593 2131 1381 85346 5340 4482 4355 1865 1363 1261 336
NM_015144chr1693470 3371 2870 2489 1550 1170 598 574 291 ----23693 1322
NM_015234chr63430 302 142 --161 31476 468 451
NM_015310chr8147115 7030 6886 6775 6710 6685 6380 5948 5675 5484 3181 2719 2535 2055 46962 5956 1377 681 26399 6077 37146 6274 687
NM_015313chr1193442 1664 1547 1173 1033 1011 669 541 507 1520 2474 92 1328
NM_015352chr20173216 3193 3138 3080 3014 2980 2856 2784 2770 2706 2450 1529 1482 1419 707 154 133 33651 2599 1404 53751 3101 2724 346 330 13083
NM_015375chr1124923 4559 4487 4324 4109 4093 4001 3548 3465 657 290 169 54306 3418 1924 881 107 23610 689 21480 671
NM_015520chr3102780 572 542 473 437 398 346 269 122 103 31814 1074 747 1958 22300 599
NM_015852chr723608 2634 151217 1136 1052 968 884 800 716 632 548 464 380 296 212 128 44 12410 --
NM_015879chr18108041 7414 6308 6000 5906 5608 5240 3025 2458 1986 48417 5957 3350 1940 17358 22175 221
NM_015886chr855767 4508 1195 311 70 34500 1541 1081 11215 22013 73
NM_015995chr15155071 5015 4892 4487 4459 4442 4098 3760 3455 2162 2127 1373 1359 1060 77 14628 22129 80 183
NM_016083chr673001 2852 2487 1372 1285 814 64 12948 23219 1404 23916 818
NM_016206chr388501 8487 7982 7163 5845 3293 863 848 22245 1440 11577 67166 6798 5913 2911 2850 112
NM_016217chr622713 982 23373 990 1109 22450 758
NM_016257chr182902 2868 2232 1222 1123 809 427 296 22604 2307 43306 2904 933 188 23346 3309
NM_016260chr256723 6050 5146 325 194 45439 2040 1825 531 23012 2577 36376 1293 198
NM_016271chr1822232 1655 ----2650 249
NM_016272chr2242647 2284 2017 415 12363 --32406 74 51
NM_016507chr1743023 2681 365 328 22483 513 --43026 1198 465 332
NM_016834chr1783901 2891 2559 1498 762 377 331 48 21312 41 23418 342 32905 2640 780
NM_016835chr1783901 2891 2559 1498 762 377 331 48 21312 41 23418 342 32905 2640 780
NM_016841chr1783901 2891 2559 1498 762 377 331 48 21312 41 23418 342 32905 2640 780
NM_016929chr683784 3574 3534 2800 1716 1539 929 909 11755 33536 471 441 23820 2990
NM_017420chr1422352 126 --23739 2354 23621 2999
NM_017551chr1092358 2284 2072 1912 1674 812 486 355 303 42396 996 677 381 122378 2376 2374 2372 2370 2368 2366 2364 2362 2360 2292 1791 --
NM_017563chr3104497 4221 4120 1944 1790 1769 1616 1565 1408 836 45882 1984 1908 1889 44605 2447 1991 1714 16117
NM_017628chr464659 4158 3435 1858 1615 238 25055 4892 14448 24478 94
NM_017633chr6103837 2905 2625 2553 1260 1230 784 762 484 80 2294 54 42907 787 253 251 1400
NM_017637chr9129158 8540 7978 7851 7675 7609 6418 6064 2654 1872 1292 231 27642 7602 107891 7678 7234 6430 3713 3384 3207 1645 745 378 76155 5868 3716 1920 1639 1594 423
NM_017650chr755843 5480 4962 1278 425 54733 3850 1579 584 40 11103 35677 4443 1298
NM_017658chr1444068 3458 3079 494 23724 3040 23438 3414 24170 215
NM_017741chr442666 2401 1777 379 22257 361 22471 1957 32405 1945 466
NM_017754chr673517 3181 1884 1789 1128 553 536 24804 2001 132 24759 4255
NM_017784chr341036 793 455 125 1880 2129 127 2875 132
NM_017902chr10105483 5340 4987 3759 3740 2039 801 642 444 74 21590 1585 65050 4434 2283 597 448 446 25271 1911
NM_018027chr1072090 1263 880 734 460 327 270 41187 745 551 450 32137 974 972 22519 2350
NM_018084chr283343 3232 3154 2901 2581 2148 733 202 22172 41 22160 136 --
NM_018351chr1254444 3350 1613 1346 400 13718 2645 37 23488 3016
NM_018364chr153867 3588 3133 3079 1238 --1749 2570 120
NM_018373chr14136017 5903 5338 4535 4485 2431 2291 1658 1647 797 669 473 464 43909 2226 1467 687 55093 2183 634 607 281 32412 2134 284
NM_018440chr8127956 7597 7165 5496 5374 3132 1689 1213 871 629 585 172 47440 6330 2652 67 --48113 7084 6617 2104
NM_018898chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018899chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018900chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018901chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018902chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018903chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018904chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018905chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018906chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018907chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018908chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018909chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018910chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_018911chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_019001chr344838 3848 3048 1456 1498 24079 3217 34642 1887 1459
NM_019004chr731614 879 236 1244 --1250
NM_019022chr1831966 1015 48 --21072 179 2561 463
NM_019072chr573988 3725 3252 2660 1168 1115 617 23299 400 --12994
NM_019557chr14909 739 266 259 --2722 720 3912 269 143
NM_020122chr265445 5290 5069 2136 436 138 33949 3680 284 35676 5537 4584 24524 142
NM_020133chr6166203 6098 6055 5474 4396 4166 4113 2401 2020 1765 1608 1475 977 712 617 288 36327 4694 29 15920 22381 1581
NM_020205chr193163 3071 2935 2904 1214 704 633 379 27 1307 1620 1766
NM_020228chr1122124 849 21701 252 6857 855 853 851 811 489 3860 725 415
NM_020245chr6154969 4600 4207 4012 3236 2020 1279 856 639 534 246 143 47 35 22 --126 --
NM_020337chr442168 2150 2125 1249 12223 --32027 1252 868
NM_020443chr1176910 6828 6114 5756 5596 5482 5294 4645 2269 1736 1419 1371 1201 648 622 390 131 45214 2371 1099 114 66831 2603 2556 1455 624 392 25024 141
NM_020466chr664318 4088 3502 1371 1184 121 21326 488 24440 1547 64984 3879 1480 1332 1321 640
NM_020673chr2045583 5352 2693 785 22799 364 22034 221 27005 335
NM_020718chr1695213 4848 4385 4060 2091 1399 544 390 383 26587 5180 --21277 626
NM_020739chr1572793 2729 1342 1018 768 740 375 43315 938 906 91 1491 13186
NM_020742chrX62127 986 709 607 461 57 --6824 576 86 84 82 70 42550 506 89 73
NM_020748chr173762 551 435 --1681 3451 444 286
NM_020766chrX63650 3266 3189 2939 2875 1587 123 --21702 1666
NM_020772chr17128660 8294 8004 7900 7400 7331 3289 3105 1492 1254 1036 227 ----26002 2193
NM_020782chr12124472 4465 4326 4154 4122 3750 3439 3337 1920 309 89 72 1836 33770 3142 182 23024 766
NM_020805chr18----41856 538 328 153 2614 296
NM_020841chr1274088 3577 2870 1517 1079 586 120 --33381 989 588 11375
NM_020844chr8126823 6008 5975 5696 5337 2885 2638 2347 2186 986 837 199 47624 2665 1549 551 1291 26024 1215
NM_020935chr274281 3630 1737 1010 591 417 339 11562 34400 3437 772 23393 80
NM_020960chr9104931 4890 3724 3071 1848 1693 1384 912 386 251 21777 260 11278 23580 1217
NM_021061chr843358 3044 2955 1109 33434 300 74 54387 4385 3941 3240 3114 23936 3321
NM_021116chr7158230 7936 7870 7768 7722 6936 6157 3523 3102 2989 2843 2738 2170 1894 1368 27299 5857 28364 6023 29104 1508
NM_021120chrX73077 2851 2386 2137 1110 823 701 32006 1168 325 33028 2839 2064 32896 887 332
NM_021911chr584787 4386 1329 1312 1237 1212 869 652 21609 1129 2916 871 13819
NM_021949chrX72378 2307 1900 615 586 558 538 2567 546 11910 1595
NM_021961chr1177010 6484 6215 5650 5601 1464 1402 32129 1897 1572 15064 1229
NM_021964chr355770 5249 4111 456 333 14745 15473 26074 1746
NM_022048chr1585971 4660 2386 1853 1500 908 428 83 45150 4930 1806 934 41831 1542 1143 420 21286 875
NM_022166chr16126022 6010 5505 4259 3832 2167 2066 2037 1984 1569 1310 672 34322 4168 3977 12169 1143
NM_022456chr12137220 7113 6658 6426 5883 5609 4716 2533 1677 1338 743 733 89 35841 5549 5324 1854 21663 902
NM_022459chr1331984 588 158 1907 1568 24014 2061
NM_022469chr172659 2558 2140 1305 1278 835 295 12637 11255 22770 1248
NM_022473chr1574229 4217 3686 3562 3109 1772 1120 64457 4266 3985 3767 3500 1461 22970 1583 1105
NM_022491chr1293472 3397 3111 2375 2340 507 388 378 330 12955 --13287
NM_022648chr2123789 3541 3439 3285 3161 3080 2987 2961 2921 1467 942 91 2216 119 163153 1582 200 198 196 194 192 190 188 186 184 182 180 178 176 174 2332 203
NM_022658chr12--1936 --3946 909 878
NM_022893chr231228 1085 624 1452 62455 467 465 463 461 459 32827 2458 470
NM_022898chr1484182 4122 3892 3292 3142 3112 1477 308 54307 3911 3155 758 57 44312 4184 3365 3146 14126
NM_024341chr1963457 1533 415 327 272 215 23708 3197 73957 3955 3953 3951 3949 3947 3945 1975
NM_024408chr173332 1450 1221 974 781 768 721 32784 154 81 12802 42541 2416 724 125
NM_024512chr3103237 3066 2759 2170 1117 1036 826 731 682 353 32949 2750 548 53057 3055 3053 3051 670 13465
NM_024554chr15638 361 195 49 29 141 21704 363 --
NM_024665chr3123967 3868 3797 3426 3409 2969 1030 975 732 598 516 279 23325 1595 14717 53980 3971 3496 1869 283
NM_024761chr9115110 4861 4642 3778 3633 3386 1879 1551 826 706 142 ----1830
NM_024770chr286255 6108 5386 5237 4891 4228 1290 819 45531 2104 1867 101 16572 1423
NM_024817chr15145983 4919 4494 3957 3816 2199 2112 2064 2006 1928 1386 815 727 414 24053 1507 35175 4243 1920 32366 2220 2116
NM_024947chr3147794 7115 6999 6169 3235 2935 2765 2422 2151 2132 1624 1611 898 575 13203 37638 2155 2153 29308 2786
NM_024949chr494286 4080 3383 3072 1998 1002 954 665 444 13968 33343 1192 900 11106
NM_024989chr2116794 6449 6273 1765 1584 1521 1216 711 319 234 57 37332 7051 1753 55426 1811 1809 723 590 21814 1699
NM_025160chr163872 3656 1053 653 429 412 --33876 3874 3121 43416 3167 1694 1630
NM_025179chr1124642 3958 3105 3046 1944 1822 1770 1190 806 534 193 29 23129 546 21824 1503 54025 1740 601 595 382
NM_030627chr544041 3324 568 293 1260 23591 297 2314 300
NM_030647chr756011 5625 4479 247 210 14719 55602 4326 4028 910 230 24214 1726
NM_030648chr475509 4659 4295 3578 3561 1542 814 42017 1523 844 600 64771 4769 4767 4667 1998 1914 11247
NM_030664chr1041925 1617 1569 1548 1474 21805 1658 21972 820
NM_030761chr1112429 2208 1963 1013 902 888 636 618 373 331 88 1692 42172 1910 890 227 1523
NM_030806chr1119355 8379 7251 6933 6920 6851 6070 2739 2671 2664 932 27788 1238 59085 7515 6756 6020 5769 36923 1668 1311
NM_030817chr1273283 2981 1304 1243 760 525 357 --83591 3423 1255 1253 1251 1249 1247 1245 13272
NM_030918chr174952 4662 4201 3953 3941 1532 1507 55337 4333 1548 912 728 65136 4955 4938 3631 1553 803 13423
NM_031243chr752379 680 557 170 43 21693 796 12138 22036 697
NM_031411chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_031427chr1455279 5232 1520 1029 474 24323 1713 34574 1481 1368 24451 1828
NM_031468chr7268229 7311 7299 7152 7037 6985 6818 6721 6447 6221 6123 5797 5445 2955 2439 2377 2136 1898 1137 726 479 453 419 358 350 200 66951 5453 5101 3186 2566 1291 76906 5447 5301 2596 2594 2405 360 11108
NM_031469chr663929 3499 3165 1452 908 468 22631 1652 11159 22981 316
NM_031849chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_031857chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_031860chr53638 605 584 22214 1722 31985 553 277 2947 918
NM_031938chr116989 825 299 109 103 93 ------
NM_032047chr352144 2126 1977 896 425 2515 473 --22227 252
NM_032105chr1147473 7411 7297 7175 6868 6374 5956 5845 2853 2842 2510 1628 1214 1180 45734 2587 2370 594 47427 7037 1378 166 --
NM_032153chr361739 1010 537 490 380 79 --42043 2039 867 824 22026 506
NM_032199chr1073857 2524 2355 1203 920 407 277 21242 1217 1355 33405 3302 2586
NM_032281chr1962696 2280 2021 876 571 90 11985 14923 92 74 72 70 68 66 64 62 54 52 50 48 46 3613 77 57
NM_032446chr553501 3279 3097 2826 193 --13503 22626 1032
NM_032682chr322449 1392 --32205 941 939 22626 915
NM_032711chr1784334 3595 3144 2699 2624 790 475 324 12637 2730 311 3869 733 327
NM_032837chr1772060 1534 1448 407 353 191 33 21381 549 --21912 637
NM_032859chr1323075 98 12623 23149 333 22551 810
NM_032900chr1093672 3343 2860 2803 2793 1338 1216 1182 198 43804 3171 2959 925 11132 1681
NM_033023chr7----8251 249 247 239 237 235 233 149 2254 242
NM_033083chr353241 963 718 415 233 185 1419 33118 2534 626
NM_033143chr454077 3693 3476 3070 1799 --23380 1398 34132 1104 112
NM_033181chr673001 2852 2487 1372 1285 814 64 12948 23219 1404 23916 818
NM_033224chr7127888 7666 7628 7346 6975 4910 2916 2775 2247 1948 512 105 57516 6448 5264 162 147 --1227
NM_033285chr874144 3782 3398 3254 1719 1023 627 --34222 3718 907 11629
NM_033429chr15112745 2586 2349 2138 1130 845 707 428 249 131 87 1920 --22748 2376
NM_033430chr4103939 3694 3381 3367 3348 2612 1477 989 919 727 2617 492 11382 22787 2728
NM_033437chr4103939 3694 3381 3367 3348 2612 1477 989 919 727 2617 492 11382 22787 2728
NM_033505chr296762 6314 5916 5455 4973 2488 1287 554 467 25823 5202 16528 35583 994 636
NM_033637chr10103584 3570 2629 1433 1262 1034 780 725 544 425 21276 916 53495 2604 2602 1435 1264 13574
NM_033656chr2185046 4842 4112 2301 1734 1334 924 816 45682 5299 3881 31 35824 4599 366 14457
NM_052851chr1332023 1914 64 288 37 2903 601 32241 2230 94
NM_052879chr1231508 737 370 32799 386 109 --23667 3457
NM_053016chr9157673 7612 7205 6467 6441 6207 5921 5672 5186 4858 2365 1881 1288 911 170 57259 5845 3180 1870 1622 36981 6374 5923 21390 1098
NM_053043chr7106157 5816 5234 4387 1911 1486 1392 1185 433 59 24207 1317 21913 1401 14848
NM_053056chr112480 373 1109 52678 222 220 218 216 2838 225
NM_080669chr17164244 4142 4068 3770 3265 1838 1702 1619 1476 587 520 495 479 322 310 144 33042 1170 33 34007 1326 146 --
NM_080717chr1221460 1044 290 56 975 71 63 61 50 48 46 44 42 21417 66
NM_080872chr8103756 3258 2473 932 861 724 516 379 203 178 --22834 66 23293 2671
NM_130391chr932426 1269 467 33141 280 214 --32561 1083 341
NM_130392chr932426 1269 467 33141 280 214 --32561 1083 341
NM_130393chr932426 1269 467 33141 280 214 --32561 1083 341
NM_133170chr20187627 6932 6298 6169 6121 6099 5858 5702 2837 2557 2267 2220 2201 1479 1384 853 554 401 67846 6995 6518 6258 5445 1237 42287 2097 1066 772 26990 122
NM_133445chr963616 3361 2910 661 350 248 53046 2312 1500 1488 1247 22903 840 1843
NM_133474chr431567 1493 1258 41459 666 151 53 1550 21570 1454
NM_138357chr1061739 1369 1237 339 271 200 21167 154 --21173 284
NM_138468chr2106200 5409 4600 4515 4414 4206 2450 1429 1167 1054 46228 5595 3909 1547 35910 4617 524 --
NM_138473chr12114788 4715 3809 1656 1524 1476 1265 147 134 87 77 34023 1400 1096 33870 1776 90 24274 1406
NM_138576chr1484182 4122 3892 3292 3142 3112 1477 308 54307 3911 3155 758 57 44312 4184 3365 3146 14126
NM_138713chr16107707 3304 3211 2909 2802 2790 1305 988 658 147 11851 11866 --
NM_138714chr16107707 3304 3211 2909 2802 2790 1305 988 658 147 11851 11866 --
NM_138731chr1463895 3837 1469 587 473 302 11111 1807 31686 1522 669
NM_138959chr1106275 6242 5368 4372 2477 1912 1221 842 493 192 26234 2194 31143 1035 52 35976 5158 614
NM_138970chr1421772 676 1650 32079 1998 678 31711 1551 968
NM_138971chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_138971chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_138972chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_138972chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_138973chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_138973chr11113589 3568 2936 2810 2765 2346 1076 794 455 416 74 12876 22956 599 33143 591 205
NM_139279chr243167 2953 857 150 3392 175 159 23379 303 1170
NM_144599chr1595130 4860 4600 3698 3690 1592 495 394 80 --51918 1625 588 586 584 33804 1953 591
NM_144973chr1295251 5048 4918 4747 4654 1703 1214 994 336 11809 44235 1599 1075 1071 34785 1078 672
NM_145013chr11112793 2502 2456 2310 2043 1964 875 713 495 350 213 12144 32964 2286 2245 12248
NM_145117chr111405 --2322 320 33115 345 331
NM_145259chr285640 5037 4591 2396 2215 2026 1938 1502 66749 5940 5935 5453 1634 1090 26077 658 26768 2617
NM_145284chrX72408 2149 1679 1600 991 964 401 11653 22255 2001 1803
NM_145649chr632633 764 69 42518 2063 51 32 --21779 344
NM_145655chr632633 764 69 42518 2063 51 32 --21779 344
NM_145808chr772673 2034 858 808 272 127 113 ----3862 717 130
NM_147150chr972690 1553 1140 1132 679 535 377 53189 2678 2662 2576 687 43194 1439 1099 1089 31110 1092 211
NM_148955chr15115320 4971 4779 4740 4230 4201 4190 4161 1067 687 622 65187 4840 1994 1986 651 199 16139 14846
NM_152263chr1115967 5044 4904 4536 4423 4080 3918 3904 3766 274 248 86035 5023 4511 4326 4198 3836 1960 1150 24006 1226 --
NM_152287chr16122454 2023 1937 1870 1769 1708 1668 955 835 472 363 258 22302 1041 --22599 738
NM_152388chr253992 3799 2981 2597 854 43966 1085 980 389 41525 1198 729 695 31407 540 217
NM_152414chr841110 589 489 458 2525 139 8595 593 591 581 579 577 575 573 11135
NM_152470chr18123216 3131 3121 3068 2684 1423 1007 870 794 775 269 230 21632 584 31624 1615 1063 21426 135
NM_152624chr5126909 6097 5703 5023 4750 4712 2518 2478 2413 1779 1162 143 21553 1002 22520 1970 11504
NM_152636chr111360 22299 1903 11050 22598 809
NM_152734chr655216 4302 4191 1719 55 24538 3990 54027 3997 3995 2193 1879 24000 3972
NM_152754chr793688 3660 3489 2904 2539 1321 1065 454 160 11215 --1671
NM_152774chr72610 219 --62221 2187 567 565 552 261 1570
NM_152787chrX83229 3091 2938 2700 1328 1161 750 211 11186 1221 1475
NM_152826chr15115320 4971 4779 4740 4230 4201 4190 4161 1067 687 622 65187 4840 1994 1986 651 199 16139 14846
NM_153442chr10166447 6414 6123 6100 6041 5765 5639 5597 4674 4241 2120 1888 1701 1515 322 23 46391 5699 5370 2512 36318 1290 434 26418 6363
NM_153456chr13116181 5886 4952 4832 4787 4482 2187 2128 1459 1097 778 85118 4618 2277 1718 1376 1353 835 749 4442 440 281 262 45193 3998 451 445
NM_153810chr1074849 4687 4009 3497 3449 1939 496 34258 1245 127 --21742 38
NM_172071chr187410 6624 5848 5400 5301 4719 1578 1183 165 15429 16903
NM_173214chr16107707 3304 3211 2909 2802 2790 1305 988 658 147 11851 11866 --
NM_173468chr435752 2000 367 23880 880 45938 4888 4193 2198 35622 4891 2025
NM_173531chr1951211 1121 748 538 462 ----23115 153
NM_173582chr1175778 5632 4979 4392 3853 1841 971 25284 1425 51756 1754 1752 1750 1748 24710 1759
NM_173642chr1158629 8087 7722 6422 6351 6223 6081 6040 3570 3484 2777 2258 2231 2193 1398 28371 2874 38219 3459 1619 59058 8496 7140 3504 3497
NM_173694chrX72071 1925 1819 1805 1676 1032 1024 1920 1968 12177
NM_175623chr12137220 7113 6658 6426 5883 5609 4716 2533 1677 1338 743 733 89 35841 5549 5324 1854 21663 902
NM_175624chr12137315 7208 6753 6521 5978 5704 4811 2628 1772 1433 838 828 184 35936 5644 5419 2949 54 31758 997 88
NM_175625chr12137315 7208 6753 6521 5978 5704 4811 2628 1772 1433 838 828 184 35936 5644 5419 2949 54 31758 997 88
NM_175634chr83838 366 138 --1248 2452 141
NM_175635chr83838 366 138 --1248 2452 141
NM_175636chr83838 366 138 --1248 2452 141
NM_175736chr12177305 6491 5799 5700 3060 2716 2668 2556 2500 2342 1141 998 726 650 600 336 86 77481 6687 5760 5565 2164 784 519 16775 35754 1059 1026
NM_175861chr1295363 5157 3900 2111 1723 1002 667 543 50 1868 11396 44929 3630 419 232
NM_175910chr1922101 1611 91922 944 862 699 615 531 263 195 111 21543 444 --
NM_178006chr1332023 1914 64 288 37 2903 601 32241 2230 94
NM_178007chr1332023 1914 64 288 37 2903 601 32241 2230 94
NM_178037chr1293202 2356 1338 1177 829 786 678 598 356 33584 882 877 13189 31232 864 419
NM_178038chr1293202 2356 1338 1177 829 786 678 598 356 33584 882 877 13189 31232 864 419
NM_178039chr1292837 1991 1247 973 812 464 421 313 233 33219 517 512 12824 3867 499 54
NM_178040chr1292837 1991 1247 973 812 464 421 313 233 33219 517 512 12824 3867 499 54
NM_178151chrX77792 7537 6555 2239 763 675 212 67383 6396 5992 2881 1132 636 36759 6538 6294 --
NM_178152chrX77792 7537 6555 2239 763 675 212 67383 6396 5992 2881 1132 636 36759 6538 6294 --
NM_178153chrX77792 7537 6555 2239 763 675 212 67383 6396 5992 2881 1132 636 36759 6538 6294 --
NM_178426chr192325 2316 1589 772 762 629 496 485 411 1502 21668 631 --
NM_178427chr192225 2216 1489 672 662 529 396 385 311 1402 21568 531 --
NM_181332chrX62127 986 709 607 461 57 --6824 576 86 84 82 70 42550 506 89 73
NM_181486chr1221460 1044 290 56 975 71 63 61 50 48 46 44 42 21417 66
NM_181521chr16116247 5529 5449 5251 2174 1740 1235 960 366 341 136 25667 4486 45094 5092 2910 2064 --
NM_182487chr994113 3875 3521 3264 3221 1472 376 296 283 43362 3065 1196 706 11453 11447
NM_182503chr655560 4483 4307 974 831 23578 150 13627 25573 4640
NM_182762chr786020 4705 4590 2505 2050 1702 1597 1028 54174 2383 2307 2168 602 36004 1226 473 34927 4628 3871
NM_182798chr531328 1018 24 21300 900 6558 356 354 352 350 348 1359
NM_182799chr541489 1328 1018 24 21300 900 6558 356 354 352 350 348 1359
NM_182801chr541489 1328 1018 24 21300 900 6558 356 354 352 350 348 1359
NM_182898chr796540 6381 6101 5899 5451 5082 942 833 32 25944 4576 21219 183 76373 4924 4381 2488 2212 1946 1222
NM_182899chr796540 6381 6101 5899 5451 5082 942 833 32 25944 4576 21219 183 76373 4924 4381 2488 2212 1946 1222
NM_182964chr111405 --2322 320 33115 345 331
NM_194285chr1183156 3118 2546 2121 1287 1094 1069 823 23380 2895 13159 23141 115
NM_194286chr12125593 5392 4908 4267 3984 2371 1491 1284 817 735 627 575 25715 137 1806 24810 473
NM_198128chr1822232 1655 ----2650 249
NM_198273chr542726 1233 1072 129 --199 21144 527
NM_198320chr1284615 4161 4105 4007 3246 891 832 786 53774 1475 842 593 130 ----
NM_198468chr653455 1683 1504 1420 988 1748 31803 1716 737 11565
NM_198484chr376161 5574 2445 1592 1513 237 77 65335 4876 4640 2321 2014 1793 25508 1184 1601
NM_198581chr296991 5983 2888 2851 2787 2024 1374 1300 194 11585 22002 1571 12984
NM_198715chr176185 6098 5878 5236 4706 2000 372 14148 56100 4698 4274 2189 1636 35961 4852 2362
NM_198859chr364974 4538 3179 1295 1273 705 24276 1737 14721 33999 1203 116
NM_198900chr12177305 6491 5799 5700 3060 2716 2668 2556 2500 2342 1141 998 726 650 600 336 86 77481 6687 5760 5565 2164 784 519 16775 35754 1059 1026
NM_199000chr761914 1877 1680 602 460 103 21732 302 2207 105 11433
NM_199003chr841528 627 351 188 --1232 2605 211
NM_199160chr941972 1594 713 661 11543 31322 682 634 2692 508
NM_199188chr1231508 737 370 32799 386 109 --23667 3457
NM_199190chr1231508 737 370 32799 386 109 --23667 3457
NM_199437chr1122124 849 21701 252 6857 855 853 851 811 489 3860 725 415
NM_199438chr1122124 849 21701 252 6857 855 853 851 811 489 3860 725 415
NM_199439chr1122124 849 21701 252 6857 855 853 851 811 489 3860 725 415
NM_199462chr1124923 4559 4487 4324 4109 4093 4001 3548 3465 657 290 169 54306 3418 1924 881 107 23610 689 21480 671
NM_201432chr17116606 6552 6313 5513 5000 4611 2494 1406 1397 120 111 --36171 6107 5002 --
NM_201433chr17116606 6552 6313 5513 5000 4611 2494 1406 1397 120 111 --36171 6107 5002 --
NM_203446chr2142173 1210 1041 390 2866 554 1150 2572 39
NM_203458chr193766 3458 3341 3254 2493 2389 1380 1313 317 23568 3325 23573 1382 23344 407
NM_203463chr284171 3672 3608 3450 3355 1740 1540 781 21395 221 64570 3463 1403 869 339 293 24385 3911
NM_205848chr182173 2056 1104 927 588 522 408 391 --32029 464 32 2930 379
NM_205860chr132475 1188 1177 1768 141 22084 1040
NM_206594chr142894 1452 1426 565 23261 1127 53590 668 666 568 550 3933 671 46
NM_206595chr142894 1452 1426 565 23261 1127 53590 668 666 568 550 3933 671 46
NM_206909chr8147115 7030 6886 6775 6710 6685 6380 5948 5675 5484 3181 2719 2535 2055 46962 5956 1377 681 26399 6077 37146 6274 687
NM_207445chr1561402 739 310 282 224 26 ----21994 31
NM_213589chr275405 5037 4756 4548 1778 1676 294 51528 1450 1121 1107 893 35407 221 219 34401 4212 4011