TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4753-5p
miRNA Sequence: CAAGGCCAAAGGAAGAGAACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr122541 195 ----11836
NM_000038chr5--11292 --1177
NM_000044chrX1161 ------
NM_000051chr1113356 11063 12620 21152 180
NM_000053chr137775 412 378 236 212 181 156 --1611 --
NM_000084chrX96929 5747 5555 5241 4627 4318 2351 2135 444 15610 25880 5294 --
NM_000088chr1711143 ------
NM_000089chr7----1325 --
NM_000090chr2--1668 ----
NM_000092chr234529 3899 3326 13703 --1259
NM_000093chr922362 1947 --1626 --
NM_000104chr222408 398 ------
NM_000109chrX1832 --1558 --
NM_000110chr111107 ------
NM_000125chr653703 3536 3318 3005 1565 --2695 122 --
NM_000129chr641471 1285 354 38 ------
NM_000138chr1511024 --32518 2412 929 --
NM_000141chr1021116 495 --11050 --
NM_000161chr1421527 69 ------
NM_000163chr511720 --1361 --
NM_000165chr62432 293 11204 ----
NM_000167chrX1152 ------
NM_000176chr512644 ------
NM_000189chr231566 1489 927 --22238 100 --
NM_000214chr2041664 1568 1538 134 --1292 --
NM_000217chr1284737 4682 4298 3982 1120 764 735 262 --1798 --
NM_000222chr421916 52 --21942 370 --
NM_000232chr442537 2501 1292 136 --22263 2189 --
NM_000237chr831832 617 402 21867 685 --11699
NM_000242chr101904 12631 ----
NM_000248chr331186 1081 585 ----1881
NM_000252chrX21305 993 ------
NM_000258chr32241 229 ------
NM_000259chr1555478 2481 1751 1447 1380 ------
NM_000264chr921242 572 ------
NM_000266chrX2924 22 ------
NM_000271chr181531 ------
NM_000278chr1062220 1547 851 757 670 654 ------
NM_000314chr1012253 12981 ----
NM_000321chr1321611 1130 --11438 --
NM_000330chrX22109 1796 11837 22054 413 11593
NM_000332chr666236 5327 4753 4609 2594 1161 11741 32846 1882 1708 --
NM_000333chr32960 254 ------
NM_000334chr1771834 1568 824 408 354 300 90 ------
NM_000335chr392253 1362 801 651 493 317 222 185 93 --1102 --
NM_000337chr5105883 5798 5651 4790 4153 1590 857 804 598 42 --14825 24133 53
NM_000338chr1521102 274 ------
NM_000345chr43858 240 216 ------
NM_000346chr171712 1755 ----
NM_000353chr1631029 936 57 ------
NM_000378chr112858 180 ------
NM_000386chr171662 ------
NM_000390chrX149 12299 12187 22390 318
NM_000391chr1141109 415 290 26 1499 1451 --
NM_000393chr221698 150 ----1138
NM_000399chr102471 123 ------
NM_000406chr41537 11932 12519 --
NM_000408chr213237 --12712 --
NM_000428chr143339 60 39 1739 2953 264 --
NM_000429chr1061654 1576 1406 1395 1263 25 --11681 --
NM_000430chr1733421 416 383 ----23017 704
NM_000439chr521725 1558 --32535 1609 721 --
NM_000449chr11339 1197 ----
NM_000451chrX32187 620 401 ------
NM_000461chr333271 1665 521 --24070 446 13940
NM_000484chr212678 215 --1752 --
NM_000486chr1272825 2686 2095 999 786 654 235 ------
NM_000489chrX23014 1078 ------
NM_000503chr8------11811
NM_000523chr2159 --1833 --
NM_000525chr1151587 1302 1077 629 162 ------
NM_000533chrX1472 ----1705
NM_000555chrX77682 5892 5253 5149 4863 3157 1605 --35484 5136 4786 --
NM_000598chr721534 993 1419 ----
NM_000599chr2103976 3902 3820 3740 3528 3502 3186 3064 2891 424 --13085 --
NM_000611chr11106473 6119 5415 5402 4758 2320 1755 1530 1040 637 --22710 736 11901
NM_000612chr1143402 2795 2679 545 --1359 2396 236
NM_000615chr1132897 2410 1102 --32215 1922 1144 --
NM_000620chr1222034 1530 11711 ----
NM_000633chr1841862 1075 1042 566 11389 33416 1358 450 --
NM_000635chr1921630 360 --21383 583 --
NM_000693chr1521489 606 1117 ----
NM_000719chr1236560 2171 24 --34977 2133 1076 --
NM_000721chr142219 630 517 348 --1292 11652
NM_000738chr113936 280 109 ------
NM_000756chr81332 ------
NM_000767chr1921249 434 ------
NM_000793chr1464170 3883 3607 1385 1124 96 --11069 --
NM_000801chr2011126 --2989 717 --
NM_000806chr5--11519 ----
NM_000813chr544042 1230 831 127 13405 ----
NM_000814chr1523600 556 ------
NM_000817chr21269 ------
NM_000826chr4--1666 22587 587 --
NM_000827chr542465 2151 1676 907 --22433 1789 --
NM_000831chr176070 5758 4419 4151 1692 1153 1012 ------
NM_000836chr192265 225 ------
NM_000839chr31368 ----1491
NM_000841chr62732 122 ------
NM_000844chr31727 ------
NM_000859chr521139 528 ------
NM_000865chr6------1204
NM_000875chr15106116 6107 4654 4470 4423 4413 2349 2194 806 239 11157 25954 5125 --
NM_000876chr621351 1082 ------
NM_000883chr71274 1648 ----
NM_000883chr71274 1648 ----
NM_000895chr12----1107 --
NM_000899chr121418 --23364 1633 13692
NM_000901chr432259 2171 562 --11697 1673
NM_000908chr51186 --1311 --
NM_000919chr51156 ------
NM_000921chr121442 ------
NM_000926chr1198038 7956 7881 7341 3166 2497 1985 771 73 15740 26676 2374 --
NM_000933chr201451 --11194 --
NM_000944chr431776 816 359 ------
NM_000945chr211725 --1267 1377
NM_000950chrX23618 231 12252 33269 3009 486 --
NM_000958chr511205 --1137 --
NM_000964chr1731373 1187 46 --1874 --
NM_001001132chr211537 11443 1273 --
NM_001001323chr1223030 347 22603 2145 12571 --
NM_001001331chr332430 498 465 --12476 --
NM_001001342chr1031412 1154 1037 --11402 --
NM_001001344chrX32443 2106 1732 ------
NM_001001394chr22685 79 ------
NM_001001395chr121996 12385 1800 --
NM_001001396chr124166 3205 --13965 --
NM_001001433chr2033027 2431 62 --11291 --
NM_001001481chr812521 1781 ----
NM_001001484chr10----21665 623 --
NM_001001523chr131237 1083 36 --1149 --
NM_001001549chr742685 2227 822 283 ------
NM_001001550chr742685 2227 822 283 ------
NM_001001555chr742685 2227 822 283 ------
NM_001001557chr82704 360 --1332 --
NM_001001664chr243451 2839 2669 588 1210 ----
NM_001001890chr2123296 1515 ------
NM_001001924chr811374 ------
NM_001001925chr811374 ------
NM_001001931chr811374 ------
NM_001002243chr21908 ------
NM_001002252chr121205 --162 --
NM_001002255chr6--1323 ----
NM_001002257chr243244 2466 970 270 ----13523
NM_001002265chr102803 127 --1277 --
NM_001002266chr102803 127 --1277 --
NM_001002843chr151872 1483 ----
NM_001002860chr1464715 3289 3281 2948 1665 1484 --13056 --
NM_001002909chr171136 --1425 --
NM_001003406chr2272682 2669 2499 2160 951 920 366 13016 ----
NM_001003652chr1866895 5899 3045 2789 1143 905 28445 7474 28012 3431 26142 2177
NM_001003678chr11--190 ----
NM_001003679chr11627 --1275 --
NM_001003688chr4--1990 ----
NM_001003694chr3----1106 --
NM_001003712chr12148 --32748 1019 77 --
NM_001003760chr611392 ----1151
NM_001003792chr331167 196 71 --1186 --
NM_001003793chr331167 196 71 --1186 --
NM_001003794chr392984 2587 1908 1195 999 598 79 65 30 --1438 --
NM_001003800chr93894 859 711 --23530 479 --
NM_001003937chr23471 412 326 ----21678 1452
NM_001003940chr15113368 3348 2948 2937 2720 2713 2529 2483 1534 497 209 --11092 13803
NM_001003942chr15113368 3348 2948 2937 2720 2713 2529 2483 1534 497 209 --11092 13803
NM_001003943chr15113372 3352 2952 2941 2724 2717 2533 2487 1538 501 213 --11096 13807
NM_001004065chr911401 11009 23384 2735 12715
NM_001004106chr53240 160 106 ------
NM_001004127chr13----1249 --
NM_001004128chr12500 257 --2478 48 --
NM_001004196chr331120 950 38 ------
NM_001004304chr1273269 2957 2164 1012 836 600 67 ------
NM_001004308chrX2451 428 --11486 --
NM_001004317chr664144 4050 3375 3108 820 311 ------
NM_001004342chr1105599 4803 4123 3812 2433 1863 1725 959 640 379 --36020 5270 2042 14522
NM_001004360chr221767 1739 ------
NM_001004419chr1243792 2803 857 358 ------
NM_001004439chr15----1112 --
NM_001004720chr221032 60 ------
NM_001004722chr221201 229 ------
NM_001005209chr24731 524 162 121 --185 --
NM_001005242chr121258 --1230 --
NM_001005266chr151756 --1618 --
NM_001005267chr151756 --1618 --
NM_001005268chr151756 --1618 --
NM_001005269chr151756 --1618 --
NM_001005271chr1731108 916 260 --1407 --
NM_001005273chr1731108 916 260 --1407 --
NM_001005290chr12419 105 --1451 --
NM_001005366chr12170 --122 --
NM_001005375chrY11391 11537 11369 --
NM_001005386chr21759 --21871 603 --
NM_001005404chr1763345 1096 828 339 219 109 ------
NM_001005463chr10----22289 1027 --
NM_001005473chr525041 1756 14675 ----
NM_001005505chr321359 143 ------
NM_001005609chrX63709 3693 1273 1136 644 578 11218 ----
NM_001005739chr21579 ------
NM_001005743chr1421084 411 ----11282
NM_001005744chr1421084 411 ----11282
NM_001005745chr1421084 411 ----11282
NM_001005781chr2199 ------
NM_001005845chr8----21834 31 --
NM_001006600chr5----1478 --
NM_001006610chr161850 --11008 --
NM_001006617chr9--1550 1218 --
NM_001006619chr9--1550 1218 --
NM_001006620chr9--1550 1218 --
NM_001006621chr9--1550 1218 --
NM_001006634chr161509 --2213 141 --
NM_001006657chr232229 1167 975 ------
NM_001006665chr12751 578 --1802 --
NM_001007023chr1464170 3883 3607 1385 1124 96 --11069 --
NM_001007024chr1763384 3277 3153 2761 736 50 1337 13730 --
NM_001007025chr1763384 3277 3153 2761 736 50 1337 13730 --
NM_001007097chr933636 1011 91 --14564 --
NM_001007099chr11246 ------
NM_001007100chr11246 ------
NM_001007156chr1511579 ----11777
NM_001007226chr1721376 231 --11115 --
NM_001007227chr1721376 231 --11115 --
NM_001007228chr1721376 231 --11115 --
NM_001007229chr1721376 231 --11115 --
NM_001007230chr1721376 231 --11115 --
NM_001007246chr2111926 ------
NM_001007250chr12368 31 ------
NM_001007271chr101396 --1763 --
NM_001007279chr222106 51 2125 100 ----
NM_001007466chr654492 4246 973 146 54 --14518 13257
NM_001007538chr1351475 1449 631 446 115 --11747 --
NM_001007553chr111057 ------
NM_001007559chr1841871 1832 795 535 1177 ----
NM_001007565chr3145 --1331 --
NM_001008220chr573604 2661 2560 820 441 393 110 ------
NM_001008222chrX3459 337 265 --1122 --
NM_001008239chr1831294 927 869 --13734 --
NM_001008388chr4----1408 159
NM_001008495chr82847 229 --1915 1746
NM_001008529chr1741302 1268 1053 93 ------
NM_001008564chr131413 --11876 --
NM_001008566chr221427 --1333 --
NM_001008660chr1111385 11211 ----
NM_001008701chr1972972 2730 2572 2379 2046 1044 1016 1359 22826 2152 --
NM_001008703chr6143 ------
NM_001008704chr6143 ------
NM_001008726chr1421194 156 ----1263
NM_001008738chr512503 --32669 2017 169 --
NM_001008860chr15------1635
NM_001008892chr15------1635
NM_001008894chr15------1635
NM_001008925chr423122 235 ------
NM_001009185chr52674 144 ------
NM_001009552chr8----148 --
NM_001009555chr4----21734 1419 --
NM_001009565chr21437 ------
NM_001009880chr22104732 4349 4275 4248 3315 3263 3170 1301 1244 646 --23137 559 --
NM_001009881chr1128 ------
NM_001009882chr1128 ------
NM_001009899chr345046 3960 1623 685 --85255 4716 4591 4077 2520 2190 1544 893 --
NM_001009909chr1133950 2594 253 --13326 --
NM_001009958chr7----1233 --
NM_001009959chr211633 --1530 --
NM_001009993chr253888 3707 3632 2895 74 --13775 1192
NM_001010852chr62152 143 ------
NM_001010861chr12869 729 ----11073
NM_001010867chr1102194 1628 1477 804 499 440 343 72 58 52 --55468 5365 2338 1743 1450 --
NM_001010891chr526435 437 --55112 4984 2715 662 423 --
NM_001010917chr1051469 636 248 226 48 --22003 598 --
NM_001010923chr611640 ------
NM_001010986chrX11952 --11977 1225
NM_001010989chr16131 ------
NM_001010990chr16131 ------
NM_001011513chr443926 3179 1096 166 ------
NM_001011545chr211207 ------
NM_001011645chrX1161 ------
NM_001011666chr742354 1554 1171 22 --1122 --
NM_001011708chr221092 339 ------
NM_001011713chr141651 --11066 --
NM_001012420chr15----1185 12003
NM_001012423chr15----1185 12003
NM_001012426chr633373 3279 521 --32536 1042 210 12852
NM_001012427chr633373 3279 521 --32536 1042 210 12852
NM_001012751chr10------11813
NM_001012756chr1922714 1133 --32895 2677 2550 --
NM_001012968chrX22661 2512 ----12769
NM_001012980chrX1158 170 ----
NM_001012989chrX1638 ------
NM_001013398chr721534 993 1419 ----
NM_001013399chr611109 ------
NM_001013415chr41127 ------
NM_001013438chr32755 627 ------
NM_001013439chr31601 ------
NM_001013615chr12439 55 21009 241 ----
NM_001013620chr1298384 6003 5965 3039 2102 1670 1527 1016 942 ------
NM_001013690chr1242488 2358 1961 1873 21650 296 1543 --
NM_001013693chr142383 426 341 313 --1924 --
NM_001013693chr142383 426 341 313 --1924 --
NM_001013699chr121411 ------
NM_001014434chr11248 ------
NM_001014797chr1078026 5136 2873 2775 2254 2115 1327 --17317 --
NM_001014809chr43809 688 650 ------
NM_001014839chr11789 --1132 1880
NM_001014841chr11789 --1132 1880
NM_001015053chr1741506 612 575 160 ------
NM_001015877chrX21205 1006 ----13042
NM_001015881chrX----11120 --
NM_001015887chr321550 1272 --11282 --
NM_001017369chr43956 712 342 --1300 1402
NM_001017371chr2--2884 486 11224 --
NM_001017395chr373073 3008 2887 2734 1113 886 318 --33183 2544 528 --
NM_001017396chr231734 807 675 ------
NM_001017415chr11115 ------
NM_001017416chr11115 ------
NM_001017423chr10139 ------
NM_001017440chr7116559 6265 6248 5360 3297 2940 1450 824 580 504 487 --56038 2328 2291 1175 678 --
NM_001017523chr1231317 302 170 ----161
NM_001017916chr1741944 1432 468 251 --21598 633 --
NM_001017917chr1741944 1432 468 251 --21598 633 --
NM_001017923chr142507 62 --1256 --
NM_001017926chr811596 --21439 1427 --
NM_001017928chr3195 ------
NM_001017930chrX------1226
NM_001017969chr91177 ------
NM_001017989chr193826 784 65 --3852 805 22 --
NM_001017995chr574012 3764 3263 1332 1111 744 378 ----2465 47
NM_001018054chr131335 897 380 --1906 --
NM_001018057chr111128 --1308 --
NM_001018064chr952108 1982 818 578 326 1363 ----
NM_001018065chr945757 5470 4765 1491 --24656 306 --
NM_001018066chr945757 5470 4765 1491 --24656 306 --
NM_001018067chr135035 4275 3474 ------
NM_001018068chr135035 4275 3474 ------
NM_001018069chr135035 4275 3474 ------
NM_001018072chr1231317 302 170 ----161
NM_001018074chr512644 ------
NM_001018075chr512644 ------
NM_001018076chr512644 ------
NM_001018077chr512644 ------
NM_001018090chr1562694 2512 841 750 684 245 ------
NM_001018091chr1562804 2622 951 860 794 355 ------
NM_001018102chr1562694 2512 841 750 684 245 ------
NM_001018108chr1542050 1748 1418 545 11483 21550 901 11998
NM_001018111chr751614 1389 1376 1122 1053 1140 23844 3586 --
NM_001020825chr51119 ------
NM_001023587chr32865 141 ------
NM_001024024chr142186 175 ------
NM_001024070chr142182 171 ------
NM_001024094chr512644 ------
NM_001024226chr131061 307 162 ----1352
NM_001024227chr131061 307 162 ----1352
NM_001024228chr131061 307 162 ----1352
NM_001024372chr831993 1822 808 --1594 --
NM_001024649chr53794 725 333 --1778 --
NM_001024660chr321092 194 --1365 --
NM_001024688chr851785 1444 578 193 119 ----1705
NM_001024809chr1731373 1187 46 --1874 --
NM_001024847chr312227 1986 ----
NM_001024858chr1492832 2824 2645 2402 2225 1965 1838 604 61 --11849 --
NM_001024934chr61191 ------
NM_001024935chr61191 ------
NM_001024936chr61191 ------
NM_001024937chr17194 --1732 --
NM_001024948chr133531 1246 619 12233 ----
NM_001024959chr31211 --126 --
NM_001024960chr31211 --126 --
NM_001025076chr1044242 2439 2242 976 --11254 16227
NM_001025077chr1075600 4977 4865 4773 2334 1006 500 --12612 17585
NM_001025079chr33795 415 325 --22646 80 --
NM_001025108chr263007 2970 2938 1487 1150 35 ------
NM_001025201chr2----1708 --
NM_001025232chr12------146
NM_001025266chr374374 4039 3493 1795 1772 1447 877 24712 4014 24273 3929 13701
NM_001025579chr1721069 34 ------
NM_001025580chrX33348 589 73 --13164 14191
NM_001025595chr41644 --11480 --
NM_001025596chr112463 36 ------
NM_001025603chr11339 1197 ----
NM_001025780chr911160 11496 11128 --
NM_001029859chr113950 524 59 --11643 1677
NM_001029863chr612288 12240 ----
NM_001029882chr1----147 --
NM_001029882chr1----147 --
NM_001029989chr151610 ------
NM_001030006chr17----1285 --
NM_001030007chr1663584 2928 1597 1303 1083 323 11253 12481 --
NM_001030055chr14--12965 33934 1149 790 --
NM_001031623chr621303 703 --134 --
NM_001031679chr1252582 1195 637 428 283 --2420 333 12310
NM_001031680chr131887 838 114 --1655 --
NM_001031684chr221323 189 ------
NM_001031690chr743075 2439 1959 590 ------
NM_001031695chr2255177 2142 1614 1598 1419 --25382 502 --
NM_001031717chr31629 ------
NM_001031732chr442811 2234 1401 681 --43228 2795 1296 1282 --
NM_001031804chr1622690 1039 --33460 1431 828 --
NM_001032282chr82897 38 ------
NM_001032283chr122998 32 1254 --1872
NM_001032284chr122998 32 1254 --1872
NM_001032288chr2011123 --1639 --
NM_001032293chr171220 ------
NM_001032296chr1322447 891 --12357 --
NM_001032363chr131892 443 265 --1245 1205
NM_001032363chr131892 443 265 --1245 1205
NM_001032380chr101359 --11977 --
NM_001032393chrX1700 ------
NM_001032999chr2065068 4843 4449 1610 1055 484 --45089 4081 1783 242 --
NM_001033047chr442639 2346 496 153 --1851 --
NM_001033059chr631403 394 372 ------
NM_001033087chr2083127 2916 2689 2633 1023 968 750 300 ------
NM_001033112chr52789 214 ------
NM_001033117chr3104672 3880 3867 3399 3384 1588 1418 1140 287 69 --3688 97 61 --
NM_001033506chr111387 ------
NM_001033507chr141692 1566 1345 1261 ----172
NM_001033518chr7145 --1194 --
NM_001033519chr7145 --1194 --
NM_001033520chr7145 --1194 --
NM_001033557chr231179 396 23 ------
NM_001033566chr171278 ------
NM_001033568chr171278 ------
NM_001033667chr14772 572 257 216 --1286 --
NM_001033925chr1022081 1591 ------
NM_001034954chr101864 --22211 791 --
NM_001034955chr101864 --22211 791 --
NM_001034956chr101864 --22211 791 --
NM_001034957chr101864 --22211 791 --
NM_001035254chr942231 1902 1043 454 --32082 1569 429 --
NM_001035511chr14328 299 253 182 ----11386
NM_001035512chr14435 406 360 289 ----11493
NM_001035513chr14435 406 360 289 ----11493
NM_001037131chr211293 ------
NM_001037164chr761287 601 388 289 194 46 --11427 --
NM_001037317chr12869 729 ----11073
NM_001037324chr3----1748 --
NM_001037334chr1822212 558 --1669 --
NM_001037339chr121181 263 --21418 115 --
NM_001037340chr121181 263 --21418 115 --
NM_001037341chr121181 263 --21418 115 --
NM_001037341chr121181 263 --21418 115 --
NM_001037533chr13303 274 195 ------
NM_001037582chr41419 --153 --
NM_001037954chr1122174 391 1281 12139 --
NM_001038493chr22404 374 11182 ----
NM_001038640chr151721 --1252 --
NM_001038702chr542714 2510 923 620 --22781 960 --
NM_001039199chr2063809 3272 3070 1576 1251 797 --24906 1127 --
NM_001039350chr721507 677 ------
NM_001039479chr1422086 787 --12285 --
NM_001039538chr243289 3258 2685 337 ----22724 215
NM_001039547chr385870 5817 5249 2907 2827 1865 1841 1805 17751 17007 1600
NM_001039550chr21700 --1691 --
NM_001039570chr2244359 4059 3956 3933 14490 --11145
NM_001039571chr2244359 4059 3956 3933 14490 --11145
NM_001039583chr223479 187 106 ------
NM_001039584chr223479 187 106 ------
NM_001039590chrX53571 3055 2810 661 212 148 ----
NM_001039591chrX53571 3055 2810 661 212 148 ----
NM_001039618chr1135590 4364 3888 25109 2157 44238 4034 1648 563 --
NM_001039690chr16111913 848 763 724 698 647 610 487 349 285 237 ----1786
NM_001039709chr2065068 4843 4449 1610 1055 484 --45089 4081 1783 242 --
NM_001039711chr11846 ----1367
NM_001039712chr11846 ----1367
NM_001039762chr1021639 145 ------
NM_001039775chr1135 ------
NM_001039840chrX35364 4801 79 ------
NM_001039877chr194728 600 235 105 ------
NM_001039916chr123764 134 101 ------
NM_001039917chr123764 134 101 ------
NM_001039918chr123764 134 101 ------
NM_001039919chr123764 134 101 ------
NM_001039920chr123764 134 101 ------
NM_001039937chr1343313 1198 1163 605 --12635 --
NM_001040144chr16111913 848 763 724 698 647 610 487 349 285 237 ----1786
NM_001040146chr16111913 848 763 724 698 647 610 487 349 285 237 ----1786
NM_001040151chr1133537 2882 29 ------
NM_001040152chr744561 3218 1967 1930 11653 --13888
NM_001040158chr51136 ------
NM_001040159chr4--1406 ----
NM_001040167chr7178 1883 ----
NM_001040214chr64919 366 285 61 --1835 --
NM_001040284chr1675960 4909 4714 4671 1361 1059 1008 --34385 1621 1241 1314
NM_001040402chr431042 928 397 ------
NM_001040409chr21836 --1744 --
NM_001040429chr1323131 121 --12921 --
NM_001040439chr1641435 1146 1006 538 ------
NM_001040440chr52209 156 ------
NM_001040441chr124097 227 ------
NM_001040455chr1131025 270 151 --1839 --
NM_001040624chr842560 2361 2296 372 ------
NM_001040625chr842560 2361 2296 372 ------
NM_001040626chr842560 2361 2296 372 ------
NM_001040627chr842560 2361 2296 372 ------
NM_001040628chr842560 2361 2296 372 ------
NM_001040629chr842560 2361 2296 372 ------
NM_001040630chr842560 2361 2296 372 ------
NM_001040708chr831015 395 368 ------
NM_001040709chr162019 968 839 642 555 177 1267 1114 --
NM_001040712chr923443 389 --13334 --
NM_001040715chr163824 769 478 --1346 11042
NM_001042353chr202493 386 --1199 --
NM_001042357chr104616 554 170 89 --11462 --
NM_001042358chr104616 554 170 89 --11462 --
NM_001042360chr104616 554 170 89 --11462 --
NM_001042361chr103585 201 120 --11493 --
NM_001042363chr104616 554 170 89 --11462 --
NM_001042364chr103585 201 120 --11493 --
NM_001042365chr103585 201 120 --11493 --
NM_001042387chr103585 201 120 --11493 --
NM_001042389chr104616 554 170 89 --11462 --
NM_001042390chr104616 554 170 89 --11462 --
NM_001042392chr104616 554 170 89 --11462 --
NM_001042393chr103585 201 120 --11493 --
NM_001042395chr104616 554 170 89 --11462 --
NM_001042396chr103585 201 120 --11493 --
NM_001042397chr103585 201 120 --11493 --
NM_001042404chr1----21893 1376 --
NM_001042413chr923043 493 --23087 2698 --
NM_001042424chr473286 2738 2381 2144 1248 1092 366 --1826 --
NM_001042453chrX1347 ------
NM_001042486chr2031121 510 317 --1158 --
NM_001042498chrX1291 --1120 --
NM_001042537chrX32205 927 505 ------
NM_001042550chr941621 666 612 252 ------
NM_001042552chr12934 585 ------
NM_001042555chr1233447 436 394 13110 34243 483 335 --
NM_001042599chr247685 7345 2257 1369 --177 1705
NM_001042601chr31658 --1835 --
NM_001042603chr12125145 4932 4783 4144 4031 3511 3453 3395 3337 1473 1057 141 --44021 740 342 114 --
NM_001042604chr333328 551 325 ----14400
NM_001042632chr2031897 298 181 1600 11939 --
NM_001042633chr2031897 298 181 1600 11939 --
NM_001042683chr641273 1148 409 150 ------
NM_001042749chrX11462 --1259 --
NM_001042750chrX11462 --1259 --
NM_001042751chrX11462 --1259 --
NM_001043318chr1443795 3471 1117 678 --12828 --
NM_001043351chr132105 1806 1609 ------
NM_001044305chr61146 ------
NM_001050chr1741227 545 101 73 ------
NM_001068chr32214 86 ------
NM_001071775chr1321962 168 ------
NM_001079874chr11193 ------
NM_001083620chr4--1665 22585 586 --
NM_001092chr172585 387 --21733 527 --
NM_001095chr1241942 1781 1717 1212 --21742 1488 --
NM_001106chr3139489 8427 7801 6944 6163 3622 3433 3073 2865 2813 2691 1716 1387 12430 67638 6784 3788 2107 1547 870 --
NM_001109977chr41173 ----1717
NM_001113490chrX23475 801 ------
NM_001121chr101294 --1196 --
NM_001128chr1663584 2928 1597 1303 1083 323 11253 12481 --
NM_001144chr16--1897 --1132
NM_001146chr811913 1248 ----
NM_001148chr42838 255 --21939 1691 --
NM_001163chr92990 277 ------
NM_001167chrX55901 5818 2455 2293 823 --14600 --
NM_001173chr14--12965 33934 1149 790 --
NM_001177chr1222291 716 ------
NM_001191chr2061276 1142 1092 942 423 211 ------
NM_001198chr6173 1790 32340 2037 976 --
NM_001204chr236570 4725 285 --17069 --
NM_001206chr921185 434 --12283 12839
NM_001212chr17141 ------
NM_001219chr711952 12024 11740 --
NM_001221chr4129 ------
NM_001222chr1051721 625 477 388 369 --11409 11738
NM_001233chr71155 12328 ----
NM_001241chr222033 951 1743 21863 457 --
NM_001241chr222033 951 1743 21863 457 --
NM_001256chr1712095 --22487 2178 --
NM_001257chr16----11264 --
NM_001259chr754622 1576 1261 109 52 13954 25496 1048 --
NM_001271chr1582988 2850 2731 2072 716 237 160 57 1816 12585 12689
NM_001280chr191173 --1445 1698
NM_001282chr17----1285 --
NM_001304chr1733251 2459 1079 --1577 1342
NM_001308chr10136 ------
NM_001313chr43809 688 650 ------
NM_001315chr652058 1447 525 382 51 ------
NM_001319chr1911104 ------
NM_001326chr111338 ------
NM_001329chr10----193 --
NM_001331chr1141934 1085 920 772 --21061 315 --
NM_001343chr511075 ----2210 51
NM_001351chr321343 356 11511 ----
NM_001356chrX2969 516 ------
NM_001357chr1----1279 --
NM_001364chr1152930 2895 265 218 79 --11039 --
NM_001365chr17157 --1617 --
NM_001386chr832128 1708 699 ------
NM_001387chr522920 2535 ------
NM_001389chr21----1475 --
NM_001390chr1832843 1077 648 --23088 992 11013
NM_001391chr1811114 ------
NM_001396chr212955 742 12615 2817 323 1837
NM_001399chrX63709 3693 1273 1136 644 578 11218 ----
NM_001402chr631996 1796 1401 ------
NM_001406chr1741415 1403 671 481 1606 ----
NM_001408chr121244 147 --11467 --
NM_001412chrX43141 1385 1014 366 ------
NM_001418chr11--1500 ----
NM_001418chr11--1500 ----
NM_001419chr1914778 --24579 1379 13213
NM_001420chr191361 ------
NM_001421chrX2469 422 --1198 --
NM_001427chr741723 522 464 433 ------
NM_001430chr2----2639 156 --
NM_001431chr61180 --1440 --
NM_001438chr1--12958 22264 963 --
NM_001440chr842270 2183 1003 540 --1527 12773
NM_001451chr16----11337 --
NM_001454chr171620 ------
NM_001460chr11147 1215 33321 605 167 --
NM_001465chr51821 ------
NM_001482chr152225 29 ------
NM_001493chrX1140 ------
NM_001494chr101670 --1229 --
NM_001497chr922643 656 --32577 2515 138 --
NM_001498chr62251 144 ------
NM_001523chr19133 ------
NM_001552chr1711042 ------
NM_001555chrX1107 ------
NM_001584chr1111213 1891 ----
NM_001616chr222147 772 12703 ----
NM_001634chr631403 394 372 ------
NM_001642chr111924 --1430 --
NM_001650chr1822811 2545 --11012 --
NM_001658chr131061 307 162 ----1352
NM_001660chr32532 46 ------
NM_001663chr142538 437 --1220 --
NM_001664chr3--1405 179 --
NM_001665chr111181 1500 ----
NM_001668chr131733 360 209 21961 454 21483 1399 --
NM_001678chr1731772 1366 555 --21305 631 --
NM_001679chr31269 ------
NM_001682chr1222744 61 22317 1859 12285 --
NM_001683chr332430 498 465 --12476 --
NM_001684chr123883 2922 --13682 --
NM_001690chr342043 1913 1832 833 1161 ----
NM_001694chr162309 159 --1113 --
NM_001695chr843170 3088 2895 143 --23859 937 --
NM_001701chr921050 257 --11353 --
NM_001709chr1132605 877 522 --12697 --
NM_001729chr4--1320 ----
NM_001730chr13--11256 --1225
NM_001730chr13--11256 --1225
NM_001731chr12--1607 ----
NM_001742chr71539 ----1715
NM_001743chr21220 ------
NM_001746chr53794 725 333 --1778 --
NM_001753chr7----11699 --
NM_001754chr2123296 1515 ------
NM_001755chr1632120 1962 740 11606 ----
NM_001759chr1264267 3901 3837 3272 3218 47 25216 3771 34524 3465 875 --
NM_001773chr121225 1138 --1584 --
NM_001777chr33795 415 325 --22646 80 --
NM_001789chr32564 409 1301 11694 --
NM_001792chr1821015 121 2291 82 ----
NM_001797chr16------125
NM_001800chr191128 ------
NM_001806chr1921172 35 12438 12905 --
NM_001822chr2----1708 --
NM_001829chr41352 1903 ----
NM_001830chrX52542 2452 1588 1265 605 23176 989 13408 12503
NM_001845chr1331234 1033 443 ------
NM_001858chr645115 4246 3294 894 --1369 --
NM_001873chr4----163 --
NM_001893chr171401 ----167
NM_001901chr6----1919 1265
NM_001915chr1741944 1432 468 251 --21598 633 --
NM_001920chr121742 ------
NM_001923chr11299 43 ------
NM_001930chr19--126 ----
NM_001933chr1431004 160 115 --11175 --
NM_001935chr21293 ------
NM_001936chr721507 677 ------
NM_001938chr1----11715 --
NM_001945chr511299 ------
NM_001949chr632958 378 330 ------
NM_001955chr641024 703 215 190 ------
NM_001962chr52232 44 ------
NM_001964chr531142 878 802 ------
NM_001967chr31420 ----1186
NM_001969chr1463204 2624 1586 1460 146 98 23472 1279 --1955
NM_001970chr172392 74 1571 1218 --
NM_001977chr4166 ----1332
NM_001982chr121145 ------
NM_001991chr1782228 1519 810 711 486 324 252 207 --151 --
NM_002006chr443888 2070 1431 285 --14151 1697
NM_002009chr15----22540 854 --
NM_002013chr141189 --154 --
NM_002014chr12------1135
NM_002015chr1353291 3056 2464 2437 668 ------
NM_002023chr1150 --21262 69 --
NM_002025chrX88678 7885 7515 5944 2948 2149 1785 1059 --39104 6964 2954 28848 373
NM_002035chr183635 231 78 --12868 --
NM_002037chr62409 26 ------
NM_002040chr213846 636 365 --11951 --
NM_002048chr9186 1377 ----
NM_002063chrX----1376 --
NM_002069chr7----1362 --
NM_002074chr121513 418 ------
NM_002079chr101446 ------
NM_002080chr162924 375 ------
NM_002082chr53203 123 69 ------
NM_002086chr1721910 610 --11587 --
NM_002092chr464582 4378 4364 3312 1077 833 --44588 3926 738 266 --
NM_002126chr1733259 2861 2574 --125 --
NM_002130chr51207 ------
NM_002131chr63404 358 223 ----1440
NM_002137chr7--11755 1293 --
NM_002147chr172670 152 ----1146
NM_002149chr22752 731 ------
NM_002158chr243210 3083 2484 727 ------
NM_002167chr12349 193 --1342 --
NM_002187chr521084 233 ------
NM_002190chr611194 1256 ----
NM_002193chr221666 702 --1523 --
NM_002196chr202379 361 ------
NM_002196chr202379 361 ------
NM_002198chr5----2663 286 --
NM_002199chr4----142 --
NM_002202chr5----1990 --
NM_002207chr3----151 --
NM_002210chr212670 199 ----
NM_002214chr713519 --15471 --
NM_002224chr63737 571 151 ------
NM_002230chr175978 440 248 159 39 --1849 --
NM_002232chr121388 58 ------
NM_002241chr192969 2811 2210 1014 930 455 271 136 33 ------
NM_002242chr211504 ------
NM_002264chr364973 4736 4207 3761 962 253 --2772 516 --
NM_002270chr565071 4965 4599 4364 1100 507 --24388 2189 --
NM_002271chr1342181 1641 953 696 --22468 2160 --
NM_002285chr263007 2970 2938 1487 1150 35 ------
NM_002293chr11940 ------
NM_002336chr1234041 3206 538 1361 ----
NM_002356chr622355 1819 1736 12697 --
NM_002359chr1773783 3620 2987 2945 1621 1298 27 --34172 3531 1534 --
NM_002373chr151850 ------
NM_002374chr243289 3258 2685 337 ----22724 215
NM_002375chr331640 1574 1493 --1380 --
NM_002382chr142894 396 ------
NM_002383chr16----1790 --
NM_002384chr182730 135 ------
NM_002387chr553225 1878 1219 503 309 13603 24116 3864 --
NM_002395chr62930 39 ------
NM_002401chr171927 21987 1962 1852 --
NM_002442chr1221233 353 ------
NM_002451chr943329 3236 2918 2667 ----12507
NM_002465chr12----1224 --
NM_002480chr12----31339 1283 469 --
NM_002481chr196191 5779 5209 4979 3159 3073 2998 1601 673 --47850 5670 5576 5194 27549 6286
NM_002482chr12278 118 --1203 --
NM_002485chr851785 1444 578 193 119 ----1705
NM_002499chr1522083 537 --22444 2411 --
NM_002501chr1963916 1523 1446 1311 437 376 ------
NM_002505chr631321 1219 480 ------
NM_002509chr202786 638 ------
NM_002518chr211126 --2376 101 --
NM_002519chr1121452 1327 ------
NM_002522chr1733491 984 358 --1400 --
NM_002537chr154992 704 683 340 --1392 --
NM_002541chr731041 359 347 ------
NM_002546chr8183 ------
NM_002547chrX63404 3323 3188 3077 1169 27 1414 33705 1366 654 11338
NM_002553chr71163 ------
NM_002556chr1131930 1523 860 ------
NM_002570chr151910 --1280 --
NM_002572chr11----2399 347 --
NM_002576chr1121157 988 ------
NM_002577chr373687 2783 2739 2701 864 242 99 --23885 3693 --
NM_002581chr955226 4444 1255 725 92 13951 ----
NM_002588chr51479 --11761 --
NM_002594chr2042269 1778 1708 391 ------
NM_002595chr121213 ----1385
NM_002599chr1141053 961 919 56 ------
NM_002600chr121181 263 --21418 115 --
NM_002603chr8162 --1212 --
NM_002607chr71121 --1879 --
NM_002608chr2241577 1168 587 352 ------
NM_002609chr551185 746 596 169 66 ------
NM_002613chr1675111 4980 1714 1394 1257 1193 751 13958 43993 3688 1876 1311 25260 2065
NM_002616chr172173 42 ------
NM_002618chr21163 ------
NM_002641chrX1653 ------
NM_002643chr21202 ------
NM_002646chr161641 1605 881 722 664 136 --12077 --
NM_002651chr14884 616 312 227 ------
NM_002655chr865258 5011 4254 3737 1486 799 14718 --15334
NM_002656chr631077 128 109 ------
NM_002657chr2053679 3413 2697 2441 506 --11142 13789
NM_002667chr61433 1202 ----
NM_002677chr8----128 --
NM_002687chr1411069 ------
NM_002693chr15173 ------
NM_002697chr1193 ------
NM_002698chr1952509 1052 183 131 57 ------
NM_002706chr22462 147 ------
NM_002707chr21124 ------
NM_002709chr223198 2843 ----1834
NM_002713chr121013 260 ------
NM_002714chr641047 714 256 72 ------
NM_002716chr1173057 3000 2924 2826 2563 520 25 12309 ----
NM_002717chr83526 476 452 ------
NM_002718chr32617 545 ----11844
NM_002719chr1422347 2107 ----12338
NM_002721chr91538 ------
NM_002730chr191330 ------
NM_002731chr152921 2866 1005 427 128 ------
NM_002734chr1711965 12120 ----
NM_002736chr7--1171 1512 --
NM_002740chr322154 678 --32624 2421 2029 --
NM_002747chr182548 214 21813 279 31845 1579 530 --
NM_002750chr10178 ----1218
NM_002755chr15----1214 --
NM_002756chr172854 685 ------
NM_002758chr172490 167 ------
NM_002779chr102535 375 --1515 --
NM_002791chr141158 ------
NM_002806chr14143 ------
NM_002809chr171321 ------
NM_002811chr161546 ------
NM_002819chr1931355 543 324 ------
NM_002821chr63654 218 25 --2298 151 --
NM_002826chr15804 715 648 269 102 --2782 352 --
NM_002827chr201554 1503 11409 --
NM_002834chr1293347 3010 1571 1464 1103 1027 844 519 351 --1647 --
NM_002839chr923443 389 --13334 --
NM_002841chr3164 --1556 --
NM_002843chr1123423 2127 --11133 --
NM_002844chr63988 873 505 --11283 --
NM_002849chr121709 ------
NM_002850chr19----1785 --
NM_002851chr7------1621
NM_002854chr22----124 --
NM_002855chr1142967 1406 682 609 --1175 1237
NM_002857chr142699 933 550 357 1587 11081 --
NM_002860chr10139 ------
NM_002865chr8------1103
NM_002867chr11467 ------
NM_002868chr1231831 932 196 --32060 922 601 12207
NM_002869chr1142157 593 341 86 --12145 --
NM_002874chr932230 1830 251 --1433 --
NM_002881chr211421 ------
NM_002883chr223734 699 28 ------
NM_002886chr334973 3309 136 --13704 --
NM_002888chr3140 ------
NM_002893chrX2114 107 --1360 --
NM_002897chr22726 693 --1765 --
NM_002902chr15----1148 --
NM_002906chr1122322 63 --1729 --
NM_002907chr121420 ------
NM_002911chr1941443 1265 515 34 ------
NM_002918chr19172 --1391 1885
NM_002923chr11236 --1638 --
NM_002924chr11402 ------
NM_002938chr411334 11265 11381 --
NM_002941chr31630 ------
NM_002942chr321336 355 ------
NM_002953chr12751 578 --1802 --
NM_002959chr173679 3469 3274 2924 1108 497 277 12885 23203 3120 11402
NM_002968chr16160 --1237 --
NM_002977chr233202 2838 2802 --1427 --
NM_002979chr11246 ------
NM_002998chr811449 ----21933 372
NM_002999chr2031719 1577 23 --2396 231 --
NM_003001chr14435 406 360 289 ----11493
NM_003011chr91582 --11191 --
NM_003016chr1731785 1334 69 ------
NM_003028chr933243 3052 2454 --43765 2745 2494 1212 12936
NM_003031chr161850 --11008 --
NM_003034chr1267576 7170 7017 6856 394 164 ----1435
NM_003039chr14413 210 54 30 ------
NM_003043chr373991 3902 3571 2867 1501 618 31 11515 13231 --
NM_003045chr1395063 4851 3838 3766 3486 1041 617 606 360 --11553 --
NM_003070chr91694 ------
NM_003071chr32472 216 ------
NM_003076chr122593 246 --2333 85 --
NM_003077chr171694 ----1200
NM_003079chr171125 ------
NM_003081chr202244 185 ------
NM_003088chr7----11084 --
NM_003098chr20149 --2213 156 --
NM_003101chr131625 1023 409 1117 ----
NM_003106chr3----1711 --
NM_003107chr62653 137 12035 ----
NM_003108chr267171 5438 2657 2427 1149 465 --15665 --
NM_003110chr171963 ------
NM_003111chr2--2884 486 11224 --
NM_003112chr731985 1295 117 11281 --12178
NM_003128chr21583 ------
NM_003130chr721198 1031 ------
NM_003131chr641763 1606 1480 343 --22037 1797 --
NM_003137chr632017 1722 1416 1429 1210 --
NM_003139chr111665 --1799 --
NM_003144chr631759 596 28 ----1257
NM_003155chr8----2916 529 --
NM_003156chr111196 ----11294
NM_003157chr3157 --2636 207 --
NM_003161chr1743322 3202 2518 1285 --11245 12894
NM_003178chr322095 1985 ------
NM_003179chrX31265 1069 1045 --2530 407 --
NM_003185chr20----21103 239 --
NM_003188chr61536 ------
NM_003189chr1113253 3099 2767 2555 2268 2068 976 750 421 310 246 --22542 169 --
NM_003193chr11195 ------
NM_003199chr1834014 3647 1828 --23903 3814 1793
NM_003200chr19112031 1904 1775 1738 1474 1456 827 591 462 219 204 --11583 --
NM_003211chr12----21750 602 --
NM_003216chr2262821 2724 1309 1293 1052 163 1913 12458 13255
NM_003217chr1251630 1478 1256 568 191 ------
NM_003221chr653881 3795 3491 3441 2616 --193 --
NM_003223chr162759 281 ------
NM_003236chr273182 3034 2237 1292 744 147 116 11250 ----
NM_003242chr312227 1986 ----
NM_003246chr1541395 777 651 104 ------
NM_003247chr6182 ------
NM_003253chr212573 242 ----1586
NM_003255chr1752050 2025 1053 985 717 --22193 2166 --
NM_003262chr333539 3307 1436 --24172 321 14329
NM_003269chr61420 --1528 --
NM_003270chrX1378 11127 ----
NM_003275chr911479 --1320 --
NM_003286chr201962 ------
NM_003291chr131163 ------
NM_003295chr13149 ------
NM_003298chr376213 5234 3921 2500 2129 1054 754 --35604 5305 1024 14962
NM_003304chr311301 --1202 11272
NM_003320chr1153745 1454 1291 626 96 11500 23566 1424 13918
NM_003334chrX177 ------
NM_003339chr51602 --21392 648 --
NM_003342chr1743085 2986 2872 909 --32865 2653 1142 --
NM_003345chr162372 205 ------
NM_003347chr2242310 1552 696 162 --22046 477 --
NM_003349chr2011123 --1639 --
NM_003368chr11115 ------
NM_003370chr191158 ------
NM_003375chr10181 ----149
NM_003387chr242700 1899 397 257 --11958 --
NM_003390chr1121075 177 1345 ----
NM_003392chr332746 835 479 ------
NM_003400chr2----1795 --
NM_003404chr201645 ----11320
NM_003406chr821707 289 ------
NM_003409chr18------11067
NM_003410chrX1814 --3628 567 38 --
NM_003411chrY11820 --135 11327
NM_003412chr3----22454 457 --
NM_003420chr31315 --1258 --
NM_003430chr191241 ------
NM_003432chr51484 --1492 --
NM_003442chr11------1788
NM_003453chr13----1693 --
NM_003455chr11----21211 497 11586
NM_003457chr171220 ------
NM_003458chr343321 3193 2641 490 ------
NM_003468chr22382 170 1317 ----
NM_003470chr1641552 661 563 153 --11586 --
NM_003472chr6----21484 1151 --
NM_003473chr101281 ------
NM_003474chr102956 586 1369 1517 --
NM_003478chr1113202 ------
NM_003483chr1222386 2138 --22153 96 --
NM_003488chr173962 822 226 ------
NM_003489chr21--13134 1843 --
NM_003502chr161131 ------
NM_003505chr72619 380 --11764 --
NM_003507chr23798 618 384 ----12010
NM_003557chr1--21532 199 ----
NM_003559chr1793206 3134 3011 2876 2440 1352 1335 1266 1198 1124 --13396
NM_003563chr1721376 231 --11115 --
NM_003564chr13634 558 228 ------
NM_003566chr12172 ----22385 1069
NM_003574chr1885380 5275 4950 4361 4104 2027 1777 133 11956 15316 15111
NM_003576chr1322447 891 --12357 --
NM_003581chr221032 60 ------
NM_003583chr1263646 3479 2861 2595 2577 2387 12947 13051 --
NM_003590chr222705 350 1189 --13253
NM_003595chr221427 --1333 --
NM_003601chr4160 ------
NM_003607chr144110 3670 1370 1224 12738 ----
NM_003615chr3----23827 3659 --
NM_003617chr164242 4084 3933 1048 359 190 --14312 --
NM_003618chr2------1989
NM_003620chr17151 1755 1149 --
NM_003626chr111370 1997 11123 --
NM_003629chr163084 3033 2515 2252 1285 998 --23453 1393 12771
NM_003634chr222782 270 ------
NM_003637chr131333 458 275 1177 11494 --
NM_003644chr1785592 5248 4746 4442 1901 1743 1292 383 12295 35759 1556 542 --
NM_003662chrX123 ------
NM_003663chr3----12616 --
NM_003670chr33436 366 296 --1406 --
NM_003671chr972920 2900 2883 2655 982 481 296 --1345 --
NM_003677chr1252325 857 647 68 30 ------
NM_003679chr153129 2477 2409 854 818 ------
NM_003685chr191634 ------
NM_003690chr24663 469 423 179 ------
NM_003693chr172652 572 ------
NM_003705chr21780 ------
NM_003713chr1--1569 1153 --
NM_003714chr532538 1093 566 12650 1774 --
NM_003716chr311028 ------
NM_003718chr71132 ------
NM_003722chr352686 2378 2264 2200 466 ----1189
NM_003735chr51479 --11761 --
NM_003736chr51479 --11761 --
NM_003740chr681464 1381 745 681 322 308 133 36 ------
NM_003741chr31281 ------
NM_003743chr25541 422 323 303 210 ------
NM_003744chr1421084 411 ----11282
NM_003749chr1342137 1529 782 431 1555 1303 --
NM_003750chr101928 ------
NM_003759chr42974 533 ------
NM_003763chr2033027 2431 62 --11291 --
NM_003766chr17137 ------
NM_003768chr131848 1570 1284 ------
NM_003774chr1232551 600 246 ------
NM_003779chr11334 ------
NM_003787chr18------189
NM_003796chr191634 ------
NM_003800chr641577 554 309 99 ----12086
NM_003822chr122949 2413 --22512 852 --
NM_003825chr15----11024 --
NM_003829chr92359 102 ------
NM_003860chr111130 --1372 --
NM_003872chr232557 2489 351 ------
NM_003873chr102930 123 ------
NM_003877chr12------1836
NM_003884chr311233 ------
NM_003904chr112227 131 ------
NM_003913chr62490 338 --1350 --
NM_003924chr41236 11301 1115 --
NM_003927chr182996 768 --181 --
NM_003930chr732391 2362 2129 ------
NM_003931chr61191 ------
NM_003932chr2221831 1528 ------
NM_003934chr91372 ------
NM_003941chr722368 1740 ------
NM_003948chr43981 688 144 12583 ----
NM_003953chr112382 --2473 382 11158
NM_003957chr1121094 389 --1252 --
NM_003958chr653619 1112 494 418 58 ------
NM_003966chr566112 2900 1820 1344 791 21 --44750 4744 2175 1103 12907
NM_003969chr191232 --1121 --
NM_003980chr611335 --21323 235 1344
NM_003981chr15131 ------
NM_003982chr142115 44 ------
NM_003987chr1062220 1547 851 757 670 654 ------
NM_003988chr1062297 1624 928 834 747 731 ------
NM_003989chr1062156 1483 787 693 606 590 ------
NM_003990chr1062156 1483 787 693 606 590 ------
NM_003994chr121418 --23364 1633 13692
NM_004006chrX1832 --1558 --
NM_004007chrX1832 --1558 --
NM_004009chrX1832 --1558 --
NM_004010chrX1832 --1558 --
NM_004011chrX1832 --1558 --
NM_004012chrX1832 --1558 --
NM_004013chrX1832 --1558 --
NM_004014chrX1832 --1558 --
NM_004015chrX1832 --1558 --
NM_004016chrX1746 --1472 --
NM_004017chrX1832 --1558 --
NM_004018chrX1746 --1472 --
NM_004020chrX1832 --1558 --
NM_004021chrX1746 --1472 --
NM_004022chrX1746 --1472 --
NM_004023chrX1746 --1472 --
NM_004024chr11544 21308 592 ----
NM_004028chr1822811 2545 --11012 --
NM_004035chr1765058 3996 3841 3314 1261 452 --24521 1046 --
NM_004036chr2--1211 ----
NM_004037chr12829 80 ------
NM_004050chr1432192 1109 708 --1738 --
NM_004067chr71218 ------
NM_004077chr122993 79 ------
NM_004081chrY11391 11537 11369 --
NM_004086chr141673 ------
NM_004089chrX----11120 --
NM_004093chr131184 --12857 --
NM_004094chr1421063 223 ------
NM_004099chr932080 1372 81 ------
NM_004100chr622281 1770 ----1201
NM_004103chr8184 ------
NM_004112chr1731660 631 463 --1648 --
NM_004114chrX2836 461 ------
NM_004117chr6156 --1656 --
NM_004153chr1262 32 ------
NM_004156chr8----148 --
NM_004162chr32801 383 ------
NM_004170chr91399 ------
NM_004171chr11119509 9355 9212 8259 7485 7358 6784 5843 2609 2191 2155 19268 11853 --
NM_004180chr2------1601
NM_004183chr11----1727 --
NM_004185chr11266 ------
NM_004187chrX------11131
NM_004209chr163840 285 273 --1947 --
NM_004215chr8--1456 ----
NM_004232chr1812598 ----22522 703
NM_004240chr19197 ------
NM_004241chr101729 --1764 --
NM_004263chr221401 1337 11165 31697 1536 1144 --
NM_004273chr10135043 4626 4606 4462 3813 3553 3284 3073 1754 1557 1344 1332 1097 ------
NM_004290chr511057 --11140 --
NM_004295chr1731087 1040 198 --1914 --
NM_004296chr1453947 2951 2726 2601 622 --22581 814 --
NM_004309chr1751076 987 939 325 140 ------
NM_004311chr1042868 894 845 331 ------
NM_004319chr142514 566 214 68 12860 ----
NM_004321chr263423 2648 2332 2237 1427 1209 --12509 --
NM_004326chr11352 1397 1970 --
NM_004331chr82917 201 ------
NM_004337chr832082 669 76 --11740 --
NM_004349chr811005 ------
NM_004350chr131887 838 114 --1655 --
NM_004364chr1941276 968 211 139 ------
NM_004367chr621110 178 --21756 1750 --
NM_004373chr122173 141 ------
NM_004379chr2147 ------
NM_004380chr1632480 1870 192 ------
NM_004385chr5----1526 --
NM_004392chr1311641 ------
NM_004393chr352160 2083 2073 835 79 ------
NM_004395chr51671 --1225 --
NM_004396chr17----1277 --
NM_004397chr1133627 2633 1164 --24165 2725 --
NM_004414chr211376 ----11277
NM_004416chr121708 --11079 --
NM_004420chr1131847 1800 906 --22173 2063 --
NM_004427chr151003 898 862 251 171 1223 ----
NM_004429chrX31022 965 466 --1128 --
NM_004430chr822811 107 --21720 694 --
NM_004431chr13540 158 58 ------
NM_004432chr922040 354 ------
NM_004433chr13721 676 179 ------
NM_004438chr222045 844 11219 23251 469 --
NM_004440chr611258 --21500 57 --
NM_004441chr321147 97 --1860 --
NM_004449chr2121359 1016 --21271 1048 1305
NM_004457chr21405 ------
NM_004458chrX--1458 ----
NM_004463chrX3481 178 140 ------
NM_004468chr1125 ------
NM_004474chr11993 ------
NM_004481chr152242 1814 1094 960 125 --1756 --
NM_004491chr1973715 2857 2683 1424 862 436 212 24343 4105 31287 363 63 --
NM_004494chr131192 1056 77 ------
NM_004501chr113456 --32708 2521 760 --
NM_004503chr122631 268 ------
NM_004504chr222646 2134 ----1677
NM_004505chr1711553 --11324 --
NM_004514chr171458 --12347 1142
NM_004515chr1--169 ----
NM_004516chr191502 --2864 117 --
NM_004535chr2021444 413 --1688 --
NM_004537chr1221113 41 ------
NM_004550chr12137 75 ------
NM_004559chr1--1394 ----
NM_004560chr91417 --1905 1848
NM_004566chr1021934 640 --1806 --
NM_004571chr2143352 2576 1267 1206 --13088 --
NM_004575chr411499 --11661 --
NM_004576chr5176 ------
NM_004578chr11838 ------
NM_004588chr1183571 2731 1025 647 435 402 371 360 --23363 974 --
NM_004593chr31615 ------
NM_004596chr19----1201 --
NM_004598chr531072 552 248 --13089 --
NM_004602chr201433 --1329 --
NM_004612chr964732 4665 4574 4546 1592 1169 14082 11519 1292
NM_004621chr1121258 456 ------
NM_004622chr232478 1889 1665 --31919 1823 24 --
NM_004630chr1121138 47 ------
NM_004631chr131335 897 380 --1906 --
NM_004634chr3----1106 --
NM_004635chr341037 1010 918 28 --1397 1310
NM_004637chr3158 --2426 418 --
NM_004654chrY--147 ----
NM_004663chr151203 --1333 --
NM_004666chr61524 --1213 --
NM_004667chr152613 220 ------
NM_004687chr1711349 --21951 1808 --
NM_004690chr6------1684
NM_004705chr11122 ------
NM_004713chr141619 ------
NM_004718chr22168 97 ------
NM_004725chr1021135 980 ------
NM_004726chrX55422 4713 2081 1397 650 --24968 2169 --
NM_004730chr531730 1505 536 ------
NM_004734chr1342935 2371 2215 486 ------
NM_004736chr112183 ------
NM_004737chr223984 936 72 1324 ----
NM_004738chr2062485 2279 1810 1777 313 116 ------
NM_004742chr331621 420 157 ------
NM_004744chr433312 1176 177 11217 --1671
NM_004745chr8106287 5926 5905 5012 4621 2414 2208 1364 1288 229 --35187 4815 1477 --
NM_004748chr1533870 2578 818 --1866 --
NM_004762chr1741766 585 35 24 ----11613
NM_004765chr16----146 --
NM_004768chr1----1470 --
NM_004772chr541517 1378 1291 250 ------
NM_004774chr1723016 928 --1127 --
NM_004775chr18--21490 618 ----
NM_004776chr2062673 2390 2096 2027 1178 847 --32408 403 232 --
NM_004783chr161457 ------
NM_004788chr1121061 201 --12232 --
NM_004789chr9186 ------
NM_004796chr1422182 373 --21897 603 1916
NM_004801chr2--1627 1549 --
NM_004805chr22305 225 1492 1954 --
NM_004808chr1052459 2333 2309 2273 1338 --22490 2296 --
NM_004822chr1793210 3103 2694 2563 1345 1309 1249 1119 101 ------
NM_004824chr611065 --1481 --
NM_004827chr42782 249 ------
NM_004839chr15--1474 1186 --
NM_004840chrX72357 2114 2027 529 467 336 273 --193 --
NM_004841chr11759 ------
NM_004842chr61319 11515 ----
NM_004845chrX83609 3592 3177 1571 1294 1208 1099 145 --1873 --
NM_004849chr631622 289 255 ----1171
NM_004850chr231662 1522 1263 ------
NM_004856chr151404 ------
NM_004857chr1453839 3714 3086 2983 1775 13981 11695 --
NM_004859chr1742964 2716 1137 243 ------
NM_004863chr1465244 5016 3662 3484 3417 925 --33517 3336 57 25301 615
NM_004866chr52637 463 ------
NM_004871chr1763384 3277 3153 2761 736 50 1337 13730 --
NM_004884chr151499 ----11722
NM_004888chr91723 1405 ----
NM_004893chr51136 ------
NM_004897chr101773 ------
NM_004904chr742354 1554 1171 22 --1122 --
NM_004905chr11129 ------
NM_004922chr102916 869 ------
NM_004924chr192962 230 ------
NM_004925chr91558 --140 --
NM_004926chr1421504 219 ------
NM_004929chr8----11485 1511
NM_004947chr342049 1812 617 204 ------
NM_004952chr13923 222 67 ------
NM_004953chr31156 ------
NM_004956chr744438 3651 157 133 ------
NM_004958chr1142 --1709 --
NM_004962chr103303 233 162 ------
NM_004965chr21----1708 --
NM_004973chr621632 342 --21585 473 --
NM_004975chr201375 --1332 --
NM_004976chr1143461 2075 1328 208 --15026 11408
NM_004978chr141543 473 435 149 --1392 --
NM_004985chr1222748 267 ------
NM_004992chrX166054 5904 5717 5393 2786 2655 2232 1641 1483 1451 1425 1040 818 699 539 151 --15693 --
NM_004992chrX166054 5904 5717 5393 2786 2655 2232 1641 1483 1451 1425 1040 818 699 539 151 --15693 --
NM_004993chr141342 --2957 410 --
NM_004998chr151656 --1640 --
NM_004999chr644186 808 454 136 --1956 --
NM_005003chr16----121 --
NM_005006chr21290 --1837 --
NM_005017chr31252 ------
NM_005020chr7--1214 1158 --
NM_005023chr51552 --1146 11276
NM_005028chr10152 12204 ----
NM_005030chr16------1278
NM_005032chrX183 ------
NM_005054chr2--1407 ----
NM_005056chr12125389 5176 5027 4388 4275 3755 3697 3639 3581 1717 1301 385 --44265 984 586 358 --
NM_005060chr131237 1083 36 --1149 --
NM_005066chr12814 139 ------
NM_005067chr33851 192 148 ------
NM_005070chr21211 ------
NM_005072chr164190 62 36 22 ------
NM_005077chr9--1505 ----
NM_005078chr15----21459 565 --
NM_005087chr31601 ------
NM_005093chr2065068 4843 4449 1610 1055 484 --45089 4081 1783 242 --
NM_005094chr93664 559 182 ------
NM_005095chr111550 --1525 --
NM_005096chrX21184 222 1472 3338 202 159 --
NM_005105chr121639 456 ------
NM_005109chr362146 1921 1806 889 756 69 --12352 --
NM_005116chr2084484 2779 1584 1324 1072 729 371 22 --23866 339 13194
NM_005119chr11831 1243 ----
NM_005121chr1743367 3248 550 372 1795 ----
NM_005124chr6----2868 308 --
NM_005151chr1822212 558 --1669 --
NM_005154chr15----1576 --
NM_005155chr63565 157 77 --156 --
NM_005156chr944940 4771 3366 955 --14551 --
NM_005160chr2245786 4911 2642 2605 36351 6305 5906 15502 --
NM_005187chr1681910 1878 1846 1814 1782 437 96 82 ----1711
NM_005188chr11107639 6904 6722 5705 5575 2840 1843 908 554 204 --87687 7606 7006 5220 5064 2656 2544 1340 --
NM_005189chr1751873 1581 363 212 124 2625 30 11811 --
NM_005190chr611109 ------
NM_005194chr20----1477 --
NM_005197chr1425483 4170 11927 ----
NM_005202chr13278 187 30 --1119 --
NM_005207chr2293564 2754 2318 1410 1010 869 786 400 288 --23547 486 --
NM_005219chr541651 1353 362 138 11503 ----
NM_005224chr19----1715 --
NM_005225chr201483 ------
NM_005233chr312550 --1353 --
NM_005234chr192310 104 ------
NM_005235chr247685 7345 2257 1369 --177 1705
NM_005238chr1162781 1394 1251 635 273 248 ----12840
NM_005239chr2132030 1542 1263 --21910 1610 1135
NM_005241chr3----1943 --
NM_005252chr142711 592 ------
NM_005259chr2------11126
NM_005264chr101223 --1876 --
NM_005273chr71114 --1295 --
NM_005277chr4----11795 --
NM_005279chr2----134 --
NM_005311chr742685 2227 822 283 ------
NM_005324chr1731988 855 411 ------
NM_005329chr1632175 733 162 ------
NM_005339chr411612 ------
NM_005349chr41587 ------
NM_005359chr1885677 5596 5377 4299 4238 2374 2330 1732 15244 26469 2293 14837
NM_005381chr21121 1412 ----
NM_005386chr201740 ------
NM_005387chr112524 140 ------
NM_005388chr951734 533 489 303 216 --21440 86 --
NM_005397chr751614 1389 1376 1122 1053 1140 23844 3586 --
NM_005398chr101916 --2199 25 --
NM_005402chr721505 183 --1386 --
NM_005406chr18----11330 --
NM_005410chr51137 ------
NM_005418chr11--1557 ----
NM_005425chr16121 ------
NM_005430chr12----1992 --
NM_005433chr1812164 12233 11102 --
NM_005436chr1023008 2601 --32973 488 330 --
NM_005438chr113513 206 77 ------
NM_005440chr1722842 888 ----1562
NM_005442chr31558 ------
NM_005443chr42579 146 --1493 --
NM_005458chr921715 117 ------
NM_005461chr20----1353 --
NM_005471chr551111 1090 1077 1005 48 ------
NM_005474chr1741506 612 575 160 ------
NM_005475chr1242983 1040 1014 726 --1201 12857
NM_005477chr1572413 2210 1786 1745 1637 810 730 ------
NM_005477chr1572413 2210 1786 1745 1637 810 730 ------
NM_005479chr1031401 1302 978 --21242 98 --
NM_005493chr6----1607 --
NM_005494chr71601 ------
NM_005497chr1786132 5778 5481 4909 4828 3949 2465 1833 --23766 2319 1463
NM_005512chr111105 ------
NM_005520chr51692 --1665 --
NM_005523chr731549 293 149 --11379 --
NM_005529chr121001 334 --11033 --
NM_005530chr1511290 --21328 127 --
NM_005537chr131198 ------
NM_005550chr163575 482 44 ------
NM_005561chr131934 --1853 --
NM_005563chr11337 --1214 --
NM_005573chr5------1136
NM_005578chr344394 3879 3590 211 13891 1327 --
NM_005594chr12194 ------
NM_005595chr12740 204 ------
NM_005596chr965380 4746 4365 3944 2318 2299 --15553 --
NM_005602chr3------11226
NM_005604chr632345 844 798 --12049 --
NM_005627chr6----1623 --
NM_005637chr1841871 1832 795 535 1177 ----
NM_005638chrX21725 235 ------
NM_005639chr1221892 719 ------
NM_005644chr1----1300 --
NM_005647chrX73255 2795 2607 2403 1340 951 597 --11141 12522
NM_005652chr161300 ------
NM_005655chr82897 38 ------
NM_005659chr221424 1438 159 --
NM_005662chr81364 ----171
NM_005664chr1531059 410 23 --1232 --
NM_005665chr143619 1829 710 63 ------
NM_005668chr534345 908 872 --13062 --
NM_005688chr31136 ------
NM_005715chr642679 1964 500 209 12413 --127
NM_005718chr31211 --126 --
NM_005722chr21759 --21871 603 --
NM_005724chr15177 --2136 31 1610
NM_005730chr1252264 1454 925 641 591 --22626 419 --
NM_005735chr2----173 --
NM_005736chr1031319 277 198 ------
NM_005737chr242735 1984 947 682 --12094 --
NM_005738chr761287 601 388 289 194 46 --11427 --
NM_005740chr223766 107 35 1894 ----
NM_005742chr21681 --1106 --
NM_005748chr1243241 3064 996 204 ------
NM_005759chr234560 3338 44 --23757 526 --
NM_005779chr543279 2965 2564 885 ------
NM_005795chr211896 --1573 --
NM_005814chr161323 1066 946 502 161 62 ------
NM_005822chr632163 2053 438 ------
NM_005826chr12568 79 ------
NM_005828chr1733919 3796 35 ------
NM_005840chrX87482 7156 6408 6046 5973 2803 2782 1293 --35009 1623 1432 27295 2709
NM_005852chr1731108 916 260 --1407 --
NM_005868chr72686 44 --1169 --
NM_005871chr1021018 126 138 ----
NM_005876chr21689 --1697 --
NM_005880chr162473 116 ------
NM_005895chr1243753 1081 762 279 13552 23073 465 --
NM_005896chr22744 658 ------
NM_005897chr131100 1010 155 ------
NM_005898chr1132434 675 323 ------
NM_005900chr4--1990 ----
NM_005901chr1866895 5899 3045 2789 1143 905 28445 7474 28012 3431 26142 2177
NM_005905chr132342 56 ------
NM_005909chr531668 1216 1150 --24057 1310 --
NM_005920chr153447 2927 1082 939 345 --32865 2713 1042 --
NM_005927chr51920 ----11042
NM_005928chr15258 25 --1658 --
NM_005933chr113626 220 68 --12279 --
NM_005935chr485082 4902 3629 3527 1739 987 580 285 12056 ----
NM_005937chr1773147 3111 1472 1345 1065 1018 53 --1672 --
NM_005938chrX41364 562 298 273 ----1348
NM_005941chr863963 2813 1504 1060 890 251 --13653 12571
NM_005944chr331120 950 38 ------
NM_005955chr1135236 4962 4555 3969 3771 2195 2138 2056 1448 1024 878 854 374 13352 ----
NM_005966chr221649 361 ------
NM_005967chr121751 ------
NM_005999chr111139 --196 --
NM_006007chr963861 3690 3328 1753 685 653 ------
NM_006011chr1531165 693 346 --14011 --
NM_006015chr111266 --1352 --
NM_006016chr621680 1407 ------
NM_006030chr321359 143 ------
NM_006033chr1822213 140 1811 1583 --
NM_006035chr1421193 43 --1500 --
NM_006037chr273446 3139 1834 1797 1291 822 635 --14145 --
NM_006038chr2031530 558 451 --1647 --
NM_006047chr2023451 1102 --22944 948 --
NM_006048chr1------1970
NM_006063chr2--157 ----
NM_006070chr3145 --1331 --
NM_006079chr6----1262 --
NM_006080chr71181 ------
NM_006089chrX21484 1445 21541 1251 11816 --
NM_006091chr1521624 1133 --11769 --
NM_006095chr421004 272 --14452 1714
NM_006106chr1122666 452 ----11236
NM_006113chr11193 ------
NM_006116chr2251589 1355 1321 647 231 ------
NM_006135chr11106 11211 ----
NM_006136chr721360 232 ------
NM_006141chr1672800 1817 1723 1093 1075 904 149 --12447 --
NM_006148chr1762908 2855 2676 2462 1822 286 --22440 880 --
NM_006158chr831632 1499 215 --2732 208 --
NM_006160chr171169 ----11392
NM_006161chr52233 181 ------
NM_006166chr1211856 --11945 --
NM_006178chr172421 58 --11415 --
NM_006180chr952108 1982 818 578 326 1363 ----
NM_006191chr121711 --2851 186 --
NM_006194chr1421213 1125 ------
NM_006195chr9--11086 --1323
NM_006201chrX4473 231 185 165 ------
NM_006202chr1942003 1523 468 186 ------
NM_006203chr585470 5127 4837 4790 3838 3553 3449 1334 --14232 --
NM_006206chr422565 2434 ------
NM_006216chr21643 ------
NM_006224chr1752118 2071 1886 1647 701 --12320 --
NM_006237chr133905 882 63 ------
NM_006243chr13933 818 760 ----1869
NM_006244chr113582 401 114 --2178 101 --
NM_006246chr141267 ------
NM_006251chr54708 556 322 296 ------
NM_006259chr42830 365 ------
NM_006267chr231814 1731 1465 ------
NM_006268chr1121012 377 ------
NM_006272chr212618 495 ------
NM_006275chr2031997 1641 79 1407 21894 441 --
NM_006282chr2084553 4224 3995 3250 1491 626 61 41 --1724 --
NM_006283chr874361 4306 4296 3920 1775 446 358 ------
NM_006287chr212448 ------
NM_006292chr11----1160 --
NM_006296chr2------1112
NM_006306chrX45102 4608 4451 207 1984 12206 --
NM_006310chr1731235 968 881 --1508 1914
NM_006313chr1211743 --11534 --
NM_006315chr463675 3110 1597 1444 945 331 ------
NM_006320chr421105 30 ------
NM_006321chr332032 575 212 --21374 659 --
NM_006323chr41135 ------
NM_006329chr142657 274 ------
NM_006336chr92423 399 11087 21328 1224 --
NM_006352chr11293 --11761 --
NM_006353chr631418 1032 448 --2403 98 --
NM_006354chr34260 148 88 34 ------
NM_006359chrX32205 927 505 ------
NM_006366chr62969 111 ----11275
NM_006369chr11158 1335 ----
NM_006375chrX21675 1575 --21219 563 --
NM_006379chr712328 1361 11490 --
NM_006380chr1722734 2728 1765 --13801
NM_006386chr2242330 2128 2048 1592 --12289 --
NM_006393chr1034390 1600 1412 21784 1388 14540 1535
NM_006407chr321381 306 ------
NM_006411chr61843 --1345 --
NM_006415chr93881 79 23 --11144 --
NM_006420chr2032376 136 121 12484 ----
NM_006430chr21414 --1117 --
NM_006434chr101864 --22211 791 --
NM_006454chr432703 1075 25 --1757 --
NM_006457chr443926 3179 1096 166 ------
NM_006458chr11124 ------
NM_006460chr1731800 1721 1438 11420 1131 --
NM_006482chr1263646 3479 2861 2595 2577 2387 12947 13051 --
NM_006517chrX31717 515 211 --1256 --
NM_006526chr2041877 1405 777 28 ------
NM_006534chr2052988 2191 1141 760 557 --1639 --
NM_006538chr244083 3070 1162 1013 13223 1997 --
NM_006544chr1442440 2131 1332 1112 --25356 2205 --
NM_006547chr731463 768 349 --11805 --
NM_006548chr331632 560 436 --11514 --
NM_006555chr741839 672 617 263 ------
NM_006557chr921470 1300 ------
NM_006559chr11173 ------
NM_006560chr112463 36 ------
NM_006561chr1044242 2439 2242 976 --11254 16227
NM_006565chr16----2356 92 --
NM_006566chr182388 323 --1365 --
NM_006570chr92392 99 ------
NM_006572chr174637 233 213 152 1293 ----
NM_006584chr17--1128 ----
NM_006587chr421718 338 --152 --
NM_006599chr1657321 5160 2879 1488 917 25290 1248 38101 2433 420 --
NM_006601chr121909 ------
NM_006602chr20------1699
NM_006603chrX11462 --1259 --
NM_006609chr232584 2404 2350 ------
NM_006614chr333554 3048 399 ----12548
NM_006618chr111531 ------
NM_006624chr1011924 --11827 --
NM_006625chr13732 340 98 ------
NM_006625chr13732 340 98 ------
NM_006625chr13732 340 98 ------
NM_006628chr1553648 3416 2915 1678 1330 --44394 3944 968 315 1519
NM_006634chr2153 ------
NM_006636chr21836 --1744 --
NM_006640chr1721697 353 --11839 --
NM_006644chr131447 ------
NM_006646chr1341108 543 151 56 ------
NM_006650chr573604 2661 2560 820 441 393 110 ------
NM_006654chr1233447 436 394 13110 34243 483 335 --
NM_006662chr162121 26 ------
NM_006667chrX1999 ------
NM_006675chr1253204 2959 2424 2292 485 ----13386
NM_006677chr33215 88 33 ------
NM_006690chr2061977 1901 1525 1506 147 32 1734 ----
NM_006694chr1--130 ----
NM_006698chr202982 131 --1211 --
NM_006699chr132286 967 80 --1371 --
NM_006703chr61176 ------
NM_006705chr9123 ------
NM_006706chr51339 ------
NM_006708chr611006 --11081 --
NM_006713chr51681 --2262 68 --
NM_006717chr933199 2530 2162 --11158 --
NM_006718chr631077 128 109 ------
NM_006722chr331186 1081 585 ----1881
NM_006729chrX84706 4199 3694 3609 2154 1494 1072 310 --11877 --
NM_006734chr611056 --11411 --
NM_006736chr231710 368 307 --11701 --
NM_006738chr1594583 4315 3459 2972 1470 1328 1280 1180 275 13936 21535 1431 --
NM_006742chr1661926 1913 1892 1769 381 241 --21291 307 11546
NM_006745chr43956 712 342 --1300 1402
NM_006749chr821033 40 --1883 --
NM_006754chr7----1100 --
NM_006761chr172262 113 ------
NM_006763chr121910 199 ------
NM_006764chr3177 ----1458
NM_006766chr81988 ------
NM_006769chr1----1491 --
NM_006775chr622946 2372 ------
NM_006777chrX42912 2260 821 689 --22799 626 --
NM_006788chr1852095 1991 771 736 297 1205 ----
NM_006791chr151525 ------
NM_006795chr1141536 1381 459 307 --11442 --
NM_006802chr11115 1268 ----
NM_006807chr1731096 264 93 ------
NM_006809chr202156 136 --2784 317 --
NM_006815chr121966 --1895 --
NM_006823chr821280 219 ------
NM_006826chr2----21033 184 --
NM_006827chr1433229 2698 69 ------
NM_006832chr141788 ------
NM_006836chr122568 429 --1435 --
NM_006851chr1212825 1454 153 --
NM_006852chr1752580 2490 2107 703 204 ------
NM_006854chr721980 1638 --21580 1419 --
NM_006856chr123761 262 149 ----1806
NM_006861chr1271887 1785 1557 733 659 620 534 --1337 --
NM_006874chr411137 --1820 --
NM_006885chr1632755 463 275 --11337 --
NM_006888chr1432799 2772 349 ------
NM_006892chr2011253 --1291 --
NM_006892chr2011253 --1291 --
NM_006898chr21592 ------
NM_006914chr91539 ------
NM_006915chrX22278 1924 ------
NM_006922chr212026 ----1592
NM_006941chr221137 1367 ----
NM_006946chr111547 ------
NM_006950chrX2770 720 ------
NM_006959chr191350 --1328 --
NM_006981chr922198 2030 ------
NM_006987chr1741224 1070 912 813 ------
NM_006999chr511949 --21446 1419 --
NM_007005chr91309 ------
NM_007010chr172729 212 --2648 235 --
NM_007011chr1556303 2291 1831 508 353 ----14248
NM_007038chr2135865 5237 4680 --14667 --
NM_007039chr1422182 231 --11493 --
NM_007042chr322597 260 ----1794
NM_007050chr20157795 7654 7636 7378 7118 6614 6021 5802 5600 2786 1859 1261 1000 631 277 23179 2056 46415 5808 2998 2820 --
NM_007052chrX165 ----1559
NM_007054chr542947 2935 2859 2632 ------
NM_007064chr321092 194 --1365 --
NM_007067chr1721511 1290 --11167 --
NM_007069chr11150 ------
NM_007074chr16------1102
NM_007078chr103971 829 490 --32943 2010 846 --
NM_007084chr1311248 --1355 11410
NM_007106chr131795 ------
NM_007118chr51691 1584 --1864
NM_007122chr12584 21 ------
NM_007124chr61327 ------
NM_007129chr131396 ------
NM_007137chrX105042 4489 4262 4082 3980 3840 3789 3625 1986 1659 --11259 --
NM_007158chr111057 ------
NM_007159chr321316 277 ------
NM_007166chr1111385 11211 ----
NM_007173chr11135 ----1169
NM_007174chr1252318 1936 1697 1479 521 11507 1682 --
NM_007185chr12312 95 --21022 240 --
NM_007191chr122623 107 ------
NM_007197chr12----2753 342 --
NM_007200chr1594583 4315 3459 2972 1470 1328 1280 1180 275 13936 21535 1431 --
NM_007203chr911401 11009 23384 2735 12715
NM_007207chr11666 ------
NM_007216chr111357 ------
NM_007218chr81185 ------
NM_007219chr203921 347 169 --1862 --
NM_007221chr13391 333 68 ------
NM_007222chr811596 --21439 1427 --
NM_007235chr12----189 --
NM_007236chr1521896 801 --31689 958 740 --
NM_007246chr41189 --1911 --
NM_007247chr172828 261 ------
NM_007249chr1376895 6801 3209 2738 2021 732 159 16155 ----
NM_007271chr61565 ------
NM_007275chr331135 319 72 --1803 --
NM_007276chr7--156 ----
NM_007278chr17----1137 --
NM_007280chr152337 91 137 ----
NM_007282chr3----1979 --
NM_007283chr392984 2587 1908 1195 999 598 79 65 30 --1438 --
NM_007292chr1765058 3996 3841 3314 1261 452 --24521 1046 --
NM_007294chr1731274 360 336 --161 --
NM_007295chr1731274 360 336 --161 --
NM_007296chr1731274 360 336 --161 --
NM_007297chr1731274 360 336 --161 --
NM_007298chr1731274 360 336 --161 --
NM_007299chr1731274 360 336 --161 --
NM_007300chr1731274 360 336 --161 --
NM_007302chr1731274 360 336 --161 --
NM_007303chr1731274 360 336 --161 --
NM_007304chr1731274 360 336 --161 --
NM_007305chr1731274 360 336 --161 --
NM_007308chr42240 216 ------
NM_007346chr202325 129 ------
NM_007347chr1522442 989 --2880 430 --
NM_007358chr11736 --178 --
NM_007365chr121913 1577 --1551 --
NM_007373chr1021370 1174 --11796 --
NM_007375chr132634 2032 1750 --22651 921 --
NM_012064chr121988 --1389 --
NM_012081chr533693 2939 729 ------
NM_012090chr11496 ------
NM_012095chr1043347 2968 2232 339 --12668 --
NM_012098chr91550 --11294 --
NM_012104chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_012104chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_012115chr61528 ------
NM_012120chr622631 2452 1201 ----
NM_012141chr1343313 1198 1163 605 --12635 --
NM_012156chr2083245 3137 3110 2292 2248 1375 1307 66 --12657 --
NM_012158chr131391 --11461 --
NM_012193chr1194964 4219 4139 3952 3287 1315 1182 426 228 11435 35190 1965 1551 --
NM_012199chr164681 3644 3513 2948 1760 1143 --44009 3321 1771 1052 --
NM_012207chr10145 --11024 --
NM_012215chr1031805 1438 68 --21841 1783 --
NM_012223chr221060 105 ----1333
NM_012224chr4153 ------
NM_012234chr31816 13588 ----
NM_012238chr10----1687 --
NM_012247chr103925 893 295 ------
NM_012249chr211374 --23593 329 --
NM_012250chr1111052 --11058 --
NM_012257chr7----1941 --
NM_012262chr155065 4640 3731 1979 1648 --24007 1995 --
NM_012264chr2252089 1734 1549 725 186 ------
NM_012264chr2252089 1734 1549 725 186 ------
NM_012281chr722196 1870 ------
NM_012285chr174429 329 110 77 ------
NM_012287chr331447 451 117 --14104 --
NM_012288chr664732 3724 1904 1803 860 169 --2637 270 --
NM_012294chr753395 3351 3249 2788 2613 ------
NM_012297chr411853 --2712 79 22480 2466
NM_012300chr532511 454 352 --22099 1775 --
NM_012301chr72890 227 ------
NM_012302chr1164 1400 1838 --
NM_012306chr1242825 2544 2310 1085 ----23502 400
NM_012307chr182700 325 --1818 --
NM_012308chr1132438 1841 869 ----11718
NM_012309chr11104027 3737 1748 1374 1164 509 458 440 289 168 ------
NM_012316chr1115363 5260 4519 4406 4149 2244 1750 1427 1391 1206 805 --11081 --
NM_012323chr22--11139 1482 --
NM_012324chr221746 --181 --
NM_012325chr201568 1534 21615 1556 --
NM_012329chr17------11405
NM_012334chr571795 1759 1690 1178 128 111 54 11139 21463 1237 --
NM_012342chr102478 45 ------
NM_012347chr612618 --42415 1940 803 560 --
NM_012382chr523502 3338 --2772 230 --
NM_012392chr12472 48 ------
NM_012402chr111105 --1492 --
NM_012407chr223479 187 106 ------
NM_012410chr162446 142 ------
NM_012419chr6----1137 1404
NM_012425chr1032156 191 104 --2281 26 --
NM_012431chr7--12626 ----
NM_012432chr1157 ------
NM_012437chr11475 ------
NM_012448chr1722038 1627 --2942 644 --
NM_012465chr1032909 2402 2271 ----13242
NM_012471chrX21361 578 --21873 347 --
NM_012479chr721926 533 1668 ----
NM_012482chr1130 ------
NM_013230chrY3598 294 98 ------
NM_013232chr51375 ------
NM_013233chr2------1350
NM_013240chr2184101 3930 3715 3666 2521 1302 1029 574 22531 1043 ----
NM_013245chr162707 162 ------
NM_013253chr111128 --1308 --
NM_013261chr423668 2428 ------
NM_013264chr112157 89 ------
NM_013267chr12------1420
NM_013269chr1233719 784 285 ------
NM_013281chr20------11399
NM_013282chr1911288 ------
NM_013304chr16149 ------
NM_013309chr15----12176 --
NM_013316chr7------1694
NM_013323chr1741210 904 463 415 ------
NM_013336chr321758 503 --21617 597 11301
NM_013341chr221092 339 ------
NM_013354chr8------1214
NM_013357chr8----1804 --
NM_013368chr193198 112 49 --1590 --
NM_013372chr1553321 2653 1209 313 85 --12524 --
NM_013374chr3--22981 2207 12409 --
NM_013381chr1232094 1950 893 12336 12158 --
NM_013390chr921414 353 ------
NM_013400chr721016 874 ------
NM_013403chr194728 600 235 105 ------
NM_013446chr73956 540 28 ------
NM_013449chr1222766 818 ------
NM_013451chr10--1151 ----
NM_013943chr113085 --12741 --
NM_013989chr1464170 3883 3607 1385 1124 96 --11069 --
NM_013995chrX1836 12156 ----
NM_014010chr91495 ------
NM_014011chr242601 2487 2119 93 ------
NM_014016chr33178 94 29 ------
NM_014023chr1031115 927 62 ------
NM_014038chr7186 --1422 --
NM_014042chr112258 21 ------
NM_014048chr1633647 2048 215 21221 972 13239 13569
NM_014089chr131413 --11876 --
NM_014106chr153867 783 29 --2576 391 --
NM_014110chr121013 260 ------
NM_014112chr844007 3899 2091 1192 ------
NM_014117chr1622142 444 12104 1188 --
NM_014153chr16----1622 --
NM_014154chr331477 1230 365 ------
NM_014155chr1176197 2946 1807 1501 1028 670 288 14652 67438 6671 6648 2443 1465 325 16961
NM_014170chr31324 ------
NM_014181chr242790 1919 854 58 22505 2294 ----
NM_014182chr12------1631
NM_014191chr1211046 ------
NM_014213chr21164 --1225 --
NM_014214chr18--1343 1155 --
NM_014225chr193111 85 27 ------
NM_014232chr1731177 572 187 --1396 --
NM_014232chr1731177 572 187 --1396 --
NM_014233chr1722125 104 --1728 --
NM_014238chr1751423 1210 455 196 31 --2461 324 --
NM_014240chr343475 2598 1266 916 --11218 --
NM_014243chr412066 ------
NM_014253chrX--1950 ----
NM_014255chr12126 ------
NM_014271chrX1135 ------
NM_014275chr53909 779 594 ------
NM_014284chr11789 --1132 1880
NM_014286chr963644 2582 2530 2412 2383 800 --42556 2358 1281 1133 12591
NM_014289chrX1405 2482 68 ----
NM_014299chr1951516 1387 816 727 33 ------
NM_014309chr2255167 2132 1604 1588 1409 --25372 492 --
NM_014319chr12----31278 571 60 --
NM_014323chr22----1171 --
NM_014326chr1531445 1242 241 ------
NM_014331chr4107150 6809 6603 6567 5673 5631 2589 2386 1359 1205 ----15184
NM_014333chr1132312 1924 1136 11015 ----
NM_014338chr222331 57 ----1410
NM_014345chr621029 41 --2794 343 --
NM_014351chr2231067 911 249 ------
NM_014368chr91349 --31776 384 159 --
NM_014372chr131433 1296 538 ------
NM_014374chr721016 874 ------
NM_014382chr321088 388 --1215 --
NM_014399chr71203 --1266 --
NM_014405chr1772244 2127 1789 655 563 380 124 --3607 299 148 --
NM_014415chr3----1390 11408
NM_014423chr544055 3828 2177 1854 --11509 14293
NM_014426chr201616 ------
NM_014445chr312430 ----11720
NM_014447chr41644 --11479 --
NM_014452chr62981 783 ------
NM_014456chr10--11257 --1538
NM_014469chr112848 289 ------
NM_014491chr7----1286 --
NM_014494chr1622315 709 --22043 1547 --
NM_014496chrX----156 --
NM_014498chr31331 ------
NM_014505chr121360 ------
NM_014507chr222793 203 --1894 --
NM_014515chr121136 ------
NM_014521chr211503 11752 1548 --
NM_014554chr1222315 877 1377 ----
NM_014572chr131204 --1572 --
NM_014574chr141229 --1990 --
NM_014577chr224759 706 666 25 ------
NM_014604chr175554 190 169 138 80 --1144 --
NM_014608chr15----1404 --
NM_014612chr91449 ------
NM_014615chr1642272 1356 1265 585 ------
NM_014630chr1531038 969 729 --22932 228 11180
NM_014635chr2--1371 11301 --
NM_014636chr973541 3533 1628 824 797 399 142 11091 ----
NM_014646chr1842054 1053 885 392 1755 11000 --
NM_014663chr12447 317 ------
NM_014667chr342391 1647 1524 678 ------
NM_014670chr251069 998 623 294 118 ------
NM_014671chr71618 --21407 322 --
NM_014679chr1121014 147 11175 ----
NM_014680chr171141 ------
NM_014682chr822200 894 ------
NM_014683chr1742036 1953 1637 1460 ------
NM_014685chr16131 ------
NM_014686chr1942334 964 690 180 --1238 12588
NM_014690chr743075 2439 1959 590 ------
NM_014693chr3----1748 --
NM_014702chr613271 ----1758
NM_014709chr21486 --1254 --
NM_014711chr1611365 ------
NM_014723chr2062791 2332 2321 2242 695 496 --12076 --
NM_014729chr821573 385 --1644 --
NM_014730chr12105140 4937 4927 4529 4318 4302 3944 3759 3285 996 --25187 1069 --
NM_014730chr12105140 4937 4927 4529 4318 4302 3944 3759 3285 996 --25187 1069 --
NM_014731chr2031511 615 538 ------
NM_014733chr511904 1468 ----
NM_014737chr2031637 1035 936 --13510 11665
NM_014739chr633335 2577 665 14000 23777 1130 1756
NM_014743chr452592 2135 508 458 414 --12162 --
NM_014747chr1115783 5281 4651 4557 4315 4230 1873 1681 745 439 392 13758 ----
NM_014748chr23367 313 94 ------
NM_014751chr8--11621 ----
NM_014755chr234096 3209 473 --11665 --
NM_014757chr531756 699 98 --1929 11977
NM_014764chr12----2391 302 --
NM_014765chr122402 300 --11918 --
NM_014766chr743340 2407 488 110 --23490 753 --
NM_014770chr1211197 ------
NM_014771chr16------1790
NM_014774chr162994 2943 2346 1224 1173 431 ------
NM_014776chr1222455 453 139 ----
NM_014779chr31284 --1118 --
NM_014781chr82302 155 ------
NM_014784chr13282 167 54 ------
NM_014786chr113818 806 187 11216 ----
NM_014787chr162534 2214 2091 1063 900 509 --12806 1447
NM_014798chr1751661 1263 1180 750 513 ------
NM_014802chr121208 ------
NM_014803chr1022880 2574 --22560 917 --
NM_014806chr9282 23 ------
NM_014807chr111827 1740 --1731
NM_014810chr152997 1197 862 397 50 ----23050 2480
NM_014812chr1----21893 1376 --
NM_014813chr12498 483 ----1158
NM_014819chr512011 --1313 1737
NM_014824chr1131597 282 141 --1417 --
NM_014826chr144110 3670 1370 1224 12738 ----
NM_014827chr1--1664 1341 --
NM_014836chr101359 --11977 --
NM_014838chr222897 350 1651 ----
NM_014841chr611108 --11333 --
NM_014850chr3104672 3880 3867 3399 3384 1588 1418 1140 287 69 --3688 97 61 --
NM_014857chr1----179 --
NM_014871chr122501 69 ------
NM_014873chr121415 1043 21228 916 13237 14419
NM_014876chr2252179 1598 821 783 62 --12218 --
NM_014877chr1766546 6118 5307 5257 2161 898 --21739 1292 --
NM_014893chrY3873 767 455 ------
NM_014897chr1732676 982 939 --23121 2053 --
NM_014899chr542903 2756 1215 210 --1635 1170
NM_014902chr2031121 510 317 --1158 --
NM_014903chr122754 126 21681 766 1683 --
NM_014904chr1011094 ------
NM_014905chr211910 --1276 --
NM_014906chr1743913 3396 2751 388 ------
NM_014909chr1442816 2455 1017 370 12865 13270 --
NM_014912chr101132 --12878 --
NM_014914chr211293 ------
NM_014920chr62509 197 ------
NM_014921chr1972972 2730 2572 2379 2046 1044 1016 1359 22826 2152 --
NM_014923chr1362267 1869 787 701 657 225 --11621 --
NM_014932chr3----170 1485
NM_014937chr101496 --131 --
NM_014938chr1262395 1991 1622 769 460 318 --11931 --
NM_014945chr521978 1233 ------
NM_014946chr21207 --43049 2536 1239 274 --
NM_014947chr122543 255 --12934 --
NM_014950chr1421598 330 ------
NM_014952chr1591816 1370 1276 709 569 531 469 346 114 --1581 --
NM_014961chr411933 --12171 --
NM_014962chr2022663 225 ------
NM_014969chr11860 --1328 --
NM_014974chr101602 11160 ----
NM_014977chr142548 102 ------
NM_014978chr103629 527 295 --11356 --
NM_014982chr1434092 3683 833 --25231 4287 --
NM_014989chr61165 --11284 --
NM_014990chr142245 92 --1906 --
NM_014991chr452580 2077 443 373 32 --1595 --
NM_014996chr31784 --2700 81 --
NM_014997chr762781 2341 2212 2018 1189 987 1113 21006 604 --
NM_014999chr122448 291 11279 1561 --
NM_015000chr12----1322 --
NM_015002chr121244 21620 861 ----
NM_015005chr142562 424 --11707 --
NM_015008chr373073 3008 2887 2734 1113 886 318 --33183 2544 528 --
NM_015009chr31106 ------
NM_015015chr192689 681 ----1441
NM_015017chr1----11250 --
NM_015020chr1623521 2846 13108 1778 --
NM_015023chr12419 292 --2468 172 --
NM_015026chr1251895 1606 1450 1420 118 1210 ----
NM_015027chr1631715 437 154 11822 ----
NM_015032chr1322675 511 1324 1701 --
NM_015039chr124043 1174 --34165 1664 1361 --
NM_015042chr15113930 3842 3811 3799 3172 3063 589 354 311 267 52 --54311 3885 1465 903 686 --
NM_015049chr23625 485 72 ------
NM_015051chr933277 2956 2668 --11117 --
NM_015052chr71397 ------
NM_015060chr7----1191 --
NM_015063chr1921140 77 --2367 147 --
NM_015064chr1242814 2583 972 560 13372 12892 --
NM_015068chr733413 819 782 1505 --12740
NM_015069chr161600 ------
NM_015071chr5116395 5947 4661 4488 4202 1962 1770 1448 1214 862 591 12185 36474 5270 1882 --
NM_015074chr1134490 3775 3173 1992 1768 1655 1548 721 666 493 353 223 108 --24715 522 --
NM_015075chrX21437 246 ------
NM_015076chr613273 --23521 2951 --
NM_015082chr532386 963 131 --12042 --
NM_015087chr1322603 609 ----1194
NM_015091chr141776 ------
NM_015092chr161202 --14501 --
NM_015093chr621716 1618 --1510 --
NM_015097chr331727 1711 1471 ------
NM_015100chr132000 1491 1335 ----2682 553
NM_015101chr152589 2259 1882 620 417 --2742 504 --
NM_015107chrX42334 1878 611 519 ------
NM_015110chr932114 975 548 ----11784
NM_015113chr1731555 1541 1502 ------
NM_015115chr431042 928 397 ------
NM_015130chr431221 386 116 ------
NM_015132chr7--11799 ----
NM_015133chr1641435 1146 1006 538 ------
NM_015138chr15--1245 12524 --
NM_015144chr1643699 2578 1524 352 13189 23315 839 --
NM_015149chr131903 710 367 --21686 629 --
NM_015150chr31113 1860 ----
NM_015155chr102470 397 --22731 450 --
NM_015156chr1452836 1239 1198 618 384 --33133 1079 442 --
NM_015161chr1641105 1098 378 212 ------
NM_015170chr822327 257 ------
NM_015171chr163178 106 88 ------
NM_015172chr131544 189 94 11614 11399 --
NM_015176chr11108 ------
NM_015185chrX12670 --12228 --
NM_015186chr91362 1383 ----
NM_015192chr202792 525 ------
NM_015193chr821382 1057 11470 150 --
NM_015199chr332990 2584 2169 ------
NM_015200chr411021 ------
NM_015206chr1573880 3822 2773 2537 2512 1069 430 ----11003
NM_015215chr111258 ------
NM_015225chr931952 798 581 --1645 --
NM_015234chr631197 1005 147 ------
NM_015236chr411448 --1295 --
NM_015238chr51645 --1732 --
NM_015250chr91416 --11832 --
NM_015251chr1622103 743 --12071 --
NM_015256chr52674 144 ------
NM_015260chr1921050 58 ------
NM_015264chr22104732 4349 4275 4248 3315 3263 3170 1301 1244 646 --23137 559 --
NM_015265chr231630 1040 663 --22379 562 1116
NM_015267chr121683 ----11994
NM_015268chr3------1547
NM_015269chr1128 ------
NM_015271chr443746 1634 1553 253 --42756 1371 1353 34 --
NM_015272chr1621497 1467 ----11816
NM_015275chr1211393 --1492 --
NM_015278chr632625 2099 742 --22938 2595 --
NM_015282chr252921 2209 1867 972 439 --2616 555 --
NM_015284chr151866 1342 594 405 132 ------
NM_015285chr1832389 2082 135 ------
NM_015288chr543574 3309 2658 186 --12457 --
NM_015292chr124667 290 196 148 ------
NM_015293chr61157 1631 ----
NM_015299chr1463720 3125 2711 2640 535 528 1580 ----
NM_015310chr836560 2121 981 25982 5866 38023 3276 2977 15496
NM_015314chr72320 123 ------
NM_015315chr521294 124 --13249 --
NM_015316chr1411084 --128 1101
NM_015317chr2--12690 22857 2337 --
NM_015326chr142704 2675 1965 724 ------
NM_015327chr131242 1226 425 --11006 --
NM_015335chr1231907 1732 420 --1298 --
NM_015346chr142480 32 --21560 555 --
NM_015347chr1241837 1043 767 187 --22298 2187 --
NM_015349chr622064 100 22857 2799 11101 --
NM_015354chr91384 ------
NM_015355chr17--11604 21375 427 --
NM_015358chr21----1996 --
NM_015361chr2162 ------
NM_015365chrX33348 589 73 --13164 14191
NM_015375chr174683 3397 3364 3273 1794 1275 274 --34498 3907 1575 --
NM_015382chr141668 1130 ----
NM_015385chr101864 --22211 791 --
NM_015387chr221871 784 --11526 --
NM_015397chr931218 1191 304 --1238 --
NM_015401chr123916 417 86 ------
NM_015404chr92593 68 ------
NM_015435chr8--3977 369 195 --1300
NM_015436chr422941 54 ------
NM_015441chr11335 ------
NM_015443chr173623 445 256 --2956 378 --
NM_015446chr151267 1133 334 229 129 ------
NM_015455chr533708 3636 1507 --11074 --
NM_015460chr33769 252 192 --11609 --
NM_015461chr181309 ----1238
NM_015463chr21646 172 ----
NM_015465chr51201 1532 ----
NM_015470chr231212 1075 227 ------
NM_015475chr21141 ------
NM_015477chr152886 330 ------
NM_015481chr121997 --11008 --
NM_015497chr151932 ------
NM_015508chr31334 ------
NM_015528chr172167 131 ------
NM_015530chr21247 ------
NM_015532chr1562694 2512 841 750 684 245 ------
NM_015535chr262596 2558 1360 1128 1090 994 --1184 --
NM_015548chr6------1127
NM_015550chr7------13178
NM_015554chr15----11834 --
NM_015555chr621303 703 --134 --
NM_015565chr2122085 1649 ------
NM_015567chr13--1255 1447 --
NM_015570chr71624 --11447 --
NM_015575chr2123355 2991 2709 2489 2467 1464 1362 1200 1182 753 417 133 --12450 23481 3288
NM_015576chr321997 1847 ----12460
NM_015577chr521435 108 --1427 21516 321
NM_015605chr103585 201 120 --11493 --
NM_015609chr152363 2120 1100 1082 766 ------
NM_015610chr7145 --1194 --
NM_015630chr2------1812
NM_015640chr135035 4275 3474 ------
NM_015641chr74965 884 846 47 ------
NM_015642chr31293 ----1240
NM_015657chr2141 ------
NM_015678chr131553 ------
NM_015686chrX22138 745 --21675 969 --
NM_015691chrX52815 2713 2486 2198 2032 --22783 2543 --
NM_015695chr61128 --1596 --
NM_015704chr222117 38 ------
NM_015716chr17194 --1732 --
NM_015723chr71200 ------
NM_015726chr131777 1189 244 ------
NM_015836chr12274 29 1408 --1130
NM_015844chr182730 135 ------
NM_015846chr182730 135 ------
NM_015847chr182730 135 ------
NM_015850chr861783 1694 501 365 144 132 ------
NM_015872chr141722 1699 1398 643 --11267 --
NM_015874chr41587 ------
NM_015878chr832226 1867 1852 ------
NM_015881chr111128 --1308 --
NM_015888chr1--1495 23027 290 --
NM_015898chr1931682 598 430 21827 1623 ----
NM_015906chr184503 4284 3306 3284 3258 1864 1801 670 1564 13357 --
NM_015912chr842326 2232 321 22 --12473 --
NM_015932chr132559 148 --1565 --
NM_015949chr71642 1261 ----
NM_015976chr11239 ------
NM_015989chr122228 26 ------
NM_015995chr1575117 5003 4761 1345 649 524 485 --45429 3966 886 53 --
NM_016003chr7145 --1194 --
NM_016009chr111804 1428 34724 3260 134 --
NM_016021chr622555 807 --22744 2247 --
NM_016023chr822010 1489 --1883 --
NM_016025chr1621907 564 --11974 --
NM_016032chrX3459 337 265 --1122 --
NM_016037chr14999 466 442 245 ------
NM_016038chr72143 75 ------
NM_016059chr61380 --198 --
NM_016061chr21491 --11605 --
NM_016073chr1511146 ------
NM_016076chr133005 2785 532 --1470 --
NM_016098chr6126 ------
NM_016100chr20--1110 ----
NM_016131chr222248 1453 --1707 --
NM_016132chr1522938 2280 --12635 --
NM_016141chr3----1742 --
NM_016144chr52682 123 ------
NM_016201chr31754 1239 --12152
NM_016205chr41223 ------
NM_016206chr379048 7636 7600 6959 6849 6427 148 ----26201 1235
NM_016230chr6----1167 --
NM_016231chr1721314 1144 ------
NM_016256chr162237 58 ------
NM_016258chr1----1257 --
NM_016260chr255291 5070 1193 802 232 11133 15969 --
NM_016271chr182851 743 ------
NM_016272chr2251789 1003 764 524 307 ------
NM_016275chr322042 711 ------
NM_016277chr6------11388
NM_016281chr121778 11084 ----
NM_016287chr131973 1648 1336 ------
NM_016289chr21201 --11836 --
NM_016308chr111843 --12089 --
NM_016315chr2----11597 --
NM_016322chr933060 2590 336 ------
NM_016351chr71182 ------
NM_016357chr1221152 1027 125 ----
NM_016374chr13618 270 247 --1629 1475
NM_016374chr13618 270 247 --1629 1475
NM_016376chr1734276 3706 1198 11344 --2620 437
NM_016377chr61319 11515 ----
NM_016395chr152579 21 --11369 --
NM_016396chr1532371 2168 927 ----12973
NM_016418chr2253695 3361 3042 2504 1302 --144 --
NM_016424chr1721818 68 --11492 11384
NM_016431chr221746 --181 --
NM_016433chr122186 98 ------
NM_016436chr20----21711 637 --
NM_016453chr32506 183 ------
NM_016463chr5155 ------
NM_016480chr52789 214 ------
NM_016488chr1231692 366 358 ------
NM_016490chr2136 ------
NM_016506chr112578 162 1450 ----
NM_016507chr1722079 525 --21962 500 --
NM_016512chr81230 ------
NM_016513chr62509 197 ------
NM_016516chr21579 ------
NM_016529chr1311008 ----1127
NM_016530chr1543978 500 449 166 --13824 23813 2547
NM_016531chr431470 614 116 ------
NM_016539chr19264 28 ------
NM_016542chrX1347 ------
NM_016559chr311440 --1995 --
NM_016575chr12115075 4621 4053 3779 3376 3338 1546 1502 1464 986 536 --34501 4026 3755 --
NM_016577chr343548 3261 1309 21 --13014 --
NM_016587chr7--156 ----
NM_016596chr123916 417 86 ------
NM_016603chr511961 ------
NM_016604chr52284 39 --2814 248 --
NM_016619chr41237 ------
NM_016621chr1153992 3436 2812 1290 454 --33206 1708 1638 --
NM_016626chr1821685 183 1113 ----
NM_016631chr21----1881 --
NM_016644chr51554 ------
NM_016824chr101294 --1196 --
NM_016836chr22726 693 --1765 --
NM_016839chr22726 693 --1765 --
NM_016929chr641182 976 670 183 ------
NM_016936chr161220 --22138 1487 --
NM_016937chrX2357 344 ------
NM_016946chr192834 2342 2306 1445 1382 1352 1212 931 213 ----11020
NM_016950chr4--1406 ----
NM_016952chr1142850 1098 935 723 --1413 --
NM_017410chr1231167 406 225 ------
NM_017412chr81967 ------
NM_017413chrX52255 1807 449 349 65 ------
NM_017420chr14----23522 1003 --
NM_017423chr41694 --1490 --
NM_017437chr1422204 286 --1195 1333
NM_017447chr2141526 1424 753 42 ------
NM_017452chr201433 --1329 --
NM_017453chr201433 --1329 --
NM_017454chr201433 --1329 --
NM_017456chr1741766 585 35 24 ----11613
NM_017482chr251571 1524 1439 1060 973 --11538 --
NM_017519chr611291 ------
NM_017522chr131335 897 380 --1906 --
NM_017548chr321435 823 ------
NM_017553chr15175 --165 --
NM_017582chr12694 624 --21719 467 --
NM_017594chr922474 560 ------
NM_017596chr1154394 4200 4025 3979 3799 3724 3173 3161 1703 1577 1461 1079 973 901 146 11828 1723 --
NM_017602chrX2661 77 ------
NM_017610chr15----1342 --
NM_017626chr1011355 --11684 --
NM_017629chr111888 --1105 --
NM_017632chr4181 ------
NM_017633chr612992 --13616 --
NM_017635chr1111179 --2535 451 --
NM_017637chr998847 8732 8625 6796 6178 3358 1948 937 44 --43155 2705 710 367 --
NM_017640chr61768 --1229 --
NM_017657chr21908 ------
NM_017658chr1421102 1030 --13212 --
NM_017660chr1932140 245 57 --1983 12943
NM_017661chr151872 1483 ----
NM_017681chrX1848 ------
NM_017686chr111065 ----1726
NM_017694chr21719 ------
NM_017709chr11963 --31427 1233 93 --
NM_017712chr19136203 5955 5369 5303 4590 2464 2225 1978 1790 1678 1301 645 294 --35144 504 401 --
NM_017715chr73743 270 242 ------
NM_017719chr3----1161 --
NM_017730chr31597 1612 ----
NM_017737chr112240 --1372 --
NM_017740chr1661726 1342 1266 530 464 242 ------
NM_017742chr181189 --11450 --
NM_017747chr5--1105 ----
NM_017752chrX2786 169 ----12143
NM_017753chr9----1883 --
NM_017754chr624440 4294 --24075 1044 --
NM_017755chr5298 50 ------
NM_017758chr1721306 1120 --1942 --
NM_017770chr622006 47 --12289 --
NM_017780chr8----1665 --
NM_017786chr81554 ------
NM_017799chr1431494 1394 1328 1454 ----
NM_017801chr342581 2036 947 504 1539 ----
NM_017811chr922240 327 --1965 12108
NM_017824chr1021980 1054 --11708 --
NM_017848chrX104627 3811 3219 1852 1693 1686 1452 552 438 185 --1654 --
NM_017849chr283067 2845 2686 2529 2491 1069 1011 976 --22026 1280 --
NM_017851chr1551044 962 953 923 137 11065 2971 269 --
NM_017857chr112636 549 --1677 --
NM_017895chr20174 ------
NM_017896chr2062397 1379 869 738 554 407 --41139 814 569 157 --
NM_017907chr111342 --2483 193 --
NM_017921chr1731708 921 390 ------
NM_017922chr141249 ------
NM_017926chr141889 ------
NM_017929chr22--11355 31203 955 396 --
NM_017933chr211064 ------
NM_017938chrX1118 --139 11742
NM_017945chr31878 11204 1282 --
NM_017955chr14----1824 --
NM_017964chr2144 1203 1668 --
NM_017972chr141889 ------
NM_017987chr1042003 632 552 96 1280 11656 --
NM_017988chr123669 320 79 ------
NM_017994chr742320 2025 1196 487 --1747 --
NM_017998chr9----11023 --
NM_018011chr131260 ------
NM_018014chr2163 ------
NM_018018chr121468 1694 ----
NM_018024chr82568 95 ----1585
NM_018027chr1032775 2002 362 ------
NM_018045chr122358 1232 1618 2995 385 --
NM_018046chr5----1694 --
NM_018047chr5----1810 1871
NM_018053chr13727 667 106 ------
NM_018054chr161509 --2213 141 --
NM_018061chr111176 --11182 --
NM_018063chr101370 1344 ----
NM_018064chr62256 227 ------
NM_018072chr11160 ------
NM_018085chr176941 6632 6530 2589 2298 2200 125 16026 28100 70 13221
NM_018092chr16----11245 --
NM_018095chr112578 162 1450 ----
NM_018111chr19--150 ----
NM_018113chr122443 205 ------
NM_018116chr12548 502 ------
NM_018121chr1022093 1205 ------
NM_018133chr332085 1564 1540 ------
NM_018155chr31699 --2395 172 11389
NM_018167chr141894 ----1370
NM_018179chr122551 203 --2615 51 --
NM_018180chr101113 ------
NM_018181chr1811398 --11899 1774
NM_018184chr321586 571 --1329 11497
NM_018191chr1321906 170 --1284 --
NM_018205chr1072222 2164 2059 1791 885 421 144 ------
NM_018207chr141504 600 416 250 ------
NM_018208chr141127 953 809 442 ------
NM_018211chr142053 1678 1542 718 ------
NM_018214chr61192 ------
NM_018239chr1072222 2164 2059 1791 885 421 144 ------
NM_018240chr1149 ----1868
NM_018241chr41178 ----1958
NM_018244chr206933 850 432 373 93 36 ------
NM_018247chr611993 12124 ----
NM_018254chr112198 --1430 --
NM_018265chr141891 1433 258 241 --11995 --
NM_018268chr52619 349 ------
NM_018287chr1011272 ------
NM_018293chr331102 812 176 12566 1113 2328 97
NM_018298chr13940 395 360 ----1263
NM_018299chr812521 1781 ----
NM_018300chr19--1183 ----
NM_018302chr422455 497 ------
NM_018307chr171278 ------
NM_018312chr1161905 1882 1863 1840 1776 770 --1805 --
NM_018313chr342422 2301 2284 335 ------
NM_018315chr41127 ------
NM_018318chr121945 ------
NM_018320chr1121159 197 ------
NM_018327chr201654 ------
NM_018334chr71201 ------
NM_018351chr1274630 3479 3465 3334 1713 1007 731 --13977 --
NM_018362chr1133614 2763 244 11244 ----
NM_018363chr10--1326 ----
NM_018364chr133871 1219 72 --23852 3653 13927
NM_018367chr112818 285 ----1191
NM_018368chr6----1224 --
NM_018371chr831132 1125 155 ------
NM_018373chr1486396 4312 2418 2040 1883 1622 1256 214 11604 25631 418 11835
NM_018374chr713826 --21692 751 --
NM_018383chr221474 149 11946 ----
NM_018388chrX2937 341 --154 --
NM_018400chr1133537 2882 29 ------
NM_018403chr353663 3619 3149 2680 426 1571 11530 11502
NM_018416chr1252597 2336 1807 755 564 --1888 --
NM_018424chr92412 69 --11598 --
NM_018440chr875984 5570 2023 1925 970 437 288 --1504 --
NM_018444chr811945 ------
NM_018448chr12----1146 --
NM_018451chr131793 ------
NM_018452chr6_random63795 2770 2667 1404 713 533 ------
NM_018462chr31759 --1143 --
NM_018469chr172426 86 --21375 282 --
NM_018482chr821939 327 --2937 310 --
NM_018488chr172617 64 ------
NM_018490chr1111445 11224 ----
NM_018492chr8126 ------
NM_018557chr231540 1345 1088 ------
NM_018566chr144146 3704 1491 815 13884 23440 846 --
NM_018569chr4----11558 --
NM_018590chr101645 ------
NM_018602chr15----3308 150 88 --
NM_018638chr1235615 1432 1205 15596 ----
NM_018639chr1221255 398 --188 --
NM_018640chr121996 12385 1800 --
NM_018644chr1122190 1833 --146 --
NM_018649chr102520 373 ------
NM_018650chr132237 1508 86 ------
NM_018652chr151721 --1252 --
NM_018657chr3------1178
NM_018683chr2011079 --11704 --
NM_018695chr5----1478 --
NM_018711chr1251451 1178 1027 487 452 --127 --
NM_018715chr132012 1905 1558 --12159 --
NM_018717chr41534 ------
NM_018719chr71361 --11232 --
NM_018841chr163603 3334 2589 1454 338 272 22447 1274 --1234
NM_018898chr51220 1633 ----
NM_018899chr51220 1633 ----
NM_018900chr51220 1633 ----
NM_018901chr51220 1633 ----
NM_018902chr51220 1633 ----
NM_018903chr51220 1633 ----
NM_018904chr51220 1633 ----
NM_018905chr51220 1633 ----
NM_018906chr51220 1633 ----
NM_018907chr51220 1633 ----
NM_018908chr51220 1633 ----
NM_018909chr51220 1633 ----
NM_018910chr51220 1633 ----
NM_018911chr51220 1633 ----
NM_018912chr51479 --11761 --
NM_018913chr51479 --11761 --
NM_018914chr51479 --11761 --
NM_018915chr51479 --11761 --
NM_018916chr51479 --11761 --
NM_018917chr51479 --11761 --
NM_018918chr51479 --11761 --
NM_018919chr51479 --11761 --
NM_018920chr51479 --11761 --
NM_018921chr51479 --11761 --
NM_018922chr51479 --11761 --
NM_018923chr51479 --11761 --
NM_018924chr51479 --11761 --
NM_018925chr51479 --11761 --
NM_018926chr51479 --11761 --
NM_018927chr51479 --11761 --
NM_018928chr51479 --11761 --
NM_018929chr51479 --11761 --
NM_018945chr643672 3469 2514 2292 1965 12421 1439
NM_018948chr11503 --2985 495 --
NM_018963chr2151392 1021 1006 285 246 ------
NM_018970chr722804 746 ------
NM_018976chr1242839 2437 1114 966 11871 ----
NM_018993chr2031282 397 286 --31393 1363 1140 --
NM_018994chr1----2393 34 --
NM_018999chr1054331 3745 3492 1261 683 --24544 4055 13050
NM_019001chr333328 551 325 ----14400
NM_019004chr7----1379 --
NM_019006chr151256 ------
NM_019042chr711054 --11094 --
NM_019045chrX3958 691 370 1217 ----
NM_019050chr42893 765 ------
NM_019058chr101729 ------
NM_019074chr151362 --2869 281 --
NM_019083chr121439 123 ------
NM_019084chr1022389 354 12464 ----
NM_019087chr53318 95 35 ------
NM_019094chr1263799 3790 3707 3685 2824 1448 --1961 12908
NM_019096chr62352 272 --2779 754 --
NM_019106chr2252593 2112 1198 697 507 ------
NM_019114chr952384 2361 2000 147 65 --12006 --
NM_019116chr1663455 3391 2956 1384 1275 858 ------
NM_019555chr321749 415 11530 --11807
NM_019557chr11352 1661 ----
NM_019592chr9----1602 --
NM_019593chr2012018 11076 ----
NM_019597chrX1700 ------
NM_019605chr13645 621 482 ------
NM_019606chr7184 ------
NM_019610chr111407 --11514 --
NM_019613chr172930 120 ------
NM_019624chr12--1273 1857 --
NM_019625chr12--1273 1857 --
NM_019843chr22187 ------
NM_019854chr122708 222 ------
NM_019860chr101474 --1610 --
NM_019903chr101294 --1196 --
NM_020039chr1241942 1781 1717 1212 --21742 1488 --
NM_020066chr11787 ------
NM_020116chr411481 ----1634
NM_020122chr235074 4020 735 --11780 --
NM_020135chr6--1437 ----
NM_020140chr12182 ------
NM_020144chr731590 845 134 --11430 --
NM_020148chr1852996 2554 2397 2301 693 --23118 259 --
NM_020178chr17--1323 1829 --
NM_020179chr11----2137 75 --
NM_020180chr181389 ------
NM_020182chr2052682 2519 778 758 162 --22955 2539 --
NM_020193chr11----21069 257 --
NM_020204chr11248 ------
NM_020205chr143125 2774 2520 2499 22810 2803 ----
NM_020228chr1112196 --22058 277 --
NM_020235chr31267 ------
NM_020240chr542714 2510 923 620 --22781 960 --
NM_020245chr644398 4152 879 52 --14424 13163
NM_020309chr19159 1281 ----
NM_020310chr175880 556 515 440 407 --11037 --
NM_020336chr2083307 3249 2912 2715 2629 2458 500 300 --1698 --
NM_020341chr2011458 1222 ----
NM_020342chr242453 1688 184 101 --1818 --
NM_020346chr1111101 ------
NM_020348chr1012366 1822 32585 2119 246 --
NM_020354chr102656 167 ------
NM_020357chr331347 1056 642 ------
NM_020362chr13618 235 150 --1808 --
NM_020363chrY11391 11537 11369 --
NM_020374chr12------11618
NM_020381chr631723 508 340 ------
NM_020382chr1221036 440 ----1204
NM_020390chr324207 4048 --11135 --
NM_020405chr1774455 3495 1609 1445 788 321 83 11524 ----
NM_020416chr431081 612 329 22172 2013 ----
NM_020420chrY11391 11537 11369 --
NM_020423chr12102 76 ------
NM_020429chr742753 2506 2156 964 --1265 --
NM_020432chr711712 ------
NM_020443chr166915 5064 4335 317 277 239 16352 21280 968 --
NM_020452chr131560 1428 537 --1849 --
NM_020456chr1331844 1441 75 --12285 --
NM_020463chr2------135
NM_020466chr614253 --13076 13990
NM_020473chrX1653 ------
NM_020526chr121800 188 --11297 --
NM_020630chr102666 63 ----1683
NM_020640chr312023 --11443 --
NM_020647chr8----1212 --
NM_020651chr211181 ------
NM_020673chr20107434 6594 6546 6180 5356 5250 4714 2892 2173 1450 --47409 5959 1238 237 --
NM_020689chr202509 308 ------
NM_020697chr811264 --1231 --
NM_020698chr1253093 3005 1999 660 464 ------
NM_020699chr134157 1869 1814 --25137 1878 --
NM_020708chr204773 712 323 228 --12479 --
NM_020711chr211633 --1530 --
NM_020715chr143569 531 324 --12154 1645
NM_020717chrX54022 3522 1921 1305 1094 --21100 859 --
NM_020718chr1666110 5300 4640 4364 4223 1410 ----15335
NM_020727chr2111284 --23460 3142 12491
NM_020732chr611291 ------
NM_020734chr1211298 --12938 --
NM_020738chr2--1577 1201 --
NM_020739chr1533870 2578 818 --1866 --
NM_020748chr1731862 1431 1407 --1295 --
NM_020749chr811374 ------
NM_020750chr6131 --1263 --
NM_020752chr101705 ------
NM_020760chr21598 ------
NM_020762chr1231038 928 404 --1121 --
NM_020764chr1611064 ------
NM_020765chr1141 ------
NM_020766chrX53777 829 634 231 212 ----23686 1582
NM_020769chrX1831 --1711 --
NM_020771chr6----11502 --
NM_020772chr17108416 7633 7585 6019 2458 1637 1405 817 738 70 ----28146 5925
NM_020773chr442183 1833 1784 1720 ----1137
NM_020774chr1844697 1966 249 61 22485 1052 14814 --
NM_020779chr232229 1167 975 ------
NM_020791chr1721143 366 ------
NM_020794chr111096 ------
NM_020795chr1731801 1539 202 --21706 84 --
NM_020796chr532130 985 909 --22740 2386 --
NM_020801chr521844 1789 --21859 930 --
NM_020804chr652579 1845 1053 863 387 ------
NM_020808chr12953 297 1393 ----
NM_020809chr111213 ------
NM_020810chr1433423 477 470 --11346 --
NM_020819chr6----1308 --
NM_020820chr2011111 --31457 287 76 --
NM_020824chr101689 ------
NM_020830chr22601 387 ------
NM_020839chr321272 449 --11530 --
NM_020841chr12148 --32748 1019 77 --
NM_020850chr1623089 2005 --22719 128 --
NM_020854chr1821224 218 ------
NM_020858chr15----1366 131
NM_020859chr423611 3465 --33402 1557 355 --
NM_020860chr41116 ------
NM_020868chr221767 1739 ------
NM_020888chr11137 --1657 1246
NM_020896chr114861 713 210 196 --1986 1229
NM_020899chr174839 647 230 74 --31728 1567 519 --
NM_020904chr19144 ------
NM_020927chr16--11792 11485 12330
NM_020935chr284367 4251 3897 3535 3075 1821 1171 189 13256 43566 3027 1132 464 --
NM_020946chr91640 ------
NM_020956chr1934143 3685 1400 --21221 1003 --
NM_020967chr203844 396 44 --1476 --
NM_020971chr191633 --1888 --
NM_020977chr42838 255 --21939 1691 --
NM_020988chr1621251 450 --189 --
NM_021020chr822582 1415 --63328 848 527 289 228 152 --
NM_021025chr5----1353 --
NM_021033chr1353237 2321 2191 1380 717 --1774 1673
NM_021035chr201118 1929 ----
NM_021044chr122420 141 ------
NM_021047chr191449 --1488 --
NM_021064chr621796 316 --11370 --
NM_021065chr6123 ------
NM_021072chr531688 871 130 --22522 2248 --
NM_021077chr15134 ------
NM_021079chr1793056 2933 2800 2482 2300 1059 760 502 209 1130 33262 574 395 --
NM_021088chr231734 807 675 ------
NM_021096chr2272682 2669 2499 2160 951 920 366 13016 ----
NM_021097chr22999 275 ----1338
NM_021106chr91705 --1617 --
NM_021116chr7136766 6581 6105 3528 3086 2893 1905 1876 1797 1717 798 697 150 37354 7251 6822 28241 659 --
NM_021120chrX33185 1119 799 --12296 --
NM_021132chr1021340 1249 --1980 1435
NM_021137chr1731783 1728 909 --1733 22002 1735
NM_021141chr22845 669 ----1258
NM_021145chr72977 424 --1413 --
NM_021148chr722275 1988 ----11640
NM_021155chr1942544 1150 867 524 --1785 --
NM_021156chr203983 136 60 ------
NM_021159chr421676 1355 ------
NM_021174chr82758 588 ------
NM_021183chrX1166 --21960 173 --
NM_021189chr11232 ------
NM_021190chr12922 468 ------
NM_021198chr231430 1304 75 --11445 --
NM_021202chr2042096 1941 1243 326 --11138 12813
NM_021215chr2012046 --1459 --
NM_021224chr9165 --1312 --
NM_021229chr121460 1135 ----
NM_021238chr1231404 1388 741 ----1292
NM_021240chr9------1209
NM_021249chr1421331 1134 ------
NM_021253chr641112 1088 1073 304 ----1910
NM_021627chr331241 901 795 ------
NM_021629chr324020 1728 ----15076
NM_021637chrX1142 ------
NM_021638chr464489 4439 3580 3362 1269 94 --14445 --
NM_021639chr12320 150 ------
NM_021643chr221860 1393 --11340 --
NM_021644chr10145 --11024 --
NM_021705chr631321 1219 480 ------
NM_021723chr71182 ------
NM_021809chr2042138 2049 774 131 --21595 1554 --
NM_021813chr665373 2185 1727 1620 1424 1407 1128 21841 1389 --
NM_021814chr61101 --1607 --
NM_021825chr11133 ------
NM_021905chr62422 187 1135 --135
NM_021907chr22284 80 ------
NM_021911chr544042 1230 831 127 13405 ----
NM_021912chr1523600 556 ------
NM_021940chr61146 ------
NM_021943chr651945 851 767 541 429 --1400 --
NM_021946chrX51241 1230 1170 954 308 --1351 --
NM_021949chrX32738 2401 2027 ------
NM_021960chr132496 1881 564 ------
NM_021961chr1136651 2906 2010 --15678 17180
NM_021962chr172585 387 --21733 527 --
NM_021964chr356132 5791 5358 2269 465 ----26483 4048
NM_021988chr2011123 --1639 --
NM_021991chr172681 143 --1552 --
NM_021998chrX----11290 --
NM_021999chr13--1119 ----
NM_022037chr2132 ------
NM_022041chr1621980 105 12714 ----
NM_022048chr1554083 1835 1764 1406 405 --24570 565 15531
NM_022060chr1421266 203 1542 2369 333 --
NM_022085chr611011 --1419 --
NM_022107chr6138 ------
NM_022114chr163390 3363 2914 1873 1039 929 11342 2862 215 --
NM_022118chr131609 1485 ----
NM_022130chr551340 406 273 180 108 --1135 --
NM_022131chr331370 1324 114 1481 ----
NM_022133chr8----11756 --
NM_022138chr621140 182 --1337 --
NM_022140chr551952 1840 1484 357 337 ----11586
NM_022170chr751424 1368 1221 182 109 ------
NM_022171chr321596 48 ------
NM_022173chr2132 ------
NM_022336chr252025 821 805 689 100 --1842 --
NM_022340chr343667 3570 3298 3191 --13386 --
NM_022351chr812805 ------
NM_022353chr22360 100 1177 ----
NM_022362chr10192 ------
NM_022368chrX126 ------
NM_022373chr7----1237 --
NM_022442chr2011123 --1639 --
NM_022459chr1354127 2529 2481 1658 1119 --25220 677 --
NM_022461chr321071 114 11447 ----
NM_022462chr1983631 3543 2920 2869 2761 1097 815 197 ----1315
NM_022465chr1212111 12425 1840 --
NM_022469chr121089 894 --12694 --
NM_022477chr2031646 1308 85 ------
NM_022552chr21168 ------
NM_022553chr61127 --1184 --
NM_022574chr732029 1599 648 11895 ----
NM_022644chr172399 180 ------
NM_022648chr233421 3320 1801 --53141 2936 1845 1839 1299 14643
NM_022720chr2261591 1349 1294 695 567 324 2150 136 ----
NM_022731chr12238 104 ------
NM_022735chr12506 117 --1437 --
NM_022744chr1621017 277 11282 21271 952 1302
NM_022748chr731124 580 473 --2986 183 --
NM_022749chr82494 228 --21070 202 --
NM_022750chr75677 521 494 60 24 ------
NM_022753chr132624 2514 890 --1750 --
NM_022755chr932323 2036 937 --11799 --
NM_022756chr111311 1192 ----
NM_022758chr642942 2443 898 681 --11995 --
NM_022763chr3----22700 2144 --
NM_022766chr2232629 2089 256 ------
NM_022768chr11116 ------
NM_022771chr123948 727 375 ------
NM_022776chr3----21341 1222 --
NM_022780chr2--1192 1208 --
NM_022781chr922999 85 --12653 12687
NM_022802chr10----193 --
NM_022821chr11169 --1335 --
NM_022824chr51361 --21460 192 --
NM_022826chr2------11192
NM_022832chr451893 369 359 124 74 ------
NM_022843chr1321083 1014 ------
NM_022845chr1632074 1916 694 11560 ----
NM_022893chr21661 --43095 3072 2888 2224 --
NM_022898chr1494685 4293 3410 2938 1415 1039 984 741 720 --24017 3685 --
NM_022912chr21694 --52750 2719 529 522 188 --
NM_022970chr1021116 495 --11050 --
NM_022977chrX--1458 ----
NM_023034chr8----1226 --
NM_023037chr132130 82 ------
NM_023067chr331196 916 248 --1383 --
NM_023074chr192867 68 ------
NM_023076chr1642546 1086 374 167 --22192 1830 --
NM_023079chr1731677 728 275 ------
NM_023105chr861783 1694 501 365 144 132 ------
NM_023106chr861783 1694 501 365 144 132 ------
NM_023110chr861783 1694 501 365 144 132 ------
NM_023111chr861783 1694 501 365 144 132 ------
NM_023927chr511137 --11171 --
NM_023929chr832723 2309 495 ----12091
NM_023940chr42981 390 --132 --
NM_023943chr3------1203
NM_024007chr552967 2560 821 531 99 ----12871
NM_024019chr41765 133 1172 --
NM_024046chr31406 1450 1242 --
NM_024050chr193629 474 406 --1433 --
NM_024052chr1712863 --1231 --
NM_024060chr111276 ------
NM_024061chr7----1233 --
NM_024076chr1941552 744 313 121 --22234 961 --
NM_024085chr23970 898 736 ------
NM_024086chr1743656 3288 953 54 --22440 1360 --
NM_024087chrX2670 600 ------
NM_024090chr411895 ------
NM_024094chr81884 --1278 --
NM_024107chr17----132 --
NM_024117chr9--1550 1218 --
NM_024294chr642942 2443 898 681 --11995 --
NM_024295chr8----21306 834 --
NM_024306chr163755 475 92 1902 ----
NM_024329chr121488 543 1151 --11370
NM_024408chr133294 817 572 ------
NM_024424chr112858 180 ------
NM_024425chr112858 180 ------
NM_024426chr112858 180 ------
NM_024493chr6--196 ----
NM_024494chr11266 ------
NM_024503chr1130 ------
NM_024523chr721167 1033 ------
NM_024529chr11166 ------
NM_024539chrX1151 --11097 --
NM_024551chr123296 243 122 --12431 --
NM_024551chr123296 243 122 --12431 --
NM_024554chr11104 --11092 --
NM_024556chr11----1421 --
NM_024563chr511350 --1727 --
NM_024567chr81131 ------
NM_024569chr112459 --2550 459 --
NM_024581chr6179 ------
NM_024586chr1------1552
NM_024590chr431576 479 99 ------
NM_024595chr12859 470 ------
NM_024612chr173825 406 117 ----1284
NM_024613chr81206 --1470 --
NM_024635chr9------1217
NM_024638chr352350 1694 833 729 633 11777 12463 --
NM_024639chr612678 ------
NM_024645chr8--11574 ----
NM_024664chr1----178 --
NM_024674chr153099 2812 2336 2298 301 --1936 --
NM_024704chr201369 --1246 --
NM_024713chr1511133 ------
NM_024721chr821979 978 ------
NM_024740chr1153983 3824 3546 390 103 ----13145
NM_024742chr1661921 1639 1286 753 421 227 ------
NM_024751chr412031 ------
NM_024769chr11146 ------
NM_024786chr5137 ------
NM_024787chr83748 228 129 1877 ----
NM_024811chr111280 ------
NM_024812chr831887 1716 702 --1488 --
NM_024814chr71126 ------
NM_024828chr921586 1117 185 ----
NM_024850chr54698 676 315 83 ------
NM_024859chrX21078 237 ------
NM_024881chr1963392 3246 3187 3163 3149 997 ------
NM_024913chr73494 487 61 ------
NM_024915chr841041 795 706 572 ------
NM_024920chr4----11403 --
NM_024939chr162246 103 ------
NM_024944chr21182 --11279 --
NM_024946chr1621737 314 ------
NM_024947chr388167 7552 6900 6399 6076 3600 2544 78 --38702 2288 1737 --
NM_024949chr443828 3649 1296 831 --14815 --
NM_024953chr1231735 493 408 11005 11953 12001
NM_024958chr203907 822 340 --1452 --
NM_024989chr267449 7023 2710 2648 2391 1572 --16310 --
NM_024991chr101864 --22211 791 --
NM_024997chr161905 11035 ----
NM_025027chr192947 250 ------
NM_025054chr832991 968 721 ------
NM_025076chr2----162 --
NM_025079chr12502 60 ------
NM_025106chr111872 --21751 127 --
NM_025126chr12--2576 226 ----
NM_025141chr151511 ------
NM_025146chr31629 --1784 --
NM_025160chr121735 60 ------
NM_025176chr201152 ------
NM_025179chr164496 4137 4075 3832 3479 1977 --24556 896 --
NM_025187chr1651376 1241 1003 900 199 11173 ----
NM_025191chr132538 796 86 1102 --11385
NM_025212chr41130 ------
NM_025219chr204629 604 456 208 --22324 112 --
NM_025222chr3----22047 126 --
NM_025230chr1451260 526 383 262 179 --2690 431 --
NM_025248chr1793080 2005 1982 1200 962 777 737 727 282 13243 21251 537 --
NM_025250chr722969 2327 ------
NM_025251chr861157 869 421 370 363 165 ------
NM_030567chr5258 44 ------
NM_030594chr153232 97 25 ------
NM_030621chr14----24023 2973 --
NM_030625chr101938 12007 ----
NM_030627chr521656 1115 ------
NM_030629chr1611328 ------
NM_030637chr142738 26 ------
NM_030640chr122624 569 ------
NM_030645chr141413 1076 357 24 --1336 --
NM_030647chr721015 868 15398 ----
NM_030648chr455344 4390 2026 1483 1467 --1511 --
NM_030650chr243884 3544 3044 2847 12642 12809 --
NM_030660chr141342 --2957 410 --
NM_030661chr731391 1277 649 ------
NM_030664chr10----21665 623 --
NM_030665chr1741242 1033 341 91 ------
NM_030674chr1274845 4156 1737 1565 795 621 298 13942 --14513
NM_030753chr171244 ------
NM_030758chr2211255 --21471 85 --
NM_030762chr1231931 1347 102 --11978 --
NM_030766chr123811 282 92 1205 ----
NM_030774chr112600 37 --11316 --
NM_030791chr14192 ------
NM_030796chr73757 152 41 --152 --
NM_030802chr172279 107 ------
NM_030805chr251152 872 412 193 66 --11028 --
NM_030806chr1128970 8600 8202 7939 7324 6983 3051 2991 2837 2684 1813 926 --1675 28464 6319
NM_030808chr171983 ------
NM_030809chr1232212 635 120 ----11882
NM_030810chr611011 --1419 --
NM_030820chr6----151 --
NM_030877chr20----179 --
NM_030881chr2242330 2128 2048 1592 --12289 --
NM_030884chr331640 1574 1493 --1380 --
NM_030912chr102222 129 --1161 --
NM_030915chr262191 1897 1802 696 587 350 --21964 929 --
NM_030922chr15------1635
NM_030927chr1031335 1171 1014 --11031 --
NM_030938chr171880 --1266 --
NM_030939chr6----1339 --
NM_030962chr11--1242 ----
NM_030963chr62610 574 ------
NM_030964chr563028 2980 2785 2664 902 206 ------
NM_030978chr91464 ------
NM_030981chr1111017 --1111 --
NM_031216chr1841427 780 236 155 11833 ----
NM_031243chr7--11755 1293 --
NM_031267chr71132 ------
NM_031268chr1675111 4980 1714 1394 1257 1193 751 13958 43993 3688 1876 1311 25260 2065
NM_031272chr17132 --1261 --
NM_031283chr22739 179 ------
NM_031296chr42997 452 --2556 475 11960
NM_031309chr841811 385 242 160 ------
NM_031371chr13618 270 247 --1629 1475
NM_031371chr13618 270 247 --1629 1475
NM_031372chr421449 1258 --174 --
NM_031409chr621110 178 --21756 1750 --
NM_031411chr51220 1633 ----
NM_031412chr12----1235 --
NM_031417chr1952780 2526 2498 620 105 --22743 229 --
NM_031424chr202493 386 --1199 --
NM_031426chr911872 --12693 --
NM_031427chr1465811 4499 3662 2154 1839 883 ------
NM_031439chr82485 143 ------
NM_031445chr242915 2902 2857 1193 1931 13337 --
NM_031459chr11502 --21636 338 --
NM_031468chr7116559 6265 6248 5360 3297 2940 1450 824 580 504 487 --56038 2328 2291 1175 678 --
NM_031477chr162264 63 ------
NM_031483chr2022207 1423 ------
NM_031844chr113456 --32708 2521 760 --
NM_031845chr243289 3258 2685 337 ----22724 215
NM_031847chr243289 3258 2685 337 ----22724 215
NM_031849chr51220 1633 ----
NM_031857chr51220 1633 ----
NM_031860chr51220 1633 ----
NM_031892chrX1247 ------
NM_031914chr141157 ------
NM_031990chr1931355 543 324 ------
NM_031991chr1931355 543 324 ------
NM_031992chr751424 1368 1221 182 109 ------
NM_032012chr984922 3974 3291 1164 570 454 283 248 ----1134
NM_032013chr2031646 1308 85 ------
NM_032017chr141654 796 759 339 --11859 --
NM_032023chr101926 ------
NM_032041chr842560 2361 2296 372 ------
NM_032042chr5----12574 --
NM_032050chr22----1171 --
NM_032088chr51479 --11761 --
NM_032092chr51479 --11761 --
NM_032102chr1162797 2654 1158 766 629 338 ------
NM_032105chr186324 5912 5342 5112 3206 3131 1734 806 --47983 5803 5709 5327 27682 6419
NM_032121chrX----2856 525 --
NM_032139chr192924 107 ------
NM_032144chr221156 191 ------
NM_032153chr362741 2676 2307 2105 796 201 --11071 --
NM_032160chr1873824 3668 3490 3302 452 375 172 --12994 --
NM_032175chr521757 1175 --11304 --
NM_032182chr10------11448
NM_032192chr171143 ------
NM_032199chr1083374 2881 2726 1280 1194 680 268 72 12756 ----
NM_032207chr1911110 --1794 --
NM_032208chr231251 872 429 --21137 784 --
NM_032211chr103863 238 215 --11122 --
NM_032217chr41122 --11032 --
NM_032221chr2021742 1266 ------
NM_032233chr14----1851 --
NM_032236chr11690 ------
NM_032246chr1511208 ------
NM_032268chr1612103 ------
NM_032271chr1641101 554 283 79 --1413 --
NM_032281chr191361 ------
NM_032283chr141500 457 361 31 --1141 --
NM_032316chr332447 2421 2350 --21551 30 --
NM_032317chr751782 1381 1339 198 54 ------
NM_032320chr112287 135 ------
NM_032327chr101379 ------
NM_032345chr121107 ------
NM_032352chr141988 --11125 --
NM_032353chr17149 ------
NM_032361chr5262 39 ------
NM_032364chr122368 330 ------
NM_032373chr10----14192 1902
NM_032376chr172670 101 ------
NM_032389chr1161174 907 783 411 374 322 --1137 --
NM_032403chr51479 --11761 --
NM_032408chr71979 --182 --
NM_032410chr81308 ------
NM_032430chr192295 122 ------
NM_032434chr211387 --11170 11248
NM_032439chr1021048 336 ------
NM_032440chr101770 --1214 --
NM_032445chr151896 --1774 --
NM_032446chr533681 2540 1349 --11083 13514
NM_032449chr172379 2217 1836 1145 926 367 22 --1453 --
NM_032452chr1421434 274 --21365 28 --
NM_032457chr423250 149 --1890 --
NM_032458chrX11336 ----13372
NM_032509chr842299 1833 1751 674 ------
NM_032511chr6--1348 ----
NM_032538chr612766 2873 180 ----
NM_032547chr431276 960 94 ------
NM_032552chr93568 391 43 --11271 --
NM_032560chr142375 91 ------
NM_032564chr113764 740 142 --1835 --
NM_032569chr161503 --2683 350 --
NM_032575chr1671672 1591 1387 1277 277 189 162 11735 ----
NM_032580chr172518 145 ------
NM_032581chr7179 --1403 --
NM_032582chr1711576 --11343 --
NM_032590chr122242 69 --1194 --
NM_032595chr1731283 277 190 ------
NM_032638chr361457 1286 1102 1059 490 380 ------
NM_032646chr1711355 ------
NM_032682chr342336 1197 672 536 12911 21157 837 --
NM_032689chr1921532 1076 --199 --
NM_032711chr1773783 3620 2987 2945 1621 1298 27 --34172 3531 1534 --
NM_032728chr91873 ------
NM_032737chr1972458 2443 2148 1844 1785 1750 406 --171 --
NM_032741chr61843 --1345 --
NM_032788chr241241 1094 499 24 ------
NM_032801chr112724 271 ------
NM_032802chr151218 ------
NM_032808chr153879 861 725 --1625 --
NM_032812chr101305 ------
NM_032826chr755188 4847 4395 4048 3787 --1331 14275
NM_032828chr19104212 4189 4061 3329 3276 3196 1488 1461 1003 347 2132 81 1429 --
NM_032833chr152592 2449 1925 489 449 --11812 --
NM_032838chr1931084 504 35 ------
NM_032846chr142286 71 11500 21288 389 --
NM_032854chr172231 61 ------
NM_032857chr15----1156 --
NM_032875chr17----1221 --
NM_032876chr1431730 433 389 --2774 214 --
NM_032880chr11115 ------
NM_032906chr41661 ------
NM_032927chr4121 ------
NM_032932chr17126219 6192 6156 5395 4185 3988 2252 1839 1670 1614 1554 1270 11880 35489 2265 2163 11317
NM_032975chr1832843 1077 648 --23088 992 11013
NM_032978chr1811114 ------
NM_032979chr1811114 ------
NM_032980chr1832843 1077 648 --23088 992 11013
NM_032981chr1811114 ------
NM_032998chr11846 ----1367
NM_033016chr2241577 1168 587 352 ------
NM_033018chrX4473 231 185 165 ------
NM_033020chr184503 4284 3306 3284 3258 1864 1801 670 1564 13357 --
NM_033023chr7197 --1855 --
NM_033030chr211385 ------
NM_033044chr11496 ------
NM_033055chr1--21107 43 1842 --
NM_033071chr61157 1631 ----
NM_033083chr352159 2147 673 641 299 13207 ----
NM_033089chr2031458 541 469 ------
NM_033116chr14----2233 90 --
NM_033117chr9139 ------
NM_033121chr1221187 268 ------
NM_033129chr2031798 1454 536 1633 ----
NM_033132chr131193 ------
NM_033133chr1763298 2633 1445 1138 855 487 --31415 1325 1196 --
NM_033136chr531652 1442 90 ------
NM_033137chr531652 1442 90 ------
NM_033147chr22284 80 ------
NM_033148chr22284 80 ------
NM_033211chr51272 ------
NM_033222chr911204 11298 ----
NM_033224chr7107923 6808 6651 5734 2929 2625 2560 1889 519 492 --37247 3078 1424 16947
NM_033225chr823106 173 ----1101
NM_033226chr16----1102 --
NM_033255chr132402 151 1462 126 --
NM_033259chr32717 360 ------
NM_033266chr16268 28 ------
NM_033278chr11124 ------
NM_033285chr843513 1684 1278 1154 1916 14069 --
NM_033290chrX73656 3135 2962 2695 1357 496 436 1189 ----
NM_033300chr131335 897 380 --1906 --
NM_033310chr112192 64 ------
NM_033315chr1742056 1434 531 205 ------
NM_033326chr11----32340 1863 854 1118
NM_033331chr972920 2900 2883 2655 982 481 296 --1345 --
NM_033340chr103977 582 81 ----11223
NM_033360chr1232869 2807 388 ------
NM_033375chr1721320 1264 --11373 --
NM_033389chr1744740 1831 958 560 --23629 693 --
NM_033394chr221546 1516 --1281 --
NM_033425chr1122174 391 1281 12139 --
NM_033429chr1542565 991 860 271 --31229 1020 769 --
NM_033449chr581894 1873 1702 1685 1406 769 442 396 ------
NM_033480chr612618 --42415 1940 803 560 --
NM_033481chr612618 --42415 1940 803 560 --
NM_033503chr15113368 3348 2948 2937 2720 2713 2529 2483 1534 497 209 --11092 13803
NM_033505chr246470 5961 2390 1928 --45799 4553 4530 534 --
NM_033512chr862900 2004 1900 783 562 87 12674 32237 550 295 --
NM_033551chr521294 124 --13249 --
NM_033624chr121244 21620 861 ----
NM_033626chrX51625 1250 1134 574 544 --21590 1375 --
NM_033631chr143710 3001 613 497 ----11384
NM_033632chr41127 ------
NM_033642chrX2836 461 ------
NM_033644chr532511 454 352 --22099 1775 --
NM_033645chr532511 454 352 --22099 1775 --
NM_033656chr2135234 5072 1728 --25443 175 --
NM_044472chr11283 ----1290
NM_052828chr621426 403 --1387 11366
NM_052834chr1832389 2082 135 ------
NM_052840chr1521489 1429 ------
NM_052845chr1241234 842 614 227 --11147 --
NM_052846chr204934 497 446 372 --1347 --
NM_052851chr1312050 --11899 --
NM_052854chr112588 508 ------
NM_052869chr1711355 ------
NM_052875chr1121920 1484 --32175 2147 651 --
NM_052877chr11110 --149 --
NM_052879chr1243575 3482 3316 455 --22586 485 13297
NM_052880chr2241331 1288 1213 363 ------
NM_052885chr1264265 3904 1679 1274 470 436 --1912 --
NM_052897chr121302 ------
NM_052898chr851192 734 267 224 164 ------
NM_052904chr61263 1107 ----
NM_052905chr211176 --11880 --
NM_052906chr22104924 4676 3547 3184 1538 1162 1087 902 793 49 --13467 --
NM_052907chr1254144 4128 3784 3623 404 ----11421
NM_052910chr1341900 1419 1399 882 ------
NM_052911chr182663 312 --1981 --
NM_052932chr1121897 547 ------
NM_052934chr13576 492 389 ------
NM_052971chr51152 ------
NM_052978chr1431386 480 170 ------
NM_053001chr81302 ------
NM_053002chr32890 462 ------
NM_053016chr977513 7187 6595 6320 6265 2960 1703 --46904 6223 5372 585 --
NM_053023chr11----11032 --
NM_053025chr31653 ------
NM_053026chr31653 ------
NM_053027chr31653 ------
NM_053028chr31653 ------
NM_053031chr31653 ------
NM_053032chr31653 ------
NM_053064chr1422342 551 --12278 --
NM_053281chrX----1290 --
NM_053283chr12--146 ----
NM_054013chr53909 779 594 ------
NM_054016chr111613 ------
NM_054016chr111613 ------
NM_054016chr111613 ------
NM_054025chr1122190 1833 --146 --
NM_057169chr1222455 453 139 ----
NM_057170chr1222455 453 139 ----
NM_057175chr42945 867 1445 ----
NM_057749chr8--1890 ----
NM_058241chr221933 851 1643 21763 357 --
NM_058241chr221933 851 1643 21763 357 --
NM_078474chr151511 ------
NM_079421chr191128 ------
NM_080415chr17----1831 --
NM_080546chr9----1232 --
NM_080550chr172828 261 ------
NM_080654chr1131294 125 35 ------
NM_080664chr1422006 511 ------
NM_080666chr1421194 156 ----1263
NM_080670chr52681 73 --1377 --
NM_080671chr222047 1733 ----11749
NM_080676chr2083127 2916 2689 2633 1023 968 750 300 ------
NM_080679chr61666 ------
NM_080680chr61666 ------
NM_080681chr61666 ------
NM_080725chr2041864 1675 158 55 11293 --1221
NM_080759chr1311641 ------
NM_080760chr1311641 ------
NM_080764chr2253009 2788 2270 512 219 --22692 747 --
NM_080792chr2032286 1935 581 --11663 --
NM_080827chr20168 ------
NM_080867chr1464715 4288 4192 3775 1151 740 --13281 --
NM_080872chr823903 2911 --23247 461 13023
NM_080881chr51671 --1225 --
NM_080927chr332369 639 402 --147 --
NM_130387chr3261 51 --1851 --
NM_130391chr923443 389 --13334 --
NM_130392chr923443 389 --13334 --
NM_130393chr923443 389 --13334 --
NM_130395chr6--1437 ----
NM_130436chr212955 742 12615 2817 323 1837
NM_130438chr2111319 13192 1900 --
NM_130466chr121146 11899 ----
NM_130468chr153769 674 320 ------
NM_130469chr142670 337 ------
NM_130795chr91705 --1617 --
NM_130797chr721507 677 ------
NM_130798chr15----11024 --
NM_130811chr202244 185 ------
NM_130846chr121709 ------
NM_133170chr20157795 7654 7636 7378 7118 6614 6021 5802 5600 2786 1859 1261 1000 631 277 23179 2056 46415 5808 2998 2820 --
NM_133264chr1733403 2924 2605 1921 23761 1062 --
NM_133265chrX23475 801 ------
NM_133330chr473286 2738 2381 2144 1248 1092 366 --1826 --
NM_133331chr473286 2738 2381 2144 1248 1092 366 --1826 --
NM_133334chr495987 4898 4871 4174 2394 1921 1433 1259 306 --24537 4089 --
NM_133335chr473286 2738 2381 2144 1248 1092 366 --1826 --
NM_133369chr51183 ----1928
NM_133370chr442811 2234 1401 681 --43228 2795 1296 1282 --
NM_133372chr512503 --32669 2017 169 --
NM_133433chr5----1360 --
NM_133444chr192125 91 ------
NM_133445chr943770 3137 1427 116 ----1869
NM_133476chr123764 134 101 ------
NM_133477chr422128 1253 --3828 748 103 --
NM_133486chrX1370 --183 --
NM_133496chr134179 4108 1457 --43116 1407 890 211 13626
NM_133498chr191119 ------
NM_133499chrX2840 790 ------
NM_133503chr121742 ------
NM_133504chr121742 ------
NM_133505chr121742 ------
NM_133506chr121742 ------
NM_133507chr121920 ------
NM_133625chr311151 ----1291
NM_133631chr31630 ------
NM_133634chr2121358 134 --1681 --
NM_133638chr51195 ------
NM_133642chr223984 936 72 1324 ----
NM_133650chr61157 1631 ----
NM_134325chr13718 111 27 ------
NM_134421chr22752 731 ------
NM_134427chr91705 --1617 --
NM_134442chr2147 ------
NM_134447chr191634 ------
NM_138270chrX23014 1078 ------
NM_138285chr2----1411 --
NM_138288chr1422133 1440 1374 11793 12035
NM_138292chr1113356 11063 12620 21152 180
NM_138300chr121715 454 11164 199 --
NM_138319chr151910 --1280 --
NM_138370chr22715 663 ------
NM_138415chr2231655 1199 292 178 ----
NM_138426chr721962 498 --22474 821 12453
NM_138444chr1324116 3028 ------
NM_138453chr5167 ------
NM_138457chr633373 3279 521 --32536 1042 210 12852
NM_138473chr1234610 1066 592 --15133 14199
NM_138479chr151937 1733 1392 374 303 ------
NM_138485chr31324 ------
NM_138492chr511253 ------
NM_138555chr151404 ------
NM_138558chr121013 260 ------
NM_138559chr2153 ------
NM_138576chr1494685 4293 3410 2938 1415 1039 984 741 720 --24017 3685 --
NM_138578chr2061276 1142 1092 942 423 211 ------
NM_138609chr51136 ------
NM_138610chr51136 ------
NM_138621chr244083 3070 1162 1013 13223 1997 --
NM_138633chr61319 11515 ----
NM_138701chr71120 ------
NM_138713chr1657321 5160 2879 1488 917 25290 1248 38101 2433 420 --
NM_138714chr1657321 5160 2879 1488 917 25290 1248 38101 2433 420 --
NM_138717chr63565 157 77 --156 --
NM_138731chr1433665 3413 2913 ------
NM_138735chr2--1627 1549 --
NM_138766chr51156 ------
NM_138771chr7178 ------
NM_138779chr131220 ------
NM_138795chr12597 433 --1295 --
NM_138799chr231596 1375 806 ------
NM_138821chr51156 ------
NM_138822chr51156 ------
NM_138927chr212282 95 ------
NM_138959chr1115875 5540 4947 4838 4802 4777 4469 1297 1264 701 656 26263 6036 25670 1635 122
NM_138966chr18----1622 --
NM_138970chr1422182 373 --21897 603 1916
NM_138971chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138971chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138972chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138972chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138973chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138973chr1163612 3356 2578 2488 2424 2414 --12670 --
NM_138980chr4----1234 --
NM_138982chr4----1234 --
NM_139012chr652058 1447 525 382 51 ------
NM_139015chr1231618 1368 81 ------
NM_139045chr91694 ------
NM_139046chr10178 ----1218
NM_139047chr10------184
NM_139049chr10------184
NM_139057chr1552434 2353 1977 900 471 1408 2954 194 --
NM_139062chr172483 50 --161 1149
NM_139071chr122593 246 --2333 85 --
NM_139131chr112524 140 ------
NM_139135chr111266 --1352 --
NM_139156chr12829 80 ------
NM_139157chr11--1557 ----
NM_139166chr8------142
NM_139168chr51265 ------
NM_139169chr101424 --1182 --
NM_139177chr1731017 387 58 --1619 --
NM_139244chr6------1159
NM_139245chr331368 1254 54 ----1136
NM_139246chr952213 1612 1442 824 395 --2936 855 1923
NM_139278chr821069 22 --1379 --
NM_139283chr1222361 1584 --32350 936 235 1498
NM_139323chr201645 ----11320
NM_144488chr91705 --1617 --
NM_144489chr91705 --1617 --
NM_144571chr425958 950 --25924 5517 --
NM_144576chr122610 521 ------
NM_144579chr292894 2772 2765 2387 2213 2027 1969 836 539 22117 236 22832 2393 --
NM_144581chr14125 ------
NM_144582chr282612 2302 2259 2199 1743 1037 593 389 --1111 --
NM_144599chr1545236 4996 4662 127 12156 ----
NM_144600chr162623 568 --1434 --
NM_144609chr1721212 1182 ------
NM_144610chr171388 ------
NM_144632chr21341 --11709 --
NM_144633chr32405 231 --1331 --
NM_144644chr4----122 --
NM_144664chr1132611 2468 1013 --21576 920 --
NM_144667chr122952 195 --1313 --
NM_144721chr452528 2429 987 566 351 ------
NM_144723chr53773 620 30 1859 ----
NM_144728chr11666 ------
NM_144729chr11666 ------
NM_144767chr1594583 4315 3459 2972 1470 1328 1280 1180 275 13936 21535 1431 --
NM_144949chr242601 2487 2119 93 ------
NM_144963chr8--3714 610 276 22245 2082 --
NM_144967chrX1187 --1278 --
NM_145008chr112727 259 ------
NM_145010chr1031945 1557 673 --12194 --
NM_145021chr102803 127 --1277 --
NM_145049chr5----1124 --
NM_145055chr1831294 927 869 --13734 --
NM_145109chr172854 685 ------
NM_145112chr142894 396 ------
NM_145113chr1411166 ------
NM_145119chrX126 ------
NM_145175chr21449 --31329 1023 332 11191
NM_145203chr131731 ------
NM_145234chrX1710 ------
NM_145239chr163845 356 131 ------
NM_145259chr235813 5791 570 ------
NM_145284chrX--1999 12519 11766
NM_145296chr192680 327 --2828 743 --
NM_145307chr1023390 1416 --13755 --
NM_145320chr7------13178
NM_145321chr7------13178
NM_145322chr7------13178
NM_145331chr61536 ------
NM_145341chr10--11257 --1538
NM_145350chr1721398 1318 --1488 --
NM_145638chr114861 713 210 196 --1986 1229
NM_145647chr82173 162 ------
NM_145690chr821707 289 ------
NM_145793chr101223 --1876 --
NM_145800chrX1963 ------
NM_145808chr742721 2065 205 47 ------
NM_145891chr1621463 196 ------
NM_145892chr1621463 196 ------
NM_145893chr1621585 318 ------
NM_145899chr63404 358 223 ----1440
NM_145901chr63404 358 223 ----1440
NM_145902chr63404 358 223 ----1440
NM_145903chr63404 358 223 ----1440
NM_145904chr63404 358 223 ----1440
NM_145905chr63404 358 223 ----1440
NM_145909chr62543 150 --1263 --
NM_145912chr22154616 4255 3906 3719 3453 3396 1623 969 944 871 818 779 290 208 192 11677 ----
NM_147150chr911401 11009 23384 2735 12715
NM_147156chr1011414 --1328 --
NM_147161chr131104 1074 376 --11038 --
NM_147175chrX----1598 --
NM_147189chr831789 240 160 --1360 --
NM_147202chr931919 1098 793 22541 668 ----
NM_147223chr261527 724 605 506 486 393 ------
NM_147233chr25541 422 323 303 210 ------
NM_148174chr832226 1867 1852 ------
NM_148571chr1721409 239 ------
NM_148894chr4------1970
NM_148898chr7----1286 --
NM_148899chr7----1286 --
NM_148904chr1------1552
NM_148905chr1------1552
NM_148906chr1------1552
NM_148907chr1------1552
NM_148908chr1------1552
NM_148909chr1------1552
NM_152227chr201616 ------
NM_152233chr1421331 1134 ------
NM_152237chr2231318 134 58 --1282 11551
NM_152238chr11239 ------
NM_152244chr1741210 904 463 415 ------
NM_152247chr221239 ------
NM_152261chr1212182 --1139 --
NM_152263chr145806 4590 2349 2193 --14792 15982
NM_152265chr11577 --11130 --
NM_152267chr224728 662 222 75 ------
NM_152271chr82975 817 ----1366
NM_152277chr521956 199 ------
NM_152280chr12730 439 --33018 2712 1312 --
NM_152289chr1931705 1283 1062 ----1101
NM_152298chr12278 118 --1203 --
NM_152300chr172729 212 --2648 235 --
NM_152332chr1432718 2635 440 11903 22590 1880 --
NM_152335chr151109 ----1623
NM_152342chr162488 197 ----1537
NM_152344chr172546 58 ------
NM_152353chr19137 ------
NM_152375chr142471 2318 2252 1785 --12109 --
NM_152380chr131278 1180 656 --1272 --
NM_152387chr2------1374
NM_152390chr2185 ------
NM_152407chr532530 2390 172 1548 1229 1130
NM_152408chr5126 ----144
NM_152409chr52101 94 --13014 --
NM_152410chr62167 126 ------
NM_152414chr81192 ------
NM_152423chrX11188 ------
NM_152424chrX74279 4271 4140 3151 1013 753 619 --11816 13786
NM_152440chr124926 747 299 71 --1417 --
NM_152450chr1531732 1486 262 ------
NM_152470chr1844112 2524 1334 817 22659 808 21144 725 --
NM_152493chr131460 460 452 ------
NM_152520chr22352 175 1219 ----
NM_152538chr321550 1272 --11282 --
NM_152549chr52209 156 ------
NM_152556chr722311 719 ------
NM_152574chr91158 ------
NM_152594chr1511491 ------
NM_152609chr121178 487 --21154 223 1952
NM_152624chr575488 4925 4814 2530 2155 1994 1489 25565 1211 27403 6533 --
NM_152629chr923043 493 --23087 2698 --
NM_152641chr1212467 --12111 --
NM_152652chr161221 --1282 --
NM_152660chr11650 ------
NM_152685chr51386 ------
NM_152688chr6153 ------
NM_152695chrX21957 643 125 ----
NM_152704chr132739 151 ----1969
NM_152713chr11------1217
NM_152724chr1032156 191 104 --2281 26 --
NM_152734chr685386 3862 1754 1510 1313 867 733 272 --14530 --
NM_152744chr773192 2558 1079 675 588 267 185 ----12257
NM_152745chr71317 ------
NM_152758chr822457 2244 --11011 --
NM_152787chrX53640 3098 965 684 174 12958 1131 --
NM_152788chr12182 ------
NM_152829chr74965 884 846 47 ------
NM_152835chr122705 2302 ------
NM_152836chr8----11756 --
NM_152837chr8----11756 --
NM_152838chr2023451 1102 --22944 948 --
NM_152860chr1221189 498 --1206 --
NM_152878chr22--11139 1482 --
NM_152896chr9----136 --
NM_152902chr11432 ----11495
NM_152903chr1322177 448 ------
NM_152924chr1556303 2291 1831 508 353 ----14248
NM_153006chr172440 420 ------
NM_153026chr121402 ------
NM_153028chr16----2266 206 --
NM_153029chr1653901 3163 3043 1233 830 --22945 2515 --
NM_153035chr132558 1982 577 ------
NM_153047chr62409 26 ------
NM_153048chr62409 26 ------
NM_153181chr18----1622 --
NM_153183chrX----21181 222 --
NM_153188chr565071 4965 4599 4364 1100 507 --24388 2189 --
NM_153207chr122711 298 --1945 13574
NM_153211chr18191 ------
NM_153228chr17----193 --
NM_153252chrX----142 --
NM_153260chr151587 ----1277
NM_153270chrX3140 112 78 ------
NM_153280chrX177 ------
NM_153360chr201546 ------
NM_153367chr1053493 3429 2945 2695 226 --11446 --
NM_153450chr11162 --1617 --
NM_153499chr1282739 2675 2651 2500 2487 2028 937 595 --12657 11887
NM_153500chr1282739 2675 2651 2500 2487 2028 937 595 --12657 11887
NM_153607chr5----12475 --
NM_153616chr15----1366 131
NM_153617chr15----1366 131
NM_153618chr15----1366 131
NM_153619chr1522385 175 ----11269
NM_153620chr721643 359 21489 629 ----
NM_153631chr731391 1277 649 ------
NM_153632chr731391 1277 649 ------
NM_153634chr12------11202
NM_153649chr132105 1806 1609 ------
NM_153693chr122631 268 ------
NM_153705chr11----22374 810 1119
NM_153756chr141386 1376 404 145 ------
NM_153757chr41265 ------
NM_153759chr21168 ------
NM_153810chr1044853 4541 4001 3543 --1504 13711
NM_153812chr13808 499 54 --12230 --
NM_153827chr17194 --1732 --
NM_153832chr1180 --1297 --
NM_170662chr31187 ------
NM_170663chr17194 --1732 --
NM_170665chr1262956 2791 1069 885 598 542 --33690 1816 1522 --
NM_170679chr521118 271 ------
NM_170692chr11759 ------
NM_170706chr124043 1174 --34165 1664 1361 --
NM_170711chr195882 590 308 125 28 --1666 --
NM_170721chr1721108 839 --11152 --
NM_170731chr1132605 877 522 --12697 --
NM_170732chr1132605 877 522 --12697 --
NM_170733chr1132605 877 522 --12697 --
NM_170734chr1132605 877 522 --12697 --
NM_170735chr1132605 877 522 --12697 --
NM_170751chr611065 --1481 --
NM_170752chr611065 --1481 --
NM_170774chr2031637 1035 936 --13510 11665
NM_171999chr181762 --1140 --
NM_172016chr641112 1088 1073 304 ----1910
NM_172058chr8------11811
NM_172059chr8------11811
NM_172060chr8------11811
NM_172070chr21517 --11420 --
NM_172071chr157459 6111 2172 1902 1718 25700 308 36399 2621 2018 --
NM_172103chr622281 1770 ----1201
NM_172105chr622281 1770 ----1201
NM_172164chr12278 118 --1203 --
NM_172169chr1051721 625 477 388 369 --11409 11738
NM_172170chr1051721 625 477 388 369 --11409 11738
NM_172171chr1051721 625 477 388 369 --11409 11738
NM_172173chr1051721 625 477 388 369 --11409 11738
NM_172226chr1282739 2675 2651 2500 2487 2028 937 595 --12657 11887
NM_172375chr1421090 266 ------
NM_173065chr143125 2737 2582 2230 --22324 1261 --
NM_173074chr21346 --184 --
NM_173075chr421613 238 ------
NM_173076chr2141 ------
NM_173082chr621010 146 ------
NM_173174chr8184 ------
NM_173175chr8184 ------
NM_173176chr8184 ------
NM_173198chr922198 2030 ------
NM_173200chr922198 2030 ------
NM_173214chr1657321 5160 2879 1488 917 25290 1248 38101 2433 420 --
NM_173353chr12197 ------
NM_173354chr2121535 74 --1130 --
NM_173359chr311303 156 2761 246 --
NM_173465chr55974 925 786 299 231 --1112 --
NM_173468chr455074 4786 3681 732 667 --15001 --
NM_173469chr152442 212 1326 ----
NM_173470chrX52811 2782 2771 2005 1992 --1419 --
NM_173475chr1621484 1111 ------
NM_173476chr1632026 1869 275 --11508 --
NM_173478chr17----11095 --
NM_173489chr5----127 --
NM_173495chrX1479 136 ----
NM_173500chr1531354 1177 497 ------
NM_173510chr2242535 2493 1031 633 12146 12838 --
NM_173511chr21494 --23444 3218 --
NM_173515chr61202 ------
NM_173525chr11160 ------
NM_173531chr1943224 2662 2530 1563 ------
NM_173552chr32411 317 1790 ----
NM_173557chr182508 117 ------
NM_173562chr662283 2187 874 865 781 500 23003 809 ----
NM_173570chr352152 2032 1898 1709 306 ------
NM_173582chr1146047 4341 2169 188 --1682 --
NM_173595chr1264416 3880 3454 1977 171 33 --15298 --
NM_173602chr1273509 2942 2301 1481 1342 1316 605 13277 ----
NM_173609chr151756 --1618 --
NM_173642chr1109130 8569 8313 6333 5622 3378 2300 735 643 158 13372 35957 3218 1810 12047
NM_173653chr321032 305 11283 ----
NM_173664chr5----31310 1090 515 --
NM_173672chr622560 1946 ------
NM_173681chr721759 1562 ------
NM_173694chrX12018 --12043 1291
NM_173797chr511093 ------
NM_173809chr1031412 1154 1037 --11402 --
NM_173822chr211848 --1379 --
NM_173825chr332726 2232 430 ------
NM_173854chr152285 2051 1640 645 200 ----1328
NM_173872chr42373 284 1835 ----
NM_174909chr51818 ------
NM_174911chr811079 ------
NM_174916chr151103 ------
NM_174921chr42326 246 ------
NM_174934chr1183579 3478 3409 3129 2671 2223 431 332 --22431 658 --
NM_174937chr101136 ------
NM_175061chr7----11675 --
NM_175077chr2021066 990 11393 11090 --
NM_175607chr3--11195 ----
NM_175612chr3--11195 ----
NM_175624chr1266745 6551 5188 4737 2585 1113 16934 12852 1542
NM_175625chr1266745 6551 5188 4737 2585 1113 16934 12852 1542
NM_175629chr21168 ------
NM_175630chr26596 356 258 215 84 45 1332 ----
NM_175634chr811005 ------
NM_175635chr811005 ------
NM_175636chr811005 ------
NM_175733chr1142014 1675 1606 1553 --32091 2040 143 --
NM_175747chr6----1377 --
NM_175847chr1931355 543 324 ------
NM_175848chr2011253 --1291 --
NM_175848chr2011253 --1291 --
NM_175849chr2011253 --1291 --
NM_175849chr2011253 --1291 --
NM_175850chr2011253 --1291 --
NM_175850chr2011253 --1291 --
NM_175852chr172567 1923 1121 890 416 263 185 --11011 --
NM_175854chr1311013 ------
NM_175856chr5------2632 129
NM_175863chr611291 ------
NM_175873chr541200 1184 300 40 ------
NM_175875chr193536 128 21 ------
NM_175884chr741339 932 353 51 ------
NM_175900chr1631501 1394 38 --21524 561 --
NM_175907chr1822532 258 1872 1621 1403
NM_175931chr1681910 1878 1846 1814 1782 437 96 82 ----1711
NM_176792chr1031129 432 100 --1366 --
NM_176795chr11----1423 --
NM_176812chr202170 43 --1586 --
NM_176814chr7--11276 ----
NM_176823chr152859 1485 575 499 207 ----13819
NM_177398chr141692 1566 1345 1261 ----172
NM_177399chr141692 1566 1345 1261 ----172
NM_177414chr1--1569 1153 --
NM_177438chr14----24023 2973 --
NM_177441chr17----132 --
NM_177452chr1432066 2011 1910 ------
NM_177454chr21183 --1293 --
NM_177925chr1232605 2534 325 1285 ----
NM_177968chr221434 463 ------
NM_177969chr22462 147 ------
NM_177972chr1153745 1454 1291 626 96 11500 23566 1424 13918
NM_177983chr21124 ------
NM_177990chr2011458 1222 ----
NM_177996chr2083245 3137 3110 2292 2248 1375 1307 66 --12657 --
NM_177999chr963390 3271 3147 649 470 191 --1197 11460
NM_178006chr1312050 --11899 --
NM_178007chr1312050 --11899 --
NM_178026chr204510 391 379 77 ------
NM_178037chr1242814 2583 972 560 13372 12892 --
NM_178038chr1242814 2583 972 560 13372 12892 --
NM_178120chr22226 196 11004 ----
NM_178126chr1742147 689 651 125 --1502 --
NM_178135chr411111 ------
NM_178151chrX77682 5892 5253 5149 4863 3157 1605 --35484 5136 4786 --
NM_178152chrX77682 5892 5253 5149 4863 3157 1605 --35484 5136 4786 --
NM_178153chrX77682 5892 5253 5149 4863 3157 1605 --35484 5136 4786 --
NM_178313chr221860 63 ------
NM_178426chr131833 460 309 22061 554 21583 1499 --
NM_178427chr131733 360 209 21961 454 21483 1399 --
NM_178450chr5----1506 --
NM_178454chr12635 557 ------
NM_178470chrX----1241 1102
NM_178496chr311566 --11403 --
NM_178508chr6143 ------
NM_178539chr1221570 145 --21775 1732 1447
NM_178565chr8----11342 11077
NM_178566chr921828 577 1139 ----
NM_178568chr1721236 1147 11469 ----
NM_178585chr452580 2077 443 373 32 --1595 --
NM_178586chr1422347 2107 ----12338
NM_178812chr821323 624 ----11492
NM_178818chr1652246 2155 1746 1581 175 189 22252 1628 --
NM_178830chr192194 71 --1256 --
NM_178832chr1031332 1031 120 ------
NM_178835chr42823 650 --1656 --
NM_181050chr161131 ------
NM_181093chr12102 76 ------
NM_181291chr141208 ------
NM_181349chr742753 2506 2156 964 --1265 --
NM_181351chr1132897 2410 1102 --32215 1922 1144 --
NM_181354chr821630 1380 ------
NM_181357chr1451260 526 383 262 179 --2690 431 --
NM_181358chr113268 13308 --23190 3080
NM_181425chr921194 30 ------
NM_181443chr2022663 225 ------
NM_181453chr2--1371 11301 --
NM_181457chr2------11251
NM_181458chr2----145 11384
NM_181460chr2------11197
NM_181491chr932509 771 189 --22376 526 194
NM_181492chr22------11190
NM_181504chr543287 988 419 324 --34027 3247 3014 --
NM_181505chr171143 ------
NM_181507chr111357 ------
NM_181508chr111357 ------
NM_181523chr543287 988 419 324 --34027 3247 3014 --
NM_181524chr543287 988 419 324 --34027 3247 3014 --
NM_181527chr20--1110 ----
NM_181528chr20--1165 ----
NM_181571chr105913 888 877 318 82 ------
NM_181659chr2052988 2191 1141 760 557 --1639 --
NM_181659chr2052988 2191 1141 760 557 --1639 --
NM_181670chr122120 61 ------
NM_181672chrX11918 --1272 --
NM_181673chrX11918 --1272 --
NM_181674chr5176 ------
NM_181675chr5176 ------
NM_181676chr5176 ------
NM_181677chr5176 ------
NM_181678chr5176 ------
NM_181689chr201740 ------
NM_181701chr942129 733 381 139 1255 ----
NM_181714chr621721 197 ------
NM_181715chr11302 ------
NM_181784chr221958 1801 ------
NM_181825chr221307 ------
NM_181828chr2253695 3361 3042 2504 1302 --144 --
NM_181829chr2253695 3361 3042 2504 1302 --144 --
NM_181830chr2253695 3361 3042 2504 1302 --144 --
NM_181832chr2253710 3376 3057 2519 1317 --159 --
NM_181836chr522006 1694 1672 ----
NM_181838chr51602 --21392 648 --
NM_181839chr821280 219 ------
NM_181843chr112356 312 ------
NM_181876chr431081 612 329 22172 2013 ----
NM_181897chr32617 545 ----11844
NM_182314chrX21675 1575 --21219 563 --
NM_182485chr441411 1371 702 52 ------
NM_182493chr1634985 4962 4839 --31919 677 91 --
NM_182498chr191283 ------
NM_182501chr282993 2492 2441 2279 1126 754 595 121 --21304 673 --
NM_182503chr655525 5477 5339 4704 1533 15082 --14167
NM_182520chr221909 ------
NM_182526chr1492998 2723 2393 2183 2055 1972 857 643 530 --1600 --
NM_182528chr22199 154 ------
NM_182537chr3----1304 --
NM_182540chrX2170 132 ------
NM_182551chr243244 2466 970 270 ----13523
NM_182557chr1131674 1595 85 --11689 --
NM_182620chr172348 120 --31690 548 397 --
NM_182646chr441411 1371 702 52 ------
NM_182664chr111528 1103 1508 --
NM_182687chr16----1189 --
NM_182691chr71102 ------
NM_182692chr71102 ------
NM_182700chr721715 282 --21772 219 --
NM_182715chr7----1100 --
NM_182717chr1041318 1293 1282 487 ------
NM_182718chr105913 888 877 318 82 ------
NM_182719chr105913 888 877 318 82 ------
NM_182720chr1041318 1293 1282 487 ------
NM_182721chr1041318 1293 1282 487 ------
NM_182722chr1041318 1293 1282 487 ------
NM_182723chr1041318 1293 1282 487 ------
NM_182724chr105913 888 877 318 82 ------
NM_182725chr105913 888 877 318 82 ------
NM_182756chr21417 ------
NM_182757chr643339 2973 772 694 ------
NM_182763chr132485 1870 553 ------
NM_182765chr1021841 505 ------
NM_182769chr105913 888 877 318 82 ------
NM_182770chr105913 888 877 318 82 ------
NM_182771chr105913 888 877 318 82 ------
NM_182772chr105913 888 877 318 82 ------
NM_182797chr201471 --11214 --
NM_182848chr1311506 --1194 --
NM_182850chr105913 888 877 318 82 ------
NM_182853chr1041318 1293 1282 487 ------
NM_182896chr321629 440 ------
NM_182898chr742354 1554 1171 22 --1122 --
NM_182899chr742354 1554 1171 22 --1122 --
NM_182907chr6173 1790 32340 2037 976 --
NM_182917chr31156 ------
NM_182918chr2121359 1016 --21271 1048 1305
NM_182920chr3----11229 --
NM_182948chr152921 2866 1005 427 128 ------
NM_182961chr61157 1631 ----
NM_182970chr2084221 3701 3543 3119 2714 1655 1461 34 --24321 3448 --
NM_182972chr132561 1937 1849 --32255 2244 652 --
NM_183004chr1463204 2624 1586 1460 146 98 23472 1279 --1955
NM_183006chr2031121 510 317 --1158 --
NM_183011chr1041318 1293 1282 487 ------
NM_183012chr1041318 1293 1282 487 ------
NM_183013chr1041318 1293 1282 487 ------
NM_183060chr105913 888 877 318 82 ------
NM_183078chr643525 1018 400 324 ------
NM_183079chr2021484 1250 --11067 --
NM_183227chr6------11388
NM_183243chr71274 1648 ----
NM_183243chr71274 1648 -