TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4758-3p
miRNA Sequence: UGCCCCACCUGCUGACCACCCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000025chr81448 ------
NM_000109chrX11956 ----1654
NM_000212chr173171 104 91 12127 --1117
NM_000217chr1254209 3466 1730 1246 1240 11743 11208 --
NM_000237chr8197 1204 ----
NM_000259chr15----14065 15069
NM_000332chr665859 2249 831 671 504 391 1812 --16424
NM_000345chr4----1824 --
NM_000362chr221156 ------
NM_000386chr17----1581 --
NM_000462chr1511711 ------
NM_000489chrX13447 ------
NM_000555chrX67205 7099 6199 6137 5110 2827 23110 238 --11816
NM_000597chr2--1249 ----
NM_000611chr1186082 5877 4995 1912 1858 1672 862 544 16657 --1386
NM_000618chr1225669 5315 ------
NM_000618chr1225669 5315 ------
NM_000680chr81126 ------
NM_000682chr261752 1682 1424 696 557 209 --2465 26 11258
NM_000724chr1021553 82 ------
NM_000767chr191409 ------
NM_000801chr201273 ------
NM_000814chr1533469 619 571 13773 ----
NM_000875chr1566487 4872 4535 2183 825 58 26236 5458 12553 --
NM_000903chr1611131 11153 ----
NM_001001330chr101121 ------
NM_001001392chr1131099 510 42 ------
NM_001001436chr16--2320 313 ----
NM_001001522chr111393 ------
NM_001002027chr17164 ------
NM_001002243chr21256 ------
NM_001002914chr1751230 1153 970 808 28 146 --11239
NM_001003698chr6164 --11376 --
NM_001003699chr6164 --11376 --
NM_001003800chr972372 891 832 317 249 236 138 13461 ----
NM_001003940chr1543724 3487 2733 1138 128 1942 13290
NM_001003942chr1543724 3487 2733 1138 128 1942 13290
NM_001003943chr1543728 3491 2737 1142 132 1946 13294
NM_001004304chr1283266 3043 2760 2721 1181 1168 1009 272 12565 ----
NM_001004317chr621441 1093 21205 540 --13201
NM_001004323chr7149 ------
NM_001005353chr111244 --11133 --
NM_001005353chr111244 --11133 --
NM_001005375chrY11461 ------
NM_001005463chr101547 ------
NM_001005739chr22806 113 ------
NM_001006945chr1--1191 ----
NM_001007099chr1--1252 ----
NM_001007100chr1--1252 ----
NM_001007156chr1571907 1561 1407 1368 1357 1284 486 11606 1417 --
NM_001007237chr1193 12770 ----
NM_001008225chr7136 ------
NM_001008392chr312525 ------
NM_001008541chr1022277 375 ----1185
NM_001008541chr1022277 375 ----1185
NM_001008925chr413119 ----12176
NM_001009554chr444224 3407 1650 466 ------
NM_001009554chr444224 3407 1650 466 ------
NM_001010867chr1106121 5567 5338 4784 2169 1247 914 431 49 42 36414 5502 515 31754 667 487 --
NM_001010924chr101892 ------
NM_001012393chr112655 250 --1181 13904
NM_001012751chr10------1286
NM_001013439chr3----1311 --
NM_001013622chr41796 7903 486 424 363 177 116 54 1968 --
NM_001013693chr1102190 1948 1168 1066 819 583 559 419 346 332 22027 184 12044 21091 705
NM_001013693chr1102190 1948 1168 1066 819 583 559 419 346 332 22027 184 12044 21091 705
NM_001014797chr1045920 2142 2068 1235 15426 --16453
NM_001014987chr162160 81 ------
NM_001014988chr162160 81 ------
NM_001014989chr162160 81 ------
NM_001015887chr3----168 --
NM_001017440chr747600 6302 649 160 25960 913 1563 --
NM_001017963chr14--1237 1822 --
NM_001017999chr11875 --195 --
NM_001017999chr11875 --195 --
NM_001018000chr11875 --195 --
NM_001018000chr11875 --195 --
NM_001018001chr11875 --195 --
NM_001023567chr1521725 61 ------
NM_001024460chr6----1955 --
NM_001025076chr1034214 2436 1506 21943 651 ----
NM_001025077chr1035572 2864 1231 12009 ----
NM_001025079chr313352 1961 --11329
NM_001025252chr812855 --11982 --
NM_001025253chr812855 --11982 --
NM_001025778chr191255 ------
NM_001030001chr141448 ------
NM_001030007chr1612647 --13429 1433
NM_001031717chr31112 1364 --1297
NM_001031732chr423598 2984 1232 ----
NM_001032279chr11187 ------
NM_001032288chr2021153 367 --1500 1301
NM_001033081chr131448 422 273 11809 ----
NM_001033082chr131448 422 273 11809 ----
NM_001033117chr354295 4155 3100 1241 760 --13877 1723
NM_001033557chr21393 ------
NM_001034833chr5----1307 --
NM_001037954chr1123536 1051 ----12489
NM_001038707chr12502 201 2813 384 21839 1792 --
NM_001038707chr12502 201 2813 384 21839 1792 --
NM_001039479chr1422146 1592 --1458 1765
NM_001040152chr7----14678 --
NM_001040217chr11285 ------
NM_001040709chr152509 2054 1903 1757 263 21590 770 22319 987 --
NM_001042357chr101175 ------
NM_001042358chr101175 ------
NM_001042360chr101175 ------
NM_001042361chr101206 ------
NM_001042363chr101175 ------
NM_001042364chr101206 ------
NM_001042365chr101206 ------
NM_001042387chr101206 ------
NM_001042389chr101175 ------
NM_001042390chr101175 ------
NM_001042392chr101175 ------
NM_001042393chr101206 ------
NM_001042395chr101175 ------
NM_001042396chr101206 ------
NM_001042397chr101206 ------
NM_001042404chr121277 603 ------
NM_001042498chrX143 --1442 --
NM_001042510chr812084 ------
NM_001042511chr812084 ------
NM_001042681chr121987 282 ------
NM_001042682chr121987 282 ------
NM_001042682chr121987 282 ------
NM_001046chr5----12426 --
NM_001106chr389647 6546 6396 3286 3030 2179 1962 1798 37932 3580 2217 28158 2862 --
NM_001128chr1612647 --13429 1433
NM_001146chr821536 195 ------
NM_001189chr4----1327 --
NM_001241chr2--11801 ----
NM_001241chr2--11801 ----
NM_001288chr6----1196 --
NM_001386chr841818 1510 157 145 --1440 --
NM_001396chr2111815 --1275 --
NM_001412chrX13130 ------
NM_001420chr1962875 2573 936 739 729 166 1434 2540 426 --
NM_001448chrX11306 --11311 --
NM_001454chr171617 1752 1887 1951
NM_001463chr21685 ------
NM_001542chr1193 12770 ----
NM_001543chr5114747 4738 4687 4020 1668 1561 1511 1370 1232 1181 993 1652 34869 4470 139 --
NM_001567chr115642 544 534 476 122 ----1550
NM_001616chr2--12506 --1541
NM_001617chr211175 ----11240
NM_001626chr1993447 2661 2423 1398 1234 962 935 721 320 13458 11409 --
NM_001654chrX1349 ------
NM_001655chr11--12101 ----
NM_001659chr1262322 1951 1718 935 505 262 ----1310
NM_001660chr3----1561 --
NM_001701chr9------1485
NM_001777chr313352 1961 --11329
NM_001782chr92260 76 ------
NM_001798chr1211019 ------
NM_001918chr139049 7090 199 ------
NM_001949chr641994 1213 1046 363 --12049 --
NM_001964chr51367 1439 ----
NM_001967chr32231 213 ------
NM_001995chr421422 1282 ------
NM_002062chr64486 390 318 27 ------
NM_002092chr425071 4339 1753 11665 --
NM_002107chr11107 ------
NM_002128chr13----12268 --
NM_002130chr5146 1488 135 --
NM_002139chrX--1417 ----
NM_002146chr17------1302
NM_002148chr21164 ------
NM_002270chr555581 3927 733 706 504 ------
NM_002309chr2263073 2273 2130 2124 84 61 32772 1935 881 12841 --
NM_002353chr1126 1261 --132
NM_002359chr1774092 4049 2751 1497 1487 1400 1317 --1235 --
NM_002375chr332222 2018 432 ------
NM_002390chr1762072 2030 1857 500 484 149 11455 11578 --
NM_002401chr1732281 1983 154 --32177 1788 172 --
NM_002480chr121171 ------
NM_002501chr1952992 2623 1021 785 530 ----11294
NM_002515chr14----1386 --
NM_002545chr112655 250 --1181 13904
NM_002577chr323457 84 1343 ----
NM_002589chr4----191 --
NM_002595chr1211425 --11746 --
NM_002608chr2231466 310 69 ------
NM_002629chr101611 ------
NM_002655chr81796 ------
NM_002713chr1144 1798 1160 --
NM_002717chr81585 ------
NM_002738chr161798 ------
NM_002821chr6----1677 --
NM_002840chr141410 534 430 303 1315 31060 308 39 1346
NM_002849chr12138 ------
NM_002859chr1251738 1729 1591 1236 390 11426 ----
NM_002867chr11157 ------
NM_002893chrX----1102 --
NM_002901chr11--1128 ----
NM_002941chr3--1575 ----
NM_002955chr6164 --11376 --
NM_002979chr1--1252 ----
NM_003011chr91511 ------
NM_003079chr171339 ------
NM_003099chr15105772 5350 4881 4401 2488 1331 1315 1280 543 256 14376 14216 --
NM_003112chr71142 ------
NM_003131chr651783 1733 906 575 389 32128 1810 1443 21557 352 --
NM_003156chr1151349 1286 1271 499 303 ----1101
NM_003161chr172716 705 ------
NM_003164chr11132 ------
NM_003186chr111393 ------
NM_003189chr13416 347 162 --22178 76 --
NM_003216chr2292854 2226 2188 1088 1001 607 601 594 210 --23123 571 --
NM_003217chr121205 ------
NM_003222chr201897 1979 ----
NM_003286chr201718 ------
NM_003349chr2021153 367 --1500 1301
NM_003387chr21246 ------
NM_003453chr132499 480 ------
NM_003478chr11----1320 --
NM_003483chr121114 --4149 129 124 119 --
NM_003559chr1752923 2583 1278 316 44 ------
NM_003566chr121703 ------
NM_003615chr311392 ------
NM_003618chr21368 ------
NM_003629chr142692 1121 858 260 --1325 --
NM_003657chr20------1796
NM_003716chr31929 ------
NM_003872chr21276 --2843 829 12803
NM_003893chr101356 ------
NM_003934chr911236 ------
NM_003945chr5----1403 --
NM_004006chrX11956 ----1654
NM_004007chrX11956 ----1654
NM_004009chrX11956 ----1654
NM_004010chrX11956 ----1654
NM_004011chrX11956 ----1654
NM_004012chrX11956 ----1654
NM_004013chrX11956 ----1654
NM_004014chrX11956 ----1654
NM_004015chrX11956 ----1654
NM_004017chrX11956 ----1654
NM_004020chrX11956 ----1654
NM_004035chr1721705 445 --14291 15077
NM_004081chrY11461 ------
NM_004153chr1129 ------
NM_004227chr742743 1241 265 173 12762 ----
NM_004235chr91200 ------
NM_004242chr6121 ------
NM_004302chr1222066 1161 ------
NM_004319chr11253 ------
NM_004321chr273266 3193 2826 2770 1168 647 568 --13204 1559
NM_004436chr12640 265 --2286 272 --
NM_004437chr153305 2443 1221 957 265 11295 ----
NM_004450chr142334 30 ------
NM_004459chr171307 ------
NM_004463chrX----1447 --
NM_004472chr5--1244 ----
NM_004486chr931169 1115 979 --2942 38 --
NM_004505chr1711956 ------
NM_004514chr1762948 2928 1982 1922 1016 455 21128 535 11872 --
NM_004537chr121970 ------
NM_004588chr1193794 3003 2870 2819 1106 924 656 390 123 1844 33110 960 796 1910
NM_004630chr11----1733 --
NM_004660chrY1541 11872 ----
NM_004687chr17--1208 ----
NM_004694chr17150 ------
NM_004717chr7--11349 ----
NM_004758chr1741199 895 123 41 --1155 11053
NM_004774chr1743081 2617 2602 2049 --12610 --
NM_004783chr164560 462 454 154 --1641 --
NM_004798chr2053578 3448 3287 3086 369 13476 ----
NM_004801chr211371 ------
NM_004834chr231337 668 624 11212 2629 610 --
NM_004845chrX43366 1646 1487 302 ------
NM_004864chr191153 ------
NM_004976chr1154013 3486 1302 1065 352 14112 23458 3397 1294
NM_004985chr1231258 763 264 ----13626
NM_004992chrX77581 7012 5899 3387 3276 3200 823 38208 6463 2909 13036 --
NM_004992chrX77581 7012 5899 3387 3276 3200 823 38208 6463 2909 13036 --
NM_004995chr1451460 1237 973 544 359 ----11440
NM_005022chr171213 ------
NM_005027chr192442 133 ------
NM_005029chr10166 ------
NM_005067chr31186 ------
NM_005079chr812855 --11982 --
NM_005087chr3----1311 --
NM_005105chr131542 453 75 ------
NM_005116chr2074406 4359 4299 3715 3006 2776 1781 21242 626 14411 --
NM_005121chr171106 ------
NM_005124chr6181 ------
NM_005133chr11187 ------
NM_005175chr17164 ------
NM_005178chr19----158 --
NM_005206chr1711082 11151 ----
NM_005229chrX2847 34 --2894 119 --
NM_005233chr3------1201
NM_005234chr19----1304 --
NM_005256chr11--1607 ----
NM_005277chr411587 ------
NM_005281chr11764 ------
NM_005339chr42979 677 24215 3227 14201 --
NM_005348chr14--1237 1822 --
NM_005376chr12749 165 21018 824 ----
NM_005381chr2151 --1357 --
NM_005386chr20----193 --
NM_005442chr31633 ------
NM_005453chr6------125
NM_005497chr1724720 1160 ------
NM_005504chr1236040 5982 4871 ------
NM_005574chr11------1104
NM_005595chr1--1904 ----
NM_005596chr912068 ------
NM_005639chr1211659 ------
NM_005715chr61133 ------
NM_005731chr21405 ------
NM_005746chr7----166 --
NM_005751chr7--1468 ----
NM_005779chr523347 407 ------
NM_005785chr1211658 21458 154 ----
NM_005786chr18--1870 --1266
NM_005801chr171118 ------
NM_005802chr91252 ------
NM_005808chr312525 ------
NM_005875chr3--1158 ----
NM_005910chr17104028 3521 3429 3095 3080 2773 1089 708 518 413 --1523 12919
NM_005920chr1103700 3422 2922 2791 2493 1013 984 957 730 329 13720 23427 1089 11510
NM_005933chr1152642 870 587 268 230 12016 --12122
NM_005935chr445079 4642 1180 754 ------
NM_005962chr1022277 375 ----1185
NM_005962chr1022277 375 ----1185
NM_006022chr131378 ------
NM_006047chr20--12550 ----
NM_006073chr6--11517 ----
NM_006136chr71387 ------
NM_006141chr1642216 752 650 469 2226 106 11832 1775
NM_006166chr1222539 2042 ------
NM_006185chr111570 --1512 --
NM_006203chr51333 11915 --15065
NM_006212chr133411 1013 300 --25191 884 14152
NM_006228chr81352 ------
NM_006239chr41162 ------
NM_006244chr111392 1555 ----
NM_006246chr141546 ------
NM_006367chr11171 ------
NM_006449chr211614 129 ----
NM_006489chr14----1386 --
NM_006494chr196839 786 777 717 572 173 --1791 --
NM_006497chr17--1215 ----
NM_006546chr1756079 5251 4372 4080 761 14764 --26559 1076
NM_006561chr1034214 2436 1506 21943 651 ----
NM_006565chr1611242 ------
NM_006599chr16----12155 --
NM_006624chr10--1671 ----
NM_006766chr811941 ------
NM_006772chr661480 1157 1150 611 213 178 ------
NM_006888chr14--12727 ----
NM_006910chr161257 ------
NM_006922chr212033 ------
NM_006981chr932077 235 202 ------
NM_007033chr132270 2157 1805 --22165 491 --
NM_007125chrY11340 ------
NM_007212chr111429 11971 12187 --
NM_007249chr1348491 7509 7084 2767 18056 1928 18156
NM_007292chr1721705 445 --14291 15077
NM_007372chr17185 ------
NM_012102chr121987 282 ------
NM_012105chr211268 ------
NM_012155chr191210 ------
NM_012199chr183917 3532 3313 1713 1421 1197 839 155 ----1101
NM_012223chr2173 ------
NM_012249chr213113 ------
NM_012259chr611169 ------
NM_012297chr4------11631
NM_012308chr1142200 1863 703 306 ----1152
NM_012329chr17----160 --
NM_012456chr11127 ------
NM_013261chr4--13341 ----
NM_013279chr1122026 549 ------
NM_013305chr18--1151 192 --
NM_013330chr1--1206 ----
NM_013410chr111244 --11133 --
NM_013438chr931340 1151 1118 ----11128
NM_013446chr72899 370 ------
NM_013995chrX----11706 --
NM_014110chr1144 1798 1160 --
NM_014112chr815000 ------
NM_014155chr111150 14581 ----
NM_014213chr22592 230 ------
NM_014233chr1772009 1946 1689 1505 332 326 151 11881 1388 --
NM_014253chrX----11689 --
NM_014278chr41415 ------
NM_014326chr1521239 271 ------
NM_014423chr525322 337 --24934 4854 --
NM_014445chr312269 ------
NM_014515chr12--144 ----
NM_014584chr14----11561 --
NM_014614chr2----11133 --
NM_014621chr2----1107 --
NM_014661chr10113737 3707 3685 3064 2971 2882 2838 610 391 369 29 21216 799 12957 --
NM_014670chr211508 ------
NM_014683chr17--12042 ----
NM_014727chr19----1277 --
NM_014730chr1223724 872 24204 1982 --13672
NM_014730chr1223724 872 24204 1982 --13672
NM_014739chr634050 3269 867 13514 ----
NM_014740chr17189 ------
NM_014747chr194732 3754 3696 2329 2119 1702 1686 1087 35 44563 4154 1665 398 --25461 357
NM_014764chr121117 ------
NM_014779chr31231 --1281 --
NM_014786chr1151195 1158 803 456 236 ------
NM_014812chr121277 603 ------
NM_014820chr311922 ------
NM_014827chr11163 ------
NM_014828chr14----2290 279 --
NM_014850chr354295 4155 3100 1241 760 --13877 1723
NM_014877chr1757684 6243 5605 4922 2277 11116 ----
NM_014909chr14113605 2984 2861 1570 1280 1097 1022 893 885 443 323 --1450 --
NM_014935chr183595 3045 1124 985 573 332 273 154 33173 2985 1073 ----
NM_014952chr1561703 1347 409 323 308 23 11673 2738 43 --
NM_015000chr1212254 ------
NM_015002chr1242033 1567 1468 392 ------
NM_015009chr3--149 ----
NM_015020chr161753 33587 1073 48 2438 167 --
NM_015027chr16----11906 --
NM_015035chr2056576 6542 5016 2150 208 1905 26528 4308 14498
NM_015039chr143126 2713 232 137 ----12784
NM_015049chr232281 2010 1275 ----1448
NM_015060chr71203 ------
NM_015068chr7----13530 --
NM_015075chrX32223 2169 1933 11831 21393 437 11561
NM_015076chr612925 ------
NM_015092chr161422 13495 ----
NM_015094chr2294410 4052 3852 3782 3404 3260 2933 979 965 24226 3959 24275 1756 --
NM_015100chr111880 ----193
NM_015144chr1613929 13119 13131 --
NM_015158chr9163 ------
NM_015163chr14----185 --
NM_015172chr111266 ------
NM_015191chr1131991 1788 153 ----1576
NM_015192chr2011931 ----12341
NM_015199chr322979 783 1925 ----
NM_015209chr11875 --195 --
NM_015250chr91674 11763 ----
NM_015265chr2----1595 --
NM_015270chr1252322 2316 1514 1460 761 42091 1467 827 231 ----
NM_015282chr2----4448 390 385 296 --
NM_015305chr1451928 1378 686 525 470 1540 ----
NM_015313chr1123904 995 --13157 14156
NM_015315chr542854 616 526 21 22369 2257 ----
NM_015335chr1221835 497 ------
NM_015336chr12----11822 --
NM_015343chr17130 ------
NM_015347chr12----1111 --
NM_015388chr6198 ------
NM_015436chr412938 ------
NM_015470chr231184 791 144 ----189
NM_015537chr961103 1024 870 848 304 60 --1741 --
NM_015548chr61186 ------
NM_015553chr613654 11213 1270 14697
NM_015564chr512857 ------
NM_015605chr101206 ------
NM_015649chr19--1146 ----
NM_015686chrX4974 290 264 105 ----12493
NM_015719chr192174 46 ------
NM_015726chr14364 315 206 31 --11799 122
NM_015872chr191687 1668 1587 1512 1318 618 518 351 195 2175 96 1258 --
NM_015878chr811701 ------
NM_015892chr101452 ------
NM_015898chr1972321 712 423 402 361 354 293 --21555 724 --
NM_016022chr121004 424 ------
NM_016096chr812084 ------
NM_016169chr1063186 2965 2910 2775 2014 810 12022 1146 --
NM_016206chr317884 26623 2805 26246 1894 12632
NM_016213chr151191 ------
NM_016231chr172435 305 ------
NM_016277chr6----1531 --
NM_016440chr191255 ------
NM_016441chr21279 ------
NM_016516chr22806 113 ------
NM_016522chr11----11633 --
NM_016588chr6--1626 ----
NM_016623chr81254 ------
NM_016823chr171952 11021 ----
NM_016834chr17104028 3521 3429 3095 3080 2773 1089 708 518 413 --1523 12919
NM_016835chr17104028 3521 3429 3095 3080 2773 1089 708 518 413 --1523 12919
NM_016841chr17104028 3521 3429 3095 3080 2773 1089 708 518 413 --1523 12919
NM_016953chr215526 14234 --1199
NM_017409chr121201 --1216 --
NM_017420chr1413649 ----13655
NM_017483chr211175 ----11240
NM_017551chr1021907 565 12234 2903 857 1169
NM_017553chr151193 ------
NM_017590chr2282490 2255 1737 873 528 356 96 34 --252 47 --
NM_017599chr121516 ----11988
NM_017629chr121697 1655 ----1394
NM_017657chr21256 ------
NM_017719chr3--12047 ----
NM_017728chr1793008 2819 2641 2494 2066 2059 1940 1009 145 1101 1999 12980
NM_017744chr11280 ------
NM_017786chr81493 ----1218
NM_017902chr1044165 1787 1229 589 14286 11506 --
NM_017919chr92777 167 1971 ----
NM_017944chr1111923 198 --12473
NM_017953chr11328 184 ----
NM_017993chr13----183 --
NM_017994chr71359 --12890 --
NM_018110chr1611301 --11069 --
NM_018150chr12672 275 1625 --2295 264
NM_018157chr1221261 857 ------
NM_018179chr121208 ------
NM_018192chr3----11019 --
NM_018201chr91735 ------
NM_018224chr7170 ------
NM_018247chr6------12808
NM_018372chr1--1191 ----
NM_018433chr21506 ------
NM_018445chr151430 --1106 --
NM_018644chr1112158 --21727 252 --
NM_018703chr161257 ------
NM_018704chr11659 ------
NM_018719chr721159 280 --1285 --
NM_018898chr5--12107 ----
NM_018899chr5--12107 ----
NM_018900chr5--12107 ----
NM_018901chr5--12107 ----
NM_018902chr5--12107 ----
NM_018903chr5--12107 ----
NM_018904chr5--12107 ----
NM_018905chr5--12107 ----
NM_018906chr5--12107 ----
NM_018907chr5--12107 ----
NM_018908chr5--12107 ----
NM_018909chr5--12107 ----
NM_018910chr5--12107 ----
NM_018911chr5--12107 ----
NM_018999chr1013639 11725 ----
NM_019022chr1812441 ------
NM_019027chr41891 ------
NM_019063chr212029 --12183 --
NM_019596chr2152859 2700 2007 1902 868 ------
NM_019892chr9----138 --
NM_020122chr225027 1180 15592 14699 --
NM_020159chr4183 ------
NM_020198chr172157 150 --11201 --
NM_020239chr12502 201 2813 384 21839 1792 --
NM_020357chr3121 --128 --
NM_020381chr61719 ------
NM_020420chrY11461 ------
NM_020443chr135069 4534 1052 --26348 197 --
NM_020456chr1311819 ------
NM_020465chr161110 ------
NM_020647chr81217 ------
NM_020673chr2076631 6591 5706 5225 904 848 68 --15645 --
NM_020713chr2073121 2854 2337 910 899 277 205 22033 713 32434 2012 798 2928 131
NM_020717chrX11556 11786 --23172 1798
NM_020747chr51620 ------
NM_020748chr1711600 ------
NM_020772chr171622 21533 1246 1666 --
NM_020781chr721237 125 --13109 --
NM_020804chr672340 2045 1979 872 207 200 192 21753 660 12424 --
NM_020870chr41507 1611 ----
NM_020886chr1111001 ------
NM_020946chr921670 489 ----1535
NM_020956chr19104484 4298 3976 3358 3288 3121 1305 1207 636 456 --34529 3884 522 --
NM_020983chr1252322 2316 1514 1460 761 42091 1467 827 231 ----
NM_021047chr191503 ------
NM_021116chr793385 3131 2319 2136 1832 1667 551 36 25 ------
NM_021160chr6134 ------
NM_021647chr444224 3407 1650 466 ------
NM_021912chr1533469 619 571 13773 ----
NM_021951chr9163 ------
NM_021966chr141127 ------
NM_021973chr41499 ------
NM_021976chr651038 1001 262 108 80 172 1993 --
NM_021977chr643285 3056 2445 629 ------
NM_021988chr2021153 367 --1500 1301
NM_022143chr751523 1407 1160 210 73 11319 --1236
NM_022166chr1664391 3842 2519 2371 2046 2017 --21848 66 --
NM_022170chr75464 325 293 31 25 11374 ----
NM_022442chr2021153 367 --1500 1301
NM_022491chr1273483 2922 2910 2805 1213 1166 642 1490 ----
NM_022553chr6--182 ----
NM_022574chr752071 2065 1756 1609 442 2516 436 1629 1775
NM_022648chr244107 1033 136 49 --23452 1863 1455
NM_022719chr22113201 2988 1208 1096 1067 901 827 681 618 317 152 --31446 837 387 --
NM_022735chr11185 ------
NM_022756chr131330 1056 484 11190 ----
NM_022823chr2156 ------
NM_022898chr143979 907 614 --11205 --
NM_022900chr7------11135
NM_022910chr161110 ------
NM_022913chr5159 ------
NM_023010chrX------1122
NM_023924chr52617 474 ------
NM_024423chr1834203 3297 1142 1880 13169 --
NM_024496chr141616 ------
NM_024546chr131256 ------
NM_024572chr2134 ------
NM_024617chr91590 ------
NM_024624chr2----1463 --
NM_024713chr1511223 ------
NM_024742chr1641551 1335 706 700 --21593 1324 --
NM_024757chr9----11018 --
NM_024834chr101441 1660 ----
NM_024969chr2----1907 --
NM_025146chr3------22424 602
NM_025154chr711398 ------
NM_025182chr94963 871 823 772 ------
NM_025203chr211435 11346 ----
NM_025219chr204842 789 244 120 --12047 12387
NM_025222chr342762 2724 2666 547 --1293 12733
NM_025235chr1022066 1830 ------
NM_025248chr1783239 2439 2403 2198 2189 1133 921 751 --22992 1056 --
NM_030579chr1653398 2648 2390 841 41 --12934 --
NM_030621chr14----12675 --
NM_030634chr111515 ------
NM_030647chr754383 4363 3930 487 195 --25995 5977 11483
NM_030648chr424589 2196 13865 14957 12175
NM_030650chr214074 ------
NM_030786chr111197 --1407 --
NM_030806chr147954 6474 2377 1185 18537 --12808
NM_030884chr332222 2018 432 ------
NM_030963chr61106 ------
NM_031407chrX----126 --
NM_031411chr5--12107 ----
NM_031450chr11147 ------
NM_031468chr747600 6302 649 160 25960 913 1563 --
NM_031849chr5--12107 ----
NM_031857chr5--12107 ----
NM_031860chr5--12107 ----
NM_031992chr75464 325 293 31 25 11374 ----
NM_032102chr111534 ------
NM_032242chr332639 2411 2339 --12133 11269
NM_032281chr1962875 2573 936 739 729 166 1434 2540 426 --
NM_032287chr2244198 3338 2566 1651 --13408 --
NM_032317chr721336 463 21325 581 ----
NM_032320chr11--1319 ----
NM_032352chr141560 ------
NM_032368chr1164 ------
NM_032382chr161201 ----1455
NM_032434chr2--1328 ----
NM_032558chr911290 ------
NM_032682chr312995 ------
NM_032711chr1774092 4049 2751 1497 1487 1400 1317 --1235 --
NM_032905chr102796 362 ------
NM_032932chr1796337 6298 5392 5340 2042 1874 1603 559 148 25812 4989 34441 4092 2449 --
NM_032983chr7----1441 --
NM_033016chr2231466 310 69 ------
NM_033088chr12680 461 --1472 --
NM_033211chr511329 ------
NM_033260chr6----1696 --
NM_033316chr3125 ------
NM_033326chr1121796 363 ------
NM_033360chr1231379 884 385 ----13747
NM_033401chr161142 ------
NM_033420chr1931008 899 199 --41053 904 842 776 --
NM_033425chr1123536 1051 ----12489
NM_033449chr551603 1521 1398 371 272 ----11718
NM_033503chr1543724 3487 2733 1138 128 1942 13290
NM_033551chr542854 616 526 21 22369 2257 ----
NM_033624chr1242033 1567 1468 392 ------
NM_033656chr2115641 25552 1099 ----
NM_044472chr11554 ------
NM_052827chr1211019 ------
NM_052876chr19112233 2225 2046 2019 1803 1743 1039 1003 662 533 241 1518 12490 --
NM_052896chr122536 967 ----12111
NM_052900chr8--1732 ----
NM_052906chr22134957 3790 3522 2029 1966 1615 1535 1493 1426 693 379 362 290 23778 3190 34216 916 346 --
NM_052910chr13----1327 --
NM_052918chr10----13272 --
NM_052934chr1173 ------
NM_052937chr811679 ------
NM_052978chr14----1438 --
NM_054016chr1----11883 --
NM_054016chr1----11883 --
NM_054016chr1----11883 --
NM_054025chr1112158 --21727 252 --
NM_058241chr2--11701 ----
NM_058241chr2--11701 ----
NM_080430chr221128 ------
NM_080632chrX------1122
NM_080669chr1753680 3622 3231 1295 653 14599 31788 1632 758 --
NM_080672chr201229 ------
NM_080732chr193380 345 196 ------
NM_130436chr2111815 --1275 --
NM_130438chr2112392 --1852 --
NM_130439chr1022277 375 ----1185
NM_130439chr1022277 375 ----1185
NM_130440chr141410 534 430 303 1315 31060 308 39 1346
NM_130838chr1511711 ------
NM_130839chr1511711 ------
NM_130846chr12138 ------
NM_133370chr423598 2984 1232 ----
NM_133445chr921351 97 ----1520
NM_133631chr3--1575 ----
NM_134325chr11625 ------
NM_138270chrX13447 ------
NM_138300chr161710 1299 1279 1215 644 451 1115 ----
NM_138316chr101345 ------
NM_138473chr1233763 3548 158 ------
NM_138558chr1144 1798 1160 --
NM_138576chr143979 907 614 --11205 --
NM_138689chr111175 ------
NM_138713chr16----12155 --
NM_138714chr16----12155 --
NM_138727chr11280 ------
NM_138728chr11280 ------
NM_138730chr6146 ------
NM_138735chr211353 ------
NM_138980chr4--1537 ----
NM_138982chr4--1537 ----
NM_138991chr211268 ------
NM_138992chr211465 ------
NM_138994chr161142 ------
NM_144570chr1632391 277 200 1213 12051 1287
NM_144574chr14----165 --
NM_145012chr10172 ------
NM_145025chr6--1158 ----
NM_145113chr1411033 ------
NM_145313chr102431 99 --1629 --
NM_145351chr1742092 1910 1687 355 --2343 330 127
NM_145686chr231337 668 624 11212 2629 610 --
NM_145687chr231337 668 624 11212 2629 610 --
NM_145733chr22----1203 --
NM_145808chr711015 ------
NM_145893chr163593 477 155 11570 ----
NM_145912chr2294213 3550 3532 3448 1820 1256 716 440 205 13218 11059 --
NM_147156chr101464 ------
NM_147171chr7--1468 ----
NM_147175chrX1217 ------
NM_147185chr7--1468 ----
NM_148174chr811701 ------
NM_148955chr15105772 5350 4881 4401 2488 1331 1315 1280 543 256 14376 14216 --
NM_148977chr101345 ------
NM_148978chr101345 ------
NM_152261chr12------1724
NM_152265chr1--1276 ----
NM_152371chr131591 604 443 --2502 401 1320
NM_152408chr5----123 --
NM_152414chr81198 ------
NM_152424chrX94435 4429 3375 3120 1840 1479 1072 84 76 --1555 --
NM_152538chr3----168 --
NM_152598chr172300 152 ------
NM_152607chr1----1190 --
NM_152622chr51815 ------
NM_152793chr753731 3693 1702 1324 722 --2215 54 --
NM_152826chr15105772 5350 4881 4401 2488 1331 1315 1280 543 256 14376 14216 --
NM_152835chr122604 2546 ------
NM_152838chr20--12550 ----
NM_152862chr21405 ------
NM_152890chr1--1857 ----
NM_153186chr9163 ------
NM_153188chr555581 3927 733 706 504 ------
NM_153244chr101164 ------
NM_153367chr104334 245 223 101 ----23482 697
NM_153607chr51697 ------
NM_153690chr35911 585 359 213 108 1100 --1351
NM_153825chr411761 ------
NM_170607chr17--11530 ----
NM_170665chr1234007 3565 1593 ----1162
NM_170686chr721237 125 --13109 --
NM_170706chr143126 2713 232 137 ----12784
NM_171998chrX2762 290 ----11917
NM_173198chr932077 235 202 ------
NM_173200chr932077 235 202 ------
NM_173214chr16----12155 --
NM_173359chr3----1164 --
NM_173470chrX--161 ----
NM_173475chr1611105 11248 ----
NM_173514chr51169 ------
NM_173552chr312383 ------
NM_173595chr12115111 4671 4608 4402 3985 3974 3484 3404 1804 1212 556 13706 13395 --
NM_173808chr11786 ------
NM_174934chr1172910 2502 1432 1150 479 414 295 --22993 1231 --
NM_175063chr195297 97 85 79 73 ------
NM_175077chr2031329 927 413 --11380 --
NM_175709chr2262657 2557 2016 1952 524 47 1225 2783 483 --
NM_175854chr1312011 ------
NM_176792chr1011036 --1537 --
NM_177438chr14----12675 --
NM_177553chr11--1607 ----
NM_177963chr1131993 1332 106 12043 11584 11566
NM_178140chr511940 ------
NM_178151chrX67205 7099 6199 6137 5110 2827 23110 238 --11816
NM_178152chrX67205 7099 6199 6137 5110 2827 23110 238 --11816
NM_178153chrX67205 7099 6199 6137 5110 2827 23110 238 --11816
NM_178450chr5264 42 1484 ----
NM_178839chr2180 ------
NM_178841chr162698 33 1646 1710 1669
NM_178864chr111516 ------
NM_181077chr1521723 61 ------
NM_181302chr14----165 --
NM_181308chr14----165 --
NM_181521chr1667069 4903 1882 1600 331 205 12588 ----
NM_181689chr20----193 --
NM_181698chr10172 ------
NM_181836chr51574 ------
NM_182485chr443506 1427 1408 332 ------
NM_182498chr192280 69 197 141 --
NM_182641chr171307 ------
NM_182646chr443506 1427 1408 332 ------
NM_182854chr164391 358 70 40 ------
NM_182970chr2064244 2608 1362 1186 637 115 23367 1477 24263 2876 --
NM_182972chr122490 659 ------
NM_183227chr6----1531 --
NM_183244chr201229 ------
NM_183246chr201229 ------
NM_183380chr61186 ------
NM_183393chr31929 ------
NM_183394chr31929 ------
NM_183422chr131378 ------
NM_194282chr413004 ------
NM_194314chr1--11808 24655 77 --
NM_194358chr1211658 21458 154 ----
NM_194359chr1211658 21458 154 ----
NM_197939chr172328 190 ------
NM_197968chr132499 480 ------
NM_198123chr8--1732 ----
NM_198124chr8--1732 ----
NM_198204chr17--11530 ----
NM_198205chr17--11530 ----
NM_198270chrX12173 1102 ----
NM_198472chr101268 ------
NM_198490chr3123338 3290 3053 2884 2726 2676 2170 786 692 647 567 420 --43201 3118 2184 670 11053
NM_198516chr11----178 --
NM_198560chr383413 2909 2857 2837 2375 1440 1315 939 22944 2887 --12674
NM_198573chr9189 ------
NM_198793chr313348 1957 --11325
NM_198993chr1741708 1382 509 225 --41387 461 230 182 --
NM_199144chr2021153 367 --1500 1301
NM_199203chr2021153 367 --1500 1301
NM_199247chr17136 ------
NM_199248chr17136 ------
NM_199262chr1751764 1639 280 176 151 11859 1364 1780
NM_199324chr413395 ------
NM_201266chr21276 --2843 829 12803
NM_201279chr21276 --2843 829 12803
NM_201570chr1021553 82 ------
NM_201571chr1021553 82 ------
NM_201572chr1021553 82 ------
NM_201590chr1021553 82 ------
NM_201591chr411587 ------
NM_201592chr411587 ------
NM_201593chr1021553 82 ------
NM_201596chr1021553 82 ------
NM_201597chr1021553 82 ------
NM_203327chr2074406 4359 4299 3715 3006 2776 1781 21242 626 14411 --
NM_203329chr1186082 5877 4995 1912 1858 1672 862 544 16657 --1386
NM_203330chr1186082 5877 4995 1912 1858 1672 862 544 16657 --1386
NM_203331chr1186082 5877 4995 1912 1858 1672 862 544 16657 --1386
NM_203342chr153305 2443 1221 957 265 11295 ----
NM_203343chr153305 2443 1221 957 265 11295 ----
NM_203351chr1732281 1983 154 --32177 1788 172 --
NM_203437chr21256 ------
NM_203464chr111244 --11133 --
NM_203499chr17185 ------
NM_203504chr4------11631
NM_203505chr4------11631
NM_207042chr12640 265 --2286 272 --
NM_207045chr12640 265 --2286 272 --
NM_207046chr12640 265 --2286 272 --
NM_207113chr731536 1024 54 ------
NM_207171chr111880 ----193
NM_207371chr102620 192 ----1534
NM_207396chr11280 ------
NM_207446chr15158 ------