TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4758-5p
miRNA Sequence: GUGAGUGGGAGCCGGUGGGGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr54987 456 288 21 --1529 --
NM_000016chr13582 511 220 ------
NM_000037chr852511 2494 1711 634 571 11739 1666 --
NM_000044chrX2343 80 ------
NM_000067chr8----1637 --
NM_000068chr1921270 303 11570 ----
NM_000080chr172923 253 ------
NM_000084chrX136966 6710 6597 5890 5262 2725 2521 2504 2013 1472 1462 1083 391 --26172 5975 --
NM_000088chr174506 400 287 154 1218 ----
NM_000089chr73605 317 199 ------
NM_000092chr264045 3989 1548 1021 984 949 24544 1576 13751 --
NM_000093chr922199 54 1911 ----
NM_000103chr1541251 503 100 23 1391 ----
NM_000104chr222159 329 11093 ----
NM_000109chrX22000 1059 11762 ----
NM_000110chr12928 763 ----1183
NM_000114chr2021266 1064 --174 --
NM_000115chr1362087 834 757 317 296 146 32169 431 233 ----
NM_000125chr663958 3568 2886 2717 1476 66 --21348 141 --
NM_000129chr611018 --1386 --
NM_000134chr421555 353 --1138 --
NM_000138chr1542579 966 344 188 --11743 --
NM_000141chr103989 354 96 --11356 --
NM_000151chr172304 112 11820 ----
NM_000153chr1431450 1097 488 1239 ----
NM_000161chr1431466 1399 794 11610 ----
NM_000165chr61658 1106 --133
NM_000167chrX2290 120 1352 --11623
NM_000168chr772735 2550 2108 1090 844 791 674 1234 23315 1262 --
NM_000176chr543266 2921 2845 703 12553 ----
NM_000188chr102295 223 ------
NM_000189chr232314 591 234 ------
NM_000192chr123317 296 288 21297 140 ----
NM_000210chr22538 493 11485 1181 --
NM_000213chr17176 1242 ----
NM_000214chr2031185 1164 305 ------
NM_000216chrX53546 2907 1623 1209 281 ------
NM_000217chr1294419 3586 2151 2011 1772 1253 985 653 386 13272 135 --
NM_000222chr4--11330 ----
NM_000227chr182312 91 ------
NM_000232chr421227 910 ----1374
NM_000248chr332576 2024 1130 ------
NM_000252chrX11432 ------
NM_000266chrX2890 799 ------
NM_000267chr17--22970 2758 12753 --
NM_000278chr1012232 ------
NM_000289chr121266 ------
NM_000304chr172875 698 ------
NM_000314chr1032746 1155 989 ----13277
NM_000330chrX42273 2180 2119 722 1379 32244 910 199 --
NM_000332chr6106467 6395 5179 5109 4952 2874 1477 1043 911 453 27020 1170 15879 --
NM_000333chr341137 446 332 195 11006 165 --
NM_000335chr331525 699 530 --2901 565 --
NM_000337chr574582 2180 1976 1927 1844 1424 1068 54450 4321 2516 1781 460 1342 --
NM_000345chr41738 --2290 165 --
NM_000346chr1731770 545 224 ------
NM_000353chr162184 169 ------
NM_000361chr2041391 555 469 427 --1545 --
NM_000362chr2252763 2742 2421 331 217 ------
NM_000368chr944247 3807 3527 365 --11696 --
NM_000386chr172756 225 ------
NM_000393chr2--1721 155 --
NM_000399chr103935 327 186 ------
NM_000408chr223470 80 --1196 --
NM_000430chr1753497 3109 2943 1360 1022 23238 449 --12673
NM_000439chr552122 2015 1851 929 809 --2891 532 --
NM_000441chr722340 88 ------
NM_000449chr12938 111 ----1502
NM_000462chr151405 ------
NM_000474chr71634 ------
NM_000486chr1273061 2090 1164 1113 1053 959 630 13252 ----
NM_000489chrX12934 12539 12991 12575
NM_000494chr104857 811 803 55 ------
NM_000500chr61315 1405 ----
NM_000523chr22341 39 ------
NM_000533chrX1753 ------
NM_000544chr6_cox_hap173231 2882 2649 2397 1012 945 303 --13117 --
NM_000555chrX117569 7503 5493 3029 3021 2687 2588 2533 1623 513 506 37774 2623 375 --11980
NM_000578chr221478 1242 --11252 --
NM_000585chr43220 76 49 ------
NM_000586chr41187 ----122
NM_000594chr62711 158 ------
NM_000595chr63109 67 56 ------
NM_000599chr2104642 4293 4070 3882 3215 3160 2872 1618 1455 672 --34062 3648 88 --
NM_000609chr1043129 2821 1147 285 13158 ----
NM_000610chr1163023 2347 2102 2003 252 133 32719 1973 71 32812 833 823 --
NM_000612chr1183446 3341 3178 2434 1459 859 697 164 ------
NM_000615chr1142956 1841 1014 228 12703 1932 --
NM_000618chr1266465 6384 6299 5893 2201 1729 --35984 1443 376 24684 2082
NM_000618chr1266465 6384 6299 5893 2201 1729 --35984 1443 376 24684 2082
NM_000620chr1251975 1945 1931 1903 249 ------
NM_000631chr221179 ------
NM_000633chr1853800 3759 3736 3391 486 14697 ----
NM_000635chr1931639 1349 52 1370 ----
NM_000663chr1632869 989 730 185 11985 --
NM_000671chr43887 137 109 ------
NM_000680chr8152 ------
NM_000682chr23751 519 452 ------
NM_000719chr12166427 6166 5377 5361 5326 5269 4579 4299 4134 2519 2498 2363 2004 1995 553 117 --12603 --
NM_000721chr162697 2361 2087 1798 361 316 --12125 --
NM_000724chr1051449 1389 709 430 272 ------
NM_000725chr123949 219 58 ------
NM_000726chr211443 31154 1002 533 ----
NM_000734chr14959 410 389 89 ----124
NM_000756chr81353 1314 ----
NM_000757chr12880 326 ------
NM_000767chr192610 42 ------
NM_000795chr112890 175 ------
NM_000800chr531206 680 28 --21607 1434 --
NM_000801chr203796 157 112 ------
NM_000806chr521701 557 1314 11197 --
NM_000811chr53727 692 172 ------
NM_000813chr544322 3474 1592 1345 24294 1009 1285 --
NM_000814chr1533379 1237 510 13622 ----
NM_000816chr51527 1251 --175
NM_000818chr103213 119 28 ------
NM_000826chr432211 2024 345 ------
NM_000827chr551838 1610 655 573 501 ------
NM_000829chr1152190 2066 1765 878 552 ----11774
NM_000831chr1116040 5638 5003 4926 4113 4082 3995 1619 1017 991 770 --16082 16048
NM_000833chr1631377 1302 1152 ----1177
NM_000838chr632435 2098 869 12533 21862 1020 --
NM_000844chr311065 ------
NM_000845chr7177 ------
NM_000855chr111356 ------
NM_000860chr421483 388 ------
NM_000864chr121082 750 ------
NM_000868chrX22333 2055 ------
NM_000872chr102587 357 ------
NM_000875chr15136413 5564 5500 5437 5378 5003 4963 4838 4775 2629 2152 1351 300 1264 21694 87 --
NM_000876chr63985 407 167 ----175
NM_000878chr2252014 1998 1443 515 97 --1597 --
NM_000883chr74615 525 167 52 ------
NM_000883chr74615 525 167 52 ------
NM_000891chr1733540 3429 877 1758 13380 12301
NM_000901chr432008 1825 586 ------
NM_000922chr1131014 167 107 ------
NM_000944chr42690 507 ----11518
NM_000949chr52639 140 ------
NM_000950chrX83151 2373 1365 917 851 685 377 121 ------
NM_000957chr12562 517 ------
NM_000961chr2063576 2887 1096 720 461 117 32470 937 894 23815 430 --
NM_000965chr3--2402 269 ----
NM_000966chr121325 ------
NM_000983chr131644 457 378 --1144 --
NM_001001132chr2111274 1286 ----
NM_001001323chr121283 ------
NM_001001331chr352649 2523 2316 1857 596 --22680 1953 --
NM_001001344chrX42187 2170 1963 38 ----1173
NM_001001389chr1163023 2347 2102 2003 252 133 32719 1973 71 32812 833 823 --
NM_001001390chr1163023 2347 2102 2003 252 133 32719 1973 71 32812 833 823 --
NM_001001391chr1163023 2347 2102 2003 252 133 32719 1973 71 32812 833 823 --
NM_001001392chr1163069 2393 2148 2049 298 179 32765 2019 117 32858 879 869 --
NM_001001395chr1232802 2714 2361 ----12531
NM_001001396chr1114506 3854 3814 3787 3629 1433 771 531 188 106 21 1828 1511 --
NM_001001419chr584928 4515 3408 1966 1599 1465 1293 394 31815 899 723 --13714
NM_001001420chr584928 4515 3408 1966 1599 1465 1293 394 31815 899 723 --13714
NM_001001433chr2011021 ----12243
NM_001001481chr832736 2436 66 ----1402
NM_001001483chr11--1436 ----
NM_001001484chr1061997 1812 1737 1539 188 53 12014 ----
NM_001001556chr1521212 41 ------
NM_001001664chr253892 2751 1209 1110 42 12523 ----
NM_001001890chr2132849 2710 1048 11455 --13172
NM_001001924chr841756 1634 1534 1286 22124 266 11826 --
NM_001001925chr841756 1634 1534 1286 22124 266 11826 --
NM_001001931chr841756 1634 1534 1286 22124 266 11826 --
NM_001001933chr12623 598 ------
NM_001001974chr10--1889 --11760
NM_001001992chr21--196 ----
NM_001002255chr61316 ------
NM_001002257chr2113280 2925 2731 2649 2329 1252 1141 841 735 670 432 21008 141 ----
NM_001002258chr22205 29 1409 1225 --
NM_001002259chr12--1252 ----
NM_001002295chr103861 215 144 ------
NM_001002814chr862936 2815 1365 1181 852 650 ------
NM_001002838chrX21679 1204 ------
NM_001002860chr1453684 3430 1751 1744 1649 11756 1557 --
NM_001002906chrY2506 401 ------
NM_001002909chr1721933 1741 ------
NM_001002919chr21215 ------
NM_001003652chr1888193 7809 6349 3321 2432 1537 745 451 11743 ----
NM_001003674chr1845813 5715 2019 900 14935 15820 12670
NM_001003675chr1845813 5715 2019 900 14935 15820 12670
NM_001003678chr111104 ------
NM_001003688chr411144 ------
NM_001003712chr1232969 2682 523 13693 13815 --
NM_001003945chr941893 1221 572 542 ----11566
NM_001004065chr943761 2765 1584 553 23959 3059 22964 372 13913
NM_001004304chr1242934 1281 1229 106 --12293 --
NM_001004313chr171548 21529 500 ----
NM_001004317chr664387 3624 2931 1329 449 148 ------
NM_001004323chr7138 ------
NM_001004342chr1135853 5843 4876 4166 4159 4135 2098 1046 897 588 544 63 42 15647 34710 1683 1578 --
NM_001004419chr1244425 2907 929 534 ------
NM_001005271chr1731101 1040 182 ------
NM_001005273chr1731101 1040 182 ------
NM_001005291chr17142 ------
NM_001005353chr131286 1075 496 144 ----
NM_001005353chr131286 1075 496 144 ----
NM_001005366chr122940 656 ------
NM_001005386chr2--174 ----
NM_001005404chr172726 454 --21721 1244 146
NM_001005417chr11167 1472 ----
NM_001005463chr1021040 415 ----1969
NM_001005473chr532454 2044 1850 14098 15849 --
NM_001005474chr321292 34 --11608 --
NM_001005476chr22683 670 ------
NM_001005505chr3127 --11233 --
NM_001005611chrX2485 38 ------
NM_001005619chr17176 1242 ----
NM_001005743chr14----1387 --
NM_001005744chr14----1387 --
NM_001005745chr14----1387 --
NM_001005746chr211443 31154 1002 533 ----
NM_001005747chr211443 31154 1002 533 ----
NM_001005753chr272040 1927 1921 1725 1582 849 544 12129 12234 --
NM_001005781chr21531 ------
NM_001005782chr22980 365 ------
NM_001005849chr171146 ------
NM_001005862chr172584 101 --1383 --
NM_001005910chr31233 ------
NM_001005911chr31233 ------
NM_001005920chr162716 329 ------
NM_001006115chr362750 2438 1964 1760 715 402 --21958 902 --
NM_001006600chr532302 1928 1687 ------
NM_001006617chr921320 440 ------
NM_001006619chr921320 440 ------
NM_001006620chr921320 440 ------
NM_001006621chr921320 440 ------
NM_001006623chr262316 2141 1740 1636 232 128 --11602 --
NM_001006634chr16130 ------
NM_001006641chr921634 1474 ------
NM_001006642chr921634 1474 ------
NM_001006643chr921634 1474 ------
NM_001006665chr12780 543 ------
NM_001006945chr1--1539 ----
NM_001006946chr281739 1697 741 471 410 264 171 50 --136 --
NM_001007024chr1744163 3295 1667 651 --11580 13941
NM_001007025chr1744163 3295 1667 651 --11580 13941
NM_001007088chrX5957 823 804 460 59 ------
NM_001007094chr1064341 3710 3432 3292 1803 254 ----1842
NM_001007097chr994324 3643 3307 3197 3122 3105 1633 1244 980 ------
NM_001007098chr1149 ------
NM_001007102chr6--21638 140 ----
NM_001007157chr7--1121 ----
NM_001007226chr1721126 579 ------
NM_001007227chr1721126 579 ------
NM_001007228chr1721126 579 ------
NM_001007229chr1721126 579 ------
NM_001007230chr1721126 579 ------
NM_001007237chr11614 --1285 --
NM_001007257chr131020 424 140 11487 ----
NM_001007271chr103742 154 46 ------
NM_001007466chr6103917 3816 3279 1831 1480 1174 1139 1051 920 780 15095 ----
NM_001007471chr91879 ------
NM_001007553chr12419 299 ------
NM_001007559chr182214 94 ------
NM_001007794chr11700 ------
NM_001008220chr573657 2976 2733 983 867 198 25 --21006 722 11070
NM_001008222chrX31217 1180 563 1915 ----
NM_001008239chr1863695 2978 2398 1455 177 42 ------
NM_001008388chr41700 2912 152 ----
NM_001008405chr731666 1309 418 ----1711
NM_001008407chr71397 ------
NM_001008408chr7126442 5999 5782 5744 5666 5577 5565 5538 5252 1254 976 411 12361 44327 1926 1800 662 --
NM_001008495chr832277 1717 905 --1498 --
NM_001008540chr22399 342 ------
NM_001008541chr1032147 1975 1707 ------
NM_001008541chr1032147 1975 1707 ------
NM_001008564chr132676 126 ------
NM_001008701chr1942925 2747 305 107 ------
NM_001008738chr522362 1832 12776 ----
NM_001008744chr142131 82 1557 ----
NM_001008801chr191554 --1735 --
NM_001008925chr483423 2650 2510 2379 2298 1091 941 462 32559 2537 550 12684 --
NM_001009185chr51587 ------
NM_001009552chr81590 ------
NM_001009554chr484684 4537 3982 3034 1717 1032 517 128 ------
NM_001009554chr484684 4537 3982 3034 1717 1032 517 128 ------
NM_001009555chr411442 11534 ----
NM_001009566chr151432 1371 996 957 376 ------
NM_001009880chr2244571 2976 517 401 13664 13552 1134
NM_001009881chr1197 1581 ----
NM_001009882chr1197 1581 ----
NM_001009899chr366020 5390 5290 5282 4425 915 25497 2558 ----
NM_001009923chr201603 ------
NM_001009931chr11330 2702 28 ----
NM_001009958chr71153 ------
NM_001009960chr732840 2527 46 1472 11846 --
NM_001009993chr222958 117 --13940 --
NM_001010861chr162667 1983 860 499 293 215 1593 158 --
NM_001010888chrX63922 3333 1722 1572 1405 442 21472 892 14072 13934
NM_001010927chr61229 ------
NM_001010934chr721137 24 ------
NM_001010942chr1221286 429 ------
NM_001010986chrX32233 709 75 22420 2078 1654 --
NM_001011513chr4--14130 --1697
NM_001011553chr71927 ------
NM_001011645chrX2343 80 ------
NM_001011657chrX1125 ------
NM_001011666chr772400 1733 1628 1328 772 622 589 36605 2602 801 15989 25385 4545
NM_001011708chr262769 2662 2621 1865 1141 233 1399 11069 --
NM_001011713chr1421008 477 ------
NM_001012270chr1731371 710 568 --11266 --
NM_001012271chr1741474 813 671 45 --11369 --
NM_001012329chr122065 1925 --22100 151 --
NM_001012393chr1144918 1217 612 228 --2967 618 1841
NM_001012398chr162797 298 ------
NM_001012410chr32130 49 ------
NM_001012420chr1542329 2215 1162 200 12015 1110 --
NM_001012421chr9--1627 ----
NM_001012423chr1542329 2215 1162 200 12015 1110 --
NM_001012426chr663167 3131 3081 2112 1250 438 12307 --11120
NM_001012427chr663167 3131 3081 2112 1250 438 12307 --11120
NM_001012642chr1541787 420 287 26 ------
NM_001012644chr20129 ------
NM_001012751chr1021666 37 11347 1673 --
NM_001012755chrX84762 4594 4565 4472 4352 3474 936 887 --1942 23797 898
NM_001012968chrX1541 1631 ----
NM_001012977chrX41145 946 445 428 ------
NM_001013031chr1062789 2719 1337 702 462 90 --1949 --
NM_001013399chr6132 ------
NM_001013415chr411570 ------
NM_001013438chr3--1124 1843 --
NM_001013439chr3----1689 --
NM_001013624chr172986 41 ------
NM_001013642chr12921 171 ------
NM_001013690chr1251733 912 383 369 207 1945 ----
NM_001013693chr152767 2320 2255 1861 887 --11932 --
NM_001013693chr152767 2320 2255 1861 887 --11932 --
NM_001013699chr122571 125 ------
NM_001013703chr15174 130 ----
NM_001013842chr81263 ------
NM_001014434chr12804 160 ------
NM_001014796chr12152 79 --161 --
NM_001014796chr12152 79 --161 --
NM_001014797chr1097081 6738 5891 2938 2324 2209 1804 1367 1055 47007 6041 1604 31 25399 1984 17748
NM_001014809chr44889 767 742 298 ------
NM_001014812chr15--2447 326 ----
NM_001015045chr451867 803 518 385 329 ------
NM_001015053chr1731527 1488 411 182 ----
NM_001015877chrX--33110 449 360 11144 12769
NM_001015881chrX31196 424 161 --1955 --
NM_001015887chr331631 1436 1318 11383 ----
NM_001017368chr1762432 2294 2073 2013 907 641 11056 22085 1912 --
NM_001017371chr2--11055 ----
NM_001017392chr1941337 1060 866 486 --21267 918 1907
NM_001017395chr343014 2984 2971 77 1795 1549 --
NM_001017415chr11528 ------
NM_001017416chr11528 ------
NM_001017926chr811413 1114 ----
NM_001017963chr141809 1961 ----
NM_001017969chr91216 ------
NM_001017977chr1--125 ----
NM_001017979chr42668 228 ------
NM_001017999chr142128 1467 1442 491 ------
NM_001017999chr142128 1467 1442 491 ------
NM_001018000chr142128 1467 1442 491 ------
NM_001018000chr142128 1467 1442 491 ------
NM_001018001chr142128 1467 1442 491 ------
NM_001018009chr32402 105 ------
NM_001018050chr2263300 2749 1111 530 295 151 ----1725
NM_001018052chr2263300 2749 1111 530 295 151 ----1725
NM_001018054chr12988 330 ------
NM_001018064chr951873 1594 1487 741 107 1482 --22093 1601
NM_001018065chr9166040 5483 5325 5270 5160 4460 3884 3653 2345 1907 1555 1519 1095 1067 222 129 --15767 --
NM_001018066chr9166040 5483 5325 5270 5160 4460 3884 3653 2345 1907 1555 1519 1095 1067 222 129 --15767 --
NM_001018074chr543266 2921 2845 703 12553 ----
NM_001018075chr543266 2921 2845 703 12553 ----
NM_001018076chr543266 2921 2845 703 12553 ----
NM_001018077chr543266 2921 2845 703 12553 ----
NM_001018108chr1551913 1888 1606 916 189 12267 ----
NM_001018676chr81427 --1164 --
NM_001018677chr81427 --1164 --
NM_001020658chr111060 ------
NM_001020658chr111060 ------
NM_001020825chr52396 320 128 ----
NM_001023567chr1541858 536 308 200 --1110 --
NM_001024094chr543266 2921 2845 703 12553 ----
NM_001024218chr141752 ------
NM_001024372chr842267 2097 1910 1684 1583 ----
NM_001024401chr1631801 1098 463 ------
NM_001024455chrX21063 548 --21852 685 --
NM_001024463chr152339 120 ------
NM_001024649chr562885 2177 2124 756 450 95 ------
NM_001024660chr321670 95 --1494 --
NM_001024688chr832162 1639 355 ------
NM_001024808chr1252805 2600 720 533 316 1201 1527 --
NM_001024847chr392531 2502 2430 2368 2060 977 918 808 115 --12144 --
NM_001024855chr31152 ------
NM_001024934chr61439 --1563 --
NM_001024935chr61439 --1563 --
NM_001024936chr61439 --1563 --
NM_001024937chr172640 571 ------
NM_001024947chr51923 ------
NM_001024948chr11770 166 --12158
NM_001025068chr331743 1484 1199 ------
NM_001025069chr331743 1484 1199 ------
NM_001025076chr10115838 5532 5425 4624 4148 2500 2115 1345 1333 607 264 14665 12262 14078
NM_001025077chr10127196 6890 6783 5982 5506 5103 2703 2691 1965 1622 530 160 16023 --15436
NM_001025079chr363685 2941 2597 1096 620 499 11434 ----
NM_001025081chr1831089 1025 70 ------
NM_001025090chr1831089 1025 70 ------
NM_001025092chr1831089 1025 70 ------
NM_001025101chr1831089 1025 70 ------
NM_001025108chr273396 2670 1614 1084 698 365 330 13475 13074 --
NM_001025232chr121131 ------
NM_001025233chr1232416 519 394 1650 11114 1547
NM_001025252chr82262 243 33224 1199 917 1718 --
NM_001025253chr82262 243 33224 1199 917 1718 --
NM_001025266chr394782 4031 3816 3283 1926 1344 633 392 111 1780 11239 11938
NM_001025366chr621474 584 --1522 --
NM_001025366chr621474 584 --1522 --
NM_001025367chr621474 584 --1522 --
NM_001025367chr621474 584 --1522 --
NM_001025368chr621474 584 --1522 --
NM_001025368chr621474 584 --1522 --
NM_001025369chr621490 600 --1538 --
NM_001025369chr621490 600 --1538 --
NM_001025370chr621474 584 --1522 --
NM_001025370chr621474 584 --1522 --
NM_001025580chrX31341 745 594 1658 ----
NM_001025595chr411575 ------
NM_001025596chr111354 ------
NM_001025603chr12938 111 ----1502
NM_001025616chr411941 1359 1635 --
NM_001025780chr931273 1208 430 ------
NM_001029858chr672556 2326 1295 1222 1091 406 245 --22376 2172 11156
NM_001029860chr81302 ------
NM_001029863chr611005 ----1935
NM_001029875chr552795 2588 2214 556 535 ------
NM_001029976chr8181 ------
NM_001029989chr152877 353 ------
NM_001030007chr1632674 781 361 --13028 22561 36
NM_001030055chr141155 1110 ----
NM_001030287chr141038 405 248 167 11121 --1809
NM_001031665chr192352 114 ------
NM_001031679chr1232399 1190 1022 33232 2791 1156 2845 247 --
NM_001031684chr21336 11505 ----
NM_001031690chr782735 2408 2178 1107 1062 1021 424 30 ------
NM_001031695chr2244937 4250 3523 1326 --14425 --
NM_001031716chr241084 894 784 56 ------
NM_001031717chr32872 265 --1912 --
NM_001031738chr21439 ------
NM_001031740chr121429 222 --21213 433 --
NM_001031746chr1041401 1061 365 93 ------
NM_001031801chr221168 ------
NM_001031804chr1662906 1317 1190 1076 575 424 13559 24242 4107 --
NM_001031812chr521874 104 11716 ----
NM_001032221chr911796 ------
NM_001032282chr811069 ------
NM_001032288chr2031333 621 582 ----1131
NM_001032296chr1352682 2560 2370 2164 2094 ------
NM_001032363chr171664 1480 1446 883 773 609 89 --12174 --
NM_001032363chr171664 1480 1446 883 773 609 89 --12174 --
NM_001032380chr102135 57 ------
NM_001032393chrX3296 133 28 ------
NM_001032394chr662805 2529 2222 2052 584 73 1432 22542 2165 --
NM_001032395chr652672 2396 2089 1919 451 1299 22409 2032 --
NM_001032410chr21--196 ----
NM_001033044chr141835 1772 1491 50 ------
NM_001033047chr41273 1482 1526 --
NM_001033056chr141835 1772 1491 50 ------
NM_001033057chr321843 703 1711 ----
NM_001033059chr642093 587 461 230 11376 ----
NM_001033112chr51104 ------
NM_001033117chr374108 3987 3935 3467 1707 1678 1340 --13032 --
NM_001033503chr5145 ------
NM_001033507chr141970 1746 1501 1449 1531 ----
NM_001033551chr17113603 3241 2873 1531 903 604 497 480 176 73 42 13863 23938 2549 --
NM_001033561chr171793 1216 ----
NM_001033566chr172389 351 ------
NM_001033568chr172389 351 ------
NM_001033723chr861976 1709 1092 1086 793 40 1400 ----
NM_001033756chr621408 518 --1456 --
NM_001033756chr621408 518 --1456 --
NM_001033925chr10--21968 872 11760 --
NM_001034837chr5----121 --
NM_001034838chr5----121 --
NM_001034841chr1665455 5247 2061 1685 1236 697 23696 2040 23768 858 --
NM_001034845chr41459 11261 ----
NM_001034850chr511372 ------
NM_001034954chr1071287 1024 759 601 277 253 52 1545 ----
NM_001034955chr1071287 1024 759 601 277 253 52 1545 ----
NM_001034956chr1071287 1024 759 601 277 253 52 1545 ----
NM_001034957chr1071287 1024 759 601 277 253 52 1545 ----
NM_001035chr151320 1172 354 254 220 1426 21122 841 --
NM_001035003chr4174 --2958 350 --
NM_001035004chr4174 --2958 350 --
NM_001035254chr921865 1625 11888 1410 --
NM_001035260chr1021270 359 --11184 --
NM_001035511chr131361 642 142 ----11913
NM_001035512chr141468 749 249 46 ----12020
NM_001035513chr141468 749 249 46 ----12020
NM_001035521chr23707 259 153 ------
NM_001037132chr72896 614 21553 208 ----
NM_001037133chr72896 614 21553 208 ----
NM_001037164chr741665 1570 1314 819 ------
NM_001037225chr112112 46 ------
NM_001037317chr162667 1983 860 499 293 215 1593 158 --
NM_001037324chr31314 --1215 --
NM_001037331chr181376 ------
NM_001037334chr1832385 408 144 --12286 --
NM_001037553chr2185125 5105 4861 3820 3187 1282 581 559 11336 34481 1958 1835 --
NM_001037582chr42611 233 ------
NM_001037872chr21581 ------
NM_001037954chr1161373 1190 430 256 57 41 --12838 --
NM_001038702chr572291 2186 2021 1775 848 678 667 ----12285
NM_001038707chr161866 1437 524 512 169 42 --11888 --
NM_001038707chr161866 1437 524 512 169 42 --11888 --
NM_001039372chr71121 1602 ----
NM_001039465chr141476 1403 ----
NM_001039538chr222637 2597 --13252 --
NM_001039550chr22719 332 ------
NM_001039577chr174486 4220 3858 3390 3383 1673 865 13406 13769 --
NM_001039590chrX2879 742 ------
NM_001039591chrX2879 742 ------
NM_001039618chr1134849 4188 317 14101 14298 11173
NM_001039690chr1622104 831 --12206 --
NM_001039802chr13544 378 138 11109 ----
NM_001039840chrX75203 4408 2213 1554 883 518 336 24069 2259 25049 1702 --
NM_001039888chr14799 787 556 535 ------
NM_001039916chr121915 --1329 --
NM_001039917chr121915 --1329 --
NM_001039918chr121915 --1329 --
NM_001039919chr121915 --1329 --
NM_001039920chr121915 --1329 --
NM_001039937chr1363465 3434 1207 635 205 81 11029 21215 24 --
NM_001040020chr721467 40 11229 11209 --
NM_001040056chr16--1577 ----
NM_001040057chr71988 --1141 --
NM_001040097chr72156 121 ------
NM_001040098chr72156 121 ------
NM_001040099chr72156 121 ------
NM_001040100chr32802 367 ------
NM_001040101chr451598 1298 605 221 101 ------
NM_001040110chr721851 176 11873 ----
NM_001040114chr162620 130 ------
NM_001040142chr22874 578 --1265 --
NM_001040143chr22874 578 --1265 --
NM_001040144chr1622104 831 --12206 --
NM_001040146chr1622104 831 --12206 --
NM_001040151chr1194257 4130 3634 3601 3447 3033 1028 517 138 --34102 3016 2913 --
NM_001040152chr755084 3329 1301 500 338 23805 404 ----
NM_001040153chr132346 230 2761 171 ----
NM_001040158chr5175 ------
NM_001040181chr31142 1161 ----
NM_001040182chr31142 1161 ----
NM_001040183chr31142 1161 ----
NM_001040199chr31142 1161 ----
NM_001040200chr31142 1161 ----
NM_001040214chr661975 1730 1594 1484 616 197 ------
NM_001040272chr93834 541 112 --21953 1533 --
NM_001040284chr1631686 1301 1199 22085 679 15923 --
NM_001040402chr453105 2494 1265 1136 842 ------
NM_001040409chr22642 363 ------
NM_001040429chr1353424 3116 2325 2308 362 --12553 --
NM_001040441chr165422 5178 4066 947 587 164 24517 1537 24363 1802 --
NM_001040445chr274489 4475 4465 4216 3481 762 660 1581 ----
NM_001040446chr532088 1859 829 --1706 --
NM_001040450chr1532081 300 234 12380 ----
NM_001040453chr1532081 300 234 12380 ----
NM_001040455chr113517 429 67 11360 ----
NM_001040619chr121488 617 11571 --11259
NM_001040624chr852608 2446 2165 2034 525 12386 ----
NM_001040625chr852608 2446 2165 2034 525 12386 ----
NM_001040626chr852608 2446 2165 2034 525 12386 ----
NM_001040627chr852608 2446 2165 2034 525 12386 ----
NM_001040628chr852608 2446 2165 2034 525 12386 ----
NM_001040629chr852608 2446 2165 2034 525 12386 ----
NM_001040630chr852608 2446 2165 2034 525 12386 ----
NM_001040665chr774796 4132 3888 3525 1876 1556 880 11092 21495 41 --
NM_001040712chr943312 2700 2394 804 ----12725
NM_001040876chr431451 639 186 11943 ----
NM_001042368chr9143 --2657 193 --
NM_001042383chr3103191 2723 2682 2208 1394 1291 1220 1153 582 225 --1439 13062
NM_001042404chr171834 1611 754 534 469 431 195 ------
NM_001042413chr943537 3384 933 263 --11074 --
NM_001042424chr441270 688 294 239 --1434 --
NM_001042430chr142174 150 ------
NM_001042440chr51800 --11870 --
NM_001042441chr51800 --11870 --
NM_001042442chr51800 --11870 --
NM_001042443chr51800 --11870 --
NM_001042444chr51800 --11870 --
NM_001042445chr51800 --11870 --
NM_001042446chr51800 --11870 --
NM_001042453chrX11094 ------
NM_001042475chr6197 ------
NM_001042481chr1422365 398 --1644 --
NM_001042492chr17--22970 2758 12753 --
NM_001042494chr1543436 1105 677 82 11223 --190
NM_001042495chr1543436 1105 677 82 11223 --190
NM_001042496chr1543436 1105 677 82 11223 --190
NM_001042497chr1543436 1105 677 82 11223 --190
NM_001042506chrX41169 946 445 428 ------
NM_001042510chr822107 128 --11695 --
NM_001042511chr822107 128 --11695 --
NM_001042533chr322810 2458 1624 ----
NM_001042537chrX11775 1327 22410 549 --
NM_001042543chr431539 1156 486 ------
NM_001042550chr931630 404 139 ------
NM_001042555chr1264715 3334 3304 1268 651 203 14668 ----
NM_001042599chr2117439 7017 6915 6904 6284 6057 5602 2902 2721 2005 1069 37145 1469 1089 12536 --
NM_001042603chr1275321 3729 1478 1334 899 455 84 ------
NM_001042604chr344050 3337 1786 312 33682 3441 717 ----
NM_001042646chr331733 706 259 --11855 --
NM_001042669chr411941 1359 1635 --
NM_001042681chr122504 2475 --22378 2133 --
NM_001042682chr122504 2475 --22378 2133 --
NM_001042682chr122504 2475 --22378 2133 --
NM_001042728chr121325 ------
NM_001042749chrX11721 11928 ----
NM_001042750chrX11721 11928 ----
NM_001042751chrX11721 11928 ----
NM_001043318chr1463299 3040 2940 2544 1180 868 13582 ----
NM_001044305chr61493 21467 1040 ----
NM_001044385chr243770 2953 2829 2496 13055 ----
NM_001044387chr1973553 3343 1178 966 641 278 27 24128 944 ----
NM_001044388chr1973553 3343 1178 966 641 278 27 24128 944 ----
NM_001044722chr521874 104 11716 ----
NM_001044723chr521874 104 11716 ----
NM_001046chr552288 1131 1089 1074 434 42494 2470 1058 799 12324 --
NM_001048183chr163535 3348 3046 2965 1083 279 1582 23285 2412 --
NM_001049chr1472350 2145 683 677 608 534 257 11791 ----
NM_001079874chr11567 --1389 --
NM_001083620chr432209 2022 344 ------
NM_001099678chr365820 5647 5558 5128 1504 865 32020 896 253 24906 159 --
NM_001100108chr1157836 7755 7039 6869 6768 6673 6219 5917 5906 3173 3010 2540 2219 1227 854 ------
NM_001106chr359563 7222 6183 2956 2838 --18110 --
NM_001113490chrX53643 3592 2269 674 470 ------
NM_001116chr1653085 2105 1241 516 177 ------
NM_001121chr1011271 ------
NM_001122631chr111508 ------
NM_001122679chr54987 456 288 21 --1529 --
NM_001123chr10--1554 --1225
NM_001126chr11424 ----11038
NM_001128chr1632674 781 361 --13028 22561 36
NM_001130chr191189 ------
NM_001140chr171252 ------
NM_001149chr1021345 1233 ------
NM_001151chr4------1296
NM_001152chrX1217 ------
NM_001160chr1232025 417 118 1293 ----
NM_001163chr91984 ------
NM_001167chrX96725 6667 6405 5346 4886 4609 4389 2637 964 --22258 2097 --
NM_001172chr143725 702 562 --1688 --
NM_001173chr141155 1110 ----
NM_001174chrX42273 1465 239 75 1334 ----
NM_001177chr1252207 1818 1771 1542 484 32479 2036 878 ----
NM_001179chr41200 ------
NM_001191chr2041486 516 449 21 ------
NM_001198chr642159 1827 473 388 --1866 22311 1562
NM_001200chr201330 ------
NM_001204chr275810 4992 2594 2106 1774 1751 982 55543 5331 2690 2413 1221 ----
NM_001206chr982950 2944 2296 1999 1215 621 538 206 ------
NM_001219chr751687 1519 540 481 144 1384 ----
NM_001222chr1041785 1460 1339 751 ------
NM_001227chr10143 ----11045
NM_001232chr12162 135 --1196 --
NM_001233chr7----21964 240 --
NM_001237chr41405 143 ----
NM_001237chr41405 143 ----
NM_001241chr232409 620 411 ------
NM_001241chr232409 620 411 ------
NM_001256chr1741038 778 133 114 22617 2573 ----
NM_001257chr163988 437 154 ------
NM_001259chr756220 5303 4987 1826 1549 45966 2522 2368 2154 16313 12170
NM_001263chr41160 ------
NM_001270chr5--1436 --1792
NM_001271chr1572947 2775 582 459 244 220 194 --13072 --
NM_001278chr10184 ------
NM_001280chr191108 ------
NM_001283chr73608 539 185 ------
NM_001289chrX31302 1270 638 ------
NM_001298chr221307 1131 --2928 109 --
NM_001304chr1753351 2918 2444 723 237 --13667 --
NM_001310chr1241052 547 208 189 1916 --11897
NM_001313chr44889 767 742 298 ------
NM_001315chr631430 376 31 ------
NM_001329chr10126 1666 ----
NM_001331chr1152522 1850 1752 928 212 11991 ----
NM_001332chr511224 ------
NM_001343chr511728 --11544 1568
NM_001346chr392260 2125 1991 1887 1014 1008 618 83 60 12086 ----
NM_001349chr2187 ------
NM_001356chrX42277 1586 668 624 1710 ----
NM_001358chr41146 ------
NM_001364chr1174664 4604 3621 3000 1629 1553 926 24156 375 23764 3456 --
NM_001385chr8148 ------
NM_001386chr851927 769 646 277 205 ------
NM_001387chr592987 2960 2851 2281 2175 2064 2037 1218 920 ------
NM_001401chr911179 1417 ----
NM_001406chr175663 577 183 150 122 ------
NM_001407chr3----1633 --
NM_001408chr15301 207 164 93 55 ------
NM_001412chrX63461 2481 1421 677 295 199 1887 ----
NM_001417chr1231833 1738 461 ------
NM_001419chr1964811 3456 1280 1003 755 521 1342 ----
NM_001420chr191251 ------
NM_001421chrX41674 1597 1265 1127 ------
NM_001426chr21226 ------
NM_001427chr71449 ------
NM_001431chr61227 131 ----
NM_001438chr163684 2522 1072 916 355 304 22271 1110 ----
NM_001440chr82880 273 1321 --1373
NM_001448chrX3608 284 163 11704 11250 --
NM_001449chrX--1152 1310 --
NM_001452chr63671 630 28 --1122 --
NM_001453chr621684 223 11705 1708 --
NM_001455chr684368 3919 3786 3348 517 334 304 198 --33498 3478 913 24914 3586
NM_001460chr132969 2209 280 1679 --183
NM_001461chr11210 --1197 --
NM_001478chr122254 126 ------
NM_001497chr972220 1979 1109 649 467 129 122 ------
NM_001521chr23707 259 153 ------
NM_001527chr664083 3001 1215 956 942 865 14601 ----
NM_001542chr11614 --1285 --
NM_001543chr5103695 3213 2947 1916 1849 1391 619 344 233 108 ------
NM_001557chr22891 311 21328 1180 ----
NM_001560chrX51902 1698 1656 684 54 1577 --11063
NM_001609chr1033044 2780 203 --13229 --
NM_001616chr223516 737 ------
NM_001634chr642093 587 461 230 11376 ----
NM_001642chr114934 417 291 169 ------
NM_001649chrX52440 2079 1921 631 431 --12447 1656
NM_001650chr1863771 1299 1202 1039 886 129 1453 ----
NM_001654chrX1112 --1299 1406
NM_001655chr1171828 1774 1768 1459 862 786 749 ------
NM_001659chr1292575 2497 2173 2115 1736 1710 1060 812 385 --22448 853 --
NM_001660chr31631 ------
NM_001663chr143853 449 90 12451 151 --
NM_001664chr32978 395 ------
NM_001668chr131600 829 588 --1699 --
NM_001674chr141038 405 248 167 11121 --1809
NM_001677chr1--1110 ----
NM_001678chr1771261 1229 1198 1167 454 301 183 ------
NM_001679chr3174 ------
NM_001683chr352649 2523 2316 1857 596 --22680 1953 --
NM_001684chr184223 3571 3531 3504 3346 1150 488 248 1545 1228 --
NM_001689chr22205 29 1409 1225 --
NM_001695chr843848 3488 1637 1028 34235 2745 1623 ----
NM_001698chr91194 1170 ----
NM_001701chr931543 1266 159 ------
NM_001703chr12297 63 ------
NM_001704chr6--153 ----
NM_001706chr32987 960 ------
NM_001709chr1132041 1770 979 --22003 786 --
NM_001718chr621235 1092 ------
NM_001721chrX159 ------
NM_001726chr11145 ------
NM_001730chr131649 1230 ----
NM_001730chr131649 1230 ----
NM_001735chr9291 36 --1279 --
NM_001742chr71228 ------
NM_001743chr21566 ----1529
NM_001746chr562885 2177 2124 756 450 95 ------
NM_001750chr51800 --11870 --
NM_001753chr731687 1480 372 --1501 --
NM_001754chr2132849 2710 1048 11455 --13172
NM_001755chr1621800 352 11904 ----
NM_001759chr1252088 1437 1423 1219 957 ------
NM_001777chr363685 2941 2597 1096 620 499 11434 ----
NM_001783chr191148 --1366 --
NM_001788chr71927 ------
NM_001789chr31525 --11378 --
NM_001791chr13544 378 138 11109 ----
NM_001792chr18168 1882 ----
NM_001796chr16158 ------
NM_001797chr161739 ------
NM_001798chr121118 1212 ----
NM_001802chr163852 185 97 1697 159 --
NM_001812chr4----1307 --
NM_001833chr91178 --149 --
NM_001839chr11556 ------
NM_001843chr12------1251
NM_001844chr12173 --1117 --
NM_001854chr111201 ------
NM_001865chr6140 ------
NM_001872chr13------1344
NM_001880chr2135 ------
NM_001881chr103512 380 373 ------
NM_001882chr52572 378 1355 ----
NM_001884chr5--1179 ----
NM_001893chr17150 --1130 --
NM_001894chr222834 488 ----196
NM_001895chr201367 ------
NM_001896chr16139 ------
NM_001903chr51305 166 ----
NM_001904chr31783 1262 ----
NM_001907chr16165 ------
NM_001920chr12--1527 ----
NM_001924chr1--169 ----
NM_001933chr1431331 474 265 ------
NM_001935chr21981 1107 ----
NM_001938chr11751 21333 564 ----
NM_001939chrX31428 1100 442 --33813 1301 298 --
NM_001942chr1831980 789 186 21952 1730 ----
NM_001944chr183591 184 106 21488 840 ----
NM_001945chr551148 1134 888 299 272 1442 ----
NM_001946chr121182 ------
NM_001949chr673217 1200 1188 1009 728 722 684 --12679 --
NM_001951chr83552 434 227 1656 ----
NM_001962chr51457 ------
NM_001968chr42270 128 1720 1912 --
NM_001977chr41205 ----1368
NM_001981chr12857 227 ------
NM_001982chr1251282 1269 1227 256 22 ----1131
NM_001991chr1772098 1862 1688 1675 1588 122 27 1611 ----
NM_001995chr42534 129 ------
NM_002006chr434166 1512 766 --1645 --
NM_002010chr131214 1178 ----
NM_002015chr1352998 2045 1286 888 521 22919 25 ----
NM_002019chr132759 234 1805 ----
NM_002023chr13498 489 205 11292 ----
NM_002024chrX32133 464 326 ------
NM_002025chrX158906 8827 7940 7925 6827 6680 6382 5971 2450 1951 1935 1419 589 422 39 26656 2772 33612 1360 83 --
NM_002027chr81427 --1164 --
NM_002031chr62337 57 ------
NM_002035chr1863670 3657 2851 779 610 89 --23305 1256 --
NM_002040chr2133076 1050 680 ------
NM_002044chr1521212 41 ------
NM_002045chr32343 80 ------
NM_002048chr9147 --1535 --
NM_002051chr103861 215 144 ------
NM_002054chr21436 ------
NM_002060chr11481 ------
NM_002063chrX41204 804 307 285 --1906 --
NM_002065chr141835 1772 1491 50 ------
NM_002069chr731452 1269 1199 ------
NM_002074chr151152 480 396 152 42 ------
NM_002076chr1222126 2119 --23135 339 --
NM_002077chr951884 1834 626 312 149 1681 ----
NM_002084chr52739 528 1114 ----
NM_002089chr41132 ------
NM_002092chr464926 4893 3280 2039 460 314 ------
NM_002107chr1----1417 --
NM_002114chr6--143 ----
NM_002126chr1763215 1085 1016 516 374 333 11054 --13227
NM_002130chr521480 1106 ------
NM_002135chr121436 ------
NM_002136chr121143 ------
NM_002137chr711781 ------
NM_002139chrX----1426 --
NM_002157chr2144 ------
NM_002158chr233692 2324 1198 135 ----
NM_002167chr11123 ------
NM_002182chr362728 2665 2172 2073 959 305 12410 1534 --
NM_002184chr51162 ------
NM_002192chr72633 493 ------
NM_002193chr22388 366 --11185 --
NM_002194chr21173 ------
NM_002196chr202867 205 ------
NM_002196chr202867 205 ------
NM_002199chr4--1241 1236 --
NM_002202chr51923 ------
NM_002204chr1731291 1004 997 ------
NM_002205chr12126 --1334 --
NM_002211chr10198 ------
NM_002214chr764811 1918 1664 1191 1083 516 31530 128 22 13553 --
NM_002222chr32151 120 ------
NM_002223chr1253724 3495 3134 2764 1148 23771 1035 ----
NM_002227chr121283 826 1253 ----
NM_002229chr192402 191 1319 ----
NM_002232chr1----195 --
NM_002247chr1021438 632 --144 --
NM_002249chr12145 89 ------
NM_002252chr22313 130 ------
NM_002253chr441086 1058 1014 236 ------
NM_002254chr282183 2174 1983 1777 1549 562 537 530 11455 ----
NM_002264chr3114929 4898 4460 4317 3555 1774 612 583 268 226 122 25015 1781 --14694
NM_002266chr17--1236 ----
NM_002267chr1331639 1603 739 134 ----
NM_002268chr321444 539 ------
NM_002270chr51687 25281 3555 23750 303 11386
NM_002271chr135839 633 385 348 118 --1869 --
NM_002285chr273396 2670 1614 1084 698 365 330 13475 13074 --
NM_002293chr172335 2150 2076 1999 1708 758 99 --1222 --
NM_002298chr133574 82 35 --11115 --
NM_002309chr2253195 2212 2039 614 150 ----11145
NM_002336chr1264477 3622 3616 3301 860 598 --14951 --
NM_002350chr831205 141 79 --1199 --
NM_002356chr632258 678 220 11884 ----
NM_002359chr1784121 3399 3337 3096 2813 586 430 390 ------
NM_002372chr51463 1633 ----
NM_002374chr222637 2597 --13252 --
NM_002382chr1431245 1180 1056 ------
NM_002385chr1831089 1025 70 ------
NM_002387chr5115030 4780 4687 4615 4577 4438 3267 3191 1960 286 205 ------
NM_002395chr621074 97 ------
NM_002398chr23413 400 311 ------
NM_002399chr152314 171 1407 --1144
NM_002401chr1731007 738 486 1390 ----
NM_002402chr72124 39 1131 164 --
NM_002408chr142698 323 ------
NM_002455chr1136 --1119 --
NM_002474chr162620 130 ------
NM_002479chr11199 ------
NM_002480chr121922 21063 414 ----
NM_002485chr832162 1639 355 ------
NM_002487chr151774 --1698 --
NM_002499chr1531641 1624 608 11938 12303 --
NM_002500chr211292 ------
NM_002501chr1943528 3178 1298 1243 --2660 173 13232
NM_002505chr631224 389 301 --1124 --
NM_002515chr1422035 657 --11345 11336
NM_002519chr111371 ------
NM_002522chr1732912 1233 202 --22518 242 --
NM_002524chr12913 38 1890 ----
NM_002526chr631739 352 164 --11085 --
NM_002527chr122264 230 ------
NM_002539chr21212 ----1230
NM_002545chr1144918 1217 612 228 --2967 618 1841
NM_002553chr71385 ------
NM_002572chr111269 ------
NM_002577chr343449 2524 2516 1161 13241 23719 326 11073
NM_002578chrX1152 1379 ----
NM_002581chr955514 3966 1922 1585 1542 11865 ----
NM_002582chr163892 856 213 ------
NM_002583chr121438 --1478 --
NM_002586chr63410 391 355 ------
NM_002589chr42118 56 ------
NM_002590chr132547 38 ------
NM_002594chr2041964 1552 655 134 1257 2661 568 --
NM_002595chr1221300 772 ------
NM_002599chr113936 296 253 ------
NM_002603chr81168 ------
NM_002605chr152959 438 1375 ----
NM_002609chr521921 1347 ------
NM_002612chr732039 1464 723 1562 --12050
NM_002627chr10--160 ----
NM_002628chr32780 436 ------
NM_002634chr171844 ------
NM_002641chrX51328 627 494 373 198 1134 1232 1646
NM_002645chr1192963 2899 2569 2074 2058 1104 964 922 699 32670 2344 2035 ----
NM_002653chr56927 914 336 189 152 145 ------
NM_002655chr885163 4499 4247 4236 3305 1708 1341 1194 1694 ----
NM_002657chr20113689 3642 3599 2736 2480 1541 1364 1304 692 678 526 --11551 --
NM_002662chr321802 534 11912 --11922
NM_002687chr14129 11139 ----
NM_002698chr1942529 322 227 73 ------
NM_002707chr23348 138 129 ------
NM_002709chr233186 2456 490 ----12260
NM_002710chr121185 --1899 --
NM_002714chr62847 134 1415 ----
NM_002715chr541310 519 359 184 1105 ----
NM_002716chr1143652 3070 620 611 --11254 --
NM_002717chr83649 126 30 ------
NM_002719chr1422274 2035 197 ----
NM_002721chr91371 ------
NM_002729chr101616 ------
NM_002730chr1951170 1090 426 284 230 --11235 --
NM_002731chr162932 2805 2225 732 226 33 ------
NM_002734chr17152 ------
NM_002737chr1776176 6072 5305 4707 2140 1660 504 --46022 4244 1088 853 16536
NM_002738chr163736 715 388 140 ----
NM_002739chr193667 95 63 ------
NM_002745chr2254571 2940 1667 717 109 33551 1155 837 13084 --
NM_002748chr151388 ------
NM_002752chr5----1136 --
NM_002755chr151147 ------
NM_002763chr11462 ------
NM_002773chr162153 97 137 ----
NM_002776chr1981979 1911 1790 1651 710 682 322 191 ----11924
NM_002791chr141108 --138 --
NM_002816chr17--1300 ----
NM_002819chr19165 ------
NM_002822chr1231190 1156 589 1738 ----
NM_002823chr2165 ------
NM_002825chr71439 ------
NM_002827chr2051786 1450 1176 392 206 ------
NM_002828chr181226 ------
NM_002835chr72298 162 ------
NM_002837chr1274604 4245 3632 2916 941 916 832 ------
NM_002839chr943312 2700 2394 804 ----12725
NM_002840chr121529 1267 ------
NM_002841chr3--124 ----
NM_002843chr1122171 1007 ------
NM_002855chr1143083 2863 83 33 --23440 2940 --
NM_002858chr131328 548 317 11316 ----
NM_002859chr1261744 1683 1661 1555 1378 233 ------
NM_002863chr14163 ------
NM_002865chr8----140 --
NM_002867chr14189 115 89 78 1632 ----
NM_002868chr1222157 210 --11913 --
NM_002869chr1141778 530 413 404 --11786 --
NM_002874chr941537 867 543 296 --12011 --
NM_002886chr344848 1637 1128 99 15146 ----
NM_002890chr5------1774
NM_002892chr142610 281 185 ----
NM_002895chr201899 --1817 --
NM_002906chr112417 105 ------
NM_002923chr12254 118 ------
NM_002924chr11179 ------
NM_002940chr431451 639 186 11943 ----
NM_002942chr32473 314 11146 ----
NM_002945chr173791 249 181 ------
NM_002953chr12780 543 ------
NM_002959chr132847 522 341 --1563 --
NM_002968chr16267 29 21091 889 ----
NM_002970chrX3344 106 31 ------
NM_002971chr31899 ------
NM_002993chr431022 684 437 ------
NM_002997chr281739 1697 741 471 410 264 171 50 --136 --
NM_002998chr831964 547 108 ------
NM_003001chr141468 749 249 46 ----12020
NM_003010chr1721501 750 ------
NM_003011chr931515 687 142 ------
NM_003012chr82508 152 23197 2003 1981 --
NM_003014chr731313 1244 262 21474 1197 ----
NM_003016chr171131 ------
NM_003022chrX--1141 ----
NM_003030chr331340 233 43 11318 ----
NM_003042chr351710 1509 801 709 64 ------
NM_003043chr363367 1200 1193 756 369 343 ------
NM_003045chr1364978 4447 3126 909 690 566 1525 23372 428 1669
NM_003071chr362025 1795 1689 667 378 303 ------
NM_003075chr121300 ------
NM_003079chr173848 811 309 ------
NM_003087chr101271 --1218 --
NM_003088chr731068 199 174 ------
NM_003100chr51397 ------
NM_003101chr151435 1302 380 131 108 31511 396 190 --11250
NM_003108chr256818 6539 2922 1862 434 25871 4930 ----
NM_003110chr174757 362 315 111 ------
NM_003111chr2--11055 ----
NM_003112chr712620 ------
NM_003113chr2165 ------
NM_003128chr252591 1775 1017 561 397 ------
NM_003131chr651921 1906 1895 597 149 --146 --
NM_003136chr14--1267 ----
NM_003137chr621801 828 --11654 --
NM_003139chr114811 682 260 148 --1244 --
NM_003142chr2192 ------
NM_003144chr621878 171 12077 1790 --
NM_003149chr331415 1037 299 11234 11444 11218
NM_003150chr1731507 934 759 12288 ----
NM_003154chr41103 ------
NM_003155chr852435 1985 1063 312 216 ------
NM_003156chr1151228 1142 388 251 240 --1470 --
NM_003173chrX21095 218 ------
NM_003174chr10--1255 1211 --
NM_003178chr31202 --12132 --
NM_003179chrX31128 390 182 ------
NM_003189chr143286 2358 1163 433 11075 ----
NM_003199chr1865120 3762 898 584 244 46 ------
NM_003200chr1921839 258 1437 1212 169
NM_003206chr6--1388 ----
NM_003216chr2263077 2961 2804 2746 1189 322 --21270 789 1440
NM_003217chr1231901 340 216 --1257 --
NM_003221chr673535 3396 3240 3199 3129 3118 252 ----13474
NM_003223chr161578 ----1172
NM_003242chr392531 2502 2430 2368 2060 977 918 808 115 --12144 --
NM_003243chr141278 1174 927 793 ----11021
NM_003246chr153684 293 195 1618 ----
NM_003250chr171349 ------
NM_003255chr172330 106 ----12265
NM_003257chr1531205 969 65 ------
NM_003262chr374978 4437 3476 3338 3317 1012 245 31757 798 131 ----
NM_003269chr621305 291 ------
NM_003270chrX----1266 --
NM_003288chr2021305 203 ------
NM_003291chr13--1520 ----
NM_003298chr3105649 5153 4932 4298 4242 3831 2328 1060 907 432 ------
NM_003304chr31120 ------
NM_003315chr17142 ------
NM_003336chrX170 ----1892
NM_003337chr521693 442 1368 ----
NM_003339chr511468 --1365 --
NM_003340chr43429 328 300 --1143 --
NM_003342chr1763248 3121 2629 2374 521 30 --13025 --
NM_003347chr2282285 2224 1872 1774 407 380 374 56 ------
NM_003348chr1211570 ------
NM_003349chr2031333 621 582 ----1131
NM_003350chr8----146 --
NM_003352chr22980 365 ------
NM_003360chr4138 ------
NM_003368chr11528 ------
NM_003369chr1132592 1109 874 167 12189 --
NM_003371chr94626 594 535 48 ------
NM_003374chr51694 1828 --1733
NM_003376chr621474 584 --1522 --
NM_003376chr621474 584 --1522 --
NM_003385chr22861 161 --148 --
NM_003387chr242503 1103 700 318 11907 32256 1870 717 --
NM_003390chr1111142 1337 1401 --
NM_003392chr334014 3773 29 --31302 964 922 --
NM_003394chr122279 90 --1601 --
NM_003404chr2021507 36 --11644 1557
NM_003405chr22----1121 --
NM_003406chr831515 647 433 1502 11571 --
NM_003409chr182334 114 ------
NM_003410chrX3770 525 78 12455 11042 --
NM_003411chrY1135 11610 ----
NM_003413chrX1277 ------
NM_003418chr31755 ------
NM_003421chr1064341 3710 3432 3292 1803 254 ----1842
NM_003430chr19--21290 133 ----
NM_003431chr1--1173 ----
NM_003439chr753455 3155 2891 2589 940 33225 2989 122 ----
NM_003442chr111100 ------
NM_003445chr191830 --1335 --
NM_003453chr13--1210 ----
NM_003455chr1121693 509 ------
NM_003458chr373706 3271 2964 2560 1469 1184 963 ----13771
NM_003463chr61521 11347 ----
NM_003466chr222440 556 ------
NM_003467chr22399 342 ------
NM_003468chr274087 1586 1496 1052 953 703 353 --12862 --
NM_003470chr1621868 1265 ------
NM_003471chr341517 585 197 92 32009 1853 522 1742 --
NM_003472chr621417 1204 1316 ----
NM_003477chr112620 234 ------
NM_003478chr1122050 236 22389 869 ----
NM_003482chr1252458 2448 2042 1114 584 ------
NM_003483chr1272255 746 628 566 482 423 103 --21108 76 --
NM_003488chr171312 160 ----
NM_003489chr2143161 2613 949 892 --23276 314 --
NM_003498chr1642555 2258 914 488 32751 2524 2464 ----
NM_003502chr162216 82 ------
NM_003506chr82289 23 1103 1871 --
NM_003507chr212026 ------
NM_003524chr6143 ------
NM_003563chr1721126 579 ------
NM_003574chr1865062 3916 3755 3688 1221 917 25444 1070 1410 --
NM_003576chr1352682 2560 2370 2164 2094 ------
NM_003583chr1243611 3409 3280 336 23273 131 1109 23788 2723
NM_003590chr273412 3231 2910 1620 760 563 556 ------
NM_003597chr231538 168 22 2873 272 1831 --
NM_003607chr1114188 4056 3779 3715 3381 3283 3048 863 277 245 35 24358 3869 22916 46 --
NM_003612chr152101 65 ------
NM_003615chr31809 13405 --12962
NM_003620chr171389 ------
NM_003624chr1921212 551 ------
NM_003628chr22683 670 ------
NM_003629chr143358 3166 2861 706 --12892 --
NM_003630chr61678 ------
NM_003633chr552357 2211 2169 1030 39 149 ----
NM_003635chr101439 ------
NM_003637chr131375 1226 433 ------
NM_003651chr12----161 --
NM_003654chr111137 --1242 --
NM_003655chr17131 ------
NM_003659chr21223 21209 936 ----
NM_003660chr192771 25 ------
NM_003670chr31377 ------
NM_003671chr963331 3165 2964 2213 1191 907 ------
NM_003685chr191174 ------
NM_003692chr92704 313 ------
NM_003704chr41570 ------
NM_003705chr21278 ------
NM_003709chr21117 ------
NM_003713chr121217 448 ------
NM_003716chr33371 312 229 ------
NM_003722chr332286 1091 430 ------
NM_003728chr41171 ------
NM_003732chr5--1309 ----
NM_003737chr112422 62 ------
NM_003741chr33336 308 127 ------
NM_003743chr241796 1741 1455 103 ------
NM_003744chr14----1387 --
NM_003749chr132211 65 1439 ----
NM_003750chr10--154 ----
NM_003758chr151145 --1347 --
NM_003758chr151145 --1347 --
NM_003759chr432903 587 25 1399 1858 --
NM_003763chr2011021 ----12243
NM_003768chr151787 751 321 249 47 --2738 102 1459
NM_003769chr121316 ------
NM_003774chr1242354 2203 1076 382 ------
NM_003780chr11167 1472 ----
NM_003787chr1811347 1519 ----
NM_003792chr91133 ------
NM_003825chr15----1996 --
NM_003829chr9--1131 ----
NM_003850chr13----1166 --
NM_003872chr242318 2104 2097 794 --12930 --
NM_003873chr1042051 2004 796 274 11861 11911 --
NM_003884chr321173 531 ------
NM_003887chr242187 2055 1672 932 ------
NM_003895chr2121496 750 11401 ----
NM_003901chr1042489 2398 1836 1736 12517 22326 2026 --
NM_003908chr2021145 175 ------
NM_003913chr673640 3615 3554 1626 1183 1055 520 ------
NM_003916chrX41193 1145 133 57 --1918 --
NM_003927chr1821059 302 ------
NM_003931chr61439 --1563 --
NM_003932chr2221744 196 11414 ----
NM_003941chr722028 198 ------
NM_003958chr653889 3519 2930 2476 1324 13714 ----
NM_003966chr596717 6574 5750 5460 5388 2560 1907 1851 1813 17824 31391 1247 858 --
NM_003968chr32456 127 ------
NM_003983chr1694055 3776 3332 3239 3141 2741 1612 730 142 ------
NM_003987chr1012232 ------
NM_003989chr1012168 ------
NM_003990chr1012168 ------
NM_004006chrX22000 1059 11762 ----
NM_004007chrX22000 1059 11762 ----
NM_004009chrX22000 1059 11762 ----
NM_004010chrX22000 1059 11762 ----
NM_004011chrX22000 1059 11762 ----
NM_004012chrX22000 1059 11762 ----
NM_004013chrX22000 1059 11762 ----
NM_004014chrX22000 1059 11762 ----
NM_004015chrX22000 1059 11762 ----
NM_004017chrX22000 1059 11762 ----
NM_004019chrX2161 75 ----1405
NM_004020chrX22000 1059 11762 ----
NM_004028chr1863771 1299 1202 1039 886 129 1453 ----
NM_004035chr1774881 4623 4214 3734 3229 1883 857 --1217 --
NM_004050chr1412558 --22566 878 --
NM_004067chr7181 --1377 --
NM_004073chr12252 231 ------
NM_004078chr151072 1004 969 53 32 ------
NM_004080chr731489 1390 1195 ------
NM_004087chr311647 ------
NM_004089chrX31196 424 161 --1955 --
NM_004093chr1382390 909 578 566 550 503 294 238 ------
NM_004094chr1472939 2480 2459 2213 2075 1958 921 21970 1910 --11202
NM_004096chr1061666 1601 1337 788 699 638 --1429 --
NM_004098chr10----11014 1440
NM_004100chr621809 444 ------
NM_004111chr111229 ------
NM_004113chr312025 3402 235 142 ----
NM_004114chrX11127 11273 ----
NM_004116chr21135 2439 319 ----
NM_004124chr1433406 2252 573 --22259 1373 --
NM_004134chr51660 ------
NM_004136chr1542570 2119 858 104 23100 1098 ----
NM_004137chr53108 73 26 ------
NM_004156chr81590 ------
NM_004157chr33351 227 196 --1216 --
NM_004170chr921275 393 ------
NM_004171chr1179339 9090 8610 6297 3716 3112 2664 23233 3221 ----
NM_004172chr511999 11398 11385 --
NM_004176chr17142 ------
NM_004183chr111741 ------
NM_004185chr13644 619 227 --1550 --
NM_004187chrX31003 414 311 ----11467
NM_004193chr105367 348 209 120 59 ------
NM_004200chr1172803 2070 1251 1212 519 381 61 --11134 --
NM_004209chr1621105 312 --1925 --
NM_004225chr851372 1202 1057 367 87 ------
NM_004229chrX41889 1560 1382 548 --11492 --
NM_004235chr9--1855 ----
NM_004236chr151563 ------
NM_004263chr221757 1229 --11498 11661
NM_004264chr121158 ------
NM_004272chr541531 627 615 117 1282 --11547
NM_004274chr1443085 3024 2184 344 12582 11263 --
NM_004277chr631402 1055 272 --11647 --
NM_004279chr732168 1550 323 ----1599
NM_004280chr6198 ------
NM_004282chr61488 --198 --
NM_004293chr973751 3719 3189 2985 2426 1411 994 1578 ----
NM_004296chr1464056 2461 1391 1380 362 297 1855 33916 3679 269 --
NM_004301chr32387 64 ----1128
NM_004302chr1282630 2525 2506 2103 1879 829 648 157 --12847 --
NM_004308chr1141877 1763 1419 726 11884 11775 --
NM_004311chr1092914 2851 2823 2752 2559 2265 2047 608 154 ------
NM_004319chr152375 1990 631 475 373 22651 803 1281 --
NM_004323chr962250 2062 2014 1787 1048 128 --1497 --
NM_004331chr82595 350 ------
NM_004338chr1845813 5715 2019 900 14935 15820 12670
NM_004342chr722313 2190 ------
NM_004343chr192488 155 ------
NM_004349chr81967 ------
NM_004379chr241389 1375 194 145 --11682 --
NM_004380chr1672302 1936 1840 1680 1661 944 687 --12117 --
NM_004381chr61135 ------
NM_004384chr521874 104 11716 ----
NM_004385chr51690 1174 ----
NM_004391chr362032 1881 1683 1430 406 372 --11476 --
NM_004392chr1322427 1030 21928 526 ----
NM_004393chr331645 1528 795 12302 ----
NM_004397chr1121667 198 --1479 --
NM_004405chr23843 414 152 --143 --
NM_004408chr92346 144 ------
NM_004414chr212389 38 --11183 --
NM_004415chr6155 ------
NM_004417chr51418 ------
NM_004420chr1131949 1633 813 ------
NM_004426chr1221393 513 ------
NM_004428chr14808 261 108 80 ------
NM_004429chrX11198 ------
NM_004430chr861846 1027 948 905 704 25 --1225 --
NM_004432chr9--12279 --12016
NM_004437chr123255 238 --11168 --
NM_004438chr223014 2945 22900 1044 ----
NM_004442chr151531 1498 1359 1352 1275 1482 21214 100 --
NM_004448chr172584 101 --1383 --
NM_004449chr212990 37 ------
NM_004450chr142307 101 1260 ----
NM_004454chr331518 609 576 --150 --
NM_004457chr2195 ------
NM_004459chr1711656 21717 1683 ----
NM_004464chr441406 1126 1043 30 ------
NM_004480chr142630 232 1683 ----
NM_004482chr24639 337 329 303 2650 589 ----
NM_004484chrX2312 69 ------
NM_004499chr51147 ------
NM_004500chr1421708 342 --11535 1818
NM_004501chr133991 3632 2663 ------
NM_004504chr242912 788 385 267 ------
NM_004505chr1721813 1633 ------
NM_004506chr61184 ------
NM_004514chr17102865 2773 2611 2327 2254 1057 870 621 476 75 1797 --12197
NM_004516chr1911138 ------
NM_004519chr8158 ------
NM_004520chr51677 ------
NM_004521chr10192 174 ----
NM_004529chr931054 548 229 1106 ----
NM_004537chr1241516 1149 475 243 ------
NM_004540chr212724 163 ------
NM_004560chr93684 337 87 --1947 --
NM_004569chr141636 ------
NM_004571chr2173304 3294 2689 2409 2335 346 270 --12277 --
NM_004575chr431149 1043 44 ------
NM_004578chr13977 823 94 --1816 --
NM_004580chr1531632 1388 616 1270 --1471
NM_004583chr173530 255 63 180 ----
NM_004586chrX64908 4368 4144 1929 1792 395 24138 3574 11654 --
NM_004598chr553067 2674 2593 2177 1328 12262 13009 21239 1065
NM_004602chr201386 --31276 485 211 --
NM_004603chr7240 21 ------
NM_004612chr941406 655 599 501 23989 3674 ----
NM_004620chr112549 137 ------
NM_004631chr12988 330 ------
NM_004635chr32763 133 ------
NM_004655chr1721171 242 11274 1929 --
NM_004656chr34975 946 72 31 --1930 --
NM_004660chrY31528 664 620 ------
NM_004663chr1531265 1209 165 ----11072
NM_004664chr12----1225 --
NM_004671chr18132 1229 ----
NM_004677chrY2506 401 ------
NM_004686chr831731 719 344 ------
NM_004687chr1721840 838 11288 ----
NM_004694chr172702 97 ------
NM_004705chr11------175
NM_004709chrX41294 467 455 103 192 2592 443 --
NM_004716chr111687 ----1116
NM_004717chr731276 524 443 ------
NM_004726chrX75579 5563 3931 3629 1986 1364 1307 ------
NM_004730chr552069 1489 782 587 234 ------
NM_004732chr175302 285 264 79 57 ------
NM_004734chr1332813 2627 61 2211 125 22471 929 --
NM_004736chr131685 526 41 --1378 --
NM_004737chr222827 519 1484 153 --
NM_004738chr2042324 1866 1039 447 1637 ----
NM_004740chr173272 119 68 ------
NM_004741chr1021315 324 ------
NM_004745chr8126690 6461 6196 6097 5169 4564 2741 2609 2030 527 484 417 55625 2720 1427 1215 704 26039 5989 15812
NM_004747chr1021041 315 --11059 --
NM_004748chr1533713 1601 423 21337 948 ----
NM_004755chr14--1159 1928 --
NM_004756chr192507 21 11096 ----
NM_004758chr1721082 338 ------
NM_004759chr131972 1764 1548 12130 11518 --
NM_004760chr772188 1990 810 767 726 500 111 ------
NM_004763chr2----61047 796 740 404 348 292 --
NM_004768chr13855 339 141 ------
NM_004772chr551548 335 321 305 202 --11204 --
NM_004774chr1742391 1937 1155 1092 32788 1211 524 ----
NM_004779chr541162 893 885 221 11198 ----
NM_004781chr111736 ------
NM_004781chr111736 ------
NM_004785chr16------1407
NM_004786chr181192 ------
NM_004788chr1132270 960 899 ------
NM_004792chr2127 ------
NM_004796chr1441886 719 308 275 --1943 --
NM_004798chr2053220 3097 2485 1318 181 ------
NM_004801chr231192 1174 305 1578 ----
NM_004808chr1093309 2755 2481 2386 2370 2103 798 687 72 --12848 --
NM_004814chr11154 ------
NM_004815chr164906 4698 4103 3969 3434 883 64895 4251 3911 3595 3336 664 ----
NM_004816chr93591 156 24 ------
NM_004821chr5140 --1769 --
NM_004822chr1773773 3707 3681 2897 2884 2822 1462 13516 ----
NM_004824chr62953 79 ------
NM_004831chr192922 913 ------
NM_004834chr233236 2283 183 ------
NM_004842chr621706 1191 ------
NM_004844chr32402 105 ------
NM_004845chrX74170 4144 3270 1668 1060 247 166 ------
NM_004850chr24617 525 279 127 21276 1115 ----
NM_004857chr1441582 1509 311 77 13480 23722 944 --
NM_004859chr1742388 2288 709 60 32951 1205 885 1715 22575 951
NM_004863chr1485221 4032 3459 805 760 329 273 143 --1443 21108 504
NM_004866chr523348 258 11822 ----
NM_004867chrX196 184 ----
NM_004869chr181460 ------
NM_004871chr1744163 3295 1667 651 --11580 13941
NM_004872chr1149 1126 ----
NM_004884chr1521352 46 ------
NM_004888chr92738 135 ------
NM_004893chr5175 ------
NM_004896chr1031185 584 274 --11099 --
NM_004898chr442527 2514 2310 61 22815 2429 ----
NM_004902chr20------1849
NM_004904chr772400 1733 1628 1328 772 622 589 36605 2602 801 15989 25385 4545
NM_004906chr61601 ------
NM_004922chr102763 169 ------
NM_004925chr94810 792 70 25 ----1828
NM_004926chr143540 86 31 1666 21649 252 --
NM_004929chr841362 1345 485 21 11033 ----
NM_004932chr541651 1523 272 76 ------
NM_004936chr941204 430 368 207 22346 2338 ----
NM_004947chr3102594 2568 2005 1831 1739 726 670 463 113 54 ------
NM_004948chr1821303 1061 --11364 --
NM_004953chr31323 ------
NM_004956chr753888 3382 1555 535 413 13777 ----
NM_004961chrX1124 --2290 186 --
NM_004966chr101635 --1890 --
NM_004969chr10179 ------
NM_004973chr611484 ------
NM_004974chr1122 ------
NM_004976chr1164718 4561 2033 907 645 88 ------
NM_004985chr1284512 4419 3950 1781 1670 1571 1148 578 ------
NM_004992chrX158232 7891 7402 7365 6845 6012 5185 2895 2685 1697 1571 1005 869 745 453 16899 ----
NM_004992chrX158232 7891 7402 7365 6845 6012 5185 2895 2685 1697 1571 1005 869 745 453 16899 ----
NM_004995chr142478 24 ------
NM_004996chr1611677 1606 ----
NM_004998chr152829 182 ------
NM_004999chr664300 4269 3636 2824 2739 79 34325 3779 1427 --1426
NM_005010chr72896 614 21553 208 ----
NM_005011chr721851 176 11873 ----
NM_005020chr72603 491 ------
NM_005023chr521214 388 ----1986
NM_005028chr103302 158 93 --21791 1527 --
NM_005032chrX------1104
NM_005044chrX53562 3504 3191 1504 118 23845 775 23247 963 --
NM_005045chr72150 55 ------
NM_005056chr1275565 3973 1722 1578 1143 699 328 ------
NM_005057chr121895 1700 ------
NM_005063chr1042985 2407 1445 117 13409 11369 --
NM_005065chr1475127 4157 3581 3484 2153 762 279 --14799 --
NM_005079chr82262 243 33224 1199 917 1718 --
NM_005087chr3----1689 --
NM_005095chr112200 1496 ----
NM_005096chrX61077 444 432 211 179 132 --2125 92 --
NM_005110chr51666 ------
NM_005114chr41556 ------
NM_005116chr2074178 4131 3724 3531 1766 998 301 11438 ----
NM_005121chr17--23223 2953 --12405
NM_005126chr312250 1227 ----
NM_005135chr1543436 1105 677 82 11223 --190
NM_005139chr41286 ------
NM_005144chr871206 1122 932 393 378 290 126 ------
NM_005147chr1611021 --21000 873 --
NM_005151chr1832385 408 144 --12286 --
NM_005153chr162661 60 ------
NM_005154chr151197 ------
NM_005156chr962094 2076 1894 1017 789 427 ------
NM_005168chr231459 371 136 --11098 --
NM_005184chr192642 262 ------
NM_005187chr1631650 1428 199 --1492 --
NM_005188chr11157515 6491 5759 5718 5343 5176 3263 3124 3107 3083 2614 1814 1807 1447 820 37136 2432 57 15563 15325
NM_005189chr1722385 168 ------
NM_005190chr6132 ------
NM_005197chr1475636 5630 4892 4251 2446 1213 237 14033 14243 --
NM_005204chr102389 281 1646 ----
NM_005206chr1721354 284 --180 11034
NM_005211chr53541 175 26 1110 ----
NM_005215chr181579 --1124 --
NM_005222chr74869 828 755 198 ------
NM_005227chr11446 --1543 --
NM_005229chrX51206 946 507 349 39 ------
NM_005231chr1111416 --11111 --
NM_005233chr342523 2425 2107 1899 22047 121 1797 --
NM_005235chr2117439 7017 6915 6904 6284 6057 5602 2902 2721 2005 1069 37145 1469 1089 12536 --
NM_005238chr1133593 2874 508 12941 ----
NM_005241chr31113 ------
NM_005242chr51541 --31274 1255 211 --
NM_005245chr41539 ------
NM_005249chr141867 1270 --1612
NM_005256chr112365 49 1955 ----
NM_005257chr1851353 501 250 213 47 --153 --
NM_005259chr231197 623 522 1118 ----
NM_005263chr13768 92 70 ------
NM_005264chr10------1121
NM_005271chr102928 122 --1983 --
NM_005274chr1135 ------
NM_005277chr42675 318 1163 ----
NM_005281chr12846 278 --1215 --
NM_005295chr7--134 ----
NM_005302chr71428 ------
NM_005313chr153931 906 21 ------
NM_005324chr1731386 572 128 11998 ----
NM_005329chr1642359 926 586 296 --1329 --
NM_005334chrX21078 124 --11623 --
NM_005339chr413422 12822 --1374
NM_005342chrX112847 2818 2701 2678 2451 2005 1051 983 967 912 272 ----12486
NM_005348chr141809 1961 ----
NM_005349chr41523 ------
NM_005359chr1855950 4654 4286 882 835 15523 26409 4325 --
NM_005370chr194820 512 70 30 11294 ----
NM_005374chr1772146 1767 930 414 221 189 28 ------
NM_005378chr2133 ------
NM_005387chr11145 ------
NM_005398chr1041429 933 518 92 ------
NM_005400chr251955 1205 1030 288 74 1892 13002 --
NM_005402chr721519 437 ------
NM_005430chr1241052 807 176 146 171 ----
NM_005433chr1841127 1113 440 150 ------
NM_005435chr71550 ------
NM_005436chr1053655 2564 2552 1180 241 --21126 774 158
NM_005443chr4--1559 1211 --
NM_005445chr101285 ------
NM_005455chr131572 320 74 ------
NM_005458chr961913 1617 756 702 468 142 --1131 --
NM_005465chr131756 1728 1571 1754 ----
NM_005474chr1731527 1488 411 182 ----
NM_005493chr62530 26 ------
NM_005497chr1786059 5296 4806 4632 4073 4007 1240 636 11031 24394 1946 12427
NM_005499chr191137 1521 ----
NM_005502chr932868 2752 421 12469 ----
NM_005507chr11----1468 --
NM_005509chr52370 174 1378 ----
NM_005520chr51296 ------
NM_005521chr101794 --139 --
NM_005523chr741594 1204 599 258 ------
NM_005530chr1521235 33 1296 ----
NM_005537chr1331060 959 126 1248 ----
NM_005540chr13601 166 96 1223 ----
NM_005541chr231194 382 291 ------
NM_005542chr731935 1899 295 ------
NM_005552chr143599 452 163 ------
NM_005565chr53511 423 86 ------
NM_005569chr223509 132 63 ------
NM_005574chr112476 73 ------
NM_005575chr51817 --135 --
NM_005578chr354263 3869 2003 885 454 11366 34522 503 262 --
NM_005584chr132515 88 ------
NM_005587chr152769 191 ------
NM_005593chr121142 ------
NM_005595chr11658 ------
NM_005596chr954884 4427 2520 1081 257 24717 866 ----
NM_005599chr131041 344 283 ------
NM_005603chr1831419 1247 94 ------
NM_005604chr621832 673 ------
NM_005607chr82945 102 ------
NM_005619chr191131 ------
NM_005626chr11427 ------
NM_005637chr182214 94 ------
NM_005639chr1231548 724 208 11511 11781 --
NM_005647chrX53372 2351 2182 676 247 --23233 2740 --
NM_005652chr163918 461 188 ------
NM_005655chr811069 ------
NM_005664chr151302 ------
NM_005665chr144825 3779 1613 317 23667 1214 --14025
NM_005668chr564142 2863 1060 755 280 218 13522 ----
NM_005669chr532273 1587 739 --12294 --
NM_005685chr7128 ------
NM_005686chr171559 1447 1254 1169 564 363 149 ------
NM_005688chr3146 ------
NM_005704chr121013 35 --1408 --
NM_005711chr531017 705 388 ------
NM_005715chr632644 2293 408 --11956 --
NM_005717chr1--1279 ----
NM_005722chr2--174 ----
NM_005734chr111320 1616 ----
NM_005736chr1031219 642 44 ------
NM_005738chr741665 1570 1314 819 ------
NM_005746chr712260 32734 2637 244 12674 --
NM_005748chr1232138 651 96 --23100 1107 --
NM_005749chr17--1109 ----
NM_005754chr51369 ------
NM_005761chr121112 ------
NM_005768chr122665 45 ------
NM_005776chr141191 ------
NM_005778chr31124 ------
NM_005785chr1241757 715 86 53 11937 ----
NM_005786chr1821135 474 --1275 --
NM_005789chr1741709 1434 683 538 ------
NM_005813chr23857 793 650 1293 ----
NM_005819chr113060 --22409 88 --
NM_005822chr642014 1523 705 443 ----1384
NM_005826chr1--1155 ----
NM_005832chr31385 ------
NM_005838chr112336 69 --129 --
NM_005839chr11992 ------
NM_005840chrX137652 7274 6765 5947 5713 5235 2376 2145 1590 1384 844 365 198 12741 12073 11392
NM_005841chr431103 236 210 ------
NM_005843chr21284 ------
NM_005848chr15--127 ----
NM_005852chr1731101 1040 182 ------
NM_005853chr16----1566 --
NM_005859chr51220 ------
NM_005862chr3--21028 980 1894 --
NM_005868chr7156 11663 12533 --
NM_005869chr5184 ------
NM_005871chr101260 ------
NM_005875chr3--1117 1128 --
NM_005876chr22611 604 --1708 --
NM_005880chr1641600 1505 1283 1258 ------
NM_005885chr51135 ------
NM_005896chr22679 257 179 ----
NM_005898chr1133008 1257 244 1777 12305 12801
NM_005900chr411144 ------
NM_005901chr1888193 7809 6349 3321 2432 1537 745 451 11743 ----
NM_005902chr1574343 4282 3460 957 697 525 224 13320 14042 180
NM_005903chr584928 4515 3408 1966 1599 1465 1293 394 31815 899 723 --13714
NM_005907chr631200 553 32 ------
NM_005909chr573472 3151 3011 2693 1133 982 842 --2834 764 --
NM_005910chr1773766 2704 1638 1354 1287 976 151 33440 257 135 11367 --
NM_005911chr21128 --1401 --
NM_005920chr173600 3244 3221 3082 2458 99 88 12653 ----
NM_005924chr7125 --1174 --
NM_005927chr521312 448 ------
NM_005933chr1172711 2150 1940 1055 717 706 151 --12050 1522
NM_005935chr474558 1543 1490 1225 631 559 405 13445 24443 3971 1142
NM_005941chr853569 2992 2697 239 174 1267 ----
NM_005955chr133718 1931 1619 --11169 23855 3791
NM_005962chr1032147 1975 1707 ------
NM_005962chr1032147 1975 1707 ------
NM_005964chr1731256 1079 361 ------
NM_005966chr261998 611 534 289 229 97 ------
NM_005967chr122522 298 ------
NM_005969chr114836 797 498 21 --11019 --
NM_005973chr12345 302 ------
NM_005986chr1382854 2791 2414 2314 499 473 370 347 --21959 167 --
NM_006003chr19--1181 ----
NM_006007chr963730 3451 3078 1344 1011 711 23145 2720 ----
NM_006011chr1574168 3922 3515 3108 2775 1127 802 1456 22741 481 --
NM_006015chr11491 ------
NM_006016chr621907 1831 ------
NM_006030chr3127 --11233 --
NM_006035chr141310 ------
NM_006037chr264847 4559 3556 3370 2992 1458 --24672 4019 1463
NM_006047chr2053502 3275 849 397 166 1700 22504 970 --
NM_006051chr5188 ------
NM_006054chr1131126 368 87 ------
NM_006060chr743948 3477 3370 823 ------
NM_006079chr62218 176 ------
NM_006089chrX31853 1286 205 ------
NM_006090chr11700 ------
NM_006091chr1541708 1495 1286 1179 --21215 50 1677
NM_006094chr862294 2059 1930 1630 902 723 ------
NM_006095chr464283 3157 2859 1204 1114 138 11471 13390 --
NM_006106chr112353 307 ------
NM_006113chr11567 --1389 --
NM_006133chr1142356 2232 1549 276 ------
NM_006134chr2141462 622 312 266 --11164 --
NM_006135chr11484 ------
NM_006136chr721255 888 11134 ----
NM_006139chr262625 2410 2321 2199 693 326 --1518 --
NM_006141chr1642071 2060 535 305 ------
NM_006143chr121127 188 ----
NM_006153chr31568 1663 ----
NM_006158chr81278 31440 1196 150 --11133
NM_006159chr12--1581 ----
NM_006160chr1741548 1249 302 131 ------
NM_006162chr1861572 1333 1219 1179 67 43 --1144 --
NM_006166chr1211898 11618 ----
NM_006180chr951873 1594 1487 741 107 1482 --22093 1601
NM_006182chr12152 79 --161 --
NM_006191chr123397 307 148 ------
NM_006194chr1421024 157 ------
NM_006195chr941206 932 912 49 ------
NM_006201chrX3814 218 127 --1897 --
NM_006202chr1981935 1440 1335 783 516 352 45 33 ------
NM_006203chr5115347 5019 4914 4075 1825 1661 1613 1401 903 272 152 15498 1140 --
NM_006206chr432231 66 29 ----1430
NM_006224chr1762170 1806 771 724 682 113 --1894 --
NM_006226chr22881 405 ------
NM_006237chr1352215 2028 1795 384 152 ------
NM_006241chr341529 909 826 783 ------
NM_006243chr11989 ------
NM_006252chr167295 7173 5031 2636 1407 974 16690 ----
NM_006256chr162530 2513 1025 862 315 153 22251 376 ----
NM_006265chr81479 11356 ----
NM_006266chr9143 --2657 193 --
NM_006267chr231398 1358 448 --11364 --
NM_006268chr113883 267 54 ------
NM_006275chr2042466 1601 835 616 11004 11863 --
NM_006277chr22542 484 ------
NM_006279chr12190 180 --1598 --
NM_006281chr81188 ------
NM_006281chr81188 ------
NM_006282chr2064653 4447 3064 1394 1232 757 13819 ----
NM_006283chr854931 3405 3330 1599 1182 24452 3447 ----
NM_006290chr631820 1664 413 ------
NM_006298chr683286 2957 2658 2263 1092 1043 962 343 1515 ----
NM_006301chr121251 ------
NM_006302chr2240 32 ------
NM_006306chrX134500 4469 3709 1977 1515 1501 1432 1368 856 845 547 527 480 ------
NM_006312chr122817 218 ------
NM_006313chr1211432 11161 ----
NM_006315chr4104238 4168 3666 2922 1688 1404 1116 969 663 649 23482 152 24118 1438 --
NM_006317chr52789 600 --2817 563 135
NM_006320chr4--2734 109 --1375
NM_006325chr121311 ------
NM_006328chr112578 80 ------
NM_006336chr951435 1028 589 282 30 --1295 --
NM_006348chr73320 156 29 --145 --
NM_006352chr111509 ------
NM_006354chr32289 59 ------
NM_006357chr21114 ------
NM_006359chrX11775 1327 22410 549 --
NM_006364chr141466 127 ----
NM_006367chr12980 248 ------
NM_006373chr1731258 576 142 --11268 --
NM_006375chrX11558 ------
NM_006380chr1763957 3267 2834 2821 2786 555 --12846 --
NM_006386chr2252173 2104 1901 1654 634 ------
NM_006387chr192920 113 --11051 --
NM_006389chr1151073 544 376 227 50 --125 --
NM_006393chr1064269 1712 1524 1115 708 632 ------
NM_006403chr621585 1195 ------
NM_006408chr72960 940 ------
NM_006409chr71213 ------
NM_006411chr67934 920 780 411 388 222 169 --1115 --
NM_006416chr6--1318 1626 --
NM_006419chr43674 603 175 1769 ----
NM_006420chr2053339 3169 2139 1019 341 12910 22322 2248 12387
NM_006421chr81491 1142 ----
NM_006434chr1071287 1024 759 601 277 253 52 1545 ----
NM_006447chr21--196 ----
NM_006449chr251587 1477 1380 859 716 ------
NM_006451chr5--1794 ----
NM_006455chr171757 ----2282 25
NM_006457chr4--14130 --1697
NM_006459chr1021428 533 --1241 1389
NM_006465chr1581728 1719 1605 755 719 517 31 24 --2793 155 --
NM_006467chr531837 1488 146 1870 ----
NM_006469chr121433 1171 ------
NM_006471chr18141 ------
NM_006472chr121183 65 ------
NM_006482chr1243611 3409 3280 336 23273 131 1109 23788 2723
NM_006489chr1422035 657 --11345 11336
NM_006494chr192644 285 ------
NM_006500chr113472 58 40 ------
NM_006504chr1062916 2528 2186 2163 903 818 ------
NM_006516chr131627 1303 488 11093 --1547
NM_006517chrX62095 2069 1981 1472 928 725 21734 785 32118 1675 750 --
NM_006521chrX11290 ------
NM_006526chr201655 ------
NM_006529chr431530 1147 477 ------
NM_006534chr2022858 802 --1587 --
NM_006537chr15123 ------
NM_006538chr284128 3832 3335 3142 2928 1323 1238 1202 --23989 3771 --
NM_006539chr163517 441 364 ------
NM_006544chr1485449 4875 4516 2038 1304 1138 380 235 24927 770 ----
NM_006546chr17116650 6321 6094 5813 5616 5463 5109 777 752 596 133 ----24440 4431
NM_006547chr732055 1752 1414 1559 ----
NM_006549chr1242798 2708 2431 2239 ------
NM_006557chr941485 1251 1226 456 --21232 1212 --
NM_006559chr121092 153 ------
NM_006560chr111354 ------
NM_006561chr10115838 5532 5425 4624 4148 2500 2115 1345 1333 607 264 14665 12262 14078
NM_006566chr182375 46 ------
NM_006570chr91398 ------
NM_006575chr1421313 437 ------
NM_006585chr21--152 ----
NM_006591chr11171 --1332 --
NM_006593chr22749 728 --1105 --
NM_006595chr1111801 --1116 --
NM_006599chr16147984 7909 7538 7481 7260 6059 5446 5302 2297 2222 1873 1218 945 609 --46590 6406 2370 329 --
NM_006602chr202640 40 ------
NM_006603chrX11721 11928 ----
NM_006609chr241833 796 286 50 1489 ----
NM_006614chr313234 --22500 288 --
NM_006618chr11517 197 ----
NM_006620chr664466 3197 1912 1509 840 809 ------
NM_006621chr141804 606 577 214 11708 ----
NM_006624chr1021407 1339 11676 ----
NM_006625chr11781 ------
NM_006625chr11781 ------
NM_006625chr11781 ------
NM_006628chr15104285 4057 3980 3466 3406 1774 1102 960 572 86 --13677 --
NM_006636chr22642 363 ------
NM_006642chr1152 ------
NM_006650chr573657 2976 2733 983 867 198 25 --21006 722 11070
NM_006654chr1264715 3334 3304 1268 651 203 14668 ----
NM_006667chrX161 1784 ----
NM_006682chr73923 851 701 ------
NM_006690chr2082009 1991 933 823 580 349 240 27 --11788 --
NM_006694chr11267 1349 ----
NM_006698chr201504 ------
NM_006699chr132547 2297 23 3943 684 419 21995 739 --
NM_006706chr51539 1204 ----
NM_006721chr10--1554 --1225
NM_006722chr332576 2024 1130 ------
NM_006726chr411126 --1294 --
NM_006727chr5160 ------
NM_006734chr621401 632 ------
NM_006736chr241729 1342 738 539 ------
NM_006742chr1631906 1678 801 --22028 1595 --
NM_006749chr811147 ------
NM_006754chr71320 ------
NM_006763chr141692 1583 480 470 ------
NM_006765chr8--129 ----
NM_006766chr841800 763 624 493 --1756 --
NM_006769chr12580 516 ------
NM_006772chr651704 1661 1282 572 284 ------
NM_006775chr632127 1240 1180 22822 2272 --1363
NM_006777chrX32084 1873 668 ------
NM_006788chr182555 449 1367 ----
NM_006805chr52564 129 11462 ----
NM_006808chr91189 ------
NM_006811chr201864 ------
NM_006815chr121107 ------
NM_006818chr12168 69 1992 1678 --
NM_006826chr23260 70 58 --199 --
NM_006827chr1473043 2895 1297 1184 912 376 352 --21337 1120 --
NM_006832chr14----1771 --
NM_006854chr721835 813 ------
NM_006857chr21636 185 ----
NM_006861chr1232056 1517 598 ------
NM_006873chr283341 2704 2687 2274 2208 1403 310 32 ------
NM_006874chr41845 1442 ----
NM_006875chrX2595 303 ------
NM_006884chr331340 233 43 11318 ----
NM_006885chr1673425 3388 1089 1062 731 516 449 ----11133
NM_006888chr1443065 2591 1191 834 13079 ----
NM_006892chr202897 376 --1321 --
NM_006892chr202897 376 --1321 --
NM_006896chr74736 464 374 173 ------
NM_006897chr12--1656 ----
NM_006908chr71291 1115 ----
NM_006910chr16--1117 ----
NM_006913chr62377 344 ------
NM_006914chr9--1120 --1388
NM_006915chrX22185 1739 --1932 --
NM_006920chr21581 1767 ----
NM_006922chr262019 1602 836 790 330 119 11632 ----
NM_006924chr17--13443 11260 --
NM_006925chr141476 1403 ----
NM_006930chr521926 149 32037 1601 1383 --1626
NM_006937chr171146 ------
NM_006940chr1221838 359 ------
NM_006943chr2053106 2471 2098 711 598 11083 ----
NM_006947chr42394 93 --11776 --
NM_006948chr211548 22353 310 ----
NM_006958chr8181 ------
NM_006962chrX5957 823 804 460 59 ------
NM_006965chr182143 32 ------
NM_006981chr92947 788 12103 ----
NM_006999chr521615 130 ------
NM_007005chr93613 156 109 ------
NM_007007chr1254218 3797 3207 1575 1243 1886 ----
NM_007011chr1595948 5551 5399 4269 2690 2440 2032 1863 1208 15982 12221 --
NM_007013chr81889 --1335 --
NM_007017chr5------130
NM_007023chr22251 145 1919 ----
NM_007024chr32536 65 ------
NM_007026chr172463 73 ------
NM_007033chr152235 796 764 401 355 ------
NM_007035chr12------1724
NM_007038chr2165456 5192 4866 4474 2198 2178 45036 995 813 687 --15216
NM_007040chr1921032 359 ------
NM_007045chr6179 ------
NM_007047chr652388 2171 1768 686 343 11557 ----
NM_007051chr1129 ------
NM_007052chrX--1149 ----
NM_007054chr541483 1160 814 226 ----11496
NM_007064chr321670 95 --1494 --
NM_007067chr1711568 --1502 --
NM_007084chr1321540 630 ------
NM_007096chr91178 --149 --
NM_007106chr1382541 2453 2346 1062 786 642 460 185 --12707 --
NM_007107chr332318 2239 2007 ----12363
NM_007114chr342666 2173 2097 237 12439 ----
NM_007118chr52814 196 ------
NM_007124chr62691 390 11278 1673 --
NM_007126chr91110 ------
NM_007137chrX84923 4669 4534 4205 4125 3913 2041 938 ----11814
NM_007144chr17252 43 ------
NM_007145chr1911146 ------
NM_007146chr172303 198 12407 ----
NM_007158chr12419 299 ------
NM_007159chr321549 55 ------
NM_007167chr1------1851
NM_007174chr1242155 953 921 265 ------
NM_007175chr863300 3008 2786 2224 1101 145 --1765 11184
NM_007191chr12--195 ----
NM_007192chr142155 29 2474 408 1200 --
NM_007202chr171678 ------
NM_007203chr943761 2765 1584 553 23959 3059 22964 372 13913
NM_007214chr621324 997 2437 417 1499 --
NM_007222chr811413 1114 ----
NM_007235chr12----179 --
NM_007236chr1541504 789 461 259 --1223 --
NM_007246chr42686 91 ------
NM_007249chr13159449 9092 8377 7276 7065 6632 6395 6148 6089 5914 5854 3481 810 591 548 17153 45710 2223 2140 1475 18438
NM_007260chr12689 678 --1308 --
NM_007270chr721520 1413 11177 11067 --
NM_007271chr611646 --21508 579 --
NM_007276chr74792 451 354 317 ------
NM_007281chr4131 ------
NM_007282chr331021 751 183 ------
NM_007292chr1774881 4623 4214 3734 3229 1883 857 --1217 --
NM_007308chr41738 --2290 165 --
NM_007331chr442669 2613 1105 647 --11018 --
NM_007332chr841580 1354 1268 1067 --11087 --
NM_007347chr153685 653 268 --12296 --
NM_007350chr1254544 4318 3029 1775 1277 22847 659 ----
NM_007358chr111791 ------
NM_007363chrX1127 ------
NM_007372chr171301 ------
NM_007375chr132787 2473 703 32498 982 637 ----
NM_012069chrX1862 --1639 1239
NM_012081chr542987 836 817 698 1353 --23651 2704
NM_012083chr102317 109 --1881 --
NM_012084chrX1122 ------
NM_012090chr12825 34 ------
NM_012095chr1073432 3426 2839 2246 590 546 221 11283 12222 --
NM_012096chr373434 3260 3020 2409 1111 1037 366 12422 ----
NM_012102chr122504 2475 --22378 2133 --
NM_012104chr1183160 2784 2776 2527 2392 1453 1015 307 11123 1661 1844
NM_012104chr1183160 2784 2776 2527 2392 1453 1015 307 11123 1661 1844
NM_012115chr61139 ------
NM_012117chr12146 ------
NM_012120chr631049 932 626 ------
NM_012123chr6----1313 --
NM_012134chr131601 1588 1261 1151 ----
NM_012137chr152833 2623 2187 281 66 1154 1944 --
NM_012141chr1363465 3434 1207 635 205 81 11029 21215 24 --
NM_012154chr8159 1338 ----
NM_012156chr2073337 3042 2560 2402 2178 584 483 23423 3271 ----
NM_012157chr31320 1951 --1934
NM_012158chr132557 182 ------
NM_012180chr41717 ------
NM_012183chr11443 ------
NM_012193chr1144870 4518 999 641 21076 835 ----
NM_012199chr174414 4383 3251 2973 1136 944 721 13713 24126 1060 --
NM_012214chr274287 4267 3957 1844 959 362 137 55577 4368 2034 821 466 16080 --
NM_012218chr1973102 2740 790 687 596 482 37 --12099 --
NM_012223chr241329 378 349 295 --1905 --
NM_012232chr1731427 137 28 --1368 --
NM_012234chr373698 3117 2920 2431 1435 1146 912 1826 22412 967 --
NM_012242chr101224 ------
NM_012243chr11867 ------
NM_012244chr1461376 1263 1195 221 170 23 ------
NM_012247chr102776 275 ------
NM_012250chr11------11096
NM_012252chr751310 1173 1122 795 384 13282 --1239
NM_012257chr71837 ------
NM_012262chr154393 4314 3841 2082 1233 11263 24320 1445 --
NM_012281chr722168 580 ------
NM_012286chrX1231 ------
NM_012287chr344284 3153 1388 367 --2982 137 14042
NM_012288chr6155533 5249 5181 5064 4927 4712 4629 4093 3942 2121 1838 1525 1203 252 194 1912 34749 4107 901 --
NM_012290chr221400 1368 21687 55 ----
NM_012294chr793007 2679 1499 1429 1011 857 533 201 125 --11392 --
NM_012296chr1183325 3302 3038 3026 2410 822 638 106 13787 22967 202 --
NM_012297chr421683 464 --12242 11650
NM_012300chr521943 860 --11885 --
NM_012301chr712029 --11700 --
NM_012302chr1----1785 --
NM_012308chr1152610 1831 1644 696 616 ------
NM_012309chr1154635 4248 1771 979 105 13046 ----
NM_012311chr101452 ------
NM_012316chr163701 2072 1938 1452 1288 751 --22168 853 15335
NM_012322chr72424 74 --1291 --
NM_012325chr202156 39 ------
NM_012329chr1731540 547 214 --1397 11639
NM_012330chr1031638 390 289 ------
NM_012333chr131238 1045 513 ------
NM_012334chr584614 3903 3694 3497 3004 1506 900 230 ------
NM_012382chr554147 2900 1306 1249 480 11597 1946 --
NM_012383chr9149 ------
NM_012384chr2042260 2019 1997 1645 ------
NM_012394chr1142 ------
NM_012398chr1962884 2775 2367 2108 1151 38 --2805 614 --
NM_012399chr2221667 1271 ------
NM_012402chr1161307 1146 868 295 275 246 ------
NM_012405chr163885 3780 3659 1447 1302 117 2604 135 ----
NM_012408chr203839 683 93 --1741 --
NM_012412chr72606 322 ------
NM_012414chr11176 1271 ----
NM_012416chr911136 --11121 --
NM_012428chr15--1771 ----
NM_012448chr1752233 1825 451 102 52 --21710 724 --
NM_012454chr61229 ------
NM_012463chr1241252 1194 460 66 ------
NM_012465chr1073094 2332 781 635 299 275 228 --12422 --
NM_012470chr71364 ------
NM_012479chr73968 514 343 ------
NM_012482chr11656 1219 ----
NM_013229chr1232025 417 118 1293 ----
NM_013230chrY1508 1313 ----
NM_013231chr14104371 4191 3753 3696 1732 1686 1405 688 339 56 1837 23484 2969 --
NM_013233chr251402 925 340 101 54 ------
NM_013235chr5--1853 ----
NM_013238chr133713 706 236 ------
NM_013243chr1511017 ------
NM_013246chr113310 283 48 --1855 --
NM_013255chr7128661 8453 7893 7451 7257 6753 6140 3543 2797 1475 801 178 28231 3282 --16232
NM_013261chr422354 1432 13307 ----
NM_013262chr631127 1121 154 ------
NM_013267chr122441 166 ------
NM_013269chr1244352 2834 856 461 ------
NM_013279chr1121670 357 --1703 --
NM_013281chr201372 ------
NM_013283chr51720 --1754 --
NM_013293chr7197 ------
NM_013302chr1683869 3761 3162 3121 2910 1776 1417 446 ----14643
NM_013313chr2232673 879 692 --22176 530 --
NM_013333chr192269 43 --2338 130 --
NM_013341chr262769 2662 2621 1865 1141 233 1399 11069 --
NM_013348chr191865 ------
NM_013354chr83897 383 197 ------
NM_013368chr191462 ------
NM_013372chr1542116 1179 1070 890 1562 ----
NM_013381chr1231515 569 182 11741 ----
NM_013382chr1442107 1671 1507 758 ------
NM_013388chr2182 ------
NM_013390chr921105 574 ------
NM_013392chr21400 ------
NM_013396chr211191 1596 1323 --
NM_013410chr131286 1075 496 144 ----
NM_013411chr162628 2332 2231 2029 1746 783 1810 ----
NM_013423chrX41235 427 158 87 ------
NM_013427chrX41235 427 158 87 ------
NM_013433chr1972024 1511 702 465 401 291 174 ----11727
NM_013434chr261783 1624 692 613 464 402 11261 21515 165 --
NM_013434chr261783 1624 692 613 464 402 11261 21515 165 --
NM_013436chr22741 196 ------
NM_013437chr821136 461 ------
NM_013444chrX2230 177 1319 ----
NM_013446chr721363 320 ------
NM_013447chr1963793 3713 3034 2412 506 255 1160 23737 1436 --
NM_013448chr142266 148 ------
NM_013449chr1222990 2150 --22998 1094 --
NM_013450chr2--1317 ----
NM_013937chr62272 100 --1384 --
NM_013943chr142493 2262 1206 68 --2805 317 --
NM_013951chr222440 556 ------
NM_013995chrX42263 979 973 300 11936 11759 --
NM_014011chr21533 ------
NM_014021chr143433 3153 2399 1352 ------
NM_014023chr1032952 879 514 --11056 --
NM_014030chr174855 818 281 63 ------
NM_014034chr63988 453 283 ------
NM_014038chr72358 42 1281 ----
NM_014042chr111212 ------
NM_014048chr1644837 4109 3695 2034 --15059 1406
NM_014057chr941451 1007 538 446 ------
NM_014089chr132676 126 ------
NM_014106chr152600 311 1365 ----
NM_014109chr8--2486 300 ----
NM_014112chr864622 4580 3342 3327 1817 701 --15425 --
NM_014117chr162724 44 ------
NM_014141chr755231 4612 2113 1502 1133 14805 ----
NM_014145chr201603 ------
NM_014154chr321348 1122 ----1637
NM_014155chr1155030 2236 1350 1277 888 16950 ----
NM_014157chr1643331 1439 1380 403 13969 ----
NM_014181chr212042 41928 545 325 127 ----
NM_014182chr124520 505 307 238 ------
NM_014225chr19197 ------
NM_014231chr1271696 1543 659 444 129 102 44 ------
NM_014232chr174648 549 419 93 ------
NM_014232chr174648 549 419 93 ------
NM_014233chr1761971 1721 1715 411 282 113 ------
NM_014240chr363507 3288 2750 2687 1432 233 23737 401 ----
NM_014246chr2212156 ------
NM_014253chrX22180 275 --11879 --
NM_014263chr1021372 1175 ------
NM_014267chr11--1233 ----
NM_014268chr1841441 1347 918 247 --1573 --
NM_014271chrX--1687 ----
NM_014283chr11113 1585 ----
NM_014289chrX31378 1363 1097 --1550 --
NM_014293chr2263812 3693 3533 1589 110 40 12634 23106 2716 --
NM_014299chr192348 335 --22022 1926 --
NM_014313chr1165 ------
NM_014323chr223389 158 134 ----1677
NM_014329chr161256 ------
NM_014331chr477249 7118 4995 2707 1190 697 533 37708 2660 1238 ----
NM_014333chr1122739 2089 12005 ----
NM_014342chr1121198 1140 11242 ----
NM_014345chr61279 ------
NM_014351chr225989 947 920 477 71 ------
NM_014352chr1131446 1141 22 --1594 --
NM_014368chr921699 451 11528 11666 --
NM_014372chr111411 21597 1360 ----
NM_014379chr811022 ------
NM_014382chr321758 1387 1296 ----
NM_014390chr72487 443 --134 --
NM_014392chr451598 1298 605 221 101 ------
NM_014393chr81363 11547 1107 --
NM_014400chr192418 397 ------
NM_014408chr13216 191 132 ----1141
NM_014410chr18--1366 ----
NM_014415chr31596 ----11237
NM_014417chr192714 154 ------
NM_014418chr1451999 1870 1341 461 333 ------
NM_014423chr554608 4564 4543 1816 1663 34833 887 619 11681 --
NM_014445chr332284 1677 28 --12142 --
NM_014447chr411574 ------
NM_014452chr61471 134 ----
NM_014454chr62895 859 --1223 --
NM_014469chr113773 658 566 ------
NM_014487chr4--2707 125 196 --
NM_014491chr72423 58 ------
NM_014494chr162200 124 1465 ----
NM_014504chr73777 375 286 162 11387 --
NM_014515chr121967 168 ----
NM_014554chr1252245 1587 785 303 144 ------
NM_014562chr21170 ----1732
NM_014572chr1341704 1558 369 269 11635 2701 27 --
NM_014575chr31451 ----1185
NM_014577chr22----1334 --
NM_014588chr201139 ------
NM_014592chr5----121 --
NM_014603chr171340 ------
NM_014607chr221344 454 11368 1419 --
NM_014612chr9--1252 ----
NM_014615chr1653502 2374 2298 1141 201 --13272 --
NM_014623chr61207 ------
NM_014630chr152862 846 11311 ----
NM_014634chr2243458 2745 2440 586 ----1940
NM_014636chr983335 3088 2942 1333 1225 1015 848 210 24016 2761 24008 3319 13409
NM_014637chr821344 1091 1465 ----
NM_014647chr16----11872 --
NM_014659chr152339 120 ------
NM_014660chr731093 459 283 11044 ----
NM_014661chr1083885 3417 995 968 481 439 348 54 --12911 --
NM_014666chr51431 ------
NM_014667chr362381 2147 2021 1915 1733 1700 ------
NM_014670chr231388 1088 1050 ------
NM_014671chr751524 363 180 131 82 ------
NM_014676chr111060 ------
NM_014679chr1131103 432 86 ------
NM_014680chr172423 126 ------
NM_014682chr841925 1656 1582 644 22281 1642 ----
NM_014686chr1942158 1936 1609 873 --182 --
NM_014690chr782735 2408 2178 1107 1062 1021 424 30 ------
NM_014693chr31314 --1215 --
NM_014701chr1533004 826 379 ------
NM_014702chr643181 2173 520 45 ----1487
NM_014705chr731800 1361 99 --11389 --
NM_014706chr124805 793 215 38 ------
NM_014707chr7------11646
NM_014720chr1031698 1217 1138 ------
NM_014721chr666443 6283 6228 2227 2179 1642 12123 35411 2299 1620 --
NM_014726chr1731209 123 59 --1172 --
NM_014729chr83536 149 119 --31824 1553 238 --
NM_014730chr1255239 4891 4599 3763 173 ------
NM_014730chr1255239 4891 4599 3763 173 ------
NM_014732chr16105738 5246 5086 4338 4258 2037 1427 1104 118 47 24244 1951 34296 3692 426 --
NM_014733chr541923 1879 835 308 ------
NM_014736chr152902 378 ------
NM_014739chr623943 2935 13851 14242 --
NM_014743chr472982 2838 2468 2283 1174 441 374 12932 1515 --
NM_014747chr185413 4133 3986 3887 819 576 474 236 --11711 11338
NM_014751chr84874 851 380 70 ------
NM_014755chr243712 3235 493 184 12690 ----
NM_014758chr1152013 1800 489 480 140 ------
NM_014761chr161121 1846 --1804
NM_014764chr12--11249 2968 225 --
NM_014765chr152544 2481 2254 2026 970 ------
NM_014766chr762835 1380 1309 1272 1202 72 11060 1680 --
NM_014767chr1083636 3595 3071 2742 2351 1328 1091 345 13522 12944 --
NM_014774chr122934 349 22571 364 --1880
NM_014776chr1253056 1991 1267 903 183 11208 1959 --
NM_014779chr331066 383 74 ------
NM_014781chr8270 64 ------
NM_014782chrX189 ------
NM_014784chr12734 35 --1273 --
NM_014786chr1131098 1054 428 ------
NM_014787chr142416 1805 1039 129 --1276 --
NM_014795chr221272 947 ------
NM_014798chr1741332 268 87 22 --2503 406 --
NM_014810chr142632 809 767 459 13582 12523 --
NM_014812chr171834 1611 754 534 469 431 195 ------
NM_014819chr541695 1540 1004 811 ------
NM_014820chr361963 1898 1497 1409 603 577 ------
NM_014826chr1114188 4056 3779 3715 3381 3283 3048 863 277 245 35 24358 3869 22916 46 --
NM_014827chr1----21360 472 --
NM_014828chr1421579 361 ------
NM_014829chr5----12032 11972
NM_014830chr1272996 2899 2827 1259 845 818 469 1372 13684 --
NM_014832chr13--2778 472 --11713
NM_014835chr2061976 1720 1594 1502 1460 181 ----22296 1698
NM_014836chr102135 57 ------
NM_014838chr2262652 2222 1124 644 125 77 42507 2408 1919 358 11910 --
NM_014839chr131854 1826 30 1150 --12071
NM_014840chr1233302 2286 289 --22368 1341 1728
NM_014841chr63475 199 118 ------
NM_014847chr11156 ------
NM_014848chr1542510 2428 2338 147 ----22128 507
NM_014850chr374108 3987 3935 3467 1707 1678 1340 --13032 --
NM_014859chr171266 --1981 11209
NM_014871chr122580 96 ------
NM_014872chr931472 957 409 12150 ----
NM_014873chr133930 3711 656 ------
NM_014876chr2252120 1950 600 376 88 1216 1171 --
NM_014877chr1787579 5589 5468 4760 2964 2420 1859 1478 21912 127 --11454
NM_014883chr451867 803 518 385 329 ------
NM_014888chr721467 40 11229 11209 --
NM_014897chr1721154 269 22900 893 13136 --
NM_014900chr231070 300 38 ------
NM_014901chr532105 799 320 ------
NM_014903chr1241841 703 493 485 1248 ----
NM_014904chr1063906 3444 3377 1231 681 256 --22902 2828 --
NM_014905chr231986 463 31 ------
NM_014906chr1754087 3605 3450 2885 1311 12707 ----
NM_014912chr105974 518 397 308 284 11002 ----
NM_014920chr662949 1444 1358 1261 582 445 --23270 1053 13723
NM_014921chr1942925 2747 305 107 ------
NM_014923chr131912 1681 ----
NM_014925chr122752 231 ------
NM_014926chr31210 ------
NM_014932chr31234 1241 ----
NM_014933chr41147 ----124
NM_014938chr1272433 2406 2353 818 452 227 93 11000 11593 --
NM_014939chr1841579 1345 1287 618 11556 11450 --
NM_014941chr22175 ------
NM_014942chr621942 402 11886 ----
NM_014944chr151432 1371 996 957 376 ------
NM_014947chr152878 2801 2503 1250 792 13138 ----
NM_014961chr41284 --11872 --
NM_014962chr2052749 2149 2139 1787 1079 --1881 --
NM_014978chr1031792 1572 1487 1715 ----
NM_014982chr1455243 3667 1815 1763 1288 11567 ----
NM_014988chr472524 2161 1985 1140 1130 1114 27 12854 ----
NM_014989chr642010 1593 1374 339 ------
NM_014990chr1411274 ------
NM_014991chr452642 2479 2460 540 295 --1337 1666
NM_014992chr141264 ------
NM_014994chr1562249 1959 1750 627 621 143 ------
NM_015000chr1242750 737 697 300 23117 666 ----
NM_015001chr11944 --1809 --
NM_015002chr1241600 782 334 115 --11760 --
NM_015008chr343014 2984 2971 77 1795 1549 --
NM_015017chr121240 1090 ------
NM_015020chr1643092 1367 208 145 1921 13453 --
NM_015024chr831305 1038 174 ------
NM_015025chr211718 11879 ----
NM_015035chr2095841 5730 5045 5008 4739 4145 2036 982 718 26424 2649 35437 1461 644 --
NM_015039chr183796 3696 2967 2882 1495 674 623 509 14028 --11161
NM_015042chr1574272 3940 3539 3118 3083 1300 637 --13872 --
NM_015044chr1663193 2999 2539 2231 730 393 12293 32262 1224 386 --
NM_015045chr101104 1811 ----
NM_015049chr223090 1291 12982 --1655
NM_015051chr922869 239 12463 ----
NM_015057chr13----1126 --
NM_015064chr12103289 2986 2695 2673 2230 1411 1042 983 294 153 12971 13571 --
NM_015071chr5105852 5242 4912 4576 1764 1249 1149 729 294 158 --22440 1085 --
NM_015074chr193732 3691 3246 1975 1969 1950 1591 1523 25 --1603 --
NM_015075chrX72077 1757 835 772 732 450 404 ------
NM_015076chr673532 2809 1738 1386 1081 742 697 11027 ----
NM_015085chr171477 --11026 11675
NM_015086chr1221318 62 11571 --11199
NM_015092chr1684409 2850 1684 1190 653 461 355 178 2982 901 2667 402 --
NM_015094chr2274258 4127 3670 3253 2986 1522 1509 --24644 3645 13199
NM_015097chr321684 841 12054 ----
NM_015100chr151836 1257 809 229 128 ------
NM_015103chr33938 756 290 ------
NM_015107chrX82364 1653 759 631 446 280 267 181 ------
NM_015113chr1742032 771 121 72 ------
NM_015115chr453105 2494 1265 1136 842 ------
NM_015129chrX31766 612 242 ------
NM_015130chr421411 485 ------
NM_015132chr711528 1713 ----
NM_015134chr172629 174 ------
NM_015137chr842331 1901 1803 677 ------
NM_015138chr1562779 2311 807 797 319 307 ----12829
NM_015144chr1663803 3534 3251 2786 620 254 13528 ----
NM_015149chr132084 654 599 ------
NM_015155chr1043319 2264 2183 672 --166 --
NM_015156chr1463892 3565 2990 2853 2792 191 22556 1411 11399 --
NM_015173chr42474 331 21772 1311 ----
NM_015176chr1--21335 697 ----
NM_015192chr2032992 2124 38 21948 764 11024 --
NM_015194chr1741614 1463 682 396 --11683 --
NM_015198chr721232 302 2309 61 ----
NM_015199chr352921 2737 2574 2451 969 --12135 --
NM_015200chr421765 1602 ------
NM_015206chr1551548 1473 1092 829 788 --11147 13057
NM_015208chr1823975 87 ------
NM_015209chr142128 1467 1442 491 ------
NM_015213chr111114 ----1826
NM_015215chr122881 2364 ------
NM_015216chr511506 185 ----
NM_015225chr9102892 2570 2493 2406 2100 2004 1040 824 118 98 --12307 1804
NM_015231chr112792 289 2120 79 ----
NM_015236chr441271 1253 480 285 ------
NM_015238chr5----1704 --
NM_015254chr852488 2063 1269 457 351 ------
NM_015256chr51587 ------
NM_015264chr2244571 2976 517 401 13664 13552 1134
NM_015265chr222175 540 32702 813 329 ----
NM_015267chr1242021 1914 202 57 ------
NM_015268chr31696 ------
NM_015269chr1197 1581 ----
NM_015270chr1222026 877 ------
NM_015271chr422820 1250 22852 307 11579 --
NM_015272chr16130 11329 ----
NM_015277chr182640 141 1336 --11255
NM_015284chr12723 417 --11316 --
NM_015288chr573806 3386 2480 896 835 727 115 --1501 --
NM_015289chr1541921 1832 1571 603 1434 1393 --
NM_015294chr1741080 895 836 270 ------
NM_015299chr1453405 3297 3030 136 88 --13036 --
NM_015305chr1441599 635 512 229 11476 11730 --
NM_015310chr877220 7168 6069 5267 1207 830 480 47493 6980 5102 383 --21279 1225
NM_015315chr543410 2598 646 338 ------
NM_015317chr242481 2138 1977 780 --11843 --
NM_015326chr1--22947 1035 ----
NM_015327chr121306 905 11345 ----
NM_015328chr732675 2092 1130 ------
NM_015332chr731385 1193 532 --13630 --
NM_015335chr1232618 1829 108 ------
NM_015336chr1232464 2136 1988 2260 76 ----
NM_015344chr852151 1978 530 476 223 11482 155 --
NM_015347chr1252750 2290 1920 799 352 22414 2406 ----
NM_015349chr642833 2606 2556 2461 --1251 --
NM_015358chr21--31114 293 137 ----
NM_015360chr51135 ------
NM_015361chr22872 697 1655 2738 648 1246
NM_015365chrX31341 745 594 1658 ----
NM_015375chr144167 3042 862 25 --14287 --
NM_015382chr142686 264 ------
NM_015385chr1071287 1024 759 601 277 253 52 1545 ----
NM_015387chr221913 196 ------
NM_015396chr32304 235 11301 ----
NM_015397chr941342 1182 343 42 1141 ----
NM_015401chr122289 77 --1769 --
NM_015429chr3170 ------
NM_015435chr81970 21193 347 ----
NM_015436chr483242 2469 2329 2198 2117 910 760 281 32378 2356 369 12503 --
NM_015455chr533985 3357 1637 --23737 3511 --
NM_015460chr331507 668 200 ------
NM_015465chr53620 495 83 ------
NM_015470chr221198 112 ------
NM_015472chr3197 ------
NM_015472chr3197 ------
NM_015475chr2--1148 ----
NM_015481chr121683 ----127
NM_015483chr71744 1447 ----
NM_015488chr271646 1476 1186 619 580 306 30 11779 21434 480 --
NM_015493chr1932140 1420 637 12216 195 --
NM_015508chr351378 1358 976 258 219 11461 1185 --
NM_015509chr1221170 163 1146 ----
NM_015511chr2011127 ------
NM_015513chr32684 77 --1724 --
NM_015520chr322541 1939 ------
NM_015530chr24848 842 613 378 ------
NM_015535chr273757 2959 1629 1230 980 250 29 --22820 1657 --
NM_015537chr92116 38 ------
NM_015541chr33999 134 90 ------
NM_015548chr61958 ------
NM_015549chr141464 --1209 --
NM_015550chr723323 415 --12586 13515
NM_015554chr1531137 346 292 12196 12437 --
NM_015557chr152856 2512 1285 1066 34 ------
NM_015564chr522886 1203 1474 ----
NM_015567chr1321000 361 1864 ----
NM_015568chr2053338 2652 2641 1401 245 14039 --12792
NM_015569chr1124464 4415 4106 4057 3809 1521 1151 1004 923 459 143 136 ------
NM_015571chr622053 1904 --192 --
NM_015575chr262866 2355 2330 2295 98 74 11236 33104 2238 1309 --
NM_015576chr34965 798 473 172 ------
NM_015577chr51373 --1396 --
NM_015578chr1931640 1383 1283 ------
NM_015584chr1711157 ------
NM_015609chr152919 2518 1089 321 313 1435 --12588
NM_015622chr7191 ------
NM_015630chr2147 ------
NM_015635chr93769 481 325 ------
NM_015641chr7--21279 315 ----
NM_015645chr11133 1372 ----
NM_015646chr1221286 429 ------
NM_015651chr942139 1731 539 528 --1911 --
NM_015657chr21663 1220 ----
NM_015678chr1321310 572 ------
NM_015686chrX52170 1711 947 498 408 ------
NM_015691chrX32897 2531 546 --1656 --
NM_015716chr172640 571 ------
NM_015850chr831957 1682 236 --1160 12425
NM_015866chr131020 424 140 11487 ----
NM_015872chr151241 1212 713 703 323 ------
NM_015874chr41523 ------
NM_015878chr8--11487 ----
NM_015879chr18167683 7289 7271 6491 6243 5308 5257 2841 2826 2584 2031 1342 1063 881 515 496 28205 6439 38192 2121 719 --
NM_015886chr874574 4531 2292 1879 1486 696 550 ----34861 1768 1463
NM_015898chr1931579 774 559 11874 ----
NM_015901chr101863 ------
NM_015904chr21226 ------
NM_015905chr7--1585 ----
NM_015906chr143449 1325 1230 1113 11944 33382 1645 613 --
NM_015912chr8--1240 ----
NM_015915chr14--178 ----
NM_015981chr522599 47 ------
NM_015994chr142665 499 ------
NM_015999chr12183 146 1740 ----
NM_016009chr164200 3936 3525 3334 1649 897 34803 4451 1085 33657 3350 3076 --
NM_016018chr832785 2173 111 11069 ----
NM_016021chr663052 2797 1999 634 477 158 1370 1379 --
NM_016022chr12918 227 ------
NM_016023chr811515 12105 1229 --
NM_016025chr1661934 1311 723 237 228 108 --11889 1389
NM_016032chrX31217 1180 563 1915 ----
NM_016037chr11882 ------
NM_016038chr73657 588 259 ------
NM_016040chr122620 678 22356 1054 11110 --
NM_016045chr20--1435 ----
NM_016057chr1241082 806 527 130 --31177 834 502 --
NM_016061chr231579 585 549 --11589 --
NM_016070chr17131 --142 --
NM_016073chr151355 ----1393
NM_016075chr1313168 23107 2652 --13192
NM_016076chr173128 2875 2818 1229 901 604 23 12246 2715 223 --
NM_016079chr272040 1927 1921 1725 1582 849 544 12129 12234 --
NM_016081chr411968 11773 ----
NM_016083chr673112 2700 2672 1171 720 184 139 1175 --11257
NM_016089chr392005 1407 810 784 642 364 222 138 54 1200 11846 --
NM_016094chr3137 ------
NM_016096chr822107 128 --11695 --
NM_016098chr61123 1339 ----
NM_016103chr5145 ------
NM_016107chr52553 64 ------
NM_016131chr242323 753 468 69 ------
NM_016132chr1533252 2836 211 --1528 --
NM_016141chr31817 ------
NM_016147chr112900 379 ----11088
NM_016152chr3--2402 269 ----
NM_016162chr122657 145 1865 ----
NM_016169chr1043233 2244 1162 957 --11138 1446
NM_016174chr92182 127 --1166 --
NM_016192chr21280 ------
NM_016195chr104825 817 701 102 ------
NM_016206chr3148253 7899 7815 7459 7099 6277 3593 3076 2653 2221 2212 1828 1644 1000 18398 21919 81 --
NM_016210chr3286 65 ------
NM_016211chr41147 ----124
NM_016216chr34866 597 583 59 ------
NM_016227chr11113 1585 ----
NM_016231chr171420 ------
NM_016247chr31492 ------
NM_016248chr1383716 3526 3479 3328 1565 1331 1278 155 13863 12974 --
NM_016252chr2--1617 ----
NM_016255chr663180 2783 2652 2318 131 108 ------
NM_016257chr193161 3083 2488 2169 993 493 452 402 230 ------
NM_016258chr1--1570 ----
NM_016260chr2107258 6648 6629 5369 2981 2180 2159 1273 1105 65 15791 11024 --
NM_016261chr173774 328 181 ------
NM_016264chr19244 26 ------
NM_016271chr1831920 1872 1824 --12278 --
NM_016272chr226711 609 568 201 187 113 1500 ----
NM_016279chr51473 ------
NM_016281chr122360 107 1741 ----
NM_016283chr5130 ------
NM_016287chr121907 502 --21410 1363 --
NM_016297chr263758 3734 3468 2887 2738 187 --13678 --
NM_016300chr3--2107 100 ----
NM_016306chr3--1336 ----
NM_016308chr111286 11438 22026 1661 --
NM_016316chr21581 ------
NM_016320chr115365 325 235 148 88 --138 --
NM_016322chr922931 2417 13000 ----
NM_016328chr7128 ------
NM_016338chr5--11091 ----
NM_016339chr171598 151 ----
NM_016340chr52236 133 ------
NM_016352chr731141 416 277 ------
NM_016356chr662867 2601 2419 682 301 275 1637 12535 --
NM_016374chr1151 41374 1185 144 32 ----
NM_016374chr1151 41374 1185 144 32 ----
NM_016376chr1793378 3009 2954 2710 1385 749 358 284 222 --13020 --
NM_016377chr621706 1191 ------
NM_016382chr111042 ------
NM_016396chr151398 ------
NM_016410chr9--1635 ----
NM_016424chr1731356 1350 708 ------
NM_016436chr2042046 1948 763 682 ------
NM_016441chr222085 181 ------
NM_016442chr532111 1718 889 --12208 --
NM_016470chr20182 ------
NM_016472chr1441525 1033 968 228 1514 ----
NM_016480chr51104 ------
NM_016485chr61156 ------
NM_016499chr111522 ------
NM_016506chr112226 32 ------
NM_016507chr1772950 2337 2121 1091 661 640 315 ----12640
NM_016513chr662949 1444 1358 1261 582 445 --23270 1053 13723
NM_016519chr4183 ------
NM_016522chr1121395 1335 ------
NM_016526chr1122446 2233 ------
NM_016529chr13--1259 11021 --
NM_016530chr1543606 3364 930 771 ------
NM_016531chr433639 902 838 --138 --
NM_016542chrX11094 ------
NM_016544chr273514 1557 1523 1100 594 288 112 1962 1847 --
NM_016574chr112890 175 ------
NM_016577chr3104364 4104 4004 3724 3662 3345 3162 530 516 180 --1420 --
NM_016578chr112446 245 1592 ----
NM_016582chr11132 ------
NM_016586chr14--1412 ----
NM_016587chr74792 451 354 317 ------
NM_016588chr62120 39 ------
NM_016591chr52460 244 ------
NM_016596chr122289 77 --1769 --
NM_016598chr331460 322 104 --126 --
NM_016603chr522060 102 ------
NM_016604chr52140 45 156 ----
NM_016605chr552582 2517 2354 1692 1029 ------
NM_016618chr2183 ------
NM_016620chr11240 2508 458 ----
NM_016621chr1154264 3188 3120 2887 693 12965 ----
NM_016626chr1821262 368 ------
NM_016631chr212731 40 ------
NM_016639chr16254 43 --2355 36 --
NM_016644chr51114 ----178
NM_016733chr223509 132 63 ------
NM_016823chr1721224 154 ----1904
NM_016824chr1011271 ------
NM_016829chr32243 183 ------
NM_016834chr1773766 2704 1638 1354 1287 976 151 33440 257 135 11367 --
NM_016835chr1773766 2704 1638 1354 1287 976 151 33440 257 135 11367 --
NM_016841chr1773766 2704 1638 1354 1287 976 151 33440 257 135 11367 --
NM_016929chr643415 1441 1349 47 13950 ----
NM_016936chr1652095 1471 1421 75 27 --1789 --
NM_016938chr112390 358 ------
NM_016946chr142626 2532 513 43 22743 338 ----
NM_016952chr1143043 2749 2647 202 ------
NM_017409chr123292 279 31 ----1184
NM_017413chrX1846 --22331 93 --
NM_017420chr141205 13590 12525 --
NM_017423chr42761 328 --1642 --
NM_017443chr951118 975 591 162 39 --11414 --
NM_017444chr821250 51 ------
NM_017447chr212962 450 ------
NM_017449chr151531 1498 1359 1352 1275 1482 21214 100 --
NM_017452chr201386 --31276 485 211 --
NM_017453chr201386 --31276 485 211 --
NM_017454chr201386 --31276 485 211 --
NM_017455chr15--1771 ----
NM_017481chr111206 ------
NM_017519chr6--1267 1126 --
NM_017522chr12988 330 ------
NM_017544chrX1160 ------
NM_017548chr31353 --21708 66 1113
NM_017558chr161307 1333 ----
NM_017563chr3135862 4899 4864 4796 3894 2184 1964 1471 1266 669 339 86 30 ----24979 4789
NM_017580chr1041921 1914 811 370 ------
NM_017582chr111498 1200 --11583
NM_017583chr1131435 1401 296 ------
NM_017590chr221364 --1517 --
NM_017594chr962621 2397 1174 228 179 48 --11326 --
NM_017596chr184334 3405 2925 1611 1567 1480 501 69 --12977 --
NM_017610chr1511646 11609 ----
NM_017628chr464309 4211 3271 3239 1765 103 --23765 922 --
NM_017629chr11751 --11359 --
NM_017633chr633791 2406 426 12755 ----
NM_017634chr831656 739 208 11703 174 1785
NM_017637chr988642 8183 7792 6853 3421 2785 2063 1303 37004 1769 1038 27861 3428 --
NM_017640chr62880 850 ------
NM_017641chr121373 ------
NM_017643chr1722419 84 ------
NM_017644chr384876 4401 3873 3471 3199 1360 1116 331 --1900 --
NM_017650chr785624 4998 4919 4804 4257 1405 1129 482 35957 5428 1771 --22436 1004
NM_017658chr1444029 3828 1474 838 13433 ----
NM_017668chr161635 1816 ----
NM_017672chr15------1385
NM_017680chr92797 265 11025 ----
NM_017684chr1531554 205 64 11400 ----
NM_017686chr13958 184 42 --1968 --
NM_017709chr143524 3512 989 578 22975 1513 --13357
NM_017719chr33986 295 225 1318 ----
NM_017730chr31682 ------
NM_017737chr1------1867
NM_017739chr12481 415 ------
NM_017741chr42517 341 ------
NM_017742chr1851368 1302 505 497 457 133 21928 1769 --
NM_017744chr162272 2052 952 722 360 232 ------
NM_017768chr11831 ------
NM_017772chr631381 157 99 ------
NM_017778chr811353 ------
NM_017779chr152500 2210 875 601 501 1695 --176
NM_017784chr361115 397 379 287 198 87 ------
NM_017787chr1032086 1977 106 --11942 --
NM_017799chr1411538 --11728 --
NM_017811chr942165 1034 1023 984 ------
NM_017812chr72736 720 ------
NM_017813chr843537 1969 781 485 11649 ----
NM_017816chr4131 ------
NM_017822chr12----1182 1306
NM_017824chr1022292 139 1521 ----
NM_017831chr1834343 4242 1494 1417 ----
NM_017848chrX84458 3187 2978 1881 1216 758 500 385 11125 ----
NM_017849chr252948 2009 1998 841 245 ------
NM_017860chr13802 608 221 ------
NM_017893chr1051238 1090 477 297 102 1985 21390 329 --
NM_017902chr10125386 3819 2257 2050 2007 1895 1781 1483 1410 1250 257 176 35756 2015 106 ----
NM_017910chr21284 ------
NM_017911chr2221523 431 --11348 --
NM_017915chr1221228 779 --146 --
NM_017919chr975161 4898 4494 4403 2253 2074 1258 15579 15211 --
NM_017933chr251611 1034 1021 352 315 ------
NM_017938chrX31453 731 592 21896 1704 ----
NM_017944chr1132061 817 725 22542 1208 ----
NM_017946chr731360 275 31 ------
NM_017957chr1731542 1404 429 21208 412 ----
NM_017969chr2131 ------
NM_017988chr121701 ------
NM_017994chr742960 2360 790 634 1836 ----
NM_018013chr642594 2152 1941 29 --12358 --
NM_018026chr1141261 490 124 21 11441 2967 457 --
NM_018027chr1053307 2946 1294 864 142 --22256 1208 --
NM_018028chr194916 533 176 127 11049 ----
NM_018030chr184966 841 802 117 ------
NM_018043chr1141501 1061 131 80 ------
NM_018045chr162919 2753 2276 2221 592 557 --31239 1221 906 --
NM_018047chr51819 145 ----
NM_018048chr1242075 2032 1505 1446 11284 ----
NM_018054chr16130 ------
NM_018061chr141744 1658 703 679 1562 ----
NM_018062chr2--1371 ----
NM_018063chr10186 ------
NM_018078chr411074 ------
NM_018079chr21474 1110 ----
NM_018084chr263305 2994 2853 2323 1188 711 ------
NM_018086chr231341 319 254 ------
NM_018092chr1611071 ------
NM_018094chrX167 ------
NM_018095chr112226 32 ------
NM_018098chr311149 31082 247 51 ----
NM_018107chr145855 808 800 60 49 ------
NM_018115chr42227 22 1307 ----
NM_018116chr12454 211 ------
NM_018120chr81572 11103 ----
NM_018121chr1053016 2313 1941 709 124 1576 ----
NM_018126chr411332 --1429 --
NM_018128chr172480 223 ----11308
NM_018133chr32649 25 ------
NM_018137chr121056 944 1906 ----
NM_018144chr101344 1321 ----
NM_018155chr333480 3216 1348 --13152 --
NM_018157chr1262491 1189 898 505 185 126 ------
NM_018171chr123882 665 271 ------
NM_018178chr14812 774 667 204 ------
NM_018182chr1752200 2178 1960 540 480 ------
NM_018184chr331431 1397 322 --11559 --
NM_018195chr1122172 2112 11496 ----
NM_018198chr161480 1313 994 912 597 393 ------
NM_018202chr11252 ------
NM_018203chr13706 247 47 ------
NM_018206chr162301 156 ------
NM_018211chr131859 1789 873 2518 77 ----
NM_018243chr443983 3560 2530 32 ----13030
NM_018247chr631016 915 886 12365 13107 --
NM_018254chr111829 ------
NM_018263chr272447 1798 1724 878 843 535 237 --22621 451 --
NM_018266chr33944 722 418 ------
NM_018270chr202912 603 ------
NM_018272chr121210 ------
NM_018293chr321021 702 11179 ----
NM_018299chr832736 2436 66 ----1402
NM_018307chr172389 351 ------
NM_018312chr111102 --2862 50 --
NM_018313chr332459 1876 530 ------
NM_018315chr411570 ------
NM_018319chr142131 82 1557 ----
NM_018320chr1161241 1029 846 464 441 403 --1118 --
NM_018327chr2011309 --1446 --
NM_018330chr1011588 --1536 --
NM_018332chr1631386 1142 226 --11291 --
NM_018339chr921425 27 ------
NM_018348chr161153 1122 ----
NM_018351chr1274389 4297 4254 3957 3209 1130 762 13780 --13691
NM_018361chr883764 3559 3471 3385 2902 1109 973 587 ------
NM_018362chr1123879 882 ------
NM_018364chr123686 681 13209 ----
NM_018367chr111452 12210 ----
NM_018370chr1252229 1967 707 469 24 ------
NM_018371chr831384 1289 978 11493 ----
NM_018372chr1--1539 ----
NM_018374chr795080 4668 3174 1517 1288 589 561 407 168 --12108 --
NM_018375chr1431259 675 327 1591 2503 73 --
NM_018383chr221800 1421 ------
NM_018388chrX21344 1175 ------
NM_018400chr1194257 4130 3634 3601 3447 3033 1028 517 138 --34102 3016 2913 --
NM_018403chr323764 899 ------
NM_018412chr71107 --122 --
NM_018424chr921622 595 1558 127 --
NM_018440chr858682 8453 7695 5308 335 28483 5279 36311 5612 376 --
NM_018442chr1--125 ----
NM_018445chr151226 ------
NM_018448chr122824 112 --1907 --
NM_018452chr6_random22714 141 12793 ----
NM_018462chr33827 675 275 ------
NM_018465chr9--1164 ----
NM_018469chr1731296 356 148 21463 1117 ----
NM_018482chr821892 247 ------
NM_018488chr172766 517 ------
NM_018489chr131684 1474 615 ------
NM_018490chr1121873 115 ------
NM_018509chr1761684 1487 1291 1190 654 442 ------
NM_018566chr132037 1515 581 --14662 --
NM_018569chr41299 11640 ----
NM_018571chr22521 140 ------
NM_018584chr1------1380
NM_018638chr1295496 4394 3987 3674 3496 3469 2216 1125 561 11148 ----
NM_018640chr1232802 2714 2361 ----12531
NM_018649chr101495 ------
NM_018650chr132101 1497 633 11668 ----
NM_018652chr15139 --1186 --
NM_018657chr31116 --187 --
NM_018660chr842646 1990 305 21 1145 12367 --
NM_018667chr163849 700 232 1618 ----
NM_018684chrX31341 1027 488 11141 2964 240 --
NM_018685chr73757 379 184 31164 1110 59 ----
NM_018689chr1552236 2024 392 341 235 --32419 2271 1039 1184
NM_018693chr21115 ------
NM_018695chr532302 1928 1687 ------
NM_018698chrX31924 497 269 11529 11684 --
NM_018700chr531402 666 106 11600 ----
NM_018703chr16--1117 ----
NM_018704chr13826 696 324 1318 --1747
NM_018708chr1931407 1063 584 11689 1234 --
NM_018710chr831285 98 59 ------
NM_018712chr1121505 1268 ------
NM_018713chr12764 195 ------
NM_018718chr762074 1793 637 601 531 413 ------
NM_018834chr5------1363
NM_018841chr133317 485 218 ------
NM_018846chr7------1627
NM_018847chr931726 452 346 ------
NM_018890chr71291 1115 ----
NM_018898chr51214 --127 --
NM_018899chr51214 --127 --
NM_018900chr51214 --127 --
NM_018901chr51214 --127 --
NM_018902chr51214 --127 --
NM_018903chr51214 --127 --
NM_018904chr51214 --127 --
NM_018905chr51214 --127 --
NM_018906chr51214 --127 --
NM_018907chr51214 --127 --
NM_018908chr51214 --127 --
NM_018909chr51214 --127 --
NM_018910chr51214 --127 --
NM_018911chr51214 --127 --
NM_018944chr21123 ------
NM_018945chr632858 639 94 22641 581 32944 224 143 --
NM_018948chr121135 565 ------
NM_018952chr171197 ------
NM_018970chr752924 2647 2482 1176 634 --13178 --
NM_018975chr162774 104 ------
NM_018976chr1231883 802 258 ------
NM_018979chr1242278 397 267 180 11062 --12636
NM_018993chr201384 1319 ----
NM_018999chr1034734 419 239 ------
NM_019000chr511372 ------
NM_019001chr344050 3337 1786 312 33682 3441 717 ----
NM_019004chr722335 709 187 ----
NM_019005chr7----192 --
NM_019008chr2242920 2785 856 293 12908 33450 1455 626 13161
NM_019022chr184920 766 700 589 12971 ----
NM_019027chr41757 11976 11686 --
NM_019028chr11--1436 ----
NM_019045chrX--1701 ----
NM_019046chr101986 --1699 --
NM_019053chr103765 697 21 --1315 --
NM_019058chr101765 ------
NM_019063chr241671 1443 748 389 ------
NM_019071chr7------1112
NM_019072chr543542 3526 3417 2849 24230 3248 1745 --
NM_019084chr1052095 1933 1927 1767 933 22600 746 11753 12493
NM_019096chr64961 854 843 128 --1300 --
NM_019098chr811858 1490 ----
NM_019106chr2273009 2768 2586 2391 2239 323 35 13399 33253 2970 2570 1690
NM_019114chr951573 1557 1009 486 77 ------
NM_019116chr1623197 1086 ----1902
NM_019555chr321696 366 31412 516 251 ----
NM_019558chr2--1319 ----
NM_019590chr10--1219 11270 --
NM_019593chr2032628 535 335 1376 12851 1572
NM_019595chr22542 484 ------
NM_019597chrX3296 133 28 ------
NM_019600chr152216 30 1310 1662 --
NM_019610chr121508 293 --1434 --
NM_019862chr1611677 1606 ----
NM_019884chr192488 26 ------
NM_019885chr23975 216 170 12945 ----
NM_019891chr1169 1953 ----
NM_019895chr31142 1161 ----
NM_019898chr1611677 1606 ----
NM_019899chr1611677 1606 ----
NM_019900chr1611677 1606 ----
NM_019903chr1011271 ------
NM_020066chr11897 ------
NM_020116chr42662 200 21506 53 ----
NM_020122chr265189 4866 4381 3660 1843 107 2273 129 25881 2085 1170
NM_020123chr1021384 404 21223 1195 ----
NM_020132chr2185125 5105 4861 3820 3187 1282 581 559 11336 34481 1958 1835 --
NM_020133chr666141 5653 5619 5012 4781 2090 34816 4763 2221 54772 4173 4009 1895 545 26157 2162
NM_020137chrX1345 ------
NM_020141chr141986 1859 839 430 ------
NM_020142chr125580 163 90 63 54 ------
NM_020143chr21123 1174 ----
NM_020145chr92578 119 ----168
NM_020147chr152375 52 --1846 --
NM_020151chr251811 1789 590 154 60 ------
NM_020155chr11------1107
NM_020159chr41175 154 ----
NM_020163chr332151 2016 361 ------
NM_020177chr553366 2356 1327 1002 88 1228 ----
NM_020178chr1761215 1012 995 311 191 114 ------
NM_020193chr112917 882 ------
NM_020194chr22639 183 ------
NM_020198chr1731585 1077 140 ------
NM_020200chr10199 3978 363 348 ----
NM_020204chr12804 160 ------
NM_020205chr133356 3250 2891 13133 ----
NM_020208chr332348 1008 937 12627 32694 1143 23 --
NM_020214chr151174 ------
NM_020226chr42238 125 1186 --1560
NM_020228chr1152509 2231 2082 905 783 1104 ----
NM_020231chr31591 ------
NM_020239chr161866 1437 524 512 169 42 --11888 --
NM_020240chr572291 2186 2021 1775 848 678 667 ----12285
NM_020245chr6103823 3722 3185 1737 1386 1080 1045 957 826 686 15001 ----
NM_020248chr122065 1925 --22100 151 --
NM_020309chr1931093 389 43 --149 --
NM_020336chr2062776 2768 2445 1346 767 99 --23182 488 --
NM_020337chr421945 1111 12982 1768 11024
NM_020338chr1093202 3062 2764 2714 1426 1068 913 695 643 11370 ----
NM_020341chr201767 ------
NM_020342chr2--22649 2356 ----
NM_020344chr9----1164 --
NM_020346chr113615 372 211 ----1200
NM_020357chr31626 ------
NM_020360chr173627 191 138 ------
NM_020384chrX41775 1707 528 281 ------
NM_020390chr323860 948 13413 ----
NM_020403chr1311324 ------
NM_020416chr451759 905 820 376 300 ------
NM_020429chr782870 2566 2545 2252 2176 1152 1096 219 1890 12416 --
NM_020432chr721514 815 1868 ----
NM_020438chr931253 1132 1063 ------
NM_020444chr52976 49 11227 ----
NM_020455chr662805 2529 2222 2052 584 73 1432 22542 2165 --
NM_020456chr1321565 359 --12044 --
NM_020463chr2--1477 ----
NM_020466chr674178 3855 3384 1414 1358 725 613 13679 1916 --
NM_020473chrX51328 627 494 373 198 1134 1232 1646
NM_020474chr181639 ------
NM_020475chr852448 2431 1648 571 508 11676 1603 --
NM_020476chr852448 2431 1648 571 508 11676 1603 --
NM_020477chr852448 2431 1648 571 508 11676 1603 --
NM_020478chr852511 2494 1711 634 571 11739 1666 --
NM_020480chr852448 2431 1648 571 508 11676 1603 --
NM_020525chr121174 ------
NM_020526chr151751 1669 1275 606 290 ------
NM_020546chr552068 1979 846 744 188 12992 12882 --
NM_020644chr111745 ------
NM_020647chr861848 1501 929 556 517 329 12159 ----
NM_020651chr211590 ------
NM_020654chr31552 ------
NM_020655chr161151 ------
NM_020673chr2096830 6368 6269 5817 5068 2547 2517 1163 1068 ----11619
NM_020676chr32620 72 ------
NM_020686chr1632869 989 730 185 11985 --
NM_020689chr2051674 1490 1483 1111 130 11291 ----
NM_020690chr5--1334 ----
NM_020697chr831079 510 223 11233 ----
NM_020699chr195008 3874 3369 1820 1808 1673 744 484 222 21917 582 --1418
NM_020708chr2032111 370 355 11811 --12160
NM_020713chr2052666 2466 1044 577 142 ------
NM_020717chrX104852 3913 3777 3295 3065 1874 646 464 404 340 11666 34235 3710 3553 24529 4155
NM_020718chr16126304 5425 5308 5148 4369 2039 1941 1887 1876 1864 804 582 --11739 --
NM_020728chr782780 2347 2263 2117 2075 1998 1140 785 ------
NM_020732chr6--1267 1126 --
NM_020734chr1263136 3031 2489 2466 2249 733 ------
NM_020739chr1533713 1601 423 21337 948 ----
NM_020742chrX1278 11932 143 --
NM_020748chr1712172 ------
NM_020749chr841756 1634 1534 1286 22124 266 11826 --
NM_020752chr1012006 12821 ----
NM_020754chr331390 1380 557 11395 21107 147 --
NM_020755chr6129 1447 ----
NM_020760chr21449 --11831 --
NM_020762chr1271027 811 762 707 288 267 235 ------
NM_020766chrX63435 3374 3246 1284 797 762 ----13133
NM_020768chr543042 2478 909 872 1486 ----
NM_020769chrX3785 122 71 ------
NM_020772chr1788227 6859 6716 3422 2889 2262 1761 487 27131 2831 --28370 404
NM_020778chr15104242 1910 1898 1547 1255 829 775 651 526 120 --11918 --
NM_020791chr1711399 --1459 --
NM_020792chr341882 1713 988 98 --11960 --
NM_020794chr111595 ------
NM_020801chr51237 1832 ----
NM_020802chr1133325 2419 1189 ------
NM_020805chr181457 11376 ----
NM_020806chr141752 ------
NM_020808chr13833 793 117 --1133 --
NM_020809chr1162311 1977 1924 844 683 305 ------
NM_020810chr1452439 747 727 352 326 --11112 --
NM_020818chr142399 302 ------
NM_020819chr611127 141 ----
NM_020821chr1531554 205 64 11400 ----
NM_020824chr101485 ------
NM_020825chr1643612 3567 1416 1397 ------
NM_020830chr242423 591 530 373 --1106 --
NM_020839chr3----1428 --
NM_020841chr1232969 2682 523 13693 13815 --
NM_020845chr1252251 1882 1010 739 372 --2953 254 --
NM_020850chr16102931 2814 2789 2554 2044 1251 1163 1025 850 113 --32759 679 181 --
NM_020854chr1811348 11381 1547 --
NM_020856chr1921225 122 11049 ----
NM_020858chr1541504 967 403 303 --22016 1621 --
NM_020859chr443769 2902 2890 2622 --1527 12984
NM_020860chr42838 66 ------
NM_020865chr3144 ------
NM_020870chr422193 1436 ------
NM_020871chrX21807 1033 12555 ----
NM_020886chr112306 25 ------
NM_020898chr124304 69 51 35 ------
NM_020899chr1721688 452 --1312 --
NM_020918chr10----1464 11035
NM_020921chr1483588 3293 1328 810 792 601 178 21 22739 636 22282 1240 --
NM_020922chrX21679 1204 ------
NM_020924chr92351 155 ------
NM_020935chr253989 3944 2978 1752 1287 1497 1425 --
NM_020940chr1032464 2224 1177 12650 ----
NM_020946chr931529 1498 79 11756 ----
NM_020947chr1632025 1593 591 12118 21951 1529 --
NM_020948chr142732 2718 899 275 --23500 3018 --
NM_020952chr91879 ------
NM_020958chr14121 ------
NM_020959chr19147 ------
NM_020962chr1571821 1684 934 905 632 453 166 ------
NM_020964chr18124621 4431 3313 3069 3044 1078 810 728 577 399 347 265 --1282 --
NM_020967chr201921 --155 --
NM_020971chr191703 --1216 --
NM_020983chr1222026 877 ------
NM_020987chr1021345 1233 ------
NM_020993chr1252805 2600 720 533 316 1201 1527 --
NM_021005chr151996 ------
NM_021007chr22874 578 --1265 --
NM_021019chr121182 ------
NM_021020chr853118 2241 937 763 105 --12890 --
NM_021032chr312025 3402 235 142 ----
NM_021033chr1322676 67 12509 1368 --
NM_021038chr353212 3194 3169 1348 773 43109 2346 1127 298 ----
NM_021047chr191264 ------
NM_021061chr841818 1125 148 26 1418 13915 --
NM_021072chr52219 56 ------
NM_021097chr252688 2037 803 171 98 ----22112 895
NM_021111chr96955 437 324 286 62 39 11283 ----
NM_021120chrX42982 738 238 218 ------
NM_021132chr1011083 1940 ----
NM_021136chr143720 513 69 ------
NM_021140chrX2762 174 ------
NM_021145chr71274 --1831 --
NM_021148chr732328 862 714 11554 ----
NM_021149chr1621207 200 11051 ----
NM_021159chr431606 1139 93 ------
NM_021160chr61164 ------
NM_021161chr14----1503 --
NM_021180chr11784 --1605 --
NM_021183chrX52173 1908 1651 719 235 1360 --1380
NM_021184chr64743 676 653 271 ------
NM_021189chr13946 909 755 ------
NM_021202chr2071988 1913 904 836 431 243 200 --22259 184 --
NM_021215chr2031548 278 244 ------
NM_021218chr9162 --1917 --
NM_021235chr192149 27 ------
NM_021239chr143504 424 209 21088 344 ----
NM_021240chr9--1494 ----
NM_021242chrX2691 282 --1759 --
NM_021249chr1461389 670 453 325 243 234 ------
NM_021252chr10--21855 246 1148 --
NM_021622chr10--1889 --11760
NM_021627chr331021 475 356 1465 1998 --
NM_021633chr121032 506 ----11230
NM_021637chrX41046 383 331 206 ------
NM_021639chr13358 235 109 ------
NM_021643chr24570 292 277 268 1480 ----
NM_021647chr484684 4537 3982 3034 1717 1032 517 128 ------
NM_021648chr621004 181 --1750 --
NM_021705chr631224 389 301 --1124 --
NM_021738chr10--1255 1211 --
NM_021813chr685756 4946 4754 3797 2206 1877 984 857 25795 1187 24925 1295 15237
NM_021814chr6--11635 11351 --
NM_021815chr263012 2231 2162 1242 1083 439 12266 1267 --
NM_021818chr1421445 554 ------
NM_021911chr544322 3474 1592 1345 24294 1009 1285 --
NM_021912chr1533379 1237 510 13622 ----
NM_021914chr142976 435 ------
NM_021931chr2051064 733 284 265 255 ------
NM_021940chr61493 21467 1040 ----
NM_021943chr63774 546 444 ----1676
NM_021947chr171905 11113 1881 --
NM_021949chrX52482 2465 2258 333 271 --2107 48 1468
NM_021956chr61604 --1491 --
NM_021958chr12310 131 ------
NM_021961chr1177351 6324 5936 5430 2917 1931 1271 36791 6007 4866 15610 15413
NM_021964chr394559 4054 4022 2530 2441 2396 2024 927 358 --15410 --
NM_021967chr531010 218 83 ----1129
NM_021973chr42565 97 --1522 --
NM_021977chr673243 3047 3013 2882 2388 1387 539 12944 43889 3235 2718 447 --
NM_021980chr102538 305 190 1944 --
NM_021984chrX1124 --2290 186 --
NM_021987chrX1124 --2290 186 --
NM_021988chr2031333 621 582 ----1131
NM_021990chrX1124 --2290 186 --
NM_021994chr72754 178 ------
NM_021998chrX51494 1238 445 434 387 11137 ----
NM_022037chr22679 277 ------
NM_022041chr1642101 1082 789 92 --12613 --
NM_022048chr15115130 4900 4451 4226 4057 3961 1694 1001 967 551 300 --1868 --
NM_022060chr147437 378 317 258 73 66 43 1849 ----
NM_022066chr17160 ------
NM_022080chr2021802 344 ----11999
NM_022085chr611269 --11367 --
NM_022090chr51506 ------
NM_022093chr12990 693 --1765 --
NM_022114chr144467 3933 3882 103 1406 11331 --
NM_022123chr141133 ------
NM_022130chr531379 230 22 --11029 --
NM_022133chr821741 1662 11421 ----
NM_022156chr17175 ------
NM_022166chr16115794 5028 4937 4289 4265 4250 2385 2227 2129 2078 1905 15490 23909 1961 --
NM_022169chr1141344 1216 612 249 11251 1360 --
NM_022170chr731710 600 90 21702 1540 ----
NM_022173chr22679 277 ------
NM_022334chr2----61047 796 740 404 348 292 --
NM_022336chr241943 848 715 420 --1247 --
NM_022351chr863251 3179 2852 2534 1353 475 --13048 --
NM_022373chr71251 ------
NM_022374chr2144 ------
NM_022405chr332348 1008 937 12627 32694 1143 23 --
NM_022442chr2031333 621 582 ----1131
NM_022454chr82782 163 ------
NM_022459chr1365426 5063 3998 1490 1441 1109 --24543 1385 --
NM_022461chr331296 1022 38 --11265 --
NM_022462chr1963536 3319 3290 3249 3196 681 12588 12410 --
NM_022469chr14946 906 611 485 ------
NM_022473chr1544178 3223 678 72 --23416 1705 --
NM_022474chr1442378 1857 769 542 2670 405 ----
NM_022475chr42564 198 ------
NM_022476chr162797 298 ------
NM_022477chr2031692 192 52 ------
NM_022494chr102173 88 ------
NM_022497chr342562 2491 616 389 ------
NM_022557chr171200 ------
NM_022566chr151392 ------
NM_022572chr271646 1476 1186 619 580 306 30 11779 21434 480 --
NM_022648chr284599 3774 3703 3659 3646 3640 1554 75 ----1635
NM_022650chr5------1774
NM_022652chr121182 ------
NM_022658chr123252 183 119 ------
NM_022716chr142730 942 258 221 --12324 --
NM_022726chr61326 21294 466 ----
NM_022728chr7132 1565 1786 --
NM_022730chr23732 177 25 --1755 --
NM_022733chr141110 1007 156 28 1275 ----
NM_022735chr11174 11229 ----
NM_022739chr171224 1308 ----
NM_022748chr742246 1795 1018 81 --12668 --
NM_022756chr131492 1349 1159 ------
NM_022758chr653059 2475 410 288 243 ------
NM_022763chr32533 498 ------
NM_022771chr121321 ------
NM_022776chr321231 436 ------
NM_022777chr71159 --31677 1415 1153 --
NM_022780chr211613 1248 ----
NM_022783chr81275 1521 ----
NM_022802chr10126 1666 ----
NM_022818chr1641417 1228 614 190 --1431 --
NM_022821chr12389 185 1481 ----
NM_022823chr22447 111 ------
NM_022824chr551824 493 438 336 35 ------
NM_022826chr221178 808 ------
NM_022831chr131653 1367 286 --21266 44 --
NM_022832chr462453 2411 2130 786 172 108 --1279 --
NM_022840chr185573 561 526 358 49 ------
NM_022841chr1532294 1818 990 ------
NM_022845chr1621754 306 11858 ----
NM_022893chr252189 2107 84 55 27 12998 ----
NM_022894chr251629 1433 487 318 61 ------
NM_022898chr1444277 3179 1518 696 1493 13868 11586
NM_022901chr931378 103 45 ------
NM_022918chr1121492 554 1322 ----
NM_022970chr103989 354 96 --11356 --
NM_022978chr531010 218 83 ----1129
NM_023000chr142610 281 185 ----
NM_023001chr142610 281 185 ----
NM_023008chr19--1278 1251 --
NM_023009chr11703 1509 ----
NM_023010chrX--1849 ----
NM_023016chr262449 2062 772 668 326 226 11872 ----
NM_023033chr121547 ------
NM_023035chr191537 1837 ----
NM_023037chr1331085 978 66 1377 1216 --
NM_023039chr52341 324 ------
NM_023071chr1221108 124 --1865 --
NM_023076chr1632023 1121 76 ------
NM_023079chr1731720 1650 1638 1431 1222 132
NM_023105chr831957 1682 236 --1160 12425
NM_023106chr831957 1682 236 --1160 12425
NM_023110chr831957 1682 236 --1160 12425
NM_023111chr831957 1682 236 --1160 12425
NM_023923chr163535 3348 3046 2965 1083 279 1582 23285 2412 --
NM_023925chr12--1252 ----
NM_023927chr521302 1184 1871 ----
NM_023929chr862746 2065 665 390 322 231 --1408 --
NM_023930chr115870 834 798 162 143 ------
NM_023940chr42902 216 1295 1970 --
NM_023948chr72156 121 ------
NM_024007chr542523 1049 720 267 ------
NM_024015chr171874 ------
NM_024017chr1731733 630 48 --1449 --
NM_024019chr42910 188 ------
NM_024040chr101135 ------
NM_024050chr192518 130 ------
NM_024052chr1742621 1945 725 307 ----11069
NM_024055chr52655 633 ------
NM_024061chr71153 ------
NM_024085chr21934 ------
NM_024090chr431949 1290 242 ------
NM_024107chr17155 ------
NM_024117chr921320 440 ------
NM_024294chr653059 2475 410 288 243 ------
NM_024295chr851695 1471 633 395 24 2191 64 ----
NM_024306chr164778 748 231 201 --2767 69 --
NM_024320chr171167 ------
NM_024328chr144253 184 148 53 --1275 --
NM_024332chrX31309 1217 679 11348 ----
NM_024341chr1973553 3343 1178 966 641 278 27 24128 944 ----
NM_024416chr941451 1007 538 446 ------
NM_024423chr1844119 2770 2762 78 12600 23731 340 --
NM_024430chr1851752 314 293 245 217 ------
NM_024490chr151459 ------
NM_024494chr13644 619 227 --1550 --
NM_024501chr22284 204 ------
NM_024511chr482953 2785 2746 2381 830 605 346 164 ------
NM_024520chr2--189 ----
NM_024522chr151568 1527 402 332 103 ----11803
NM_024524chr353172 3158 2005 1202 223 --12192 --
NM_024525chr11535 --1257 --
NM_024546chr132891 391 ------
NM_024548chr331619 1490 293 ----131
NM_024561chr1311222 11291 ----
NM_024574chr4176 --1332 --
NM_024582chr421077 914 149 ----
NM_024595chr13934 776 767 2292 116 ----
NM_024602chr1------1652
NM_024612chr1751130 987 973 962 829 ------
NM_024613chr841355 1282 666 178 ------
NM_024615chr5--1231 ----
NM_024617chr92735 52 --2578 35 --
NM_024624chr221320 603 ------
NM_024631chr11----150 --
NM_024639chr632745 253 186 ------
NM_024643chr142146 122 ------
NM_024645chr831458 1371 989 1622 11391 --
NM_024646chr143583 2562 1211 1118 --23331 2903 --
NM_024665chr354569 3353 2981 2943 89 11882 ----
NM_024666chr1531465 361 326 1301 163 1426
NM_024670chr1031432 454 429 --11686 --
NM_024674chr152874 2241 645 587 475 12414 ----
NM_024704chr201891 1992 ----
NM_024713chr1511150 1441 ----
NM_024721chr81898 ------
NM_024722chr172569 543 185 ----
NM_024750chr3----1529 --
NM_024757chr911049 --1818 --
NM_024759chr83660 335 185 ------
NM_024761chr9104662 4376 4156 3450 3365 1301 1081 1067 591 99 14529 2381 155 24101 2080
NM_024770chr275646 5615 5137 2300 2084 1518 1395 42610 2481 1929 276 1814 16507
NM_024779chr1271351 1314 1205 1164 1025 563 393 1509 ----
NM_024785chr231501 566 485 11528 ----
NM_024792chr1721134 1002 --2384 50 --
NM_024798chr1532385 489 424 ----1139
NM_024811chr1121649 504 11830 ----
NM_024812chr842161 1991 1804 1578 1477 ----
NM_024817chr1575376 4850 4774 2353 1982 891 584 --24465 1976 --
NM_024828chr91625 ------
NM_024834chr101448 ----1560
NM_024835chr172358 37 ------
NM_024837chr152508 229 21841 118 ----
NM_024850chr52779 48 ------
NM_024854chr1231437 1072 348 ------
NM_024887chr13721 54 23 ------
NM_024899chr181487 ------
NM_024900chr441711 892 488 269 ------
NM_024900chr441711 892 488 269 ------
NM_024909chr631387 620 528 --21562 1117 --
NM_024939chr1621401 1215 --1161 --
NM_024947chr376823 6785 6458 6069 2358 1332 93 ----26507 2486
NM_024953chr123606 587 220 --1744 --
NM_024960chr20--178 ----
NM_024969chr2----1588 --
NM_024971chr91879 ------
NM_024989chr277563 7482 7251 5375 5117 5089 2693 27834 2521 15930 --
NM_024991chr1071287 1024 759 601 277 253 52 1545 ----
NM_024993chr231307 1101 645 1214 ----
NM_025004chr11----1550 --
NM_025054chr863686 2749 2708 1496 1480 530 11272 --13501
NM_025057chr1441261 1107 1097 214 21268 1166 ----
NM_025073chr194509 3803 1135 1106 1049 887 722 496 209 14658 --21605 64
NM_025083chr1541998 1759 1583 638 --1500 --
NM_025099chr173376 239 122 ------
NM_025104chr1731324 1176 333 --21699 136 --
NM_025140chr123554 247 121 ------
NM_025146chr322566 481 --12213 --
NM_025147chr221101 958 1384 ----
NM_025154chr721282 984 11087 ----
NM_025160chr164277 3677 3560 1077 331 263 ------
NM_025164chr1141953 1830 580 440 --11851 --
NM_025179chr174719 4283 3646 3392 1278 1113 476 --13027 --
NM_025180chr3103190 2723 2682 2208 1394 1291 1220 1153 582 225 --1439 13062
NM_025182chr95926 919 427 410 327 ------
NM_025187chr161475 ------
NM_025195chr841300 687 519 502 ------
NM_025208chr1132326 2142 1980 11798 ----
NM_025216chr22477 464 --1195 --
NM_025221chr4174 --2958 350 --
NM_025224chr2062111 2080 1775 833 703 92 ------
NM_025235chr1021873 224 11461 ----
NM_025236chr64644 278 201 93 --175 1271
NM_025237chr172546 286 11488 11134 --
NM_025248chr1783194 2260 2080 1299 552 330 94 43 --1613 --
NM_025263chr64743 537 390 137 --11900 --
NM_030594chr1521256 867 ------
NM_030621chr1434147 2596 2581 11355 ----
NM_030623chr241602 1429 518 313 1668 1134 --
NM_030625chr1042533 2412 2105 278 1809 22086 2078 --
NM_030627chr534006 961 797 ------
NM_030647chr756254 2419 1747 1612 23 11706 1168 --
NM_030648chr474970 3633 2203 1896 1127 542 169 13440 --12219
NM_030650chr22266 76 23754 3110 24178 3654 --
NM_030664chr1061997 1812 1737 1539 188 53 12014 ----
NM_030665chr1731421 1064 313 ------
NM_030674chr1255640 4086 1742 1699 75 ----14559
NM_030751chr102687 382 ------
NM_030751chr102687 382 ------
NM_030755chr1442625 2468 829 143 --11002 --
NM_030758chr2231266 438 100 166 ----
NM_030759chr101190 --1541 --
NM_030761chr162639 2559 2219 1762 1693 705 22001 1049 1276 --
NM_030767chr942721 2096 1906 454 ------
NM_030784chr6179 ------
NM_030786chr141809 1396 1234 453 --1694 --
NM_030802chr172127 22 ------
NM_030806chr1109043 8899 8612 8346 8055 6542 6215 6165 2068 1059 18001 38354 8121 790 25886 1114
NM_030809chr12132 ------
NM_030810chr611269 --11367 --
NM_030816chr133103 1158 644 23580 1171 33681 3489 2633 --
NM_030820chr62800 326 1707 ----
NM_030881chr2252173 2104 1901 1654 634 ------
NM_030885chr321810 750 ------
NM_030912chr102588 312 ------
NM_030915chr262410 2068 860 683 493 482 ------
NM_030918chr1115426 5401 5073 4932 4825 3822 3681 3615 3353 2153 1661 ------
NM_030920chr131909 816 806 ------
NM_030937chr141450 1184 354 347 1370 ----
NM_030939chr631137 326 71 ------
NM_030940chr921207 193 --11420 --
NM_030949chr6--21517 279 ----
NM_030952chr111298 --1392 --
NM_030963chr6176 ------
NM_030964chr542724 526 516 122 --1808 --
NM_030971chr1021325 75 11637 ----
NM_030979chr131382 ------
NM_030981chr1171176 1125 948 847 840 793 201 ------
NM_031157chr121143 ------
NM_031216chr182357 322 ------
NM_031226chr1541251 503 100 23 1391 ----
NM_031243chr711781 ------
NM_031266chr51147 ------
NM_031283chr22644 100 ------
NM_031305chr411941 1359 1635 --
NM_031306chr12859 52 --1361 --
NM_031314chr1421708 342 --11535 1818
NM_031371chr1151 41374 1185 144 32 ----
NM_031371chr1151 41374 1185 144 32 ----
NM_031372chr411230 11529 ----
NM_031411chr51214 --127 --
NM_031412chr1241128 915 908 815 ------
NM_031417chr1941940 737 594 148 1727 1438 --
NM_031418chr1152409 1073 1043 658 396 12823 11847 --
NM_031419chr321292 34 --11608 --
NM_031427chr1495829 5705 4303 3912 1904 1693 751 657 126 44658 4116 2312 1924 15559 --
NM_031431chr1321782 1333 11689 ----
NM_031435chr1252359 2126 1338 747 69 1396 --12158
NM_031438chr52523 50 --1581 --
NM_031442chrX33128 2667 2643 ------
NM_031444chr2252541 2256 2169 384 199 --162 --
NM_031445chr242087 1289 850 671 ------
NM_031453chr1052438 2317 1935 467 345 22069 587 1715 --
NM_031457chr112370 353 1344 ----
NM_031469chr653710 3256 370 238 53 13161 ----
NM_031476chr1652646 2499 2081 647 403 ----11906
NM_031483chr2053478 3171 3163 2365 1253 --1166 --
NM_031492chr113588 539 208 1421 ----
NM_031844chr133991 3632 2663 ------
NM_031845chr222637 2597 --13252 --
NM_031847chr222637 2597 --13252 --
NM_031849chr51214 --127 --
NM_031857chr51214 --127 --
NM_031860chr51214 --127 --
NM_031866chr101172 ------
NM_031890chr2292627 2464 1903 1099 850 734 421 290 205 22188 2119 ----
NM_031892chrX2254 209 --1735 --
NM_031904chr1142105 1341 811 557 ------
NM_031939chr1821131 207 2886 352 ----
NM_031953chr4--1479 ----
NM_031990chr19165 ------
NM_031991chr19165 ------
NM_031992chr731710 600 90 21702 1540 ----
NM_032012chr943428 2119 2037 298 1230 25026 1600 --
NM_032013chr2031692 192 52 ------
NM_032017chr151593 1376 613 330 36 ------
NM_032027chr12282 89 ------
NM_032037chr19123 ------
NM_032041chr852608 2446 2165 2034 525 12386 ----
NM_032050chr223389 158 134 ----1677
NM_032052chr223543 519 168 ----11062
NM_032102chr1132424 2186 61 ------
NM_032104chr12566 43 ------
NM_032105chr1117669 7367 6795 6271 3155 2937 1280 1101 955 566 43 31601 1417 865 22351 1042 37171 5700 2826
NM_032120chr7--1129 ----
NM_032124chr1821180 248 ------
NM_032153chr352284 2156 1082 1064 773 11810 1399 --
NM_032156chr12--1252 ----
NM_032160chr1863572 2821 2752 789 464 50 23939 3025 13354 --
NM_032181chr21583 ------
NM_032182chr1071603 1486 1428 1402 1315 1120 1053 1606 ----
NM_032186chr11240 2508 458 ----
NM_032189chr1394332 4167 3836 3341 3304 2008 1643 447 219 1405 24287 673 --
NM_032192chr17164 --1235 --
NM_032199chr1043323 1507 251 51 23769 3466 ----
NM_032208chr223449 396 13495 22360 2290 --
NM_032211chr1011065 11165 1949 --
NM_032217chr421329 179 --11303 --
NM_032221chr2021271 177 --1312 --
NM_032226chr94724 693 250 134 1751 ----
NM_032228chr1111168 12312 ----
NM_032229chr13--1238 11170 --
NM_032231chr15--1323 ----
NM_032246chr1521110 1069 --1173 --
NM_032256chr12--1200 ----
NM_032271chr1651342 1156 500 291 174 ------
NM_032281chr191251 ------
NM_032291chr141768 1197 633 298 ----11499
NM_032293chr91279 ------
NM_032294chr1751693 1438 258 116 39 ------
NM_032299chr11199 ------
NM_032307chr91118 ------
NM_032312chr21783 1331 ----
NM_032320chr11281 34 ------
NM_032321chr222163 2098 32836 2689 441 12965 --
NM_032325chr1161915 601 487 438 336 25 ------
NM_032327chr102427 33 ------
NM_032352chr1421190 371 21298 1010 ----
NM_032373chr1054207 3775 1235 191 156 35618 4991 4781 --1714
NM_032375chr193785 120 64 ------
NM_032408chr731168 223 128 ------
NM_032410chr811251 ------
NM_032415chr72406 193 ------
NM_032420chr53618 76 63 ------
NM_032424chr1121088 435 ------
NM_032433chr1931343 1028 300 ------
NM_032434chr241401 1344 478 393 ------
NM_032438chr6--21638 140 ----
NM_032439chr104362 152 137 25 11540 ----
NM_032440chr101827 12161 ----
NM_032441chrX1125 ------
NM_032445chr15--21988 1618 2265 209 --
NM_032446chr563387 2720 2466 2404 790 81 --22854 1225 --
NM_032449chr142511 2096 649 566 31975 1045 51 --22277 63
NM_032452chr141220 ------
NM_032457chr463835 2585 705 628 240 129 --11547 --
NM_032458chrX--33440 779 690 --13099
NM_032466chr8--11421 ----
NM_032491chr124831 442 326 276 11315 11234 --
NM_032499chr152539 447 --1223 --
NM_032510chr1822438 885 --178 --
NM_032511chr6141 --1179 --
NM_032512chrX2716 61 ------
NM_032523chr21177 ------
NM_032536chr9----1123 --
NM_032538chr662377 2121 2104 1792 340 321 --1619 --
NM_032576chrY------1132
NM_032578chr1021553 1451 11225 1504 --
NM_032582chr1721825 1656 ------
NM_032588chr12457 424 ------
NM_032590chr1221112 828 ------
NM_032595chr1721212 1123 --11052 --
NM_032626chr161127 ------
NM_032632chr1421447 1244 ------
NM_032638chr32429 90 ------
NM_032646chr1711802 ------
NM_032682chr352778 2767 2431 2228 773 --12382 --
NM_032689chr192445 325 ------
NM_032711chr1784121 3399 3337 3096 2813 586 430 390 ------
NM_032737chr193568 226 188 ------
NM_032741chr67934 920 780 411 388 222 169 --1115 --
NM_032765chr51348 ------
NM_032778chr322810 2458 1624 ----
NM_032801chr1141819 148 108 90 --11961 --
NM_032808chr15171 ------
NM_032810chr1011023 ------
NM_032812chr101249 ------
NM_032826chr7124485 4358 4141 4101 3723 3691 3557 3380 3371 2050 1644 1164 13794 1238 12154
NM_032833chr121889 167 --1157 --
NM_032836chr191405 ------
NM_032839chr31115 ------
NM_032840chr122963 119 --2406 268 --
NM_032842chr71288 ------
NM_032846chr1451419 1367 1300 464 321 --31226 1116 611 --
NM_032857chr151184 ------
NM_032859chr1313381 --13257 13357
NM_032870chr61496 ------
NM_032873chr1174127 3113 1766 1366 1011 723 342 1133 --24243 3362
NM_032875chr174751 563 254 182 2756 650 ----
NM_032884chr1--1324 1251 --
NM_032892chr15159 ------
NM_032898chr3----1396 --
NM_032900chr1043305 3083 2944 320 2833 298 1163 --
NM_032905chr1011040 ------
NM_032906chr4----2609 167 --
NM_032924chr73898 781 737 ------
NM_032932chr17106141 5963 5850 5798 5601 1519 1095 751 403 92 --55673 5586 4758 4253 1021 --
NM_032949chr132547 38 ------
NM_032951chr7126 ------
NM_032953chr7126 ------
NM_032960chr131345 1137 306 11503 ----
NM_032961chr411095 1966 ----
NM_032967chrX6930 917 746 415 304 27 ------
NM_032968chrX23436 692 1927 ----
NM_032969chrX23436 692 1927 ----
NM_032971chrY5957 944 773 331 54 ------
NM_032972chrY5957 944 773 331 54 ------
NM_032973chrY23432 692 1927 ----
NM_032982chr742565 1974 856 423 1864 ----
NM_032995chr221650 1149 ------
NM_033014chr941451 1007 538 446 ------
NM_033017chr72642 605 11495 ----
NM_033018chrX3814 218 127 --1897 --
NM_033020chr143449 1325 1230 1113 11944 33382 1645 613 --
NM_033025chr19--1695 ----
NM_033027chr32751 316 ------
NM_033030chr241147 1060 281 137 ------
NM_033044chr12825 34 ------
NM_033102chr141010 1000 994 58 --1863 --
NM_033102chr141010 1000 994 58 --1863 --
NM_033116chr14160 ------
NM_033127chr12285 137 ------
NM_033129chr2051340 726 675 399 212 --22075 647 --
NM_033133chr1753704 3594 3515 2356 817 43779 2757 1159 106 33244 2665 226 --
NM_033135chr1132326 2142 1980 11798 ----
NM_033136chr521387 209 --21788 1615 --
NM_033137chr521387 209 --21788 1615 --
NM_033138chr722313 2190 ------
NM_033139chr722313 2190 ------
NM_033140chr722313 2190 ------
NM_033141chr1482133 1855 1847 1558 1416 880 312 158 ------
NM_033143chr441737 1457 1374 361 ------
NM_033150chr12173 --1117 --
NM_033157chr722313 2190 ------
NM_033181chr673112 2700 2672 1171 720 184 139 1175 --11257
NM_033201chr163852 816 298 ------
NM_033211chr521909 475 2382 309 ----
NM_033224chr747263 6894 2996 1988 --27766 4926 --
NM_033225chr83530 93 81 22242 297 --1158
NM_033226chr162178 160 --1451 --
NM_033244chr1551047 920 115 100 85 ------
NM_033290chrX43689 998 924 394 22812 1084 ----
NM_033300chr12988 330 ------
NM_033326chr1162313 1759 973 915 699 378 ------
NM_033331chr963331 3165 2964 2213 1191 907 ------
NM_033338chr10143 ----11045
NM_033339chr10143 ----11045
NM_033340chr101159 ----11161
NM_033360chr1274633 4540 4071 1791 1692 1269 699 ------
NM_033375chr1731294 1142 545 ----11306
NM_033387chr9102637 2449 2101 1740 1667 702 279 99 82 70 12295 22572 2120 --
NM_033389chr1724783 3620 ------
NM_033396chr112425 49 ------
NM_033402chr81503 ------
NM_033411chr6--1225 ----
NM_033419chr1711221 ------
NM_033421chr2041736 1347 559 409 ------
NM_033425chr1161373 1190 430 256 57 41 --12838 --
NM_033426chr1492958 2745 2315 2093 2019 1974 331 126 62 2562 554 11862 --
NM_033429chr1573299 3278 3074 627 536 364 329 22611 2310 ----
NM_033430chr424076 3729 43545 2572 1283 1174 ----
NM_033437chr424076 3729 43545 2572 1283 1174 ----
NM_033449chr541780 1368 349 174 ------
NM_033495chrX3979 926 198 ------
NM_033496chr102295 223 ------
NM_033497chr102295 223 ------
NM_033498chr102295 223 ------
NM_033500chr102295 223 ------
NM_033505chr285834 5450 4503 2258 1552 1029 679 360 11507 14544 --
NM_033516chr951577 1336 132 97 67 1366 ----
NM_033540chr311045 ------
NM_033542chr2031292 356 276 ------
NM_033546chr18----1155 --
NM_033551chr543410 2598 646 338 ------
NM_033624chr1241600 782 334 115 --11760 --
NM_033626chrX21682 118 --21359 1352 --
NM_033631chr183327 3050 2873 970 926 648 424 272 ----12454
NM_033632chr411570 ------
NM_033642chrX11127 11273 ----
NM_033644chr521943 860 --11885 --
NM_033645chr521943 860 --11885 --
NM_033656chr21105755 4868 4733 2021 1655 1270 1252 1217 506 189 ------
NM_044472chr11116 ------
NM_052827chr121118 1212 ----
NM_052840chr152578 152 ------
NM_052847chr1993795 3723 3493 2922 2660 1461 1025 284 87 ----11354
NM_052849chr152754 161 1697 ----
NM_052869chr1711802 ------
NM_052879chr1222824 31 1729 --1934
NM_052880chr222107 80 11205 ----
NM_052885chr1245001 3978 3220 812 ------
NM_052896chr121889 350 ------
NM_052897chr122698 110 --1118 --
NM_052900chr861717 1652 1517 582 467 226 --1480 --
NM_052901chr921634 1474 ------
NM_052904chr641381 1354 1097 471 1197 ----
NM_052907chr1223764 390 ----14049
NM_052918chr1052988 2918 901 661 289 12326 11148 --
NM_052936chrX1620 1672 --1762
NM_052937chr822119 896 ------
NM_052954chr213445 251 162 11675 165 --
NM_052966chr163254 1562 1438 1121 626 62 ----1986
NM_052978chr1421579 296 --1489 --
NM_052996chr1651716 1597 1392 681 464 11317 ----
NM_052997chr10155 1271 ----
NM_053001chr81347 ------
NM_053016chr9147771 7493 7245 7139 7059 6831 5971 5595 3160 2396 2038 1825 994 578 11206 47133 6474 2226 51 --
NM_053023chr1153062 2359 2227 2209 453 13076 ----
NM_053024chr311102 1273 ----
NM_053025chr351437 1127 494 339 328 21583 1178 ----
NM_053026chr351437 1127 494 339 328 21583 1178 ----
NM_053027chr351437 1127 494 339 328 21583 1178 ----
NM_053028chr351437 1127 494 339 328 21583 1178 ----
NM_053031chr351437 1127 494 339 328 21583 1178 ----
NM_053032chr351437 1127 494 339 328 21583 1178 ----
NM_053042chr452254 2116 1244 804 519 --1337 --
NM_053043chr7126442 5999 5782 5744 5666 5577 5565 5538 5252 1254 976 411 12361 44327 1926 1800 662 --
NM_053046chr191409 ------
NM_053056chr1132231 1004 813 ------
NM_053064chr1442808 1242 1220 115 --1800 --
NM_053279chr832583 1041 243 ------
NM_054016chr141272 170 47 39 --1657 --
NM_054016chr141272 170 47 39 --1657 --
NM_054016chr141272 170 47 39 --1657 --
NM_054033chr2--2568 448 ----
NM_054035chr172680 78 ------
NM_057089chr72406 337 ------
NM_057159chr911179 1417 ----
NM_057169chr1253056 1991 1267 903 183 11208 1959 --
NM_057170chr1253056 1991 1267 903 183 11208 1959 --
NM_057175chr452614 2565 2357 2107 900 ------
NM_057178chr1762432 2294 2073 2013 907 641 11056 22085 1912 --
NM_057749chr81133 ------
NM_058237chr14--11069 ----
NM_058241chr232309 520 311 ------
NM_058241chr232309 520 311 ------
NM_078470chr1072527 2427 2362 1908 690 676 632 ------
NM_078471chr1741190 1037 986 816 ------
NM_078481chr19189 1580 ----
NM_079420chr22260 99 ------
NM_079422chr22260 99 ------
NM_080415chr171926 ------
NM_080422chr182293 76 ------
NM_080423chr182293 76 ------
NM_080491chr1183325 3302 3038 3026 2410 822 638 106 13787 22967 202 --
NM_080546chr9----12138 --
NM_080597chr184966 841 802 117 ------
NM_080611chr20129 ------
NM_080617chr203875 829 47 ------
NM_080628chr2061008 989 974 967 180 90 ------
NM_080629chr111201 ------
NM_080630chr111201 ------
NM_080632chrX--1849 ----
NM_080672chr203386 157 58 ------
NM_080679chr62661 28 ------
NM_080680chr62661 28 ------
NM_080681chr62661 28 ------
NM_080717chr123317 296 288 21297 140 ----
NM_080723chr62547 410 ------
NM_080732chr191409 ------
NM_080737chrX11217 1306 ----
NM_080742chr62288 84 ------
NM_080743chr632166 946 722 1542 ----
NM_080744chr71641 --1181 --
NM_080759chr1322427 1030 21928 526 ----
NM_080760chr1322427 1030 21928 526 ----
NM_080832chrX31379 1257 253 1456 11246 --
NM_080867chr1465015 4585 3942 1912 693 74 1184 23113 520 --
NM_080927chr363257 1297 1033 967 691 664 --2933 530 --
NM_080928chr71306 ------
NM_130385chr1172243 2206 2131 1184 521 138 41 ------
NM_130391chr943312 2700 2394 804 ----12725
NM_130392chr943312 2700 2394 804 ----12725
NM_130393chr943312 2700 2394 804 ----12725
NM_130434chr1531029 836 120 1448 ----
NM_130435chr1062916 2528 2186 2163 903 818 ------
NM_130438chr212402 246 ------
NM_130439chr1032147 1975 1707 ------
NM_130439chr1032147 1975 1707 ------
NM_130440chr121529 1267 ------
NM_130459chr921622 55 ------
NM_130466chr1241500 718 454 254 ------
NM_130469chr144958 943 633 265 1780 ----
NM_130798chr15----1996 --
NM_130808chr3174 ------
NM_130809chr532939 2899 39 1226 1835 12874
NM_130838chr151405 ------
NM_130839chr151405 ------
NM_130847chr1175492 5115 5001 4558 3785 378 323 11643 11657 --
NM_133171chr2041046 510 216 61 --1322 --
NM_133172chr5188 ------
NM_133173chr5188 ------
NM_133174chr5188 ------
NM_133177chr121013 35 --1408 --
NM_133178chr121013 35 --1408 --
NM_133264chr1753959 2453 1532 853 70 ----13948
NM_133265chrX53643 3592 2269 674 470 ------
NM_133330chr441270 688 294 239 --1434 --
NM_133331chr441270 688 294 239 --1434 --
NM_133334chr485482 5245 5182 4903 2169 1796 204 55 --15862 16297
NM_133335chr441270 688 294 239 --1434 --
NM_133368chr16------138
NM_133369chr53916 908 216 --1210 --
NM_133372chr522362 1832 12776 ----
NM_133445chr973727 3663 3545 1455 371 365 179 --21106 1037 --
NM_133452chr1921154 933 ------
NM_133457chr72389 228 ------
NM_133476chr121915 --1329 --
NM_133478chr232546 1855 1566 --188 --
NM_133499chrX3948 668 80 1645 1297 --
NM_133503chr12--1527 ----
NM_133504chr12--1527 ----
NM_133505chr12--1527 ----
NM_133506chr12--1527 ----
NM_133510chr141281 ------
NM_133633chr223938 807 158 11119 1801 --
NM_133634chr2141562 1239 674 375 11739 ----
NM_133638chr51324 ------
NM_133642chr222827 519 1484 153 --
NM_133645chr61481 ------
NM_133647chr1543436 1105 677 82 11223 --190
NM_134428chr9--1256 ----
NM_134442chr241389 1375 194 145 --11682 --
NM_138270chrX12934 12539 12991 12575
NM_138288chr1421949 425 --11925 --
NM_138317chr14----1503 --
NM_138318chr14----1503 --
NM_138323chr153663 657 282 --1870 --
NM_138328chr1743209 3084 2406 890 --13000 --
NM_138338chr2263300 2749 1111 530 295 151 ----1725
NM_138346chr1------1228
NM_138357chr1051573 1554 1499 1130 561 ----1362
NM_138396chr121644 --1223 --
NM_138426chr741590 793 605 215 1680 ----
NM_138444chr1384987 1450 1375 1176 279 263 108 24 24321 3914 --24493 3141
NM_138448chr2--1168 ----
NM_138455chr8--159 ----
NM_138457chr663167 3131 3081 2112 1250 438 12307 --11120
NM_138458chr22358 42 ------
NM_138468chr285355 4894 4566 2034 1527 938 798 623 11239 56105 5666 5371 4588 2356 --
NM_138473chr1265000 4126 3995 1299 489 458 ------
NM_138493chr6138 ------
NM_138494chr732840 2527 46 1472 11846 --
NM_138565chr1111416 --11111 --
NM_138569chr6164 ------
NM_138576chr1444277 3179 1518 696 1493 13868 11586
NM_138578chr2041486 516 449 21 ------
NM_138609chr5175 ------
NM_138610chr5175 ------
NM_138621chr284128 3832 3335 3142 2928 1323 1238 1202 --23989 3771 --
NM_138633chr621706 1191 ------
NM_138638chr142976 435 ------
NM_138689chr111168 ------
NM_138713chr16147984 7909 7538 7481 7260 6059 5446 5302 2297 2222 1873 1218 945 609 --46590 6406 2370 329 --
NM_138714chr16147984 7909 7538 7481 7260 6059 5446 5302 2297 2222 1873 1218 945 609 --46590 6406 2370 329 --
NM_138727chr162272 2052 952 722 360 232 ------
NM_138728chr162272 2052 952 722 360 232 ------
NM_138731chr1451714 1293 1272 610 169 24263 61 ----
NM_138735chr231192 1174 305 1578 ----
NM_138771chr71615 ----11079
NM_138773chr53649 247 221 ------
NM_138774chr192220 134 ------
NM_138775chr111306 1846 ----
NM_138782chr521702 48 1480 ----
NM_138804chr23587 302 165 ------
NM_138927chr212710 126 ------
NM_138931chr32