TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4761-3p
miRNA Sequence: GAGGGCAUGCGCACUUUGUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr1--1616 ----
NM_000018chr172122 37 ------
NM_000021chr1441070 890 880 298 ------
NM_000024chr51136 ------
NM_000033chrX2940 96 ------
NM_000037chr832356 1725 974 --22465 534 --
NM_000038chr551956 1815 1417 777 426 ------
NM_000044chrX294 39 --1282 --
NM_000052chrX52278 2145 1296 597 574 1528 43079 2942 2851 106 --
NM_000053chr1351829 1540 623 141 127 --2644 602 --
NM_000055chr31316 ------
NM_000068chr19--21248 108 ----
NM_000084chrX96350 4931 4908 4260 2598 2214 2095 1686 1665 16760 ----
NM_000087chr4134 ------
NM_000088chr1751230 1159 947 472 355 ------
NM_000092chr274524 3227 3220 3105 3082 1225 731 --23011 1838 --
NM_000093chr962442 2106 992 821 538 292 --11569 --
NM_000097chr31997 1102 1961 --
NM_000109chrX------12633
NM_000112chr585365 5066 4128 2093 1715 1105 776 566 2856 436 24904 683 14268
NM_000125chr654249 2893 1191 1179 725 1917 44133 3659 3205 1383 --
NM_000127chr8156 ------
NM_000129chr62981 565 --11280 --
NM_000141chr103472 304 73 ----1981
NM_000161chr1451326 757 719 451 372 ------
NM_000163chr511795 --1133 --
NM_000167chrX1734 ------
NM_000168chr732703 2295 2236 22873 2043 11225 --
NM_000170chr92446 38 ------
NM_000176chr562959 2672 2622 497 319 75 126 ----
NM_000177chr9252 39 ------
NM_000202chrX53828 3302 2629 2546 1220 13314 ----
NM_000208chr1993367 3186 3158 3137 1635 1585 1337 787 102 13611 13985 --
NM_000214chr2021268 432 21425 1315 --1320
NM_000217chr1265038 3671 3599 1657 1329 1270 --13388 1127
NM_000222chr421578 760 --21670 564 --
NM_000240chrX31490 417 311 ------
NM_000245chr742102 1944 373 91 ------
NM_000248chr342343 682 345 202 1491 1774 --
NM_000252chrX1144 ------
NM_000253chr42797 75 ------
NM_000254chr132426 904 21 167 ----
NM_000259chr1574963 4671 4435 4256 4152 1315 599 14904 --16311
NM_000262chr2261666 1445 1175 392 291 67 --1161 --
NM_000264chr953373 2247 2064 1054 990 13103 1109 --
NM_000267chr1783287 2786 2636 2137 372 186 75 69 23519 2826 12684 --
NM_000276chrX42027 519 321 296 ------
NM_000280chr111135 ------
NM_000286chr172181 153 ------
NM_000314chr1043219 3201 3007 519 ------
NM_000315chr11--134 ----
NM_000318chr8102743 2658 2453 1942 1056 926 595 465 426 277 12866 ----
NM_000319chr1221097 365 --1264 --
NM_000321chr132378 348 1444 ----
NM_000325chr4----1182 --
NM_000330chrX41629 832 558 232 ------
NM_000332chr696707 6486 6286 5995 5730 4617 936 496 286 ------
NM_000333chr311061 1952 189 --
NM_000335chr351893 1869 1746 1563 839 --1238 --
NM_000337chr566439 5762 5604 5238 4916 1326 14735 11049 11410
NM_000346chr17--31505 736 566 21360 520 --
NM_000361chr2051890 1822 1783 1506 635 ------
NM_000362chr22113627 3442 3131 2956 2928 1373 1364 1289 776 545 408 ------
NM_000368chr984809 4409 4192 4075 3915 1919 1488 184 --12955 --
NM_000369chr1441765 1532 713 100 --11487 --
NM_000378chr1161258 1146 826 338 308 187 ------
NM_000379chr24413 350 215 37 --11515 --
NM_000387chr32583 531 1151 ----
NM_000390chrX1853 1774 ----
NM_000391chr1171662 1493 592 250 175 70 38 21707 207 ----
NM_000393chr231988 1768 451 ------
NM_000399chr102864 855 1913 ----
NM_000403chr12298 47 ------
NM_000408chr243180 2439 804 108 --12687 --
NM_000411chr21123011 2876 2779 2557 2495 2069 2020 1223 1070 581 250 39 --31213 691 387 --
NM_000424chr12124 ------
NM_000430chr17123804 3721 3693 3257 3053 2931 2778 2555 2494 1341 944 98 --22505 1176 --
NM_000434chr63207 46 32 ------
NM_000447chr12429 349 --1412 --
NM_000448chr1142384 2319 570 432 --1146 --
NM_000450chr141313 1296 514 388 11433 2566 118 --
NM_000459chr92228 77 1328 1173 --
NM_000461chr394131 3625 3217 3188 1716 1634 1342 1072 581 21478 564 24379 217 --
NM_000462chr1511429 ------
NM_000476chr961346 1119 492 444 346 95 ------
NM_000480chr1141443 1281 169 108 21604 420 ----
NM_000482chr112109 44 ------
NM_000484chr2131038 743 157 ------
NM_000486chr12153261 3233 3146 2918 2484 2168 2149 2030 1301 933 908 461 438 365 208 12175 11978 --
NM_000489chrX43102 2647 2405 310 22721 611 ----
NM_000503chr82146 35 ------
NM_000522chr71411 ------
NM_000530chr12717 291 --11109 --
NM_000533chrX41243 380 240 88 ------
NM_000536chr112523 103 ------
NM_000540chr19--142 ----
NM_000555chrX137799 7288 6991 6053 5898 5711 5300 5212 4821 2943 1828 437 314 27484 6798 1859 --
NM_000598chr751311 1254 474 307 163 ----141
NM_000599chr264057 3460 3307 3235 3168 805 ------
NM_000615chr114889 785 767 150 ------
NM_000618chr1275855 5448 4781 2561 2032 1476 54 14088 11063 --
NM_000618chr1275855 5448 4781 2561 2032 1476 54 14088 11063 --
NM_000619chr122475 379 ------
NM_000627chr21633 ------
NM_000634chr251293 1074 1023 440 343 --21267 362 --
NM_000637chr82514 388 1471 ----
NM_000665chr71185 --123 --
NM_000682chr231309 687 64 --1324 --
NM_000687chr20137 ------
NM_000701chr11238 ------
NM_000720chr31144 ------
NM_000721chr121784 367 11721 129 --
NM_000722chr72251 63 ------
NM_000723chr17101571 1509 1423 1384 1313 1307 1279 1218 1191 1065 --1122 --
NM_000724chr1041878 1799 1641 702 1496 ----
NM_000726chr21191 11329 1165 --
NM_000756chr8185 ------
NM_000780chr81808 ------
NM_000793chr1463589 3508 3135 887 553 399 --24084 3555 24288 3601
NM_000794chr5257 30 ------
NM_000800chr561284 1273 1231 429 419 146 11073 ----
NM_000801chr2021025 135 ------
NM_000806chr511255 ------
NM_000807chr42626 215 ------
NM_000809chr439028 6929 1551 1345 ----
NM_000810chr153495 188 148 ------
NM_000811chr51548 ------
NM_000813chr595294 5076 5063 4623 4171 3724 3624 1897 407 14818 15009 --
NM_000814chr1543935 3825 1665 221 1857 21194 361 --
NM_000816chr53646 161 122 ------
NM_000817chr22981 879 --137 1404
NM_000824chr4--2803 186 ----
NM_000826chr422402 943 1194 ----
NM_000827chr562449 2163 2145 2014 1847 626 --1856 --
NM_000828chrX31746 1534 1425 1173 ----
NM_000829chr1112158 127 ----
NM_000831chr1155569 5525 5387 5264 5256 5237 5196 4442 4388 1502 1181 818 499 260 140 11090 16093 23908 1437
NM_000836chr191989 ------
NM_000838chr652753 2562 1754 703 364 1157 1329 11979
NM_000839chr31452 ------
NM_000859chr521410 221 ------
NM_000860chr421299 277 11268 ----
NM_000864chr13970 268 38 ------
NM_000868chrX61936 1797 1764 466 253 156 12501 ----
NM_000870chr571407 1349 1277 650 638 627 36 ------
NM_000872chr1061441 1319 1068 441 270 68 ------
NM_000875chr15116260 5512 4520 2823 2056 1733 1593 947 851 312 126 15891 24829 1455 --
NM_000876chr62237 98 ------
NM_000880chr82611 194 ------
NM_000891chr1763401 2843 1416 1275 917 786 1374 ----
NM_000899chr1244337 3545 1639 625 --23795 702 --
NM_000901chr442415 2393 2365 961 21977 30 2908 639 --
NM_000902chr343259 2895 2383 301 2692 162 ----
NM_000912chr873539 2640 2450 2353 1191 718 473 13326 12648 --
NM_000917chr101691 1841 --1386
NM_000921chr121495 ------
NM_000924chr1271344 1192 1122 1092 1084 458 248 ------
NM_000933chr2011521 ----1328
NM_000935chr33964 772 186 ------
NM_000937chr171380 --1120 --
NM_000939chr2272 62 ------
NM_000944chr422077 121 --2671 231 11871
NM_000945chr231777 1559 819 --181 --
NM_000949chr52125 74 1854 ----
NM_000959chr123186 2919 11243 1310 --
NM_000960chr193496 253 31 ------
NM_000965chr32966 951 ------
NM_000966chr124753 679 214 95 ------
NM_000971chr8156 ------
NM_001001132chr2151270 1249 1191 465 133 ------
NM_001001323chr1233050 2885 137 11041 ----
NM_001001331chr352385 2215 1806 1043 740 1761 1938 1782
NM_001001344chrX42360 1687 885 510 --12057 --
NM_001001349chr1781647 1541 1419 1357 1283 1251 533 479 ------
NM_001001395chr1242606 1117 843 781 ------
NM_001001396chr184502 3916 3878 3796 3444 1746 1716 819 23688 638 13315 --
NM_001001419chr584681 4136 1981 1972 1901 1137 1070 233 1291 14250 --
NM_001001420chr584681 4136 1981 1972 1901 1137 1070 233 1291 14250 --
NM_001001433chr2043140 2733 1090 471 ------
NM_001001436chr161732 ------
NM_001001438chr212125 76 --1313 --
NM_001001481chr811089 12501 12818 --
NM_001001484chr1022122 144 1832 ----
NM_001001502chr52449 76 1168 ----
NM_001001549chr731011 717 338 1967 ----
NM_001001550chr731011 717 338 1967 ----
NM_001001555chr731011 717 338 1967 ----
NM_001001557chr851674 764 699 655 549 ------
NM_001001664chr253174 2772 1417 1140 270 22546 405 13505 --
NM_001001665chr252583 2310 961 472 213 --23428 3384 --
NM_001001669chr542472 2454 2113 1742 --11722 --
NM_001001694chr22142311 2248 2177 2034 1706 1546 1481 820 553 429 280 269 112 27 ------
NM_001001740chr11234 ------
NM_001001740chr11234 ------
NM_001001787chr12471 79 ------
NM_001001791chr1031705 1544 245 1578 ----
NM_001001852chr224724 227 147 40 ------
NM_001001890chr2174193 3559 3207 3110 2715 2606 1440 --33362 3179 3141 --
NM_001001928chr22117596 6185 5553 5362 5273 5062 2970 1726 1640 743 251 38341 7937 7922 27654 1298 18289
NM_001001936chr101471 ------
NM_001001971chr103959 513 230 --11284 --
NM_001001974chr1021477 835 --1538 --
NM_001001995chrX61470 1460 1216 420 373 64 1763 ----
NM_001002032chr172505 67 ------
NM_001002233chr851951 1430 253 226 74 --1602 --
NM_001002243chr22900 297 177 ----
NM_001002255chr61353 ------
NM_001002257chr253050 2629 2258 613 446 23324 3146 ----
NM_001002259chr12174 --1320 --
NM_001002295chr1011113 ------
NM_001002762chr1092857 2819 2326 2074 2067 979 951 406 238 12179 ----
NM_001002814chr8173559 3438 3385 3320 3295 3259 3132 2803 2633 2577 1430 1030 931 918 253 226 74 23694 2653 1602 --
NM_001002838chrX41599 1347 1302 742 ------
NM_001002860chr14104390 4247 3958 3617 3208 2973 1243 1228 694 513 ----24437 1424
NM_001002909chr1792116 1906 1838 1648 1430 1385 430 340 202 --11544 --
NM_001002914chr172793 785 ------
NM_001002919chr2146 ------
NM_001003407chr1094864 4115 4102 3950 1867 1243 523 359 50 11892 --1932
NM_001003408chr1094864 4115 4102 3950 1867 1243 523 359 50 11892 --1932
NM_001003652chr18128645 8150 7540 3345 3239 2448 2318 1829 1091 880 758 553 17359 68569 8021 7285 7270 5985 1402 12397
NM_001003674chr18125825 5627 5387 5131 5117 4911 4718 4544 2690 2596 2395 969 16999 ----
NM_001003675chr18125825 5627 5387 5131 5117 4911 4718 4544 2690 2596 2395 969 16999 ----
NM_001003676chr115640 334 247 221 62 ------
NM_001003681chr2221758 1358 2410 281 ----
NM_001003682chr1123 --2586 122 --
NM_001003688chr4----11150 --
NM_001003698chr631632 666 77 1224 ----
NM_001003699chr631632 666 77 1224 ----
NM_001003712chr1253020 2790 1400 1385 785 ------
NM_001003760chr653516 3485 941 815 681 11197 2719 141 --
NM_001003792chr3136 ------
NM_001003793chr3136 ------
NM_001003800chr9113704 3283 2722 2443 1480 1459 1386 1315 1241 1137 225 --13610 --
NM_001003805chr14163 ------
NM_001003810chr41627 --1251 --
NM_001003891chr223727 279 131 ------
NM_001003940chr1573719 3617 3606 3537 3223 2779 848 --11207 --
NM_001003942chr1573719 3617 3606 3537 3223 2779 848 --11207 --
NM_001003943chr1573723 3621 3610 3541 3227 2783 852 --11211 --
NM_001003945chr931883 697 98 11874 1107 --
NM_001004065chr973793 3538 3222 3039 2929 2816 944 ------
NM_001004106chr55927 827 715 674 139 ------
NM_001004196chr31502 --1799 --
NM_001004304chr1282740 2697 2403 2364 2173 1102 1023 940 --23019 770 --
NM_001004317chr674465 4427 3050 1713 1652 782 660 --13027 --
NM_001004329chr121261 ------
NM_001004360chr232007 1707 318 1380 1748 --
NM_001004419chr1264157 1815 1594 1505 552 186 ------
NM_001004439chr1531189 1028 455 1193 --11237
NM_001004441chr511372 --11071 --
NM_001004720chr23675 435 369 ------
NM_001004722chr21844 ------
NM_001005266chr15----1694 --
NM_001005267chr15----1694 --
NM_001005268chr15----1694 --
NM_001005269chr15----1694 --
NM_001005271chr1711113 ------
NM_001005273chr1711113 ------
NM_001005291chr173479 143 65 ------
NM_001005353chr12462 182 ------
NM_001005353chr12462 182 ------
NM_001005354chr12145 ------
NM_001005360chr193724 577 21 1618 ----
NM_001005361chr193724 577 21 1618 ----
NM_001005362chr193724 577 21 1618 ----
NM_001005366chr121736 ------
NM_001005375chrY31453 1217 727 ------
NM_001005377chr19252 24 ------
NM_001005386chr231695 698 107 1306 1349 --
NM_001005404chr1763357 2797 1228 966 721 666 ------
NM_001005463chr1052478 2259 839 658 394 --12441 11695
NM_001005473chr5146643 6493 6362 5972 5743 5414 4941 4166 2404 2345 2040 1249 773 428 12631 35514 1719 862 35372 4318 495
NM_001005474chr341354 1101 538 261 21058 83 ----
NM_001005527chr321205 408 ------
NM_001005609chrX42577 599 121 30 1567 ----
NM_001005611chrX1510 ------
NM_001005739chr2171 --1325 --
NM_001005746chr21191 11329 1165 --
NM_001005747chr21191 11329 1165 --
NM_001005781chr22485 224 ------
NM_001005782chr23934 817 673 ------
NM_001005920chr163861 776 760 ------
NM_001006115chr362633 1033 501 440 295 263 3754 665 246 11875 --
NM_001006600chr51811 --1396 --
NM_001006610chr161755 ------
NM_001006617chr951061 1028 322 288 82 164 11109 --
NM_001006619chr951061 1028 322 288 82 164 11109 --
NM_001006620chr951061 1028 322 288 82 164 11109 --
NM_001006621chr951061 1028 322 288 82 164 11109 --
NM_001006623chr232464 2034 624 --11702 --
NM_001006641chr951585 709 404 376 173 ----11105
NM_001006642chr951585 709 404 376 173 ----11105
NM_001006643chr951585 709 404 376 173 ----11105
NM_001006665chr12290 163 --1570 --
NM_001006943chr11218 ------
NM_001006944chr112695 107 ------
NM_001006946chr241909 1883 1382 1292 ------
NM_001007023chr1463589 3508 3135 887 553 399 --24084 3555 24288 3601
NM_001007094chr1061333 1147 1085 947 938 80 ------
NM_001007097chr984356 4255 3267 3250 1307 1104 889 875 --34938 1275 1161 11775
NM_001007098chr15825 785 356 324 70 ------
NM_001007156chr1541733 1552 450 132 --11444 --
NM_001007214chr151901 1591 1197 697 347 ------
NM_001007226chr1731296 1215 1135 ------
NM_001007227chr1731296 1215 1135 ------
NM_001007228chr1731296 1215 1135 ------
NM_001007229chr1731296 1215 1135 ------
NM_001007230chr1731296 1215 1135 ------
NM_001007237chr142512 1932 918 707 ------
NM_001007246chr2111376 --11191 --
NM_001007257chr1153 --1463 --
NM_001007466chr6105025 4871 4228 4140 4123 3949 3758 3180 184 66 1426 11132 1393
NM_001007527chr5--1230 ----
NM_001007538chr1351531 1191 451 382 273 ------
NM_001007553chr11923 1412 ----
NM_001007559chr1831648 1391 592 ------
NM_001008216chr12298 47 ------
NM_001008220chr5103813 3639 3625 3286 3157 3130 2861 2617 2579 2507 ------
NM_001008222chrX11102 11270 ----
NM_001008225chr73709 490 131 ------
NM_001008239chr1882896 2369 1513 1483 617 563 503 297 13284 ----
NM_001008392chr392705 1077 1066 830 606 404 314 136 68 --12872 13050
NM_001008407chr761706 1666 1389 620 471 380 ------
NM_001008408chr7135910 5613 5306 5221 4697 4554 4037 3997 3937 1765 1730 954 114 11162 15479 --
NM_001008410chr241863 1755 844 48 --22235 2185 --
NM_001008495chr841573 1394 635 219 11492 ----
NM_001008529chr1741132 1016 455 261 --11175 --
NM_001008541chr1021770 721 --21864 576 --
NM_001008541chr1021770 721 --21864 576 --
NM_001008564chr13--11579 ----
NM_001008660chr111371 ------
NM_001008701chr1942836 2689 624 120 ------
NM_001008707chr1421890 121 --1329 --
NM_001008711chr8173 --11653 --
NM_001008738chr532800 2093 1103 --1628 --
NM_001008925chr453436 2947 2479 2187 1045 ------
NM_001008938chr11--2315 195 ----
NM_001009185chr51647 ------
NM_001009552chr8123 ------
NM_001009554chr453326 1660 1063 524 351 13814 24575 292 13708
NM_001009554chr453326 1660 1063 524 351 13814 24575 292 13708
NM_001009566chr161347 1329 1203 938 527 372 --11388 --
NM_001009567chr102586 118 ------
NM_001009571chr741727 1681 1614 70 ------
NM_001009899chr374505 4267 4256 3950 2403 1831 497 36348 6251 5384 34992 4608 4431 --
NM_001009959chr251976 846 656 495 30 ----182
NM_001009993chr284130 3473 3217 3187 1711 1488 937 584 --1108 --
NM_001010000chr1873161 3085 3021 2814 2570 2404 804 23215 2436 22598 527 --
NM_001010862chrX43047 2615 528 139 ------
NM_001010867chr1145664 4932 4878 4708 2221 2136 2129 2012 1971 1886 1215 611 170 149 --12312 --
NM_001010888chrX64100 3307 3263 1862 568 284 --54543 4235 3971 3040 1493 13679
NM_001010891chr565502 4563 2654 1679 464 293 35448 1179 272 1558 --
NM_001010908chr101504 ------
NM_001010924chr101922 --2990 246 1312
NM_001010971chr1--1866 ----
NM_001010984chr172030 1713 855 747 364 153 32 21963 1888 ----
NM_001010986chrX22494 256 ------
NM_001011513chr453252 2717 2533 983 223 23997 839 --1394
NM_001011515chr421038 953 195 ----
NM_001011516chr421038 953 195 ----
NM_001011537chr362055 1743 1528 1464 455 421 --1174 --
NM_001011553chr71624 --1170 --
NM_001011645chrX294 39 --1282 --
NM_001011666chr7116051 5379 5207 5067 4757 4751 4739 4268 1485 599 540 15126 ----
NM_001011708chr262461 2002 1189 1179 1172 1166 --12846 --
NM_001011713chr1411575 21441 407 --11430
NM_001011885chr1511718 11656 11541 --
NM_001012264chr142666 144 ------
NM_001012267chr941413 438 412 270 1699 ----
NM_001012329chr162287 1911 1852 1697 607 125 ------
NM_001012393chr1194914 4732 4584 3684 3545 2062 2021 1947 482 1441 ----
NM_001012420chr1572032 2026 1034 950 751 656 272 ------
NM_001012423chr1572032 2026 1034 950 751 656 272 ------
NM_001012732chr461187 1125 1086 1013 464 273 --2804 64 --
NM_001012751chr1031526 706 97 ------
NM_001012754chr1361889 1796 1567 492 273 162 11664 ----
NM_001012761chr592563 2521 2271 2134 796 506 406 242 126 --2874 492 --
NM_001012968chrX62419 926 887 564 516 197 --12195 --
NM_001012974chr6143 --1213 --
NM_001012977chrX41167 1155 1103 979 ------
NM_001012979chrX1160 ------
NM_001012989chrX2560 168 --1469 --
NM_001013031chr1073267 2221 1100 1081 1008 840 752 22984 207 ----
NM_001013398chr751311 1254 474 307 163 ----141
NM_001013399chr61921 ------
NM_001013406chr711748 11357 11562 --
NM_001013415chr421256 53 ------
NM_001013438chr32838 368 ------
NM_001013439chr32684 214 ------
NM_001013622chr48998 818 480 418 357 171 110 48 ------
NM_001013624chr173284 159 59 ------
NM_001013635chr1261145 1086 904 481 284 110 --1878 --
NM_001013642chr141134 997 987 218 1913 1325 --
NM_001013693chr192142 2107 1890 955 903 883 684 616 232 ------
NM_001013693chr192142 2107 1890 955 903 883 684 616 232 ------
NM_001013703chr15--1428 ----
NM_001014283chr1321468 410 1462 ----
NM_001014435chr163411 245 189 ------
NM_001014442chr13----1106 --
NM_001014445chr176978 790 743 736 142 56 1401 ----
NM_001014797chr10118127 7505 6510 6247 5990 1937 1851 1749 1445 936 286 --27494 1214 --
NM_001014809chr4149 --1130 --
NM_001014812chr153435 392 111 ------
NM_001014831chr194705 678 502 106 ------
NM_001014832chr194705 678 502 106 ------
NM_001014834chr194705 678 502 106 ------
NM_001014835chr194705 678 502 106 ------
NM_001015045chr441915 1679 1640 848 21763 163 32444 1628 459 --
NM_001015053chr1741593 600 371 264 ----1402
NM_001015508chr81518 ------
NM_001015877chrX2823 799 32551 2194 1015 ----
NM_001015880chr1061648 1548 1160 1069 419 35 21657 1604 ----
NM_001015881chrX21281 1148 11087 1883 1136
NM_001015887chr331513 324 180 11372 2216 46 --
NM_001017368chr1742303 2050 997 155 129 ----
NM_001017371chr2------1147
NM_001017395chr373279 3154 2852 2776 2396 1011 396 ----22994 2273
NM_001017396chr261809 1663 1374 827 721 111 21948 1438 ----
NM_001017406chr1141 ------
NM_001017415chr11518 ------
NM_001017416chr11518 ------
NM_001017424chr12637 255 1480 2246 55 --
NM_001017425chr12637 255 1480 2246 55 --
NM_001017434chr13713 476 174 ------
NM_001017523chr12--1721 11430 --
NM_001017916chr1731577 1526 343 ------
NM_001017917chr1731577 1526 343 ------
NM_001017923chr1411315 1439 145 --
NM_001017926chr81337 ------
NM_001017962chr101691 1841 --1386
NM_001017979chr42713 38 --1283 --
NM_001017999chr151956 643 581 534 472 ------
NM_001017999chr151956 643 581 534 472 ------
NM_001018000chr151956 643 581 534 472 ------
NM_001018000chr151956 643 581 534 472 ------
NM_001018001chr151956 643 581 534 472 ------
NM_001018005chr15149 ------
NM_001018008chr15--172 --1619
NM_001018009chr3--1117 1394 --
NM_001018025chrX131 --1350 --
NM_001018050chr2263368 2961 2776 853 670 134 --22761 2661 --
NM_001018052chr2263368 2961 2776 853 670 134 --22761 2661 --
NM_001018054chr11973 ------
NM_001018064chr941651 1520 441 98 --1425 --
NM_001018065chr945431 4595 167 65 1191 75318 5277 4473 3817 1476 729 601 --
NM_001018066chr945431 4595 167 65 1191 75318 5277 4473 3817 1476 729 601 --
NM_001018067chr154930 4870 3485 2153 1467 ------
NM_001018068chr154930 4870 3485 2153 1467 ------
NM_001018069chr154930 4870 3485 2153 1467 ------
NM_001018072chr12--1721 11430 --
NM_001018074chr562959 2672 2622 497 319 75 126 ----
NM_001018075chr562959 2672 2622 497 319 75 126 ----
NM_001018076chr562959 2672 2622 497 319 75 126 ----
NM_001018077chr562959 2672 2622 497 319 75 126 ----
NM_001018078chr92176 77 ------
NM_001018100chr15--1631 --1805
NM_001018108chr1571770 1560 836 579 332 123 32 --1795 --
NM_001020658chr121618 228 --1643 --
NM_001020658chr121618 228 --1643 --
NM_001020818chr1931459 668 541 1689 ----
NM_001020819chr1931459 668 541 1689 ----
NM_001020820chr1931459 668 541 1689 ----
NM_001020821chr1931459 668 541 1689 ----
NM_001020825chr53434 147 97 ------
NM_001023567chr154754 659 482 272 12367 ----
NM_001024071chr142348 159 1215 ----
NM_001024094chr562959 2672 2622 497 319 75 126 ----
NM_001024218chr14135 ------
NM_001024372chr841894 1544 150 22 ------
NM_001024401chr1642538 809 578 58 11904 ----
NM_001024455chrX82673 2253 781 656 531 420 228 184 12284 11679 --
NM_001024463chr1511049 ----1811
NM_001024465chr6----153 --
NM_001024647chr12176957 6250 6148 6013 5999 5288 5154 5004 4986 4918 2879 2748 2107 1489 1224 549 22 26381 128 11852 --
NM_001024666chrX3645 446 112 ------
NM_001024668chr122790 29 ----1317
NM_001024808chr1281867 1058 1028 729 489 430 424 220 ------
NM_001024847chr34848 679 284 28 --1190 --
NM_001024858chr1453021 2947 1035 169 155 12392 21988 193 --
NM_001024912chr1921491 146 1491 2594 533 --
NM_001024934chr6--1530 145 --
NM_001024935chr6--1530 145 --
NM_001024936chr6--1530 145 --
NM_001024947chr51751 ------
NM_001024948chr152922 2632 2371 386 236 22169 276 2325 223 --
NM_001024956chr1163647 2189 1718 1636 808 344 ------
NM_001025068chr341669 1591 1195 486 --11462 --
NM_001025069chr341669 1591 1195 486 --11462 --
NM_001025070chr5140 ------
NM_001025071chr5140 ------
NM_001025076chr10124874 4863 4808 4689 4485 4208 3835 1328 1322 86 58 26 --12226 11817
NM_001025077chr10156232 6221 6166 6047 5843 5566 5193 4870 2686 2680 1444 1416 410 150 26 ------
NM_001025079chr353443 2651 2575 735 377 --1302 12892
NM_001025081chr184473 260 115 29 153 ----
NM_001025090chr184473 260 115 29 153 ----
NM_001025092chr184473 260 115 29 153 ----
NM_001025101chr184473 260 115 29 153 ----
NM_001025108chr274179 3335 3002 1258 1229 626 477 --11479 11368
NM_001025205chr31110 ------
NM_001025266chr3104918 4561 4395 3869 3857 3210 1545 1527 667 428 1438 ----
NM_001025356chr1262742 2560 2286 1083 1053 987 1661 ----
NM_001025366chr641484 1363 1353 1187 ------
NM_001025366chr641484 1363 1353 1187 ------
NM_001025367chr641484 1363 1353 1187 ------
NM_001025367chr641484 1363 1353 1187 ------
NM_001025368chr641484 1363 1353 1187 ------
NM_001025368chr641484 1363 1353 1187 ------
NM_001025369chr641500 1379 1369 1203 ------
NM_001025369chr641500 1379 1369 1203 ------
NM_001025370chr641484 1363 1353 1187 ------
NM_001025370chr641484 1363 1353 1187 ------
NM_001025389chr1141443 1281 169 108 21604 420 ----
NM_001025390chr1141443 1281 169 108 21604 420 ----
NM_001025580chrX63477 3452 3320 872 326 317 13789 ----
NM_001025595chr431495 1269 1097 --11468 --
NM_001025616chr431242 755 180 ------
NM_001025780chr931371 1154 107 ------
NM_001029858chr683378 3346 2982 2569 2548 946 696 207 ------
NM_001029863chr632455 2082 457 22773 1135 ----
NM_001029875chr563020 2233 2143 2031 781 145 ------
NM_001029891chrX2768 746 ------
NM_001029998chr421441 454 1145 21407 366 --
NM_001030002chr172349 25 1260 ----
NM_001030006chr1772536 2520 2400 2130 1868 673 245 12605 ----
NM_001030007chr1653792 2818 1542 1011 529 33250 2441 731 1181 --
NM_001030019chr7133 ------
NM_001030055chr1411449 24643 4007 ----
NM_001031679chr1222321 2205 13455 ----
NM_001031681chr1772145 1770 1689 862 670 347 274 1459 ----
NM_001031685chr11344 ------
NM_001031690chr7123033 2784 2650 2124 1968 1923 1167 990 959 729 406 24 ------
NM_001031692chr7----1285 --
NM_001031694chr13784 341 220 --1308 --
NM_001031694chr13784 341 220 --1308 --
NM_001031695chr22144587 4481 4345 4039 3569 3316 1767 1381 1293 886 879 709 300 204 24024 1551 13803 --
NM_001031702chr34684 281 118 34 ------
NM_001031716chr2------144
NM_001031732chr423189 3102 ------
NM_001031804chr1622734 90 --11458 --
NM_001032221chr941278 590 518 420 --21348 157 --
NM_001032280chr651317 1108 251 174 144 ------
NM_001032282chr811004 ------
NM_001032288chr202544 376 --11209 --
NM_001032293chr171661 --1592 --
NM_001032296chr1372754 2721 2625 1912 1167 657 567 1718 ----
NM_001032363chr151711 1539 1513 782 71 ------
NM_001032363chr151711 1539 1513 782 71 ------
NM_001032393chrX----1493 --
NM_001032394chr631060 571 68 ------
NM_001033044chr131207 406 132 --1550 --
NM_001033056chr131207 406 132 --1550 --
NM_001033057chr311581 --11880 --
NM_001033059chr621500 818 --1201 --
NM_001033081chr131910 1369 402 --31758 751 452 --
NM_001033082chr131910 1369 402 --31758 751 452 --
NM_001033087chr2043262 1246 1015 874 13009 12036 --
NM_001033088chr152324 27 ------
NM_001033112chr51639 ------
NM_001033117chr394784 4426 4103 3997 3910 3544 3511 1542 810 23809 1275 ----
NM_001033503chr51399 ----1456
NM_001033504chr172598 160 ------
NM_001033507chr131810 1771 724 ------
NM_001033518chr762836 2814 2365 1004 890 846 ------
NM_001033519chr762836 2814 2365 1004 890 846 ------
NM_001033520chr762836 2814 2365 1004 890 846 ------
NM_001033602chr1352203 944 635 161 103 12194 ----
NM_001033756chr641418 1297 1287 1121 ------
NM_001033756chr641418 1297 1287 1121 ------
NM_001033859chr172122 37 ------
NM_001033925chr1042071 1989 550 175 ------
NM_001033952chr111249 ------
NM_001034025chr121164 ------
NM_001034837chr55762 739 668 255 72 1277 ----
NM_001034838chr55762 739 668 255 72 1277 ----
NM_001034841chr16115219 4402 3936 3822 3737 3465 3341 1606 1114 207 33 13530 14933 --
NM_001034845chr421238 387 ------
NM_001034850chr521546 648 --11518 --
NM_001034852chr1441765 757 679 117 ------
NM_001034915chr821464 1238 1168 1470 21456 987
NM_001034954chr1052494 2394 996 633 332 --12594 13157
NM_001034955chr1052494 2394 996 633 332 --12594 13157
NM_001034956chr1052494 2394 996 633 332 --12594 13157
NM_001034957chr1052494 2394 996 633 332 --12594 13157
NM_001035chr1170 1469 ----
NM_001035003chr421336 908 ------
NM_001035004chr421336 908 ------
NM_001035254chr9112152 2106 1814 967 892 694 670 564 475 373 115 --1659 --
NM_001035256chr2272 62 ------
NM_001035260chr102554 322 ------
NM_001037132chr752179 1952 1448 839 319 ------
NM_001037133chr752179 1952 1448 839 319 ------
NM_001037164chr73155 141 96 ------
NM_001037174chr211898 --11437 --
NM_001037290chr111324 ------
NM_001037331chr181265 1932 ----
NM_001037332chr551618 503 459 427 374 --1167 --
NM_001037333chr551618 503 459 427 374 --1167 --
NM_001037334chr1831597 478 323 32270 432 204 1284 --
NM_001037339chr151469 1200 438 404 195 ------
NM_001037340chr151469 1200 438 404 195 ------
NM_001037341chr151469 1200 438 404 195 ------
NM_001037341chr151469 1200 438 404 195 ------
NM_001037533chr12712 637 --2655 219 --
NM_001037631chr2----1454 --
NM_001037872chr22611 84 --125 --
NM_001037954chr1142680 2631 2498 676 ------
NM_001038493chr24977 622 577 551 ------
NM_001038640chr1541023 821 726 339 ------
NM_001038707chr172229 2221 2042 1773 1444 826 446 22067 1570 ----
NM_001038707chr172229 2221 2042 1773 1444 826 446 22067 1570 ----
NM_001039091chrX1418 ------
NM_001039348chr21925 ------
NM_001039349chr21925 ------
NM_001039459chr74837 740 394 23 --1320 --
NM_001039465chr141470 ----1372
NM_001039479chr1452076 1654 1552 770 119 --22243 35 --
NM_001039490chr114589 527 165 146 ------
NM_001039538chr222592 247 ------
NM_001039547chr3147789 6956 6393 2912 2902 2605 2390 2076 1725 1417 1068 1057 944 551 31194 917 614 37267 7019 2644 --
NM_001039570chr22103799 3745 3521 3481 3367 1667 1372 1267 779 573 13661 14506 --
NM_001039571chr22103799 3745 3521 3481 3367 1667 1372 1267 779 573 13661 14506 --
NM_001039577chr1154388 4153 4038 3924 3139 3119 3098 1717 1709 1299 1268 1022 927 686 382 ------
NM_001039580chr454164 3559 3278 1015 910 1579 43525 1309 953 255 --
NM_001039583chr222416 136 ------
NM_001039584chr222416 136 ------
NM_001039585chr143443 3176 112 46 11500 1567 --
NM_001039590chrX63560 3544 1581 1522 1479 597 33511 3062 1155 ----
NM_001039591chrX63560 3544 1581 1522 1479 597 33511 3062 1155 ----
NM_001039618chr1155816 5314 4385 1259 477 11131 35291 793 323 --
NM_001039690chr1631972 1788 467 ------
NM_001039693chr233313 2730 1564 2557 501 --11366
NM_001039711chr121072 107 ------
NM_001039712chr121072 107 ------
NM_001039762chr102571 100 --1725 --
NM_001039802chr1----1117 --
NM_001039840chrX145681 5622 5330 4322 4172 4148 3670 1741 1682 1569 1384 769 498 55 1321 1380 --
NM_001039888chr12724 615 --1226 --
NM_001039916chr1231037 1010 479 ------
NM_001039917chr1231037 1010 479 ------
NM_001039918chr1231037 1010 479 ------
NM_001039919chr1231037 1010 479 ------
NM_001039920chr1231037 1010 479 ------
NM_001039937chr1373294 3074 2734 2702 1233 1012 693 --1934 1520
NM_001039960chr1251702 1664 619 463 114 11067 ----
NM_001040057chr721250 536 ------
NM_001040059chr172569 152 ------
NM_001040092chr82350 135 ------
NM_001040110chr71694 --1557 --
NM_001040113chr161876 ------
NM_001040134chr1941423 1200 589 391 11179 1598 --
NM_001040142chr21916 ----11818
NM_001040143chr21916 ----11818
NM_001040144chr1631972 1788 467 ------
NM_001040146chr1631972 1788 467 ------
NM_001040152chr751852 1180 555 80 54 --11164 13705
NM_001040153chr131259 ------
NM_001040157chr432702 841 465 --12718 1675
NM_001040158chr51537 ------
NM_001040159chr421302 979 ------
NM_001040167chr781208 1022 474 420 374 186 152 73 ------
NM_001040172chr571407 1349 1277 650 638 627 36 ------
NM_001040173chr571407 1349 1277 650 638 627 36 ------
NM_001040202chr441708 1014 982 337 ------
NM_001040214chr642310 1881 583 317 2562 535 ----
NM_001040260chr481144 1048 947 780 767 482 191 179 ------
NM_001040261chr481144 1048 947 780 767 482 191 179 ------
NM_001040284chr1655868 4788 3943 726 48 25416 1270 15079 --
NM_001040402chr442864 2529 2326 1058 11124 ----
NM_001040429chr1362894 1159 763 701 374 142 12974 ----
NM_001040431chr17261 24 ------
NM_001040439chr1641466 1344 1119 397 --1221 --
NM_001040441chr184473 3893 3801 3688 3329 1785 1450 798 1181 13723 --
NM_001040446chr542207 1096 733 265 11967 ----
NM_001040619chr13342 234 111 ------
NM_001040624chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040625chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040626chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040627chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040628chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040629chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040630chr882654 2429 2291 2132 2045 1022 782 183 ----12004
NM_001040633chr72970 261 1359 ----
NM_001040653chr382565 2521 2408 2298 1972 1701 1665 994 ------
NM_001040665chr784808 4660 4449 4374 1962 1855 1607 1364 14956 --11649
NM_001040666chr73510 151 76 1658 ----
NM_001040694chr1151061 1034 918 257 86 ------
NM_001040712chr923390 3273 13034 12461 --
NM_001040875chr842256 775 702 540 --12329 --
NM_001040876chr431519 410 92 --11295 11838
NM_001042353chr202470 393 ------
NM_001042355chr1695026 4927 4830 4570 3722 3602 655 419 136 13443 ----
NM_001042404chr1--1543 ----
NM_001042406chr63434 257 84 ------
NM_001042412chr1695026 4927 4830 4570 3722 3602 655 419 136 13443 ----
NM_001042413chr933199 2735 476 --22692 2532 --
NM_001042414chr131194 --152 --
NM_001042425chr651317 1108 251 174 144 ------
NM_001042430chr143558 489 157 ------
NM_001042453chrX21158 98 --11126 --
NM_001042472chr206540 485 468 177 106 38 ------
NM_001042473chr1021371 258 ------
NM_001042476chr16101994 1799 1762 1632 732 605 595 465 260 26 ------
NM_001042479chrX41869 1682 1538 660 --1366 --
NM_001042480chrX41869 1682 1538 660 --1366 --
NM_001042481chr1452694 623 474 413 222 11777 21723 656 --
NM_001042486chr202968 405 11350 ----
NM_001042492chr1783287 2786 2636 2137 372 186 75 69 23519 2826 12684 --
NM_001042494chr1573846 3670 3348 3262 2806 1512 227 --22487 936 --
NM_001042495chr1573846 3670 3348 3262 2806 1512 227 --22487 936 --
NM_001042496chr1573846 3670 3348 3262 2806 1512 227 --22487 936 --
NM_001042497chr1573846 3670 3348 3262 2806 1512 227 --22487 936 --
NM_001042510chr8--2545 372 11480 --
NM_001042511chr8--2545 372 11480 --
NM_001042517chr131321 ----153
NM_001042537chrX52157 1964 966 473 467 ------
NM_001042548chr23784 712 308 1770 ----
NM_001042555chr1294765 4285 4274 3224 1293 1035 680 559 407 24570 889 1895 24626 3776
NM_001042599chr2137822 7158 6709 6437 6290 6147 5822 5762 5639 5630 5554 5506 665 1555 --16175
NM_001042601chr31560 --22168 219 --
NM_001042603chr1264656 4361 3954 3541 1540 968 14237 11430 1488
NM_001042610chr1631176 947 244 --11188 --
NM_001042632chr2062361 2213 852 525 333 231 --12123 --
NM_001042633chr2062361 2213 852 525 333 231 --12123 --
NM_001042669chr431242 755 180 ------
NM_001042681chr122457 838 11890 ----
NM_001042682chr122457 838 11890 ----
NM_001042682chr122457 838 11890 ----
NM_001042723chr19--142 ----
NM_001042728chr124753 679 214 95 ------
NM_001042749chrX21813 723 11831 --11410
NM_001042750chrX21813 723 11831 --11410
NM_001042751chrX21813 723 11831 --11410
NM_001043318chr1473917 3709 3390 1388 1047 773 693 --13399 --
NM_001043351chr142011 1894 1550 742 1454 ----
NM_001044305chr611196 --21254 479 --
NM_001044385chr273872 3766 3619 2882 1473 1361 1047 ----21481 517
NM_001045556chr851178 467 435 334 28 ------
NM_001045557chr851178 467 435 334 28 ------
NM_001046chr533056 403 336 1835 ----
NM_001048183chr163714 3222 2621 1323 940 373 ------
NM_001068chr3148 ------
NM_001070chr17--132 ----
NM_001071775chr1331532 1483 1205 ------
NM_001077628chr13261 124 36 --148 --
NM_001079874chr121442 654 ------
NM_001083620chr422400 942 1194 ----
NM_001092chr1762310 2291 1777 657 246 219 ------
NM_001099678chr376434 4889 4667 4198 2061 1145 388 25116 693 26451 4694 --
NM_001100108chr1127928 7717 6921 6532 6203 5797 3304 2238 1399 589 400 335 25151 597 12945 --
NM_001106chr3188668 7697 7208 7170 6607 3890 3805 3796 3182 2798 2141 2097 1053 1038 588 492 485 314 31260 901 215 ----
NM_001109977chr41243 1578 1625 --
NM_001113490chrX21344 1326 1229 1686 --
NM_001116chr1673046 2980 2115 738 255 95 31 --12030 --
NM_001117chr1822066 1977 --1490 --
NM_001119chr44511 203 73 23 --21492 237 --
NM_001121chr1051894 1858 1808 235 184 1775 ----
NM_001126chr13862 233 150 --1925 --
NM_001127chr222870 207 ------
NM_001128chr1653792 2818 1542 1011 529 33250 2441 731 1181 --
NM_001135chr153662 279 80 ------
NM_001140chr173514 105 78 ------
NM_001144chr1641113 1013 360 42 ------
NM_001146chr821993 520 11865 --11746
NM_001147chr82138 89 --1429 --
NM_001148chr42803 568 --21496 738 --
NM_001157chr101440 1656 1200 --
NM_001160chr1222795 222 ------
NM_001172chr14--1103 ----
NM_001173chr1411449 24643 4007 ----
NM_001186chr2122407 1134 --12520 --
NM_001191chr2071344 1331 1308 1051 1044 403 108 ------
NM_001196chr2241102 900 283 207 ------
NM_001197chr222253 51 --2340 104 --
NM_001201chr453747 2961 1536 1229 592 1424 1946 --
NM_001204chr247433 3066 2119 1960 --17116 --
NM_001206chr942369 2136 410 124 --12832 --
NM_001233chr7--21905 649 ----
NM_001238chr191431 --1465 --
NM_001241chr241909 834 401 83 ----21846 1708
NM_001241chr241909 834 401 83 ----21846 1708
NM_001251chr172569 152 ------
NM_001256chr17----12724 --
NM_001259chr776373 4340 4236 2200 1556 1539 1096 24997 1654 1604 --
NM_001260chr131121 ------
NM_001262chr11327 ------
NM_001264chr64815 773 263 82 --2367 30 --
NM_001270chr51284 173 1925 --
NM_001271chr1553066 2490 2258 2143 2040 13174 ----
NM_001274chr11184 ------
NM_001277chr114916 822 815 688 --11010 --
NM_001278chr101290 ------
NM_001280chr192612 515 ------
NM_001282chr1772536 2520 2400 2130 1868 673 245 12605 ----
NM_001283chr72669 274 --1677 --
NM_001284chr51107 ------
NM_001290chr41358 ------
NM_001298chr211300 ------
NM_001299chr192394 50 ------
NM_001304chr17123711 3655 3566 3371 2696 2595 2464 2434 1452 1021 847 719 23061 1120 ----
NM_001308chr10147 ------
NM_001310chr1242440 1138 699 617 2983 420 ----
NM_001313chr4149 --1130 --
NM_001315chr662161 2035 2007 305 263 240 1611 12099 --
NM_001316chr201371 ------
NM_001326chr11--1411 --1197
NM_001331chr11152837 2227 1891 1877 1867 1790 1119 1079 979 748 728 620 402 145 123 --12784 --
NM_001332chr531532 1018 476 ------
NM_001343chr561585 1416 1349 636 318 99 1132 ----
NM_001349chr21531 ------
NM_001356chrX52544 1621 887 365 315 --1347 --
NM_001357chr11252 ------
NM_001358chr42174 77 ------
NM_001363chrX2614 180 ----1810
NM_001364chr11104731 3826 3540 3370 3306 3286 1652 1439 984 311 ------
NM_001365chr173565 555 319 ------
NM_001378chr21151 ------
NM_001380chr102740 345 --153 --
NM_001386chr861800 1635 764 630 611 396 ----12222
NM_001387chr582971 2558 2513 2214 2151 2053 820 800 1279 12236 --
NM_001390chr1863307 2735 2607 1124 981 200 11152 ----
NM_001391chr18--152 11027 --
NM_001396chr2122645 193 11752 ----
NM_001397chr142305 2018 1949 675 12388 ----
NM_001399chrX42577 599 121 30 1567 ----
NM_001401chr92996 434 ----1578
NM_001402chr631717 1678 1473 --21820 1660 --
NM_001406chr1771482 1303 1172 212 191 139 105 ------
NM_001407chr341637 503 367 120 1641 1417 11621
NM_001412chrX33328 3045 335 146 ----
NM_001417chr1231828 1724 338 ------
NM_001418chr11----2718 609 --
NM_001418chr11----2718 609 --
NM_001419chr1964409 4327 1944 1732 1587 1101 13186 ----
NM_001420chr19112517 2415 2357 2262 2156 1094 860 507 382 324 198 ------
NM_001421chrX51764 1577 1251 581 164 ------
NM_001426chr21470 ------
NM_001427chr731672 647 627 11760 11908 --
NM_001429chr223873 310 303 ------
NM_001430chr221829 170 1563 ----
NM_001431chr611142 --1759 --
NM_001438chr133534 2970 334 --13644 --
NM_001448chrX21449 1427 1522 ----
NM_001449chrX71250 1019 506 367 358 56 21 170 ----
NM_001453chr631578 379 229 ------
NM_001493chrX2671 252 --1684 --
NM_001497chr962767 2650 2464 2290 1850 1786 22096 588 22118 222 --
NM_001527chr664586 4475 4030 3685 1761 539 ------
NM_001530chr1411106 --1164 --
NM_001542chr142512 1932 918 707 ------
NM_001543chr5144534 4405 3941 3748 3209 3144 1936 1440 1424 1227 1167 659 395 388 34307 3379 3295 ----
NM_001555chrX145 ------
NM_001566chr2157 ------
NM_001584chr111983 ------
NM_001587chrX42027 519 321 296 ------
NM_001604chr111135 ------
NM_001614chr171128 ------
NM_001614chr171128 ------
NM_001616chr232578 2352 153 12609 12720 --
NM_001621chr7--1805 ----
NM_001621chr7--1805 ----
NM_001622chr31315 ------
NM_001626chr19133350 3302 3009 2873 2248 1354 1286 1172 686 530 434 394 205 1753 ----
NM_001634chr621500 818 --1201 --
NM_001635chr73885 424 351 --188 --
NM_001642chr1131123 826 424 --1317 --
NM_001649chrX32432 2172 2007 ------
NM_001650chr1863333 1338 1328 1075 625 46 ------
NM_001654chrX2332 87 ------
NM_001656chr51428 ------
NM_001659chr12122345 2136 2037 1880 1076 1067 818 397 340 201 126 118 1824 ----
NM_001660chr31252 ------
NM_001661chr171531 ------
NM_001663chr1412169 --2276 235 --
NM_001664chr32915 170 1210 1350 --
NM_001665chr116396 387 145 62 54 34 2474 83 2421 129 --
NM_001668chr162121 1504 865 756 346 154 --52279 2264 2164 1765 409 --
NM_001677chr141109 717 317 242 ------
NM_001678chr1781795 1606 1565 1527 1484 340 51 40 ------
NM_001679chr33274 198 166 ------
NM_001682chr1222764 2599 1755 11167 --
NM_001683chr352385 2215 1806 1043 740 1761 1938 1782
NM_001684chr194219 3633 3595 3513 3161 1639 1463 1433 536 23405 355 13032 --
NM_001688chr14656 565 241 195 ------
NM_001695chr884296 3687 3513 3328 2900 1508 974 31 13743 ----
NM_001699chr1951720 1687 1634 1260 524 ------
NM_001701chr921151 576 ------
NM_001706chr33836 825 677 ------
NM_001709chr1141795 746 335 169 ------
NM_001717chr15124 ------
NM_001723chr6----1193 --
NM_001726chr1--1121 ----
NM_001730chr1321392 1126 ------
NM_001730chr1321392 1126 ------
NM_001741chr111249 ------
NM_001742chr721393 652 ------
NM_001743chr2153 1173 ----
NM_001744chr52580 54 ------
NM_001745chr51385 ------
NM_001748chr11923 1932 ----
NM_001753chr731431 661 561 --11848 1584
NM_001754chr2174193 3559 3207 3110 2715 2606 1440 --33362 3179 3141 --
NM_001755chr16--42238 1808 857 774 11993 --
NM_001759chr12105203 4785 4037 3846 3394 3320 1597 1530 550 318 14735 1603 13816
NM_001760chr61371 --2857 798 1364
NM_001773chr131327 965 547 ------
NM_001777chr353443 2651 2575 735 377 --1302 12892
NM_001788chr71624 --1170 --
NM_001789chr331388 641 268 ----1132
NM_001791chr1----1117 --
NM_001792chr181245 ------
NM_001798chr1231097 1087 331 1110 ----
NM_001806chr1932483 2401 2008 ----12796
NM_001821chr184560 4449 3894 3459 1952 1339 849 792 --11097 --
NM_001826chr1286 45 ------
NM_001839chr13695 658 181 1133 ----
NM_001842chr91471 --1525 --
NM_001843chr12------1239
NM_001844chr122281 112 1355 ----
NM_001845chr131331 1125 ----
NM_001854chr1----31498 573 145 --
NM_001858chr644294 4079 3499 1238 11016 11200 --
NM_001859chr963717 3523 3067 2428 850 529 ----13887
NM_001875chr2--11085 --1131
NM_001895chr2031202 421 25 ------
NM_001901chr63858 674 334 ------
NM_001904chr311007 ------
NM_001914chr182328 298 ------
NM_001915chr1731577 1526 343 ------
NM_001918chr198634 8482 8255 8059 7715 6724 6057 2903 800 16411 29278 2981 1639
NM_001921chr461187 1125 1086 1013 464 273 --2804 64 --
NM_001923chr113607 56 48 ------
NM_001924chr1----1370 --
NM_001932chr173749 649 620 ------
NM_001935chr221025 809 ------
NM_001938chr12524 366 ------
NM_001939chrX93443 3026 2509 1473 1415 837 793 504 322 13403 13629 --
NM_001941chr1863809 3574 2707 1247 1171 249 2678 532 11098 --
NM_001942chr1852058 1827 1680 652 320 --1422 11478
NM_001945chr541038 998 337 195 --1244 --
NM_001946chr121233 ----1810
NM_001949chr642362 779 424 305 ------
NM_001951chr82610 499 --1405 --
NM_001964chr55830 775 391 318 237 ------
NM_001967chr32384 108 ------
NM_001969chr1443578 3495 3191 891 1620 22618 990 --
NM_001977chr42589 583 11372 ----
NM_001980chr1252230 1903 1875 1572 1480 ------
NM_001981chr142330 880 863 315 ------
NM_001982chr1241007 809 359 50 ------
NM_001987chr1241652 1289 647 621 23732 1567 44269 2951 1157 681 --
NM_001995chr42969 462 2406 175 ----
NM_001999chr511122 ------
NM_002015chr1323131 1339 ------
NM_002017chr1111053 11267 ----
NM_002019chr131755 ------
NM_002023chr121343 519 21125 532 11642 --
NM_002024chrX21669 550 --1438 --
NM_002025chrX148954 8911 8837 8684 8329 7686 7099 7083 6773 6333 1889 1761 1429 794 --13216 1826
NM_002026chr22990 116 ------
NM_002036chr1144 ------
NM_002040chr2112849 ------
NM_002041chr15--197 ----
NM_002045chr32122 99 ------
NM_002051chr1011113 ------
NM_002055chr1751677 1608 1516 633 413 21358 160 ----
NM_002061chr121720 568 ------
NM_002062chr631596 1262 1059 ------
NM_002063chrX51124 980 936 800 349 ------
NM_002065chr131207 406 132 --1550 --
NM_002069chr721684 634 --1449 --
NM_002072chr92648 29 ------
NM_002076chr1253232 3198 3192 2887 2437 12508 ----
NM_002077chr931515 688 402 ------
NM_002079chr102455 120 ------
NM_002081chr291699 1340 1246 1102 641 376 228 182 174 --1525 --
NM_002082chr55890 790 678 637 102 ------
NM_002083chr14----171 --
NM_002092chr484261 4082 1871 1621 1155 937 636 407 ------
NM_002095chr8163 ------
NM_002103chr1951009 849 200 118 30 --1711 --
NM_002106chr41107 ------
NM_002107chr1--1444 ----
NM_002111chr4103323 2899 2858 2415 1530 614 383 324 167 71 12973 --11096
NM_002114chr62454 196 ------
NM_002126chr1743744 1275 1210 218 23149 2738 ----
NM_002128chr1342575 784 475 184 ------
NM_002130chr5--1179 1547 --
NM_002135chr12158 --1177 --
NM_002137chr722003 1762 --1245 --
NM_002138chr41627 --1251 --
NM_002139chrX2565 496 ------
NM_002140chr91411 1991 1451 --
NM_002146chr171917 1581 ----
NM_002147chr171234 ------
NM_002148chr22656 565 --1597 --
NM_002149chr26736 675 573 562 96 78 --1637 --
NM_002158chr232878 781 179 12611 12410 --
NM_002193chr251320 608 538 514 330 --1618 --
NM_002196chr202404 36 ------
NM_002196chr202404 36 ------
NM_002199chr42635 315 ------
NM_002202chr53867 418 121 ------
NM_002203chr553472 2985 2934 2849 689 32878 2689 636 13604 --
NM_002204chr1731353 256 73 21220 419 ----
NM_002206chr12134 1346 ----
NM_002211chr1041161 1101 940 242 --1431 --
NM_002214chr721318 655 14929 12199 --
NM_002222chr3--1408 1233 --
NM_002223chr1273696 3566 3080 1424 900 646 42 ------
NM_002224chr6134 1762 --1249
NM_002230chr173944 164 153 2923 683 ----
NM_002235chr1261332 1200 1171 627 445 242 ------
NM_002240chr212223 165 ----1538
NM_002247chr1032343 905 258 ------
NM_002251chr2071810 1550 491 465 389 103 31 --11724 --
NM_002252chr21421 ------
NM_002254chr242392 1567 1465 158 --2619 226 --
NM_002264chr394996 4398 3916 3646 1868 1589 1294 147 134 13107 ----
NM_002265chr171361 ------
NM_002267chr1331850 448 106 ------
NM_002268chr331619 1371 190 ------
NM_002270chr565435 4683 4548 1397 570 369 11513 ----
NM_002274chr174351 250 77 53 ------
NM_002280chr171249 ----144
NM_002285chr274179 3335 3002 1258 1229 626 477 --11479 11368
NM_002290chr621353 1022 1402 ----
NM_002293chr152706 2667 1687 124 66 12687 11934 --
NM_002298chr1331638 1434 61 21611 417 1528 --
NM_002313chr1094864 4115 4102 3950 1867 1243 523 359 50 11892 --1932
NM_002319chr77670 317 263 241 234 156 86 ------
NM_002332chr122547 222 ------
NM_002334chr1141995 1719 637 102 31967 1298 623 ----
NM_002336chr1234629 1637 957 ----1286
NM_002355chr1241127 994 163 112 ------
NM_002356chr631951 368 262 ------
NM_002359chr17144191 3989 3937 3819 3627 3604 3511 2887 1412 1361 1126 660 489 65 14181 ----
NM_002373chr1531222 462 256 ------
NM_002374chr222592 247 ------
NM_002375chr3112332 2107 2013 1748 1726 1684 1602 1584 773 690 309 --1530 --
NM_002376chr141473 1212 ----
NM_002382chr1441072 383 367 325 1445 ----
NM_002385chr184473 260 115 29 153 ----
NM_002387chr584776 3637 3585 2044 1806 1422 201 141 --15058 --
NM_002395chr631524 1099 195 --11036 --
NM_002397chr542235 1795 1443 504 --11476 --
NM_002398chr22316 129 ------
NM_002399chr1531301 897 319 ------
NM_002401chr1781735 938 780 619 557 307 231 138 1595 ----
NM_002402chr7177 --1457 --
NM_002412chr101102 ------
NM_002419chr111414 2387 37 1450 --
NM_002428chr1661134 1105 1006 953 886 139 ------
NM_002430chr225954 852 784 612 380 ------
NM_002438chr102586 118 ------
NM_002444chrX71993 1713 1433 1377 1333 670 495 21879 328 1309 11825
NM_002448chr41541 ------
NM_002449chr52216 95 ----11043
NM_002451chr963863 3830 2823 2805 2781 2767 1695 23712 108 1676
NM_002473chr2241211 1040 123 112 11303 ----
NM_002480chr122571 327 --1128 --
NM_002481chr1147957 7627 7578 7267 7223 7213 6843 4965 2744 2067 1732 831 402 75 15460 56637 6629 495 263 178 --
NM_002494chr4128 ------
NM_002499chr1582286 2276 2026 1763 1521 925 911 172 ------
NM_002500chr21153 ------
NM_002501chr1973934 3448 2938 1202 1013 964 350 44016 3409 1539 493 1830 --
NM_002505chr651507 1388 1172 166 100 ------
NM_002508chr151631 738 499 278 84 3803 621 292 ----
NM_002509chr202772 213 ------
NM_002515chr1431626 1578 424 ------
NM_002520chr5176 ------
NM_002522chr1782755 2451 1328 825 789 670 236 150 ------
NM_002537chr153997 953 697 ------
NM_002544chr172358 65 ------
NM_002545chr1194914 4732 4584 3684 3545 2062 2021 1947 482 1441 ----
NM_002546chr8--1302 1731 --
NM_002552chr221118 153 ------
NM_002553chr72381 329 ------
NM_002556chr1121620 1415 22124 182 ----
NM_002569chr1571422 1398 1293 1264 1234 998 350 ------
NM_002575chr182223 110 --2439 393 --
NM_002576chr11196 --21193 82 --
NM_002577chr342806 2597 1483 472 --13963 --
NM_002578chrX1440 ------
NM_002579chr1941423 1200 589 391 11179 1598 --
NM_002581chr975059 4194 2029 1281 821 324 132 2931 857 --14620
NM_002583chr12----1242 1397
NM_002586chr611077 --1419 --
NM_002588chr571585 1461 1255 561 352 154 128 --1709 --
NM_002589chr4279 22 ------
NM_002590chr131455 1103 ----
NM_002594chr2062502 899 721 705 188 54 ----1222
NM_002595chr122364 117 11240 ----
NM_002600chr151469 1200 438 404 195 ------
NM_002609chr551210 721 150 101 23 ------
NM_002613chr16114256 3670 3365 1831 1352 961 876 436 258 229 24 ------
NM_002616chr172445 56 ------
NM_002633chr12508 451 --1170 --
NM_002634chr173874 855 802 ------
NM_002641chrX52019 1732 1362 709 573 11889 ----
NM_002645chr1152738 2608 2330 2155 960 22838 622 12213 --
NM_002648chr651196 1027 830 447 41 1961 ----
NM_002651chr12790 270 ------
NM_002655chr843286 1997 1960 211 150 13681 --
NM_002656chr62848 177 ------
NM_002657chr20113252 2968 2857 2595 2529 2489 2472 1374 1344 1286 1015 33361 3174 3150 ----
NM_002660chr2041168 476 431 193 --11207 --
NM_002668chrX2252 126 ------
NM_002670chr341511 1035 103 44 ------
NM_002687chr1421204 511 193 1403 --
NM_002693chr15--1357 1343 1381
NM_002699chr12969 269 ------
NM_002705chr16189 --1253 --
NM_002709chr2------1748
NM_002710chr123735 385 347 ------
NM_002713chr121183 242 ----11216
NM_002714chr63968 830 719 ------
NM_002716chr1163280 3272 3195 3109 3018 2945 ------
NM_002719chr1482015 1927 1556 830 739 712 299 220 --11755 12435
NM_002721chr94496 454 121 37 ------
NM_002734chr1751891 1532 698 539 181 12172 1889 --
NM_002737chr1785863 5598 4620 2430 1949 1177 1083 217 11356 35917 5663 5519 --
NM_002738chr1621033 299 --1149 --
NM_002742chr143607 288 73 ----1624
NM_002745chr22154505 4158 4033 3598 3518 2953 2834 1752 1545 1428 1352 1331 1144 982 899 --1351 --
NM_002747chr1841798 1323 147 100 1165 ----
NM_002748chr152952 316 ------
NM_002752chr5--1132 1126 --
NM_002753chr42635 56 ------
NM_002763chr12206 56 ------
NM_002764chrX1854 ------
NM_002765chrX1418 ------
NM_002768chr1661250 501 363 195 80 59 ------
NM_002779chr103573 540 363 ------
NM_002787chr7--1492 ----
NM_002790chr1----154 --
NM_002808chr31111 ------
NM_002814chrX--2551 54 ----
NM_002819chr1941115 997 380 349 31344 957 336 1265 --
NM_002821chr62811 85 1110 ----
NM_002822chr121433 --21806 687 --
NM_002824chr12198 --1345 --
NM_002825chr7------1526
NM_002827chr2021757 1478 ----11770
NM_002829chr931233 1009 345 21219 260 1267 --
NM_002833chr1521193 408 1245 ----
NM_002834chr1233892 3389 2955 --23367 1237 --
NM_002835chr71652 2214 151 ----
NM_002836chr20137 ------
NM_002837chr1284230 3997 3546 3490 3077 1365 988 600 44361 3156 2859 1216 24634 1684 2488 75
NM_002838chr1----1482 --
NM_002839chr923390 3273 13034 12461 --
NM_002840chr121190 515 --11278 --
NM_002841chr3----1467 --
NM_002843chr1153029 2281 2230 523 64 ------
NM_002844chr621360 1295 ------
NM_002849chr12----2957 894 --
NM_002850chr19145 --1767 --
NM_002851chr71168 1501 ----
NM_002855chr11153453 3305 3193 3117 3012 2847 2700 2675 2666 2568 2456 1207 763 719 280 --1845 --
NM_002856chr19----1307 --
NM_002858chr12439 399 --1235 --
NM_002861chr174497 458 84 36 ------
NM_002868chr1272401 2261 2231 1843 1823 1566 671 ------
NM_002869chr1131521 1405 556 --11979 --
NM_002871chr171977 1509 1440 411 185 132 92 31944 593 333 ----
NM_002873chr5--1389 ----
NM_002874chr952367 2239 2096 1588 939 --1336 --
NM_002880chr33243 217 159 ------
NM_002886chr343591 3360 1049 171 11803 ----
NM_002890chr5280 40 ------
NM_002892chr1421165 524 --11101 11475
NM_002893chrX1251 ------
NM_002895chr203844 216 66 ------
NM_002897chr2--1612 1703 --
NM_002898chr123671 183 62 --1607 --
NM_002902chr15----1677 --
NM_002903chr172240 21 ------
NM_002906chr113456 436 380 --12425 --
NM_002924chr11173 ------
NM_002931chr63221 209 52 ------
NM_002938chr471770 1690 1630 1281 768 716 129 ------
NM_002940chr431519 410 92 --11295 11838
NM_002941chr3154 --11289 11081
NM_002942chr3130 ------
NM_002953chr12290 163 --1570 --
NM_002955chr631632 666 77 1224 ----
NM_002956chr122533 156 --11257 --
NM_002957chr9173775 3765 1300 1072 854 830 795 747 675 648 595 588 461 447 138 90 25 ----13387
NM_002959chr184170 4082 3929 3684 3347 3109 3080 649 24218 3663 13966 --
NM_002968chr163757 391 315 --1855 --
NM_002971chr3--1864 ----
NM_002977chr273382 2901 2767 2190 1182 421 305 ------
NM_002994chr431963 1838 1289 ------
NM_002996chr1661627 1417 1225 580 339 314 ------
NM_002997chr241909 1883 1382 1292 ------
NM_002998chr831656 428 414 --1450 --
NM_003010chr1731884 465 229 22290 1874 ----
NM_003012chr84747 671 609 63 11165 1407 --
NM_003013chr41135 ------
NM_003016chr1721755 1410 --11713 --
NM_003022chrX11014 --11256 --
NM_003026chr921109 1004 ------
NM_003027chr153127 93 62 ------
NM_003028chr983756 3462 3206 2977 2954 2435 868 23 --21190 281 --
NM_003029chr131269 436 271 --2311 33 --
NM_003031chr161755 ------
NM_003034chr1276386 6276 5362 3114 2873 2448 478 17003 12959 --
NM_003035chr12335 295 ------
NM_003036chr111156 ------
NM_003038chr252393 453 226 86 40 12673 ----
NM_003045chr13104936 4582 3773 3554 3427 1615 920 818 622 550 11164 ----
NM_003047chr131053 545 80 ------
NM_003048chr232563 499 270 ------
NM_003051chr121817 776 1285 ----
NM_003060chr541296 1243 890 111 ------
NM_003063chr11138 155 161 --
NM_003068chr82849 691 1446 ----
NM_003070chr91625 ----1552
NM_003071chr311900 ------
NM_003072chr191182 ------
NM_003074chr361840 1653 1403 338 262 225 ------
NM_003076chr1241079 520 362 79 ------
NM_003081chr202309 130 ------
NM_003085chr52449 76 1168 ----
NM_003088chr75442 256 249 144 112 ------
NM_003099chr15126284 6235 5577 5266 4599 4462 4303 1938 1014 807 56 41 11872 32615 2123 942 16115
NM_003104chr1521263 293 1163 1211 --
NM_003107chr622414 2021 ------
NM_003108chr257236 6498 5529 1812 257 14911 11099 --
NM_003110chr178704 395 248 189 162 100 89 50 ------
NM_003111chr2------1147
NM_003112chr722667 2454 --13082 --
NM_003113chr22615 180 ------
NM_003127chr94217 76 59 38 ------
NM_003128chr272220 1976 1966 1841 1813 450 25 22600 1064 ----
NM_003130chr741208 1072 71 62 ----1248
NM_003131chr691885 1586 1417 585 520 367 321 247 60 ------
NM_003137chr61264 ------
NM_003139chr111878 ------
NM_003140chrY143 ------
NM_003142chr22242 100 ------
NM_003144chr61879 41996 1859 746 44 1395 --
NM_003146chr112292 32 --1123 --
NM_003149chr341640 1621 519 49 --21654 1209 11504
NM_003150chr1732273 1551 316 ------
NM_003153chr124883 268 106 60 --179 --
NM_003155chr831925 905 421 12030 ----
NM_003156chr1131321 205 36 ------
NM_003161chr1723444 3236 23515 1411 --1857
NM_003162chr22992 96 ------
NM_003164chr111177 --1364 --
NM_003168chr1751067 776 345 267 31 1393 ----
NM_003170chr173545 227 89 ------
NM_003173chrX41264 1255 1191 70 1137 11285 --
NM_003174chr103736 698 284 --1308 --
NM_003178chr342061 1583 1441 197 ------
NM_003183chr21818 --2778 618 --
NM_003184chr8264 33 ------
NM_003185chr202507 299 ------
NM_003188chr61282 1612 ----
NM_003189chr162574 2287 691 650 552 386 21012 598 ----
NM_003199chr1845520 5442 3934 1095 1530 24777 3705 --
NM_003200chr1972370 1960 1756 1747 1543 585 48 ----1400
NM_003204chr1731582 1257 1205 --1100 --
NM_003211chr1221435 1256 ------
NM_003216chr22113133 3045 2206 2164 2072 1035 963 861 842 626 269 12268 ----
NM_003220chr651317 1108 251 174 144 ------
NM_003221chr633185 2999 1319 --13301 --
NM_003223chr163831 538 276 ------
NM_003234chr33955 859 213 ------
NM_003236chr263084 3015 2400 2216 875 86 12600 ----
NM_003239chr141708 1434 ----
NM_003242chr34848 679 284 28 --1190 --
NM_003243chr11789 21202 1188 1965 --
NM_003244chr181366 --1435 --
NM_003247chr61167 2646 468 131 --
NM_003253chr2131304 1179 86 148 11491 --
NM_003255chr176994 824 793 757 523 296 ------
NM_003257chr151155 11275 ----
NM_003269chr6----21005 250 --
NM_003274chr2132764 567 404 --1962 12382
NM_003275chr921181 60 --21173 25 --
NM_003286chr20179 1179 ----
NM_003288chr2071460 1362 1341 1292 995 976 237 11249 ----
NM_003298chr3125922 5460 5160 4889 3983 3802 3781 2450 2186 1941 1695 1069 14652 1205 --
NM_003318chr6----1216 --
NM_003319chr21382 --1775 --
NM_003320chr1174339 4120 3188 2794 1196 967 922 13149 22971 1316 --
NM_003334chrX1152 ------
NM_003337chr511537 --11131 1325
NM_003339chr511615 ----11553
NM_003340chr43484 383 154 1340 ----
NM_003342chr1773020 2602 2565 2487 2255 2148 686 13264 ----
NM_003344chr741413 1378 1106 642 --11319 --
NM_003347chr2241695 896 459 214 11655 22356 2105 --
NM_003348chr121168 ----1470
NM_003349chr202544 376 --11209 --
NM_003350chr81739 ------
NM_003352chr23934 817 673 ------
NM_003360chr4----1114 --
NM_003368chr11518 ------
NM_003369chr1162682 2648 2175 2094 2021 385 ------
NM_003373chr1041748 704 607 326 --11662 --
NM_003376chr641484 1363 1353 1187 ------
NM_003376chr641484 1363 1353 1187 ------
NM_003380chr10187 ------
NM_003385chr22767 340 ------
NM_003387chr232102 1123 480 12619 ----
NM_003390chr11----1799 --
NM_003392chr311542 --12976 --
NM_003394chr12169 ------
NM_003403chr142209 71 ----1200
NM_003405chr222684 261 ------
NM_003406chr841946 1722 1430 357 ------
NM_003410chrX32900 2363 2017 --11026 --
NM_003411chrY21840 165 ------
NM_003412chr322922 1112 --1721 --
NM_003413chrX3576 311 262 --1175 11917
NM_003418chr31664 ------
NM_003421chr1061333 1147 1085 947 938 80 ------
NM_003423chr1922008 145 --11002 --
NM_003427chr63683 543 465 ------
NM_003432chr5172 ------
NM_003452chr93718 661 278 ------
NM_003453chr131675 ------
NM_003457chr171661 --1592 --
NM_003458chr3133970 3960 3447 3430 3126 3048 2778 2626 2472 1589 1023 443 278 --23365 583 --
NM_003463chr663301 2666 2643 2337 1357 802 --21057 832 --
NM_003468chr242828 2675 1302 221 23355 3004 13501 --
NM_003469chr2--1320 ----
NM_003470chr1691667 1655 1648 1557 1176 714 352 175 78 ------
NM_003478chr1122803 939 1126 --12103
NM_003481chr123504 463 92 ------
NM_003482chr1252671 2096 1075 1015 770 1912 ----
NM_003483chr1212953 --12061 --
NM_003489chr2121162 341 --11072 --
NM_003503chr12436 169 --11287 --
NM_003507chr211321 ------
NM_003558chr91505 ------
NM_003559chr17103656 3572 3184 2808 2564 1421 1375 1161 974 550 ------
NM_003563chr1731296 1215 1135 ------
NM_003564chr12137 27 ------
NM_003566chr1223005 496 13304 ----
NM_003574chr1894992 3882 3818 3747 3491 2208 1614 1488 138 11232 25051 1900 --
NM_003575chr751346 1306 1088 277 78 ------
NM_003576chr1372754 2721 2625 1912 1167 657 567 1718 ----
NM_003581chr23675 435 369 ------
NM_003583chr1232819 2798 411 --1440 13946
NM_003586chr162512 457 ------
NM_003590chr263888 3699 2806 1599 1148 459 --12626 --
NM_003591chr101169 ------
NM_003601chr4184 ------
NM_003602chr72442 328 --1119 --
NM_003603chr411535 1231 --195
NM_003612chr152500 24 ------
NM_003613chr15130 --1133 --
NM_003615chr343954 1513 822 503 --42498 786 754 179 --
NM_003621chr11--2486 398 ----
NM_003626chr11------11087
NM_003629chr131376 1335 812 --12548 --
NM_003630chr61100 ------
NM_003633chr542435 1019 706 687 ----1159
NM_003635chr10131 --1514 --
NM_003644chr17166590 5933 5857 5374 4521 4230 4182 2465 2399 1661 942 921 614 332 210 81 --11457 --
NM_003648chr282479 2367 2347 2311 1642 742 524 391 12157 ----
NM_003651chr12----1486 --
NM_003654chr111113 177 ----
NM_003658chr112678 579 --1232 --
NM_003659chr2----21073 786 --
NM_003663chr322496 303 --11341 --
NM_003664chr5168 ------
NM_003670chr341204 1140 1025 484 ------
NM_003671chr993128 3107 2728 2507 1361 1067 1028 744 143 --11303 --
NM_003672chr12554 108 11941 ----
NM_003677chr1241977 1459 362 279 ------
NM_003681chr21115545 5319 5101 4903 2455 2348 2083 1994 1239 1001 989 25464 81 35888 5279 1514 --
NM_003684chr16944 799 783 458 317 101 ------
NM_003692chr92845 798 ------
NM_003701chr1331048 807 323 --2772 138 --
NM_003704chr41154 ------
NM_003713chr131198 422 63 ------
NM_003716chr32192 103 1987 154 11052
NM_003726chr172265 36 ------
NM_003735chr571585 1461 1255 561 352 154 128 --1709 --
NM_003736chr571585 1461 1255 561 352 154 128 --1709 --
NM_003741chr32117 103 ------
NM_003743chr22613 432 11848 ----
NM_003749chr1322306 911 --22418 932 --
NM_003750chr10----1748 --
NM_003763chr2043140 2733 1090 471 ------
NM_003766chr171531 129 ----
NM_003768chr151824 1632 1462 1163 639 21533 1497 ----
NM_003769chr12--1275 ----
NM_003774chr1243224 2527 1026 831 12593 12316 1205
NM_003787chr1841120 615 212 136 11322 ----
NM_003794chr3136 1438 ----
NM_003795chr61129 --1105 --
NM_003796chr191242 ------
NM_003800chr632375 1801 1775 ------
NM_003822chr163195 3035 2273 1139 797 520 22974 2895 ----
NM_003825chr1531419 1358 184 ------
NM_003831chr1831628 1414 502 ------
NM_003835chr17--1261 147 --
NM_003860chr112336 74 ------
NM_003861chr1412849 --12323 --
NM_003870chr1522096 1909 ------
NM_003872chr242718 2343 864 631 ------
NM_003873chr1042089 824 754 417 11691 21940 742 --
NM_003877chr122855 83 --1298 --
NM_003884chr331472 1457 256 ------
NM_003887chr242255 903 790 126 ------
NM_003893chr102411 29 ------
NM_003899chr13102435 2272 2164 2077 1985 1918 723 477 443 120 11979 1411 12552
NM_003902chr11327 ------
NM_003908chr2051330 1055 970 312 157 ------
NM_003909chr852529 2284 804 688 416 12686 ----
NM_003913chr634357 4255 3186 --1430 --
NM_003922chr15145 ------
NM_003931chr6--1530 145 --
NM_003939chr1062920 1519 1489 733 631 469 13338 23681 2821 --
NM_003941chr731691 233 123 ----1555
NM_003942chr112695 107 ------
NM_003953chr172681 2497 2419 1936 1855 1847 1810 1335 1822 --
NM_003954chr1771052 980 566 478 284 166 68 ------
NM_003955chr1751028 532 388 244 148 ------
NM_003956chr10145 ------
NM_003958chr683847 3416 3186 2990 2711 2540 157 92 13262 ----
NM_003966chr5157589 7578 6862 6387 6272 6232 6068 2701 2668 1893 1510 1226 1203 1189 55 25814 5054 1886 --
NM_003971chr171482 --181 --
NM_003972chr1011127 ------
NM_003980chr611020 ------
NM_003992chr151275 ------
NM_003994chr1244337 3545 1639 625 --23795 702 --
NM_004006chrX------12633
NM_004007chrX------12633
NM_004009chrX------12633
NM_004010chrX------12633
NM_004011chrX------12633
NM_004012chrX------12633
NM_004013chrX------12633
NM_004014chrX------12633
NM_004015chrX------12633
NM_004016chrX------12547
NM_004017chrX------12633
NM_004018chrX------12547
NM_004020chrX------12633
NM_004021chrX------12547
NM_004022chrX------12547
NM_004023chrX------12547
NM_004028chr1863333 1338 1328 1075 625 46 ------
NM_004035chr1795069 4948 4459 4336 4038 3410 1218 1093 551 14756 14910 --
NM_004050chr1462467 2248 1857 632 625 619 --32126 1045 71 --
NM_004055chr1161958 1886 821 653 635 51 1382 ----
NM_004063chr85811 380 290 165 120 ------
NM_004068chr31110 ------
NM_004081chrY31453 1217 727 ------
NM_004089chrX21281 1148 11087 1883 1136
NM_004090chr17123419 3062 3017 2711 2637 2494 2307 882 726 468 341 218 --1784 --
NM_004093chr1353114 670 366 56 48 --12688 --
NM_004094chr1452333 1893 747 665 324 --1159 --
NM_004096chr1051815 1788 1690 1607 775 ------
NM_004097chr23862 853 265 ------
NM_004099chr931977 1683 595 1421 ----
NM_004100chr642117 1721 331 72 22662 657 ----
NM_004102chr14435 250 242 203 ------
NM_004105chr21925 ------
NM_004113chr311963 ------
NM_004114chrX21188 331 ------
NM_004116chr22154 60 1308 1449 --
NM_004124chr1453195 2624 1139 797 79 --1757 --
NM_004130chr32563 545 ------
NM_004134chr52616 214 ------
NM_004156chr8123 ------
NM_004161chr2--11140 ----
NM_004171chr11209301 8621 8386 7921 7742 6825 6361 6008 5940 3861 3585 3191 2817 2230 2097 2022 1967 1372 1003 841 29087 651 59475 2774 610 565 324 --
NM_004176chr173479 143 65 ------
NM_004181chr41323 ------
NM_004185chr12557 153 ------
NM_004187chrX31353 1258 591 --11080 --
NM_004200chr1152953 2875 2061 1050 801 32853 1021 958 153 --
NM_004202chrY3467 286 127 ------
NM_004227chr782841 2367 2021 1919 1208 1195 724 286 --1546 --
NM_004229chrX32158 1548 1524 ------
NM_004230chr1962371 2256 2121 1867 635 100 ------
NM_004232chr1841431 755 661 285 ------
NM_004235chr9--1755 --1715
NM_004236chr151100 ------
NM_004261chr13375 358 206 122 ----
NM_004263chr241256 1189 491 398 11629 ----
NM_004272chr521795 1375 ------
NM_004274chr1443057 2625 2210 746 --12723 --
NM_004279chr752409 2372 2175 917 708 ------
NM_004293chr943457 2400 622 62 12652 --11177
NM_004295chr172419 321 --1269 --
NM_004302chr1252546 2227 1922 758 377 --1602 --
NM_004311chr1052362 2085 1901 1213 1089 ------
NM_004316chr1231096 1073 205 ------
NM_004319chr122906 315 --12305 --
NM_004321chr282700 2484 1369 1303 854 409 219 64 12569 ----
NM_004329chr103508 501 402 --1240 --
NM_004331chr832118 2024 1788 ------
NM_004338chr18125825 5627 5387 5131 5117 4911 4718 4544 2690 2596 2395 969 16999 ----
NM_004342chr72886 201 ------
NM_004349chr841314 1179 1101 72 1893 ----
NM_004352chr161519 ------
NM_004356chr113453 439 39 ------
NM_004357chr114589 527 165 146 ------
NM_004362chr4----1569 --
NM_004364chr1971189 988 976 500 347 319 290 --1854 --
NM_004368chr1941060 969 377 170 ------
NM_004369chr2------1593
NM_004370chr651865 1625 1563 1557 590 32164 1949 490 ----
NM_004379chr21616 1368 ----
NM_004380chr1612207 --1317 --
NM_004385chr52496 62 ------
NM_004389chr22228 98 ------
NM_004392chr1332319 2029 1061 --1423 --
NM_004393chr381976 1951 1893 1799 1466 735 664 376 11792 22221 1625 --
NM_004396chr17144 ------
NM_004397chr1164079 3750 3460 1581 883 69 2850 462 12700 --
NM_004405chr21283 --11048 --
NM_004408chr93385 196 173 --1190 --
NM_004411chr72696 263 144 ----
NM_004416chr1231032 73 54 --1282 --
NM_004417chr5149 ------
NM_004422chr174461 367 74 54 ------
NM_004423chr342197 2064 925 687 1671 12289 --
NM_004426chr1231446 1388 713 31777 777 719 ----
NM_004427chr121112 403 ------
NM_004428chr13721 636 268 ------
NM_004430chr871695 1105 941 872 732 655 147 ------
NM_004432chr931828 327 253 --11767 --
NM_004433chr141792 1552 667 103 11564 ----
NM_004434chr1421890 121 --1329 --
NM_004436chr11576 --1445 --
NM_004438chr242494 2239 2118 436 1731 ----
NM_004440chr6----199 --
NM_004443chr33585 262 86 1740 ----
NM_004447chr1211101 ------
NM_004450chr14----2401 365 --
NM_004454chr341485 884 744 106 --1378 --
NM_004455chr141091 826 766 436 ------
NM_004456chr71168 142 ----
NM_004457chr21593 ------
NM_004458chrX41759 1700 770 369 ------
NM_004459chr1741788 692 432 342 11465 ----
NM_004461chr191187 ------
NM_004475chr1751221 1077 858 458 369 1102 ----
NM_004480chr141283 --1201 --
NM_004481chr152694 1870 1688 386 195 11806 22479 2204 --
NM_004482chr22751 223 ------
NM_004494chr151202 1167 954 806 114 ------
NM_004499chr51475 ------
NM_004501chr134068 3948 1359 --1842 --
NM_004504chr221918 529 --1661 --
NM_004505chr1721649 667 ------
NM_004514chr1772878 2714 2191 2020 1155 434 268 ------
NM_004516chr192989 189 --1450 --
NM_004520chr51119 ------
NM_004529chr911337 1389 1488 --
NM_004530chr165984 299 176 100 41 1481 ----
NM_004537chr1211040 ------
NM_004540chr211781 1308 --1716
NM_004554chr1431840 1368 191 11655 ----
NM_004566chr1082229 2056 1788 965 886 263 215 54 --12533 --
NM_004575chr411161 ------
NM_004577chr71251 ----1523
NM_004580chr1531622 726 42 2344 237 ----
NM_004586chrX64504 4178 3454 1472 725 343 14993 21918 517 --
NM_004588chr1193351 3202 2806 2639 2489 1625 951 832 600 --1205 --
NM_004593chr3--129 --1673
NM_004598chr542450 686 430 111 ------
NM_004600chr11407 ------
NM_004603chr791097 1040 954 830 379 339 309 131 80 ------
NM_004612chr974749 4620 4509 4125 4101 3132 2960 --2824 619 --
NM_004613chr2071450 1287 1201 1184 386 147 79 11260 2304 213 --
NM_004627chr21----1708 --
NM_004631chr11973 ------
NM_004640chr6136 ------
NM_004643chr141733 ------
NM_004660chrY42317 1565 860 363 1214 1345 --
NM_004661chr53932 457 228 --11214 --
NM_004663chr15--1453 11543 2523 129
NM_004670chr1061648 1548 1160 1069 419 35 21657 1604 ----
NM_004687chr1731548 476 326 2835 441 ----
NM_004690chr61113 ------
NM_004698chr12174 36 ------
NM_004703chr1732546 2496 2377 ------
NM_004708chr19----193 --
NM_004709chrX1168 --1517 --
NM_004711chr22163364 3260 3029 2992 2755 2652 2224 1158 992 915 908 654 500 206 109 82 --13338 --
NM_004717chr731266 578 50 --1498 --
NM_004719chr1222622 654 ------
NM_004723chr14819 352 116 28 1409 1233 --
NM_004726chrX84936 4912 4696 3796 1860 1691 776 537 15632 25514 2237 14740
NM_004730chr52721 296 194 11788 --
NM_004734chr134992 787 594 555 ------
NM_004737chr222463 142 ----11264
NM_004738chr2022032 121 ------
NM_004739chr113560 183 48 ------
NM_004740chr172286 76 ------
NM_004742chr3--21871 1834 21673 440 --
NM_004745chr876749 6307 6027 5540 4732 1582 310 35564 1119 931 1793 --
NM_004747chr1031398 607 383 ------
NM_004748chr1543770 1062 733 400 ------
NM_004755chr143859 369 56 ------
NM_004759chr171712 1344 850 778 503 479 390 --11836 --
NM_004762chr1741990 716 497 49 ------
NM_004770chr8178 ------
NM_004772chr531158 582 328 ------
NM_004774chr1732948 2535 1167 ------
NM_004775chr1832383 185 98 12172 ----
NM_004779chr51194 ------
NM_004781chr151671 1133 544 208 146 1444 21546 387 --
NM_004781chr151671 1133 544 208 146 1444 21546 387 --
NM_004783chr162517 472 ------
NM_004788chr1152538 2049 2040 192 146 ----12600
NM_004789chr9--1312 ----
NM_004798chr20103420 3019 1469 1108 925 777 687 597 301 42 --33324 2478 881 --
NM_004799chr11347 ------
NM_004800chr13177 ------
NM_004801chr21454 --1167 --
NM_004814chr1179 --1390 --
NM_004815chr174886 4046 3935 3851 1781 823 125 13418 --13588
NM_004818chr122243 51 ----1557
NM_004821chr51699 --2807 186 --
NM_004822chr17163825 3479 3230 3110 3080 2892 2783 2639 2536 1494 1470 1377 1365 1332 645 350 12440 ----
NM_004824chr641330 1181 1119 277 ------
NM_004831chr19--1942 ----
NM_004836chr2165 ------
NM_004840chrX92376 2328 597 576 410 381 347 52 32 1631 ----
NM_004844chr3--1117 1394 --
NM_004862chr1621081 88 3496 394 294 ----
NM_004867chrX2524 22 ------
NM_004869chr1861586 1434 1280 1248 625 531 --11644 --
NM_004874chr8185 ------
NM_004886chr193189 70 31 ------
NM_004893chr51537 ------
NM_004896chr102469 237 ------
NM_004898chr432412 2291 1955 12524 ----
NM_004902chr202725 223 ------
NM_004904chr7116051 5379 5207 5067 4757 4751 4739 4268 1485 599 540 15126 ----
NM_004905chr12763 183 1370 ----
NM_004906chr62642 92 ------
NM_004912chr711748 11357 11562 --
NM_004921chr12655 527 ------
NM_004922chr103987 980 197 --1180 --
NM_004924chr195897 848 402 353 324 --1315 --
NM_004926chr1431629 375 151 --1296 --
NM_004929chr821490 1339 ------
NM_004937chr1782510 2135 2054 1035 712 639 170 41 1824 ----
NM_004938chr921108 375 ----11095
NM_004945chr193724 577 21 1618 ----
NM_004947chr352301 955 744 629 533 ------
NM_004948chr183985 446 217 11089 ----
NM_004952chr14961 885 352 319 ------
NM_004955chr64573 538 491 470 ------
NM_004956chr744599 3190 2798 429 --13000 --
NM_004957chr92176 77 ------
NM_004960chr162213 40 ------
NM_004961chrX41445 398 316 266 ------
NM_004962chr10145 ------
NM_004968chr71640 ------
NM_004969chr101207 ------
NM_004973chr641665 1329 1127 705 ------
NM_004977chr192561 379 ------
NM_004978chr161667 1654 1636 1045 637 591 --31300 416 382 --
NM_004979chrX21086 306 2768 259 ----
NM_004985chr122867 223 13599 --1494
NM_004992chrX138082 7702 6993 6161 3195 2531 2163 1488 1376 1369 1326 1238 414 28547 5192 26531 1024 --
NM_004992chrX138082 7702 6993 6161 3195 2531 2163 1488 1376 1369 1326 1238 414 28547 5192 26531 1024 --
NM_004999chr674510 4309 4224 3508 3361 742 63 ------
NM_005005chr8--165 ----
NM_005010chr752179 1952 1448 839 319 ------
NM_005011chr71694 --1557 --
NM_005017chr32223 25 ------
NM_005026chr12503 125 --1404 --
NM_005028chr1062156 1772 1721 1676 805 764 --11551 --
NM_005032chrX5336 324 309 273 31 ------
NM_005036chr22117596 6185 5553 5362 5273 5062 2970 1726 1640 743 251 38341 7937 7922 27654 1298 18289
NM_005045chr721015 49 ------
NM_005055chr112182 44 ------
NM_005056chr1264900 4605 4198 3785 1784 1212 14481 11674 1732
NM_005057chr141610 1540 1449 379 ------
NM_005063chr1083572 3137 2980 2637 1437 965 233 171 22941 2374 13735 --
NM_005065chr1464783 4374 3521 2158 1407 466 14231 34830 4445 158 --
NM_005066chr11237 ------
NM_005076chr1103983 3808 3702 2957 2912 1683 1033 975 596 135 12981 1749 --
NM_005078chr1531758 342 156 --21142 599 --
NM_005087chr32684 214 ------
NM_005094chr94721 522 201 161 ------
NM_005096chrX71206 428 422 413 140 57 45 ------
NM_005097chr10----1104 --
NM_005099chr151131 249 176 163 21 1141 ----
NM_005102chr23784 712 308 1770 ----
NM_005109chr382595 2092 2062 984 973 628 603 237 1315 ----
NM_005110chr54800 594 189 142 ------
NM_005112chr43786 730 100 ------
NM_005116chr2064305 1544 1147 570 430 214 --34147 2845 469 --
NM_005119chr121091 410 ------
NM_005121chr1741344 692 528 427 ------
NM_005126chr332024 1585 555 ----11684
NM_005128chr21----1477 --
NM_005135chr1573846 3670 3348 3262 2806 1512 227 --22487 936 --
NM_005151chr1831597 478 323 32270 432 204 1284 --
NM_005153chr163746 724 33 --1144 --
NM_005156chr974671 4413 4243 4072 3437 3338 633 11058 15381 --
NM_005157chr971953 1847 752 564 305 223 187 --1713 --
NM_005159chr1521799 879 --11458 --
NM_005161chr1162200 2031 1550 428 138 53 2677 94 ----
NM_005174chr10149 ------
NM_005178chr192270 51 ------
NM_005180chr101602 --11215 --
NM_005182chr163411 245 189 ------
NM_005184chr1971211 1140 306 222 201 168 27 --1451 --
NM_005186chr113505 474 101 ------
NM_005188chr11287886 7793 7731 7192 6964 6948 6760 6441 6369 6246 6186 6149 6051 5582 5515 5350 3053 2865 2682 2661 2237 1665 1255 1233 961 399 225 113 27526 6079 37460 7314 927 --
NM_005189chr17112473 2391 2322 1947 1866 1847 689 597 442 248 204 ------
NM_005190chr61921 ------
NM_005191chr341059 358 125 110 ------
NM_005197chr1465262 4178 1732 1680 1411 1149 --11645 --
NM_005201chr31170 ------
NM_005202chr142205 604 578 25 ------
NM_005203chr101287 ------
NM_005204chr101996 --1844 --
NM_005206chr1731095 899 89 ------
NM_005207chr2283438 3216 3124 2829 2289 1439 1357 941 22835 46 ----
NM_005214chr2----1417 --
NM_005219chr561382 1372 1256 486 146 50 1274 1721 --
NM_005221chr71217 ------
NM_005225chr2061152 1120 962 459 408 36 ------
NM_005229chrX31086 1044 421 --2105 51 --
NM_005230chr121601 1567 ----
NM_005233chr32976 907 --2724 680 1141
NM_005235chr2137822 7158 6709 6437 6290 6147 5822 5762 5639 5630 5554 5506 665 1555 --16175
NM_005241chr311238 --11349 194
NM_005243chr221257 ------
NM_005244chr20--1612 ----
NM_005249chr142853 647 ------
NM_005254chr1521120 870 ------
NM_005256chr111944 ------
NM_005257chr182880 119 ----11101
NM_005261chr82310 24 1888 ----
NM_005276chr1251317 1306 650 605 226 ------
NM_005276chr1251317 1306 650 605 226 ------
NM_005277chr41730 ------
NM_005281chr13775 670 294 1908 ----
NM_005295chr71238 ------
NM_005310chr172349 25 1260 ----
NM_005311chr731011 717 338 1967 ----
NM_005312chr9102628 2332 2258 2181 2095 1046 942 629 454 30 1925 ----
NM_005316chr111980 ------
NM_005324chr17----12125 --
NM_005327chr42257 57 1498 179 --
NM_005329chr1632044 1685 1562 12028 11573 --
NM_005339chr443106 2758 571 160 ------
NM_005342chrX52514 2031 1926 443 90 1149 22142 478 12534
NM_005349chr4--1512 ----
NM_005358chr1331849 1378 416 ------
NM_005359chr18115808 5187 4983 4872 4828 4666 4225 2235 2223 1718 138 14070 15464 --
NM_005370chr1921246 831 --11270 --
NM_005374chr17112234 2056 1826 1802 1598 1478 711 268 230 206 114 --1879 --
NM_005375chr621180 1158 11094 ----
NM_005386chr201572 ------
NM_005392chr961681 1569 763 605 480 375 ------
NM_005399chr122723 540 33095 1156 437 21009 141 --
NM_005402chr741562 701 682 396 ----1600
NM_005406chr185535 476 301 278 140 ------
NM_005407chr142122 26 ------
NM_005418chr114638 264 138 32 ------
NM_005426chr11344 ------
NM_005430chr122660 395 ------
NM_005433chr18----1906 --
NM_005436chr1053544 3383 3147 1517 523 1770 23932 2744 13662
NM_005437chr101990 1407 ----
NM_005439chr121514 ------
NM_005442chr32430 102 1581 ----
NM_005443chr4--1152 ----
NM_005455chr11297 1639 1221 --
NM_005458chr931586 816 625 --1796 --
NM_005460chr51175 --1112 1209
NM_005461chr2021792 1391 ------
NM_005467chr111162 ------
NM_005474chr1741593 600 371 264 ----1402
NM_005475chr1262879 2826 1021 776 271 34 1875 ----
NM_005476chr911216 ------
NM_005483chr19295 38 ------
NM_005487chr2221758 1358 2410 281 ----
NM_005488chr224735 643 220 42 ------
NM_005493chr61306 ------
NM_005497chr1785487 4986 3924 2445 1910 1145 871 415 1919 ----
NM_005499chr191265 --170 --
NM_005501chr1721166 69 21033 232 ----
NM_005502chr983052 2648 908 899 565 545 439 191 22943 731 ----
NM_005504chr1244980 1968 1473 614 21323 678 16437 --
NM_005506chr422431 41 11138 12870 --
NM_005509chr51136 ----1154
NM_005512chr1141275 736 725 295 1787 11476 --
NM_005517chr1----1348 --
NM_005520chr5192 ------
NM_005522chr72970 391 1529 ----
NM_005523chr751554 1421 466 406 65 ------
NM_005524chr3----1312 --
NM_005529chr11400 21011 860 ----
NM_005541chr231186 926 817 ------
NM_005563chr11646 1805 1827 --
NM_005573chr51180 ------
NM_005578chr32946 251 24173 125 ----
NM_005582chr5--152 ----
NM_005587chr15--151 ----
NM_005596chr9106241 6050 5024 4911 4475 2403 1489 1475 789 53 ----1430
NM_005598chr151577 1446 674 551 354 --21505 1404 --
NM_005602chr31213 1185 ----
NM_005607chr82928 86 ------
NM_005613chr152145 2112 1822 1621 1580 11926 146 --
NM_005614chr72788 709 1836 ----
NM_005617chr5140 ------
NM_005618chr63241 205 66 ------
NM_005626chr11362 --1376 --
NM_005627chr62710 359 ------
NM_005628chr194223 159 40 26 ------
NM_005629chrX4338 262 213 87 ------
NM_005630chr381900 1671 725 372 300 261 137 22 --21843 1529 --
NM_005634chrX1111 ------
NM_005637chr1831648 1391 592 ------
NM_005638chrX41536 1359 606 147 ------
NM_005639chr1241449 1275 196 42 --21831 1250 --
NM_005647chrX72852 2135 2114 1222 835 669 460 13481 ----
NM_005652chr1631077 865 69 ------
NM_005655chr811004 ------
NM_005662chr81327 ------
NM_005665chr184924 4381 1901 1527 1240 386 367 165 14657 13645 --
NM_005667chr22161 50 ------
NM_005668chr564259 3306 3276 3035 2800 1331 1174 ----
NM_005688chr3196 ------
NM_005700chr111355 ------
NM_005704chr131129 777 87 ------
NM_005707chr151150 ------
NM_005715chr642253 2039 1790 148 ------
NM_005717chr14920 163 115 82 1871 ----
NM_005722chr231695 698 107 1306 1349 --
NM_005730chr1262917 2651 1177 1098 680 58 23164 1444 1468 --
NM_005734chr111280 1556 ----
NM_005736chr1051145 1107 1002 448 409 ------
NM_005737chr242843 2696 708 597 --12689 --
NM_005738chr73155 141 96 ------
NM_005746chr732289 492 124 --11075 --
NM_005748chr1263357 3202 3142 2426 2226 172 138 ----
NM_005751chr71338 ------
NM_005754chr51802 --1979 1947
NM_005756chrX149 11218 1389 --
NM_005759chr243679 3140 1507 1038 --23661 854 --
NM_005764chr1152 ------
NM_005766chr13--11361 ----
NM_005776chr14--1324 ----
NM_005778chr3----192 --
NM_005786chr181423 --1156 --
NM_005789chr1751912 1775 1714 498 56 --11689 --
NM_005796chr163368 250 77 1293 ----
NM_005803chr63147 94 23 ------
NM_005808chr392705 1077 1066 830 606 404 314 136 68 --12872 13050
NM_005811chr12121 ------
NM_005813chr242212 1926 643 554 ------
NM_005822chr632085 1767 81 --1940 1552
NM_005826chr1--1551 1189 --
NM_005828chr17104699 4662 4276 3878 3509 1599 1481 694 634 394 1140 ----
NM_005840chrX147213 7139 6482 6457 6250 5894 5139 4696 2035 1414 989 690 476 383 35669 5102 2175 33025 1191 170 --
NM_005841chr4--1934 ----
NM_005842chr131744 1500 ----
NM_005843chr221888 622 ------
NM_005851chr114446 361 354 109 --1409 --
NM_005852chr1711113 ------
NM_005853chr161604 ------
NM_005857chr131453 1435 47 --21423 537 --
NM_005859chr511442 ------
NM_005862chr32708 427 1232 1905 --
NM_005864chr141123 --1652 --
NM_005868chr732308 367 329 ------
NM_005870chr131214 ------
NM_005875chr32369 66 ------
NM_005876chr23776 669 620 ------
NM_005879chr34387 170 161 36 ------
NM_005884chr194705 678 502 106 ------
NM_005885chr511643 --142 1419
NM_005898chr1133088 3076 998 22419 212 12126 --
NM_005900chr4----11150 --
NM_005901chr18128645 8150 7540 3345 3239 2448 2318 1829 1091 880 758 553 17359 68569 8021 7285 7270 5985 1402 12397
NM_005902chr1574609 4578 3140 1689 707 447 251 --1982 --
NM_005903chr584681 4136 1981 1972 1901 1137 1070 233 1291 14250 --
NM_005904chr183947 435 409 ------
NM_005909chr543970 2910 1173 812 23563 943 ----
NM_005911chr221414 98 31399 1243 303 1365 --
NM_005920chr163663 2896 2838 1202 596 121 --1216 --
NM_005923chr6------1431
NM_005933chr1142788 2675 2225 2004 ----1145
NM_005934chr19132390 2247 2167 2154 2054 1774 1741 1716 1637 1608 850 119 68 1103 ----
NM_005935chr495104 4751 4005 3478 3388 3208 1365 554 231 23285 2132 34999 1220 27 --
NM_005938chrX41441 1298 1075 358 ------
NM_005941chr853574 3183 1474 1378 272 11585 23872 741 --
NM_005943chr621559 1289 1244 --1456
NM_005944chr31502 --1799 --
NM_005955chr1174972 4782 4090 4010 3881 2133 1885 1707 1576 1531 1495 1315 1000 883 756 750 63 1837 14617 --
NM_005962chr1021770 721 --21864 576 --
NM_005962chr1021770 721 --21864 576 --
NM_005964chr1731524 1365 604 11133 1379 --
NM_005966chr212348 ------
NM_005967chr123515 212 110 1564 ----
NM_005984chr223367 355 49 ------
NM_005996chr1231172 274 193 ------
NM_006007chr931246 494 335 --1207 --
NM_006009chr12------1134
NM_006011chr15124210 4182 4036 4004 3684 3409 3028 3014 1287 1139 1115 1048 ----13350
NM_006015chr12211 71 ------
NM_006016chr6180 31978 1659 658 ----
NM_006020chr1421312 142 2898 878 ----
NM_006022chr133938 302 286 1370 ----
NM_006034chr1171956 1887 1682 444 232 100 33 1800 1838 --
NM_006036chr272528 2349 889 763 332 229 195 --11915 --
NM_006037chr2104925 4717 4627 3273 3265 3230 1956 1304 691 676 11840 13757 1740
NM_006047chr2053492 2372 1329 1271 365 11293 ----
NM_006048chr1----21229 266 --
NM_006051chr5144 ------
NM_006062chr221133 1071 131 2841 185 --
NM_006091chr152631 605 --11146 --
NM_006095chr4114499 3781 3380 3300 1691 1486 1463 1037 1010 627 575 12868 ----
NM_006106chr1143384 2938 915 150 11362 33019 2681 2595 --
NM_006107chr17--1423 ----
NM_006113chr121442 654 ------
NM_006135chr121409 186 ------
NM_006139chr221981 62 ------
NM_006145chr192977 466 ------
NM_006148chr1742646 2608 714 644 12273 ----
NM_006154chr1531947 898 319 1536 32276 1106 865 --
NM_006157chr111159 ------
NM_006158chr821401 1238 ------
NM_006160chr1721035 36 ------
NM_006162chr1821422 1227 31409 618 406 ----
NM_006164chr2180 ------
NM_006167chr841971 1679 538 41 ------
NM_006180chr941651 1520 441 98 --1425 --
NM_006185chr112136 85 --1473 --
NM_006186chr221201 455 ------
NM_006194chr142111 95 21194 1112 ----
NM_006195chr9----135 --
NM_006202chr1931644 326 93 ------
NM_006203chr535508 1223 927 13470 24003 23 11201
NM_006206chr472898 2772 2707 2355 1121 948 208 --12552 --
NM_006209chr82350 135 ------
NM_006211chr8199 ------
NM_006212chr1115276 5166 4730 1686 1659 1273 1131 502 311 113 68 13648 2790 360 --
NM_006216chr21432 ------
NM_006218chr3------1247
NM_006223chrX1123 --1513 --
NM_006224chr1762506 2228 2064 937 356 109 --1159 --
NM_006226chr22445 233 1104 ----
NM_006237chr1331616 766 169 ------
NM_006241chr342055 959 662 171 ------
NM_006243chr131092 782 349 ------
NM_006244chr113549 443 193 ------
NM_006245chr671018 797 678 301 258 196 55 ------
NM_006246chr141532 1978 11235 --
NM_006251chr523034 1152 ------
NM_006252chr156847 6172 4880 2584 419 16899 ----
NM_006255chr142763 393 ------
NM_006256chr162265 800 614 461 345 72 12486 ----
NM_006258chr103291 180 27 --1114 --
NM_006265chr82376 121 ------
NM_006267chr22607 516 --11537 --
NM_006268chr117895 468 395 321 280 251 137 ------
NM_006270chr192175 50 ------
NM_006275chr2042419 2311 2119 1708 1501 ----
NM_006277chr21213 1219 ----
NM_006281chr82902 138 198 ----
NM_006281chr82902 138 198 ----
NM_006282chr2084765 4246 2968 1336 1330 730 647 93 1802 1741 --
NM_006283chr864427 3058 1421 740 548 129 41831 875 583 71 ----
NM_006289chr91430 ------
NM_006290chr651398 1279 664 159 150 21543 1291 ----
NM_006301chr12--1641 ----
NM_006306chrX65802 3932 1960 1850 1038 521 --25009 1113 --
NM_006309chr3130 ------
NM_006311chr17188 ------
NM_006313chr1211273 1363 ----
NM_006315chr4154192 4180 3662 3581 3434 3303 3135 3059 3010 2993 1329 958 731 473 269 ------
NM_006317chr51688 ------
NM_006321chr342055 831 614 84 22122 623 ----
NM_006323chr41271 ------
NM_006325chr12152 ------
NM_006336chr931037 344 59 11080 ----
NM_006338chr13498 444 188 --180 --
NM_006352chr111374 --1761 --
NM_006357chr21528 ------
NM_006359chrX52157 1964 966 473 467 ------
NM_006364chr141988 1101 ----
NM_006366chr631222 438 200 --1822 --
NM_006367chr161023 834 138 116 96 27 ------
NM_006369chr13382 307 29 ------
NM_006371chr3144855 4808 4802 3823 3473 3299 3214 2002 1545 612 501 457 168 58 34216 3805 1395 13814 --
NM_006375chrX11425 --11202 --
NM_006379chr7----143 --
NM_006380chr1734306 2851 1098 1986 1683 --
NM_006384chr15122 ------
NM_006386chr2252437 2308 1753 866 492 ----11898
NM_006389chr113525 496 96 ------
NM_006400chr121264 ------
NM_006405chr141208 --148 --
NM_006410chr112484 146 1405 ----
NM_006420chr2053255 3129 1341 1302 1116 ------
NM_006421chr831063 243 43 ------
NM_006434chr1052494 2394 996 633 332 --12594 13157
NM_006454chr4113074 2850 2799 2563 2541 2403 2184 2117 1970 700 640 ------
NM_006457chr453252 2717 2533 983 223 23997 839 --1394
NM_006460chr1731348 1244 632 ------
NM_006465chr1572185 2106 2050 760 748 389 231 --32266 478 470 --
NM_006469chr12527 498 ----11081
NM_006471chr18----173 --
NM_006472chr121211 1123 ------
NM_006478chr22------1212
NM_006480chr51479 --176 --
NM_006482chr1232819 2798 411 --1440 13946
NM_006489chr1431626 1578 424 ------
NM_006496chr141839 1685 1566 1254 ----11500
NM_006504chr1042851 2565 2065 867 ----1126
NM_006516chr171394 1162 1026 359 322 287 144 ----1398
NM_006526chr202736 507 --11479 --
NM_006527chr41275 1143 ----
NM_006532chr1982025 1733 1695 721 662 457 317 95 --1818 --
NM_006534chr2093067 2559 2322 2121 1198 629 532 508 327 1551 1593 12997
NM_006538chr233938 1431 1353 22827 471 13609 --
NM_006539chr161538 ------
NM_006540chr8----21404 354 --
NM_006544chr1455252 1998 1933 1208 1056 ------
NM_006546chr17105427 5034 4210 4111 2111 1017 839 811 782 62 12633 ----
NM_006547chr732090 1723 1481 --1182 --
NM_006548chr311338 --11599 --
NM_006549chr1242817 2614 2448 979 ----183
NM_006552chr111108 192 ----
NM_006557chr91616 ------
NM_006561chr10124874 4863 4808 4689 4485 4208 3835 1328 1322 86 58 26 --12226 11817
NM_006565chr162849 504 ------
NM_006572chr1763491 2882 2776 972 740 350 12687 23128 2614 23294 3248
NM_006593chr2--1789 ----
NM_006595chr1132037 157 136 ------
NM_006599chr1688062 8049 6797 5903 5615 5038 1722 1385 17377 22449 45 --
NM_006601chr1221124 893 ------
NM_006602chr20----2283 200 --
NM_006603chrX21813 723 11831 --11410
NM_006609chr212217 --12445 --
NM_006614chr31776 --12847 --
NM_006618chr151169 1093 1026 1001 377 ------
NM_006620chr673381 1722 1536 1515 1001 527 226 14845 --1636
NM_006621chr151812 1378 672 524 404 --11274 --
NM_006624chr1022101 167 1745 ----
NM_006625chr11420 ------
NM_006625chr11420 ------
NM_006625chr11420 ------
NM_006626chr932677 2302 1004 ----1616
NM_006628chr1563725 3590 3235 3066 1725 1335 23862 1009 34557 4476 1153 --
NM_006633chr51157 ------
NM_006640chr172632 535 ------
NM_006650chr5103813 3639 3625 3286 3157 3130 2861 2617 2579 2507 ------
NM_006653chr6166 ------
NM_006654chr1294765 4285 4274 3224 1293 1035 680 559 407 24570 889 1895 24626 3776
NM_006656chr1131069 997 848 1156 11197 --
NM_006658chr73947 919 85 ------
NM_006667chrX21011 844 ------
NM_006690chr2082025 1840 1619 1578 484 461 227 186 --1693 --
NM_006695chr172104 23 ------
NM_006699chr132647 1004 829 12180 ----
NM_006703chr6--1426 ----
NM_006704chr13147 1318 ----
NM_006708chr63866 318 278 1934 1206 --
NM_006717chr952237 1054 583 372 101 12548 --12649
NM_006718chr62848 177 ------
NM_006720chr1094864 4115 4102 3950 1867 1243 523 359 50 11892 --1932
NM_006722chr342343 682 345 202 1491 1774 --
NM_006726chr4----11223 --
NM_006729chrX75324 4237 4161 4101 3732 3419 1587 22221 2035 55371 5223 4494 1961 890 --
NM_006734chr62246 93 199 ----
NM_006735chr7163 ------
NM_006738chr1564403 3739 3525 1744 1371 1040 24138 3341 43667 2959 1786 365 14427
NM_006744chr103235 169 86 ------
NM_006748chr851178 467 435 334 28 ------
NM_006750chr16207606 7591 7490 7153 7042 6228 5753 4910 3119 3071 2817 2194 1795 1720 859 666 569 504 107 89 --47207 5546 2400 1478 --
NM_006751chr21402 ------
NM_006754chr72277 157 11212 ----
NM_006756chr811363 11189 1157 --
NM_006761chr172676 134 ------
NM_006763chr151888 1739 485 390 212 1579 ----
NM_006766chr812445 --22576 2308 --
NM_006769chr12148 30 2743 568 ----
NM_006772chr651613 1401 693 221 115 ------
NM_006775chr63548 174 54 11160 12517 --
NM_006777chrX12127 ------
NM_006778chr631842 695 195 1512 21307 1247 --
NM_006788chr1831867 1466 462 --11455 --
NM_006800chrX4567 194 111 32 ------
NM_006802chr1--11094 ----
NM_006805chr541513 681 461 115 ------
NM_006807chr171134 --31208 962 106 --
NM_006811chr201913 ------
NM_006813chr63762 251 89 ------
NM_006819chr111271 ------
NM_006823chr81516 ------
NM_006826chr211177 --1457 1974
NM_006827chr1493139 3029 2865 2640 1235 824 756 431 300 11162 ----
NM_006828chr62197 89 ------
NM_006832chr141919 1127 2905 822 --
NM_006833chr71138 ------
NM_006837chr81105 1116 ----
NM_006838chr1231911 1508 1342 --11750 --
NM_006852chr1732528 2471 262 12544 12559 --
NM_006854chr72676 30 1189 ----
NM_006861chr1281713 702 687 664 582 343 331 212 1305 ----
NM_006873chr232592 551 330 2673 195 ----
NM_006874chr41836 ------
NM_006885chr1633303 1145 255 --12981 --
NM_006892chr2041413 1365 446 89 ------
NM_006892chr2041413 1365 446 89 ------
NM_006896chr731091 826 287 --21072 1060 --
NM_006898chr22679 111 ------
NM_006899chr202296 132 ------
NM_006902chr153152 1057 604 566 220 21076 595 13029 --
NM_006906chr117815 797 614 372 334 165 125 ------
NM_006908chr72998 434 ------
NM_006912chr152373 905 829 117 88 ------
NM_006914chr911519 --1112 --
NM_006918chr1163647 2189 1718 1636 808 344 ------
NM_006920chr2--11832 ----
NM_006922chr21870 ------
NM_006924chr1734228 3777 271 23476 2794 1868 --
NM_006925chr141470 ----1372
NM_006930chr551971 1719 756 447 418 ------
NM_006939chr142890 207 --31055 358 108 --
NM_006940chr1211594 --11243 --
NM_006943chr2073283 2482 2313 1334 999 156 130 1695 12303 --
NM_006946chr112538 386 ------
NM_006948chr21----21963 707 --
NM_006951chr101769 ------
NM_006979chr61471 ------
NM_006981chr942935 2874 812 94 --22973 2826 --
NM_006990chr182202 1869 1788 1763 558 536 372 50 21574 514 2632 568 --
NM_006991chr31160 ------
NM_006997chr101296 1374 ----
NM_006999chr551592 1357 819 436 228 ------
NM_007005chr931257 1092 51 ------
NM_007011chr15134237 4165 2672 2666 2158 1253 1144 1109 932 820 710 406 251 15344 16792 --
NM_007033chr142213 2114 1725 696 12252 164 --
NM_007039chr141236 11755 ----
NM_007040chr1921052 714 ------
NM_007045chr62110 97 ------
NM_007050chr20137649 7157 7142 6584 6350 5828 5317 2809 2711 2229 1143 460 377 25190 2253 11023 --
NM_007054chr543781 948 377 49 1414 ----
NM_007067chr1761555 1355 1104 962 138 83 --1315 --
NM_007073chr621333 1055 --33765 315 227 --
NM_007078chr1021036 798 --12147 12424
NM_007084chr13--1985 ----
NM_007106chr1322564 2517 ----12323
NM_007114chr321217 1166 --22777 1067 --
NM_007118chr53610 566 347 ------
NM_007123chr131258 430 142 --1336 --
NM_007124chr6147 --11832 --
NM_007125chrY21317 39 ------
NM_007137chrX114511 4342 3942 3873 3819 3609 3420 2206 904 879 527 22154 935 ----
NM_007144chr1731279 1242 502 ------
NM_007145chr1921397 63 ------
NM_007146chr1741862 1834 1057 927 12612 --11850
NM_007150chrX71974 1770 1606 728 357 237 136 11395 ----
NM_007158chr11923 1412 ----
NM_007159chr311384 ------
NM_007162chr64600 578 418 112 ------
NM_007166chr111371 ------
NM_007170chr13822 365 147 ------
NM_007174chr1231517 672 211 --11794 --
NM_007178chr121489 --1366 --
NM_007181chr19----1137 --
NM_007182chr34710 570 239 206 1546 ----
NM_007185chr13779 287 88 --1231 --
NM_007191chr121458 ------
NM_007192chr1421052 936 --1828 --
NM_007197chr1211008 ------
NM_007200chr1564403 3739 3525 1744 1371 1040 24138 3341 43667 2959 1786 365 14427
NM_007203chr973793 3538 3222 3039 2929 2816 944 ------
NM_007207chr1131 --1657 --
NM_007212chr131663 496 344 ------
NM_007217chr3152 ------
NM_007222chr81337 ------
NM_007236chr1572091 1843 938 926 692 371 160 12440 --1536
NM_007241chr171145 ------
NM_007245chr164882 747 716 121 ------
NM_007249chr13128821 8322 7900 7467 3261 2902 2399 1441 1196 1162 739 265 39136 7946 2038 1616 --
NM_007260chr12772 116 ------
NM_007271chr631850 1268 714 --11153 11495
NM_007282chr31673 ------
NM_007287chr343259 2895 2383 301 2692 162 ----
NM_007288chr343259 2895 2383 301 2692 162 ----
NM_007289chr343259 2895 2383 301 2692 162 ----
NM_007292chr1795069 4948 4459 4336 4038 3410 1218 1093 551 14756 14910 --
NM_007313chr971953 1847 752 564 305 223 187 --1713 --
NM_007322chr191405 ------
NM_007324chr11347 ------
NM_007325chrX31746 1534 1425 1173 ----
NM_007331chr442601 2096 1717 72 ------
NM_007349chr7----191 --
NM_007350chr1254329 3244 3103 2892 1151 13352 13938 --
NM_007351chr43804 748 79 --1814 --
NM_007353chr781943 1124 1029 828 786 754 578 112 ------
NM_007358chr131680 542 466 ------
NM_007359chr1791713 1599 1535 1335 1149 1077 474 461 161 11559 ----
NM_007363chrX------1736
NM_007365chr171683 855 776 671 290 174 145 --1391 --
NM_007372chr173895 110 34 ------
NM_007373chr101528 ------
NM_007375chr112037 --22246 1780 --
NM_012081chr533342 3196 179 3639 460 71 13383 13275
NM_012084chrX3570 353 231 ------
NM_012090chr1--1132 ----
NM_012095chr1062899 2828 2545 943 936 585 1496 ----
NM_012097chr211898 --11437 --
NM_012102chr122457 838 11890 ----
NM_012104chr1173385 1333 1218 953 825 138 131 13532 23077 1388 11137
NM_012104chr1173385 1333 1218 953 825 138 131 13532 23077 1388 11137
NM_012110chr43229 67 55 ------
NM_012118chr4----1398 --
NM_012124chr11--1241 ----
NM_012129chr72912 775 --11638 1131
NM_012134chr171485 1302 761 748 375 340 110 11204 --1165
NM_012137chr152223 1885 1849 487 62 --12858 --
NM_012141chr1373294 3074 2734 2702 1233 1012 693 --1934 1520
NM_012153chr1131838 845 726 11967 11757 1198
NM_012154chr8--2751 271 1150 --
NM_012156chr2063405 3368 3322 2493 2213 770 --13100 --
NM_012158chr131685 --11527 --
NM_012164chr9146834 6805 6112 6026 6019 4982 4840 4576 2765 2453 1543 1521 1266 716 24582 1239 ----
NM_012174chr1252943 2686 2492 482 127 1761 1455 --
NM_012193chr11115157 4802 4653 4626 3957 2011 1848 1622 1443 1131 598 11568 35300 5182 4777 11692
NM_012197chr931279 1131 54 ------
NM_012199chr1164543 4111 4075 3617 3165 3146 2919 1794 1576 1539 1492 1312 1065 779 283 212 --1122 --
NM_012207chr101271 ------
NM_012214chr296352 5862 5803 4862 4784 2514 2315 2015 188 --35093 2206 730 --
NM_012215chr101397 --11835 --
NM_012224chr41769 ------
NM_012228chr1021127 941 ------
NM_012232chr1762198 1920 1679 770 318 246 ------
NM_012234chr343624 3487 2958 1123 13105 --12746
NM_012236chr13784 341 220 --1308 --
NM_012238chr10--11217 ----
NM_012243chr1------1291
NM_012244chr1461580 504 341 275 209 60 ----11695
NM_012245chr142413 383 ------
NM_012247chr103948 748 165 ------
NM_012249chr21128 32590 2422 1391 ----
NM_012250chr111554 --1257 --
NM_012252chr743553 1253 920 456 24255 1132 166 11644
NM_012257chr72922 92 1220 ----
NM_012259chr611146 --2330 39 --
NM_012261chr201463 ------
NM_012262chr194671 4499 4305 4275 4242 3689 3322 1582 393 23355 1816 ----
NM_012272chr122381 161 ------
NM_012281chr71663 ------
NM_012286chrX2405 31 ------
NM_012287chr343368 1539 909 406 --1839 --
NM_012288chr6115486 5231 3948 3929 2260 1302 430 315 259 247 100 24323 328 ----
NM_012290chr21623 ------
NM_012294chr754112 3695 2953 1457 1164 --33446 1072 577 --
NM_012296chr1183297 2485 1401 1364 1214 598 298 240 12435 ----
NM_012297chr452347 2158 899 411 283 ------
NM_012300chr541712 1576 446 70 ------
NM_012301chr721388 673 ------
NM_012302chr1----1925 --
NM_012304chr552500 1767 713 653 432 --1873 --
NM_012307chr18----1353 --
NM_012308chr1172456 2425 1995 833 573 343 117 --12285 12414
NM_012309chr11104853 4735 3616 1131 1089 680 546 523 479 32 ------
NM_012311chr102641 206 1594 ----
NM_012316chr1195288 4945 4632 4444 4181 4135 3555 2118 2049 1706 1508 1458 1074 1002 601 517 415 132 118 11743 11989 --
NM_012325chr2021391 599 11575 11448 1401
NM_012327chr1821571 354 ------
NM_012329chr1731572 1291 1041 ------
NM_012330chr1031785 1261 541 1556 1404 --
NM_012333chr141095 1086 587 471 1520 ----
NM_012337chr1----130 --
NM_012339chr103635 496 227 ------
NM_012347chr612458 12470 22918 319 --
NM_012388chr1553070 2951 1002 417 380 186 1143 --
NM_012399chr2221510 717 --11538 --
NM_012402chr113429 195 98 --1345 --
NM_012406chr124826 306 290 208 1532 11199 --
NM_012407chr222416 136 ------
NM_012412chr7--1637 ----
NM_012423chr193449 58 41 ------
NM_012434chr661290 1080 607 546 499 67 ------
NM_012446chr51140 1217 ----
NM_012461chr143267 76 47 --1635 --
NM_012463chr12--1111 ----
NM_012464chr442422 1852 764 292 22797 2591 12653 --
NM_012471chrX31591 197 57 ------
NM_012474chr11232 ------
NM_012479chr731947 1716 132 12390 ----
NM_012482chr1--1503 1111 --
NM_012486chr12429 349 --1412 --
NM_013227chr153662 279 80 ------
NM_013229chr1222795 222 ------
NM_013232chr5--1387 ----
NM_013233chr231339 1247 37 ------
NM_013236chr222476 217 ------
NM_013245chr166696 639 484 240 213 189 ------
NM_013254chr121512 --173 --
NM_013261chr463422 3137 2783 2738 2400 900 --13384 --
NM_013262chr61982 11277 ----
NM_013269chr1264084 1742 1521 1432 479 113 ------
NM_013272chr151151 ------
NM_013279chr1142021 1474 310 44 21916 693 --11651
NM_013281chr2021320 210 1603 ----
NM_013283chr52669 219 --2180 134 --
NM_013300chr12164 ------
NM_013309chr1532308 2103 1679 129 ----
NM_013316chr71867 --1246 --
NM_013341chr262461 2002 1189 1179 1172 1166 --12846 --
NM_013354chr81133 --1909 --
NM_013363chr32399 42 ------
NM_013368chr191440 ----1230
NM_013373chr22----1726 --
NM_013380chr192787 261 ------
NM_013381chr121365 ----1840
NM_013386chr11262 --1514 --
NM_013396chr2121037 59 1555 ----
NM_013399chr1661264 1147 747 627 309 132 1147 ----
NM_013400chr73364 261 255 --1437 --
NM_013410chr12462 182 ------
NM_013433chr193208 179 87 --1138 --
NM_013436chr22647 43 ------
NM_013437chr811422 --1233 --
NM_013438chr941703 1688 1142 281 ------
NM_013443chr921108 901 --1299 --
NM_013444chrX1425 1416 ----
NM_013446chr741423 1317 1289 1030 1119 ----
NM_013449chr1272907 2364 745 356 144 133 86 ------
NM_013450chr221060 887 ------
NM_013960chr81567 --1146 --
NM_013986chr221257 ------
NM_013989chr1463589 3508 3135 887 553 399 --24084 3555 24288 3601
NM_014000chr1041748 704 607 326 --11662 --
NM_014001chr1721628 48 1637 188 11537
NM_014007chr931250 903 391 ------
NM_014011chr242550 1918 812 478 ----11635
NM_014016chr331707 1270 170 --1105 --
NM_014021chr112966 ------
NM_014023chr1082801 2456 2125 1783 1178 1034 397 142 --12196 --
NM_014028chr642728 2055 953 666 12588 ----
NM_014034chr621229 1150 --1469 --
NM_014035chr51171 ------
NM_014043chr311146 1604 ----
NM_014048chr1665070 4328 3551 1706 1411 1106 --25105 795 --
NM_014057chr931515 362 284 ------
NM_014060chrX188 ------
NM_014079chr35784 264 256 248 163 ------
NM_014089chr13--11579 ----
NM_014109chr83463 408 63 --1448 --
NM_014110chr121183 242 ----11216
NM_014112chr864698 3921 3792 3504 1791 682 34629 4039 112 21165 770 --
NM_014117chr1642018 625 524 171 1665 11953 12135
NM_014141chr795288 4707 4210 3849 3757 3569 3527 1043 905 --24625 1822 1507
NM_014153chr16----1728 --
NM_014154chr311423 ------
NM_014155chr1176173 1595 1454 1393 1197 1043 95 ------
NM_014169chr141283 --1234 --
NM_014171chr23724 143 49 ------
NM_014181chr222775 141 173 11130 --
NM_014189chr44511 203 73 23 --21492 237 --
NM_014190chr43555 425 375 --21844 589 11244
NM_014191chr1211006 ------
NM_014217chr12637 255 1480 2246 55 --
NM_014231chr1261759 1539 1462 375 68 57 --150 --
NM_014232chr1761647 1375 1119 433 271 227 ------
NM_014232chr1761647 1375 1119 433 271 227 ------
NM_014233chr1741822 1666 513 492 21737 844 ----
NM_014235chrX41789 640 255 26 ------
NM_014240chr353665 3103 2614 244 143 21354 719 ----
NM_014241chr101296 ------
NM_014243chr42763 587 ------
NM_014250chr2221758 1358 2410 281 ----
NM_014251chr72912 787 1803 1624 --
NM_014253chrX62485 2405 1698 534 424 130 ------
NM_014263chr1031248 964 338 ------
NM_014264chr41221 ------
NM_014271chrX2698 177 ------
NM_014275chr52759 726 ------
NM_014280chr11259 ----1633
NM_014283chr12627 370 ------
NM_014286chr9113218 2971 2548 1270 1226 921 717 446 165 128 23 1389 12875 --
NM_014289chrX31422 1119 993 11437 ----
NM_014294chr841333 213 103 28 ------
NM_014296chr32615 609 --1308 --
NM_014297chr19121 ------
NM_014299chr19112052 1921 1894 1799 1585 1509 1441 1421 603 252 163 1514 ----
NM_014309chr22144577 4471 4335 4029 3559 3306 1757 1371 1283 876 869 699 290 194 24014 1541 13793 --
NM_014316chr16101994 1799 1762 1632 732 605 595 465 260 26 ------
NM_014319chr1211958 11493 ----
NM_014320chr61140 ------
NM_014325chr1242099 1715 1619 343 ------
NM_014331chr457478 6003 5918 5062 2008 15214 14845 --
NM_014332chrX1109 ------
NM_014333chr112966 299 ----1865
NM_014342chr111142 ----11171
NM_014351chr222298 26 ------
NM_014368chr941889 1719 1557 495 ------
NM_014372chr1--1532 ----
NM_014374chr73364 261 255 --1437 --
NM_014376chr551618 503 459 427 374 --1167 --
NM_014393chr83866 333 164 ------
NM_014394chr103890 162 150 ------
NM_014397chr9--146 ----
NM_014415chr321354 439 ------
NM_014423chr554719 3431 2102 1401 1110 11423 35178 2245 1026 --
NM_014432chr6122 11230 11275 --
NM_014437chr15870 796 666 389 44 ------
NM_014445chr341546 871 480 194 11652 ----
NM_014447chr431494 1268 1096 --11467 --
NM_014452chr641098 1070 972 308 --11193 --
NM_014455chr12322 197 ------
NM_014458chr11920 ------
NM_014482chr21107 ------
NM_014491chr7----1350 --
NM_014494chr1632135 1924 1500 11522 1503 --
NM_014498chr31360 ------
NM_014503chr121462 ------
NM_014504chr731774 538 312 12012 ----
NM_014507chr2231198 758 449 ------
NM_014515chr121783 1169 ----
NM_014517chr331379 783 268 ------
NM_014554chr1231623 577 160 --11604 --
NM_014573chr1721832 34 ------
NM_014574chr141399 1377 ----
NM_014575chr32404 131 ------
NM_014577chr22----1315 --
NM_014585chr22120 98 11120 11023 --
NM_014587chr1641517 1400 1308 961 ------
NM_014591chr1031120 403 262 ----2958 45
NM_014592chr55762 739 668 255 72 1277 ----
NM_014600chr251540 1439 1292 1192 129 ----11469
NM_014603chr1781539 1514 1236 1117 1092 575 245 175 ----11373
NM_014607chr241877 854 630 291 --11393 --
NM_014608chr15----140 --
NM_014612chr9195 21440 965 21342 1108 --
NM_014613chr582996 2446 2210 2067 1070 1015 753 669 --1632 --
NM_014615chr1633387 2665 397 ------
NM_014616chr332745 1221 427 12870 11058 --
NM_014620chr123786 189 35 ------
NM_014623chr6181 ------
NM_014630chr15163818 3299 3273 2741 2701 2503 1609 800 748 427 367 341 266 247 134 59 ----13039
NM_014634chr2292874 2532 2479 636 492 298 101 45 22 23040 948 ----
NM_014636chr943390 3106 3068 1001 ----1699
NM_014637chr841459 1000 532 198 ------
NM_014647chr161588 11676 ----
NM_014655chr12159 111 ------
NM_014659chr1511049 ----1811
NM_014660chr72161 128 ------
NM_014663chr131121 703 306 ------
NM_014665chr8103553 3335 3228 2888 2693 2322 2297 701 252 170 --12307 --
NM_014667chr312480 12288 ----
NM_014670chr231199 458 68 ------
NM_014671chr72978 505 ------
NM_014673chr8180 ------
NM_014674chr353984 3593 1240 894 240 22740 1117 21292 195 --
NM_014676chr121618 228 --1643 --
NM_014677chr821379 1146 1172 ----
NM_014682chr811433 ------
NM_014683chr1732157 1696 872 1187 150 --
NM_014686chr1962480 2455 2371 2217 809 267 ------
NM_014689chr21559 ------
NM_014690chr7123033 2784 2650 2124 1968 1923 1167 990 959 729 406 24 ------
NM_014701chr1521208 937 --22197 745 13437
NM_014707chr722270 1831 ------
NM_014709chr21105 ------
NM_014718chr126569 552 275 224 213 40 --1780 --
NM_014720chr101381 ------
NM_014721chr687345 5858 5305 4578 2946 2188 1855 1445 37049 6995 5527 25202 4509 --
NM_014723chr2063210 2667 1220 469 403 382 --12527 --
NM_014726chr1781386 1204 472 451 403 294 217 99 ------
NM_014729chr8--1290 ----
NM_014730chr12145229 4336 4323 3843 3835 3791 3656 3641 3596 3238 2116 1318 1302 1226 14983 11747 --
NM_014730chr12145229 4336 4323 3843 3835 3791 3656 3641 3596 3238 2116 1318 1302 1226 14983 11747 --
NM_014731chr2081498 1115 699 543 494 333 271 159 11623 2391 35 --
NM_014732chr1695196 4657 4347 4106 3652 2057 1916 1467 916 1129 24706 622 --
NM_014733chr52577 128 ------
NM_014735chrX32120 1617 35 --21817 722 --
NM_014739chr634090 2815 1384 13541 14007 --
NM_014742chr2031764 1445 1315 11811 11773 --
NM_014743chr432495 739 381 --22828 466 --
NM_014746chr284048 4041 2969 2864 1738 1112 767 107 1100 24259 551 --
NM_014747chr1165139 5069 5035 4916 4375 3856 3829 3767 2102 1446 1253 1241 772 625 114 103 15647 33658 2047 61 --
NM_014748chr23274 57 25 ------
NM_014750chr141220 ------
NM_014752chr1141820 1511 639 124 11270 11900 --
NM_014754chr81805 ----1907
NM_014755chr2114147 3511 3501 2930 2872 2795 763 445 165 95 26 ------
NM_014756chr11--2315 195 ----
NM_014757chr532324 1538 572 --1758 --
NM_014761chr161960 1832 ----
NM_014762chr152552 921 726 678 494 ------
NM_014764chr122456 132 ------
NM_014766chr763797 3104 1303 1290 775 505 ----12326
NM_014767chr10163551 3086 2931 2721 2707 2510 2409 2367 2331 1318 1189 1157 989 484 404 245 ------
NM_014770chr1261286 870 504 333 323 250 ------
NM_014774chr142606 2007 862 625 1374 ----
NM_014776chr1293106 2967 2914 2748 2437 2267 2034 1186 765 21126 189 33026 2114 2046 --
NM_014779chr31189 ------
NM_014781chr83907 385 50 ------
NM_014783chr1521144 377 1118 ----
NM_014784chr14802 710 335 287 ------
NM_014797chr653105 2917 2590 2453 510 --1149 --
NM_014798chr1781811 1703 1547 1533 1452 661 580 237 ------
NM_014800chr74837 740 394 23 --1320 --
NM_014807chr111809 --1655 --
NM_014810chr142298 1381 687 179 --11357 11469
NM_014811chr93696 460 168 ------
NM_014812chr1--1543 ----
NM_014819chr521943 355 ------
NM_014820chr31542 ------
NM_014824chr1181880 1762 1436 1425 628 560 271 178 ------
NM_014827chr131671 605 149 ------
NM_014830chr1233424 679 101 21067 909 ----
NM_014838chr2242528 2277 1935 225 1157 ----
NM_014839chr111818 ------
NM_014840chr1252903 2541 2107 850 386 1856 1770 --
NM_014846chr8136 ------
NM_014847chr12503 134 ------
NM_014850chr394784 4426 4103 3997 3910 3544 3511 1542 810 23809 1275 ----
NM_014853chr1741185 1009 934 237 11436 1188 --
NM_014859chr1721359 238 ------
NM_014862chr15144229 4194 3666 3463 2916 2903 2878 2749 1418 815 625 342 94 59 33291 2613 607 ----
NM_014864chr183779 3651 3257 3175 2788 1747 1332 980 23099 461 ----
NM_014868chr122578 365 --1816 --
NM_014872chr912129 --173 --
NM_014876chr2262156 2100 1805 485 422 80 ------
NM_014877chr1797049 6951 6637 5942 5617 5176 2953 2605 1642 25838 5004 27800 1320 --
NM_014883chr441915 1679 1640 848 21763 163 32444 1628 459 --
NM_014884chr19146 ------
NM_014891chr771390 1256 648 576 535 460 79 --11110 --
NM_014897chr171921 12761 ----
NM_014898chr1932087 2043 101 ------
NM_014899chr512406 21021 371 33027 1138 261 --
NM_014900chr21990 1204 ----
NM_014902chr202968 405 11350 ----
NM_014903chr1211548 21952 827 ----
NM_014904chr1053439 3073 2639 1425 1086 1614 23926 921 --
NM_014906chr1773894 3601 3093 1447 1402 1147 449 14020 ----
NM_014909chr1463509 3094 2804 990 479 154 1759 ----
NM_014912chr1052752 2531 1167 1035 561 --11053 --
NM_014917chr11830 ------
NM_014918chr1521538 174 11442 ----
NM_014921chr1942836 2689 624 120 ------
NM_014923chr13----1265 --
NM_014924chr1473149 2110 2018 1062 1001 857 579 ------
NM_014926chr321136 235 --1172 --
NM_014931chr192531 95 ------
NM_014934chr1343097 2878 2707 1305 21233 95 13081 13277
NM_014935chr173396 3213 1158 885 323 295 211 ------
NM_014936chr622732 713 12392 32081 738 525 11107
NM_014944chr161347 1329 1203 938 527 372 --11388 --
NM_014945chr561581 627 513 278 227 166 21939 266 ----
NM_014946chr242674 1184 1134 212 ------
NM_014947chr142956 1972 1068 943 1219 12809 --
NM_014952chr152594 393 1839 11497 --
NM_014953chr1344206 3898 3471 1017 1938 --13801
NM_014956chr115924 875 670 314 74 --11040 --
NM_014961chr441982 1639 1544 602 --1337 --
NM_014963chr193572 128 24 ------
NM_014964chr1762255 1553 966 363 286 203 ----1845
NM_014969chr11452 ------
NM_014974chr1041756 1525 364 230 ------
NM_014978chr1041313 505 495 140 --1694 --
NM_014982chr14104878 4761 3720 1831 996 967 887 646 158 83 ------
NM_014988chr422766 2701 --22400 1106 --
NM_014989chr61141 ------
NM_014991chr413001 ------
NM_014992chr142715 77 ------
NM_014996chr321000 327 --1315 1256
NM_014997chr752571 2124 1123 737 724 --1137 --
NM_014999chr1231145 523 53 ------
NM_015000chr1222319 1081 1486 ----
NM_015001chr12352 136 ------
NM_015002chr1251535 1429 257 192 164 11457 ----
NM_015008chr373279 3154 2852 2776 2396 1011 396 ----22994 2273
NM_015015chr1992040 1987 1837 1827 1676 708 130 85 54 11579 --1294
NM_015018chr6165 ------
NM_015020chr1643633 2617 398 261 --23292 2603 --
NM_015023chr171776 1708 674 356 275 250 51 ------
NM_015024chr851235 906 593 320 305 ------
NM_015025chr252544 2159 2080 913 43 11728 ----
NM_015026chr1233289 1245 637 ----14143
NM_015027chr164791 610 544 303 1214 11583 --
NM_015033chr992820 2778 2484 2368 797 368 166 150 84 12586 22968 592 --
NM_015035chr20196534 6305 6115 4975 4749 4420 2487 2417 1771 1709 1404 1331 1248 1188 1143 632 538 472 102 --22559 1295 --
NM_015039chr1103328 3209 3079 1585 1355 1269 435 391 352 313 14071 43979 910 448 409 2371 293
NM_015040chr253379 2386 2280 2158 2126 ------
NM_015042chr15144371 3836 3764 3529 3408 3306 3126 2848 2779 1663 1340 876 845 334 --24083 1055 --
NM_015044chr1673199 3153 3047 3014 2617 2202 401 1671 42988 2877 655 156 --
NM_015045chr1031592 1422 761 ------
NM_015046chr962469 2164 2058 1844 1788 802 --1219 --
NM_015051chr92614 251 12355 ----
NM_015052chr72406 167 ------
NM_015055chr1152876 1908 1866 862 820 12323 22260 804 --
NM_015056chr2142692 2172 2048 134 ----12019
NM_015057chr132545 40 ------
NM_015059chr1553933 965 907 817 232 --13622 1199
NM_015063chr194967 421 156 64 ------
NM_015064chr12183142 3100 3017 2981 2608 2570 2428 1430 1366 1349 1306 1298 770 712 669 583 541 438 ------
NM_015068chr751436 1176 978 704 32 ----12557
NM_015069chr162214 196 ------
NM_015074chr153223 1612 1225 750 171 --11514 --
NM_015075chrX52275 1950 1746 1724 293 --11592 --
NM_015076chr674172 3640 3541 3280 3179 2767 1707 ------
NM_015079chr15152357 2341 2019 1987 1305 1208 826 709 685 415 231 215 190 143 116 1595 21969 881 --
NM_015082chr572459 2391 2152 2142 388 341 313 1685 32301 654 210 --
NM_015087chr1311853 22439 2029 ----
NM_015090chr1185797 5650 5216 5161 4708 4593 3796 3786 2435 2415 1785 1549 1300 1236 959 766 712 593 --35692 1325 578 11337
NM_015091chr14--2311 154 ----
NM_015092chr1644627 4525 4131 3276 ------
NM_015097chr32895 684 ----1458
NM_015100chr121781 1510 ------
NM_015101chr132885 1858 830 12501 --1774
NM_015107chrX81745 689 482 294 205 115 88 44 ------
NM_015112chr1146 ------
NM_015113chr1782049 1979 1615 1523 601 381 227 98 ------
NM_015115chr442864 2529 2326 1058 11124 ----
NM_015116chr1351179 563 321 80 31 1669 ----
NM_015125chr192510 465 ------
NM_015130chr411288 ----11081
NM_015132chr731881 1773 701 --1538 --
NM_015133chr1641466 1344 1119 397 --1221 --
NM_015138chr156935 874 500 402 273 36 12530 ----
NM_015143chr441046 484 247 146 --11432 --
NM_015149chr131942 1432 469 ------
NM_015150chr31323 ------
NM_015155chr1063109 3097 2478 1138 1010 827 11322 ----
NM_015156chr1443040 1112 854 723 1157 23484 1249 --
NM_015157chr1141106 934 790 257 ------
NM_015158chr9--1827 ----
NM_015163chr143213 195 161 ------
NM_015172chr11589 --11033 --
NM_015176chr121656 1640 --1375 1652
NM_015178chr841938 940 350 63 --11058 --
NM_015185chrX72903 2658 2116 1086 673 638 401 11892 22562 664 --
NM_015187chr41799 ----1309
NM_015191chr1162526 2072 1044 679 240 96 12280 ----
NM_015192chr2042845 2484 2470 167 ------
NM_015194chr17131839 1591 1533 1459 1356 706 345 306 288 225 180 158 83 ------
NM_015197chr14143188 3070 2972 2916 2475 2435 2406 2136 1310 594 474 430 320 186 --11123 --
NM_015199chr322230 797 12863 ----
NM_015200chr42128 82 ------
NM_015206chr1551316 912 904 675 547 --1865 13628
NM_015208chr183809 71 44 130 2962 93 --
NM_015209chr151956 643 581 534 472 ------
NM_015215chr133139 2092 2083 1815 ----
NM_015221chr103398 181 34 2333 310 ----
NM_015225chr942969 1254 1244 525 --1964 --
NM_015230chr4--11750 1554 --
NM_015231chr111797 ------
NM_015233chr1352203 944 635 161 103 12194 ----
NM_015236chr431217 224 111 ------
NM_015238chr52654 115 ------
NM_015247chr1695026 4927 4830 4570 3722 3602 655 419 136 13443 ----
NM_015250chr942006 1585 745 422 --11912 --
NM_015251chr1641749 1730 235 139 22323 2016 1503 --
NM_015254chr892930 2459 1274 831 596 402 334 241 36 12775 1448 --
NM_015256chr51647 ------
NM_015260chr1951548 1003 635 408 50 --11262 --
NM_015263chr1521086 388 ------
NM_015265chr232307 584 311 ------
NM_015267chr122711 595 ------
NM_015268chr3189 ------
NM_015271chr413628 --1727 13197
NM_015272chr1641643 1610 426 44 11460 ----
NM_015278chr662968 2215 972 401 375 368 32944 1369 597 22466 1052 1293
NM_015284chr152146 1970 1751 516 479 ------
NM_015285chr1832363 468 63 --1210 --
NM_015288chr5163798 3746 3737 3095 2774 2538 2472 2399 1184 1149 928 789 668 652 257 32 --13303 --
NM_015291chr1102659 2638 1401 450 317 299 287 151 114 48 22939 2514 1813 --
NM_015296chr1321206 490 ------
NM_015299chr1483678 3669 2617 1518 1299 546 411 387 2804 233 11037 --
NM_015305chr1461783 1621 1464 493 462 393 ----11360
NM_015310chr8127833 7247 7085 6740 6664 1843 1729 1029 961 706 489 171 11586 12885 --
NM_015313chr11104807 4705 4399 3776 1721 1669 1580 650 392 149 44144 3456 1741 1372 13469 --
NM_015315chr572835 1397 1316 1180 1108 954 68 1920 1569 --
NM_015317chr242590 2384 2156 255 22539 656 ----
NM_015319chr121151 ------
NM_015320chr22918 188 1810 ----
NM_015326chr132065 773 192 12159 1351 --
NM_015328chr772692 2613 2459 2070 2025 503 197 ------
NM_015329chr1992499 2493 2486 2363 2177 1878 1091 358 150 ------
NM_015332chr7123511 3492 3481 3413 3235 2927 1211 856 832 492 334 61 --11109 --
NM_015335chr122771 327 1728 ----
NM_015336chr12--11639 ----
NM_015339chr202283 92 ------
NM_015343chr171131 --176 --
NM_015344chr831669 580 250 --1587 --
NM_015345chr672759 2362 2317 911 851 246 216 --32688 2424 832 --
NM_015346chr1441641 1627 420 147 1112 21606 66 --
NM_015347chr1262793 2107 1981 1957 817 547 12225 ----
NM_015349chr642693 2269 2086 1936 12041 ----
NM_015353chr17112626 2494 2439 2322 2127 2099 1941 1894 1788 634 601 --1979 --
NM_015355chr171625 --11712 --
NM_015361chr23635 252 42 ------
NM_015365chrX63477 3452 3320 872 326 317 13789 ----
NM_015378chr172491 2454 2330 2130 2084 929 281 --13007 --
NM_015382chr142783 108 ------
NM_015385chr1052494 2394 996 633 332 --12594 13157
NM_015387chr23699 237 135 --11499 --
NM_015393chr4103604 3499 3433 3289 2968 2482 1473 712 661 598 13215 ----
NM_015397chr921338 382 ------
NM_015401chr121896 --134 --
NM_015407chr31169 ------
NM_015416chr122790 29 ----1317
NM_015423chr1121646 638 1664 11090 --
NM_015429chr311000 ------
NM_015443chr172538 411 ------
NM_015444chr3152 ------
NM_015446chr131301 1224 326 ------
NM_015453chr31546 1837 ----
NM_015455chr543390 3300 1512 289 22564 928 ----
NM_015458chr874537 4490 4411 1707 1189 884 66 --11175 --
NM_015460chr33679 146 58 1209 ----
NM_015469chr9--1764 ----
NM_015470chr241190 911 105 54 ------
NM_015475chr21255 ------
NM_015477chr152665 245 1857 192 --
NM_015481chr1231118 300 221 ------
NM_015483chr721014 458 ----1132
NM_015488chr2101594 1522 1470 1461 1337 1330 1292 519 506 402 --11503 1465
NM_015516chr1151301 1185 305 294 41 ----11111
NM_015520chr322279 1879 --12578 --
NM_015527chr165635 583 535 512 276 ------
NM_015530chr21370 ------
NM_015541chr31560 1376 ----
NM_015544chr172598 160 ------
NM_015550chr763168 2826 2805 1299 879 50 33291 1059 662 13105 1342
NM_015553chr6115171 4998 4528 4065 1373 1184 802 796 536 514 312 --23300 1950 13232
NM_015554chr1552246 2103 1988 1911 251 11895 12763 --
NM_015556chr142174 55 ------
NM_015557chr1143286 3127 3040 2776 1438 1212 1168 1005 995 989 896 696 456 265 1500 12351 --
NM_015559chr181737 --11067 --
NM_015564chr562574 2291 1283 924 391 198 --33441 2596 1014 --
NM_015565chr2122165 2056 --22228 556 --
NM_015567chr131113 ------
NM_015568chr20154271 3736 3678 3582 3521 3375 3279 2998 1642 1622 1546 1351 1252 169 29 ------
NM_015569chr134469 3494 3165 1607 ----
NM_015575chr263678 2566 1428 1060 720 647 ------
NM_015576chr311821 --11958 --
NM_015577chr581696 1576 1417 1401 649 420 364 255 1561 11138 --
NM_015578chr1951905 1804 1742 1693 721 ------
NM_015607chr11198 ------
NM_015608chr10139 ------
NM_015609chr162720 2701 2681 2427 724 361 11845 12162 --
NM_015610chr762836 2814 2365 1004 890 846 ------
NM_015626chr1721210 1155 1930 ----
NM_015627chr1111744 1632 1207 1175 688 513 505 332 312 238 180 --1205 --
NM_015634chr101202 ------
NM_015638chr205616 468 228 97 73 ------
NM_015640chr154930 4870 3485 2153 1467 ------
NM_015645chr112292 264 --128 --
NM_015651chr941691 1658 1437 339 --1133 --
NM_015657chr21718 --1675 --
NM_015658chr12368 328 ------
NM_015670chr171455 ------
NM_015686chrX112509 2416 2247 2104 1988 1884 1815 1583 954 602 303 ------
NM_015691chrX62243 2203 1807 927 671 573 12969 ----
NM_015695chr62779 31 --11914 12000
NM_015723chr71479 ------
NM_015831chr71929 --1767 --
NM_015850chr892294 1907 1714 935 726 541 413 375 149 --12409 --
NM_015866chr1153 --1463 --
NM_015872chr161609 1476 1449 1375 1218 386 11738 ----
NM_015874chr4--1512 ----
NM_015878chr821673 1602 1230 ----
NM_015879chr18198590 8371 8303 7489 6817 6647 6457 5942 3312 3296 2116 1968 1697 1652 1183 1108 692 147 44 32621 1726 524 27159 2745 --
NM_015886chr855703 4272 4057 1885 1621 --1670 --
NM_015888chr121220 53 12730 --12666
NM_015889chr223727 279 131 ------
NM_015902chr81327 ------
NM_015904chr23709 280 199 ------
NM_015906chr144564 4196 1604 1432 22939 1717 24762 3271 --
NM_015957chr111266 ------
NM_015975chrX2702 275 ----1695
NM_015995chr15124877 4831 4558 4422 3472 3399 2199 1904 1728 1332 1283 1202 13537 13507 25496 595
NM_016003chr762836 2814 2365 1004 890 846 ------
NM_016006chr31174 ------
NM_016009chr184563 4462 4280 4252 3375 3315 1951 1138 13151 ----
NM_016018chr832304 1751 904 1451 ----
NM_016019chr72299 171 1911 ----
NM_016021chr663008 2184 1126 846 664 310 1525 --1915
NM_016022chr14428 370 285 144 --1440 --
NM_016025chr1632029 1284 49 ----11721
NM_016032chrX11102 11270 ----
NM_016037chr1------21087 765
NM_016040chr112482 ------
NM_016045chr2021288 392 ----11627
NM_016048chr51267 ------
NM_016057chr1261292 992 314 290 281 273 --21138 87 --
NM_016061chr221344 461 ----11638
NM_016073chr153986 331 239 ------
NM_016075chr1362773 2159 1284 1206 910 679 ------
NM_016076chr162646 2624 2321 1067 630 203 22127 1292 ----
NM_016078chr171817 ------
NM_016083chr683363 3209 3181 2815 1108 992 388 107 13021 2439 329 --
NM_016087chr73692 68 30 ------
NM_016096chr8--2545 372 11480 --
NM_016097chr181718 ------
NM_016098chr6--1174 ----
NM_016103chr51399 ----1456
NM_016107chr52363 41 1268 11252 --
NM_016129chr41320 ------
NM_016131chr231794 1495 507 21775 515 ----
NM_016132chr1512718 --13244 --
NM_016133chr21481 1523 ----
NM_016141chr3260 53 1748 ----
NM_016147chr1151108 1026 942 844 267 ------
NM_016152chr32966 951 ------
NM_016156chr1122276 2247 --1715 --
NM_016166chr15174 ------
NM_016169chr1072956 1246 1115 1105 551 539 318 11044 --11145
NM_016172chr91140 ------
NM_016173chr3204401 3917 3862 3748 3397 3385 3264 3084 1683 1639 1617 1577 1443 1432 1423 1368 1229 1103 497 193 34512 3002 2852 43448 3299 122 23 --
NM_016179chr13153 ------
NM_016192chr21101 ------
NM_016201chr382312 859 830 767 509 491 333 50 ------
NM_016203chr72970 261 1359 ----
NM_016205chr42907 396 --1421 --
NM_016206chr3107680 7631 7418 3550 3372 2497 2345 2078 2071 505 13438 1566 18144
NM_016227chr12627 370 ------
NM_016230chr6----1434 --
NM_016231chr1711218 ------
NM_016248chr1323498 1354 12475 ----
NM_016250chr142774 285 ----1199
NM_016252chr2----2637 121 --
NM_016255chr663097 2484 2127 1293 807 378 ------
NM_016257chr1113294 3060 2860 2791 2612 2532 2151 1397 1287 572 247 --11309 --
NM_016258chr12771 241 ------
NM_016260chr252970 2799 2013 1862 163 36496 2917 1751 35180 2703 2101 16548
NM_016263chr19101090 974 897 845 789 742 307 178 161 80 --1365 --
NM_016270chr19----1311 --
NM_016272chr221849 21933 692 11784 --
NM_016275chr331999 1813 504 --1675 --
NM_016281chr121102 ------
NM_016287chr151489 757 310 259 190 ------
NM_016289chr231830 892 791 ------
NM_016297chr251210 970 646 640 599 1991 ----
NM_016300chr3----1206 --
NM_016308chr11287 ------
NM_016312chr121388 ------
NM_016316chr22611 84 --125 --
NM_016320chr11262 33 ------
NM_016322chr922570 250 11053 13134 --
NM_016338chr51318 1391 ----
NM_016351chr7193 ------
NM_016352chr781376 1215 1168 1090 1003 578 391 162 11066 ----
NM_016353chr832252 1907 105 ------
NM_016357chr122928 57 ------
NM_016373chr16187 ------
NM_016374chr1----11042 --
NM_016374chr1----11042 --
NM_016376chr1794331 3994 3595 3025 2949 1541 1127 506 56 --24260 1048 13451
NM_016396chr1542608 2072 947 132 22894 379 32016 1144 1035 --
NM_016410chr91134 ------
NM_016413chr132443 31 ------
NM_016422chr1142771 2291 769 506 ------
NM_016423chr14----1489 --
NM_016424chr172531 234 11928 11403 --
NM_016436chr202800 527 11877 1608 --
NM_016441chr232274 1620 416 155 ----
NM_016442chr512140 ------
NM_016451chr111208 ------
NM_016470chr201553 ------
NM_016480chr51639 ------
NM_016507chr1741085 898 775 492 ------
NM_016516chr2171 --1325 --
NM_016522chr1151669 1341 1188 350 205 --11428 --
NM_016525chr93257 213 200 1679 1313 --
NM_016529chr1351097 473 331 268 201 ------
NM_016530chr1573897 3196 1514 1322 1177 550 477 11428 ----
NM_016531chr443960 583 419 58 --22655 914 --
NM_016542chrX21158 98 --11126 --
NM_016544chr263842 3364 3275 2941 2861 103 ------
NM_016559chr331206 1000 154 ------
NM_016569chr1231172 274 193 ------
NM_016577chr383922 3506 3321 2828 1411 910 763 433 14539 ----
NM_016588chr62719 49 ------
NM_016596chr121896 --134 --
NM_016598chr361394 1248 1035 590 318 224 ------
NM_016603chr552190 1871 1641 414 218 --22066 1560 --
NM_016605chr552576 2545 2533 947 842 ------
NM_016620chr121103 930 ------
NM_016621chr1184194 4101 4018 3177 3148 3024 1557 522 --14479 --
NM_016626chr1831339 488 428 ------
NM_016631chr211137 ------
NM_016641chr1641378 1345 250 208 1256 ----
NM_016644chr51524 ------
NM_016645chr152324 27 ------
NM_016651chr141172 ------
NM_016654chr1521120 870 ------
NM_016655chr15--197 ----
NM_016823chr171965 ------
NM_016824chr1051894 1858 1808 235 184 1775 ----
NM_016831chr152050 1505 959 948 759 11878 ----
NM_016836chr2--1612 1703 --
NM_016839chr2--1612 1703 --
NM_016929chr673968 3468 3404 3262 2965 1113 90 14339 14516 --
NM_016932chr22314 28 --1901 --
NM_016936chr1661885 1542 1388 784 752 213 ------
NM_016946chr173262 2337 2248 1252 841 558 164 2681 39 1182 194
NM_016950chr421302 979 ------
NM_016952chr1183608 3317 2843 1482 999 992 821 162 13934 --1183
NM_016954chrX--1148 1486 --
NM_017410chr1211286 ------
NM_017412chr831390 1008 61 ------
NM_017413chrX72529 2192 1761 1590 1005 368 29 32362 1965 654 ----
NM_017415chr574346 3802 3121 2967 633 521 200 23477 1777 33567 1202 212 --
NM_017420chr1473780 3702 3257 3110 1511 1293 987 13610 13204 --
NM_017423chr431397 791 271 ------
NM_017433chr103561 515 154 ------
NM_017447chr2144373 3945 3723 2870 21680 1401 127 13213
NM_017450chr1731472 1362 29 --1130 --
NM_017456chr1741990 716 497 49 ------
NM_017481chr112254 41 ------
NM_017488chr241485 1138 636 233 ------
NM_017491chr43786 730 100 ------
NM_017514chrX5787 256 250 172 139 1817 ----
NM_017519chr611037 ------
NM_017522chr11973 ------
NM_017530chr162101 22 ------
NM_017540chr5113187 2841 2622 2559 2418 2226 2078 2017 858 712 296 ------
NM_017544chrX2718 29 ------
NM_017545chr201438 1184 ----
NM_017546chr21875 ------
NM_017548chr321751 534 2542 166 ----
NM_017549chr73453 345 258 11181 ----
NM_017551chr1082669 2612 2112 2033 1081 601 578 413 12178 ----
NM_017553chr1541008 944 311 120 ------
NM_017580chr1041820 687 553 165 1925 22165 953 --
NM_017582chr121311 1147 11593 ----
NM_017590chr2222648 226 ------
NM_017593chr42467 379 --2427 367 --
NM_017595chr1781647 1541 1419 1357 1283 1251 533 479 ------
NM_017596chr1234545 4476 4247 4190 4151 4061 3939 3600 3508 3468 3220 3211 3144 2939 1583 1541 1487 703 670 596 507 158 137 13179 24508 4385 --
NM_017602chrX4898 215 111 50 --1935 --
NM_017610chr1531664 1381 25 ------
NM_017622chr175614 512 219 147 88 ------
NM_017626chr1051695 1657 1164 361 160 ------
NM_017628chr485315 4827 4647 4547 4500 2031 1871 1592 ------
NM_017629chr1165 11406 1512 --
NM_017633chr633747 832 128 ----1946
NM_017637chr968699 8488 8249 7963 6051 3137 --69024 8055 6960 6370 790 131 --
NM_017640chr63706 343 152 --1276 --
NM_017643chr1743121 2146 1234 781 ------
NM_017644chr364030 3696 3591 2068 663 130 24487 4359 ----
NM_017651chr631409 497 420 ------
NM_017657chr22900 297 177 ----
NM_017658chr1434336 3129 174 24350 4298 2966 676 --
NM_017660chr19113117 3039 2805 2719 2233 1333 1103 602 473 266 107 ----12322
NM_017662chr92627 35 11511 ----
NM_017664chr1321066 216 ------
NM_017666chrX42235 1736 801 276 --21896 245 --
NM_017668chr161647 ------
NM_017670chr117766 758 713 586 200 180 26 ------
NM_017672chr15----1306 --
NM_017680chr93992 379 22 ------
NM_017686chr111147 1986 ----
NM_017693chr1351502 1127 424 394 212 ------
NM_017707chr14852 807 161 24 ------
NM_017715chr71478 ------
NM_017719chr32456 370 12200 1805 --
NM_017728chr17123046 3032 2958 2582 2340 1986 1894 1217 1140 760 392 186 ------
NM_017730chr3----1579 1240
NM_017737chr111631 1878 ----
NM_017742chr182519 150 ------
NM_017745chrX----1630 --
NM_017748chr171863 ------
NM_017753chr91165 ------
NM_017754chr674784 4649 3793 1192 570 425 224 23461 1121 ----
NM_017758chr17--11527 ----
NM_017762chr152652 200 ------
NM_017772chr631133 639 32 ------
NM_017778chr821289 1169 ------
NM_017779chr152734 2581 2100 981 727 1571 12721 --
NM_017780chr8----2864 264 --
NM_017786chr82232 205 ------
NM_017789chr23692 149 99 ------
NM_017791chr1451320 1021 448 342 308 1403 ----
NM_017799chr1441698 1691 1557 1286 ------
NM_017801chr321691 1023 ------
NM_017811chr942206 2067 674 30 --12637 --
NM_017813chr875721 5627 5467 5021 3803 1338 942 25203 3885 ----
NM_017824chr1022660 346 --21838 578 --
NM_017831chr1864259 3784 1817 1518 1219 1208 --1445 11159
NM_017842chr122657 479 2678 55 ----
NM_017845chr41679 ------
NM_017847chr132063 165 123 ------
NM_017848chrX44597 4481 3991 1109 --14034 1128
NM_017849chr282431 1252 1197 613 550 392 172 146 11217 ----
NM_017851chr155912 430 155 80 73 2256 44 1382 --
NM_017856chrX41869 1682 1538 660 --1366 --
NM_017866chr82444 66 ------
NM_017873chr982943 2863 2683 2537 2170 1236 1224 613 ------
NM_017880chr21111 ------
NM_017893chr1061383 1306 943 521 254 131 11151 126 --
NM_017896chr2073476 3269 2603 2339 2252 973 265 --11028 --
NM_017902chr1095108 4717 4546 4015 3845 1736 1168 612 214 25150 4093 25493 459 --
NM_017905chr131532 1169 ----
NM_017913chr9------1383
NM_017917chr141108 ------
NM_017919chr995079 4918 4121 3928 3920 1842 1678 1565 728 34589 3943 1401 14418 --
NM_017925chr921468 188 11530 11491 --
NM_017933chr231483 1151 276 1364 1500 --
NM_017938chrX31752 343 278 ------
NM_017944chr1162757 2083 2076 917 363 155 1132 ----
NM_017954chr741727 1681 1614 70 ------
NM_017955chr1451136 958 909 855 103 ------
NM_017957chr1731294 1259 1086 --11562 --
NM_017987chr101476 2533 264 11681 --
NM_017994chr772745 2547 2307 1201 1082 886 208 --182 --
NM_018004chr32319 273 1308 ----
NM_018009chr121118 --1159 --
NM_018011chr132498 481 --1144 --
NM_018013chr652837 2343 2264 2186 553 --1864 --
NM_018014chr2----1280 11067
NM_018015chrX1759 ------
NM_018027chr102833 61 1174 11317 --
NM_018028chr191444 1878 1168 --
NM_018030chr18------1744
NM_018032chr162278 255 ------
NM_018061chr131279 687 150 --1270 --
NM_018063chr10----1398 --
NM_018064chr6130 --1307 --
NM_018071chr143228 191 154 ------
NM_018078chr43358 79 46 1819 ----
NM_018084chr2150 ----12963
NM_018085chr1167834 7376 7041 6827 6254 5370 2925 2458 2107 1523 1510 1324 950 770 482 465 17178 ----
NM_018086chr221635 227 ------
NM_018087chr11194 ------
NM_018092chr162615 335 ----11385
NM_018096chr176978 790 743 736 142 56 1401 ----
NM_018110chr1631385 879 855 ------
NM_018115chr43746 54 48 1695 ----
NM_018121chr1032632 2489 1140 11232 ----
NM_018133chr32841 428 --21834 199 --
NM_018150chr12899 808 ------
NM_018155chr342951 2932 2125 268 22823 1120 32974 721 223 --
NM_018156chr172491 2454 2330 2130 2084 929 281 --13007 --
NM_018157chr1242881 2200 1229 672 12814 2344 91 --
NM_018159chrX2256 174 ------
NM_018164chr121200 ------
NM_018178chr131681 794 582 ------
NM_018179chr12--1635 ----
NM_018181chr1841942 1927 580 528 11738 1417 --
NM_018184chr321996 111 ------
NM_018191chr1321728 34 2469 70 ----
NM_018193chr15277 69 ------
NM_018195chr1141829 1677 650 423 11428 --11935
NM_018200chr1561931 1769 616 575 432 211 1698 21025 712 --
NM_018201chr9122335 2308 2298 2201 1753 1575 722 251 205 193 134 52 1741 ----
NM_018202chr14903 694 280 22 ------
NM_018203chr12561 28 ------
NM_018205chr1092312 2275 2144 1695 1689 875 452 265 184 --11955 --
NM_018206chr162634 86 ------
NM_018208chr121195 871 1416 1934 --
NM_018211chr122059 868 166 --1505
NM_018222chr1151843 1733 1177 382 107 174 ----
NM_018223chr1231114 306 133 ------
NM_018227chr4--32902 815 550 22351 767 --
NM_018234chr241863 1755 844 48 --22235 2185 --
NM_018239chr1092312 2275 2144 1695 1689 875 452 265 184 --11955 --
NM_018240chr13205 185 175 --1768 --
NM_018243chr462591 1578 1276 1208 640 253 22886 477 23017 203 13782
NM_018247chr652764 2604 2529 2129 619 12910 --12464
NM_018252chr11502 --2519 290 --
NM_018263chr221615 735 12109 ----
NM_018265chr162033 1923 1762 529 361 194 11903 1661 --
NM_018290chr4--1296 1324 --
NM_018299chr811089 12501 12818 --
NM_018312chr1132091 1657 850 --21771 487 11485
NM_018313chr321067 870 2623 464 ----
NM_018315chr421256 53 ------
NM_018323chr441539 1396 402 385 2736 466 ----
NM_018325chr91105 ------
NM_018327chr2031453 1445 1226 --11802 --
NM_018340chr1674996 3957 3271 916 817 627 159 13790 21962 126 --
NM_018348chr16--170 ----
NM_018351chr1254565 3967 3805 3390 1702 13328 ----
NM_018357chr151365 ------
NM_018361chr82935 244 ----12556
NM_018362chr1163779 3495 3459 3194 2977 141 1227 ----
NM_018364chr144145 3237 3064 347 --13398 --
NM_018373chr1455876 5447 4091 2509 743 24025 1022 ----
NM_018374chr795174 4279 3677 3436 2084 2077 1505 1146 924 ----14857
NM_018383chr241371 1267 703 197 1432 2818 652 --
NM_018388chrX----11164 --
NM_018394chr31210 ------
NM_018403chr3103556 3138 2760 2550 1653 974 738 626 614 558 ------
NM_018416chr1242101 988 554 302 11974 11910 --
NM_018419chr203376 141 84 ------
NM_018424chr951838 1823 1740 1665 1401 --11705 --
NM_018425chr1052077 1848 701 462 240 1317 22477 1657 --
NM_018434chr5136 ------
NM_018439chr1852215 1982 417 407 317 ------
NM_018440chr8137425 7413 7149 6548 6156 5716 3432 3343 1094 510 455 353 202 25940 1943 27396 6998 12329
NM_018441chr23170 38 21 ----1798
NM_018445chr15--166 ----
NM_018452chr6_random52829 2423 2377 1360 1026 --1580 --
NM_018457chr12145 ------
NM_018460chr22111 46 ------
NM_018465chr9177 1187 ----
NM_018469chr1741362 934 144 128 ------
NM_018471chr2----1547 --
NM_018482chr84828 662 172 53 ------
NM_018489chr121712 67 --12062 --
NM_018490chr111205 ------
NM_018534chr2--1626 ----
NM_018557chr231431 1159 465 11065 ----
NM_018566chr163784 3267 3261 2050 726 218 33712 3332 1257 34426 4307 1024 --
NM_018569chr41198 ----1581
NM_018571chr2------125
NM_018584chr121085 982 ------
NM_018638chr1285312 3835 2244 1937 1415 1337 367 129 --13871 --
NM_018639chr1211377 11073 ----
NM_018640chr1242606 1117 843 781 ------
NM_018650chr161762 846 679 570 118 76 11607 ----
NM_018652chr1541025 821 726 339 ------
NM_018657chr31302 1268 ----
NM_018660chr872900 2656 2419 2345 2254 833 526 --12373 --
NM_018667chr1682144 1031 715 387 156 131 80 64 12474 ----
NM_018682chr71122 ------
NM_018683chr2031598 643 631 ------
NM_018684chrX61292 1034 975 869 258 165 1420 168 --
NM_018686chr12--1136 1325 --
NM_018691chr521041 148 ------
NM_018695chr51811 --1396 --
NM_018698chrX51993 1957 1766 1754 168 ----1203
NM_018700chr521368 180 ----3420 394 53
NM_018712chr1121033 236 --1114 --
NM_018713chr151081 1046 973 374 218 --1116 --
NM_018717chr452104 1117 1033 904 741 --1303 --
NM_018718chr752166 2137 1601 757 647 --11738 --
NM_018841chr173369 2633 1587 1024 1015 975 161 --23485 471 13828
NM_018845chr11419 ----2547 524
NM_018890chr72998 434 ------
NM_018898chr522200 319 --1772 --
NM_018899chr522200 319 --1772 --
NM_018900chr522200 319 --1772 --
NM_018901chr522200 319 --1772 --
NM_018902chr522200 319 --1772 --
NM_018903chr522200 319 --1772 --
NM_018904chr522200 319 --1772 --
NM_018905chr522200 319 --1772 --
NM_018906chr522200 319 --1772 --
NM_018907chr522200 319 --1772 --
NM_018908chr522200 319 --1772 --
NM_018909chr522200 319 --1772 --
NM_018910chr522200 319 --1772 --
NM_018911chr522200 319 --1772 --
NM_018912chr571585 1461 1255 561 352 154 128 --1709 --
NM_018913chr571585 1461 1255 561 352 154 128 --1709 --
NM_018914chr571585 1461 1255 561 352 154 128 --1709 --
NM_018915chr571585 1461 1255 561 352 154 128 --1709 --
NM_018916chr571585 1461 1255 561 352 154 128 --1709 --
NM_018917chr571585 1461 1255 561 352 154 128 --1709 --
NM_018918chr571585 1461 1255 561 352 154 128 --1709 --
NM_018919chr571585 1461 1255 561 352 154 128 --1709 --
NM_018920chr571585 1461 1255 561 352 154 128 --1709 --
NM_018921chr571585 1461 1255 561 352 154 128 --1709 --
NM_018922chr571585 1461 1255 561 352 154 128 --1709 --
NM_018923chr571585 1461 1255 561 352 154 128 --1709 --
NM_018924chr571585 1461 1255 561 352 154 128 --1709 --
NM_018925chr571585 1461 1255 561 352 154 128 --1709 --
NM_018926chr571585 1461 1255 561 352 154 128 --1709 --
NM_018927chr571585 1461 1255 561 352 154 128 --1709 --
NM_018928chr571585 1461 1255 561 352 154 128 --1709 --
NM_018929chr571585 1461 1255 561 352 154 128 --1709 --
NM_018945chr643426 3286 1036 109 ------
NM_018951chr7--1265 ----
NM_018952chr172182 112 ------
NM_018963chr2121442 175 ------
NM_018964chr2151038 734 278 110 54 ------
NM_018970chr722905 1963 2822 235 1304 --
NM_018972chr842256 775 702 540 --12329 --
NM_018976chr1221075 592 ------
NM_018977chrX21042 884 ------
NM_018979chr1251704 909 770 502 457 11759 1384 --
NM_018992chr1631660 467 67 ------
NM_018994chr11565 ------
NM_019000chr521546 648 --11518 --
NM_019005chr7155 ------
NM_019008chr22123721 3580 3350 2974 2791 1377 1196 787 453 414 342 213 --23766 402 --
NM_019027chr442139 751 235 193 1736 21789 1740 --
NM_019035chr431947 826 805 ------
NM_019036chr63434 257 84 ------
NM_019041chr642327 1711 862 512 ----1737
NM_019042chr71966 --11153 --
NM_019045chrX1313 ------
NM_019046chr103899 361 348 ------
NM_019049chr1----2762 525 --
NM_019053chr1031048 1016 308 ------
NM_019063chr23626 590 549 --2840 601 --
NM_019071chr7----1494 --
NM_019072chr553666 3563 1648 943 675 ------
NM_019074chr154620 393 266 110 ------
NM_019084chr10----22117 765 --
NM_019094chr1253842 1523 1391 855 776 ----1226
NM_019096chr63999 740 70 ------
NM_019106chr2272505 2171 899 866 682 268 229 ------
NM_019114chr992260 2114 2058 2051 1714 1643 781 103 39 11863 ----
NM_019116chr1643666 1126 1099 787 --23635 2809 --
NM_019555chr31273 ------
NM_019556chrX31213 440 62 ------
NM_019557chr1259 34 --1827 --
NM_019558chr21126 ------
NM_019593chr2063045 2833 2173 2108 2099 2039 --32436 1010 88 --
NM_019595chr21213 1219 ----
NM_019597chrX----1493 --
NM_019600chr151657 ----1189
NM_019605chr12294 135 1682 ----
NM_019606chr73487 172 37 ------
NM_019613chr17169 1476 1925 --
NM_019854chr122200 123 ------
NM_019859chr1061472 1350 1099 472 301 99 ------
NM_019860chr1061520 1398 1147 520 349 147 ------
NM_019885chr282369 1813 855 602 523 392 272 118 22745 1004 --1835
NM_019891chr121348 131 ------
NM_019903chr1051894 1858 1808 235 184 1775 ----
NM_020062chr201990 ------
NM_020116chr42469 369 --21801 524 --
NM_020119chr753927 3508 768 545 186 ----13117
NM_020122chr2105181 5111 4850 4491 4015 3870 2306 1121 999 628 25847 746 24530 28 --
NM_020144chr731681 1437 473 --11718 --
NM_020147chr15----121 --
NM_020150chr102576 168 ----12193
NM_020152chr214947 779 709 44 ------
NM_020153chr111136 --3304 128 88 --
NM_020154chr15--1238 ----
NM_020156chr7--1382 ----
NM_020159chr4--1395 ----
NM_020177chr543234 2879 908 116 1427 22697 2205 --
NM_020178chr1741115 1091 1078 71 1503 11189 --
NM_020182chr2083433 3175 2649 2636 2573 1081 1055 960 ------
NM_020188chr16----123 --
NM_020198chr1711287 ------
NM_020205chr143373 3009 2331 560 11109 ----
NM_020214chr15288 51 ------
NM_020228chr112884 260 ------
NM_020231chr32698 676 ----1685
NM_020235chr31305 ------
NM_020238chr1151061 1034 918 257 86 ------
NM_020239chr172229 2221 2042 1773 1444 826 446 22067 1570 ----
NM_020245chr694931 4777 4134 4046 4029 3855 3664 3086 90 1332 11038 1299
NM_020246chr72257 104 ------
NM_020248chr162287 1911 1852 1697 607 125 ------
NM_020309chr1941084 814 691 97 ------
NM_020310chr1792732 2441 2224 2153 2088 910 778 701 520 ------
NM_020314chr16267 59 --1639 --
NM_020336chr2063743 3737 3463 2559 703 619 ------
NM_020337chr463057 2436 1093 843 170 74 --22836 2354 --
NM_020340chr631655 1496 893 1863 ----
NM_020341chr2032070 1649 1362 11524 ----
NM_020342chr222001 430 ------
NM_020346chr1111136 ----21744 1448
NM_020348chr1062436 2130 1009 914 758 116 --22806 325 --
NM_020374chr1261680 1372 1297 786 628 91 ------
NM_020382chr1231396 1061 58 --1142 --
NM_020383chr102373 280 --137 --
NM_020390chr31393 --21707 1320 --
NM_020403chr1341298 1192 627 96 ------
NM_020420chrY31453 1217 727 ------
NM_020431chr1462745 2578 1094 648 636 398 ------
NM_020432chr752173 1803 1506 706 569 1364 ----
NM_020443chr1106379 5931 5339 2518 1977 1492 1446 926 665 218 12307 15267 --
NM_020452chr151603 794 678 316 127 --12164 --
NM_020455chr631060 571 68 ------
NM_020458chr291480 835 562 539 510 314 296 228 195 ------
NM_020463chr21211 ------
NM_020466chr663553 3189 3147 1877 928 797 1153 ----
NM_020473chrX52019 1732 1362 709 573 11889 ----
NM_020474chr1842007 1850 1718 798 ------
NM_020475chr832293 1662 911 --22402 471 --
NM_020476chr832293 1662 911 --22402 471 --
NM_020477chr832293 1662 911 --22402 471 --
NM_020478chr832356 1725 974 --22465 534 --
NM_020480chr832293 1662 911 --22402 471 --
NM_020530chr223887 329 44 ------
NM_020548chr2----155 --
NM_020630chr10185 --1508 --
NM_020640chr312031 1726 ----
NM_020647chr8--32325 416 340 1866 --
NM_020651chr2193 --1269 --
NM_020654chr311563 ------
NM_020655chr1681375 1308 1234 1226 1170 1013 323 163 ------
NM_020673chr20167635 7629 7555 7315 6533 6301 5678 5672 4913 2494 1800 1793 1610 1098 1000 611 --17277 --
NM_020697chr831311 1182 100 --1197 --
NM_020699chr1154795 4707 4700 4670 3860 3814 3635 2147 1643 1535 1359 1221 832 379 173 --14609 --
NM_020702chr941816 1264 1160 219 1749 ----
NM_020704chr752000 870 192 174 58 --1682 --
NM_020708chr20102457 2343 2154 1894 1538 1001 740 237 111 104 ------
NM_020711chr251976 846 656 495 30 ----182
NM_020713chr2072618 2385 2104 814 564 221 83 --1765 --
NM_020717chrX134565 4035 3998 3739 3321 3286 1828 1780 1517 570 453 392 298 1681 ----
NM_020718chr16115510 4412 4140 1978 1895 1202 1149 1052 424 113 61 --36634 4248 995 --
NM_020724chr432545 2168 247 ------
NM_020727chr2143711 2957 2604 642 11533 23514 166 13876
NM_020732chr611037 ------
NM_020734chr124777 669 278 96 1835 ----
NM_020739chr1543770 1062 733 400 ------
NM_020742chrX2907 742 32686 2599 35 ----
NM_020747chr5--1939 --194
NM_020748chr171824 --22005 330 11892
NM_020752chr1062756 2537 2505 1157 496 280 ------
NM_020754chr331404 1121 346 --1459 --
NM_020755chr61368 1264 ----
NM_020760chr241778 201 142 52 ------
NM_020765chr1146 ------
NM_020766chrX63532 2928 1575 1267 1161 819 13727 ----
NM_020769chrX5884 780 196 184 102 ------
NM_020771chr621402 258 ------
NM_020772chr17218036 7951 7241 6684 6575 6551 6496 6448 6127 5235 3435 2722 2311 2250 1962 1945 1718 1578 926 850 77 15867 37452 5536 549 --
NM_020774chr1854762 3928 2330 1565 773 1901 25641 974 --
NM_020777chr4112572 2121 1990 1872 1836 1627 874 771 683 564 533 ------
NM_020778chr15124850 4073 3610 3338 3137 1540 1300 1290 838 732 672 450 24142 4011 24000 605 14584
NM_020783chr1821543 502 --2458 376 --
NM_020787chr1721347 991 ------
NM_020792chr321099 317 ------
NM_020794chr11345 --1381 1585
NM_020795chr1711936 --21873 1827 --
NM_020796chr542816 2267 581 51 ------
NM_020801chr552631 2046 779 547 332 --22571 629 --
NM_020806chr14135 ------
NM_020807chr1641587 1375 1145 89 31364 557 345 ----
NM_020808chr13759 292 39 1456 ----
NM_020809chr1141886 878 556 22 --1333 --
NM_020810chr1462648 2617 2274 2256 638 338 1116 13596 --
NM_020824chr101751 ------
NM_020825chr16143682 3510 3273 2786 2757 2498 1310 1217 1020 941 518 467 361 295 --11108 --
NM_020826chr11103602 3333 2998 2955 1499 1302 1206 808 262 68 12414 ----
NM_020830chr243211 3019 2657 2173 22693 2350 --12647
NM_020832chr13498 430 254 1424 ----
NM_020834chr1451929 687 450 287 281 --11837 --
NM_020839chr311221 ------
NM_020841chr1253020 2790 1400 1385 785 ------
NM_020844chr856128 4730 2932 815 689 16955 16972 --
NM_020845chr1252498 2283 311 290 158 ------
NM_020850chr1683196 3190 2600 2219 1317 976 875 59 12407 ----
NM_020854chr182499 78 ------
NM_020856chr1911512 --11269 --
NM_020861chr621148 531 ------
NM_020866chr13--1767 11047 --
NM_020868chr232007 1707 318 1380 1748 --
NM_020870chr42221 136 ------
NM_020871chrX21880 1021 1104 ----
NM_020872chr3--11679 --1183
NM_020873chr31564 ------
NM_020888chr162013 1860 692 520 361 172 --1197 --
NM_020889chr17----121 --
NM_020897chr141189 510 163 65 ------
NM_020918chr1062754 1236 1169 587 141 107 --22954 2397 12489
NM_020921chr1422638 1245 --13650 --
NM_020922chrX41599 1347 1302 742 ------
NM_020924chr91182 1172 ----
NM_020925chr1------1502
NM_020927chr1651952 434 316 195 75 12251 ----
NM_020935chr274154 3781 3477 1237 1137 365 162 11732 ----
NM_020940chr1012940 --1346 11040
NM_020943chr2------133
NM_020946chr931396 650 225 ------
NM_020948chr142257 1340 718 155 ------
NM_020951chr1941789 1665 762 292 12379 --12166
NM_020956chr19194625 3862 3847 3769 3643 3382 3273 3215 3206 3171 2902 1573 1516 1387 1279 1177 1104 1008 36 --23398 1475 --
NM_020958chr141379 ------
NM_020962chr15112494 1937 1866 1547 952 876 707 495 425 340 76 1663 --12302
NM_020964chr18114384 4153 4129 4004 3772 3060 1905 1515 1107 1057 298 11442 33008 2920 1354 --
NM_020975chr1051720 1372 521 471 261 ------
NM_020977chr42803 568 --21496 738 --
NM_020980chr152686 250 ----11553
NM_020993chr1281867 1058 1028 729 489 430 424 220 ------
NM_020998chr3----125 --
NM_021003chr142309 295 --1692 --
NM_021005chr151394 ------
NM_021007chr21916 ----11818
NM_021012chr17123091 2963 2916 2813 2396 2313 2216 1142 1045 781 626 97 11027 ----
NM_021019chr122199 78 ------
NM_021032chr311963 ------
NM_021033chr1321214 203 --22810 2596 12644
NM_021035chr20229 22 ------
NM_021038chr3--13391 ----
NM_021061chr863543 1466 1067 1044 929 665 --23872 379 --
NM_021069chr411535 1231 --195
NM_021072chr51924 --11832 --
NM_021076chr22----1419 --
NM_021079chr1752715 2600 1096 1066 991 12044 ----
NM_021083chrX43626 3221 2527 421 22968 2672 ----
NM_021088chr261809 1663 1374 827 721 111 21948 1438 ----
NM_021090chr22103792 3312 1605 1562 1485 1371 858 653 517 215 13534 ----
NM_021097chr232938 2178 827 ------
NM_021101chr332272 568 508 11912 12134 --
NM_021106chr91585 --1529 --
NM_021109chrX2305 49 ------
NM_021109chrX2305 49 ------
NM_021111chr931334 48 26 ------
NM_021116chr7188246 7797 7695 7118 6257 3377 3233 2695 2562 2532 2399 2352 1851 1743 1411 1351 424 46 48978 7464 7000 3440 48577 5816 1944 1593 --
NM_021120chrX73070 2910 1258 1153 902 409 234 --13133 --
NM_021143chr193488 404 375 ------
NM_021158chr203733 548 100 ------
NM_021159chr431568 1322 50 --1539 --
NM_021161chr143531 475 161 183 ----
NM_021173chr11125 --1352 --
NM_021174chr82257 129 ------
NM_021183chrX----2832 386 --
NM_021188chr14----1441 173
NM_021189chr14999 863 801 214 ------
NM_021190chr111053 1307 ----
NM_021192chr23361 82 64 ------
NM_021198chr2101461 1248 1095 1005 937 589 538 402 364 213 ------
NM_021202chr2093023 2739 2696 2326 2031 591 542 305 236 ------
NM_021205chr122232 157 12820 1478 --
NM_021220chr202349 124 ------
NM_021227chr41450 ------
NM_021237chr32131 124 ------
NM_021238chr1241574 489 221 107 ------
NM_021242chrX1293 ------
NM_021249chr1461596 1525 1483 399 85 36 1589 ----
NM_021253chr621399 68 --1476 --
NM_021255chr1423794 187 --12653 --
NM_021260chr144498 478 451 106 ------
NM_021622chr1021477 835 --1538 --
NM_021627chr31404 ------
NM_021629chr311057 14740 ----
NM_021631chr8122 ------
NM_021643chr251875 1690 1625 1604 665 11901 ----
NM_021644chr101271 ------
NM_021647chr453326 1660 1063 524 351 13814 24575 292 13708
NM_021648chr682480 2425 2297 2122 1078 552 427 296 22630 1948 1334 --
NM_021705chr651507 1388 1172 166 100 ------
NM_021723chr7193 ------
NM_021728chr142891 103 ------
NM_021729chr112313 97 ------
NM_021738chr103736 698 284 --1308 --
NM_021783chrX4900 873 792 102 11535 12423 --
NM_021813chr685605 5131 5040 4123 1802 1461 1327 498 --14393 15339
NM_021814chr6272 64 1271 --1418
NM_021905chr6131742 1718 1695 1686 1631 1618 1568 1554 1474 1410 677 669 619 --1280 --
NM_021911chr595294 5076 5063 4623 4171 3724 3624 1897 407 14818 15009 --
NM_021912chr1543935 3825 1665 221 1857 21194 361 --
NM_021913chr1951720 1687 1634 1260 524 ------
NM_021914chr1442086 866 452 260 --3648 344 222 --
NM_021931chr201115 ----1804
NM_021940chr611196 --21254 479 --
NM_021943chr62746 489 11710 11622 --
NM_021945chr663399 3335 3301 1073 946 331 ----13018
NM_021947chr171335 11068 ----
NM_021949chrX32655 1982 805 --12352 --
NM_021954chr1373715 2450 1369 1309 1281 804 622 1909 ----
NM_021959chr63808 708 284 ------
NM_021960chr122110 1913 ------
NM_021961chr11106974 6442 5006 4942 2685 2494 2102 1967 1927 117 56274 4661 2784 2200 640 37424 5096 2439 --
NM_021962chr1762310 2291 1777 657 246 219 ------
NM_021963chrX--136 ----
NM_021964chr335568 4092 2466 2485 190 14959 --
NM_021965chr91403 1182 166 --
NM_021970chr41584 ------
NM_021977chr663200 2842 2496 1535 890 66 ------
NM_021979chr14135 --178 --
NM_021984chrX41445 398 316 266 ------
NM_021987chrX41445 398 316 266 ------
NM_021988chr202544 376 --11209 --
NM_021990chrX41445 398 316 266 ------
NM_021991chr172647 179 1626 ----
NM_022003chr1121203 1069 ------
NM_022037chr21209 ------
NM_022041chr1642513 795 614 469 1560 22619 2076 --
NM_022044chr22198 ------
NM_022047chr61352 ------
NM_022048chr1595825 5168 4327 4175 2555 1739 1301 1026 137 34363 4242 1412 22373 2247 25664 1633
NM_022060chr1451370 1117 1015 911 79 ------
NM_022066chr176962 738 388 276 119 90 ------
NM_022068chr18--1605 ----
NM_022075chr12351 154 1387 1968 --
NM_022080chr2072790 2716 2664 2355 2319 1006 78 --2998 322 --
NM_022085chr641235 1158 1141 1096 11422 ----
NM_022090chr51502 ------
NM_022100chr12584 500 ------
NM_022114chr1134758 4344 4028 3502 3199 3141 1784 1774 1108 1093 821 699 346 13665 ----
NM_022123chr142426 195 ------
NM_022129chr1041017 289 154 77 ------
NM_022130chr521008 533 ------
NM_022133chr811161 --1545 --
NM_022137chr1441765 757 679 117 ------
NM_022138chr651115 967 412 368 215 --11319 --
NM_022156chr171186 --168 --
NM_022166chr16146364 6125 5729 4156 4118 2100 1853 1672 1541 1467 1409 572 404 183 26187 1489 24574 1159 --
NM_022173chr21209 ------
NM_022307chr71640 ------
NM_022336chr241876 1861 211 23 ----1124
NM_022337chr114619 606 538 126 1545 ----
NM_022351chr813466 ------
NM_022366chr11371 ------
NM_022371chr1131 1275 ----
NM_022442chr202544 376 --11209 --
NM_022456chr12176957 6250 6148 6013 5999 5288 5154 5004 4986 4918 2879 2748 2107 1489 1224 549 22 26381 128 11852 --
NM_022457chr11234 ------
NM_022459chr1356366 6155 5621 817 313 2895 80 35658 2499 2079 --
NM_022465chr1282325 2243 1872 1121 858 568 279 41 --22486 2306 --
NM_022469chr163373 961 509 222 149 77 ------
NM_022474chr141271 --11101 12244
NM_022479chr751353 1249 1238 977 75 ----1438
NM_022482chr20--2753 396 ----
NM_022483chr5--11211 --11252
NM_022484chr731297 1246 120 --2890 303 21442 335
NM_022485chr3171 ------
NM_022496chr12--191 ----
NM_022552chr22913 173 ------
NM_022572chr2101594 1522 1470 1461 1337 1330 1292 519 506 402 --11503 1465
NM_022574chr762105 2056 2012 1454 868 466 ------
NM_022648chr2144554 4230 4154 4145 3550 3100 1833 1733 1400 1163 1087 878 659 624 11049 21131 322 --
NM_022650chr5280 40 ------
NM_022652chr121233 ----1810
NM_022658chr1211285 ------
NM_022716chr152996 901 448 410 64 2920 439 22873 1240 --
NM_022719chr22103420 3290 2902 2865 2755 2614 2407 1407 312 178 13381 ----
NM_022726chr6--1120 --1127
NM_022733chr151178 1035 1017 852 200 ------
NM_022735chr131846 1712 386 ------
NM_022739chr171458 11081 ----
NM_022745chr152068 1834 1177 1125 534 22758 120 21855 548 --
NM_022748chr792776 2632 2597 2234 2208 1859 663 332 34 ------
NM_022749chr81551 --1962 --
NM_022750chr72589 35 ------
NM_022753chr172228 2178 1817 825 774 630 153 11992 ----
NM_022756chr131378 1164 109 --1500 --
NM_022758chr6113128 2515 2316 2273 2200 2080 1068 910 874 791 540 ------
NM_022763chr373198 2844 2785 2778 2669 2502 972 22935 514 12710 --
NM_022776chr321434 574 11317 ----
NM_022778chr171465 1219 1037 931 503 195 69 1163 ----
NM_022780chr21118 ------
NM_022824chr51346 ------
NM_022826chr23299 142 89 ----1450
NM_022831chr11582 11516 1405 --
NM_022844chr161876 ------
NM_022845chr161889 42192 1762 811 728 11947 --
NM_022893chr222976 730 --12092 1889
NM_022894chr221169 622 1278 ----
NM_022897chr51816 1982 1263 --
NM_022898chr1494612 3983 3974 3503 3444 1603 1273 901 542 ----11141
NM_022899chr351580 1514 1340 480 243 ------
NM_022903chr3174 ------
NM_022912chr233063 2131 1906 1112 ----
NM_022918chr111265 ------
NM_022970chr103472 304 73 ----1981
NM_022977chrX41759 1700 770 369 ------
NM_023000chr1421165 524 --11101 11475
NM_023001chr1421165 524 --11101 11475
NM_023009chr15253 99 90 80 51 ------
NM_023010chrX276 26 1569 ----
NM_023018chr171177 1151 1109 357 234 145 39 ------
NM_023039chr5127 ------
NM_023074chr1931105 325 58 --1947 --
NM_023079chr1751427 1400 1232 508 371 --21671 493 21796 1494
NM_023105chr892294 1907 1714 935 726 541 413 375 149 --12409 --
NM_023106chr892294 1907 1714 935 726 541 413 375 149 --12409 --
NM_023110chr892294 1907 1714 935 726 541 413 375 149 --12409 --
NM_023111chr892294 1907 1714 935 726 541 413 375 149 --12409 --
NM_023923chr163714 3222 2621 1323 940 373 ------
NM_023925chr12174 --1320 --
NM_023929chr822582 991 1795 ----
NM_023931chr1631412 1127 1054 ------
NM_023934chrX42119 2080 2074 426 --1101 --
NM_024007chr542962 2321 1216 912 ----12102
NM_024017chr171168 --1299 --
NM_024034chr201990 --1267 --
NM_024043chr1631176 947 244 --11188 --
NM_024046chr3101259 1246 1231 1150 972 882 870 411 319 113 2497 294 198 --
NM_024052chr1773122 2630 2461 1925 1182 462 303 ------
NM_024071chr14--1451 ----
NM_024076chr1941708 945 890 572 --12432 --
NM_024087chrX2617 512 ------
NM_024090chr411866 ------
NM_024092chr11101146 948 501 395 387 380 362 182 97 86 --21105 825 --
NM_024117chr951061 1028 322 288 82 164 11109 --
NM_024293chr23728 314 163 ------
NM_024294chr6113128 2515 2316 2273 2200 2080 1068 910 874 791 540 ------
NM_024306chr162448 27 1360 ----
NM_024329chr161319 1077 1036 1009 395 355 11438 ----
NM_024336chr162275 101 ------
NM_024345chr985639 5019 4771 4752 3826 1561 1300 1133 ----15564
NM_024411chr2091459 1276 425 399 377 299 201 100 87 1590 ----
NM_024416chr931515 362 284 ------
NM_024421chr182777 238 1881 ----
NM_024424chr1161258 1146 826 338 308 187 ------
NM_024425chr1161258 1146 826 338 308 187 ------
NM_024426chr1161258 1146 826 338 308 187 ------
NM_024429chr72970 261 1359 ----
NM_024491chr33475 419 104 ------
NM_024494chr12557 153 ------
NM_024496chr143821 780 771 129 ----
NM_024511chr462551 2244 2177 1123 782 35 11070 ----
NM_024522chr151909 1731 748 504 118 ------
NM_024524chr352166 680 371 142 106 ------
NM_024529chr111113 1359 ----
NM_024539chrX11225 11017 ----
NM_024546chr1321158 34 ------
NM_024551chr1242347 2211 2001 1725 11824 2669 450 12318
NM_024551chr1242347 2211 2001 1725 11824 2669 450 12318
NM_024554chr161590 1469 1197 577 368 175 11496 1203 --
NM_024563chr531871 766 478 ------
NM_024565chr54550 520 507 344 ------
NM_024567chr84701 694 636 156 ------
NM_024569chr172758 2574 2496 2013 1932 1924 1887 1412 1899 --
NM_024595chr1--1221 1279 --
NM_024607chr8124378 3965 3792 3499 3346 3114 2975 1600 969 818 434 337 ------
NM_024612chr1711001 ------
NM_024613chr82570 169 1493 ----
NM_024624chr221458 25 --21329 523 --
NM_024626chr151579 1352 1266 580 405 ------
NM_024631chr111193 ------
NM_024639chr652926 2408 1113 323 209 22090 164 1377 --
NM_024643chr143530 461 129 ------
NM_024646chr153964 3263 3069 682 221 --2465 430 13804
NM_024665chr344548 4070 1320 236 --1743 --
NM_024674chr131030 972 952 1567 22585 192 --
NM_024680chr111367 ------
NM_024686chr1----1404 --
NM_024689chrX11229 1461 11135 --
NM_024692chr251446 1372 712 535 522 1348 11261 --
NM_024700chr13218 111 100 21003 123 ----
NM_024704chr20138 --1185 --
NM_024713chr1521404 1272 ----1553
NM_024721chr832097 2053 648 --12019 --
NM_024742chr16151564 1536 1343 1330 1291 1253 771 726 533 483 477 391 201 86 73 ------
NM_024745chr1621142 402 153 ----
NM_024761chr984747 3542 1675 1287 1247 511 168 51 14994 24429 1901 --
NM_024770chr2116630 5335 4795 4662 2159 1571 1446 1376 1207 1196 212 --22389 183 --
NM_024779chr1261419 1293 1105 347 282 185 ------
NM_024787chr83365 276 176 ------
NM_024792chr1751226 914 882 773 75 1167 ----
NM_024798chr1582493 2331 2154 908 616 408 271 116 153 32398 2224 193 --
NM_024811chr113448 435 267 ------
NM_024818chr311389 ------
NM_024824chr142690 601 ------
NM_024825chr192293 73 ------
NM_024828chr9----11292 --
NM_024834chr1011998 21920 1539 11755 --
NM_024841chr11102300 2062 1909 1751 1674 688 543 339 318 128 1107 12043 --
NM_024875chr1031828 543 137 ------
NM_024884chr1484187 3935 2971 1668 1250 1214 1078 194 --13057 --
NM_024896chr952040 1663 684 625 29 22542 1946 11901 --
NM_024909chr651509 1449 1399 1020 568 ------
NM_024911chr12158 100 ------
NM_024915chr872880 2719 2376 2027 1824 514 483 22204 229 ----
NM_024920chr441602 1531 1253 982 ------
NM_024926chr73256 240 119 ------
NM_024927chr17156 ------
NM_024930chr5