TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4761-5p
miRNA Sequence: ACAAGGUGUGCAUGCCUGACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521186 969 ------
NM_000016chr12586 221 ------
NM_000037chr832187 787 516 22413 810 11884 --
NM_000038chr531353 1321 162 11817 21981 1409 --
NM_000051chr11103487 3388 3239 2957 2757 2567 2320 2296 2209 1305 11079 1264 --
NM_000052chrX73080 2917 2347 2211 756 72 66 12540 31337 1253 1068 --
NM_000063chr62265 54 ------
NM_000081chr141854 1637 677 34 ------
NM_000084chrX76079 5949 5483 2726 2444 1337 782 14406 25842 5387 12668
NM_000088chr1721115 128 ------
NM_000090chr23901 704 69 ------
NM_000091chr252586 2343 1080 905 873 ------
NM_000109chrX--2501 318 11946 --
NM_000110chr141161 1059 809 448 ------
NM_000111chr72286 126 ------
NM_000115chr1362566 2356 2026 1986 1829 615 ------
NM_000117chrX1287 --1248 --
NM_000125chr683636 3618 3171 2593 532 386 172 67 ----24227 3275
NM_000138chr1592519 2443 2389 2358 1957 1870 370 223 189 --12594 12192
NM_000141chr1011222 --11361 --
NM_000142chr421382 568 --2459 192 --
NM_000151chr1741846 1629 1439 1207 ------
NM_000158chr32605 229 ------
NM_000161chr1462001 1849 1810 1536 614 202 31868 1364 721 1481 11402
NM_000163chr532283 2093 905 21912 1569 ----
NM_000165chr631545 682 425 11374 --1506
NM_000167chrX71428 1321 714 691 498 359 248 1101 11667 --
NM_000168chr783297 3104 2889 2560 2034 1100 779 66 12610 ----
NM_000176chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_000188chr101735 --1225 --
NM_000189chr212094 --1354 1840
NM_000208chr19154712 4325 4188 4017 3549 3436 3343 3327 3172 3130 3073 2884 1477 1209 144 --34518 3022 1805 --
NM_000210chr221723 950 21869 135 ----
NM_000212chr1752467 2110 1895 1677 435 --12016 --
NM_000214chr2051456 1415 1382 1138 584 21751 523 ----
NM_000217chr12135332 5202 4959 4947 4635 4583 4174 3755 3345 2059 1918 602 431 23891 1142 22094 2013 15181
NM_000222chr441741 1678 1356 142 ------
NM_000227chr182345 34 --1161 --
NM_000232chr442533 1168 683 345 137 ----
NM_000245chr721397 437 --22260 36 --
NM_000248chr352698 2454 2366 990 678 --12331 --
NM_000259chr1554959 4941 4870 4623 1316 36039 1390 999 21079 164 --
NM_000262chr2281611 1504 1184 544 477 433 316 59 ------
NM_000264chr963080 2889 2730 2293 1261 1004 --13071 --
NM_000266chrX1374 ------
NM_000267chr1773333 3309 2459 2351 2293 2274 166 ------
NM_000276chrX42230 1708 588 420 ----2737 480
NM_000277chr121218 ----1695
NM_000284chrX31842 299 27 1229 11553 --
NM_000291chrX2750 166 ------
NM_000293chr161628 ------
NM_000297chr432053 649 138 ------
NM_000310chr13533 461 176 ----11187
NM_000314chr1082913 2637 2339 747 585 278 224 142 --12075 --
NM_000321chr1331315 344 213 --11400 --
NM_000329chr11807 ------
NM_000332chr6166814 5798 5669 5226 5041 5004 4725 2587 2529 2009 1525 1391 1190 1141 1044 127 15585 11157 25115 1400
NM_000333chr33978 465 40 ------
NM_000337chr5156089 5788 5273 5060 4519 2644 1513 1472 1453 1443 1313 1085 697 603 108 ------
NM_000345chr411047 ------
NM_000346chr1751961 1586 694 376 253 ------
NM_000361chr2031806 494 77 1328 1429 --
NM_000368chr984481 4426 3802 3669 3582 3125 873 366 ------
NM_000369chr1411681 ----21834 1812
NM_000378chr112501 430 --11254 --
NM_000389chr631339 514 63 ----21156 476
NM_000390chrX43196 2188 2078 32 --21278 341 --
NM_000393chr261677 1642 1505 808 711 262 167 ----
NM_000396chr12532 171 --169 --
NM_000399chr1031039 865 464 ------
NM_000404chr32288 166 ------
NM_000406chr473043 3021 2928 2677 2241 318 280 22064 1042 ----
NM_000408chr273181 3006 2775 2118 999 543 524 13280 ----
NM_000416chr62351 168 126 ----
NM_000421chr171269 ------
NM_000430chr1742876 2651 2556 1084 13571 12870 --
NM_000436chr531558 1531 1429 --1480 --
NM_000437chr142045 871 497 409 3722 233 157 1185 --
NM_000439chr53810 218 123 1600 ----
NM_000441chr742018 1985 495 163 --11670 --
NM_000442chr1711235 ------
NM_000449chr161348 1312 569 532 471 45 --11151 --
NM_000461chr374196 4029 3418 3042 1467 813 429 ------
NM_000462chr1541794 1643 1430 334 21761 601 ----
NM_000474chr72455 189 ------
NM_000480chr111153 1466 11427 --
NM_000495chrX21085 712 --1843 --
NM_000503chr831805 1446 1292 1638 ----
NM_000508chr42897 870 1299 ----
NM_000516chr201239 ------
NM_000522chr751176 1098 869 824 307 ------
NM_000523chr231166 834 183 ------
NM_000527chr1962430 821 712 547 467 58 --22170 1636 --
NM_000533chrX51785 1518 1340 746 75 ------
NM_000555chrX166706 6191 5922 5712 5345 5292 5262 4971 4822 2534 2410 2403 2204 2180 914 860 --15410 --
NM_000578chr231265 522 234 ------
NM_000583chr4--126 ----
NM_000598chr73344 204 196 ------
NM_000601chr71409 ------
NM_000602chr721310 162 --21375 971 --
NM_000610chr1152816 2603 698 633 482 12922 ----
NM_000611chr11167005 6838 6547 5353 5017 4767 2818 1908 1784 1767 1459 1166 1072 1000 731 372 1165 ----
NM_000612chr1143832 2940 2872 208 1532 33749 3622 2916 --
NM_000615chr1173000 2945 2787 2246 1015 750 712 --22199 531 --
NM_000618chr12136110 6048 5817 5810 5523 2318 2219 1565 1242 474 389 359 78 26358 699 1188 --
NM_000618chr12136110 6048 5817 5810 5523 2318 2219 1565 1242 474 389 359 78 26358 699 1188 --
NM_000633chr18125040 4908 4503 4154 3888 2088 1751 1636 1492 1399 1359 781 11688 15185 --
NM_000635chr1921477 311 1118 ----
NM_000639chr12324 284 1127 ----
NM_000663chr1652993 2827 2778 2138 979 1303 1258 --
NM_000668chr42945 270 ------
NM_000684chr1021104 302 ------
NM_000693chr152738 724 11543 ----
NM_000719chr12126348 5924 5295 5243 5030 4914 4416 1890 1747 857 843 724 ------
NM_000721chr162652 2417 2220 1985 1671 317 ------
NM_000724chr1021404 594 11622 ----
NM_000725chr123865 841 256 ------
NM_000726chr221356 71 11160 ----
NM_000739chr72185 98 ------
NM_000756chr81431 ------
NM_000788chr411040 11408 ----
NM_000793chr1474932 4074 3509 3219 1627 1120 400 25146 1264 ----
NM_000794chr521055 661 ------
NM_000795chr1131116 891 308 11105 ----
NM_000801chr20----1119 --
NM_000809chr4169077 6684 6609 6509 6258 3557 3094 2998 2965 2737 2641 2621 2303 2063 1705 776 68454 8373 3465 3067 2929 1996 11615 1957
NM_000813chr585364 2126 2052 2003 1738 1147 367 115 12032 ----
NM_000814chr1533826 3768 3068 33588 3364 363 ----
NM_000816chr52491 454 1188 ----
NM_000817chr21314 1120 ----
NM_000818chr10----1121 --
NM_000824chr44821 738 692 145 ------
NM_000826chr452486 2436 997 742 336 1252 --1301
NM_000827chr552350 1890 973 837 502 --12091 --
NM_000829chr1152276 1420 731 642 557 11564 ----
NM_000833chr1621540 186 ------
NM_000838chr682546 2246 2210 2047 1871 1119 1013 590 22770 826 --12687
NM_000840chr71105 ------
NM_000844chr321114 1002 --1406 --
NM_000855chr111357 ------
NM_000859chr521661 1530 ------
NM_000861chr332595 2514 1821 22188 203 --1521
NM_000864chr11980 1110 --1765
NM_000866chr351304 1254 729 481 318 11883 11642 --
NM_000868chrX41798 1035 453 138 ------
NM_000870chr551606 1159 553 381 214 21469 1128 ----
NM_000875chr15135949 5733 5534 5131 5095 4991 4830 4357 2674 2153 1213 515 502 ------
NM_000876chr631228 941 231 1397 --1487
NM_000883chr72654 53 ------
NM_000883chr72654 53 ------
NM_000885chr291939 1903 1608 851 776 696 507 419 118 1292 ----
NM_000891chr1763225 2828 1239 1233 851 289 3828 810 788 ----
NM_000899chr1263615 2833 2822 808 703 120 13250 ----
NM_000901chr462426 2318 1953 1919 640 25 11773 --12118
NM_000903chr1641505 1184 1148 1018 1573 ----
NM_000917chr102779 161 ------
NM_000919chr52432 128 ------
NM_000922chr1141033 995 279 178 ------
NM_000924chr123879 329 194 --11158 --
NM_000926chr11209407 8357 8344 8226 7932 7682 7575 7133 6677 5944 2939 2825 2478 1939 1447 1433 1376 966 904 842 38796 6418 2245 29065 8015 --
NM_000944chr442043 1769 1711 388 --12055 --
NM_000945chr271879 1654 787 587 289 199 30 ------
NM_000950chrX83335 3202 3155 2589 2415 2214 515 65 ----2759 728
NM_000956chr142978 361 ------
NM_000965chr351270 1067 848 330 38 ------
NM_001001323chr1262944 2783 2734 2316 902 211 12358 --12920
NM_001001331chr342263 1833 741 344 --11670 --
NM_001001342chr1031350 1048 224 --1483 11274
NM_001001344chrX72304 1964 1926 1733 872 478 336 ------
NM_001001389chr1152816 2603 698 633 482 12922 ----
NM_001001390chr1152816 2603 698 633 482 12922 ----
NM_001001391chr1152816 2603 698 633 482 12922 ----
NM_001001392chr1162862 2649 744 679 528 65 12968 ----
NM_001001394chr21580 ----1570
NM_001001395chr1242806 2763 693 683 --12770 --
NM_001001396chr163740 2907 2731 1412 1133 1069 11478 11091 1774
NM_001001419chr575203 3704 3689 3351 942 854 775 21776 63 21968 1333 --
NM_001001420chr575203 3704 3689 3351 942 854 775 21776 63 21968 1333 --
NM_001001433chr2021975 480 22120 1267 --11129
NM_001001436chr161800 --1680 --
NM_001001481chr843146 2311 1274 984 --11085 159
NM_001001484chr1022083 860 ----128
NM_001001521chr22257 217 ----1297
NM_001001549chr742614 2368 923 394 22532 351 1279 --
NM_001001550chr742614 2368 923 394 22532 351 1279 --
NM_001001555chr742614 2368 923 394 22532 351 1279 --
NM_001001556chr1521163 186 ------
NM_001001557chr822176 1595 --3221 55 22 1480
NM_001001664chr284084 3617 3090 2902 2619 845 508 271 --11067 --
NM_001001701chr431927 1492 1443 --1143 11958
NM_001001877chrY140 148 ----
NM_001001890chr2193740 3694 3653 3111 2850 1464 1173 504 43 23209 777 ----
NM_001001924chr841921 1849 1446 377 --1283 --
NM_001001925chr841921 1849 1446 377 --1283 --
NM_001001928chr22178198 7756 7099 6995 6980 6894 6874 6208 5523 5058 3232 1738 1607 1187 422 102 24 --21976 627 --
NM_001001931chr841921 1849 1446 377 --1283 --
NM_001001933chr11167 1436 1126 --
NM_001001936chr102339 44 ------
NM_001001971chr1061363 1109 881 508 107 26 1969 ----
NM_001001974chr1062256 2206 2016 1870 686 355 22249 547 21954 911 --
NM_001001994chrX1452 --1131 --
NM_001001995chrX41389 1207 498 255 ----1233
NM_001001996chrX1452 --1131 --
NM_001002033chr172318 113 ------
NM_001002233chr852043 1441 669 75 44 11854 ----
NM_001002244chr171115 ------
NM_001002245chr171150 ------
NM_001002246chr171150 ------
NM_001002247chr171150 ------
NM_001002248chr171150 ------
NM_001002249chr171150 ------
NM_001002257chr243445 1271 1142 1037 22606 1024 --22937 673
NM_001002295chr10----1146 --
NM_001002296chr841373 428 268 146 --1195 --
NM_001002811chr151616 1561 1528 1486 981 --1444 --
NM_001002812chr151616 1561 1528 1486 981 --1444 --
NM_001002812chr151616 1561 1528 1486 981 --1444 --
NM_001002814chr863941 3327 1441 669 75 44 --11047 --
NM_001002838chrX91880 1673 1537 1482 648 583 521 355 319 ------
NM_001002843chr151127 ------
NM_001002860chr1454475 3815 1610 398 262 ----11818
NM_001002901chr11457 ------
NM_001002909chr172630 507 --11743 --
NM_001003407chr1063776 1663 1585 796 490 259 14623 14263 --
NM_001003408chr1063776 1663 1585 796 490 259 14623 14263 --
NM_001003652chr18148636 8629 8263 7613 7554 7301 6840 6367 5536 3307 3215 2539 2340 1513 27741 7518 43471 3034 2377 144 --
NM_001003674chr18126485 6345 6033 5575 5306 5289 4918 4479 2644 2634 1047 343 26183 2738 ----
NM_001003675chr18126485 6345 6033 5575 5306 5289 4918 4479 2644 2634 1047 343 26183 2738 ----
NM_001003678chr11----1106 --
NM_001003681chr2242008 1975 858 176 --1687 --
NM_001003688chr43353 266 41 21235 99 1173 --
NM_001003712chr1243762 3039 2749 741 --23054 1009 --
NM_001003760chr652799 2446 1352 1269 896 --12389 --
NM_001003792chr32777 143 138 ----
NM_001003793chr32777 143 138 ----
NM_001003800chr973510 3397 2853 2692 1242 795 294 12957 ----
NM_001004051chrX1121 ------
NM_001004125chr931115 780 112 ------
NM_001004196chr32495 343 ------
NM_001004303chr11685 ------
NM_001004303chr11685 ------
NM_001004304chr1273155 2924 2422 2203 2109 596 318 --11274 --
NM_001004308chrX111481 1064 550 419 413 380 276 222 156 103 23 11513 11584 --
NM_001004317chr653615 3376 812 646 489 11261 33845 3178 2933 --
NM_001004342chr186051 5844 5194 4191 2099 1429 1233 449 24030 370 ----
NM_001004354chr941029 990 421 56 ------
NM_001004360chr251386 582 432 422 348 11265 ----
NM_001004419chr1244273 1469 675 553 2819 466 ----
NM_001004441chr5123 ------
NM_001005158chr32383 132 ------
NM_001005159chr32383 132 ------
NM_001005209chr21704 ------
NM_001005266chr153569 274 182 1243 1260 --
NM_001005267chr153569 274 182 1243 1260 --
NM_001005268chr153569 274 182 1243 1260 --
NM_001005269chr153569 274 182 1243 1260 --
NM_001005271chr1761063 928 398 271 193 90 1209 ----
NM_001005273chr1761063 928 398 271 193 90 1209 ----
NM_001005291chr171475 1175 144 --
NM_001005335chr192227 91 ------
NM_001005366chr124900 617 284 255 1951 ----
NM_001005375chrY21571 1305 ------
NM_001005386chr231726 503 297 22432 669 11752 --
NM_001005404chr17104428 3618 3581 3327 3209 2872 1072 749 145 110 14032 34382 2881 298 --
NM_001005417chr11564 --1169 --
NM_001005463chr1052186 607 590 348 138 1639 12340 --
NM_001005473chr5115983 5855 5488 5328 5033 4942 4820 4582 4216 2626 257 --24714 2013 14135
NM_001005474chr321196 1003 1298 21570 1011 --
NM_001005476chr22627 42 --170 --
NM_001005609chrX53343 2459 1527 1401 788 33104 2470 188 ----
NM_001005746chr221356 71 11160 ----
NM_001005747chr221356 71 11160 ----
NM_001005753chr242302 2041 1726 905 ------
NM_001005781chr22520 139 1459 ----
NM_001005782chr22969 253 1908 ----
NM_001005845chr831477 1291 761 ------
NM_001005849chr171406 ------
NM_001005861chr34698 401 265 197 ------
NM_001005862chr17----1586 --
NM_001006115chr312714 --12049 --
NM_001006118chrY1243 ------
NM_001006120chrY1243 ------
NM_001006600chr531717 1681 539 42432 2154 1603 343 ----
NM_001006610chr163873 786 243 ----1401
NM_001006623chr272490 1033 842 687 504 300 242 1139 ----
NM_001006626chr72185 98 ------
NM_001006627chr72185 98 ------
NM_001006628chr72185 98 ------
NM_001006629chr72185 98 ------
NM_001006630chr72185 98 ------
NM_001006631chr72185 98 ------
NM_001006632chr72185 98 ------
NM_001006657chr2102646 2585 2390 2335 2069 1238 1037 1014 638 259 1346 --13203
NM_001006665chr11672 --1606 --
NM_001006681chrX1117 ------
NM_001006682chrX1117 ------
NM_001006683chrX1117 ------
NM_001006945chr13470 216 201 ------
NM_001007023chr1474932 4074 3509 3219 1627 1120 400 25146 1264 ----
NM_001007024chr1754138 3193 3126 1513 732 13155 34292 4026 3725 --
NM_001007025chr1754138 3193 3126 1513 732 13155 34292 4026 3725 --
NM_001007067chr861040 960 813 399 338 165 ------
NM_001007068chr861040 960 813 399 338 165 ------
NM_001007069chr861040 960 813 399 338 165 ------
NM_001007070chr861040 960 813 399 338 165 ------
NM_001007098chr1186 ------
NM_001007102chr651224 1194 666 529 212 ------
NM_001007156chr1551967 1865 605 396 304 --21890 38 --
NM_001007237chr141991 1861 811 470 --1616 --
NM_001007245chr71632 1647 ----
NM_001007246chr2121679 1587 11338 11821 --
NM_001007257chr141231 1184 1021 355 ------
NM_001007271chr10----148 --
NM_001007277chr11----1418 --
NM_001007466chr654603 4498 3918 3783 285 --13713 --
NM_001007526chrY1243 ------
NM_001007553chr16886 379 360 335 234 142 --1301 --
NM_001007559chr1842045 774 398 118 ------
NM_001007794chr11631 1492 1186 --
NM_001008222chrX1557 --1874 --
NM_001008225chr72599 591 ------
NM_001008239chr1893076 3014 2387 1309 1190 1015 797 430 354 ------
NM_001008392chr332348 728 463 13351 12779 --
NM_001008405chr711523 1110 --11460
NM_001008408chr776225 4698 4640 2317 2029 1885 1271 25685 4485 ----
NM_001008495chr841543 617 357 244 11603 12029 --
NM_001008541chr1041696 1470 943 461 12333 11735 --
NM_001008541chr1041696 1470 943 461 12333 11735 --
NM_001008564chr1331741 880 168 --2546 438 --
NM_001008567chr9146 ----1102
NM_001008660chr1151593 1545 1535 1185 1080 ------
NM_001008707chr1441912 769 189 136 ------
NM_001008738chr532406 2100 1796 1433 ----
NM_001008744chr1471498 1430 1420 573 413 360 206 ------
NM_001008801chr1911944 --3484 412 384 11365
NM_001008860chr15--2801 728 ----
NM_001008892chr15--2801 728 ----
NM_001008894chr15--2801 728 ----
NM_001008895chr1321482 144 31436 579 255 11256 --
NM_001008897chr62535 137 154 ----
NM_001008925chr423424 2299 21416 1313 ----
NM_001009183chr142155 128 ----131
NM_001009554chr4134655 3927 3801 3490 3169 1743 1033 750 733 559 518 277 129 ------
NM_001009554chr4134655 3927 3801 3490 3169 1743 1033 750 733 559 518 277 129 ------
NM_001009555chr451671 1367 1243 1087 690 ----156
NM_001009880chr2263556 3369 3227 1826 1294 884 --1519 --
NM_001009899chr3176542 6389 6112 6021 5825 5403 5346 5231 5173 4837 4717 4609 4389 4257 4040 2039 1832 14507 46070 2176 2004 296 11953
NM_001009909chr1133679 2869 2445 ------
NM_001009955chr11156 ------
NM_001009955chr11156 ------
NM_001009958chr72568 408 ------
NM_001009960chr732387 377 293 ------
NM_001009993chr293982 3526 3520 3212 3154 2835 1819 1438 75 ------
NM_001010846chr193543 3489 3366 3309 3223 1671 1329 203 37 23322 3176 1475 24261 3719
NM_001010853chr621043 268 ----12798
NM_001010861chr142655 974 802 297 21925 449 12167 --
NM_001010862chrX62681 2035 622 587 268 90 22784 2117 ----
NM_001010888chrX84012 3959 1830 1726 1697 1573 1268 1251 13265 24002 660 --
NM_001010895chr951485 1476 706 626 122 ----1804
NM_001010927chr6------1232
NM_001010932chr71409 ------
NM_001010938chr31558 --1204 --
NM_001010942chr1251064 340 175 97 78 11165 ----
NM_001010980chr162314 1065 881 487 160 121 11334 1901 --
NM_001010984chr142327 748 491 149 21715 291 ----
NM_001010986chrX52537 2474 2288 414 274 1562 ----
NM_001010989chr161531 ------
NM_001010990chr161531 ------
NM_001011513chr453326 2923 817 339 276 --21175 561 --
NM_001011546chr203341 318 116 --2655 555 --
NM_001011553chr73776 722 220 1172 ----
NM_001011663chr103737 387 294 1272 196 --
NM_001011666chr7136356 6275 5993 5586 5208 5050 4683 4477 1253 623 498 429 338 1958 ----
NM_001011713chr14----1158 --
NM_001011885chr1551793 1461 1262 723 456 --2463 225 --
NM_001012267chr921711 427 11415 21662 329 --
NM_001012393chr1174994 4136 3908 1801 1255 1056 595 33938 3932 268 ----
NM_001012398chr163924 422 31 2830 247 ----
NM_001012420chr1521183 504 ------
NM_001012423chr151504 ------
NM_001012514chr261046 1024 970 949 449 96 ------
NM_001012516chr261046 1024 970 949 449 96 ------
NM_001012643chr191392 ------
NM_001012732chr421174 1048 ----173
NM_001012751chr1011575 11868 11248 --
NM_001012754chr1362048 1952 1855 1482 864 560 1749 ----
NM_001012755chrX44754 4604 4383 1118 24875 653 ----
NM_001012761chr5102732 2128 1870 1788 1765 993 875 456 398 271 ------
NM_001012968chrX52599 403 338 198 178 1145 --11078
NM_001012977chrX4520 452 446 41 ------
NM_001012980chrX1227 ------
NM_001012989chrX2582 120 ------
NM_001013031chr10102978 2971 2486 2222 1410 1218 1176 1018 646 463 23547 3061 ----
NM_001013398chr73344 204 196 ------
NM_001013406chr711178 --1125 --
NM_001013415chr41239 ------
NM_001013438chr32261 105 41008 749 370 329 ----
NM_001013439chr31107 4854 595 216 175 ----
NM_001013620chr12127871 6937 5433 5244 2889 2276 2109 1958 1254 1039 956 909 12241 27499 5999 --
NM_001013624chr171290 --170 --
NM_001013635chr1231138 168 24 ------
NM_001013659chr1965379 5345 1403 1142 1035 272 --64569 4272 3558 2162 288 69 --
NM_001013690chr1231734 1548 866 ------
NM_001013693chr162956 2848 2736 2143 917 904 ------
NM_001013693chr162956 2848 2736 2143 917 904 ------
NM_001013699chr122119 50 ------
NM_001013839chr1732622 2533 1601 --21981 237 --
NM_001013843chr152747 690 ------
NM_001014380chr13145837 5821 5309 5067 4891 4331 4098 3931 3664 1973 1777 933 825 765 25286 590 ----
NM_001014443chr11250 ------
NM_001014449chr162240 206 ------
NM_001014451chr162240 206 ------
NM_001014796chr11177 ------
NM_001014796chr11177 ------
NM_001014797chr10108035 7766 7511 7204 5582 3184 3171 3099 2148 1368 1288 27454 7304 13081
NM_001014839chr12946 62 ------
NM_001014841chr12946 62 ------
NM_001015048chr1473044 2949 2782 2316 964 711 613 23204 2426 ----
NM_001015049chr1473044 2949 2782 2316 964 711 613 23204 2426 ----
NM_001015877chrX32244 2006 1955 1498 ----
NM_001015881chrX61277 1207 1197 1190 884 379 ------
NM_001015882chr92750 358 1691 ----
NM_001015887chr341834 1726 1319 1283 ------
NM_001017369chr421065 143 11058 --11094
NM_001017371chr231345 854 152 ------
NM_001017395chr383649 2635 1233 1021 715 576 397 210 1598 --12365
NM_001017396chr24828 692 430 299 11856 ----
NM_001017406chr1----158 --
NM_001017420chr82968 270 ------
NM_001017424chr141282 597 208 175 ------
NM_001017425chr141282 597 208 175 ------
NM_001017440chr7117956 7673 6271 5955 5272 3238 3052 1472 1069 1053 307 12131 ----
NM_001017523chr1231734 716 389 ------
NM_001017923chr1431570 324 249 21665 1656 ----
NM_001017962chr102779 161 ------
NM_001017963chr144938 329 277 170 1358 1386 --
NM_001017973chr52320 61 ------
NM_001017974chr52320 61 ------
NM_001017979chr42190 114 ----1206
NM_001017992chr531511 1102 966 ------
NM_001018004chr15----1226 --
NM_001018006chr15----1226 --
NM_001018007chr15----1226 --
NM_001018009chr31403 1138 ----
NM_001018020chr15----1226 --
NM_001018050chr2253025 2902 2777 1321 1264 1235 32833 1113 577 --
NM_001018052chr2253025 2902 2777 1321 1264 1235 32833 1113 577 --
NM_001018054chr12325 229 ------
NM_001018056chr91122 ----1394
NM_001018064chr971963 1877 1833 777 488 426 66 ------
NM_001018065chr9145507 5293 4783 4725 4461 3838 3704 1498 1477 1385 634 536 469 223 25604 1186 --1121
NM_001018066chr9145507 5293 4783 4725 4461 3838 3704 1498 1477 1385 634 536 469 223 25604 1186 --1121
NM_001018067chr195168 5027 4943 4622 3920 3505 1491 1120 780 1484 25182 2074 --
NM_001018068chr195168 5027 4943 4622 3920 3505 1491 1120 780 1484 25182 2074 --
NM_001018069chr195168 5027 4943 4622 3920 3505 1491 1120 780 1484 25182 2074 --
NM_001018072chr1231734 716 389 ------
NM_001018074chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_001018075chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_001018076chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_001018077chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_001018089chr1573100 2883 2601 1032 1016 507 431 2210 125 ----
NM_001018100chr153699 318 21 1811 ----
NM_001018108chr1552121 1917 1838 1612 683 11552 ----
NM_001020658chr141698 1537 1352 1077 --11390 --
NM_001020658chr141698 1537 1352 1077 --11390 --
NM_001020825chr541279 456 410 181 ------
NM_001023567chr152507 439 ----12390
NM_001023587chr32954 107 ------
NM_001024094chr583804 3356 2981 2935 2706 2545 1384 198 --13255 --
NM_001024218chr143725 612 327 ----1125
NM_001024226chr121040 723 --1823 --
NM_001024227chr121040 723 --1823 --
NM_001024228chr121040 723 --1823 --
NM_001024372chr842268 2089 2055 474 1182 ----
NM_001024649chr5122886 2874 2867 2228 2018 1919 1043 513 329 311 282 82 22610 1101 ----
NM_001024660chr321709 653 11244 ----
NM_001024680chr24669 358 165 104 --11592 --
NM_001024688chr832068 800 206 32182 1953 151 1461 --
NM_001024808chr122425 70 11754 11984 --
NM_001024847chr36905 816 809 779 521 274 2790 370 ----
NM_001024912chr1941378 676 616 383 2522 48 21365 726 --
NM_001024947chr52896 752 154 1430 --
NM_001024948chr1102973 2553 2533 2340 1210 944 771 534 182 147 1858 --1745
NM_001024956chr1195632 4647 4409 4154 3678 2333 1398 979 862 --24578 1486 --
NM_001025068chr331416 720 253 ------
NM_001025069chr331416 720 253 ------
NM_001025072chr342613 2356 1955 1015 --22779 2429 1876
NM_001025073chr342613 2356 1955 1015 --22779 2429 1876
NM_001025076chr10146255 4402 4178 4124 2153 2116 1858 1841 1569 1334 675 608 578 51 --25673 5642 --
NM_001025077chr10157613 5760 5536 5482 5111 5050 4973 2927 2692 2033 1966 1936 1409 278 201 --27031 7000 1347
NM_001025079chr383939 3553 2791 2647 1307 1103 862 773 23404 82 1556 --
NM_001025100chr1853673 1396 1128 944 574 ----1495
NM_001025108chr253878 3037 1450 354 226 11411 31383 1319 1254 --
NM_001025232chr12140 1317 ----
NM_001025252chr863159 3102 3082 2487 2041 1211 11110 163 --
NM_001025253chr863159 3102 3082 2487 2041 1211 11110 163 --
NM_001025266chr3144919 4901 4749 3686 3193 3090 3004 1808 1645 1243 989 312 260 52 --14241 --
NM_001025356chr1262696 2116 678 424 232 26 12744 193 --
NM_001025366chr6--11447 1184 --
NM_001025366chr6--11447 1184 --
NM_001025367chr6--11447 1184 --
NM_001025367chr6--11447 1184 --
NM_001025368chr6--11447 1184 --
NM_001025368chr6--11447 1184 --
NM_001025369chr6--11463 1200 --
NM_001025369chr6--11463 1200 --
NM_001025370chr6--11447 1184 --
NM_001025370chr6--11447 1184 --
NM_001025389chr111153 1466 11427 --
NM_001025390chr111153 1466 11427 --
NM_001025579chr172842 328 ------
NM_001025580chrX94300 3498 3357 3048 2708 2642 799 746 65 23945 2755 1563 --
NM_001025595chr441431 1084 558 422 ------
NM_001025596chr112155 147 1499 ----
NM_001025603chr161348 1312 569 532 471 45 --11151 --
NM_001025616chr441203 717 536 506 1674 ----
NM_001025777chr251610 1250 1023 511 120 ------
NM_001025780chr921209 638 ------
NM_001029839chr341475 1360 1233 1030 1564 ----
NM_001029840chr341475 1360 1233 1030 1564 ----
NM_001029858chr6102983 2290 2149 2129 2115 2105 996 965 425 407 --11093 --
NM_001029859chr1142293 963 189 155 11645 1946 --
NM_001029863chr661006 787 633 342 103 70 ------
NM_001029875chr552994 2218 2189 2119 665 11903 ----
NM_001029998chr431302 911 297 1413 ----
NM_001030006chr1742681 1808 764 401 11820 ----
NM_001030007chr16163803 3599 3516 3400 3339 3295 2482 1219 1091 1039 1005 853 651 473 463 223 42862 2680 1412 157 21538 366 --
NM_001030055chr1494707 4301 4100 3968 3851 1058 571 565 299 24623 3651 ----
NM_001031623chr641725 1323 625 471 31741 265 36 11510 --
NM_001031679chr1223497 1230 1422 1711 --
NM_001031684chr221217 426 1414 ----
NM_001031689chr9----1122 --
NM_001031690chr772805 2772 2690 2450 2066 1114 978 --1880 --
NM_001031695chr2265020 4341 4076 3670 1218 641 --21328 1185 --
NM_001031710chr711035 1854 ----
NM_001031716chr2165 2927 707 ----
NM_001031723chr42132 23 ------
NM_001031732chr473630 1424 1094 901 532 222 45 1343 13185 --
NM_001031801chr222350 169 ------
NM_001031804chr1663261 3164 907 829 552 406 14028 11319 --
NM_001031812chr521565 875 ------
NM_001032221chr951730 1627 400 328 299 ------
NM_001032279chr111398 --1269 --
NM_001032282chr851322 1073 918 469 34 ------
NM_001032283chr122275 185 --21021 206 --
NM_001032284chr122275 185 --21021 206 --
NM_001032296chr1352798 2338 961 802 568 --21121 938 --
NM_001032367chr15176 ------
NM_001032380chr1041859 1695 136 58 --11641 --
NM_001032393chrX1609 ------
NM_001032394chr662718 2415 2223 716 532 111 ------
NM_001032395chr652585 2282 2090 583 399 ------
NM_001033047chr442201 940 530 62 1853 12584 --
NM_001033049chr2172194 1973 1582 1528 434 353 94 ------
NM_001033057chr331429 832 704 ------
NM_001033059chr651780 1574 1419 462 189 ------
NM_001033081chr151922 752 553 269 234 1177 ----
NM_001033082chr151922 752 553 269 234 1177 ----
NM_001033117chr3104809 4549 4374 3911 3645 3586 3400 1267 98 62 ------
NM_001033518chr762279 1774 1018 623 337 59 182 ----
NM_001033519chr762279 1774 1018 623 337 59 182 ----
NM_001033520chr762279 1774 1018 623 337 59 182 ----
NM_001033564chr651693 769 398 233 95 21259 698 31455 670 246 --
NM_001033723chr852606 2096 1104 549 132 12279 --11864
NM_001033756chr6--11381 1118 --
NM_001033756chr6--11381 1118 --
NM_001033925chr1021840 332 ------
NM_001034025chr122961 912 179 ----
NM_001034837chr52114 54 --1124 --
NM_001034838chr52114 54 --1124 --
NM_001034841chr16105518 4816 4437 3626 3346 1771 1251 679 187 154 55221 4856 4844 4099 777 12154 15492
NM_001034850chr521556 1076 11459 ----
NM_001034852chr1472108 1915 1893 1404 1310 640 133 --21997 1616 --
NM_001035chr13825 519 169 1184 ----
NM_001035003chr431167 545 75 1980 --11041
NM_001035004chr431167 545 75 1980 --11041
NM_001035260chr1021076 310 1346 --11404
NM_001037132chr731953 1704 372 ------
NM_001037133chr731953 1704 372 ------
NM_001037164chr751666 786 606 347 156 32069 1645 1486 11404 --
NM_001037172chr331213 1082 387 ------
NM_001037174chr242046 1891 1500 169 21578 1439 ----
NM_001037317chr142655 974 802 297 21925 449 12167 --
NM_001037331chr182747 114 ------
NM_001037332chr552563 2136 1945 1810 516 ----11700
NM_001037333chr552563 2136 1945 1810 516 ----11700
NM_001037334chr1872431 2199 2020 1865 1779 659 598 11753 ----
NM_001037339chr11568 21487 197 ----
NM_001037340chr11568 21487 197 ----
NM_001037341chr11568 21487 197 ----
NM_001037341chr11568 21487 197 ----
NM_001037535chrX21360 1246 ----11140
NM_001037536chrX21360 1246 ----11140
NM_001037540chrX21360 1246 ----11140
NM_001037582chr411147 11375 --11605
NM_001037631chr22394 259 ------
NM_001037872chr21472 1667 ----
NM_001038493chr221544 1530 11415 ----
NM_001038702chr552187 2150 2062 816 810 12592 22546 35 --
NM_001038707chr142239 1690 817 741 ----131
NM_001038707chr142239 1690 817 741 ----131
NM_001039091chrX41292 939 480 468 21020 302 1566 --
NM_001039348chr22911 56 11061 ----
NM_001039349chr22911 56 11061 ----
NM_001039395chr962461 1704 1661 558 521 85 --11919 --
NM_001039457chr12248 33 ------
NM_001039459chr721137 878 --2176 83 --
NM_001039538chr252588 1403 664 338 297 ------
NM_001039547chr3136813 6777 6346 6198 6111 5810 5158 3131 2843 2052 1231 1213 810 12384 47412 5515 2093 1861 --
NM_001039569chr223250 2824 1649 42926 2611 1304 1168 --
NM_001039570chr2274475 4111 4071 3411 1255 1154 664 14522 11389 --
NM_001039571chr2274475 4111 4071 3411 1255 1154 664 14522 11389 --
NM_001039573chr171397 ----1169
NM_001039580chr495029 4236 3603 1538 1180 1140 840 687 144 23764 3362 25075 4933 14989
NM_001039585chr154164 3436 2858 596 39 11149 ----
NM_001039590chrX43833 3471 3228 2583 ----1627
NM_001039591chrX43833 3471 3228 2583 ----1627
NM_001039618chr1154500 991 564 82 69 34458 2310 1945 --15775
NM_001039690chr1652060 1707 822 699 252 --11599 --
NM_001039711chr14967 777 326 243 --122 --
NM_001039712chr14967 777 326 243 --122 --
NM_001039802chr121316 401 ------
NM_001039840chrX135204 4173 3995 3936 3851 2300 1671 1663 1458 1056 1016 167 56 15631 35883 4410 506 --
NM_001039888chr11536 ------
NM_001039937chr13153332 3256 3101 2714 1380 1083 1070 854 823 769 606 495 372 348 75 ------
NM_001039960chr1241462 1106 680 499 ------
NM_001040001chr681964 1831 1686 1449 1405 1307 793 343 11648 123 --
NM_001040002chr173478 113 71 --11481 --
NM_001040020chr741403 1347 1094 35 --1104 --
NM_001040057chr71337 ------
NM_001040101chr421377 222 21088 55 1630 --
NM_001040110chr72721 97 11435 ----
NM_001040113chr161971 ------
NM_001040142chr242346 2066 1665 420 ------
NM_001040143chr242346 2066 1665 420 ------
NM_001040144chr1652060 1707 822 699 252 --11599 --
NM_001040146chr1652060 1707 822 699 252 --11599 --
NM_001040151chr1174117 3870 3344 2994 2971 1303 333 --33506 3035 519 --
NM_001040152chr753173 2057 1943 1134 92 ----11399
NM_001040153chr131363 ------
NM_001040157chr482624 2012 951 750 528 207 197 33 --21986 419 --
NM_001040159chr441529 1272 980 291 --1459 --
NM_001040172chr551606 1159 553 381 214 21469 1128 ----
NM_001040173chr551606 1159 553 381 214 21469 1128 ----
NM_001040181chr31204 --1422 --
NM_001040182chr31204 --1422 --
NM_001040183chr31204 --1422 --
NM_001040199chr31204 --1422 --
NM_001040200chr31204 --1422 --
NM_001040214chr631997 813 500 --1249 1436
NM_001040260chr411096 --2369 358 --
NM_001040261chr411096 --2369 358 --
NM_001040272chr922338 148 ------
NM_001040284chr16115869 5676 5542 5310 5200 5142 4688 4428 1048 920 639 --44884 4135 3982 3939 25660 4151
NM_001040402chr442712 2288 2009 1137 12328 ----
NM_001040429chr1373492 2955 2724 2357 1160 500 306 --23118 2969 --
NM_001040441chr165069 4037 815 474 291 173 11416 35043 4490 1669 --
NM_001040446chr572507 2042 1105 987 960 870 734 12570 1622 --
NM_001040450chr1542682 875 710 556 52521 2188 1973 893 590 ----
NM_001040453chr1542682 875 710 556 52521 2188 1973 893 590 ----
NM_001040624chr842035 783 146 131 --1704 --
NM_001040625chr842035 783 146 131 --1704 --
NM_001040626chr842035 783 146 131 --1704 --
NM_001040627chr842035 783 146 131 --1704 --
NM_001040628chr842035 783 146 131 --1704 --
NM_001040629chr842035 783 146 131 --1704 --
NM_001040630chr842035 783 146 131 --1704 --
NM_001040708chr83302 112 72 --1270 --
NM_001040712chr983015 3006 3000 2752 2462 2200 680 310 ------
NM_001040876chr41187 1353 ----
NM_001042355chr1695212 4980 4831 4637 3842 2017 1329 522 56 23269 421 11408 --
NM_001042357chr1041105 539 378 200 11272 ----
NM_001042358chr1041105 539 378 200 11272 ----
NM_001042360chr1041105 539 378 200 11272 ----
NM_001042361chr1051136 570 409 231 25 11303 ----
NM_001042363chr1041105 539 378 200 11272 ----
NM_001042364chr1051136 570 409 231 25 11303 ----
NM_001042365chr1051136 570 409 231 25 11303 ----
NM_001042383chr352940 2630 2401 279 24 --1227 --
NM_001042387chr1051136 570 409 231 25 11303 ----
NM_001042388chr181898 1206 ----
NM_001042389chr1041105 539 378 200 11272 ----
NM_001042390chr1041105 539 378 200 11272 ----
NM_001042392chr1041105 539 378 200 11272 ----
NM_001042393chr1051136 570 409 231 25 11303 ----
NM_001042395chr1041105 539 378 200 11272 ----
NM_001042396chr1051136 570 409 231 25 11303 ----
NM_001042397chr1051136 570 409 231 25 11303 ----
NM_001042399chr123486 389 352 ------
NM_001042403chr122791 386 ------
NM_001042404chr161249 778 755 579 237 109 ------
NM_001042406chr62827 807 ------
NM_001042412chr1695212 4980 4831 4637 3842 2017 1329 522 56 23269 421 11408 --
NM_001042413chr943645 3304 1449 54 33201 3184 38 23470 1185 --
NM_001042430chr141462 --1176 --
NM_001042437chr21159 194 ----
NM_001042459chr33277 248 104 ------
NM_001042473chr10----22047 532 --
NM_001042481chr1441802 780 167 152 ----12368
NM_001042492chr1773333 3309 2459 2351 2293 2274 166 ------
NM_001042494chr1563637 3214 2571 1023 924 431 --22763 1394 --
NM_001042495chr1563637 3214 2571 1023 924 431 --22763 1394 --
NM_001042496chr1563637 3214 2571 1023 924 431 --22763 1394 --
NM_001042497chr1563637 3214 2571 1023 924 431 --22763 1394 --
NM_001042506chrX4520 452 446 41 ------
NM_001042510chr8130 2810 307 11400 --
NM_001042511chr8130 2810 307 11400 --
NM_001042517chr132730 338 ------
NM_001042537chrX52396 2219 1860 1829 540 12112 ----
NM_001042555chr12124770 4609 4105 3830 3720 3372 1544 1221 729 310 137 30 ------
NM_001042599chr2167293 7103 6976 6919 6894 5926 5624 5412 5240 4835 2903 1522 1303 1246 638 312 46703 6623 5807 2657 26286 5604 --
NM_001042601chr353211 3072 2181 2073 517 ------
NM_001042603chr1295370 4841 4703 4501 4110 3730 969 640 456 ------
NM_001042604chr384033 3341 3013 1868 260 189 149 47 11583 ----
NM_001042632chr2022145 1651 22452 61 ----
NM_001042633chr2022145 1651 22452 61 ----
NM_001042646chr32201 170 11617 ----
NM_001042669chr441203 717 536 506 1674 ----
NM_001042681chr142446 2081 914 278 12531 ----
NM_001042682chr142446 2081 914 278 12531 ----
NM_001042682chr142446 2081 914 278 12531 ----
NM_001042683chr631494 700 443 --1590 --
NM_001042749chrX21981 520 ------
NM_001042750chrX21981 520 ------
NM_001042751chrX21981 520 ------
NM_001042762chr731125 913 335 1253 1795 --
NM_001043318chr1464085 3765 2670 1293 1277 1118 13828 32576 1468 870 21662 1329
NM_001043351chr14402 381 296 211 12057 ----
NM_001044305chr631498 1366 1053 ------
NM_001044722chr521565 875 ------
NM_001044723chr521565 875 ------
NM_001045556chr83591 151 66 --11738 --
NM_001045557chr83591 151 66 --11738 --
NM_001046chr552292 1898 664 435 399 42983 2268 1979 328 ----
NM_001048183chr163523 3492 3430 3178 3000 1324 --31202 762 199 1139
NM_001049chr1492218 1911 1763 1689 948 627 556 258 239 --1998 --
NM_001050chr1731064 546 345 --11250 --
NM_001071775chr1361743 1677 1540 531 214 205 1671 ----
NM_001076chr42123 108 ------
NM_001076chr42123 108 ------
NM_001079874chr162067 1988 1968 1777 548 365 --12124 --
NM_001083620chr452484 2434 996 741 335 1251 --1300
NM_001092chr1752003 1734 658 634 358 --1165 1543
NM_001095chr1221545 430 ------
NM_001096chr172792 242 ------
NM_001099678chr3186435 6291 6055 5452 5190 5183 4274 4259 4194 2473 2208 1710 1704 1485 1060 1002 287 99 --14771 --
NM_001100108chr1127977 7868 6834 6349 6045 3329 3011 2451 2205 1112 1093 500 47546 6801 6024 2001 36088 5448 5106 13044
NM_001106chr3219220 8845 8831 8085 7989 7802 7291 7069 6711 6059 3434 3214 2898 2866 2757 2540 1599 1255 871 760 458 26436 126 ----
NM_001109977chr42769 181 ------
NM_001113490chrX53548 2652 2259 1269 1206 43191 2926 1025 803 23645 1197 --
NM_001117chr1832435 2076 198 12480 ----
NM_001121chr1021796 581 ------
NM_001122679chr521186 969 ------
NM_001123chr103834 571 288 ------
NM_001126chr11169 ------
NM_001128chr16163803 3599 3516 3400 3339 3295 2482 1219 1091 1039 1005 853 651 473 463 223 42862 2680 1412 157 21538 366 --
NM_001131chr63822 404 336 ------
NM_001143chrY139 ------
NM_001148chr442037 1851 791 397 --12122 --
NM_001149chr1031205 415 220 ------
NM_001153chr24593 577 373 283 --1943 142
NM_001156chr102543 505 ------
NM_001160chr1262796 2305 572 255 191 183 12371 1817 --
NM_001167chrX116406 5902 5573 5449 4930 4849 2240 1938 1233 1113 831 16358 22102 1363 --
NM_001169chr16----1413 --
NM_001172chr141261 ------
NM_001173chr1494707 4301 4100 3968 3851 1058 571 565 299 24623 3651 ----
NM_001177chr1222377 485 ----21934 1735
NM_001186chr2122667 699 ------
NM_001198chr652348 1828 1727 1650 719 ------
NM_001200chr203951 331 98 ------
NM_001201chr463507 3385 3237 3069 1080 700 ------
NM_001204chr2197575 7514 7117 6443 6283 6264 5811 4787 1951 1600 1529 1416 1270 1058 808 593 485 474 212 12179 26938 4860 --
NM_001206chr952195 1968 796 756 492 ------
NM_001215chr12369 87 ------
NM_001219chr711520 --1231 12097
NM_001222chr1051857 1502 1461 1410 1305 21981 371 ----
NM_001237chr421193 270 ------
NM_001237chr421193 270 ------
NM_001241chr252403 1902 1712 714 675 11527 ----
NM_001241chr252403 1902 1712 714 675 11527 ----
NM_001248chr31958 ------
NM_001256chr1772676 2488 2170 1017 769 529 134 2939 318 1673 --
NM_001257chr1631182 542 184 ------
NM_001259chr795852 5342 5048 4840 4582 1540 1402 1356 1097 31907 1050 308 11117 --
NM_001260chr131111 ------
NM_001262chr12354 307 1224 ----
NM_001270chr54980 936 729 444 ------
NM_001271chr1512041 --22823 204 1247
NM_001273chr124448 112 97 51 ------
NM_001277chr112905 353 ------
NM_001280chr192134 109 ------
NM_001282chr1742681 1808 764 401 11820 ----
NM_001283chr73533 186 122 ----1542
NM_001290chr41278 ------
NM_001299chr191481 ------
NM_001304chr1793508 2977 2730 2723 1530 1386 1359 1265 238 ------
NM_001310chr1282779 2386 2286 1960 902 400 310 170 --12278 22969 2947
NM_001331chr1162200 2061 2017 1763 1753 616 12478 ----
NM_001332chr531368 1098 238 --21321 1087 --
NM_001343chr541696 480 464 173 11393 1552 --
NM_001346chr382600 2577 2250 2117 2023 1777 964 736 1297 1166 --
NM_001351chr321279 110 ------
NM_001356chrX31642 424 75 ------
NM_001363chrX1264 1137 2526 176 --
NM_001364chr1183336 1917 1848 1672 1554 1213 1135 445 11417 13734 1423
NM_001378chr2----1174 --
NM_001380chr101969 ------
NM_001385chr82434 277 ------
NM_001386chr841873 1598 347 320 ------
NM_001387chr552778 1961 1267 1211 314 1206 ----
NM_001389chr212438 62 ------
NM_001390chr1833226 3180 2552 --12760 13374
NM_001391chr181200 ------
NM_001392chr18--149 ----
NM_001396chr2152337 1825 889 564 204 --11012 12228
NM_001399chrX53343 2459 1527 1401 788 33104 2470 188 ----
NM_001400chr12928 388 ------
NM_001401chr921540 1342 --11330 1206
NM_001407chr321151 230 31369 1336 1171 11184 11290
NM_001412chrX53041 2594 1316 336 29 --1201 --
NM_001415chrX31310 609 116 11972 1573 --
NM_001416chr171130 --199 --
NM_001417chr1231787 397 124 ----11444
NM_001419chr1954235 3611 3142 1236 377 33989 1541 1103 ----
NM_001421chrX21537 1266 1268 ----
NM_001423chr1221762 1588 1210 11540 --
NM_001427chr751456 1375 523 323 281 --1451 --
NM_001429chr2241052 970 421 311 ------
NM_001430chr241297 768 260 175 --11507 --
NM_001431chr63955 299 36 ----1333
NM_001432chr483823 3654 2670 2606 2513 1354 1193 1006 11092 23932 3394 --
NM_001438chr183685 2975 2380 2358 1414 1073 512 203 ------
NM_001443chr2159 ------
NM_001448chrX61496 1428 1343 151 80 59 --1354 --
NM_001451chr1621034 929 ------
NM_001452chr6----1637 --
NM_001453chr631775 1593 281 --1225 --
NM_001460chr173266 3065 3000 1158 1005 223 50 ------
NM_001466chr171112 ------
NM_001482chr152818 682 ------
NM_001483chr72242 202 ----2690 307
NM_001491chr632410 805 413 11788 32172 517 209 --
NM_001495chr82487 282 --2123 95 --
NM_001527chr684569 4118 3761 3272 1591 1349 307 101 24890 4581 23145 535 --
NM_001530chr1441161 1062 402 269 --2965 754 --
NM_001533chr192227 91 ------
NM_001542chr141991 1861 811 470 --1616 --
NM_001546chr631233 924 361 ------
NM_001550chr71632 1647 ----
NM_001560chrX22065 23 137 ----
NM_001564chr41144 ------
NM_001584chr1111147 ------
NM_001587chrX42230 1708 588 420 ----2737 480
NM_001609chr1093728 3591 3311 3303 1571 1130 684 204 82 33485 3171 348 1507 --
NM_001616chr252915 2802 2627 853 215 --23465 1180 13238
NM_001617chr211012 --1490 11028
NM_001620chr114841 770 123 53 ------
NM_001634chr651780 1574 1419 462 189 ------
NM_001635chr73991 122 74 ------
NM_001650chr1893908 3676 2954 1552 1382 940 735 508 261 --24120 888 --
NM_001656chr551678 551 155 134 48 ------
NM_001658chr121040 723 --1823 --
NM_001659chr1292665 2390 2346 2199 1876 1737 1011 898 139 --12289 --
NM_001662chr71100 1377 ----
NM_001663chr1472656 1970 1090 1048 996 826 91 1882 21766 855 --
NM_001664chr31740 --2855 128 --
NM_001668chr15923 871 636 347 254 21950 1485 ----
NM_001676chr132169 56 ------
NM_001678chr1721203 188 1529 31287 1169 519 --
NM_001679chr32755 507 --195 --
NM_001681chr12----1137 --
NM_001682chr1252658 2497 2448 2030 616 12072 --12634
NM_001683chr342263 1833 741 344 --11670 --
NM_001684chr163457 2624 1528 1129 850 786 11195 1808 1491
NM_001688chr1----2664 312 --
NM_001690chr332566 685 414 12489 ----
NM_001693chr851185 1159 1042 972 83 ------
NM_001695chr843794 3679 3456 447 12680 13471 13367
NM_001699chr1981851 1792 1754 1431 525 93 78 70 ----1181
NM_001701chr931267 622 459 ------
NM_001703chr12278 224 --165 --
NM_001704chr63512 486 386 ------
NM_001706chr3170 ------
NM_001707chr73828 359 166 ------
NM_001713chr51759 1218 ----
NM_001718chr6137 1106 --11238
NM_001723chr62680 56 1217 ----
NM_001731chr125946 815 804 233 185 ------
NM_001742chr721862 345 ------
NM_001743chr21516 ------
NM_001744chr5150 ------
NM_001745chr541199 821 261 94 ------
NM_001746chr5122886 2874 2867 2228 2018 1919 1043 513 329 311 282 82 22610 1101 ----
NM_001748chr14924 887 294 277 --21118 78 --
NM_001753chr741527 233 137 114 11553 ----
NM_001754chr2193740 3694 3653 3111 2850 1464 1173 504 43 23209 777 ----
NM_001755chr1652206 1730 353 294 79 ------
NM_001759chr1274717 4166 3475 3219 1598 876 544 14318 --25338 976
NM_001777chr383939 3553 2791 2647 1307 1103 862 773 23404 82 1556 --
NM_001781chr122285 102 ------
NM_001788chr73776 722 220 1172 ----
NM_001791chr121316 401 ------
NM_001792chr183458 255 88 ------
NM_001797chr163576 532 183 ------
NM_001798chr123858 122 71 --11015 --
NM_001800chr19171 ------
NM_001806chr1992985 2752 1806 1182 1127 723 611 523 172 12053 ----
NM_001812chr41321 ------
NM_001826chr1161 1447 --1103
NM_001830chrX74005 3128 3076 2679 1574 1214 492 23914 3473 ----
NM_001851chr62122 97 1296 --1587
NM_001854chr1143 ------
NM_001855chr92883 701 ------
NM_001858chr644287 4119 3579 3507 25117 1919 23158 309 --
NM_001859chr953496 1307 1092 1080 278 12734 33596 2445 546 22883 990
NM_001880chr21292 ------
NM_001882chr52519 175 1119 ----
NM_001884chr51499 ------
NM_001890chr42369 52 ------
NM_001894chr2251182 1142 1017 952 828 ------
NM_001895chr2041198 994 768 398 11073 ----
NM_001896chr16140 ------
NM_001901chr631052 901 317 1988 ----
NM_001903chr53865 796 656 --1733 --
NM_001904chr31982 1147 ----
NM_001921chr421174 1048 ----173
NM_001924chr12170 56 ------
NM_001935chr23196 158 130 ------
NM_001938chr111801 --198 --
NM_001939chrX113585 3502 3439 2502 2404 1474 1101 737 487 323 261 13803 12659 --
NM_001942chr1831874 1395 539 ------
NM_001945chr521425 1097 ------
NM_001946chr125983 885 814 734 341 ------
NM_001949chr6190 1881 ----
NM_001951chr83553 514 97 ------
NM_001957chr462336 2260 2243 2232 1620 474 1781 --11778
NM_001967chr32625 97 ------
NM_001968chr42154 117 --1851 --
NM_001969chr1472990 2912 2897 1372 780 588 116 13064 13035 --
NM_001977chr42433 280 1650 ----
NM_001980chr1262231 2222 1909 842 597 121 1260 ----
NM_001981chr131575 1552 221 ------
NM_001982chr1231270 1184 195 --1830 --
NM_001987chr1253633 2723 2666 1408 167 23381 3055 11139 --
NM_001991chr1732213 2099 546 ------
NM_001993chr14903 876 831 248 ----1188
NM_001995chr431212 351 220 --11418 --
NM_001999chr511519 1135 1348 --
NM_002006chr485491 4186 4014 3788 2186 976 873 651 --21953 1514 --
NM_002009chr1552713 2353 1869 740 693 ------
NM_002010chr131116 ------
NM_002015chr1342577 2187 833 544 --21074 958 --
NM_002024chrX61654 1585 562 465 198 69 12098 ----
NM_002025chrX168879 8495 7762 7334 7206 6083 5991 5697 2973 2887 2542 2517 2069 1881 1770 253 23030 2747 --11322
NM_002026chr241030 899 726 428 ------
NM_002029chr19122 ----155
NM_002035chr1873999 3793 3671 2791 2760 1603 395 1387 13163 11437
NM_002039chr45686 680 616 326 286 ------
NM_002040chr2162597 2499 2296 1946 955 67 1172 ----
NM_002044chr1521163 186 ------
NM_002045chr31344 ------
NM_002051chr10----1146 --
NM_002052chr811371 ------
NM_002056chr23867 778 55 2206 73 ----
NM_002063chrX1805 ----183
NM_002069chr721402 384 --11457 --
NM_002074chr131667 1563 345 ------
NM_002076chr1283263 2965 2839 2605 2571 2560 1092 387 ------
NM_002077chr962134 1888 627 607 571 41 12055 --11990
NM_002078chr3------157
NM_002081chr2142 --11163 --
NM_002086chr1742150 2031 1904 1552 --2669 140 --
NM_002087chr171303 ------
NM_002092chr494109 4063 3978 3354 1289 1156 938 647 58 --13553 --
NM_002126chr1783997 3762 2965 2948 1121 1086 1017 97 14173 12718 13218
NM_002128chr1372441 2280 2194 1648 1596 319 213 1678 ----
NM_002130chr521685 1133 21711 395 ----
NM_002137chr732275 704 211 ------
NM_002140chr931172 1013 90 --1345 --
NM_002146chr174942 918 397 390 1423 ----
NM_002154chr52530 58 ------
NM_002156chr2123 ------
NM_002158chr272861 2699 2318 1407 1130 1082 480 ------
NM_002166chr22485 172 ------
NM_002182chr332203 1797 922 22255 1009 ----
NM_002192chr72634 448 ------
NM_002196chr202712 206 1444 ----
NM_002196chr202712 206 1444 ----
NM_002203chr574105 3569 3014 2856 2684 1525 1320 --1631 11493
NM_002207chr34755 606 482 225 ------
NM_002210chr2----12895 23376 30
NM_002211chr1011121 11007 11066 --
NM_002214chr7104689 4550 4488 4056 3655 2216 1922 766 305 237 24318 1868 ----
NM_002227chr1----21296 828 --
NM_002241chr183103 2807 2304 2263 2227 2028 1934 400 --1449 --
NM_002245chr11107 ------
NM_002247chr1051797 947 924 840 693 ------
NM_002252chr21109 ------
NM_002253chr421361 519 ------
NM_002254chr241797 538 440 404 12103 2709 672 --
NM_002264chr3115048 4997 4843 4567 4297 3556 3282 1157 1062 621 135 23323 406 --21461 679
NM_002265chr174853 482 471 54 --1245 --
NM_002267chr1352313 2093 1640 951 22 --2381 151 --
NM_002268chr3101706 1460 1445 1358 1238 627 517 445 386 377 ------
NM_002269chr61403 ------
NM_002270chr5135006 4591 4365 4095 3572 2184 2172 1931 1849 1725 762 697 508 24810 1102 15221 --
NM_002271chr1352307 1818 1668 840 833 --21797 525 --
NM_002285chr253878 3037 1450 354 226 11411 31383 1319 1254 --
NM_002293chr182702 2673 2485 1688 1108 780 245 234 168 ----
NM_002313chr1063776 1663 1585 796 490 259 14623 14263 --
NM_002314chr7----11027 11084
NM_002317chr5--1361 ----
NM_002334chr1131715 1376 795 --21790 242 --
NM_002335chr111162 ------
NM_002336chr1295010 4881 4321 4124 3692 3363 735 682 525 --11646 11595
NM_002349chr221322 1256 ------
NM_002355chr1271415 1345 1274 1107 906 496 143 ------
NM_002356chr672296 1756 1136 324 318 263 249 1831 42577 1876 1069 898 --
NM_002359chr1794173 3802 3532 3409 3061 3054 1535 1429 890 ------
NM_002360chr722641 271 ------
NM_002372chr53698 550 46 ------
NM_002374chr252588 1403 664 338 297 ------
NM_002376chr142592 99 ------
NM_002381chr22992 700 1908 ----
NM_002382chr141427 1451 ----
NM_002387chr5115089 5007 4828 4628 4494 4028 3966 3475 1987 1759 397 13181 ----
NM_002395chr61455 11059 3978 576 191 --
NM_002397chr542236 2202 1647 60 ------
NM_002399chr1521357 1036 1389 ----
NM_002401chr1712263 12461 11850 11804
NM_002402chr71125 21186 211 1334 --
NM_002408chr145584 324 316 308 117 ------
NM_002422chr11134 --1210 --
NM_002449chr541198 1164 945 374 ------
NM_002467chr82158 99 ------
NM_002469chr122411 201 ------
NM_002478chr111440 ------
NM_002480chr1211396 11239 ----
NM_002481chr198009 7543 6100 5351 4907 989 832 321 169 47586 2470 2277 1621 11688 12678
NM_002485chr832068 800 206 32182 1953 151 1461 --
NM_002486chr932490 766 438 12172 11688 --
NM_002487chr153309 246 141 ------
NM_002499chr1592494 2211 2084 2007 1794 1632 899 408 346 --1307 --
NM_002500chr22420 189 ------
NM_002515chr142219 73 ------
NM_002518chr21934 --1992 --
NM_002519chr1161299 614 431 289 126 104 ------
NM_002522chr1753761 3425 2522 2392 440 23412 1112 23181 2648 --
NM_002524chr131064 914 39 ------
NM_002536chrX1229 ------
NM_002538chr53475 401 75 ------
NM_002541chr721027 348 ----1419
NM_002545chr1174994 4136 3908 1801 1255 1056 595 33938 3932 268 ----
NM_002546chr81750 ------
NM_002547chrX73773 2646 1323 457 129 123 23 23707 420 ----
NM_002563chr31832 --1781 --
NM_002568chr8--1133 ----
NM_002569chr15277 48 ------
NM_002572chr11----192 --
NM_002577chr3104035 3864 2871 2834 1126 890 873 631 307 298 13695 22735 539 --
NM_002581chr985450 5154 5087 4521 1271 966 817 603 24840 4252 11544 --
NM_002586chr641160 565 392 228 ------
NM_002591chr204582 489 476 23 ----1146
NM_002594chr2011553 --11630 1919
NM_002595chr1241557 1332 724 526 11616 --1519
NM_002599chr1131121 201 138 --2450 274 --
NM_002600chr11568 21487 197 ----
NM_002605chr151920 ----11116
NM_002608chr2241522 1507 1364 257 ------
NM_002612chr73833 703 22 11957 ----
NM_002613chr16135064 4608 4390 4364 3949 3783 3709 3469 2164 1715 1312 877 126 15210 ----
NM_002627chr10179 ------
NM_002628chr331118 1086 494 1221 31227 1152 261 1358
NM_002629chr102750 315 ----1108
NM_002643chr21165 ------
NM_002645chr1152903 2833 2573 2001 375 23093 290 11237 --
NM_002655chr893633 3207 1602 1428 1342 1230 842 594 358 ------
NM_002657chr20103614 3356 2601 2568 2442 1365 1305 849 825 398 1189 23749 361 23003 1053
NM_002663chr171523 ------
NM_002670chr341602 1299 1248 466 ------
NM_002674chr122177 23 ------
NM_002687chr145997 845 512 262 68 21188 1182 ----
NM_002699chr11476 ------
NM_002707chr22376 363 ------
NM_002709chr2113588 3532 3340 3024 2335 1004 889 859 827 252 114 ----12885
NM_002711chr71611 ------
NM_002714chr63936 869 262 --1992 --
NM_002715chr51185 --1903 --
NM_002716chr1123140 2257 12287 52876 2766 1461 1401 646 --
NM_002717chr81225 --1254 --
NM_002718chr372685 1856 1848 626 586 236 134 197 22578 1961 11893
NM_002719chr1442269 1990 951 306 1750 --1587
NM_002721chr9----196 --
NM_002731chr163178 2778 2724 2174 987 227 --13019 --
NM_002734chr1751745 1731 1415 637 223 --11669 --
NM_002736chr771911 1751 595 513 429 229 181 21832 783 ----
NM_002738chr16------11083
NM_002740chr382801 2320 2178 2135 2030 905 628 502 12822 --12168
NM_002745chr2294506 4371 3796 1652 1353 532 486 451 419 --11767 23439 112
NM_002747chr1851611 1198 329 230 101 11847 ----
NM_002750chr10174 1199 ----
NM_002764chrX4885 661 330 233 1673 ----
NM_002765chrX41292 939 480 468 21020 302 1566 --
NM_002767chr171522 ------
NM_002786chr11--182 ----
NM_002811chr161524 ------
NM_002825chr71459 --1589 --
NM_002827chr2041155 713 489 154 --21722 1306 1209
NM_002829chr92374 134 ------
NM_002830chr21147 1124 ----
NM_002834chr1243549 1538 1395 138 ----13174
NM_002835chr75653 270 118 80 23 ------
NM_002837chr1253592 3547 3348 3054 1845 24388 1226 ----
NM_002839chr983015 3006 3000 2752 2462 2200 680 310 ------
NM_002840chr111539 --1469 --
NM_002843chr1122116 242 11341 --1830
NM_002848chr1231223 938 861 ----11281
NM_002851chr73750 715 671 ------
NM_002857chr172388 1939 1841 1647 366 342 292 --12015 --
NM_002867chr11236 --1685 --
NM_002868chr1292140 1652 1622 970 834 672 602 247 151 --1271 --
NM_002869chr111661 --11797 --
NM_002874chr952307 2177 1918 1839 839 --11605 --
NM_002886chr384905 4882 4656 3722 3400 3245 1849 1001 --1101 14249
NM_002890chr561031 902 263 247 178 101 1295 ----
NM_002892chr1451652 1177 1116 611 394 ------
NM_002893chrX2332 139 ------
NM_002895chr203962 276 32 ------
NM_002906chr1161985 1826 1603 1561 677 636 11855 193 --
NM_002912chr61215 --1272 1832
NM_002923chr1--187 --1629
NM_002924chr11556 --151 --
NM_002938chr451713 1447 1351 538 360 ------
NM_002940chr41187 1353 ----
NM_002941chr31243 ------
NM_002942chr331443 1098 198 ------
NM_002950chr3----144 --
NM_002953chr11672 --1606 --
NM_002956chr122317 288 ------
NM_002958chr34698 401 265 197 ------
NM_002959chr184460 4399 3855 3680 3487 3477 1135 189 ------
NM_002968chr1661006 882 758 232 201 151 ----2823 442
NM_002971chr32967 346 --167 --
NM_002973chr121536 ------
NM_002977chr262191 1267 688 422 313 306 ----1657
NM_002993chr421042 756 2695 134 ----
NM_002994chr441497 581 557 462 1722 --1159
NM_002998chr841981 1495 377 117 --1549 --
NM_002999chr201129 ----1467
NM_003010chr171302 --11985 --
NM_003011chr931699 1516 644 1178 ----
NM_003013chr45766 689 539 289 227 ------
NM_003016chr1771938 1841 1786 1714 1470 779 135 --1790 --
NM_003017chr61567 ------
NM_003026chr94962 949 912 136 ------
NM_003027chr151153 ------
NM_003029chr171390 1318 1165 1088 517 430 102 ------
NM_003030chr351786 1743 1666 1432 371 --21983 151 --
NM_003031chr163873 786 243 ----1401
NM_003036chr11288 --21167 978 --
NM_003042chr341896 399 265 82 ------
NM_003043chr374305 4274 3232 1563 757 509 494 ------
NM_003045chr1394914 4363 4182 3376 3328 3127 420 347 333 --11717 --
NM_003048chr22553 203 --22819 1099 --
NM_003051chr171958 1750 1619 1493 660 604 424 11660 1615 --
NM_003060chr541297 1149 468 186 ------
NM_003068chr81309 ------
NM_003071chr322102 245 ------
NM_003074chr341997 1733 1518 170 ------
NM_003076chr1261463 1156 1124 1116 442 80 ------
NM_003079chr173918 210 170 ------
NM_003081chr202918 162 ------
NM_003099chr1596520 6067 6040 5917 5782 4705 2144 1492 1235 12499 15722 168
NM_003105chr11------187
NM_003107chr672605 2326 2105 2094 1682 891 207 --1467 --
NM_003108chr266624 5701 4414 2150 2045 1150 11559 --25039 2849
NM_003111chr231345 854 152 ------
NM_003112chr773083 2375 989 783 711 369 50 ------
NM_003113chr24874 585 548 311 ------
NM_003118chr531922 642 378 ------
NM_003128chr272629 2592 2041 945 496 176 36 ----12717
NM_003133chr12351 22 ------
NM_003137chr692103 1558 1530 1417 823 482 271 211 116 12079 11803 --
NM_003144chr642235 2188 880 575 1402 11467 --
NM_003150chr174463 454 164 105 --31766 1659 630 --
NM_003154chr42104 76 ------
NM_003156chr1151322 1241 1143 1056 1048 ------
NM_003161chr1773249 3072 3046 1390 1140 832 247 12846 13559 --
NM_003162chr24851 422 252 22 ------
NM_003183chr21641 ------
NM_003185chr2031199 954 48 ----1227
NM_003189chr173213 2976 2646 1308 485 387 138 23298 2402 ----
NM_003198chr11273 ------
NM_003199chr1875633 5295 3735 3480 2126 1640 1465 12214 25040 4372 --
NM_003201chr101260 --1868 --
NM_003202chr51566 11330 11431 --
NM_003203chr272173 1918 1781 687 385 300 159 ------
NM_003206chr61139 1359 ----
NM_003217chr1261902 1749 1580 582 197 123 ------
NM_003221chr6103870 3768 3573 3536 3415 3391 3193 2743 1662 828 ------
NM_003222chr2041110 404 204 116 1460 ----
NM_003223chr162862 620 ------
NM_003234chr342155 1846 1674 1500 1378 1122 --
NM_003242chr36905 816 809 779 521 274 2790 370 ----
NM_003244chr181339 ------
NM_003246chr1541970 1457 218 55 ------
NM_003247chr611670 ------
NM_003253chr2131542 1241 160 ------
NM_003255chr1752272 2073 1967 653 297 11639 --1440
NM_003257chr1541050 1010 970 83 21088 1081 ----
NM_003262chr344360 1523 1181 975 14626 24323 1296 --
NM_003270chrX3447 254 35 ------
NM_003274chr2141844 863 568 47 12880 ----
NM_003281chr183634 3506 1823 1670 874 785 363 302 25161 5145 ----
NM_003286chr2031104 834 125 ------
NM_003290chr19193 --1763 1341
NM_003291chr131812 --1597 --
NM_003298chr3115729 5587 5135 4680 2397 1942 1846 1043 1025 925 421 13870 36030 1303 459 --
NM_003304chr31634 --11362 --
NM_003305chr43347 279 109 ------
NM_003314chr51100 ------
NM_003318chr61288 ------
NM_003319chr2----1619 --
NM_003320chr1154478 4099 4078 1735 1155 ------
NM_003321chr16--1177 ----
NM_003334chrX1159 ------
NM_003336chrX51097 1065 1006 823 126 ------
NM_003337chr521067 435 31674 1409 160 11368 --
NM_003338chr1041894 779 410 260 11481 ----
NM_003339chr551580 1490 1338 1187 108 ------
NM_003340chr41107 --11200 --
NM_003341chr33584 533 165 ------
NM_003342chr1743132 3105 2375 1083 --1322 --
NM_003348chr1231516 687 120 ------
NM_003350chr83839 787 371 ------
NM_003352chr22969 253 1908 ----
NM_003363chr32696 60 --1536 --
NM_003369chr1172593 2521 579 555 407 273 134 ------
NM_003373chr1031788 1478 493 ----1184
NM_003374chr5153 --1302 --
NM_003376chr6--11447 1184 --
NM_003376chr6--11447 1184 --
NM_003379chr641022 913 754 436 ------
NM_003383chr91122 ----1394
NM_003387chr232937 2624 1124 --1897 --
NM_003390chr111429 1699 ----
NM_003392chr374344 4267 4079 3167 1643 1333 1017 11624 14122 --
NM_003400chr22757 197 ------
NM_003403chr144804 703 205 41 ------
NM_003404chr2032022 1630 1254 --11301 1657
NM_003406chr851820 1796 1480 1389 514 ----1212
NM_003407chr191656 ------
NM_003409chr1821318 1101 --124 --
NM_003410chrX62283 2073 2066 2018 648 306 2317 40 22918 741 --
NM_003411chrY51640 1580 1347 611 136 137 ----
NM_003412chr362837 2717 2363 990 955 592 --12478 --
NM_003435chr196716 615 532 189 125 80 ----1773
NM_003439chr793539 2775 2765 2691 2613 1418 1241 415 300 --23579 2278 23209 1193
NM_003442chr112158 45 ------
NM_003458chr383942 3777 3366 3127 2779 478 380 295 --1993 --
NM_003463chr663267 2682 2349 2310 1363 499 --1618 --
NM_003466chr221919 176 ----12397
NM_003468chr253346 1256 301 276 89 --11443 --
NM_003471chr352163 693 654 302 212 ------
NM_003478chr1122541 130 22718 98 ----
NM_003482chr1232235 1115 832 ------
NM_003483chr1242486 556 194 104 12849 ----
NM_003489chr2163162 2640 1260 1062 635 522 --12478 --
NM_003505chr721630 1362 ------
NM_003506chr831313 1272 947 11299 1486 --
NM_003507chr282027 1988 1866 1796 1661 1640 1456 21 ------
NM_003557chr141589 1105 429 148 11317 ----
NM_003558chr92511 283 ------
NM_003565chr1241581 1164 481 215 --11504 11485
NM_003566chr12103309 2753 2294 1358 1235 1038 930 486 277 195 --12874 --
NM_003567chr12441 54 ------
NM_003569chr61120 ------
NM_003574chr1865374 5063 4283 3689 2320 483 15740 13734 14216
NM_003576chr1352798 2338 961 802 568 --21121 938 --
NM_003583chr1283950 3344 3281 2975 2521 1294 1019 532 --11120 --
NM_003589chr1321482 144 31436 579 255 11256 --
NM_003590chr283653 3017 2841 1593 929 571 455 217 11048 1394 --
NM_003592chr7------1346
NM_003597chr242153 2070 1973 1447 22261 2192 ----
NM_003601chr41157 ------
NM_003603chr441608 1438 1421 1402 32036 1805 1431 ----
NM_003607chr174374 3861 3727 3671 3626 945 60 14001 ----
NM_003615chr382485 1328 1185 1000 969 823 400 343 23790 2500 ----
NM_003617chr1124814 4414 4187 3806 3195 3156 3132 3104 1993 1064 668 565 13886 24532 4045 --
NM_003618chr231181 502 112 ------
NM_003626chr1121019 100 11080 ----
NM_003628chr22627 42 --170 --
NM_003629chr163468 3359 3212 2856 2586 2231 22877 1395 ----
NM_003630chr63729 480 162 1517 ----
NM_003631chr10----1946 --
NM_003633chr532279 1763 580 --1148 12239
NM_003637chr11415 ------
NM_003653chr171253 --144 --
NM_003659chr211240 ------
NM_003660chr191271 ------
NM_003663chr353104 2832 2738 1091 555 ----1758
NM_003671chr973558 3513 2939 2375 908 636 490 1169 1402 --
NM_003672chr12146 116 11318 11350 --
NM_003679chr182802 2769 2420 2397 2308 2255 536 409 11348 ----
NM_003690chr22215 187 1631 ----
NM_003705chr23597 304 233 --1321 137
NM_003710chr15176 ------
NM_003711chr5178 ------
NM_003713chr131290 697 313 ------
NM_003718chr73514 451 213 ------
NM_003722chr352476 2201 2133 1774 886 ------
NM_003728chr41172 1224 ----
NM_003743chr262165 2043 2024 1908 1460 211 ------
NM_003749chr1352302 2161 922 877 812 1684 ----
NM_003750chr102316 309 ------
NM_003754chr111138 ------
NM_003758chr152180 27 1582 ----
NM_003758chr152180 27 1582 ----
NM_003759chr474088 4067 4024 3919 3069 3037 476 1560 ----
NM_003760chr1------1797
NM_003762chr111456 21338 928 ----
NM_003763chr2021975 480 22120 1267 --11129
NM_003766chr172495 140 ------
NM_003772chr1161229 862 397 333 265 243 --1880 --
NM_003774chr1262568 1317 1150 1027 662 383 22522 2164 ----
NM_003779chr12499 21 ------
NM_003780chr11564 --1169 --
NM_003783chr111210 ------
NM_003787chr1841630 1450 596 538 ------
NM_003794chr31959 ------
NM_003796chr192443 115 ------
NM_003800chr652273 1979 310 243 215 ------
NM_003816chr831091 508 375 ------
NM_003825chr1521006 65 ------
NM_003831chr1821335 203 ------
NM_003838chr141602 1562 318 301 --126 --
NM_003840chr84732 578 151 41 --11923 1307
NM_003842chr862031 890 701 463 293 43 2480 256 12210 --
NM_003846chr12610 261 --1707 1632
NM_003850chr131540 ------
NM_003858chr14194 --1683 --
NM_003861chr1442507 1853 1097 1048 12544 ----
NM_003872chr232719 2090 483 22491 2060 12616 --
NM_003873chr1022136 1915 11626 ----
NM_003884chr331558 746 126 ----11227
NM_003885chr1761077 1044 503 184 167 111 1886 1239 --
NM_003887chr232200 1511 470 ------
NM_003888chr1541672 1331 1067 204 ------
NM_003896chr21159 194 ----
NM_003899chr1322330 1743 22429 306 22279 116 --
NM_003901chr1062624 2437 2399 1822 1701 1002 181 ----
NM_003902chr11317 ------
NM_003913chr693947 3616 3484 1674 1634 1575 1103 747 648 ------
NM_003916chrX61518 1092 935 535 478 226 ------
NM_003934chr921040 485 --11319 --
NM_003936chr23937 780 477 ------
NM_003939chr1053300 2822 1365 1098 986 ------
NM_003941chr711979 --1929 --
NM_003945chr52497 92 --1198 --
NM_003947chr311354 ------
NM_003949chr1761924 1596 676 613 184 81 ------
NM_003955chr1711564 ------
NM_003958chr6103890 3620 3357 2986 2778 2712 2463 2433 715 508 --12875 11475
NM_003966chr5187688 7630 7170 7101 6321 6213 6069 5847 5711 5461 4751 4745 2801 2602 1295 734 386 340 2913 202 32020 624 551 26680 4956
NM_003968chr33502 140 46 ------
NM_003971chr173568 545 527 ------
NM_003972chr10----1320 --
NM_003980chr641101 1067 1047 386 ------
NM_003983chr1694391 4248 3731 3170 2712 1647 1114 890 747 --11189 --
NM_003994chr1263615 2833 2822 808 703 120 13250 ----
NM_004006chrX--2501 318 11946 --
NM_004007chrX--2501 318 11946 --
NM_004009chrX--2501 318 11946 --
NM_004010chrX--2501 318 11946 --
NM_004011chrX--2501 318 11946 --
NM_004012chrX--2501 318 11946 --
NM_004013chrX--2501 318 11946 --
NM_004014chrX--2501 318 11946 --
NM_004015chrX--2501 318 11946 --
NM_004016chrX--2415 232 11860 --
NM_004017chrX--2501 318 11946 --
NM_004018chrX--2415 232 11860 --
NM_004020chrX--2501 318 11946 --
NM_004021chrX--2415 232 11860 --
NM_004022chrX--2415 232 11860 --
NM_004023chrX--2415 232 11860 --
NM_004028chr1893908 3676 2954 1552 1382 940 735 508 261 --24120 888 --
NM_004034chr102543 505 ------
NM_004035chr17134975 4968 4949 4872 4370 4014 3962 3878 3810 3411 1542 1290 1149 --43272 1743 1186 797 --
NM_004047chr12248 33 ------
NM_004056chr82875 97 ------
NM_004061chr52571 557 ------
NM_004067chr731531 506 272 1565 1212 --
NM_004073chr11232 ------
NM_004075chr121427 1520 ----
NM_004077chr1241229 1093 874 841 --1358 --
NM_004079chr12948 45 1764 22705 876 12418
NM_004081chrY21571 1305 ------
NM_004085chrX2208 101 ------
NM_004089chrX61277 1207 1197 1190 884 379 ------
NM_004090chr1752817 2501 785 640 154 1707 --1412
NM_004093chr1352816 2721 2689 2038 185 --22070 832 --
NM_004094chr1452758 2597 2542 2214 2088 42029 1864 1050 749 --22928 202
NM_004096chr1051966 1608 1501 1441 692 1559 ----
NM_004099chr942119 1978 1480 1327 21965 1727 ----
NM_004100chr642550 2028 695 216 12119 ----
NM_004105chr22911 56 11061 ----
NM_004112chr1751634 1428 632 458 451 11286 ----
NM_004113chr331727 1682 658 --11651 --
NM_004114chrX1277 ------
NM_004116chr23406 394 312 ------
NM_004117chr652208 2123 2112 1482 353 ------
NM_004124chr1482790 2720 1100 1057 733 642 185 167 --12516 --
NM_004132chr102369 270 11226 11165 --
NM_004134chr52609 456 ----1702
NM_004136chr1573004 2904 2377 2288 2163 794 23 12517 13120 --
NM_004157chr31890 --2873 198 --
NM_004161chr231637 987 403 ------
NM_004170chr931726 1325 433 --11409 --
NM_004171chr11169522 9476 8648 8341 7359 7308 6760 6561 6250 6024 6015 3302 1724 1562 1373 1315 27498 1261 28065 431 --
NM_004172chr532024 102 21 1571 ----
NM_004176chr171475 1175 144 --
NM_004181chr44300 274 130 21 ------
NM_004186chr32919 374 --1933 1685
NM_004187chrX31412 1004 958 ------
NM_004193chr10----1357 --
NM_004199chr52320 61 ------
NM_004200chr1182871 2840 2549 2530 2165 2154 870 62 ------
NM_004203chr162134 25 ------
NM_004205chr111516 ------
NM_004209chr1631168 1032 835 ------
NM_004226chr21109 ------
NM_004229chrX62055 1476 666 597 579 175 --1737 --
NM_004232chr1863719 1558 1459 673 593 549 --33036 30 23 --
NM_004235chr9--1555 1139 --
NM_004240chr192225 78 ------
NM_004261chr12886 37 ------
NM_004268chr113355 159 144 142 ----
NM_004270chr51210 2278 114 ----
NM_004274chr1452185 1298 1191 747 189 --12098 --
NM_004277chr641308 472 273 141 --1280 --
NM_004279chr752384 2373 1471 742 679 ------
NM_004293chr9133871 3720 3517 3508 3375 3143 3085 2396 2380 2354 1448 556 95 ----12496
NM_004301chr34354 83 39 25 ------
NM_004302chr1232855 2422 187 ------
NM_004311chr1022133 1945 ------
NM_004316chr123857 70 40 1802 ----
NM_004327chr2252492 2388 2128 1964 706 22007 410 ----
NM_004329chr1031191 438 398 ------
NM_004330chr1541174 971 304 261 1808 ----
NM_004331chr831985 1732 596 --12636 --
NM_004337chr841968 1837 1541 429 2700 331 1393 1759
NM_004338chr18126485 6345 6033 5575 5306 5289 4918 4479 2644 2634 1047 343 26183 2738 ----
NM_004342chr72464 416 ------
NM_004349chr81920 1157 ----
NM_004352chr162599 165 ------
NM_004354chr44283 257 228 121 ------
NM_004362chr42570 188 1174 ----
NM_004365chr53293 125 44 ------
NM_004370chr641586 1505 818 642 ------
NM_004371chr1180 --1307 --
NM_004374chr81137 ------
NM_004380chr1632216 1841 468 22239 2047 11615 --
NM_004384chr521565 875 ------
NM_004386chr1931943 1649 30 21903 326 11706 --
NM_004392chr1362431 1843 1703 1632 1031 43 ------
NM_004393chr331825 891 194 ------
NM_004397chr11144298 3775 3698 3609 3385 3220 2968 1417 1265 1160 993 491 185 93 13291 13430 --
NM_004411chr72275 35 ------
NM_004414chr212620 581 ------
NM_004415chr62189 56 131 ----
NM_004419chr104760 426 411 292 ------
NM_004423chr342228 2056 344 83 --11737 --
NM_004429chrX3949 335 99 --11210 11156
NM_004430chr862534 2290 1847 1831 204 26 ----1287
NM_004432chr942255 2048 1622 611 2732 329 ----
NM_004434chr1441912 769 189 136 ------
NM_004438chr262544 2240 840 740 76 57 13138 12696 --
NM_004439chr4----145 --
NM_004440chr63782 521 450 ----1265
NM_004441chr321282 1233 ------
NM_004444chr73693 604 226 ----2306 105
NM_004446chr1139 ------
NM_004448chr17----1586 --
NM_004449chr2131474 1403 242 11273 ----
NM_004450chr141152 --1103 --
NM_004454chr351699 1473 722 489 306 ------
NM_004457chr241392 1244 1072 580 ------
NM_004458chrX1532 2697 485 ----
NM_004459chr173765 256 209 1694 ----
NM_004463chrX2159 119 ------
NM_004464chr443844 3762 584 269 13304 ----
NM_004472chr52665 172 ------
NM_004480chr141266 ------
NM_004481chr122596 2123 --3954 896 667 --
NM_004482chr22898 708 1799 ----
NM_004491chr1974377 1737 1721 1569 1522 451 122 165 12992 11238
NM_004492chr152171 32 ------
NM_004498chr152332 252 ------
NM_004499chr54434 361 350 118 ------
NM_004500chr1421471 725 ------
NM_004501chr164144 3625 3175 1541 1337 898 12710 23382 3152 --
NM_004504chr272913 2821 1164 1145 408 386 182 1937 --1707
NM_004505chr1731594 1312 746 --11818 --
NM_004514chr1742816 2561 1065 848 22989 737 --12264
NM_004516chr192378 314 11160 ----
NM_004519chr8145 ------
NM_004520chr52683 554 ------
NM_004521chr101327 ------
NM_004525chr221313 39 21492 1168 ----
NM_004527chr173478 113 71 --11481 --
NM_004529chr951452 1411 1120 1058 549 1276 ----
NM_004537chr1231351 587 46 2226 22 ----
NM_004538chrX3754 697 593 167 ----
NM_004566chr1092185 2037 1930 850 814 788 625 290 129 --11595 1491
NM_004571chr2153235 2826 2163 578 104 --12501 1284
NM_004575chr421384 77 1636 1400 --
NM_004578chr14915 737 248 85 ------
NM_004580chr151586 --11826 --
NM_004583chr173774 222 180 ------
NM_004586chrX105213 4724 4450 4145 4103 3850 3589 3462 823 518 24477 3947 --14371
NM_004588chr1153902 3352 1537 1026 436 --11165 --
NM_004593chr32860 121 ------
NM_004594chr161210 1949 ----
NM_004598chr573349 2887 2720 2531 2085 935 687 13034 --12458
NM_004602chr2011451 1967 ----
NM_004606chrX2123 60 ------
NM_004612chr943631 3238 327 242 33134 518 457 13449 11326
NM_004621chr1141254 1211 798 93 ------
NM_004622chr232306 156 25 22108 300 ----
NM_004631chr12325 229 ------
NM_004635chr32352 253 1399 1765 --
NM_004637chr311094 ------
NM_004642chr123686 595 32 ------
NM_004645chr171123 1731 1692 --
NM_004651chrX1356 ------
NM_004654chrY31085 988 437 11039 ----
NM_004655chr1721003 988 ------
NM_004660chrY2555 422 1339 ----
NM_004663chr1531526 600 87 11115 ----
NM_004673chr141461 1192 1112 38 ------
NM_004681chrY1179 ------
NM_004685chr132679 570 42979 2806 2437 1966 ----
NM_004687chr1721952 1454 --1203 2399 120
NM_004694chr171103 ------
NM_004703chr1792257 2197 1921 1815 946 720 710 549 50 12486 133 --
NM_004709chrX31340 1142 169 ------
NM_004710chr172977 224 ------
NM_004719chr1252721 2573 1079 705 251 1735 1807 --
NM_004721chr31119 --1305 --
NM_004725chr1041367 1358 1186 172 1277 ----
NM_004726chrX95732 5281 4908 4089 4046 3556 2208 777 35 15435 25253 2077 11310
NM_004730chr542159 1805 1447 576 11351 2236 181 --
NM_004736chr151950 1862 520 80 27 ------
NM_004737chr2241166 1160 291 158 1816 ----
NM_004742chr331769 1317 618 ------
NM_004745chr856103 6065 5975 5787 1573 11992 24642 1549 11563
NM_004748chr1594081 3262 3162 1664 613 555 327 282 235 23239 735 --1172
NM_004755chr1461139 879 754 370 357 36 ------
NM_004756chr192529 346 --11069 --
NM_004759chr162014 1843 1765 779 504 102 ------
NM_004760chr762428 2383 850 308 245 131 --1433 --
NM_004762chr1731991 1621 36 --11583 --
NM_004768chr121097 962 11176 ----
NM_004772chr551292 1243 1042 386 125 ------
NM_004774chr1753077 1231 766 506 460 ------
NM_004775chr182919 418 11602 --11854
NM_004776chr20113257 2951 2893 2709 2568 2403 2280 2097 523 388 168 --1776 12703
NM_004779chr52537 288 --11164 --
NM_004786chr181193 1161 ----
NM_004788chr1152111 1095 900 607 534 ------
NM_004789chr91339 1442 ----
NM_004796chr14--11925 ----
NM_004798chr20103545 3408 2976 2479 816 794 427 411 282 201 13526 ----
NM_004799chr1171 ------
NM_004801chr221536 1393 ------
NM_004805chr261001 903 317 204 193 56 ------
NM_004808chr1063310 3226 2513 2387 2329 469 1634 22941 751 --
NM_004815chr194811 4365 4322 4094 4087 3852 3448 1587 485 34305 3471 3058 ----
NM_004822chr1711599 --22617 66 11323
NM_004824chr631379 1337 1038 ------
NM_004831chr1941043 808 392 326 --21071 35 --
NM_004834chr232156 822 303 ------
NM_004841chr151129 856 850 288 146 ------
NM_004842chr62320 274 ----11573
NM_004844chr31403 1138 ----
NM_004845chrX41572 736 585 255 --22544 1136 --
NM_004850chr23526 419 332 --11545 --
NM_004856chr153568 463 197 --189 --
NM_004857chr1433914 3499 1544 --33419 1185 670 --
NM_004859chr1742884 2336 2220 745 22517 2058 ----
NM_004865chr63288 166 40 ------
NM_004866chr5124974 4477 4054 3658 3488 1950 1470 1099 869 538 41 28 13665 14133 --
NM_004869chr1841517 1435 1255 1124 --1642 --
NM_004871chr1754138 3193 3126 1513 732 13155 34292 4026 3725 --
NM_004872chr11331 ------
NM_004873chr1473044 2949 2782 2316 964 711 613 23204 2426 ----
NM_004879chr111329 --1296 --
NM_004887chr52165 61 ------
NM_004888chr951017 977 385 198 136 ------
NM_004891chr2--124 ----
NM_004896chr102991 225 1261 --11319
NM_004898chr482914 2621 1989 1075 1066 760 728 646 12029 ----
NM_004902chr20--1132 --158
NM_004904chr7136356 6275 5993 5586 5208 5050 4683 4477 1253 623 498 429 338 1958 ----
NM_004906chr6--1228 ----
NM_004912chr711178 --1125 --
NM_004915chr212609 564 ------
NM_004922chr1021031 141 ------
NM_004925chr93793 184 169 142 ----
NM_004926chr1451375 708 513 389 376 ------
NM_004930chr11686 ------
NM_004932chr531541 1308 166 11341 ----
NM_004952chr14881 812 300 223 ------
NM_004956chr742874 885 430 176 --23890 737 24275 1561
NM_004958chr1199 ------
NM_004969chr102511 80 --172 --
NM_004972chr921189 399 --1408 --
NM_004976chr1185013 4477 4249 4132 3816 3244 908 633 --25107 2035 --
NM_004984chr12133 ------
NM_004985chr1263835 3619 3273 1722 1374 134 13287 11819 --
NM_004987chr22371 325 ------
NM_004992chrX148272 7403 7236 6265 5869 5196 3196 3139 3123 2946 2104 1985 1426 248 11689 ----
NM_004992chrX148272 7403 7236 6265 5869 5196 3196 3139 3123 2946 2104 1985 1426 248 11689 ----
NM_004995chr145569 505 392 192 41 ------
NM_004996chr1631628 1497 1308 ------
NM_004998chr152305 132 1780 ----
NM_004999chr674356 4270 3096 1612 920 873 291 --13866 --
NM_005010chr731953 1704 372 ------
NM_005011chr72721 97 11435 ----
NM_005012chr11121 ------
NM_005016chr121129 ------
NM_005017chr32210 46 ------
NM_005026chr132018 546 510 21844 406 11685 --
NM_005028chr1052219 1861 707 210 127 --198 --
NM_005036chr22178198 7756 7099 6995 6980 6894 6874 6208 5523 5058 3232 1738 1607 1187 422 102 24 --21976 627 --
NM_005044chrX94586 4370 4032 3637 2811 1203 1142 617 119 --1828 --
NM_005045chr72884 151 ------
NM_005054chr251334 1119 1099 549 463 11702 11341 11600
NM_005056chr1295614 5085 4947 4745 4354 3974 1213 884 700 ------
NM_005058chrY1243 ------
NM_005063chr1043263 2947 973 245 ------
NM_005065chr14154837 4600 4375 4326 4078 1970 1832 1598 1367 968 936 719 659 366 80 64704 4302 4010 801 496 22 ----
NM_005066chr11261 ------
NM_005069chr2151717 1264 719 366 297 ----1271
NM_005077chr92363 336 2138 122 2421 316 --
NM_005079chr863159 3102 3082 2487 2041 1211 11110 163 --
NM_005087chr31107 4854 595 216 175 ----
NM_005095chr152201 1709 392 373 227 11444 ----
NM_005096chrX41095 1009 854 26 1930 11026 --
NM_005109chr352543 1966 1818 1783 722 --1407 --
NM_005112chr41855 1272 --1990
NM_005113chr142436 419 ------
NM_005114chr4------1647
NM_005116chr20114351 4337 4266 4205 3584 2896 2800 1568 681 470 140 11372 ----
NM_005119chr111216 1500 ----
NM_005121chr1783627 3510 3014 2801 2733 2614 2473 818 ----12588
NM_005124chr62961 72 ------
NM_005126chr321838 1697 ------
NM_005133chr111398 --1269 --
NM_005134chr181898 1206 ----
NM_005135chr1563637 3214 2571 1023 924 431 --22763 1394 --
NM_005151chr1872431 2199 2020 1865 1779 659 598 11753 ----
NM_005156chr974384 4237 1750 1697 1611 1374 811 11106 ----
NM_005157chr961801 1479 1327 479 444 197 21681 1408 1108 --
NM_005159chr1572140 1509 805 503 84 74 25 1798 ----
NM_005168chr23632 578 140 --11483 1374
NM_005171chr1221006 379 ------
NM_005188chr11147848 7461 6842 6723 6182 5810 5221 2866 2776 1768 1619 1287 962 600 27270 7008 ----
NM_005189chr1742371 2166 1812 205 11724 32387 438 220 --
NM_005191chr331448 1262 558 1207 1106 --
NM_005194chr202570 103 ------
NM_005197chr14146153 5839 5383 5159 5071 4918 4697 4481 3957 2450 2159 2058 1681 650 --25199 4267 --
NM_005201chr31296 ----11039
NM_005203chr102101 72 ------
NM_005204chr10----1293 --
NM_005206chr171402 --11221 --
NM_005207chr22113548 3079 3058 2650 2353 2290 1171 1119 1037 819 642 --22454 413 --
NM_005210chr2121 ------
NM_005214chr22357 222 ------
NM_005215chr18143 --1584 --
NM_005222chr76944 845 298 267 251 227 ------
NM_005230chr121119 ------
NM_005233chr331788 967 492 21596 682 ----
NM_005235chr2167293 7103 6976 6919 6894 5926 5624 5412 5240 4835 2903 1522 1303 1246 638 312 46703 6623 5807 2657 26286 5604 --
NM_005238chr1142857 2431 2326 119 --12968 --
NM_005239chr2151611 1329 1302 796 776 --11832 --
NM_005240chr12631 239 ------
NM_005249chr142755 698 1361 ----
NM_005252chr14182 1705 ----
NM_005254chr1531409 1182 899 156 ----
NM_005256chr11--1738 ----
NM_005257chr1851314 1305 973 389 280 ------
NM_005259chr211006 ------
NM_005260chr51144 124 ----
NM_005261chr84857 701 211 135 1368 ----
NM_005271chr1041206 993 837 282 ------
NM_005277chr441954 1788 758 342 ----21276 480
NM_005278chrX1452 --1131 --
NM_005281chr11330 1318 ----
NM_005284chr63356 177 111 ------
NM_005296chrX1853 1290 ----
NM_005308chr10--1401 ----
NM_005311chr742614 2368 923 394 22532 351 1279 --
NM_005312chr982656 2577 2138 2096 1736 606 531 71 ------
NM_005313chr1541349 1250 1200 932 --123 --
NM_005328chr83710 243 40 ------
NM_005339chr494249 4053 3726 3602 3358 3254 3089 1162 402 11529 1628 --
NM_005342chrX1604 --1283 --
NM_005346chr62253 60 ------
NM_005348chr144938 329 277 170 1358 1386 --
NM_005349chr42497 431 --1462 --
NM_005359chr18145501 5324 5316 4776 4480 4016 1948 1719 1392 1363 1202 1118 139 89 11796 12326 --
NM_005370chr1921322 188 ------
NM_005376chr12865 195 11169 ----
NM_005378chr23855 690 170 --2285 35 1867
NM_005382chr81117 ------
NM_005385chr312732 ----1879
NM_005386chr203726 694 680 ------
NM_005392chr92272 106 --21408 714 --
NM_005398chr1031462 1103 1040 --11146 --
NM_005400chr262775 2316 2275 2169 723 23 11884 ----
NM_005402chr731729 1586 438 2398 29 ----
NM_005406chr181360 ------
NM_005415chr23721 660 44 ------
NM_005417chr2032004 1251 557 --11484 --
NM_005433chr1862579 2472 1919 965 743 151 ------
NM_005435chr71203 ------
NM_005436chr1063286 3131 1241 1204 973 653 14026 11159 --
NM_005437chr103991 548 270 21353 1136 ----
NM_005442chr3--1539 --1111
NM_005445chr101294 ------
NM_005455chr161685 1610 704 463 376 125 ------
NM_005458chr93960 896 385 ------
NM_005465chr161629 791 336 145 101 33 ----11429
NM_005475chr1243320 2984 2929 2493 12828 13180 --
NM_005476chr94347 163 138 117 --1434 --
NM_005477chr1562559 1922 1787 987 683 471 32075 1639 1038 1703 --
NM_005477chr1562559 1922 1787 987 683 471 32075 1639 1038 1703 --
NM_005479chr102414 200 --2510 441 --
NM_005483chr19----191 --
NM_005487chr2242008 1975 858 176 --1687 --
NM_005493chr63778 618 197 ------
NM_005494chr7----1242 --
NM_005497chr1756133 4200 2024 1387 438 --45504 5162 4260 2461 --
NM_005501chr172436 96 ----1412
NM_005502chr963085 2565 2395 2375 550 308 ----12871
NM_005504chr12105531 5024 4366 2437 2175 1934 949 847 776 217 22393 1608 12028 --
NM_005509chr541395 1214 624 481 ------
NM_005522chr73524 352 196 ------
NM_005524chr31119 ------
NM_005539chr1021091 873 ------
NM_005542chr721548 1262 1332 ----
NM_005561chr132795 84 --1133 --
NM_005563chr11245 ------
NM_005573chr5----1190 --
NM_005574chr113625 62 21 --185 --
NM_005575chr53809 712 163 1264 ----
NM_005576chr152242 193 ------
NM_005578chr384338 3932 3196 1213 893 795 307 120 1203 ----
NM_005591chr1121008 902 --21125 160 1778
NM_005593chr123553 143 135 ------
NM_005596chr9126075 4929 4550 4492 3964 2521 2433 1798 1676 1490 1345 39 11496 12093 --
NM_005598chr131356 675 95 --21290 620 --
NM_005599chr1--1329 ----
NM_005603chr182242 71 --1542 --
NM_005604chr642477 1710 734 726 ------
NM_005607chr82366 349 11038 --1171
NM_005613chr172206 1818 1694 879 844 759 573 ----1818
NM_005625chr861040 960 813 399 338 165 ------
NM_005626chr1----1429 --
NM_005630chr311255 143 ----
NM_005632chr16159 ------
NM_005637chr1842045 774 398 118 ------
NM_005638chrX51296 407 357 137 126 11361 ----
NM_005639chr121503 ------
NM_005644chr11375 ------
NM_005647chrX63346 2224 1277 864 525 510 12880 43411 3104 1296 905 --
NM_005650chr2241390 1272 1241 376 ------
NM_005655chr851322 1073 918 469 34 --1813 --
NM_005665chr184406 3958 3858 3646 3592 1671 797 476 13698 ----
NM_005668chr584370 4346 4143 4097 3023 2823 1293 380 11758 1904 --
NM_005688chr341293 950 150 92 --11315 --
NM_005711chr511062 ------
NM_005715chr642573 1001 800 718 --1248 --
NM_005717chr111060 ------
NM_005721chr2--1400 ----
NM_005722chr231726 503 297 22432 669 11752 --
NM_005724chr152556 547 ------
NM_005734chr111152 1134 ----
NM_005736chr1041228 1211 352 45 ------
NM_005737chr222250 785 --22625 490 12292
NM_005738chr751666 786 606 347 156 32069 1645 1486 11404 --
NM_005746chr732569 1854 693 ------
NM_005748chr1253432 2648 2642 2318 278 --12710 --
NM_005749chr171470 ------
NM_005751chr71345 ------
NM_005754chr541107 487 279 79 --1912 --
NM_005756chrX31283 304 60 11252 ----
NM_005759chr2114743 4302 4289 4166 3673 3624 3257 3129 969 907 122 --11808 --
NM_005761chr12----1114 --
NM_005768chr122675 666 ------
NM_005779chr542636 1396 703 41 12352 ----
NM_005780chr13176 ------
NM_005781chr31558 --1204 --
NM_005783chr21599 ------
NM_005786chr182971 120 ------
NM_005789chr1752171 2050 730 567 57 21652 548 12179 1541
NM_005795chr232446 725 646 --1748 22152 472
NM_005797chr1121750 724 11358 1558 --
NM_005802chr92606 205 1678 ----
NM_005808chr332348 728 463 13351 12779 --
NM_005813chr252555 1750 686 583 273 ----1832
NM_005819chr183315 3238 3145 2814 2602 1358 357 280 --13335 --
NM_005826chr12535 93 ------
NM_005828chr1785074 4397 4148 1803 1640 719 572 478 13798 24460 687 13889
NM_005832chr331291 1224 562 ------
NM_005833chr92164 116 ------
NM_005836chr8166 ------
NM_005839chr11865 ------
NM_005840chrX146715 5697 5343 5069 4644 3014 2612 2139 2077 1500 998 736 171 69 --11516 12588
NM_005842chr132676 89 ------
NM_005843chr241809 723 616 521 ------
NM_005848chr15163 ------
NM_005852chr1761063 928 398 271 193 90 1209 ----
NM_005859chr521426 221 ------
NM_005862chr3189 ------
NM_005871chr10148 ------
NM_005880chr1621601 189 --1600 --
NM_005885chr551256 659 315 272 243 --1395 --
NM_005895chr1243231 1051 996 458 ------
NM_005896chr23545 277 180 ------
NM_005898chr1173162 3154 3084 2380 764 687 231 32699 2622 1149 --1225
NM_005899chr171194 ------
NM_005900chr43353 266 41 21235 99 1173 --
NM_005901chr18148636 8629 8263 7613 7554 7301 6840 6367 5536 3307 3215 2539 2340 1513 27741 7518 43471 3034 2377 144 --
NM_005902chr1594469 4434 4348 3020 2863 1471 1271 1232 537 13084 1395 31798 719 227
NM_005903chr575203 3704 3689 3351 942 854 775 21776 63 21968 1333 --
NM_005904chr18156 --11373 --
NM_005906chr651693 1468 1382 1355 653 2576 544 21500 391 --
NM_005907chr631646 1308 49 21411 91 ----
NM_005909chr583517 2922 2826 2708 1289 678 69 37 11670 ----
NM_005910chr17104049 3785 3675 3425 3300 2648 2606 1484 494 206 22579 840 1978 --
NM_005911chr241506 1256 961 561 ------
NM_005920chr153315 3290 2752 2597 1264 --1293 --
NM_005923chr61104 ------
NM_005924chr71884 ------
NM_005930chr142585 85 ------
NM_005933chr1152789 2267 1861 1186 672 12851 11999 12611
NM_005934chr1932444 312 143 1971 12328 --
NM_005935chr4175265 5105 4838 4820 4690 4562 3918 3802 3750 3599 3555 3349 2087 1533 560 227 28 21871 1428 ----
NM_005937chr1784100 3856 3740 3293 1473 1318 936 447 34031 3385 106 13797 --
NM_005941chr844115 3300 1379 832 12815 ----
NM_005944chr32495 343 ------
NM_005955chr1114835 4054 3980 3722 3586 3501 1911 1683 1577 260 122 ------
NM_005962chr1041696 1470 943 461 12333 11735 --
NM_005962chr1041696 1470 943 461 12333 11735 --
NM_005966chr252334 2023 1727 1719 411 ------
NM_005968chr19--1237 1215 --
NM_005977chr131281 ------
NM_005994chr171897 ------
NM_006007chr963118 2902 1697 1370 871 30 13226 13080 --
NM_006011chr1594183 4154 4143 3690 1684 1207 716 323 275 13275 --11591
NM_006016chr632206 2196 626 22093 871 ----
NM_006022chr13--1929 1844 --
NM_006023chr101168 ------
NM_006035chr14----1108 --
NM_006037chr2104894 4837 4305 4258 4146 3574 3492 3175 3140 1681 23824 1202 34371 3372 472 --
NM_006040chr161903 --1468 --
NM_006042chr174508 477 399 152 ------
NM_006043chr163695 637 276 --1133 --
NM_006047chr2093493 3349 3162 2441 2227 2212 2197 850 518 1681 ----
NM_006054chr1151632 1304 1063 448 254 ------
NM_006055chr232722 1159 988 ------
NM_006076chr73591 479 98 ----11039
NM_006079chr66588 347 329 297 177 91 2212 102 ----
NM_006080chr722457 236 ------
NM_006084chr141311 ------
NM_006089chrX41600 1485 483 156 21611 1562 --11214
NM_006090chr11631 1492 1186 --
NM_006094chr842376 1775 976 927 2694 197 ----
NM_006095chr464207 3782 3565 706 471 260 34375 4013 3765 ----
NM_006106chr1163438 3351 3147 2971 1332 891 53260 2658 2373 2100 592 ----
NM_006107chr171345 1353 ----
NM_006113chr162067 1988 1968 1777 548 365 --12124 --
NM_006116chr2231608 539 187 --11145 11486
NM_006134chr2121399 1371 --31546 363 291 --
NM_006136chr721256 460 ------
NM_006139chr242295 2200 2172 795 12267 1862 --
NM_006141chr1682757 2499 2408 2153 2061 1981 620 306 1831 ----
NM_006145chr1921014 745 --1708 --
NM_006148chr1732824 2668 2241 ------
NM_006154chr1572905 2010 787 637 573 544 174 42935 867 115 58 ----
NM_006159chr121652 ------
NM_006161chr51247 ------
NM_006164chr21191 ------
NM_006166chr1252428 1750 1638 893 468 --12070 12098
NM_006180chr971963 1877 1833 777 488 426 66 ------
NM_006182chr11177 ------
NM_006186chr21431 1966 --11072
NM_006194chr1421077 881 1113 ----
NM_006195chr931150 212 115 137 1970 --
NM_006197chr822241 1771 1191 ----
NM_006202chr1941981 1551 697 373 ----11938
NM_006203chr564540 1967 1685 888 754 208 35236 5129 133 14138 --
NM_006206chr462763 2292 594 284 184 67 ------
NM_006216chr2271 41 ------
NM_006218chr3--1269 ----
NM_006224chr1762480 2419 1945 1613 405 24 11841 12459 11639
NM_006241chr342401 2277 2250 859 ------
NM_006243chr11969 ------
NM_006246chr144516 499 218 108 ------
NM_006247chr191117 ------
NM_006251chr553192 3131 2735 2413 2095 --1525 --
NM_006252chr1117296 7192 6425 5639 2905 2729 2719 2095 1945 788 169 56751 5364 2680 1468 655 56401 4897 3008 2990 1767 --
NM_006253chr1211285 --1921 11261
NM_006256chr172586 2362 1922 1710 1034 350 316 --22208 888 --
NM_006258chr1051359 591 349 282 28 ------
NM_006264chr41590 --1572 --
NM_006265chr821213 170 ------
NM_006267chr25576 561 265 170 147 21781 1657 ----
NM_006275chr2052481 1642 836 819 39 22449 218 --12370
NM_006278chr111371 ------
NM_006281chr811015 1292 --11132
NM_006281chr811015 1292 --11132
NM_006282chr20104339 3389 3265 2893 1786 1516 1337 1312 608 114 13571 13321 1176
NM_006283chr864412 4118 3277 1126 313 66 ------
NM_006287chr232163 638 171 22504 1901 ----
NM_006292chr111174 ------
NM_006298chr6103216 2187 2086 1280 1162 1056 966 646 299 170 ------
NM_006313chr123606 578 33 11548 --11135
NM_006315chr474356 3181 3060 617 580 295 252 23436 2756 11464 --
NM_006317chr51263 ------
NM_006321chr33899 713 174 ------
NM_006325chr123849 621 289 ------
NM_006328chr113205 179 93 ------
NM_006330chr841405 1145 1047 1024 11541 ----
NM_006335chr11138 ------
NM_006345chr45523 444 324 314 35 ------
NM_006357chr24441 434 180 43 ------
NM_006359chrX52396 2219 1860 1829 540 12112 ----
NM_006364chr1441029 1023 478 356 ------
NM_006366chr64823 484 398 330 ------
NM_006367chr13926 696 88 ------
NM_006370chr14--137 ----
NM_006371chr3105149 4291 4113 3815 3518 1491 558 518 458 218 24857 1547 1928 --
NM_006372chr62384 368 1456 ----
NM_006375chrX31347 534 319 ------
NM_006377chr921227 346 --1917 --
NM_006379chr752189 1997 1824 722 258 ------
NM_006380chr1783297 3268 2921 1639 1620 529 150 28 ------
NM_006386chr2241695 1655 1635 83 11629 12455 --
NM_006389chr1111358 ------
NM_006393chr1053818 2793 1713 1379 961 24450 903 23121 363 --
NM_006416chr61695 ------
NM_006420chr2033279 2669 2623 --1105 --
NM_006430chr21410 --167 --
NM_006451chr541038 837 729 682 11078 --1827
NM_006457chr453326 2923 817 339 276 --21175 561 --
NM_006459chr1041998 1494 748 566 11968 ----
NM_006464chr241675 1521 509 94 1575 21389 236 --
NM_006467chr55715 610 456 416 169 ----1149
NM_006469chr141434 1253 1119 219 ------
NM_006471chr18----143 --
NM_006472chr17989 842 802 471 388 113 69 1396 11200 --
NM_006475chr132271 228 ----1247
NM_006476chr113696 642 567 ----1507
NM_006482chr1283950 3344 3281 2975 2521 1294 1019 532 --11120 --
NM_006486chr223677 647 222 ------
NM_006489chr142219 73 ------
NM_006496chr141886 1606 725 57 ----1478
NM_006504chr10102847 2648 2471 2307 2187 2040 1102 653 402 294 12943 ----
NM_006516chr111208 11086 ----
NM_006517chrX41600 1548 776 483 --1712 --
NM_006519chr61109 ------
NM_006529chr421531 679 1333 ----
NM_006534chr2073352 2859 2640 1016 720 328 317 --21303 95 --
NM_006536chr13960 953 682 1378 1193 --
NM_006537chr15196 ------
NM_006538chr284129 3024 2718 846 738 675 320 163 ----11219
NM_006540chr831587 1452 247 11406 ----
NM_006541chr101202 ------
NM_006544chr1475371 4876 4249 4028 752 158 97 15227 ----
NM_006546chr17105559 5168 5110 4793 4781 1994 1464 1101 722 248 46456 6235 6057 5674 14057 --
NM_006558chr82321 140 ------
NM_006559chr12286 144 --11094 --
NM_006560chr112155 147 1499 ----
NM_006561chr10146255 4402 4178 4124 2153 2116 1858 1841 1569 1334 675 608 578 51 --25673 5642 --
NM_006565chr1641097 973 801 60 ------
NM_006571chr81110 ------
NM_006574chr3--1298 ----
NM_006575chr142990 423 ------
NM_006584chr17150 ------
NM_006591chr1121404 205 --11797 --
NM_006593chr22829 218 ------
NM_006595chr1131802 809 187 1277 12020 1335
NM_006599chr16167841 7421 7264 6895 6347 5881 5819 5710 5616 5447 3221 946 936 885 196 54 15982 12511 --
NM_006601chr121432 --11063 --
NM_006602chr202229 62 1144 ----
NM_006603chrX21981 520 ------
NM_006609chr282309 2218 2053 2030 963 271 71 54 1682 ----
NM_006614chr3103541 3476 2781 2532 2252 1275 1067 843 680 409 ------
NM_006618chr141452 518 303 196 --1479 --
NM_006621chr141490 366 331 305 ------
NM_006622chr51183 ------
NM_006624chr1061822 798 738 643 439 121 21461 415 ----
NM_006625chr131021 416 200 ------
NM_006625chr131021 416 200 ------
NM_006625chr131021 416 200 ------
NM_006626chr962303 2250 1946 753 431 211 32634 1827 1082 --12338
NM_006628chr15144558 4256 3981 3499 2970 1856 1815 1645 1331 969 706 650 399 329 ------
NM_006631chr193257 175 99 ----1624
NM_006633chr52544 256 ------
NM_006644chr133676 649 189 ------
NM_006646chr1373074 2489 2141 1060 992 980 100 --12946 --
NM_006654chr12124770 4609 4105 3830 3720 3372 1544 1221 729 310 137 30 ------
NM_006675chr1273336 3156 2949 1240 1135 780 494 --1335 --
NM_006682chr762445 2253 2225 768 77 64 --1363 --
NM_006690chr2031765 1754 1507 ------
NM_006695chr17----274 46 --
NM_006699chr162635 2305 2088 1683 911 449 31006 831 164 1351 --
NM_006703chr61461 ------
NM_006706chr52788 740 1239 1155 --
NM_006710chr22675 29 --1747 --
NM_006711chr165793 758 669 328 62 ------
NM_006713chr51202 ------
NM_006717chr953238 2366 782 670 603 12064 ----
NM_006720chr1063776 1663 1585 796 490 259 14623 14263 --
NM_006721chr103834 571 288 ------
NM_006722chr352698 2454 2366 990 678 --12331 --
NM_006726chr41912 11069 ----
NM_006729chrX105357 5143 4731 4140 3830 3798 3601 2013 1962 1189 23444 1923 35585 4195 1065 1467
NM_006731chr995779 5524 5369 4942 3877 3780 2328 2309 2265 2800 501 12080 --
NM_006734chr631286 494 258 ------
NM_006735chr71295 ------
NM_006738chr15124233 4208 4005 3908 3740 3224 3054 2950 1536 1311 1181 878 11746 ----
NM_006745chr421065 143 11058 --11094
NM_006746chrX21360 1246 ----11140
NM_006748chr83591 151 66 --11738 --
NM_006750chr16138088 7585 7177 6805 5770 3157 2947 2925 2195 667 610 179 165 32349 401 28 17475 --
NM_006751chr22795 250 --184 --
NM_006754chr72295 129 1437 11201 164
NM_006755chr111164 ------
NM_006756chr831491 299 124 ------
NM_006759chr22257 217 ----1297
NM_006763chr142131 1955 1924 1502 --21866 1782 --
NM_006764chr3197 ------
NM_006766chr862644 2530 2342 1912 1793 1744 32302 969 213 ----
NM_006769chr12129 89 --1263 --
NM_006773chr23547 325 33 21343 469 --124
NM_006775chr683102 2980 2794 2518 2053 2007 288 85 --12078 --
NM_006777chrX72826 2589 676 669 653 372 343 ------
NM_006783chr131508 ----1240
NM_006788chr1831489 471 53 --21798 767 --
NM_006793chr102616 24 --1217 --
NM_006800chrX2597 215 --1117 --
NM_006805chr541627 399 275 101 ------
NM_006806chr212317 173 ------
NM_006807chr1731314 1138 1092 1996 1243 --
NM_006811chr204985 732 304 67 ------
NM_006815chr1241280 991 537 155 1462 21234 54 --
NM_006818chr13691 682 88 --2919 29 --
NM_006823chr811171 ------
NM_006827chr1433270 3108 2787 --129 --
NM_006836chr122193 39 1581 ----
NM_006838chr1261868 1778 1667 1375 608 28 21599 752 ----
NM_006846chr5161 ------
NM_006851chr1292947 2911 2747 2266 1951 1888 872 643 176 --12106 --
NM_006852chr1762761 2376 2205 2108 205 184 ------
NM_006854chr771994 1981 1912 1872 1598 1493 1337 --1184 --
NM_006861chr1222057 398 --11564 --
NM_006870chr203341 318 116 --2655 555 --
NM_006877chr62335 266 ------
NM_006884chr351786 1743 1666 1432 371 --21983 151 --
NM_006885chr1664167 3506 2587 1090 1063 732 12983 2523 414 --
NM_006888chr1492835 2321 1383 1338 1192 1037 711 244 144 13425 ----
NM_006892chr2061425 1366 1264 1188 1029 970 ------
NM_006892chr2061425 1366 1264 1188 1029 970 ------
NM_006908chr73921 371 322 ------
NM_006912chr142460 1779 830 748 12322 21700 899 --
NM_006914chr92616 597 ------
NM_006915chrX4841 549 402 73 ------
NM_006918chr1195632 4647 4409 4154 3678 2333 1398 979 862 --24578 1486 --
NM_006920chr261516 1444 1292 686 413 331 1200 ----
NM_006922chr252333 1791 863 837 307 ------
NM_006924chr1774241 3381 3048 2839 986 641 342 --13885 --
NM_006937chr171406 ------
NM_006940chr1231633 707 560 ------
NM_006943chr2042205 974 937 393 --23343 1119 --
NM_006947chr441717 395 306 148 --1244 --
NM_006950chrX4735 685 581 69 1153 ----
NM_006981chr952875 2678 2150 737 290 ------
NM_006983chr1121 ------
NM_006988chr2121287 94 ------
NM_006990chr152480 1977 720 399 24 12210 22465 1959 --
NM_006991chr31859 ----1178
NM_006997chr102482 98 ------
NM_006999chr532092 1294 165 --11376 --
NM_007005chr91554 --147 --
NM_007006chr1652301 1135 567 320 129 ------
NM_007007chr1284820 4721 1691 1550 1244 721 585 24 14203 11557 23956 391
NM_007008chr24586 293 192 33 189 1318 --
NM_007010chr1731294 1256 763 21451 537 1567 --
NM_007011chr1596760 6551 6244 5784 2644 2059 1952 1249 780 --25418 4271 26234 1480
NM_007013chr83890 792 364 1742 ----
NM_007023chr23894 316 261 ----1422
NM_007030chr574955 4633 4447 4146 3467 959 376 --14659 --
NM_007033chr142063 922 867 370 22011 1493 11675 --
NM_007034chr12717 333 ------
NM_007036chr51820 1362 ----
NM_007038chr21105846 5577 5392 4920 4867 4060 2335 1849 416 196 25713 5475 15487 11893
NM_007039chr1471494 856 656 529 482 438 232 ------
NM_007040chr193732 689 272 ------
NM_007042chr3132363 2289 2202 1760 1750 1666 1652 780 734 334 284 210 147 --1920 --
NM_007050chr20168025 7714 7650 7590 7048 5803 5318 2886 2646 2389 2248 1524 1448 1344 278 161 46417 1778 1217 633 --21849 1185
NM_007052chrX2546 88 1117 ----
NM_007054chr542871 959 944 682 --11203 --
NM_007064chr321709 653 11244 ----
NM_007067chr1711245 --2519 507 --
NM_007068chr221361 --1699 182
NM_007073chr663766 3313 1178 960 228 69 21626 1432 1814 --
NM_007078chr1021888 1115 1566 22562 2472 --
NM_007084chr131586 ------
NM_007099chr21135 --2662 254 --
NM_007107chr311541 12175 ----
NM_007111chr131872 ------
NM_007124chr661617 1598 1433 1263 429 391 ------
NM_007125chrY1362 11301 ----
NM_007144chr172929 53 --31238 491 105 --
NM_007146chr1792028 1919 1808 1155 1136 864 527 351 199 ------
NM_007150chrX32115 2020 574 1709 1289 --
NM_007157chrX31991 1095 781 1157 12649 --
NM_007158chr16886 379 360 335 234 142 --1301 --
NM_007166chr1151593 1545 1535 1185 1080 ------
NM_007173chr1142427 2062 690 616 2508 317 1426 11887
NM_007174chr1232400 2332 2194 1684 1245 22385 33
NM_007175chr873138 3048 2836 2797 2578 700 88 --42768 2317 1231 611 --
NM_007187chr131892 ------
NM_007192chr145992 922 829 320 289 ------
NM_007197chr12----1927 --
NM_007200chr15124233 4208 4005 3908 3740 3224 3054 2950 1536 1311 1181 878 11746 ----
NM_007202chr17--1720 ----
NM_007207chr15934 859 803 356 141 ------
NM_007210chr12--1564 2750 357 --
NM_007212chr12869 93 1877 ----
NM_007214chr641325 1301 530 164 --11351 --
NM_007218chr82350 78 1612 ----
NM_007229chr222328 288 ------
NM_007242chr162240 206 ------
NM_007245chr16------2655 349
NM_007246chr441030 791 675 104 21069 304 1840 --
NM_007249chr13208601 8578 8415 8385 7877 7726 7277 6976 6948 6876 6667 6504 5878 5780 5733 3474 2554 2118 1882 333 16380 29426 3696 --
NM_007271chr651695 1558 1398 1292 590 ------
NM_007275chr31372 --1853 --
NM_007276chr711053 21010 184 ----
NM_007280chr152415 127 ------
NM_007282chr331022 980 781 ------
NM_007292chr17134975 4968 4949 4872 4370 4014 3962 3878 3810 3411 1542 1290 1149 --43272 1743 1186 797 --
NM_007313chr961801 1479 1327 479 444 197 21681 1408 1108 --
NM_007324chr1171 ------
NM_007331chr462539 2315 1849 769 723 191 11725 ----
NM_007332chr851543 1400 1346 1258 152 1234 --1585
NM_007345chr1841770 1477 1448 21 1565 ----
NM_007346chr201350 ------
NM_007347chr1542651 2060 1984 1125 11053 ----
NM_007349chr73426 331 164 1380 ----
NM_007358chr121498 432 ------
NM_007359chr1741204 1122 610 216 ------
NM_007363chrX3903 814 794 1302 1335 --
NM_007372chr174854 573 349 267 1840 ----
NM_007373chr1021215 1150 ------
NM_007375chr131949 1878 786 12378 ----
NM_012069chrX32575 2460 127 11723 ----
NM_012074chr143819 396 49 --11053 --
NM_012081chr573770 3179 2971 2381 1495 154 94 ----23483 2990
NM_012083chr10----1111 --
NM_012090chr141230 1164 826 365 11304 --137
NM_012095chr1052663 2541 876 666 399 --23033 1319 --
NM_012096chr353599 2982 2573 1284 1038 12621 ----
NM_012097chr242046 1891 1500 169 21578 1439 ----
NM_012102chr142446 2081 914 278 12531 ----
NM_012104chr1132685 1421 381 1140 23352 59 --
NM_012104chr1132685 1421 381 1140 23352 59 --
NM_012120chr672632 2453 2409 2206 2046 925 233 ------
NM_012124chr112825 175 ------
NM_012134chr141464 1330 1226 179 --11390 --
NM_012137chr142733 2131 912 552 11172 --21131 513
NM_012141chr13153332 3256 3101 2714 1380 1083 1070 854 823 769 606 495 372 348 75 ------
NM_012153chr1132385 2001 317 12152 --11697
NM_012156chr2073298 3121 2579 2432 2269 1268 653 1630 ----
NM_012157chr34979 618 205 171 ------
NM_012158chr1341794 1787 1683 24 11282 --11864
NM_012161chr441064 926 792 61 --11090 --
NM_012164chr9177487 7471 6433 6124 5800 5728 5678 5521 5383 2576 2454 2271 2166 1218 608 280 31 ------
NM_012175chr112632 272 1599 ----
NM_012180chr4--1552 ----
NM_012183chr12610 163 ------
NM_012193chr11164896 4686 4442 4415 3991 3887 3666 2025 1591 1562 993 820 553 521 262 192 15231 11748 --
NM_012197chr931203 44 26 11224 1518 --
NM_012199chr1114560 4427 3994 3951 1517 1457 1004 822 662 623 123 11773 1233 --
NM_012207chr10--1191 ----
NM_012214chr2105282 5179 4863 4661 4591 4340 4195 4045 3939 1974 --36090 5612 1295 24329 3960
NM_012215chr1041778 1328 602 372 11364 148 2767 157
NM_012218chr1952840 2595 1093 233 28 12765 --22327 2204
NM_012223chr211117 ------
NM_012224chr411112 1325 1472 --
NM_012229chr101287 --11026 --
NM_012234chr343699 3400 2543 195 --12318 12996
NM_012238chr101427 ------
NM_012242chr101130 1327 ----
NM_012249chr273172 2876 2532 2326 1331 1005 798 12441 1866 --
NM_012250chr1171325 1144 1073 988 945 84 47 --174 --
NM_012252chr765344 5303 4056 3952 2117 394 ------
NM_012255chr201107 ------
NM_012257chr72860 831 ------
NM_012259chr611406 ------
NM_012261chr20169 --178 --
NM_012262chr151925 1421 1249 460 55 24527 1504 --21375 1293
NM_012264chr2242041 1925 469 112 --11615 --
NM_012264chr2242041 1925 469 112 --11615 --
NM_012266chr91905 ----11085
NM_012281chr731887 717 229 ------
NM_012286chrX148 ------
NM_012287chr354013 3721 3108 2959 1192 23060 775 23317 354 --
NM_012288chr6135136 5065 4870 4328 2224 2122 1771 1742 1303 1226 373 367 303 11010 34129 2173 1394 1591
NM_012294chr784044 4038 3691 3011 2880 2709 1539 396 11633 21365 616 140
NM_012297chr452511 2014 544 407 129 --12474 --
NM_012300chr542154 1944 1001 724 --1377 --
NM_012302chr14926 430 183 145 ------
NM_012308chr1152490 2439 2125 2039 1793 11874 ----
NM_012309chr1194854 4736 4276 4249 4221 4203 4076 3617 3366 ----24516 982
NM_012316chr1105223 4920 4035 3933 1509 857 535 437 330 201 12040 34962 4649 2149 13723
NM_012322chr7175 1384 ----
NM_012325chr2041127 1057 502 192 --1142 --
NM_012326chr21819 ------
NM_012327chr181629 1986 ----
NM_012328chr751494 1385 946 485 105 ------
NM_012329chr1721615 1054 --1452 --
NM_012330chr1041531 1397 213 64 21591 543 ----
NM_012333chr131390 601 249 --1515 --
NM_012342chr104524 136 101 72 ------
NM_012343chr511113 ------
NM_012383chr92162 59 ------
NM_012388chr1563017 2660 1235 721 597 429 1241 ----
NM_012399chr2231272 653 112 ------
NM_012405chr143553 2432 2361 24 13006 ----
NM_012408chr20194 ------
NM_012416chr93396 243 197 1989 ----
NM_012417chr171601 ------
NM_012420chr1031951 438 171 1463 ----
NM_012421chr11430 ------
NM_012428chr151380 1817 ----
NM_012433chr22250 45 ------
NM_012443chr103777 625 117 ------
NM_012444chr201326 ------
NM_012448chr1751923 1623 667 309 35 1378 11992 --
NM_012454chr6------1232
NM_012461chr141760 ----1526
NM_012464chr462628 994 624 444 437 381 21934 615 --12163
NM_012471chrX41645 465 227 136 11875 1339 11953
NM_012475chr11250 ------
NM_013229chr1262796 2305 572 255 191 183 12371 1817 --
NM_013230chrY41619 584 124 41 21220 324 ----
NM_013231chr14104389 3802 3545 3458 1608 1453 1406 1188 1080 752 11392 34352 1380 341 --
NM_013246chr111666 --150 --
NM_013247chr21162 ------
NM_013255chr7158781 8078 7248 7101 5460 2882 2542 2126 2116 1922 1625 1476 1432 1106 917 1744 1447 --
NM_013261chr443328 2517 2301 938 --11393 --
NM_013262chr631241 1047 330 ------
NM_013269chr1244200 1396 602 480 2746 393 ----
NM_013272chr151147 1258 ----
NM_013277chr123776 697 240 --2912 202 --
NM_013279chr1141900 1614 686 418 1784 ----
NM_013281chr2021241 295 11322 1415 --
NM_013282chr1921308 428 ------
NM_013286chr373822 3220 3076 2359 1474 953 498 --21160 85 --
NM_013293chr72137 115 ----1223
NM_013314chr10141 ------
NM_013323chr171770 --2445 407 --
NM_013351chr172730 505 ------
NM_013354chr82432 96 ------
NM_013357chr82819 620 ------
NM_013358chr12670 371 --1111 --
NM_013361chr193702 502 180 ------
NM_013372chr1543267 1034 833 326 12899 12583 --
NM_013374chr342796 2771 2562 948 ------
NM_013377chr121179 --1468 --
NM_013382chr1422108 903 1481 21974 507 --
NM_013386chr12603 475 11616 11706 --
NM_013390chr951421 1385 1089 255 173 --1380 --
NM_013396chr212288 268 ------
NM_013433chr1952037 1749 1623 1308 662 11911 ----
NM_013436chr23742 78 44 ------
NM_013437chr831299 921 362 11424 1402 --
NM_013438chr941602 626 412 253 ------
NM_013444chrX2766 207 ------
NM_013446chr751440 1372 1273 1012 160 ------
NM_013447chr1942853 1380 248 88 12319 1887 --
NM_013449chr1282908 2714 2267 1944 1152 707 129 45 --126 --
NM_013450chr231061 873 391 1505 ----
NM_013951chr221919 176 ----12397
NM_013952chr221996 253 ----12474
NM_013953chr221996 253 ----12474
NM_013989chr1474932 4074 3509 3219 1627 1120 400 25146 1264 ----
NM_013992chr221996 253 ----12474
NM_013999chr173515 150 108 --11518 --
NM_014000chr1031788 1478 493 ----1184
NM_014001chr1711525 --1648 130
NM_014002chr12709 152 ------
NM_014016chr341309 1292 1260 445 1172 1124 --
NM_014023chr1031842 939 732 1806 32251 2150 970 --
NM_014028chr653161 3042 2425 2347 655 1398 12114 --
NM_014034chr621257 1066 11385 ----
NM_014038chr7143 --1360 --
NM_014043chr341353 1147 632 334 ------
NM_014048chr1694964 4681 4539 4022 3231 2025 517 371 285 --24324 3590 --
NM_014089chr1331741 880 168 --2546 438 --
NM_014109chr871215 1080 429 417 342 206 96 1465 ----
NM_014112chr855186 4791 4307 1037 228 --1257 14900
NM_014117chr1642755 1954 1818 91 1831 1648 --
NM_014149chr73855 805 771 ------
NM_014154chr321036 308 11060 --1263
NM_014155chr1187362 6167 6158 5902 1920 875 139 54 ------
NM_014157chr1683989 3813 3701 3613 1487 1355 837 541 12844 1870 --
NM_014166chr1341083 858 817 751 ------
NM_014171chr22303 264 2654 51 ----
NM_014176chr12121 22 167 ----
NM_014181chr252855 2791 2686 2650 278 12777 --11965
NM_014190chr451761 1221 1180 685 48 ------
NM_014191chr122843 387 11033 --1161
NM_014212chr121655 1276 ----
NM_014216chr1411604 11320 11152 11467
NM_014217chr141282 597 208 175 ------
NM_014233chr1771885 1674 1667 1523 1422 114 65 21873 1391 ----
NM_014240chr352678 2591 1239 1148 739 --22999 1604 13711
NM_014241chr10184 ------
NM_014243chr441848 588 377 150 11862 11498 --
NM_014245chr341123 301 150 52 ------
NM_014249chr151519 ------
NM_014250chr2242008 1975 858 176 --1687 --
NM_014252chr132369 142 ------
NM_014253chrX42451 1699 1591 276 22487 2358 ----
NM_014263chr1021326 523 ------
NM_014264chr42594 217 ------
NM_014265chr82779 605 1146 ----
NM_014267chr113805 274 161 ------
NM_014271chrX2619 219 ------
NM_014278chr43383 105 58 ------
NM_014279chr91959 1103 ----
NM_014282chr921202 134 --11232 --
NM_014283chr171305 1266 1228 441 352 165 133 ------
NM_014284chr12946 62 ------
NM_014289chrX31282 1189 1047 ------
NM_014293chr2254107 3988 2692 1531 974 --43535 3477 1456 42 --
NM_014296chr331346 1013 594 11547 21198 470 --
NM_014300chr151466 ------
NM_014309chr2265010 4331 4066 3660 1208 631 --21318 1175 --
NM_014317chr10--1242 171 --
NM_014319chr1221768 1751 --21694 1518 --
NM_014323chr2221034 827 ------
NM_014325chr1231484 892 463 ------
NM_014331chr4157713 7643 7110 6394 6343 6235 5581 5361 5284 2818 1725 1225 772 96 21 15883 25610 1382 1565
NM_014332chrX2396 373 ------
NM_014333chr1152537 2520 2258 1000 300 ------
NM_014342chr1141473 963 504 113 --21095 289 --
NM_014344chr112836 777 1599 ----
NM_014345chr62776 123 --2826 281 --
NM_014350chr51994 11034 ----
NM_014360chr143578 204 37 ------
NM_014363chr131268 132 ----
NM_014372chr152044 1938 1723 1579 249 1213 ----
NM_014376chr552563 2136 1945 1810 516 ----11700
NM_014382chr331631 1146 286 1186 ----
NM_014388chr1164977 4971 4708 4493 4420 4308 2225 1979 1131 867 765 689 521 444 205 142 ------
NM_014392chr421377 222 21088 55 1630 --
NM_014393chr831988 503 417 1868 ----
NM_014399chr75673 297 114 48 40 1734 ----
NM_014415chr321713 274 21356 1188 ----
NM_014421chr452090 1653 1581 1542 516 ------
NM_014423chr5105318 4915 4213 4131 3639 3521 3490 1434 1334 427 ----13655
NM_014429chr31643 1504 ----
NM_014445chr361997 1510 934 638 427 195 ------
NM_014447chr441430 1083 558 422 ------
NM_014452chr641089 982 819 341 --2859 433 --
NM_014454chr641025 982 896 400 ------
NM_014456chr1031858 512 253 --11468 --
NM_014458chr171336 1307 1117 1041 947 305 57 ------
NM_014469chr111112 ------
NM_014488chr112536 525 ------
NM_014494chr1662308 2173 1907 1877 1867 518 21502 505 1126 2738 700
NM_014498chr31323 ------
NM_014503chr121423 ------
NM_014506chr941697 1064 109 57 ------
NM_014515chr1221019 865 ------
NM_014517chr351933 1230 638 527 372 ------
NM_014521chr231720 1686 255 --1450 --
NM_014554chr1292198 2027 2013 1641 786 527 346 201 71 126 1278 12098
NM_014572chr1341786 1172 694 168 21198 318 ----
NM_014574chr1431129 979 151 ------
NM_014577chr222807 252 1719 1789 --
NM_014585chr251207 1172 1138 1115 420 1122 ----
NM_014586chr2174426 4178 3767 3476 1655 1543 1201 --33605 3157 1846 --
NM_014592chr52114 54 --1124 --
NM_014600chr221403 596 1120 11528 --
NM_014606chr42623 461 11392 ----
NM_014607chr261764 836 667 565 475 337 11879 1746 --
NM_014612chr92960 122 11298 ----
NM_014613chr562075 2061 1199 864 301 276 11125 ----
NM_014614chr231110 473 221 1465 11297 --
NM_014615chr1653033 2787 2734 960 780 33389 2532 62 --1169
NM_014629chr811228 ------
NM_014635chr241570 1405 511 427 11680 11309 1161
NM_014636chr964362 3451 3037 2863 2835 1698 14374 23794 1269 --
NM_014646chr1843075 2898 2146 995 --1899 --
NM_014647chr1652234 2222 662 589 123 --12162 --
NM_014655chr121560 440 31489 923 151 21646 1525 11584
NM_014665chr862293 1239 926 840 710 126 ------
NM_014667chr332435 1775 987 ------
NM_014670chr251601 1287 1213 315 82 21534 522 ----
NM_014671chr721288 1052 ------
NM_014674chr383980 3413 3157 2652 1529 937 823 284 --1335 127
NM_014676chr141698 1537 1352 1077 --11390 --
NM_014677chr851327 1023 1006 548 323 ------
NM_014679chr112964 465 1555 1269 --
NM_014682chr842120 1669 545 438 ------
NM_014683chr1751716 1390 522 472 278 22159 1367 ----
NM_014685chr161531 ------
NM_014686chr1922481 2248 --22367 2193 1433
NM_014690chr772805 2772 2690 2450 2066 1114 978 --1880 --
NM_014701chr1563235 1050 998 959 618 56 1991 --13356
NM_014702chr642174 1284 695 468 21138 383 ----
NM_014705chr751727 1362 280 266 86 12034 ----
NM_014707chr711921 ------
NM_014709chr22245 182 ------
NM_014711chr1632129 1808 477 22034 1534 ----
NM_014713chr21517 ------
NM_014717chr191859 ----1594
NM_014720chr10101518 1504 1480 1432 1285 694 250 238 111 61 --1220 11144
NM_014721chr6117025 6444 6406 5403 5306 4558 2180 2057 2047 660 40 1890 21412 1186 --
NM_014723chr2022764 89 13191 43000 1040 588 438 --
NM_014726chr172408 151 --1554 165
NM_014727chr191258 --157 --
NM_014729chr81737 22169 1885 ----
NM_014730chr1294847 4530 3792 2117 1956 1394 997 595 381 24372 1436 23559 911 --
NM_014730chr1294847 4530 3792 2117 1956 1394 997 595 381 24372 1436 23559 911 --
NM_014732chr16115728 5663 5557 5181 5175 5087 4395 2228 2202 2044 450 1570 --15859
NM_014735chrX31733 1552 485 ------
NM_014739chr663771 3278 2939 2564 1401 1392 1155 ----
NM_014742chr2051629 1520 633 190 174 ------
NM_014743chr422038 298 11940 11144 --
NM_014746chr244099 4076 1408 90 23438 1263 12943 --
NM_014747chr1105671 4868 4850 4652 4390 4113 3974 3730 2227 1749 13524 ----
NM_014751chr831868 878 141 21732 185 11968 --
NM_014752chr1141358 1327 748 37 --11454 --
NM_014755chr293826 3742 3609 3364 1557 1329 427 196 185 ------
NM_014757chr562021 1874 1641 1632 837 79 ------
NM_014758chr1141821 1801 1787 653 11652 ----
NM_014761chr16--1915 1476 --
NM_014764chr122149 44 1348 ----
NM_014765chr1112267 2114 2027 2002 1087 817 805 716 685 381 138 1936 ----
NM_014766chr733188 142 44 1333 --1156
NM_014772chr1832428 1017 360 --12197 11415
NM_014774chr1123147 3110 2617 2607 2528 2286 2149 2055 389 350 123 116 22310 2046 ----
NM_014776chr12102749 2671 2575 2555 2533 2507 2136 2068 1000 511 ----1659
NM_014779chr351067 888 772 384 75 ------
NM_014781chr82288 90 ------
NM_014783chr1551543 1308 1108 537 260 ------
NM_014795chr221273 1237 --11283 --
NM_014800chr721137 878 --2176 83 --
NM_014802chr121711 1168 ----
NM_014803chr1052763 1950 988 303 41 2460 232 ----
NM_014810chr193401 3269 3167 3153 884 603 378 248 105 --11071 11094
NM_014812chr161249 778 755 579 237 109 ------
NM_014819chr532125 1771 905 ------
NM_014820chr331786 1410 1385 11293 11918 --
NM_014824chr113814 402 78 --1704 --
NM_014826chr174374 3861 3727 3671 3626 945 60 14001 ----
NM_014827chr141441 1316 223 21 1590 ----
NM_014828chr1432449 2402 1680 ------
NM_014829chr572342 2284 2094 929 758 350 107 1661 --22190 430
NM_014830chr1251321 1123 1089 904 102 12864 --23699 821
NM_014836chr1041859 1695 136 58 --11641 --
NM_014839chr132235 1599 332 ------
NM_014840chr1292943 2758 2686 1299 1004 851 751 629 387 2734 148 ----
NM_014841chr61182 ----11396
NM_014847chr12556 31 ------
NM_014850chr3104809 4549 4374 3911 3645 3586 3400 1267 98 62 ------
NM_014859chr173389 267 247 --1361 --
NM_014862chr1584225 3781 3534 2986 2863 1130 1010 626 23930 1264 23576 3022 11045
NM_014864chr1114052 2684 1399 1241 1116 1084 741 486 358 212 128 21504 913 1400 --
NM_014872chr931998 1835 363 --1570 --
NM_014873chr144808 2962 1896 730 14410 ----
NM_014874chr151781 1374 379 222 174 ------
NM_014876chr2262219 1878 1854 1639 1373 377 --1817 --
NM_014877chr17177654 7552 6800 6398 6391 5039 4977 3004 2947 2577 2299 1704 1479 1336 1206 978 498 25736 207 26883 6598 15381
NM_014880chr262534 2257 2041 1045 703 341 --32624 2443 2279 --
NM_014885chr4173 1139 ----
NM_014888chr741403 1347 1094 35 --1104 --
NM_014890chr33277 248 104 ------
NM_014892chr63131 89 28 ------
NM_014893chrY42384 2304 741 598 21844 944 ----
NM_014897chr1742885 2692 2527 2346 1172 ----
NM_014898chr1942401 2044 1794 174 --1686 --
NM_014903chr1232465 410 31 12003 ----
NM_014904chr1073610 3332 3074 2817 2486 699 497 ------
NM_014906chr1784031 3568 3511 3152 3062 2940 1609 495 13843 ----
NM_014909chr1473939 3909 3866 3271 2857 394 185 1492 23723 1013 --
NM_014910chr192137 62 ------
NM_014912chr1073098 1383 1358 1158 776 258 241 ----1231
NM_014918chr1551150 653 644 399 186 1224 ----
NM_014920chr633119 302 113 --1623 --
NM_014923chr1322076 169 11998 ----
NM_014924chr1462598 2308 2111 1139 922 386 ------
NM_014925chr122664 324 --1770 --
NM_014926chr321019 948 1295 ----
NM_014932chr321682 136 --11691 --
NM_014934chr1383790 3700 2708 2425 1611 1362 785 537 33148 2681 1205 23135 1517 --
NM_014935chr153889 3753 3063 1120 319 --12417 23361 1203
NM_014936chr63479 336 139 196 1227 --
NM_014937chr1021329 1284 11269 3869 269 234 --
NM_014945chr531887 460 394 11352 --11306
NM_014946chr251918 998 640 622 208 22736 214 ----
NM_014947chr142304 842 103 39 11974 ----
NM_014948chr2042053 1654 972 417 11543 11739 --
NM_014949chr11984 ------
NM_014950chr14199 1634 2191 180 --
NM_014951chr1021880 293 --11008 11685
NM_014952chr1531958 1723 233 ------
NM_014961chr461884 1748 746 603 504 285 2243 124 ----
NM_014962chr2052874 2437 1157 1035 461 ----21082 333
NM_014964chr1772226 1915 599 442 353 255 172 12164 ----
NM_014969chr11908 ------
NM_014970chr1------1217
NM_014974chr1051546 1239 661 534 218 ------
NM_014977chr142494 483 ------
NM_014978chr105496 477 231 98 29 ------
NM_014982chr1484748 4007 3748 3284 1861 1832 1764 1437 34513 3582 415 --199
NM_014988chr462320 1028 695 644 584 380 --11928 --
NM_014989chr621594 1380 11286 ----
NM_014990chr142433 212 ------
NM_014991chr4102796 2570 2282 2127 2078 2009 1082 965 859 238 ------
NM_014994chr1522304 833 --32268 1618 261 --
NM_014996chr32978 391 ------
NM_014997chr762902 2282 473 464 287 176 --42716 1881 1020 570 --
NM_014999chr1231387 1212 464 ------
NM_015000chr1242200 972 659 458 22607 1102 ----
NM_015001chr12796 187 1917 ----
NM_015002chr1272079 1963 1425 760 526 516 24 ------
NM_015008chr383649 2635 1233 1021 715 576 397 210 1598 --12365
NM_015009chr33646 640 198 ------
NM_015020chr1663496 3348 1493 952 881 735 ------
NM_015025chr292704 2669 2603 1930 1772 1722 1017 875 762 ------
NM_015026chr1294700 4527 4462 3801 3109 3062 1260 1216 1024 24078 1287 14707 --
NM_015032chr1332603 2371 138 ------
NM_015035chr20146430 6183 6024 5724 5030 4582 2386 1797 1764 633 568 480 386 254 14888 26276 5302 --
NM_015039chr184007 3942 3116 1519 1356 973 180 41 ------
NM_015040chr233329 2281 2231 13381 21106 180 --
NM_015042chr1594273 4258 3858 3765 3715 3307 2849 998 979 1688 ----
NM_015045chr1021537 268 ------
NM_015046chr932470 822 158 11834 1599 --
NM_015049chr263258 2904 2668 2377 2200 572 --12264 --
NM_015050chr631336 1032 366 ------
NM_015051chr942754 2669 1261 240 2703 569 ----
NM_015056chr2132607 878 62 ------
NM_015061chr91731 ------
NM_015064chr1233261 1350 531 23336 3079 ----
NM_015068chr741192 1094 909 795 11504 --1251
NM_015071chr5126246 5878 5751 5592 5105 5000 4940 4208 2174 1883 1391 807 ------
NM_015073chr1951828 1721 797 607 23 ------
NM_015074chr1144956 4732 4625 3567 3039 3014 1387 1020 758 474 419 349 138 30 11994 ----
NM_015075chrX42289 1798 654 492 ------
NM_015076chr694557 3123 2822 2801 1486 789 725 454 314 ------
NM_015090chr1116068 6004 5790 4664 4047 3948 1150 626 382 331 98 21627 1397 24321 31 --
NM_015091chr142825 545 ------
NM_015092chr16114633 4606 4256 3773 3722 2851 1872 1270 1053 720 707 --11549 --
NM_015094chr2214128 --44166 1784 1646 35 --
NM_015099chr173705 244 109 --1153 --
NM_015100chr13745 702 560 11765 ----
NM_015107chrX72474 2220 1563 635 398 295 182 ------
NM_015110chr962130 1735 1620 1545 804 515 ------
NM_015115chr442712 2288 2009 1137 12328 ----
NM_015116chr1371652 1551 1271 1220 171 81 66 21520 565 1458 --
NM_015122chr191225 ------
NM_015124chr2252464 994 817 682 374 --21808 829 --
NM_015125chr19----1423 --
NM_015130chr441058 968 486 305 ----11128
NM_015135chr71129 ------
NM_015137chr872509 2015 2008 1919 1640 559 264 --1515 --
NM_015138chr1572500 829 487 436 403 345 55 --12313 --
NM_015141chr342507 2147 1804 1732 21862 504 12012 --
NM_015143chr461433 1377 1272 1025 258 31 ------
NM_015144chr16103951 3736 3514 3284 3146 2798 1525 1396 440 255 --13721 --
NM_015149chr172179 2085 2023 1749 1418 655 386 --1601 --
NM_015151chr2121030 331 --1657 --
NM_015153chr63662 96 56 ------
NM_015155chr1062230 1317 1210 882 633 451 --22395 748 --
NM_015156chr1463690 3628 3195 1312 768 399 --22809 1576 --
NM_015158chr93793 294 217 ------
NM_015161chr1651542 1432 1300 348 305 1618 ----
NM_015172chr151479 1281 1252 1106 241 ------
NM_015173chr451757 1704 684 642 520 ------
NM_015176chr151552 1522 445 421 199 21688 1132 ----
NM_015180chr14----1291 --
NM_015185chrX31185 927 402 22887 2230 ----
NM_015187chr4194 ----1224
NM_015191chr1142743 2397 634 354 1914 ----
NM_015192chr2042580 2485 2325 90 32776 2204 430 12363 12009
NM_015196chr41108 ------
NM_015199chr332874 1898 960 1194 12720 22095 70
NM_015200chr442534 1740 924 779 1130 ----
NM_015206chr1553027 2996 2975 1411 66 1914 ----
NM_015208chr1833482 1125 550 --13839 --
NM_015210chr182459 28 ------
NM_015215chr15914 879 800 744 205 --2775 242 --
NM_015216chr541297 624 371 349 ------
NM_015219chr1732622 2533 1601 --21981 237 --
NM_015221chr1041324 605 148 27 1176 ----
NM_015225chr972335 2005 765 455 324 290 89 --1100 --
NM_015230chr43450 404 210 ----1395
NM_015236chr421254 296 --144 --
NM_015239chr92207 48 1512 ----
NM_015245chr631942 1907 186 ----12639
NM_015247chr1695212 4980 4831 4637 3842 2017 1329 522 56 23269 421 11408 --
NM_015250chr931812 1699 349 11259 ----
NM_015252chr22984 731 --1263 --
NM_015263chr151177 ------
NM_015264chr2263556 3369 3227 1826 1294 884 --1519 --
NM_015265chr262502 2020 1724 935 469 257 12001 1231 11752
NM_015267chr1262164 2085 1915 1860 203 43 --1850 --
NM_015271chr474036 1652 1627 758 521 458 185 21046 729 1676 --
NM_015277chr1831144 470 53 1590 ----
NM_015278chr653213 2939 1321 661 143 13148 1391 --
NM_015282chr2102968 2769 2748 2724 2664 2323 1006 997 828 399 12143 ----
NM_015284chr172133 1987 1867 1718 1350 693 571 11789 ----
NM_015285chr1832319 1917 582 --11796 --
NM_015288chr533476 3387 1331 --23412 405 --
NM_015291chr193389 3237 2410 2394 2372 1309 1174 1084 868 2783 693 12286 --
NM_015293chr63575 505 458 188 ----
NM_015294chr1731149 925 415 138 ----
NM_015296chr132943 52 ------
NM_015299chr1473981 3726 3363 2884 1432 727 228 33252 2642 561 1138 --
NM_015305chr1461973 1669 1387 1198 513 369 ------
NM_015308chr113860 798 153 ------
NM_015310chr8178181 7777 7371 6810 6741 3082 2886 2789 2462 2206 1844 1829 1298 1173 450 434 221 47636 6482 2867 1432 --11501
NM_015313chr11104680 4636 4494 4366 4073 3813 3401 3112 1568 393 --1552 --
NM_015314chr742443 1648 795 584 --12497 --
NM_015315chr563268 2518 2512 2331 993 580 ------
NM_015317chr252607 2226 1090 1064 316 --12178 11052
NM_015321chr19104905 4414 4371 4303 3688 3468 1778 1232 1163 735 13520 ----
NM_015326chr142807 2017 868 625 2353 151 22134 396 --
NM_015328chr783013 2830 2681 2605 2337 2071 2021 1919 1484 ----
NM_015335chr1242660 2628 1782 930 22573 1867 11831 --
NM_015336chr1222090 151 --12214 --
NM_015338chr2061586 1567 715 565 428 412 1643 21246 778 --
NM_015339chr206841 819 653 643 406 93 ------
NM_015344chr842055 397 326 136 ------
NM_015345chr682775 2445 2318 912 367 247 171 109 --1741 --
NM_015346chr1431688 1665 359 ------
NM_015347chr12102663 2443 2273 1921 1903 1154 691 530 229 70 1732 --22213 2177
NM_015349chr642873 1102 1042 559 ------
NM_015353chr1762602 1889 1813 1021 681 211 1981 ----
NM_015355chr173619 357 193 1515 ----
NM_015358chr2131097 861 415 ------
NM_015361chr23698 52 25 ------
NM_015365chrX94300 3498 3357 3048 2708 2642 799 746 65 23945 2755 1563 --
NM_015367chr2241521 1260 553 270 11565 ----
NM_015378chr163008 2500 2221 1954 659 561 --12835 12209
NM_015387chr231922 1423 1382 21621 401 ----
NM_015393chr463595 2930 2845 2395 1141 239 13662 13507 1300
NM_015396chr321480 1071 --2306 100 1161
NM_015409chr1262695 1881 452 258 75 43 12384 ----
NM_015412chr342613 2356 1955 1015 --22779 2429 1876
NM_015419chrX5815 457 435 213 201 1144 ----
NM_015429chr311072 ------
NM_015435chr811337 ----1572
NM_015436chr423243 2118 21235 1132 ----
NM_015443chr1741359 1040 567 138 ------
NM_015446chr121302 533 11324 --1437
NM_015449chr11511 ------
NM_015455chr534063 3049 1484 127 23386 3171 --
NM_015458chr8114689 4348 4312 3887 1757 1712 1639 1585 1522 1501 79 195 35166 3941 213 13378
NM_015463chr22790 339 ------
NM_015477chr153933 716 193 ----1369
NM_015483chr73845 808 745 ------
NM_015484chr12781 240 ------
NM_015488chr221523 1398 11251 21622 398 --
NM_015497chr1531152 456 171 ------
NM_015508chr331512 1028 112 ------
NM_015509chr1241385 1374 429 334 152 ----
NM_015516chr1121287 1204 1572 ----
NM_015520chr312127 --1320 11778
NM_015525chr61855 11178 ----
NM_015527chr161681 --3689 631 88 --
NM_015535chr243495 1485 709 221 23349 1587 ----
NM_015541chr351097 1074 958 916 460 ------
NM_015542chr1011103 ------
NM_015550chr783418 3005 2981 2508 2271 1035 928 611 23069 2221 --21427 214
NM_015554chr1522801 821 12443 1247 12454
NM_015555chr641725 1323 625 471 31741 265 36 11510 --
NM_015564chr563319 3067 2820 2425 1154 417 11016 ----
NM_015568chr2084225 3647 3011 2943 2820 1631 673 260 ------
NM_015569chr1104724 4661 4470 3810 3790 3550 1112 947 260 147 11027 --1872
NM_015570chr731394 1212 461 ------
NM_015571chr63761 542 486 --12516 --
NM_015575chr263025 1386 1095 556 361 59 ----13161
NM_015576chr382993 2968 2955 2465 2198 742 332 176 ------
NM_015577chr531720 1338 1279 11205 ----
NM_015578chr1931284 650 197 ------
NM_015602chr131341 651 54 --11419 --
NM_015605chr1051136 570 409 231 25 11303 ----
NM_015610chr762279 1774 1018 623 337 59 182 ----
NM_015630chr241026 398 378 181 ------
NM_015640chr195168 5027 4943 4622 3920 3505 1491 1120 780 1484 25182 2074 --
NM_015641chr731299 939 880 ------
NM_015646chr1251064 340 175 97 78 11165 ----
NM_015678chr1381196 1114 680 482 446 429 327 163 11549 21426 1371 11610
NM_015686chrX52139 1676 970 964 355 --21850 510 --
NM_015687chr61377 ------
NM_015695chr631835 1791 502 ------
NM_015726chr151413 1318 1249 583 571 --1100 --
NM_015833chr2172194 1973 1582 1528 434 353 94 ------
NM_015855chr111841 ------
NM_015866chr141231 1184 1021 355 ------
NM_015874chr42497 431 --1462 --
NM_015878chr852222 1891 1775 888 588 21869 1841 11428 11508
NM_015879chr18188591 7237 6538 6224 6077 5501 5262 2842 2807 2764 2585 2498 2372 2317 2152 1092 777 455 37988 3230 626 23120 1418 --
NM_015886chr8105166 5048 4792 4696 4532 3585 2171 1552 1034 109 25040 1740 25423 1288 11178
NM_015888chr182883 2365 1097 998 592 538 291 71 13274 --12564
NM_015891chr611418 1725 ----
NM_015902chr84915 799 632 116 ------
NM_015906chr134024 1876 1352 --1967 --
NM_015912chr842093 1747 776 205 ------
NM_015920chr151609 ------
NM_015933chr3180 ------
NM_015954chr122435 234 ------
NM_015955chr21500 ------
NM_015975chrX71698 1412 1226 722 267 92 83 ------
NM_015986chr1731462 910 356 ------
NM_015994chr142454 234 ------
NM_015995chr15145451 5430 5376 4992 4362 4157 3967 1729 1629 1489 1183 950 686 301 12154 1629 --
NM_015999chr12471 147 2687 270 ----
NM_016003chr762279 1774 1018 623 337 59 182 ----
NM_016009chr164587 4209 3762 3227 3165 38 1950 13392 14493
NM_016021chr652993 2568 625 590 271 ----1637
NM_016023chr82850 104 ------
NM_016025chr1632030 807 509 ------
NM_016026chr1431247 199 124 ------
NM_016032chrX1557 --1874 --
NM_016037chr1--1296 2983 462 --
NM_016040chr152763 1951 1769 621 154 1269 ----
NM_016041chr172128 92 ------
NM_016045chr2051717 1185 670 482 341 ------
NM_016047chr2154 1128 ----
NM_016057chr1221279 1241 ------
NM_016061chr231144 77 23 ----1250
NM_016075chr1343169 2640 2155 506 ------
NM_016076chr163164 3037 928 307 286 189 43175 2886 944 706 ----
NM_016078chr171989 1731 ----
NM_016079chr242302 2041 1726 905 ------
NM_016083chr663764 3508 2617 1412 1227 557 ----23058 2611
NM_016096chr8130 2810 307 11400 --
NM_016097chr1841089 838 99 59 --1975 --
NM_016099chr841373 428 268 146 --1195 --
NM_016107chr531230 1165 428 ------
NM_016120chrX2489 76 ------
NM_016122chr123486 389 352 ------
NM_016123chr12192 --21100 476 --
NM_016124chr111429 --31277 390 244 --
NM_016127chr83564 500 56 ------
NM_016129chr43378 289 33 ------
NM_016131chr242158 2140 1592 112 1709 --1480
NM_016132chr1532837 2265 1262 --12681 --
NM_016133chr231602 1409 1027 ----11375
NM_016147chr1141162 1140 1079 1038 ------
NM_016151chr162103 45 ------
NM_016152chr351270 1067 848 330 38 ------
NM_016156chr1172265 1935 1775 1607 1598 511 115 2504 424 12132 --
NM_016166chr15284 68 ------
NM_016169chr1053292 2509 2418 877 219 --11086 --
NM_016172chr92165 91 ------
NM_016185chr172318 113 ------
NM_016205chr42397 121 ----11165
NM_016206chr3258844 8595 8533 8381 8234 8160 7700 7632 7216 7171 6811 6512 6484 6332 6109 5688 5527 3082 2341 2157 2072 1976 1912 1645 257 18949 38134 1837 321 15892
NM_016217chr643561 3196 1121 118 22846 2634 ----
NM_016221chr52557 87 ----11912
NM_016224chr661712 1702 1689 819 765 522 --11464 --
NM_016226chr123374 128 94 1389 ----
NM_016227chr171305 1266 1228 441 352 165 133 ------
NM_016230chr61399 ------
NM_016231chr1741678 1328 465 178 --11690 --
NM_016248chr13113808 3717 3682 3536 3349 3264 2949 2720 1439 742 200 53880 3164 3117 2959 1454 12434 --
NM_016250chr141642 2155 130 ----
NM_016252chr21288 ------
NM_016257chr1103541 3295 3162 3111 2593 1366 1150 1035 966 676 12862 22754 567 --
NM_016260chr2157476 7466 7139 5868 4996 4939 2478 2459 2102 1319 948 757 398 99 77 ----14903
NM_016271chr1841635 1619 45 24 ----21970 170
NM_016275chr362000 1926 1857 1777 891 859 52798 2612 2588 2117 677 11752 --
NM_016281chr1241103 1032 449 289 ----1960
NM_016282chr921752 1715 ------
NM_016287chr131908 1850 1628 ------
NM_016302chr31304 ------
NM_016306chr3122 ------
NM_016315chr251486 1175 369 280 151 ----1310
NM_016316chr21472 1667 ----
NM_016322chr963252 3169 2925 1113 938 91 --12486 --
NM_016329chr32383 132 ------
NM_016338chr511035 ------
NM_016339chr1741645 1398 1149 89 11727 2212 59 --
NM_016353chr832186 459 267 ------
NM_016356chr672726 2476 2259 1970 1796 1168 545 12450 22869 2487 --
NM_016357chr124825 803 422 125 ------
NM_016374chr151148 1043 463 153 52 --125 --
NM_016374chr151148 1043 463 153 52 --125 --
NM_016376chr1783371 3154 2735 1184 1178 946 798 782 ----13584
NM_016377chr62320 274 ----11573
NM_016395chr152662 63 ------
NM_016396chr1572496 2258 2004 1952 1189 834 399 ------
NM_016410chr9125 ----1574
NM_016422chr1152689 2428 2367 2239 896 --2981 779 --
NM_016424chr1741850 1474 532 468 21858 1405 1397 158
NM_016436chr2031070 876 553 12518 12184 --
NM_016441chr262258 1677 671 502 478 182 ------
NM_016442chr54919 568 558 263 ------
NM_016447chr71217 ------
NM_016448chr151904 1198 603 292 276 21873 1173 ----
NM_016451chr11168 ------
NM_016467chr211364 11159 ----
NM_016470chr20173 --184 --
NM_016472chr1441239 935 427 92 ----1380
NM_016475chr1431174 1119 801 ------
NM_016476chr171150 ------
NM_016485chr662075 2033 1729 655 614 380 11675 ----
NM_016488chr1221924 1403 --21571 1272 --
NM_016505chr13657 507 50 158 ----
NM_016507chr1733130 591 237 ----32603 664 611
NM_016513chr633119 302 113 --1623 --
NM_016519chr42183 67 ------
NM_016520chr93569 314 31 --1109 --
NM_016522chr1141478 1282 206 165 --1452 --
NM_016529chr13168 ------
NM_016530chr1574028 3761 2604 653 478 352 292 12892 1556 --
NM_016531chr473625 3354 3300 2973 1266 539 223 ------
NM_016536chr19----174 --
NM_016538chr17----133 --
NM_016574chr1131116 891 308 11105 ----
NM_016575chr1285333 4099 3793 3372 3354 2097 872 129 --11498 --
NM_016577chr344377 4191 2881 749 1722 13770 11067
NM_016578chr11--1174 ----
NM_016587chr711053 21010 184 ----
NM_016603chr552136 567 540 321 227 ------
NM_016604chr541259 886 845 324 1858 ----
NM_016605chr532656 2355 2202 1523 12165 --
NM_016607chrX11333 --161 --
NM_016618chr2184 ------
NM_016621chr1144014 3189 1578 1124 1919 ----
NM_016628chr102665 92 ------
NM_016631chr212670 221 --1841 --
NM_016644chr52550 70 1373 ----
NM_016649chr20135 ------
NM_016654chr1531409 1182 899 156 ----
NM_016818chr212609 564 ------
NM_016824chr1021796 581 ------
NM_016834chr17104049 3785 3675 3425 3300 2648 2606 1484 494 206 22579 840 1978 --
NM_016835chr17104049 3785 3675 3425 3300 2648 2606 1484 494 206 22579 840 1978 --
NM_016841chr17104049 3785 3675 3425 3300 2648 2606 1484 494 206 22579 840 1978 --
NM_016929chr6113791 3567 3441 3245 1776 1502 1198 422 334 227 102 23482 92 1123 --
NM_016931chr11--160 ----
NM_016946chr173171 2706 2630 2565 2338 1262 1164 22799 380 23448 2616 --
NM_016950chr441529 1272 980 291 --1459 --
NM_016952chr1173764 3681 1379 1290 854 502 232 13338 13234 1753
NM_016953chr275504 5129 4823 4620 4572 4196 226 34405 4269 853 16012 1145
NM_017410chr1241287 967 961 921 --21080 303 --
NM_017412chr861398 1009 963 944 450 27 ------
NM_017413chrX42504 1597 252 226 ------
NM_017415chr564464 1565 1314 590 249 71 22911 1593 33583 1748 1173 11421
NM_017420chr1423439 3213 ------
NM_017423chr461903 686 451 232 216 208 ------
NM_017426chr4140 ------
NM_017437chr143824 749 621 ------
NM_017440chr122655 591 2489 108 ----
NM_017443chr91976 --126 --
NM_017447chr2184168 4029 3830 3058 2685 577 444 139 43725 2965 2673 62 1964 12977
NM_017452chr2011451 1967 ----
NM_017453chr2011451 1967 ----
NM_017454chr2011451 1967 ----
NM_017455chr151380 1817 ----
NM_017456chr1731991 1621 36 --11583 --
NM_017483chr211012 --1490 11028
NM_017488chr221347 249 ----11363
NM_017489chr821354 1241 11177 --11316
NM_017491chr41855 1272 --1990
NM_017516chr1141108 810 762 246 ------
NM_017519chr621364 277 ------
NM_017522chr12325 229 ------
NM_017526chr12132 113 ------
NM_017544chrX3903 719 671 --1105 --
NM_017545chr201533 1453 ----
NM_017551chr1072388 2018 1774 751 614 414 239 ------
NM_017553chr1521283 160 --193 --
NM_017554chr331710 1598 603 1184 ----
NM_017563chr3166376 6210 5450 5308 5223 5154 4996 4912 4713 2524 2176 1220 580 419 365 31 32391 389 175 ----
NM_017567chr21120 ------
NM_017569chr131309 ------
NM_017580chr1061563 936 729 447 332 150 ------
NM_017582chr131265 477 53 --1230 --
NM_017590chr2252579 2216 1926 1819 145 12612 12717 --
NM_017593chr42503 98 ------
NM_017594chr961218 1018 599 573 493 415 11033 11012 --
NM_017599chr12101873 1830 1702 1381 1368 767 667 661 322 259 ------
NM_017602chrX6877 821 805 759 596 68 ------
NM_017610chr1531901 1834 1766 22123 371 11582 --
NM_017612chr123564 370 38 ------
NM_017628chr4133797 3280 3272 1954 1786 1730 1554 1433 1407 1382 1189 1089 517 11594 34213 2027 1921 --
NM_017629chr131469 496 146 ------
NM_017633chr623685 547 --23783 3202 12647
NM_017634chr821870 56 --1339 --
NM_017635chr111618 ----11286
NM_017637chr9149321 8893 8475 7577 7437 7211 6865 6706 5957 5949 3412 3091 999 821 59230 8994 2772 2441 540 38724 8324 2809 37341 6856 6492
NM_017640chr6174 1824 ----
NM_017641chr124970 891 285 243 ------
NM_017643chr1733086 2452 2061 11912 ----
NM_017644chr3114860 4539 4307 4102 3472 1361 1257 1165 1117 301 246 ------
NM_017649chr1021107 133 ------
NM_017650chr795642 5464 4811 3674 2285 1406 802 701 207 --32160 1600 279 --
NM_017658chr14104524 4207 3964 3164 2879 1865 1252 1154 256 236 11348 ----
NM_017661chr151127 ------
NM_017666chrX62236 2028 1366 590 314 177 ------
NM_017667chr72360 107 --1235 --
NM_017672chr152285 62 ------
NM_017676chr521842 220 31296 376 94 ----
NM_017686chr12959 767 ------
NM_017693chr1341016 528 130 110 ------
NM_017694chr262067 2026 2007 1993 1768 1391 ------
NM_017699chr3140 --21722 305 --
NM_017709chr1123864 3849 3624 3581 3423 3339 2948 2872 1691 1353 1234 251 12919 1991 11263
NM_017719chr361970 1902 1890 484 183 122 12370 ----
NM_017721chr191326 ------
NM_017724chr33714 315 122 --1182 --
NM_017730chr33463 171 156 ------
NM_017737chr141682 749 586 521 --1554 --
NM_017739chr11110 ------
NM_017741chr442747 969 678 259 --1207 --
NM_017742chr1831862 506 419 11894 ----
NM_017745chrX--1649 ----
NM_017752chrX72108 2034 1555 591 343 180 92 --11772 --
NM_017753chr92352 40 --1876 --
NM_017754chr664316 4153 1918 1643 1309 1247 15021 24181 1849 --
NM_017769chr1452622 2552 2528 846 787 --12716 188
NM_017779chr132735 2573 502 22688 41 ----
NM_017780chr84831 757 737 167 1811 ----
NM_017784chr32853 98 --21213 359 --
NM_017798chr201113 141 ----
NM_017799chr1411860 11396 --11734
NM_017810chr16191 ------
NM_017811chr982291 2019 1985 1967 1133 1024 695 603 ------
NM_017812chr73726 691 278 1192 ----
NM_017813chr8105815 5661 5628 5504 5239 4902 4127 2257 1234 794 13776 31438 963 719 24096 3646
NM_017819chr32217 204 ------
NM_017822chr123265 102 25 ------
NM_017824chr1052670 2661 2002 1750 623 11056 ----
NM_017842chr122697 499 ------
NM_017848chrX104186 3944 3779 3772 3746 3587 3282 1797 1181 141 43882 1787 1695 1323 --13352
NM_017849chr283226 2965 2864 1999 822 729 521 114 13069 12525 --
NM_017860chr11618 ------
NM_017873chr923158 2264 --22166 740 --
NM_017880chr21291 --1407 --
NM_017893chr1021168 534 ------
NM_017896chr2063427 2512 2421 1342 1140 136 12605 22734 2480 --
NM_017899chr12----2134 34 --
NM_017902chr10105606 4992 4831 4625 2128 1824 1570 1015 700 223 12152 24794 3971 14844
NM_017913chr9292 75 ------
NM_017919chr985084 1850 1838 1557 1393 1169 723 77 25525 1731 ----
NM_017922chr142594 502 ------
NM_017925chr931916 1806 257 1163 1455 11476
NM_017929chr222936 306 11205 1462 --
NM_017938chrX51946 1442 650 323 314 12029 ----
NM_017943chr1411077 --1792 --
NM_017944chr1123148 2237 ------
NM_017945chr311033 ----181
NM_017946chr741297 240 56 35 --11227 --
NM_017964chr23698 295 70 ------
NM_017969chr21173 ------
NM_017974chr261243 1042 1028 917 454 253 --1427 --
NM_017982chr1258 51 11110 ----
NM_017987chr1072026 1901 1380 888 686 364 269 1662 ----
NM_017988chr125813 725 627 330 65 1283 ----
NM_017994chr752345 548 516 424 99 11985 1240 --
NM_018011chr13145 ------
NM_018017chr1062153 1085 818 359 86 77 22805 2009 11033 --
NM_018018chr1231617 1491 558 176 ----
NM_018027chr1023275 220 --1355 --
NM_018045chr152515 885 522 386 70 --1202 --
NM_018046chr521576 259 --11876 --
NM_018060chr11351 ------
NM_018061chr151444 1412 581 533 444 1432 21670 1256 --
NM_018070chr11156 ------
NM_018078chr42934 835 ------
NM_018079chr21136 ------
NM_018084chr252611 2310 2224 1061 258 22925 2297 ----
NM_018085chr168125 6725 2201 2038 546 82 27850 72 36136 5245 1205 1108
NM_018086chr231511 1497 137 ------
NM_018092chr1631300 1089 1072 1114 ----
NM_018098chr311210 1752 ----
NM_018103chr12254 106 ------
NM_018105chr82959 907 ------
NM_018117chr101250 1510 ----
NM_018121chr1042641 2150 869 777 1971 33162 2387 2315 11944
NM_018128chr1721087 1042 1142 21421 1172 --
NM_018133chr332196 2008 267 12087 --1688
NM_018144chr101261 ----147
NM_018151chr22785 525 ------
NM_018155chr353376 2680 1221 858 548 12730 ----
NM_018156chr163008 2500 2221 1954 659 561 --12835 12209
NM_018157chr1252786 2392 2141 433 44 ------
NM_018178chr151996 1714 1336 813 555 1164 ----
NM_018179chr123231 64 43 --194 --
NM_018181chr1871786 1761 1644 1528 1303 1274 133 ------
NM_018182chr1732021 822 295 --3679 621 266 --
NM_018184chr32553 294 ------
NM_018193chr152135 29 --1104 --
NM_018195chr1141905 1488 1456 467 --11825 --
NM_018199chr1421043 250 11068 ----
NM_018202chr13845 695 276 ------
NM_018206chr163714 306 160 ------
NM_018207chr141283 654 312 290 21506 212 ----
NM_018211chr141434 666 627 217 --11576 --
NM_018214chr62834 114 1519 ----
NM_018227chr443138 2915 1282 1057 1229 ----
NM_018237chr101250 ------
NM_018243chr453745 3164 2972 1513 1019 --33415 2659 1190 12609
NM_018247chr663166 1920 1017 815 596 513 ------
NM_018254chr132465 1860 1696 ------
NM_018263chr292625 2245 2126 2051 1923 1835 985 548 212 22517 312 2930 182 12381
NM_018266chr341086 851 689 311 ------
NM_018287chr102955 114 ------
NM_018293chr342884 2765 2559 703 ------
NM_018299chr843146 2311 1274 984 --11085 159
NM_018302chr451979 1933 1705 412 306 --22430 967 1643
NM_018312chr112876 269 1372 1425 --
NM_018313chr372247 2195 1708 720 531 475 152 ------
NM_018314chr112712 28 1152 ----
NM_018315chr41239 ------
NM_018317chr4193 ------
NM_018319chr1471498 1430 1420 573 413 360 206 ------
NM_018323chr431259 607 545 ------
NM_018328chr21408 ------
NM_018330chr1041583 1278 512 349 ------
NM_018339chr92694 99 11851 31707 438 73 --
NM_018340chr1683785 3447 3386 3292 1040 652 297 26 13840 24008 1566 1853
NM_018348chr1631183 981 337 11131 ----
NM_018351chr1284655 4390 4279 4230 3958 3210 1153 341 14605 ----
NM_018361chr8133687 3609 3449 3351 1619 1298 1199 1110 856 443 421 352 110 ------
NM_018362chr1163561 2696 947 807 597 181 23899 531 ----
NM_018364chr173729 2984 1487 1416 583 343 99 ------
NM_018367chr1152504 2217 740 692 369 11632 --11949
NM_018371chr82635 31 ------
NM_018372chr13470 216 201 ------
NM_018374chr764870 4756 3437 3380 1231 659 --11122 --
NM_018375chr1421932 1324 --199 --
NM_018383chr21547 22015 1713 21423 766 --
NM_018387chr93513 452 126 ------
NM_018388chrX31122 989 395 ------
NM_018400chr1174117 3870 3344 2994 2971 1303 333 --33506 3035 519 --
NM_018403chr364086 3733 2772 2612 709 332 23665 2692 --1863
NM_018409chr432466 1077 706 ------
NM_018416chr1271938 1760 1023 583 418 385 307 ------
NM_018424chr961578 1520 1449 1317 687 31 2708 675 ----
NM_018427chr1631230 1204 492 --11157 --
NM_018429chr532820 2555 873 --12139 --
NM_018433chr22516 92 172 ----
NM_018439chr183797 502 459 12033 ----
NM_018440chr8228044 7999 7947 7891 7531 6986 6774 6673 6652 5881 5838 3101 3006 2784 2514 2295 2246 2115 1932 1818 1674 1272 38475 7525 2192 16173 12854
NM_018441chr2------148
NM_018445chr153514 467 21 ------
NM_018448chr1241184 825 397 113 ------
NM_018462chr31227 --1808 --
NM_018464chr103388 286 89 1310 ----
NM_018466chrX2568 21 ------
NM_018469chr1721132 415 --11196 --
NM_018471chr22171 157 --1145 --
NM_018477chr143858 159 24 ------
NM_018482chr862214 2203 2101 1667 513 209 22236 1642 ----
NM_018489chr141906 1468 232 152 --11788 --
NM_018490chr112411 72 ------
NM_018509chr1741482 1439 1237 34 ------
NM_018534chr2171 --1245 --
NM_018557chr231525 366 253 --1678 --
NM_018566chr164527 3750 3501 3358 1729 1607 11169 11145 --
NM_018571chr22600 40 ------
NM_018584chr121128 463 1943 --21201 87
NM_018602chr1531705 292 89 ----11468
NM_018638chr12134529 3955 3817 3497 2179 2152 2000 1962 1754 1712 1139 699 112 1449 1586 --
NM_018639chr1221212 1121 --11394 --
NM_018640chr1242806 2763 693 683 --12770 --
NM_018650chr132105 1699 914 32095 741 681 ----
NM_018657chr33846 720 652 ------
NM_018667chr1642555 2339 850 711 22579 1911 ----
NM_018685chr74962 952 834 44 ----11018
NM_018686chr12----1233 --
NM_018689chr1582286 2072 1877 1818 1739 569 452 239 1583 1343 --
NM_018695chr531717 1681 539 42432 2154 1603 343 ----
NM_018700chr561679 1606 1509 311 239 155 ------
NM_018704chr121963 194 --11318 --
NM_018710chr841372 1123 128 69 ------
NM_018712chr1121461 1297 1238 2524 232 --
NM_018713chr1----142 --
NM_018717chr452820 2529 2446 1982 991 ------
NM_018719chr721069 235 ------
NM_018728chr1551548 1361 1251 1052 24 ------
NM_018834chr51236 ------
NM_018841chr1133786 3486 3385 3082 2879 2629 2432 1238 1191 1079 689 557 74 21399 390 ----
NM_018844chr711765 1352 --11702
NM_018846chr71641 1854 ----
NM_018890chr73921 371 322 ------
NM_018898chr542265 1899 877 783 ------
NM_018899chr542265 1899 877 783 ------
NM_018900chr542265 1899 877 783 ------
NM_018901chr542265 1899 877 783 ------
NM_018902chr542265 1899 877 783 ------
NM_018903chr542265 1899 877 783 ------
NM_018904chr542265 1899 877 783 ------
NM_018905chr542265 1899 877 783 ------
NM_018906chr542265 1899 877 783 ------
NM_018907chr542265 1899 877 783 ------
NM_018908chr542265 1899 877 783 ------
NM_018909chr542265 1899 877 783 ------
NM_018910chr542265 1899 877 783 ------
NM_018911chr542265 1899 877 783 ------
NM_018940chr51424 ------
NM_018945chr6123647 3435 3113 2268 1217 986 979 661 565 479 132 95 --32811 641 315 --
NM_018948chr131095 986 181 11196 ----
NM_018951chr721142 891 ----1918
NM_018963chr2121149 105 2952 287 ----
NM_018970chr75848 635 529 357 27 --1542 --
NM_018975chr161814 --1776 --
NM_018976chr1262780 2637 2184 1961 1063 769 12194 ----
NM_018979chr1272608 2513 2271 1605 910 789 656 ----12412
NM_018992chr161658 11526 ----
NM_018993chr2051388 1377 1370 1060 52 ------
NM_018999chr10104735 4712 4545 4424 4136 3990 3481 3263 491 149 44356 3693 1822 1718 11401 11504
NM_019000chr521556 1076 11459 ----
NM_019001chr384033 3341 3013 1868 260 189 149 47 11583 ----
NM_019003chrX1117 ------
NM_019004chr732336 2306 885 22289 78 22094 2015 --
NM_019008chr2263515 2834 2661 2538 883 343 1919 23533 1390 --
NM_019010chr172398 257 ------
NM_019016chr173201 152 88 ------
NM_019018chr52620 230 ------
NM_019022chr1853124 2206 1137 1087 455 ------
NM_019027chr442566 1012 375 246 ----11806
NM_019035chr42438 210 21270 592 ----
NM_019036chr62827 807 ------
NM_019041chr662571 2296 2245 2106 476 465 ------
NM_019049chr12659 560 ------
NM_019050chr452230 2186 915 533 39 ------
NM_019058chr101279 ------
NM_019059chr7----1330 --
NM_019060chr1------1124
NM_019063chr222023 1784 ------
NM_019072chr534196 854 706 33576 2898 2720 13584 --
NM_019083chr151218 1202 1164 548 135 ----1215
NM_019084chr1042143 1819 791 766 ------
NM_019087chr551751 1552 1300 1226 550 31310 369 37 ----
NM_019088chr19157 ------
NM_019091chr261101 1034 765 422 228 104 ------
NM_019098chr811862 --11197 --
NM_019106chr2242751 1324 736 73 --1125 --
NM_019114chr942533 2157 1947 841 1762 ----
NM_019116chr1653010 2327 1214 403 98 23740 2288 12833 --
NM_019117chrX42779 2244 904 677 23047 1365 ----
NM_019555chr371697 591 416 367 143 89 38 11176 ----
NM_019556chrX61385 1133 973 584 435 294 11379 --1313
NM_019557chr12750 46 ------
NM_019558chr21112 ------
NM_019590chr1031348 1177 1133 ------
NM_019592chr94883 755 198 118 ------
NM_019593chr2022345 2142 32483 2250 548 1482 1301
NM_019594chr941446 1429 1175 336 ------
NM_019597chrX1609 ------
NM_019600chr152787 629 ------
NM_019605chr1--123 ----
NM_019610chr152172 2165 755 243 112 12062 ----
NM_019842chr62341 139 ------
NM_019843chr22194 ------
NM_019845chr21258 --147 --
NM_019859chr1011444 ------
NM_019862chr1631628 1497 1308 ------
NM_019885chr252519 789 689 611 486 ------
NM_019891chr121087 482 11224 ----
NM_019895chr31204 --1422 --
NM_019898chr1631628 1497 1308 ------
NM_019899chr1631628 1497 1308 ------
NM_019900chr1631628 1497 1308 ------
NM_019903chr1021796 581 ------
NM_020039chr1221545 430 ------
NM_020066chr12362 217 ------
NM_020120chr251610 1250 1023 511 120 ------
NM_020122chr296054 5997 5898 2112 1053 537 410 361 70 35727 2380 239 24737 649 --
NM_020123chr103618 116 25 --11062 --
NM_020134chr22395 228 ----1193
NM_020135chr6--1178 ----
NM_020139chr421867 1831 --31678 765 285 --
NM_020140chr12174 ------
NM_020141chr112201 1615 11816 --
NM_020144chr781979 1793 1641 1603 1421 1334 605 122 ------
NM_020150chr104827 636 597 577 1862 22131 1941 --
NM_020156chr71616 ------
NM_020157chr202181 116 1835 ----
NM_020168chr1521326 971 ------
NM_020177chr582928 2080 1218 1182 1025 885 837 726 11210 ----
NM_020178chr171476 --11111 --
NM_020182chr2083320 2998 2966 2423 1403 869 759 554 ------
NM_020184chr22888 280 ------
NM_020193chr11124 1936 191 --
NM_020205chr132681 2642 2293 --1882 --
NM_020210chr155978 891 816 717 128 ------
NM_020225chr4176 ------
NM_020239chr142239 1690 817 741 ----131
NM_020240chr552187 2150 2062 816 810 12592 22546 35 --
NM_020243chr224737 611 298 96 1667 --1832
NM_020245chr664509 4404 3824 3689 2035 191 --13619 --
NM_020309chr192836 710 ------
NM_020336chr20123765 3547 3464 3049 2928 2864 2635 2446 1093 699 383 167 ------
NM_020337chr483042 2360 1174 761 524 498 244 134 22314 2061 22114 773 --
NM_020338chr1083378 2830 2715 900 734 486 383 64 --11465 --
NM_020340chr642072 1520 1492 649 ------
NM_020341chr202400 159 2601 485 ----
NM_020342chr221888 386 1486 ----
NM_020346chr1131615 1359 578 ------
NM_020357chr351227 1142 1107 632 270 --11399 --
NM_020360chr173638 612 257 ----1458
NM_020381chr631943 1800 1389 ------
NM_020384chrX31588 703 130 --1234 --
NM_020390chr3154871 4855 4654 4398 4240 4185 3516 3472 1847 1665 1537 798 743 550 452 11709 ----
NM_020403chr1321613 123 11723 ----
NM_020405chr1764296 3730 3159 1458 869 664 131 1997 --
NM_020416chr432210 2132 831 ------
NM_020420chrY21571 1305 ------
NM_020424chr163641 239 174 ------
NM_020429chr752871 2395 1983 1971 674 21945 429 12203 --
NM_020432chr73720 389 168 --11502 --
NM_020433chr2021482 1331 ----1429
NM_020440chr183268 2903 2246 1240 736 729 723 206 ----12744
NM_020443chr1106649 6461 5932 5268 5129 2463 1832 1464 254 167 24640 1494 --11193
NM_020444chr541411 1327 999 61 21176 596 1140 --
NM_020455chr662718 2415 2223 716 532 111 ------
NM_020457chr161221 ------
NM_020466chr674999 3859 3344 3257 3148 1538 1406 34306 3773 863 11985 --
NM_020474chr181329 12042 ----
NM_020475chr842124 992 724 453 22350 747 11821 --
NM_020476chr842124 992 724 453 22350 747 11821 --
NM_020477chr842124 992 724 453 22350 747 11821 --
NM_020478chr832187 787 516 22413 810 11884 --
NM_020480chr842124 992 724 453 22350 747 11821 --
NM_020525chr121175 ------
NM_020532chr24586 293 192 33 189 1318 --
NM_020546chr542886 1994 1260 57 33161 1194 661 ----
NM_020630chr102598 116 ------
NM_020638chr1261396 792 700 333 220 197 31437 506 401 ----
NM_020640chr352204 2032 1759 700 248 --1149 --
NM_020644chr113759 749 90 1274 ----
NM_020647chr832212 1570 789 ------
NM_020651chr241446 1336 606 437 ------
NM_020653chr17137 ------
NM_020654chr3----11513 --
NM_020666chr53623 280 238 1339 ----
NM_020673chr20147719 7519 7410 6415 5821 5803 5697 2186 676 640 550 379 347 245 --26358 5575 11166
NM_020686chr1652993 2827 2778 2138 979 1303 1258 --
NM_020689chr2021254 558 --11075 --
NM_020693chr112506 382 ------
NM_020696chr3--131 ----
NM_020697chr84905 259 205 74 ------
NM_020699chr1105398 4694 4318 3861 3815 2136 1746 1714 1674 843 --24862 925 --
NM_020703chr11583 ------
NM_020713chr2032687 2306 1045 12293 23062 2100 --
NM_020715chr1442265 1865 1738 1699 --1565 --
NM_020717chrX134955 4310 4023 3991 3960 3265 2001 1764 1101 714 689 612 393 23937 455 14719 --
NM_020718chr16106499 5834 5473 4790 2629 1802 881 710 516 186 --21440 1025 --
NM_020727chr2133478 2940 2805 ------
NM_020728chr752916 2716 1158 313 119 22459 2223 32641 808 470 --
NM_020732chr621364 277 ------
NM_020734chr1273219 3192 2603 2080 1263 880 847 33080 3054 519 --12305
NM_020739chr1594081 3262 3162 1664 613 555 327 282 235 23239 735 --1172
NM_020742chrX32458 2032 612 ----1704
NM_020748chr1751863 739 296 204 191 --11427 --
NM_020749chr841921 1849 1446 377 --1283 --
NM_020750chr62558 97 ------
NM_020752chr1062658 2475 980 641 582 195 3771 441 307 ----
NM_020755chr6------132
NM_020760chr221539 574 1336 ----
NM_020761chr1721366 327 11972 ----
NM_020765chr1------1289
NM_020766chrX94229 4004 3375 1576 1564 1302 935 536 395 33922 3475 233 23861 799 13147
NM_020768chr552153 2039 716 309 161 --12106 --
NM_020772chr17197853 7795 7591 7273 7251 6860 6736 6597 6449 5916 5770 5722 2796 2491 2270 2251 1963 1557 421 25611 551 16937 22638 1899
NM_020774chr1865664 3929 2392 2049 607 243 14764 --12167
NM_020775chr1146 --2209 35 --
NM_020778chr1574749 4458 4214 1867 1816 1528 942 14449 1295 --
NM_020779chr2102646 2585 2390 2335 2069 1238 1037 1014 638 259 1346 --13203
NM_020782chr12124273 4084 3820 3279 1705 1666 1365 1315 1112 929 392 191 23746 3626 13954 --
NM_020783chr1851622 789 732 377 100 12185 11689 --
NM_020791chr1721011 379 ------
NM_020792chr362673 2632 945 455 306 71 22557 425 ----
NM_020796chr52232 213 --11166 --
NM_020801chr52750 76 ------
NM_020803chr451935 1480 703 87 77 32144 805 291 12216 --
NM_020806chr143725 612 327 ----1125
NM_020807chr1631779 267 90 ------
NM_020808chr11745 ------
NM_020809chr1131758 1707 287 12165 1931 --
NM_020810chr1463215 3164 3072 1405 996 111 13133 23150 328 --
NM_020819chr61109 ------
NM_020825chr1642942 2491 1014 362 23055 1022 23156 3094 --
NM_020834chr1441285 451 428 92 --11542 --
NM_020839chr361378 1333 1120 1064 1043 291 ----11481
NM_020841chr1243762 3039 2749 741 --23054 1009 --
NM_020850chr1683274 2924 2763 2489 2248 1135 876 255 ------
NM_020854chr1811533 ------
NM_020856chr1961181 407 379 334 234 60 1399 --1546
NM_020858chr1582388 2348 2050 647 538 273 138 74 --1408 --
NM_020859chr473523 3329 3066 2804 1289 739 231 21214 465 11614 11025
NM_020860chr42388 74 ----1896
NM_020868chr251386 582 432 422 348 11265 ----
NM_020871chrX31733 852 115 1256 ----
NM_020872chr321574 660 11164 21728 592 --
NM_020873chr32730 100 ------
NM_020888chr121353 400 ----1258
NM_020896chr113795 758 62 --1281 11062
NM_020899chr1751866 1853 1718 719 581 1756 1400 --
NM_020909chr274047 4028 3300 2710 2649 1577 440 ------
NM_020918chr1032833 2238 518 ------
NM_020919chr221296 110 ------
NM_020920chr141377 ------
NM_020921chr1483580 3139 3039 2952 2468 2329 1371 35 11071 1794 --
NM_020922chrX91880 1673 1537 1482 648 583 521 355 319 ------
NM_020927chr1662190 1942 1734 1652 411 285 ----1887
NM_020935chr284556 3948 3791 1714 1104 757 185 62 23899 3042 14430 --
NM_020940chr1062941 2856 2468 2324 2194 1178 1320 ----
NM_020946chr941745 1147 651 329 21167 705 11769 --
NM_020947chr1662169 1943 1891 1492 291 260 1765 11786 --
NM_020948chr141379 326 248 74 --12951 --
NM_020971chr19169 ------
NM_020973chr4--2640 234 ----
NM_020977chr442037 1851 791 397 --12122 --
NM_020981chr21762 ------
NM_020987chr1031205 415 220 ------
NM_020988chr1611114 11075 ----
NM_020993chr122425 70 11754 11984 --
NM_021003chr144693 678 61 30 ------
NM_021007chr242346 2066 1665 420 ------
NM_021032chr331727 1682 658 --11651 --
NM_021033chr1362970 2736 2677 2573 1164 988 23450 3281 ----
NM_021038chr333360 3213 2280 --2464 209 1342
NM_021064chr641508 604 553 156 --1338 --
NM_021069chr441608 1438 1421 1402 32036 1805 1431 ----
NM_021076chr223543 526 87 ------
NM_021083chrX103508 3446 3371 2536 2346 2281 1189 843 790 623 11237 ----
NM_021088chr24828 692 430 299 11856 ----
NM_021090chr2274211 3492 3479 1869 1347 1238 193 23424 1220 190 --
NM_021097chr262541 2499 2256 1911 483 218 ------
NM_021109chrX181 ------
NM_021109chrX181 ------
NM_021110chr82735 52 ------
NM_021111chr92508 325 21118 50 ----
NM_021116chr7158924 8643 7950 7624 7369 6839 6217 5583 2745 2353 2066 2059 1955 1916 1258 12039 36274 3077 2125 --
NM_021117chr1152243 1907 1686 742 318 ------
NM_021127chr1821358 481 --1223 --
NM_021132chr1011242 ------
NM_021137chr1732060 1645 178 11902 1593 --
NM_021140chrX2471 264 ------
NM_021145chr7------1722
NM_021151chr72395 384 ------
NM_021155chr1973022 2676 2567 2189 960 634 503 --12586 --
NM_021159chr421140 190 11546 ----
NM_021167chr742841 2283 644 332 --22420 660 --
NM_021174chr83720 265 229 ------
NM_021183chrX51881 973 894 523 108 21709 516 ----
NM_021190chr141326 1070 547 476 ------
NM_021192chr21417 ------
NM_021202chr2062184 1139 897 592 393 380 12961 22513 1127 12335
NM_021219chr211244 ------
NM_021222chr131317 937 184 1341 --11350
NM_021224chr91417 ------
NM_021229chr1231083 456 324 ------
NM_021237chr32304 227 ------
NM_021238chr1241657 1575 818 142 --12014 --
NM_021239chr1431158 1149 278 162 ----
NM_021244chr6------1178
NM_021252chr1071387 1332 811 796 231 89 49 ------
NM_021253chr641429 1391 1367 377 11401 2128 115 --
NM_021255chr1493694 3527 3017 3010 2571 1023 318 282 75 13572 1745 --
NM_021572chr65976 371 329 315 297 ------
NM_021574chr2252492 2388 2128 1964 706 22007 410 ----
NM_021619chr921190 1183 --21063 163 --
NM_021622chr1062256 2206 2016 1870 686 355 22249 547 21954 911 --
NM_021629chr394444 4252 3507 888 841 354 242 187 82 13820 24493 3225 1768
NM_021633chr12543 275 1903 ----
NM_021637chrX2197 96 1416 1227 --
NM_021638chr4114611 4529 3804 3732 997 595 505 288 224 211 190 --34932 3917 455 --
NM_021643chr221815 293 ------
NM_021644chr10--1191 ----
NM_021647chr4134655 3927 3801 3490 3169 1743 1033 750 733 559 518 277 129 ------
NM_021783chrX51677 586 509 378 35 12106 ----
NM_021784chr20182 1532 ----
NM_021809chr2041678 1007 654 296 --11581 --
NM_021813chr695703 5252 2207 1959 1842 1092 1014 851 187 12309 ----
NM_021814chr631533 1316 586 ------
NM_021818chr143996 336 210 ------
NM_021905chr642063 1936 1857 1465 ------
NM_021911chr585364 2126 2052 2003 1738 1147 367 115 12032 ----
NM_021912chr1533826 3768 3068 33588 3364 363 ----
NM_021913chr1981851 1792 1754 1431 525 93 78 70 ----1181
NM_021914chr1462192 2179 1529 867 512 453 22133 346 ----
NM_021931chr2021065 199 ------
NM_021935chr32931 40 ------
NM_021940chr631498 1366 1053 ------
NM_021942chr41843 ------
NM_021943chr632180 703 490 --183 1659
NM_021945chr643542 2610 628 265 --22981 1380 1978
NM_021947chr1751331 1118 852 366 249 ------
NM_021949chrX72599 2259 2221 2028 1167 773 631 ------
NM_021951chr93849 790 54 ------
NM_021954chr13133448 3434 3401 3141 3069 2957 2857 1452 1392 1141 929 819 216 ------
NM_021960chr162232 2142 833 780 560 240 --12675 --
NM_021961chr1187519 7467 7148 5825 5691 4671 2117 152 12477 22830 1808 --
NM_021962chr1752003 1734 658 634 358 --1165 1543
NM_021963chrX2732 67 1153 ----
NM_021964chr3115652 4569 4152 4026 2589 2480 1850 1421 514 204 35 11176 26350 2532 --
NM_021965chr9198 ----11249
NM_021970chr4127 ------
NM_021977chr683467 3260 3170 3147 2883 1299 572 67 12413 1557 1942
NM_021998chrX21313 388 ------
NM_021999chr132245 160 ------
NM_022037chr251025 934 763 278 218 --1684 --
NM_022041chr1622672 2093 12621 ----
NM_022048chr15116189 5051 4921 3962 2374 2084 2017 1005 753 744 566 26289 4728 --11043
NM_022049chr131538 1481 376 ----1403
NM_022051chr12568 175 ------
NM_022068chr182633 163 ------
NM_022073chr1431474 334 26 ------
NM_022075chr1178 ------
NM_022091chr621733 957 ----12090
NM_022093chr11609 1706 1912 --
NM_022114chr174185 4124 3934 3706 1402 1040 967 --11833 --
NM_022116chr731125 913 335 1253 1795 --
NM_022118chr132160 151 ------
NM_022121chr61308 180 ----
NM_022123chr14------188
NM_022124chr104200 165 122 110 ------
NM_022130chr511238 31485 969 280 ----
NM_022132chr51134 ------
NM_022133chr841742 1461 1162 231 21360 628 ----
NM_022137chr1472108 1915 1893 1404 1310 640 133 --21997 1616 --
NM_022138chr641320 522 285 227 --2126 102 --
NM_022165chr19165 ------
NM_022166chr16126137 5609 4796 4604 4598 2177 1872 1854 1828 1701 1654 1575 2913 624 35000 4513 2387 --
NM_022170chr721607 512 --21153 556 --
NM_022173chr251025 934 763 278 218 --1684 --
NM_022340chr343668 3402 945 22 --32699 1409 810 23632 158
NM_022351chr843509 1330 1092 557 12774 ----
NM_022361chr61422 1528 ----
NM_022373chr71899 1714 2788 362 --
NM_022444chr741591 1572 320 26 ------
NM_022455chr51112 ------
NM_022459chr13106085 5609 5337 5292 5041 4156 2080 1659 1562 1256 21803 130 12416 11730
NM_022465chr1252636 2412 577 503 348 ------
NM_022469chr133082 2346 426 22792 1036 ----
NM_022473chr1574426 3596 3224 3042 818 747 174 23474 441 11313 --
NM_022474chr1452530 2352 2118 649 560 --1544 --
NM_022475chr42601 568 ------
NM_022476chr163924 422 31 2830 247 ----
NM_022483chr521537 693 --11688 --
NM_022484chr72251 100 1897 1127 --
NM_022491chr1273561 3124 1381 986 179 155 116 33580 2489 2355 --11192
NM_022497chr3123186 2935 2702 2492 1497 1430 1069 941 880 838 524 69 --1999 --
NM_022552chr231198 408 174 ------
NM_022566chr152594 416 ------
NM_022572chr221523 1398 11251 21622 398 --
NM_022574chr752106 1861 869 173 149 --1712 --
NM_022648chr293704 3647 3551 2820 1840 1401 1069 884 98 12938 ----
NM_022650chr561031 902 263 247 178 101 1295 ----
NM_022652chr125983 885 814 734 341 ------
NM_022658chr1221341 167 1894 ----
NM_022716chr193137 2438 2195 2059 2014 1984 1104 770 555 ------
NM_022719chr2253463 725 650 308 199 23684 2678 22455 284 13846
NM_022726chr621663 258 1222 ----
NM_022731chr11223 ------
NM_022733chr131134 300 249 ------
NM_022735chr12181 103 21893 699 ----
NM_022739chr17--41191 799 438 250 ----
NM_022748chr762777 2757 1860 1801 1135 82 ------
NM_022750chr72274 174 142 ----
NM_022753chr172438 2032 1757 1717 742 715 141 2722 632 ----
NM_022757chr33982 775 182 ------
NM_022758chr673083 1179 1044 651 411 332 51 22108 743 22327 245 --
NM_022763chr372883 2845 2489 1241 1020 288 155 ------
NM_022771chr122836 82 --2326 35 1311
NM_022776chr321294 229 1356 ----
NM_022781chr972753 2694 2229 2140 2131 736 370 12402 22610 1080 --
NM_022787chr142327 2300 2074 1684 12750 2712 165 11808
NM_022818chr1641611 1229 408 264 ------
NM_022824chr521492 1271 ------
NM_022826chr231085 1075 960 ------
NM_022828chr53716 141 113 11376 ----
NM_022831chr161851 1660 1521 583 389 336 ----11448
NM_022832chr472596 2391 1795 1680 957 727 477 ------
NM_022840chr1831040 514 50 --1528 --
NM_022841chr1522266 668 1919 ----
NM_022843chr1331400 1211 45 ------
NM_022844chr161971 ------
NM_022845chr1652160 1684 307 248 33 ------
NM_022893chr262679 2348 2093 1206 960 731 2663 306 ----
NM_022894chr231679 1418 1283 2160 133 --1490
NM_022898chr14104632 4514 4244 3872 3161 2988 1825 1382 1215 963 21605 765 1665 --
NM_022901chr931617 1586 701 ------
NM_022912chr222820 209 1496 22742 1035 13077
NM_022918chr1152117 2086 1886 1493 1395 ----143
NM_022965chr421382 568 --2459 192 --
NM_022970chr1011222 --11361 --
NM_022977chrX1532 2697 485 ----
NM_023000chr1451652 1177 1116 611 394 ------
NM_023001chr1451652 1177 1116 611 394 ------
NM_023008chr19----1135 --
NM_023010chrX2660 518 ------
NM_023011chr132336 174 ------
NM_023012chr121775 ------
NM_023016chr252837 2820 2747 2615 1057 1199 ----
NM_023035chr192789 330 ------
NM_023037chr134929 800 722 324 ------
NM_023039chr52345 319 ------
NM_023067chr341332 1294 876 234 --11150 --
NM_023071chr122344 113 --1732 --
NM_023079chr1751721 1562 1428 650 248 11803 ----
NM_023923chr163523 3492 3430 3178 3000 1324 --31202 762 199 1139
NM_023929chr81862 ------
NM_023940chr42957 302 1744 ----
NM_023943chr31147 ------
NM_024007chr553028 2254 539 268 155 12662 ----
NM_024015chr172365 131 ------
NM_024019chr41424 ----11084
NM_024034chr201980 1717 ----
NM_024037chr13841 346 135 133 ----
NM_024045chr101182 ------
NM_024052chr1782414 2402 2247 1990 367 263 252 54 12865 ----
NM_024054chr7--1271 1337 --
NM_024061chr72568 408 ------
NM_024063chr15175 ------
NM_024071chr142584 481 ------
NM_024085chr24811 705 689 296 ------
NM_024086chr1753778 3238 1241 1141 474 13173 ----
NM_024091chr5----191 --
NM_024095chr122443 198 ------
NM_024106chr19157 ------
NM_024107chr174530 238 228 56 --1585 --
NM_024165chr6146 ------
NM_024294chr673083 1179 1044 651 411 332 51 22108 743 22327 245 --
NM_024312chr1231568 1446 411 11334 ----
NM_024315chr73433 312 306 --1174 --
NM_024332chrX3472 445 346 1411 1681 --
NM_024345chr9115915 5441 5171 5042 4744 3924 2344 1946 1400 1296 208 11201 22123 1578 --
NM_024408chr182610 2562 1276 930 790 626 568 250 --13159 --
NM_024411chr202551 46 ------
NM_024424chr112501 430 --11254 --
NM_024425chr112501 430 --11254 --
NM_024426chr112501 430 --11254 --
NM_024491chr31622 2609 167 ----
NM_024513chr363625 3465 2799 975 898 152 --33367 2477 1253 13488
NM_024524chr363094 3051 2006 1958 1240 824 ------
NM_024529chr12825 340 21122 1115 11132 --
NM_024539chrX21076 342 1880 ----
NM_024546chr132183 66 ------
NM_024548chr32347 242 ------
NM_024554chr141613 1246 1093 510 ------
NM_024557chr1121065 89 1442 1175 --
NM_024561chr1321237 1196 1974 1446 --
NM_024569chr162965 2014 1810 1180 1028 166 11089 ----
NM_024574chr4157 ------
NM_024582chr42919 309 --1717 --
NM_024590chr431423 703 438 21578 481 ----
NM_024595chr14940 410 98 59 --11009 --
NM_024607chr894448 4379 4355 3957 3716 1381 1278 799 424 --21617 986 13330
NM_024611chr1573100 2883 2601 1032 1016 507 431 2210 125 ----
NM_024613chr841861 531 465 53 ------
NM_024626chr161590 1534 1441 581 556 447 11502 ----
NM_024627chr2284748 4406 3718 3597 1947 1922 1397 329 24887 3138 1565 1536
NM_024628chr331114 964 220 --2938 124 --
NM_024639chr652162 2049 2026 1109 84 1703 ----
NM_024640chr13936 847 179 ------
NM_024643chr141434 --1148 --
NM_024645chr821223 605 1145 ----
NM_024646chr154011 3823 2682 1171 242 --32770 1583 501 --
NM_024652chr1531080 843 832 ------
NM_024663chr20----147 --
NM_024665chr383992 3203 2982 1475 1206 697 551 346 14305 ----
NM_024674chr13692 646 476 32997 974 262 42467 2332 635 458 --
NM_024686chr11436 1360 ----
NM_024699chr82694 321 ------
NM_024700chr11965 --1207 --
NM_024702chr173605 88 49 ------
NM_024705chr133824 229 42 --11129 --
NM_024713chr1531151 1055 253 --11077 --
NM_024721chr841946 936 749 741 ------
NM_024740chr1193889 3820 3584 3340 3159 2736 2561 1659 1091 13606 135 --
NM_024744chr242642 2300 1644 168 ------
NM_024745chr161303 --1721 --
NM_024749chr151884 786 666 65 53 ------
NM_024755chr152747 690 ------
NM_024757chr94983 935 283 184 --1239 --
NM_024761chr934562 4157 1609 34921 3938 1722 1160 14090
NM_024763chr111022 --11209 --
NM_024769chr112726 213 ------
NM_024770chr296009 4363 4286 4220 2379 1654 1125 916 433 12511 31950 1747 679 11006
NM_024771chr1152170 1680 984 928 389 --22254 1627 --
NM_024779chr1241557 1493 1352 1159 1284 1406 --
NM_024785chr221146 585 --180 1325
NM_024792chr173372 183 94 ------
NM_024798chr1532728 2235 2053 12644 1288 --
NM_024811chr112568 526 ----159
NM_024812chr842162 1983 1949 368 176 ----
NM_024817chr1595417 5044 4805 4545 3704 2149 1421 449 324 15004 ----
NM_024818chr331390 1047 958 11154 ----
NM_024828chr941610 1293 445 240 ------
NM_024841chr1142310 948 254 239 --11529 --
NM_024884chr1484270 4239 3958 3581 1235 987 870 589 --1367 --
NM_024885chrX4857 588 125 31 ------
NM_024887chr141379 427 302 161 --125 --
NM_024896chr921675 7