TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4762-3p
miRNA Sequence: CUUCUGAUCAAGAUUUGUGGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1132286 776 297 3824 210 41 13002 23165 2461
NM_000084chrX65978 2419 2410 1930 1223 1019 22542 2400 26233 4863 --
NM_000092chr243776 3601 3371 1352 33516 719 285 34148 2833 1167 --
NM_000104chr292794 2574 2497 2341 2101 1923 1117 445 139 3950 552 30 --12516
NM_000176chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_000217chr1274629 4403 3765 1063 803 468 371 24258 390 15114 13571
NM_000240chrX42055 1804 1577 709 3909 594 354 --2508 296
NM_000259chr1595653 5368 5084 2325 2112 1360 874 837 720 --46295 5059 4560 4287 21697 1507
NM_000321chr1331412 695 560 31664 1446 434 11634 31263 535 528
NM_000332chr6146687 6607 6336 5897 5805 5309 2278 1875 1083 891 564 487 337 135 45527 2572 2412 1756 --1531
NM_000337chr585852 4911 4268 2050 1851 1789 918 345 --24939 4512 15842
NM_000368chr964817 4731 4487 3039 1734 410 41855 1830 1273 656 --13211
NM_000390chrX73423 2352 1313 929 899 371 54 42954 2789 263 92 12472 --
NM_000448chr1162477 2240 1066 723 675 248 33134 3015 157 2788 613 --
NM_000461chr354228 4139 3647 3138 1803 21383 806 --24391 714
NM_000555chrX107693 7423 7326 7252 7235 6813 6244 5388 979 21 35973 1880 1095 35774 5362 5274 11347
NM_000618chr12106218 5847 5207 5020 4664 4637 4582 2223 2040 1396 --34493 2355 2180 14960
NM_000618chr12106218 5847 5207 5020 4664 4637 4582 2223 2040 1396 --34493 2355 2180 14960
NM_000633chr1884548 4088 4069 3937 3553 1678 1106 939 --11270 23768 914
NM_000809chr4147308 6621 6170 5860 2783 2768 2663 2054 1407 1143 1058 717 410 278 36689 2654 193 58707 8238 6135 1127 1103 28991 7574
NM_000813chr574459 2092 1514 1001 961 316 288 1572 13688 22216 761
NM_000814chr1533752 3303 2679 11172 --1446
NM_000866chr31553 21893 1650 11755 21659 202
NM_000899chr1233579 3443 278 53137 2896 2670 1000 164 1764 11064
NM_000902chr362844 2575 2498 2186 1167 1091 1720 --13188
NM_000926chr11128506 8297 8194 8026 7469 6753 5933 3791 3494 2093 889 61 59316 7205 3592 3172 1777 33784 760 185 27046 2670
NM_000958chr531120 122 91 ----21056 360
NM_000959chr163525 3086 2758 2649 2424 136 43760 3442 3313 912 --21256 1004
NM_001001323chr1262501 2256 2195 1228 1137 91 42149 1949 842 23 ----
NM_001001419chr594782 4024 3964 3833 3384 3199 1795 1366 199 1244 13436 --
NM_001001420chr594782 4024 3964 3833 3384 3199 1795 1366 199 1244 13436 --
NM_001002257chr2113435 3387 2410 2400 2393 2231 1410 1326 844 598 266 52968 2835 2472 2431 867 12801 1508
NM_001002860chr14104166 3112 2944 1652 1490 896 864 767 736 151 54410 4321 3371 663 545 1508 1814
NM_001003652chr18107085 6905 6076 5870 3459 3274 2415 1285 516 175 13158 27468 2140 13189
NM_001003674chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_001003675chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_001004441chr561568 1561 1493 1314 1097 635 --1578 145
NM_001005375chrY81520 1490 1222 1207 274 261 219 60 11551 ----
NM_001005473chr5106455 5990 5877 5314 4678 4171 2617 2464 702 396 35816 4020 1643 --25738 1860
NM_001005502chr1274571 3651 3337 1353 779 577 43 34383 4172 3570 13320 --
NM_001007094chr1093538 3295 3194 3162 2796 1385 1053 975 620 33405 3057 1763 22856 421 24230 272
NM_001008239chr1883636 2744 1298 1252 1065 307 250 94 11151 11046 --
NM_001008405chr751378 1233 737 725 153 21144 264 2231 76 --
NM_001008726chr1431078 398 294 11353 --11398
NM_001009899chr395660 5567 5475 5340 4659 4162 2318 1985 154 35715 3987 177 26340 4103 1940
NM_001011666chr786512 5872 5851 5778 4637 4051 1073 76 --25665 2641 15605
NM_001012420chr1562824 2128 1931 1914 1074 912 12594 --12418
NM_001012423chr1572824 2386 2128 1931 1914 1074 912 12594 11008 12418
NM_001012754chr1351655 1596 1542 1456 731 --11965 1119
NM_001012755chrX74475 3420 3307 1417 1110 890 235 24316 1941 --24294 870
NM_001013620chr1297892 7594 7517 6765 5769 2548 2256 2071 44 57946 7103 3191 2479 357 26752 1935 --
NM_001014380chr1353875 724 534 496 261 21769 315 --11259
NM_001014797chr10167541 6834 6268 6004 5860 5689 5624 5402 3070 2298 1709 1423 1402 1069 847 479 57398 6742 5877 5381 1320 23227 1715 2398 111
NM_001017926chr82518 422 1459 1695 11655
NM_001018065chr9106043 5011 4980 4341 4149 4132 2168 1329 1265 1240 25920 4868 24709 255 --
NM_001018066chr9106043 5011 4980 4341 4149 4132 2168 1329 1265 1240 25920 4868 24709 255 --
NM_001018067chr134647 3651 384 54978 4760 1441 250 212 14302 11265
NM_001018068chr134647 3651 384 54978 4760 1441 250 212 14302 11265
NM_001018069chr134647 3651 384 54978 4760 1441 250 212 14302 11265
NM_001018074chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_001018075chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_001018076chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_001018077chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_001024094chr583791 3326 3096 3089 1252 1240 1084 1000 13442 1713 2481 257
NM_001024649chr552640 2186 1961 1946 508 22542 99 --12625
NM_001025076chr1031994 855 289 14851 --26032 5845
NM_001025077chr1055096 5089 4619 2213 1647 36209 890 673 15015 27390 7203
NM_001025233chr1242590 1787 1123 332 22762 2071 22408 997 1884
NM_001025580chrX53763 2917 1686 1221 979 32848 929 913 12880 --
NM_001031665chr191291 ----2381 300
NM_001031695chr2264135 4122 3769 3326 1881 754 44254 1679 1063 900 21027 971 1387
NM_001032999chr2074457 3350 2111 1304 1143 563 521 34028 3581 2004 15226 11207
NM_001033557chr231419 1260 1028 ----11017
NM_001037165chr788808 7641 7443 6711 6379 5578 5515 3246 48178 3231 1942 1331 26264 1736 16641
NM_001037553chr21115194 4854 4564 4526 4182 3991 3251 1692 903 774 157 --1853 192
NM_001039538chr2--13440 2693 556 22251 1384
NM_001039547chr3137445 7288 6881 6786 6149 5550 5408 3029 3018 2128 1948 1309 1061 27928 2966 12400 26907 2537
NM_001039585chr163782 3343 3015 2906 2681 393 44017 3699 3570 1169 --21513 1261
NM_001039618chr1162334 1459 1042 860 705 101 --15762 25441 4760
NM_001039709chr2074457 3350 2111 1304 1143 563 521 34028 3581 2004 15226 11207
NM_001039840chrX96063 6042 5803 5352 5322 4123 4059 2028 1021 22002 430 --14987
NM_001040152chr784879 4712 4695 4687 4390 3136 1170 875 33941 3635 1722 --13314
NM_001040202chr44963 700 665 572 ----2683 345
NM_001040429chr1343591 3030 2830 1237 3928 872 182 13272 12344
NM_001040441chr175214 4304 4152 4009 1980 1805 848 23337 1213 23923 1361 11368
NM_001040665chr764822 4552 3891 979 810 282 14038 --23258 724
NM_001042599chr264917 3118 2101 1845 241 170 47846 2540 1073 976 21818 474 --
NM_001042601chr372703 2680 2462 2348 2016 1288 1234 12652 12026 12295
NM_001042604chr394601 3143 1404 1132 666 635 495 357 143 --2644 84 --
NM_001071775chr1331684 315 186 11252 1526 11239
NM_001099678chr365334 4909 3964 1591 1477 1458 25104 1752 36301 2510 1470 11295
NM_001100108chr1117839 7385 7313 7195 7172 7065 6123 5481 3255 2048 857 57589 7103 6560 3136 85 1545 1658
NM_001106chr3159631 8489 8363 8351 8168 6688 2993 2887 2874 2558 2403 1905 1465 466 359 29608 6539 26042 3611 --
NM_001167chrX66670 6347 6316 6084 5457 389 22607 904 2894 82 --
NM_001196chr221905 11060 --21289 457
NM_001201chr453155 1095 427 281 131 32625 2552 1379 23051 1415 1816
NM_001204chr2137387 6849 6703 6475 6390 6131 5953 5779 5521 2986 2526 1407 1100 26277 5187 11627 --
NM_001256chr1762544 2536 2471 2286 1930 331 22917 782 2922 857 --
NM_001259chr776389 6367 5538 5416 2415 1746 737 46062 4596 1830 990 --24460 588
NM_001412chrX73737 2631 2572 2286 840 819 606 23585 2965 12753 13759
NM_001609chr10124434 4222 3817 3707 3244 2941 2841 2807 1566 1473 694 585 21152 793 13085 33459 3411 1027
NM_001616chr253323 1283 1185 343 324 32228 2215 1101 12595 12900
NM_001650chr1854020 3853 3438 1196 39 1674 11455 43134 3085 2632 95
NM_001709chr1161773 1013 846 806 698 24 1345 12821 12067
NM_001746chr552640 2186 1961 1946 508 22542 99 --12625
NM_001821chr174048 1832 1634 1308 1259 869 212 1771 34837 92 50 --
NM_001858chr643489 3428 619 245 11492 24788 1402 13944
NM_001859chr943634 2784 927 685 22820 2689 23025 1204 23371 494
NM_001874chr1274571 3651 3337 1353 779 577 43 34383 4172 3570 13320 --
NM_001918chr1128063 8046 7504 7278 6800 6523 5755 2428 1685 366 220 155 47917 1967 1904 1327 58168 8020 5879 3389 2892 59171 8748 8297 1466 1281
NM_002006chr455727 5122 3943 769 353 95504 5302 4864 4408 3572 1885 879 306 56 --25062 341
NM_002009chr1542358 448 419 213 12326 1606 1537
NM_002025chrX58965 7626 3362 2793 451 38831 6618 5847 37288 6796 2245 38720 7990 3282
NM_002040chr2152503 2208 687 546 187 2781 265 --22635 2348
NM_002158chr221289 324 62803 2540 1300 701 617 562 2921 670 1188
NM_002214chr744938 4911 4876 3507 51522 1501 1144 943 190 1773 15298
NM_002223chr1253240 3022 2460 1151 964 23690 2922 --23004 242
NM_002264chr394508 3936 3811 1698 1557 785 465 275 33 34757 3562 657 23983 3781 --
NM_002336chr12114431 3555 1963 1930 1848 1604 1509 1284 687 413 89 54017 3988 3681 3565 3147 23910 2006 --
NM_002374chr2--13440 2693 556 22251 1384
NM_002481chr176001 4858 2528 2221 2117 2087 489 77056 6852 6416 5951 2892 1261 565 16623 --
NM_002577chr373805 3798 3295 2838 588 381 262 21046 664 --13314
NM_002655chr884702 3718 3530 1655 1499 1092 804 506 14411 --11278
NM_002737chr1766344 5482 5274 2074 1977 1456 66654 6053 5949 5911 5709 4369 --11165
NM_002822chr1231541 1339 484 31506 1235 514 11266 11163
NM_002837chr1274539 4032 4022 3438 1407 813 531 21811 1253 12811 11838
NM_002906chr1131893 1527 488 21465 848 1575 1564
NM_003099chr15136165 6078 5344 4913 4239 4228 4188 1177 1046 447 403 388 302 14834 26291 4858 12047
NM_003112chr742842 2645 2511 2366 2765 527 22907 2189 22590 2462
NM_003199chr1864069 1571 1222 1070 1056 247 13535 12067 11117
NM_003236chr283318 3003 2508 2430 2221 1239 619 66 32407 1047 840 --1734
NM_003262chr375129 4887 4641 4389 4182 3914 1036 31940 1703 1016 13582 23937 1952
NM_003320chr11144395 4292 3617 3172 3030 1395 1368 1346 1230 1105 801 609 540 404 21339 1182 23238 1355 --
NM_003410chrX1279 52125 1991 1033 674 430 33016 1885 1057 --
NM_003421chr1093538 3295 3194 3162 2796 1385 1053 975 620 33405 3057 1763 22856 421 24230 272
NM_003439chr742912 2313 1342 1262 31369 1170 57 --23391 3311
NM_003489chr2173037 2882 1254 1121 371 238 179 22172 1318 1958 33354 764 497
NM_003590chr243800 1417 1208 862 23847 302 23130 1403 13166
NM_003615chr363623 2556 1229 931 920 860 23376 233 1913 --
NM_003644chr17125784 5706 5644 5573 2353 1843 887 799 692 627 430 394 16616 1436 11654
NM_003861chr1482614 2526 2129 1867 1157 1028 692 475 --22268 1845 1386
NM_003895chr2112074 31608 285 267 1691 21902 1516
NM_003966chr5116452 6276 5635 5517 4879 1968 1868 1687 1307 335 86 26184 1678 26120 5975 15414
NM_003983chr16104466 3902 3161 3058 1708 1134 829 646 202 170 34154 1267 625 13398 --
NM_003994chr1233579 3443 278 53137 2896 2670 1000 164 1764 11064
NM_004028chr1854020 3853 3438 1196 39 1674 11455 43134 3085 2632 95
NM_004035chr1744816 4694 1778 775 51001 930 221 152 35 14233 13970
NM_004081chrY81520 1490 1222 1207 274 261 219 60 11551 ----
NM_004133chr832274 1938 67 2764 575 --2454 391
NM_004171chr11189127 8763 8528 8478 8361 7942 7698 7646 7131 6632 6149 3694 3350 3142 3077 2716 2472 1718 27016 2654 37539 7445 3131 36932 6470 3344
NM_004232chr1853740 2952 1210 834 528 23225 745 23287 2763 --
NM_004293chr923026 2716 83696 3407 2820 644 598 567 461 77 2830 389 --
NM_004338chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_004458chrX41826 536 389 88 42344 1947 1046 851 1884 --
NM_004480chr14------2641 615
NM_004586chrX75238 4591 1657 1553 903 731 206 33799 3783 1254 12080 11839
NM_004612chr994452 3925 3324 3265 1850 1711 606 483 418 11739 11142 --
NM_004719chr1232782 2011 841 --32364 2048 32 32508 2408 330
NM_004734chr13103186 2630 2568 2453 937 695 611 576 369 47 22619 674 21288 53 --
NM_004745chr8116334 5774 5382 5094 4611 2120 1410 432 373 293 163 26872 5086 --15372
NM_004774chr1742927 2736 757 87 1836 12998 22704 152
NM_004781chr14553 370 342 60 11640 21303 175 21268 620
NM_004781chr14553 370 342 60 11640 21303 175 21268 620
NM_004788chr1152173 2093 1793 1758 136 1242 --1440
NM_004791chr131539 --3618 497 49 2197 160
NM_004815chr173529 1762 1546 1350 1062 832 360 34938 3086 2981 23707 3141 14714
NM_004857chr1474730 3984 3736 3091 3080 961 705 23642 2958 14272 --
NM_004859chr1733018 718 195 32642 2364 2262 --22704 2458
NM_004866chr594166 1958 1922 1754 1628 1445 1413 1387 559 15030 12025 --
NM_004904chr786512 5872 5851 5778 4637 4051 1073 76 --25665 2641 15605
NM_004956chr784374 4334 4222 3913 3330 2816 1199 1092 23386 515 ----
NM_004992chrX76063 5204 2590 2382 1701 971 873 48364 8306 7916 2004 --26282 2314
NM_004992chrX76063 5204 2590 2382 1701 971 873 48364 8306 7916 2004 --26282 2314
NM_004999chr663738 3444 3154 1374 1201 686 11006 23473 868 23761 777
NM_005065chr14135169 4959 4740 4646 4587 4140 1907 1539 1340 1235 552 282 147 11047 34980 4824 3434 23769 842
NM_005093chr2074457 3350 2111 1304 1143 563 521 34028 3581 2004 15226 11207
NM_005119chr1------2478 329
NM_005121chr1742338 1097 875 377 --23099 2761 12439
NM_005156chr963962 1401 1020 733 503 293 54144 3718 965 872 235 31639 1389 457 1250
NM_005235chr264917 3118 2101 1845 241 170 47846 2540 1073 976 21818 474 --
NM_005238chr1183341 2949 2850 2759 1323 754 255 232 --23386 375 13190
NM_005256chr113691 616 269 ----1283
NM_005359chr18116371 6300 5953 5662 5584 4953 4622 2012 1726 212 191 --24137 36 --
NM_005436chr1014040 1157 1800 34125 1361 938
NM_005440chr1773294 2550 2425 2157 1007 935 714 --32202 2122 694 13015
NM_005497chr1795771 5539 5197 4397 4293 3801 3783 3721 2295 32070 2011 857 25099 647 23822 997
NM_005504chr1286170 5467 4875 4784 4511 2288 1123 886 24623 1716 45475 5275 941 811 --
NM_005578chr375058 4479 3833 3325 1888 619 581 21740 129 31686 1044 612 14152
NM_005611chr162239 171 1279 11250 11063
NM_005668chr544147 1348 1337 479 21722 572 1349 11090
NM_005725chr152376 2091 1882 578 413 3430 366 341 ----
NM_005746chr732626 2375 2102 22120 760 22167 1751 22581 1793
NM_005759chr253870 3817 3301 1159 292 44032 1575 332 310 14076 13171
NM_005785chr1211593 21709 303 2390 338 31376 41 24
NM_005824chr73707 76 68 3750 493 157 2294 122 --
NM_005863chr1031193 351 226 ----11389
NM_005901chr18107085 6905 6076 5870 3459 3274 2415 1285 516 175 13158 27468 2140 13189
NM_005903chr594782 4024 3964 3833 3384 3199 1795 1366 199 1244 13436 --
NM_005935chr4105161 4269 3364 3234 2051 1799 1472 1191 1126 1027 34308 3830 3244 23322 87 11353
NM_005941chr873905 3851 3825 3210 1041 1028 287 1908 23952 3786 1403
NM_005955chr175066 4956 4405 3680 3425 1434 911 181 1939 34479 4185 484
NM_006007chr923123 509 13554 23306 1637 11556
NM_006055chr262175 1210 1147 648 182 133 22917 2595 --1826
NM_006060chr763931 3412 3118 3093 1144 651 2931 329 14370 13440
NM_006136chr73501 137 90 11245 --1958
NM_006153chr3------2613 485
NM_006206chr442175 1185 887 619 22791 59 --1969
NM_006265chr841316 260 239 188 11435 11131 11105
NM_006282chr2094702 3935 3341 3015 1838 1574 1092 1043 242 24157 128 11485 13677
NM_006315chr463689 2841 1214 1062 653 494 13375 1904 13473
NM_006393chr1043635 3143 686 129 23644 1718 --21300 891
NM_006534chr2012685 13267 32777 935 396 11359
NM_006544chr1496077 4640 4621 4539 2327 1554 1525 472 307 45481 1642 1171 369 34725 4207 655 11814
NM_006561chr1031994 855 289 14851 --26032 5845
NM_006599chr16148120 7723 7650 6817 6187 5893 5698 5604 5594 5395 5229 3023 2987 2229 96283 6241 6053 6037 5358 4985 2319 1862 657 17240 1349
NM_006620chr664545 3892 3025 1742 1439 852 34625 3627 3605 14653 14789
NM_006708chr62264 32 21153 392 1249 11065
NM_006731chr994886 4682 4333 1568 1095 633 566 528 495 35293 4463 1937 35799 5477 616 --
NM_006750chr16107829 7513 7246 6784 5509 5391 5084 3053 645 415 37761 2266 1330 12313 --
NM_006777chrX52297 597 480 151 56 --1612 11139
NM_006851chr1262530 1080 582 534 416 164 31154 744 105 12175 --
NM_006868chr1842153 2120 2054 456 1180 --31041 589 520
NM_006915chrX21635 921 12138 22357 443 1273
NM_006924chr1793868 3785 3555 3309 2784 1522 1069 465 99 23667 1264 13708 --
NM_006948chr2141770 1673 164 60 --22294 2002 12327
NM_006956chr721790 277 --1464 41880 88 52 26
NM_006981chr952517 2194 950 843 565 ----32846 2371 2308
NM_007007chr1254638 3778 3590 3462 3294 21697 1353 34503 1680 644 13684
NM_007038chr2155654 5543 5150 2290 269 32423 1493 1345 14767 25333 1114
NM_007106chr13192 182 1328 1820
NM_007222chr82518 422 1459 1695 11655
NM_007249chr13119179 9095 8918 8380 7142 6797 6039 5917 2472 2226 313 59207 7336 6226 2749 1599 37058 3713 1429 27257 3578
NM_007287chr362844 2575 2498 2186 1167 1091 1720 --13188
NM_007288chr362844 2575 2498 2186 1167 1091 1720 --13188
NM_007289chr362844 2575 2498 2186 1167 1091 1720 --13188
NM_007292chr1744816 4694 1778 775 51001 930 221 152 35 14233 13970
NM_007350chr1264566 4287 3808 1550 1270 1020 34241 1202 498 --11123
NM_012081chr532788 2306 705 23501 480 --1314
NM_012096chr323729 3603 33715 2434 955 1520 11495
NM_012214chr296083 5565 5148 4874 4796 1662 1328 974 399 16019 --1459
NM_012243chr14780 347 326 230 2951 591 1219 --
NM_012252chr784687 3856 2109 1987 1313 886 622 443 41708 1468 735 705 1843 11629
NM_012262chr154056 3973 3762 1053 1008 64187 3450 1730 1640 1625 311 24778 4750 --
NM_012281chr721805 531 11676 32046 778 278 1772
NM_012338chr721224 829 3892 416 81 --1481
NM_012382chr5104298 3942 3741 3734 3313 3236 1720 1508 1023 442 34083 1253 458 12894 11476
NM_013231chr14113660 3487 3293 3140 2972 868 822 408 378 358 38 21614 1516 13427 --
NM_013381chr1252331 1991 1585 340 36 ----11834
NM_014048chr1675230 3473 2000 1071 1006 777 696 33255 1775 567 --14414
NM_014106chr1542988 2879 2700 1080 1176 --12388
NM_014112chr863404 1593 1429 1156 961 938 24449 1942 14477 14688
NM_014141chr753259 2065 1628 879 367 34444 3387 518 24550 1944 15335
NM_014155chr11106405 6370 6296 6124 5930 5483 2749 2289 2160 600 25732 2420 27071 248 --
NM_014243chr421399 644 1333 --21600 444
NM_014253chrX42228 2033 2002 1870 22442 266 186 12319
NM_014309chr2264125 4112 3759 3316 1871 744 44244 1669 1053 890 21017 961 1377
NM_014331chr496722 6710 5734 5499 4985 3079 1612 1308 683 36787 6548 6221 37387 6277 810 42635 1333 755 707
NM_014423chr515310 44508 2153 1689 1583 --24333 1215
NM_014616chr361401 1234 1085 782 450 131 --1992 1698
NM_014701chr1593159 2167 2131 1145 1105 1030 891 532 362 3845 739 439 ----
NM_014702chr643482 3404 1329 1275 33397 2639 781 43475 3034 2136 186 21159 1065
NM_014721chr6127052 7015 6710 5665 5543 2284 1721 1651 1513 895 823 553 46518 6412 2334 862 56421 2963 2438 2417 266 1405
NM_014729chr831827 815 659 12041 --198
NM_014730chr1254047 3360 1891 1672 327 64945 4139 4039 3495 1118 357 25263 4147 11080
NM_014730chr1254047 3360 1891 1672 327 64945 4139 4039 3495 1118 357 25263 4147 11080
NM_014746chr253579 3011 759 599 488 41662 1595 609 368 13492 13522
NM_014774chr132090 1158 990 42760 404 198 23 --22656 755
NM_014819chr52729 542 2508 129 1532 12169
NM_014838chr2272786 2675 1831 1037 887 381 103 31147 1064 672 11018 --
NM_014873chr123381 910 54816 3544 3061 1557 354 2693 85 13505
NM_014877chr17106937 5432 5007 4787 2894 2750 2011 1879 1521 1360 15423 45780 5242 4780 1107 --
NM_014904chr1063317 2872 1137 544 309 97 52547 554 410 380 332 14027 11577
NM_014906chr1773852 2785 2585 1622 1303 1269 348 2820 610 156 13781
NM_014934chr1352630 1243 1143 837 178 42965 2935 2594 278 1662 13518
NM_015026chr1264101 3863 3665 3055 1166 366 34053 3691 3428 13189 11784
NM_015032chr131567 22825 917 --21003 964
NM_015051chr943115 2827 2591 2528 --2762 225 23349 1078
NM_015068chr773731 3564 3547 3539 3242 1110 22 52793 2487 1366 991 574 11292 --
NM_015071chr5126455 5921 5599 5386 5245 4286 2518 2255 2120 2042 1575 343 32189 1316 331 1928 16332
NM_015092chr1694261 4228 4202 3741 3457 3177 2865 1083 40 44687 4158 557 406 --13900
NM_015154chr1553160 3004 2525 925 363 11026 22268 759 1383
NM_015156chr1483568 3237 2693 1327 1009 420 340 56 11627 21165 1017 --
NM_015200chr441920 1786 493 111 22321 1797 21695 652 11855
NM_015310chr8126240 6150 5414 5332 5204 1926 1881 1615 1483 1116 574 254 38414 5674 1525 37530 2879 2010 --
NM_015313chr11134479 4233 4086 4067 3407 3062 1863 1843 1420 909 480 335 260 1668 --24015 243
NM_015335chr1232380 1009 911 --22293 1861 11713
NM_015336chr1242260 2251 2063 475 12243 22694 798 31773 1056 343
NM_015359chr831934 631 548 --12425 22907 1014
NM_015365chrX53763 2917 1686 1221 979 32848 929 913 12880 --
NM_015375chr1114618 4290 4187 4069 3578 3415 1710 1454 865 535 419 23382 427 14629 24039 1333
NM_015535chr262870 2611 1453 1233 673 379 31529 1344 647 3844 286 90 13222
NM_015564chr593420 2913 2836 2748 2725 2509 868 607 30 1338 22235 2178 --
NM_015569chr164760 4729 3997 3877 1420 722 1190 23974 3319 11644
NM_015640chr134647 3651 384 54978 4760 1441 250 212 14302 11265
NM_015879chr18198335 8289 7839 7747 7482 6879 5440 5267 3423 2801 2702 2437 2415 1756 1233 1011 944 409 70 47797 6693 6463 1742 27937 363 12629
NM_015886chr855474 4701 3872 1147 771 44109 1535 1061 813 24659 4432 --
NM_015888chr162939 2261 1352 1051 372 119 22892 2473 12483 --
NM_015906chr184789 3713 3457 1569 1283 1171 453 154 41649 1633 1531 291 11521 14849
NM_015971chr17------2333 319
NM_016009chr134364 3426 578 24085 1745 --34518 3341 126
NM_016018chr832285 2241 287 21738 910 --1558
NM_016021chr633013 996 979 22292 964 12773 12780
NM_016083chr653677 3438 3245 2722 1584 22849 593 53559 2889 2778 2678 806 1383
NM_016132chr1532173 2106 1208 32432 2414 405 --12562
NM_016206chr3148960 8917 7973 7093 7009 6982 5843 3120 2897 2368 2315 2162 1552 1397 55534 1259 511 367 328 --13252
NM_016248chr1343394 3124 2715 2604 43927 3415 1070 785 --1435
NM_016260chr2117591 6994 6941 2894 2760 1962 1585 1175 789 379 351 107552 7201 6600 6025 5902 4615 2644 1462 1028 482 ----
NM_016271chr1832222 748 428 1867 1634 1799
NM_016289chr272008 1926 786 408 326 227 63 11638 42319 1490 1433 475 --
NM_016297chr2103513 2956 1364 1087 1055 994 830 716 665 568 12395 ----
NM_016485chr641597 833 718 138 --177 21993 438
NM_016531chr493857 3111 2822 2649 1656 1389 1310 352 202 --23772 2832 1368
NM_016577chr354454 4306 3613 3294 167 11600 44139 3886 3214 795 24270 3094
NM_016929chr654028 3445 3111 2928 825 33194 437 351 11712 23840 3316
NM_016953chr265255 4703 4049 2145 1242 530 45012 4816 1956 93 --15324
NM_017447chr2121432 1305 44225 4094 2932 734 1840 1611
NM_017563chr3126380 5829 5690 5573 4930 4631 4537 4481 4422 4252 2128 1300 45564 2310 2273 1612 25500 273 --
NM_017637chr9108853 8567 7431 6520 3671 2924 2860 2275 1240 1221 77125 6894 3059 2977 2212 1982 1591 11127 --
NM_017650chr795949 5130 5042 4886 4781 3827 2264 1426 762 34326 1781 1651 14155 1981
NM_017658chr1484536 3986 3971 3810 3526 2995 761 657 13803 11096 13011
NM_017709chr164274 4128 3756 3310 1357 1167 21486 1128 33687 3025 755 13791
NM_017801chr372607 2435 2197 2010 1956 1918 1044 52159 1880 1658 882 394 11729 --
NM_017813chr855429 4599 4154 1764 171 35092 4781 1188 --21715 138
NM_017831chr1884388 4362 4009 3926 1683 1014 603 302 33899 975 894 14722 --
NM_017848chrX74602 4560 4273 3893 1287 1253 562 34582 582 312 --1683
NM_017919chr985504 4830 4736 3755 1743 454 441 426 14190 54785 4279 4051 2285 1885 --
NM_018003chr1551885 1603 936 413 149 22252 354 --22425 653
NM_018014chr2--21078 931 11044 21205 987
NM_018017chr1052880 2247 1857 1786 579 22308 716 22388 768 12417
NM_018036chr14123887 3777 3702 3301 3278 3178 1402 1299 1131 388 73 53 23381 109 --23813 981
NM_018046chr541921 1344 1219 439 21199 127 1388 11477
NM_018085chr1138056 6782 5826 5632 3282 3224 2498 2394 1663 965 581 494 355 45648 3199 827 703 37898 5960 1240 11152
NM_018105chr851183 1015 447 424 117 1975 1412 --
NM_018191chr1372141 1856 1580 1375 689 303 106 11624 1751 --
NM_018246chr852544 2293 862 496 184 22686 2259 --12619
NM_018374chr774950 4886 4774 4244 3722 3341 1401 34686 1109 846 ----
NM_018440chr8108328 6978 6740 6314 6208 3081 2791 2539 2099 1598 47787 2671 1498 380 12071 17462
NM_018566chr1104882 4873 4665 4537 3877 3433 1709 1413 1273 584 22041 1519 ----
NM_018638chr1265095 4179 3857 3486 1857 636 35318 4715 1374 --2605 213
NM_018710chr851359 1190 1019 981 544 1496 --11055
NM_018847chr941887 455 334 93 11594 --21785 1552
NM_018947chr774661 4432 4201 3649 1372 393 251 34951 4800 732 ----
NM_018970chr763041 2036 1258 588 409 176 11249 ----
NM_018999chr1073980 3286 3006 1095 962 111 26 11011 34882 3928 504 14214
NM_019001chr394601 3143 1404 1132 666 635 495 357 143 --2644 84 --
NM_019080chr1321433 527 1618 --1515
NM_019087chr51165 1352 --31606 1247 558
NM_019610chr152056 1645 867 499 411 ----12107
NM_020132chr21115194 4854 4564 4526 4182 3991 3251 1692 903 774 157 --1853 192
NM_020133chr646288 6233 4276 4110 46145 5623 4305 2107 11010 14863
NM_020144chr712018 1739 2581 387 2622 105
NM_020336chr2083384 3243 2957 2815 2732 1377 907 417 21065 960 --1684
NM_020347chr362106 1588 859 847 743 133 21628 727 1636 --
NM_020420chrY81520 1490 1222 1207 274 261 219 60 11551 ----
NM_020640chr352208 2095 1529 590 292 1747 --1357
NM_020718chr1666427 5151 4732 2204 1498 51 35967 5608 4239 --22468 2107
NM_020772chr1798242 7887 6139 5626 3027 2469 1476 196 41 87113 6945 6061 5997 3213 2550 2497 1842 27727 7643 18625
NM_020774chr1875784 4331 2494 2222 1665 1369 659 46222 4669 2424 1193 13864 11954
NM_020802chr111735 23164 2834 --33202 3001 988
NM_020810chr1473496 3489 2457 2446 1048 606 408 11152 1581 11161
NM_020828chr19--1497 --31300 555 327
NM_020844chr877723 7386 7189 7178 4792 2378 2324 25423 530 35196 1121 1052 16000
NM_020859chr464069 3805 3501 2784 2697 1095 33773 1333 337 23822 2879 23711 3534
NM_020918chr1053136 2501 944 805 598 23379 606 13200 1690
NM_020948chr183639 3241 2827 2803 2663 2576 2423 186 ------
NM_021038chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_021045chr1021977 953 32623 972 83 --2153 63
NM_021061chr874106 3350 3284 3169 3014 2986 1408 83644 3236 3202 3109 3075 2922 2770 179 11761 22864 980
NM_021148chr732286 1795 717 1479 1629 22192 573
NM_021163chr782894 1043 464 407 384 286 210 122 2965 23 12420 12457
NM_021629chr3104291 4220 3630 3387 3258 1786 847 647 266 112 --11602 --
NM_021645chr1342121 1547 179 170 11632 1187 --
NM_021813chr645512 4976 4899 1131 44150 1266 543 350 --35181 3611 1201
NM_021911chr574459 2092 1514 1001 961 316 288 1572 13688 22216 761
NM_021912chr1533752 3303 2679 11172 --1446
NM_021964chr3106127 5901 5343 4340 2540 2222 974 930 665 39 14452 --21279 240
NM_022133chr831517 756 47 1552 --11542
NM_022351chr82938 592 21227 1047 --33331 1396 71
NM_022459chr1395674 5468 4768 4703 4297 2214 963 478 351 25139 1241 11286 15084
NM_022828chr551562 1118 657 393 131 11430 1372 1422
NM_022898chr1454286 3131 2931 1355 673 33753 3360 1711 11266 13733
NM_022977chrX41826 536 389 88 42344 1947 1046 851 1884 --
NM_024345chr995096 4478 4248 2371 1950 1611 1251 837 84 22177 2102 1428 1774
NM_024639chr662513 934 743 666 98 91 62331 2281 2112 1027 428 288 11845 2500 51
NM_024744chr242561 2286 710 530 22313 54 --12377
NM_024761chr995169 4951 3913 3655 3425 3322 3257 1218 640 14163 24208 755 25289 5201
NM_024770chr2116728 6385 6310 6225 5259 5088 1982 817 714 530 391 --35792 4889 4691 11266
NM_025054chr864153 4006 3260 1361 943 490 34192 2712 1348 ----
NM_025208chr111757 2679 407 --11864
NM_025235chr103829 605 469 --21807 1606 1644
NM_030579chr1673713 3649 2291 1372 865 352 179 2882 23 13064 --
NM_030621chr1443195 1333 752 357 23675 3271 --171
NM_030627chr543735 966 755 35 12718 13835 23535 684
NM_030647chr734286 1951 1804 45544 4981 3949 2392 --25511 1844
NM_030670chr1261830 1492 589 470 65 57 --1331 11419
NM_030671chr1261830 1492 589 470 65 57 --1331 11419
NM_030806chr188516 7803 7726 7086 6782 6740 2924 545 37655 3111 2653 38154 7813 5952 17774
NM_030817chr1273622 3448 2730 1191 757 649 516 21522 984 --11028
NM_031427chr14105562 5469 4724 4203 1418 1247 1150 452 431 394 85938 5046 3883 1303 1181 567 487 218 35463 4035 1594 23699 2368
NM_031435chr1252967 1317 720 713 47 1878 23345 203 --
NM_031469chr6103690 3594 2521 1364 1246 1139 1086 967 424 190 1313 43519 3233 645 438 13410
NM_031483chr2062890 2789 2604 1109 204 184 --22453 915 13092
NM_031845chr2--13440 2693 556 22251 1384
NM_031847chr2--13440 2693 556 22251 1384
NM_032042chr582605 2565 2349 2069 1823 740 557 94 ----11025
NM_032047chr342014 1700 1641 325 31486 652 215 1132 1715
NM_032102chr1142906 2087 1023 158 12704 12747 11035
NM_032116chr1353875 724 534 496 261 21769 315 --11259
NM_032160chr1894332 4023 3213 3098 3075 3052 1647 1092 917 32662 656 617 2550 68 13509
NM_032208chr293538 3209 2513 2293 1181 538 215 52 42 134 23474 3153 12675
NM_032373chr1045329 4765 3962 582 45056 4951 1548 469 14224 34555 1512 1191
NM_032446chr572893 2610 2469 2457 625 506 230 23150 658 32949 2486 646 12909
NM_032457chr451211 1107 865 794 145 23269 549 12950 1479
NM_032505chr342643 2278 912 537 41978 1841 567 88 1295 --
NM_032859chr1352520 1391 888 744 69 21600 1296 ----
NM_032968chrX32972 189 87 43926 3229 969 31 --33670 1146 801
NM_032969chrX32972 189 87 43926 3229 969 31 --33670 1146 801
NM_032973chrY32967 189 87 43918 3224 969 31 --33662 1146 801
NM_033020chr184789 3713 3457 1569 1283 1171 453 154 41649 1633 1531 291 11521 14849
NM_033030chr231500 594 364 ----1645
NM_033135chr111757 2679 407 --11864
NM_033181chr653677 3438 3245 2722 1584 22849 593 53559 2889 2778 2678 806 1383
NM_033211chr531719 1576 448 ----21475 362
NM_033224chr787907 7375 6529 6340 5844 5638 3095 2707 47770 6420 6369 5431 21278 304 --
NM_033656chr21135850 5358 5029 4299 3644 2206 1774 1751 1562 1469 1452 888 733 --12222 --
NM_052879chr1273938 3720 3068 1471 1040 998 801 11410 --24117 423
NM_052885chr1274598 4152 3843 3739 3588 3458 864 33422 1932 765 13374 13308
NM_052918chr1033240 3038 2349 22657 836 --32792 2377 41
NM_052927chr562208 1939 1865 1430 1374 659 11657 160 11642
NM_053023chr1142271 2131 1200 929 22853 592 --12400
NM_053064chr1482585 2182 1226 905 803 557 522 393 --32694 2137 1184 --
NM_058170chr121035 304 31207 1070 312 --1390
NM_080546chr942016 1952 1696 1478 1551 --22262 158
NM_080666chr1431078 398 294 11353 --11398
NM_080867chr1474677 3917 1786 1764 1757 1505 1127 44770 1833 1266 1073 11983 13340
NM_080872chr873863 3685 2731 2636 534 527 408 21186 442 33480 1467 828 --
NM_130847chr1194982 4369 3987 3803 2366 2359 2243 1924 1395 23789 1661 15235 31501 1472 99
NM_133646chr285216 4901 4733 4214 2067 1730 1313 1261 45520 4304 2044 767 11712 45052 3526 1413 471
NM_138286chr1942836 1474 659 602 64161 3589 2749 1664 514 280 --1224
NM_138292chr1132286 776 297 3824 210 41 13002 23165 2461
NM_138348chr5176680 6366 6226 6172 5561 5453 4484 2348 2120 2110 1663 1572 1487 1238 945 449 227 56483 5548 4730 2190 2157 22320 288 --
NM_138468chr295931 5303 3954 2359 2010 1427 1164 1151 752 31921 1907 1729 26030 494 2248 224
NM_138473chr12124436 4397 3806 3790 3668 3647 3558 3217 1521 1120 1091 804 14512 2968 132 --
NM_138559chr2--21068 921 11034 21195 977
NM_138576chr1454286 3131 2931 1355 673 33753 3360 1711 11266 13733
NM_138713chr16148120 7723 7650 6817 6187 5893 5698 5604 5594 5395 5229 3023 2987 2229 96283 6241 6053 6037 5358 4985 2319 1862 657 17240 1349
NM_138714chr16148120 7723 7650 6817 6187 5893 5698 5604 5594 5395 5229 3023 2987 2229 96283 6241 6053 6037 5358 4985 2319 1862 657 17240 1349
NM_138731chr1454171 3220 1275 1091 107 23107 937 --23940 1461
NM_138782chr56940 857 513 473 341 326 2390 221 22324 1840 --
NM_138959chr176301 5235 4268 2595 1940 1386 491 106354 6345 5054 4371 4193 2402 2211 1887 539 406 --15220
NM_144571chr486890 6855 6498 5362 5275 5225 5123 1703 15608 11792 25138 2737
NM_144578chr1493774 1443 1402 1113 954 545 340 187 94 53903 3512 1715 1536 133 ----
NM_144599chr1595165 5150 4745 4686 4261 3908 1329 1170 102 34910 2145 790 1723 --
NM_144628chr2052134 1880 748 415 158 12625 1831 2547 540
NM_144721chr422087 1026 --1948 1894
NM_144963chr832467 857 652 22317 978 31056 898 870 --
NM_145055chr1883636 2744 1298 1252 1065 307 250 94 11151 11046 --
NM_145207chr4115261 4988 4654 4327 4151 3701 3364 2091 1657 1506 1317 11557 25174 4102 11583
NM_145259chr2106872 6366 5893 4704 4552 1407 1033 890 837 411 46856 5833 2132 1067 --24335 1182
NM_145307chr1094673 4283 3788 3130 2933 899 875 565 58 --31540 1326 1154 44539 4362 3996 847
NM_148170chr11115426 4618 4438 4226 3569 3441 2063 2009 1634 646 411 11546 23500 1698 25023 1958
NM_148955chr15136165 6078 5344 4913 4239 4228 4188 1177 1046 447 403 388 302 14834 26291 4858 12047
NM_152261chr1272506 2175 873 713 705 650 511 12308 12140 11766
NM_152263chr185947 5870 4078 1945 1733 1497 606 405 46015 4817 1591 943 25289 3971 --
NM_152332chr1442100 396 179 46 32868 1070 613 1968 --
NM_152407chr563109 2554 2483 2424 2122 477 13267 43237 2489 895 180 --
NM_152409chr533414 2537 31 43129 2712 2290 1270 21387 429 --
NM_152414chr811616 21663 262 --2486 149
NM_152624chr556360 5825 4570 1595 1120 47338 6612 5796 1696 14856 26133 38
NM_152641chr1262833 2116 1813 1039 961 485 22308 530 1300 12256
NM_152774chr722330 2318 1254 --32520 2128 800
NM_152826chr15136165 6078 5344 4913 4239 4228 4188 1177 1046 447 403 388 302 14834 26291 4858 12047
NM_152836chr831517 756 47 1552 --11542
NM_152837chr831517 756 47 1552 --11542
NM_152903chr133987 736 410 21847 138 --22562 1136
NM_152999chr764822 4552 3891 979 810 282 14038 --23258 724
NM_153013chr562435 2342 812 541 378 121 155 1209 1882
NM_153371chr1362395 2356 2226 1638 1572 234 11560 1916 11625
NM_153456chr13116039 5183 4516 4207 4104 1493 1244 1084 917 251 25 22483 1141 11410 1849
NM_153607chr573052 2719 2347 500 486 399 185 22648 28 1221 --
NM_153810chr10134926 4761 4684 4362 4129 4031 3604 1556 1464 1314 416 96 69 44527 3446 1339 274 --1520
NM_170665chr121936 --14432 24064 3680
NM_170731chr1161773 1013 846 806 698 24 1345 12821 12067
NM_170732chr1161773 1013 846 806 698 24 1345 12821 12067
NM_170733chr1161773 1013 846 806 698 24 1345 12821 12067
NM_170734chr1161773 1013 846 806 698 24 1345 12821 12067
NM_170735chr1161773 1013 846 806 698 24 1345 12821 12067
NM_172070chr2--31470 604 287 --2883 467
NM_172071chr185790 5462 4880 2464 2437 2419 1085 791 46806 5619 491 106 12481 31365 769 540
NM_173198chr952517 2194 950 843 565 ----32846 2371 2308
NM_173200chr952517 2194 950 843 565 ----32846 2371 2308
NM_173214chr16148120 7723 7650 6817 6187 5893 5698 5604 5594 5395 5229 3023 2987 2229 96283 6241 6053 6037 5358 4985 2319 1862 657 17240 1349
NM_173468chr454350 1821 1407 1299 800 65953 4571 1891 1509 1461 1393 14610 12303
NM_173500chr1551257 1038 1018 446 439 21009 876 ----
NM_173582chr1195448 4662 4508 4178 1895 1817 1306 550 510 --34848 1943 916 --
NM_173642chr1138207 8060 7211 6806 6576 6495 5816 3286 3050 2775 1419 525 466 39228 8966 3392 13632 11093
NM_173654chr342400 792 132 60 22160 1570 --11741
NM_173826chr351735 1121 700 552 424 ----31652 1384 1357
NM_173829chr585421 4341 4251 4115 4018 2325 764 376 11381 23973 869 26022 1939
NM_174916chr1531575 1487 897 1804 1889 11553
NM_175624chr12107126 7094 6571 5920 5416 5150 1702 1476 706 21 45205 2166 2034 1813 12599 26015 2649
NM_175625chr12107126 7094 6571 5920 5416 5150 1702 1476 706 21 45205 2166 2034 1813 12599 26015 2649
NM_175736chr12107803 6788 6301 5205 5099 2590 2509 1949 84 37 37043 5180 1518 27168 1009 --
NM_177438chr1443195 1333 752 357 23675 3271 --171
NM_177553chr113691 616 269 ----1283
NM_177966chr321603 668 21922 278 --21478 1199
NM_177972chr11144395 4292 3617 3172 3030 1395 1368 1346 1230 1105 801 609 540 404 21339 1182 23238 1355 --
NM_178151chrX107693 7423 7326 7252 7235 6813 6244 5388 979 21 35973 1880 1095 35774 5362 5274 11347
NM_178152chrX107693 7423 7326 7252 7235 6813 6244 5388 979 21 35973 1880 1095 35774 5362 5274 11347
NM_178153chrX107693 7423 7326 7252 7235 6813 6244 5388 979 21 35973 1880 1095 35774 5362 5274 11347
NM_178154chr14------2641 615
NM_178155chr14------2641 615
NM_178156chr14------2641 615
NM_178157chr14------2641 615
NM_180991chr572430 1803 1729 1089 1006 784 448 11829 32859 955 611 21836 362
NM_181481chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_181482chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_181483chr1877027 6525 6193 5540 4581 2540 669 76455 5876 5738 5700 5422 4819 1474 ----
NM_181489chr3136631 6259 5436 5053 4608 2279 2246 2080 1656 1507 1464 1302 1146 21928 1026 --25681 844
NM_181521chr1686794 6756 5063 2218 1567 1232 1047 77 35719 4475 2789 16258 25221 1917
NM_181659chr2012685 13267 32777 935 396 11359
NM_181659chr2012685 13267 32777 935 396 11359
NM_181723chr842227 477 270 91 1443 11875 1341
NM_181787chr842738 1153 570 339 --53719 1372 1306 875 85 --
NM_181836chr562617 2235 1907 1056 681 558 1550 --12082
NM_181869chr1232440 2315 82 ----21861 1799
NM_182503chr685605 5529 4842 4337 3401 1307 413 170 3560 531 258 ----
NM_182551chr2113435 3387 2410 2400 2393 2231 1410 1326 844 598 266 52968 2835 2472 2431 867 12801 1508
NM_182762chr795967 5357 4296 3915 2452 2414 2152 2048 592 45813 1788 316 165 --25947 820
NM_182898chr786512 5872 5851 5778 4637 4051 1073 76 --25665 2641 15605
NM_182899chr786512 5872 5851 5778 4637 4051 1073 76 --25665 2641 15605
NM_183416chr111604 21491 437 51986 1425 693 667 525 --
NM_194247chr294373 3991 3326 1106 824 319 252 189 100 54461 3775 956 149 58 13804 11817
NM_194314chr154992 4198 3843 1326 118 34416 982 822 15484 --
NM_194318chr1352233 2096 1993 959 922 1838 --52563 2350 2083 2022 1941
NM_194358chr1211593 21709 303 2390 338 31376 41 24
NM_194359chr1211593 21709 303 2390 338 31376 41 24
NM_197966chr221905 11060 --21289 457
NM_197967chr221905 11060 --21289 457
NM_197970chr231500 594 364 ----1645
NM_198128chr1832222 748 428 1867 1634 1799
NM_198320chr1274571 3651 3337 1353 779 577 43 34383 4172 3570 13320 --
NM_198465chrX62638 1149 924 891 687 339 42174 1828 389 71 --11033
NM_198503chr141656 593 528 134 ----11721
NM_198581chr287159 5045 2945 2677 2426 2366 1810 1217 26988 6117 26228 129 21822 1102
NM_198900chr12107803 6788 6301 5205 5099 2590 2509 1949 84 37 37043 5180 1518 27168 1009 --
NM_198968chr1352630 1243 1143 837 178 42965 2935 2594 278 1662 13518
NM_199000chr721542 1509 3776 498 289 21479 111 1262
NM_199003chr831467 1299 401 21259 124 1970 1228
NM_199188chr1273938 3720 3068 1471 1040 998 801 11410 --24117 423
NM_199190chr1273938 3720 3068 1471 1040 998 801 11410 --24117 423
NM_199421chr1474677 3917 1786 1764 1757 1505 1127 44770 1833 1266 1073 11983 13340
NM_199462chr1114618 4290 4187 4069 3578 3415 1710 1454 865 535 419 23382 427 14629 24039 1333
NM_201432chr17125784 5706 5644 5573 2353 1843 887 799 692 627 430 394 16616 1436 11654
NM_201433chr17125784 5706 5644 5573 2353 1843 887 799 692 627 430 394 16616 1436 11654
NM_203301chr1461640 583 346 339 331 177 ------
NM_203349chr15--1182 --31912 1687 195
NM_203406chr552715 2142 1169 742 634 --1442 1118
NM_203446chr2112884 32418 1095 1077 1363 32712 2326 2081
NM_203459chr171743 969 781 493 270 250 25 --22411 2276 --
NM_206853chr673789 3508 3023 2862 1415 291 36 13013 --13878
NM_206854chr685050 4769 4284 4123 1552 1297 870 415 34274 1029 773 --15139
NM_206855chr6106015 5734 5249 5088 2517 2262 1835 1380 817 465 35239 1994 1738 --26104 4190
NM_206909chr8126240 6150 5414 5332 5204 1926 1881 1615 1483 1116 574 254 38414 5674 1525 37530 2879 2010 --
NM_207292chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_207293chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_207294chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_207295chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_207296chr363101 2792 2275 1170 722 690 21309 810 12199 --
NM_207297chr363126 2817 2300 1195 747 715 21334 835 12224 --
NM_207303chr1053999 3888 3291 2593 865 34138 3770 1127 54175 4053 1222 701 643 --
NM_207361chr1386131 4160 1595 1468 1407 1073 801 633 35517 3937 44 24517 982 34847 4417 4403
NM_212558chr933983 3085 2653 24181 100 23906 1331 11586