TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4762-5p
miRNA Sequence: CCAAAUCUUGAUCAGAAGCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX65981 5439 4756 2612 1701 283 --36977 5702 2281 15065
NM_000092chr273604 3485 1648 542 458 408 189 --11454 23889 3526
NM_000112chr5145547 5539 4694 4635 4574 4311 4193 4187 4151 3534 1561 998 608 366 15100 1489 --
NM_000332chr6147071 6565 6366 4966 4368 2660 2465 2274 1913 1826 1532 1086 725 113 25435 5076 35313 1602 575 --
NM_000337chr5126451 6371 6106 5855 2603 2335 2008 1698 1676 1558 900 222 --11799 25138 1759
NM_000461chr384567 4416 3808 2945 2805 1520 933 225 --34435 3934 1651 --
NM_000618chr12115530 5466 5141 4865 4387 4145 2169 1687 1359 1337 181 ------
NM_000618chr12115530 5466 5141 4865 4387 4145 2169 1687 1359 1337 181 ------
NM_000809chr4169174 8816 7975 7709 7631 7391 6243 6201 5893 5754 3666 3548 2318 1986 1524 1298 ----18750
NM_000926chr11149310 9125 8626 8608 8423 8365 8292 7783 5913 2442 1320 689 500 304 19394 12369 12734
NM_001001395chr1262821 2289 2172 1744 752 230 ----21896 1025
NM_001001556chr1571606 1183 1051 618 591 274 258 1268 ----
NM_001003652chr18168238 7984 7757 7445 7106 5906 5777 5696 3204 2914 1419 1108 524 501 280 228 --17091 13279
NM_001003679chr162217 2198 1702 1379 282 73 ----1203
NM_001012393chr1154853 4687 4052 794 571 --24392 119 1645
NM_001012968chrX82612 2354 2338 1975 1862 1804 955 943 --1910 --
NM_001014380chr1374960 4782 3982 1694 1485 416 310 --15218 11506
NM_001014797chr10128197 7947 7403 7385 6786 6105 3206 2250 2088 1862 1388 1199 16082 1851 --
NM_001015882chr941085 242 229 216 ----1288
NM_001025077chr1095579 5527 5452 5148 5092 4728 2881 695 582 32919 2850 263 11311 --
NM_001030055chr14104500 4455 4363 3805 3566 3426 2880 1445 200 30 1601 ----
NM_001039618chr1175753 5200 3940 3882 3791 2328 1210 24991 1632 12049 14802
NM_001040284chr16115823 4528 4353 4067 3907 2283 1844 761 597 547 273 14095 --15650
NM_001100108chr198133 7318 5224 5130 3247 3027 3003 2745 2333 11166 38339 8077 6526 12809
NM_001106chr3118534 7062 6282 5961 1979 1486 1396 1076 795 664 621 39371 6457 2371 ----
NM_001173chr14104500 4455 4363 3805 3566 3426 2880 1445 200 30 1601 ----
NM_001204chr2107743 7723 6711 6478 6271 6211 5171 3102 1967 144 12827 --1391
NM_001304chr17123532 3278 3245 3215 3110 2810 2709 1107 651 631 504 438 13388 11298 --
NM_001390chr1853508 3460 2686 1232 503 --1239 22404 1395
NM_001412chrX103700 2808 2767 2686 2359 1460 586 424 124 58 ------
NM_001918chr199257 9045 8110 6088 5697 3712 3166 1241 104 --1952 17624
NM_001981chr172394 1930 1680 677 667 553 143 ----1110
NM_002006chr485346 4510 4335 1549 1362 1307 897 744 --11860 --
NM_002009chr1552428 1881 442 216 42 12659 --2324 192
NM_002044chr1571606 1183 1051 618 591 274 258 1268 ----
NM_002214chr785037 4941 4879 4539 3770 3570 989 604 --12053 14211
NM_002270chr5104747 3967 3724 3543 3528 2107 1809 1565 1046 822 --11039 --
NM_002310chr5106370 5812 5727 5331 4587 4422 963 704 480 392 --15963 --
NM_002481chr1137619 6592 6299 5912 5529 5338 5098 5032 3199 1293 1248 1235 335 --16187 16862
NM_002545chr1154853 4687 4052 794 571 --24392 119 1645
NM_003034chr1285765 2472 2459 1996 563 504 448 48 --28019 223 13220
NM_003108chr2116875 6671 6321 6297 6030 5549 5377 5237 5117 5048 1227 --36826 5434 1203 22115 1356
NM_003199chr18135609 5543 4431 4096 3880 3473 2218 1225 1050 816 776 758 154 15646 ----
NM_003298chr3126237 5972 5892 4024 3915 1998 1913 1638 1233 1192 292 224 --24223 2104 --
NM_003478chr1153323 1017 583 277 85 --33010 2989 2282 11033
NM_003574chr1895338 5102 4613 4465 4433 3538 1393 951 690 24658 1205 35622 1227 60 --
NM_003590chr2114057 4010 3333 2936 2847 1318 682 652 625 442 334 ----1503
NM_003617chr1104856 4020 3524 3371 1622 1245 1185 654 490 343 14772 --11314
NM_004171chr11139682 8662 8474 7469 6686 6545 6421 3598 2938 2828 2313 1492 837 --37547 6999 6656 --
NM_004586chrX125434 4833 4826 4581 4303 4265 3870 3363 1801 1097 925 190 --13580 13481
NM_004857chr1494767 4589 4126 3947 2948 2906 1067 487 95 14075 ----
NM_004985chr1283765 3733 3322 2744 1252 807 543 252 --23307 1328 --
NM_005065chr1484209 3626 3539 2012 1547 1398 925 598 13735 --11810
NM_005121chr1783789 3457 3267 2377 2364 1371 715 518 12492 13056 --
NM_005156chr985054 4448 2002 1167 928 565 190 149 1921 --1298
NM_005188chr11158056 7941 7105 6544 5484 5412 3227 3218 2437 1895 1122 738 463 148 25 1896 --15669
NM_005197chr14135809 5525 4878 4489 3782 3770 1856 1575 1181 431 117 72 61 ------
NM_005359chr1875341 4943 4640 2559 2022 1344 848 22043 1045 16330 11332
NM_005504chr12116445 6368 6064 5912 5737 5220 2415 842 484 263 87 ----11494
NM_005840chrX77264 6658 6551 6518 5174 894 316 ----36698 5166 279
NM_005901chr18168238 7984 7757 7445 7106 5906 5777 5696 3204 2914 1419 1108 524 501 280 228 --17091 13279
NM_006203chr585404 5141 4318 3586 1266 780 579 234 24410 3870 14092 --
NM_006464chr2134663 4356 4265 4257 4218 3230 3076 2982 1692 1215 1016 800 111 1820 ----
NM_006620chr6104599 4377 4286 3742 3030 1108 1030 966 263 248 14589 1481 13835
NM_006750chr16127383 6040 5720 2794 2675 2437 2137 795 755 662 382 268 15180 37440 5702 2474 --
NM_007007chr1264563 3863 3563 3327 1211 808 1931 13752 1758
NM_007011chr15106260 6035 5822 5766 1917 1822 1687 1421 1337 691 --26716 6276 11073
NM_007249chr13119210 8921 8758 8108 7632 5929 3344 3187 2843 2576 1674 --23605 2379 --
NM_012072chr2094418 4405 4205 3960 1785 1108 770 405 227 --24247 2809 13691
NM_012096chr363734 3349 1202 776 543 529 13613 1168 13387
NM_012214chr2136276 6178 6014 5818 5481 5408 5050 4896 2252 714 633 494 195 --16306 15968
NM_012252chr784662 4306 3859 3818 3656 3317 1198 994 ----14523
NM_012287chr394421 3658 3570 3088 2945 2936 1636 669 258 23865 3744 --14075
NM_012347chr652201 489 346 334 309 --11123 12120
NM_012431chr763263 2996 1109 990 755 102 --12980 1841
NM_014155chr11137401 7036 6366 5538 5236 5129 5104 2801 2638 2076 1693 1165 284 11977 --27537 6472
NM_014181chr262701 259 252 241 215 137 12261 --1444
NM_014331chr487146 5826 5106 4819 1884 1160 349 57 26627 2416 12327 15804
NM_014721chr6106626 6562 5668 4945 4599 2737 2710 2287 1880 508 188 15808 --
NM_014746chr274308 3986 2850 1397 1161 1029 604 --1763 14185
NM_014864chr1124410 4284 4152 3417 3365 3321 3150 1539 1485 1152 1123 385 --11648 --
NM_014877chr1797261 7028 6267 5323 4824 3029 2901 2753 1464 --1943 15190
NM_014946chr253013 2826 2531 2305 1190 ----2716 708
NM_015458chr8115180 5006 4899 4627 3758 3501 1040 859 761 467 138 ----11133
NM_015564chr553057 2694 2373 1349 864 ----23356 2740
NM_015569chr194732 4535 4345 3741 3187 1655 1467 1423 1208 1182 1240 --
NM_015879chr1887422 6453 5711 2285 2256 442 281 168 23402 260 17362 --
NM_015906chr163587 3183 3160 1491 1077 255 1249 34399 1582 513 --
NM_016206chr3178524 8316 8093 7577 7357 7003 6422 5865 3482 3123 2230 2066 1580 1376 1295 1035 681 11994 23608 2441 --
NM_016260chr2127577 7275 7210 5964 5950 5378 4956 3066 2819 1531 873 335 --37503 7153 6114 --
NM_017643chr17182861 2720 2492 2458 2374 2162 2111 2067 1140 1119 993 954 428 420 264 129 116 37 --11230 --
NM_017644chr394911 4118 3607 3533 1694 1613 1347 1039 50 ----14217
NM_017658chr1484103 4044 4022 3571 3368 3327 3056 941 ----11777
NM_017693chr1331637 1437 77 --11590 1323
NM_017848chrX104108 3647 2853 1165 1119 699 526 448 113 102 --11406 --
NM_017952chr294416 4187 4023 3968 3125 3054 1487 905 166 12821 31192 839 113 --
NM_018364chr184141 3966 3447 2973 2577 2537 1300 389 ----11328
NM_018373chr1485854 5749 5028 4980 4374 1263 594 378 --16046 1104
NM_018374chr774904 4809 4470 4265 4181 1522 1404 14919 --13315
NM_018638chr12105659 4182 3831 3445 2263 2227 2098 1565 1324 521 14018 11677 --
NM_018640chr1262821 2289 2172 1744 752 230 ----21896 1025
NM_020673chr20137668 7615 7469 6312 4860 3049 1809 1632 1504 1391 1089 628 313 ------
NM_020727chr2193951 3737 3446 3272 3163 2918 617 318 42 1231 22790 1526 --
NM_020772chr17148608 7839 7237 6142 6043 3372 3071 2592 2376 2221 1728 1711 588 266 --15490 --
NM_020774chr18116263 5985 5904 4898 4568 3908 3816 3789 2247 1852 1686 --14930 --
NM_020921chr1453604 3483 2828 844 619 --12750 1213
NM_020948chr183252 2820 2409 829 686 280 165 141 --1581 11293
NM_021116chr7108701 8650 6092 5972 3388 3082 2457 2424 2395 1372 --38872 7072 317 17773
NM_021813chr651575 722 705 693 310 21913 1436 23696 766 13971
NM_021961chr1197228 6636 6456 5785 2514 2482 2283 1685 1396 25014 1520 16187 --
NM_021964chr3126296 5773 5603 4697 4547 4169 4159 2522 2183 977 793 92 24683 1441 26328 5477 1987
NM_022459chr13105417 5386 4873 1289 1027 929 781 669 591 110 24463 4182 15032 --
NM_022473chr15114044 4029 3833 3718 3651 2726 1195 879 592 205 194 23811 865 ----
NM_022716chr173026 2860 2516 2039 804 697 575 --12446 12477
NM_023929chr852527 1925 1035 967 480 11770 12373 12297
NM_024524chr353056 3032 2878 2450 324 11025 --22115 975
NM_024744chr2102564 2220 1980 1771 1058 981 928 872 745 533 ------
NM_024837chr153248 213 206 ----21923 83
NM_024949chr475005 4930 3495 1397 1018 780 147 14744 24336 69 --
NM_024989chr288104 7584 7029 5823 2414 1098 1078 322 --47019 5694 5165 903 --
NM_025073chr154642 3308 1662 484 385 --24526 1185 198
NM_032012chr984576 3965 3354 1754 1159 818 763 221 11497 11997 15080
NM_032116chr1374960 4782 3982 1694 1485 416 310 --15218 11506
NM_032373chr10115600 5059 4720 3808 3704 3644 2345 1795 991 957 105 ------
NM_032968chrX74043 2873 1687 1591 1087 974 324 22885 988 191 --
NM_032969chrX74043 2873 1687 1591 1087 974 324 22885 988 191 --
NM_032973chrY74035 2868 1681 1590 1087 974 324 22880 988 191 --
NM_032975chr1853508 3460 2686 1232 503 --1239 22404 1395
NM_032980chr1853508 3460 2686 1232 503 --1239 22404 1395
NM_033020chr163587 3183 3160 1491 1077 255 1249 34399 1582 513 --
NM_033224chr7107115 6388 6034 5589 2021 1833 1503 1177 1035 602 --35642 2900 2270 --
NM_033360chr1283886 3854 3443 2865 1373 928 664 373 --23428 1449 --
NM_033480chr652201 489 346 334 309 --11123 12120
NM_033481chr652201 489 346 334 309 --11123 12120
NM_033656chr2185244 5051 4440 4115 1951 947 884 819 25766 694 12210 14220
NM_052879chr1293515 2897 2536 1298 805 796 614 325 134 1586 43979 3164 3029 293 --
NM_052937chr852237 2058 654 323 317 --1303 --
NM_133477chr473129 2843 1312 1294 990 870 85 12433 --12086
NM_144578chr1465341 4925 4750 4085 1509 1471 34692 2128 1611 22068 1414 1751
NM_145207chr4125125 5104 5084 4943 4748 4526 4322 2094 1509 997 887 150 ------
NM_152622chr592586 2487 2308 2208 2147 1019 753 562 533 --165 --
NM_152624chr5137157 7061 7043 5158 2880 2766 2363 1941 1167 1123 875 551 200 12392 26762 5991 --
NM_152756chr5103678 3449 3316 2720 1714 1168 704 558 291 56 --14229 --
NM_152835chr142616 2071 130 118 21100 954 42258 518 503 360 --
NM_152924chr15106260 6035 5822 5766 1917 1822 1687 1421 1337 691 --26716 6276 11073
NM_153188chr5104747 3967 3724 3543 3528 2107 1809 1565 1046 822 --11039 --
NM_172071chr1116460 5473 5219 5048 4765 4637 2130 1826 1191 794 372 21701 980 25714 2390 26638 5206
NM_173468chr4115561 5118 4716 4521 4272 3972 2443 2336 1005 822 62 --1106 --
NM_173808chr143496 1008 540 515 1790 --33926 3134 1579
NM_173829chr5135928 5799 5696 4815 4505 3907 3876 2072 1800 1748 1738 1474 516 ------
NM_175624chr12107322 6953 6471 6130 5830 2941 2631 1707 709 581 27386 1787 21481 953 --
NM_175625chr12107322 6953 6471 6130 5830 2941 2631 1707 709 581 27386 1787 21481 953 --
NM_175861chr12105798 5752 5121 4819 4523 911 757 280 257 102 25437 4653 ----
NM_178539chr1251785 1381 203 137 90 --11924 21936 215
NM_181521chr16147095 6969 6326 5975 5125 5049 4684 2820 2583 1381 1281 1141 752 80 25444 998 --15137
NM_181705chr555737 5284 5022 5015 1339 --15031 --
NM_194285chr1193272 3039 2343 2288 2102 1073 706 93 51 ----1818
NM_194434chr1895338 5102 4613 4465 4433 3538 1393 951 690 24658 1205 35622 1227 60 --
NM_198270chrX83176 3045 2840 2723 2698 918 796 488 42277 2237 2177 2124 ----
NM_198581chr287314 7136 6995 4779 2384 2032 2015 1377 25878 5331 --16783
NM_199188chr1293515 2897 2536 1298 805 796 614 325 134 1586 43979 3164 3029 293 --
NM_199190chr1293515 2897 2536 1298 805 796 614 325 134 1586 43979 3164 3029 293 --
NM_199229chr231727 575 441 ----21699 244
NM_199436chr253013 2826 2531 2305 1190 ----2716 708
NM_206854chr685201 5053 3673 3587 3485 902 257 186 --14517 1224
NM_206855chr6136166 6018 4638 4552 4450 4080 3991 1867 1222 1151 707 335 39 --25482 354 11189