TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4764-3p
miRNA Sequence: UUAACUCCUUUCACACCCAUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001049chr1472132 1552 972 965 958 810 751 12249 ----
NM_020150chr1041966 1595 737 524 1879 --21761 722
NM_182515chr1966706 4619 4381 4081 1738 867 24991 2623 --12124