TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4764-5p
miRNA Sequence: UGGAUGUGGAAGGAGUUAUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX53368 3199 2504 2119 567 32932 2885 480 ----
NM_000084chrX96088 5779 5045 4822 4706 2488 1033 110 82 16411 15029 --
NM_000089chr7------1114
NM_000091chr232823 1784 350 21827 271 ----
NM_000092chr294462 4058 3247 1676 1291 1277 1252 673 164 --13407 14380
NM_000108chr72424 239 11871 21768 62 --
NM_000109chrX52609 2314 2211 523 269 21059 540 1780 --
NM_000129chr641374 1298 988 302 11428 ----
NM_000151chr1731845 1206 225 --11185 --
NM_000161chr142606 81 ----11859
NM_000165chr631614 483 424 11475 ----
NM_000168chr762821 2606 2572 852 758 506 21258 791 12730 --
NM_000176chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_000217chr1243991 1536 451 430 13586 ----
NM_000245chr772258 2051 2018 1992 1683 819 504 ------
NM_000259chr15126220 6176 5960 5705 5271 3957 2339 2162 1921 1911 1805 454 ------
NM_000267chr1733229 2929 2310 --12797 --
NM_000276chrX31820 1733 657 1868 1163 11424
NM_000284chrX31736 1281 564 --21509 588 1532
NM_000314chr1051230 970 746 620 479 1160 21199 404 --
NM_000318chr832887 1183 520 12930 32675 2399 2389 --
NM_000321chr1341630 1156 557 100 ------
NM_000332chr654811 4765 4418 2177 247 --11720 --
NM_000337chr5106229 5733 5314 4234 2642 2175 1512 405 329 203 22515 260 35805 1442 317 --
NM_000362chr2253413 2477 1145 1010 745 12742 12300 --
NM_000368chr954728 4261 3235 1761 1568 13895 ----
NM_000382chr173765 188 180 --11883 --
NM_000408chr242136 568 246 129 23470 922 1288 12605
NM_000439chr542561 1920 638 110 --1217 --
NM_000442chr1721144 245 138 123 --
NM_000448chr1162768 2341 2269 2247 609 478 ------
NM_000452chr1331766 469 315 1688 ----
NM_000489chrX43131 2746 2259 2135 --1821 --
NM_000503chr86699 651 469 264 169 74 ------
NM_000522chr731109 798 402 11192 11142 --
NM_000538chr1331795 1295 616 21123 22 ----
NM_000555chrX86916 6170 5261 3013 2401 1232 947 140 15597 13134 --
NM_000615chr1142867 2403 1158 682 --21174 126 --
NM_000618chr12146392 6265 6108 4237 4218 2550 2317 2282 1758 1485 1205 849 658 156 ------
NM_000618chr12146392 6265 6108 4237 4218 2550 2317 2282 1758 1485 1205 849 658 156 ------
NM_000633chr18105211 4616 4357 4053 3374 3171 2039 1635 1570 909 ------
NM_000719chr12115906 5836 5255 5179 5113 4165 4099 2440 2239 1887 871 25957 5361 24666 2109 16166
NM_000724chr1021832 61 ----1709
NM_000793chr14104912 4777 3839 3310 3269 1881 1787 775 305 198 14386 ----
NM_000809chr4169269 8829 8805 8654 7734 7165 6303 6158 6072 3577 2889 2606 2398 2329 1820 1768 ------
NM_000813chr575397 3707 3414 1788 1452 443 83 --15048 --
NM_000814chr1564129 3493 3324 3104 861 453 33247 1533 889 1520 11230
NM_000826chr421697 335 32225 1606 243 12192 --
NM_000831chr195829 5544 5286 4949 4750 4622 4135 944 72 --34346 4318 4166 --
NM_000860chr431571 1391 1260 --1562 --
NM_000868chrX52214 2097 883 518 459 ------
NM_000875chr15125532 5430 5373 5319 4530 4448 2667 1975 1673 1469 1196 167 ----16578
NM_000899chr1253942 3046 1339 1306 792 13221 2635 119 --
NM_000902chr352509 2495 550 503 425 ----12403
NM_000933chr2061788 1752 1735 1126 658 642 1488 11503 --
NM_000945chr261876 1515 574 445 235 124 2645 71 ----
NM_000958chr561355 1020 195 130 119 76 1314 ----
NM_000990chr1143929 3841 676 84 23520 762 21204 350 --
NM_001001323chr1232827 2155 1035 12612 2101 66 --
NM_001001395chr1231059 765 42 1576 ----
NM_001001664chr224117 996 --11455 --
NM_001001890chr2194072 3963 3347 3233 1463 1287 1171 1100 898 ----13869
NM_001001938chr953221 3110 2703 921 842 --13419 --
NM_001001974chr1022003 1608 1888 22227 411 --
NM_001002860chr1453973 3457 504 359 42 --34309 800 750 --
NM_001002909chr1741511 614 598 285 1898 1665 --
NM_001003652chr1898329 7514 7464 6887 6816 2986 2609 2262 2218 15499 --23321 1608
NM_001003665chr142793 932 342 158 --22751 812 13179
NM_001003674chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_001003675chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_001003679chr172066 1492 712 614 517 407 340 ------
NM_001003760chr673590 3279 2387 2333 665 564 330 12562 12377 13458
NM_001003800chr933753 3212 35 --21146 265 --
NM_001004303chr13684 564 72 1807 --1298
NM_001004303chr13684 564 72 1807 --1298
NM_001004317chr623843 1483 33624 1329 562 --14112
NM_001004419chr1253573 3236 3210 3201 758 13664 ----
NM_001005375chrY31673 1627 1616 ------
NM_001005404chr1763956 3899 1350 818 125 56 --11378 --
NM_001005473chr556389 4554 2544 2222 2010 15252 15854 --
NM_001005474chr351612 1524 1320 1232 232 ------
NM_001005502chr1233822 1651 27 25256 4229 1859 23938 1083
NM_001005753chr242301 1542 1448 865 1849 ----
NM_001006605chr141000 840 430 218 1233 1741 --
NM_001006605chr141000 840 430 218 1233 1741 --
NM_001006623chr262403 1796 1667 991 299 36 1402 1829 --
NM_001006657chr212049 1701 22645 2018 --
NM_001006932chr663254 2623 2324 2051 472 39 --1387 12301
NM_001007023chr14104912 4777 3839 3310 3269 1881 1787 775 305 198 14386 ----
NM_001007097chr964995 4583 3474 3142 1676 1208 34217 3370 1652 13285 14245
NM_001007237chr122047 482 ----1281
NM_001007255chr11220 130 146 --
NM_001008239chr1833003 965 450 13695 ----
NM_001008408chr764685 4450 3974 3885 1297 884 --1219 --
NM_001008536chr12295 166 ----169
NM_001008541chr1032229 942 363 ------
NM_001008541chr1032229 942 363 ------
NM_001008564chr1351799 343 246 167 89 --1895 --
NM_001008783chr62888 269 --1848 --
NM_001008801chr194825 295 237 135 ------
NM_001009554chr483394 3144 2969 1680 1638 880 602 27 --21532 1370 13159
NM_001009554chr483394 3144 2969 1680 1638 880 602 27 --21532 1370 13159
NM_001009555chr441670 1304 479 318 1234 ----
NM_001009571chr741676 1100 336 232 184 ----
NM_001009899chr376388 5707 5502 5278 4329 4159 4099 14874 ----
NM_001009909chr1133583 400 141 22721 29 1682 --
NM_001009993chr254378 658 280 136 41 --11818 --
NM_001010861chr162482 2464 2260 2079 616 570 1293 ----
NM_001010867chr1106523 6206 4383 4160 2650 2370 1952 1786 1516 548 --12625 14856
NM_001010888chrX54125 1217 1117 922 164 1763 ----
NM_001010891chr5136715 5988 5865 5047 4672 2307 1956 1731 1524 972 752 630 247 15731 26306 1365 11721
NM_001010942chr122273 96 1251 1165 --
NM_001010986chrX32242 1895 388 22437 2233 ----
NM_001011551chrX1137 ----178
NM_001011666chr796522 6461 5819 4886 4293 4093 2267 1414 428 12400 36024 5113 1762 --
NM_001011885chr1531801 1155 222 11297 ----
NM_001012393chr1154668 4343 525 318 44 33540 558 432 11428 --
NM_001012755chrX105064 4884 4768 4378 4091 3194 1889 1709 995 802 25023 4472 13499 --
NM_001012993chr92541 305 21220 277 1951 --
NM_001013406chr741396 1083 491 33 ------
NM_001013415chr421140 632 --11059 --
NM_001013642chr14847 820 811 349 2921 777 ----
NM_001013691chr194703 649 204 120 ------
NM_001014380chr1385594 5583 5081 3872 2204 1396 1254 1042 34743 1289 430 15236 15450
NM_001014797chr1087263 5636 5593 3140 2889 2850 2162 1891 25780 30 27883 7858 26040 2406
NM_001015053chr17------181
NM_001015877chrX43000 2380 2314 1160 145 ----
NM_001017926chr81288 ----1656
NM_001018065chr9145864 5664 5422 5340 4890 4771 4281 3786 2217 2165 2155 1634 347 118 24033 1219 ----
NM_001018066chr9145864 5664 5422 5340 4890 4771 4281 3786 2217 2165 2155 1634 347 118 24033 1219 ----
NM_001018067chr174479 1490 1430 1374 825 779 655 25371 999 ----
NM_001018068chr174479 1490 1430 1374 825 779 655 25371 999 ----
NM_001018069chr174479 1490 1430 1374 825 779 655 25371 999 ----
NM_001018074chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_001018075chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_001018076chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_001018077chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_001024094chr543871 3168 2518 244 22952 1258 32510 1279 1167 --
NM_001024649chr532080 2059 281 3450 163 95 ----
NM_001024808chr1251958 1913 1873 471 45 12176 12581 12081
NM_001024855chr311210 1368 --2560 28
NM_001024956chr1195078 4952 4877 4097 3897 1822 1291 1229 510 21019 85 22272 1274 --
NM_001025076chr1085667 4366 4316 4005 2042 1353 153 50 ----14725
NM_001025077chr10117025 5724 5674 5363 2711 1511 1408 1140 558 545 98 ----16083
NM_001025079chr364037 3662 3552 2732 2539 1167 11096 1628 --
NM_001025108chr233810 3178 1317 23474 1614 23877 3285 --
NM_001025252chr852961 2726 2365 890 771 32053 586 262 23101 61 --
NM_001025253chr852961 2726 2365 890 771 32053 586 262 23101 61 --
NM_001025356chr1252896 2621 2547 1179 975 ------
NM_001025580chrX54127 1562 1443 1288 512 ------
NM_001025595chr441633 1366 1059 421 1283 ----
NM_001029858chr632220 2114 1181 11151 --13003
NM_001029863chr632595 2215 2155 ----12271
NM_001029875chr592951 2936 2814 2569 2551 1919 1041 848 33 12795 ----
NM_001029884chr641722 1698 451 402 12737 ----
NM_001029998chr431378 950 546 --31347 1335 1119 --
NM_001030007chr1672948 2528 1462 1337 481 291 271 --13802 --
NM_001030055chr1443478 849 555 436 23902 1021 14099 1109
NM_001031679chr1243281 2860 2421 2257 33231 2895 2349 12211 --
NM_001031690chr742848 2129 2091 745 12882 12924 1549
NM_001031732chr443427 3247 3206 3051 ------
NM_001031804chr1654275 3756 2934 2679 1255 ------
NM_001031806chr173821 244 236 --11939 --
NM_001031812chr54940 554 499 158 --12316 --
NM_001032288chr2021540 330 ----1307
NM_001032999chr2064177 3786 3308 1904 1726 643 --44054 1328 1295 936 --
NM_001033045chr264374 3948 3890 1452 1002 859 --1697 --
NM_001033117chr354328 1150 541 328 299 --1890 34340 4076 172
NM_001033557chr241391 1239 945 369 ------
NM_001033659chr1721164 384 21628 392 ----
NM_001034841chr1644741 3758 1759 186 35247 854 231 ----
NM_001035003chr461425 1211 1193 404 315 183 ------
NM_001035004chr461425 1211 1193 404 315 183 ------
NM_001037174chr232117 1954 539 --11979 --
NM_001037317chr162482 2464 2260 2079 616 570 1293 ----
NM_001037332chr582131 1943 1878 1738 1653 360 179 134 --12100 12095
NM_001037333chr582131 1943 1878 1738 1653 360 179 134 --12100 12095
NM_001037339chr141270 619 560 29 ------
NM_001037340chr141270 619 560 29 ------
NM_001037341chr141270 619 560 29 ------
NM_001037341chr141270 619 560 29 ------
NM_001037954chr1131396 845 172 13173 11306 --
NM_001039348chr24783 739 669 99 1967 ----
NM_001039349chr24783 739 669 99 1967 ----
NM_001039395chr93865 726 66 22167 1518 11618 --
NM_001039459chr731153 1136 948 1938 2455 123 --
NM_001039538chr253144 2957 2328 2289 327 1646 ----
NM_001039547chr3107830 7334 7228 7190 6571 6470 6352 2549 1663 271 1531 11747 --
NM_001039580chr445087 4931 2020 1139 13399 ----
NM_001039590chrX43883 3504 2833 1615 ------
NM_001039591chrX43883 3504 2833 1615 ------
NM_001039618chr1195899 4150 2206 1403 1332 990 354 95 81 15961 ----
NM_001039693chr272800 2669 1605 1404 1298 88 26 1193 23637 539 --
NM_001039709chr2064177 3786 3308 1904 1726 643 --44054 1328 1295 936 --
NM_001039762chr1062229 2050 1674 823 639 488 --21741 606 --
NM_001039840chrX74074 1361 1015 919 911 680 355 15734 34602 4435 166 --
NM_001039937chr1364044 2564 1660 1097 579 555 --14147 --
NM_001040002chr1711451 --3598 498 112 --
NM_001040020chr72564 221 ----11467
NM_001040092chr81306 ----1430
NM_001040142chr272327 2181 1756 981 938 901 597 ------
NM_001040143chr272327 2181 1756 981 938 901 597 ------
NM_001040151chr1164116 3110 2788 1733 1484 53 2154 122 ----
NM_001040152chr764387 4381 3651 1893 1829 587 --34505 1318 1267 14295
NM_001040157chr431057 368 353 ------
NM_001040181chr3------1142
NM_001040182chr3------1142
NM_001040183chr3------1142
NM_001040199chr3------1142
NM_001040200chr3------1142
NM_001040202chr451679 866 678 535 248 ------
NM_001040284chr1685901 5425 4648 4631 4509 3881 3612 1891 1647 25116 3731 --
NM_001040402chr443219 2600 755 237 23105 2691 ----
NM_001040409chr2----21030 309 --
NM_001040429chr13103334 3055 2773 2618 1007 726 653 600 594 133 22549 1347 ----
NM_001040441chr165495 5369 2020 1959 538 452 --14119 --
NM_001040450chr1532505 965 311 2300 234 ----
NM_001040453chr1532505 965 311 2300 234 ----
NM_001040665chr754761 4362 1654 1615 1222 33888 3465 1246 ----
NM_001040712chr942298 1099 1032 717 2906 48 11299 11173
NM_001042355chr1645272 5253 4808 1829 25104 4772 15122 185
NM_001042404chr131845 1217 664 11787 ----
NM_001042412chr1645272 5253 4808 1829 25104 4772 15122 185
NM_001042440chr541915 557 439 146 11866 21333 350 --
NM_001042441chr541915 557 439 146 11866 21333 350 --
NM_001042442chr541915 557 439 146 11866 21333 350 --
NM_001042443chr541915 557 439 146 11866 21333 350 --
NM_001042444chr541915 557 439 146 11866 21333 350 --
NM_001042445chr541915 557 439 146 11866 21333 350 --
NM_001042446chr541915 557 439 146 11866 21333 350 --
NM_001042453chrX51668 1364 655 579 304 ------
NM_001042481chr1442587 2461 344 90 ----22511 706
NM_001042492chr1733229 2929 2310 --12797 --
NM_001042494chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_001042495chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_001042496chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_001042497chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_001042533chr333147 2882 670 33274 2707 2458 ----
NM_001042537chrX22005 146 --12049 1709
NM_001042550chr921311 223 --11793 --
NM_001042555chr1274528 3960 3675 3529 2916 1087 802 34653 2907 1659 ----
NM_001042599chr287292 2567 2193 1708 1521 1285 732 444 36915 1601 1468 ----
NM_001042603chr1265239 4693 600 186 172 45 24333 81 --14043
NM_001042604chr354849 4552 577 341 63 22961 1663 11832 --
NM_001042749chrX--2646 409 21980 1821 --
NM_001042750chrX--2646 409 21980 1821 --
NM_001042751chrX--2646 409 21980 1821 --
NM_001043318chr1473943 3718 3250 3149 2574 1667 1593 23289 1441 --13275
NM_001043351chr141866 1828 332 283 ------
NM_001044385chr273633 1250 1024 763 651 639 127 22829 929 ----
NM_001044722chr54940 554 499 158 --12316 --
NM_001044723chr54940 554 499 158 --12316 --
NM_001046chr552817 776 367 196 78 11989 ----
NM_001071775chr1321832 198 1742 2326 204 --
NM_001079874chr131966 292 121 --11491 --
NM_001083620chr421696 334 32223 1605 242 12190 --
NM_001099678chr355813 4223 882 820 225 16313 24845 4143 --
NM_001100108chr188164 8148 7009 6790 6368 3040 1185 33 ------
NM_001106chr3148713 8662 8286 7911 7712 7680 6600 6492 3884 3616 2500 950 707 240 19503 1695 11359
NM_001113490chrX53210 2368 2362 2290 286 22529 674 12336 --
NM_001116chr1663033 2974 2907 2827 2438 863 12632 1383 --
NM_001121chr1021657 61 ----150
NM_001128chr1672948 2528 1462 1337 481 291 271 --13802 --
NM_001153chr23905 696 667 --1576 --
NM_001173chr1443478 849 555 436 23902 1021 14099 1109
NM_001186chr2152876 2400 2292 734 322 22948 352 ----
NM_001204chr297087 6821 6282 6143 6073 5202 2523 1368 484 ----13080
NM_001206chr952977 2856 2394 2050 176 ----1618
NM_001256chr1752325 2251 1149 962 599 22434 778 ----
NM_001259chr745560 4556 3919 2512 14987 ----
NM_001310chr1233109 2000 321 1208 ----
NM_001329chr1041395 1209 1017 460 --1561 --
NM_001332chr521273 1127 --1980 11224
NM_001343chr51362 --1353 11381
NM_001356chrX12216 22277 709 --11586
NM_001364chr1144170 3947 3348 941 21690 1251 3968 444 405 --
NM_001386chr851793 1495 639 545 56 ----1218
NM_001391chr1851091 957 925 199 178 ------
NM_001412chrX22593 23 23461 3344 33192 2489 965 --
NM_001415chrX4586 273 248 25 ------
NM_001419chr1953821 3079 806 783 763 --23476 927 --
NM_001422chr11170 --1136 1348
NM_001423chr1221857 1538 --1475 11840
NM_001438chr122772 225 --23472 2579 --
NM_001440chr8--22723 320 3993 683 89 12734
NM_001460chr172753 2679 2529 2306 1148 900 781 1280 ----
NM_001530chr1441160 1148 980 414 180 ----
NM_001542chr122047 482 ----1281
NM_001587chrX31820 1733 657 1868 1163 11424
NM_001609chr1054382 3310 2764 1756 1716 ----13044
NM_001621chr743033 1907 555 259 ----12799
NM_001621chr743033 1907 555 259 ----12799
NM_001650chr1821269 333 ----1452
NM_001655chr1132159 1783 183 1786 ----
NM_001656chr52239 78 --11690 --
NM_001663chr1432301 2136 733 12599 --12011
NM_001668chr122096 2049 2751 335 22255 2139 1829
NM_001701chr941213 1126 1101 102 ------
NM_001709chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_001746chr532080 2059 281 3450 163 95 ----
NM_001750chr541915 557 439 146 11866 21333 350 --
NM_001754chr2194072 3963 3347 3233 1463 1287 1171 1100 898 ----13869
NM_001755chr1642193 1624 1411 91 ------
NM_001759chr1285029 4853 4696 4585 3952 1182 1168 700 --11962 --
NM_001777chr364037 3662 3552 2732 2539 1167 11096 1628 --
NM_001830chrX73931 3378 3273 3242 1238 801 688 11120 1760 --
NM_001858chr654912 4190 3918 1582 442 31271 532 337 ----
NM_001874chr1233822 1651 27 25256 4229 1859 23938 1083
NM_001918chr1108886 8763 8504 8434 8415 6788 6278 2331 2253 208 46740 2712 2697 782 11151 15681
NM_001939chrX73604 2947 2657 1435 1407 1396 1383 13284 33302 736 105 --
NM_001951chr83547 528 221 2655 212 ----
NM_001969chr1493716 3503 3079 1544 1197 587 265 254 188 1171 ----
NM_002006chr465540 5179 4524 2308 1314 719 35572 4950 3917 1650 11408
NM_002025chrX188760 8243 7962 7772 7333 6781 6649 6481 6354 5703 3448 3399 3347 2541 1859 1726 1093 638 28906 1943 --37925 2228 1419
NM_002035chr1843629 2778 1387 1375 12442 11477 12556
NM_002048chr951357 1190 922 845 301 ----11052
NM_002062chr631647 205 138 --11586 --
NM_002092chr475007 4753 4743 3536 2015 1629 908 1460 21723 57 --
NM_002126chr1764051 3527 3237 3075 3011 1646 11053 11040 --
NM_002128chr133886 616 427 1669 ----
NM_002146chr174469 395 339 228 ------
NM_002182chr342322 1885 1710 715 22409 530 ----
NM_002202chr5------1343
NM_002203chr554119 1597 1258 279 38 13618 22589 1554 14064
NM_002210chr243470 3383 933 26 ------
NM_002223chr1273924 3545 2944 2592 1208 1049 219 --1227 --
NM_002233chr113445 181 165 ------
NM_002253chr421374 895 11144 1164 --
NM_002264chr374904 4566 4051 1843 1661 1368 1133 15014 2853 160 --
NM_002270chr565004 3849 3570 761 743 213 --15447 --
NM_002285chr233810 3178 1317 23474 1614 23877 3285 --
NM_002293chr182258 2218 779 523 306 276 174 27 1452 ----
NM_002310chr5106629 5720 5413 5246 4856 1264 1097 1076 808 64 44603 4529 4289 1778 ----
NM_002359chr1733665 3456 1437 --13360 --
NM_002374chr253144 2957 2328 2289 327 1646 ----
NM_002409chr2293143 2980 2941 2754 2541 2092 767 401 191 11283 1526 --
NM_002481chr1117489 7393 6441 6352 5121 4864 2795 2674 2546 1510 329 1514 11686 --
NM_002500chr22811 798 11292 ----
NM_002514chr851197 1090 941 852 315 ------
NM_002545chr1154668 4343 525 318 44 33540 558 432 11428 --
NM_002547chrX64168 3835 3713 3101 2939 799 23292 297 ----
NM_002563chr31779 --1865 1157
NM_002572chr111122 ----1269
NM_002581chr994747 2166 2005 1709 946 832 786 371 159 32179 1968 1832 149 --
NM_002594chr2032336 1770 270 1215 1455 --
NM_002595chr1231530 668 595 11300 ----
NM_002600chr141270 619 560 29 ------
NM_002641chrX21883 558 21328 692 ----
NM_002645chr1112247 42963 2899 1104 912 1165 --
NM_002655chr865128 1579 1496 1110 367 234 15163 --25169 851
NM_002670chr32139 27 --1644 --
NM_002706chr23674 522 228 ------
NM_002709chr263022 2882 2737 615 286 250 22456 490 12709 --
NM_002718chr372450 2283 2275 591 491 346 163 22229 789 12074 --
NM_002719chr1452297 2164 1989 1865 881 ------
NM_002734chr173850 753 501 ----12039
NM_002748chr1531029 422 271 ------
NM_002839chr942298 1099 1032 717 2906 48 11299 11173
NM_002874chr921999 1528 ----189
NM_002886chr394752 4591 4483 4342 3490 2086 2050 1891 866 --31101 688 51 --
NM_002890chr5----2396 110 --
NM_002906chr1172369 2078 1929 422 298 245 86 --1407 --
NM_002977chr223449 299 11375 1727 --
NM_002998chr842124 1849 682 192 12246 ----
NM_003016chr1711883 ----11821
NM_003028chr943848 3796 2382 353 12690 --12732
NM_003034chr12107599 7428 7201 6726 5162 2788 2258 1847 575 191 25664 5565 ----
NM_003108chr276695 6461 5496 2845 1600 997 683 15741 14495 --
NM_003128chr242757 522 386 77 ------
NM_003137chr64517 309 291 193 11827 1390 --
NM_003155chr882717 2644 1134 649 564 489 173 165 2894 312 11799 11102
NM_003161chr1793410 3005 2477 2441 2373 572 246 221 62 23245 1036 ----
NM_003189chr112871 1372 22975 1294 11163
NM_003199chr1885107 4990 4659 1693 958 552 239 21 13489 ----
NM_003221chr663682 1579 1432 1210 858 531 12627 23675 3560 --
NM_003246chr1552020 2002 763 424 217 ------
NM_003247chr631600 1551 701 1207 ----
NM_003253chr2131674 1484 1379 11208 --11759
NM_003257chr1551354 1317 561 439 404 ------
NM_003262chr385212 4312 3236 1420 1179 910 870 383 21012 130 ----
NM_003292chr142150 2125 677 273 11558 ----
NM_003298chr365773 4065 2144 1775 887 457 24410 1656 1900 --
NM_003326chr142517 1874 1102 825 --1876 --
NM_003337chr53526 287 223 ----11246
NM_003338chr1041763 1449 739 253 ------
NM_003342chr1712748 1309 --12629
NM_003348chr1241433 1080 147 119 ------
NM_003349chr2021540 330 ----1307
NM_003387chr262930 2871 2196 2054 730 287 32503 602 318 1710 --
NM_003392chr334341 2831 855 14014 23298 2774 1327
NM_003410chrX42881 2580 1975 646 1436 ----
NM_003411chrY41569 609 397 387 ----179
NM_003412chr342851 2669 2384 613 12203 ----
NM_003413chrX2551 117 --12016 1610
NM_003439chr783206 3031 2764 2740 1240 717 425 141 12964 13372 --
NM_003458chr332995 2957 795 --23153 532 1110
NM_003463chr643123 2731 2347 510 21254 1041 12742 1521
NM_003471chr3----1169 1585
NM_003472chr611302 --1431 --
NM_003474chr1042392 1742 1483 318 --12157 --
NM_003489chr2163268 2518 1312 1299 1189 391 22465 1357 ----
NM_003566chr1253174 2986 2399 901 434 ------
NM_003574chr1885688 5217 4155 3551 2216 1447 1175 241 --14140 --
NM_003583chr1263568 2919 823 612 514 364 1336 12444 --
NM_003590chr243478 3038 2811 1213 --1618 --
NM_003615chr353305 3155 2863 1183 627 13404 ----
NM_003617chr134412 3927 79 13980 24263 1682 --
NM_003659chr231187 1154 211 31208 223 164 1825 --
NM_003692chr9--1835 --2704 310
NM_003705chr24764 346 319 302 ------
NM_003713chr13714 613 362 11484 11347 --
NM_003714chr563079 2263 2192 911 752 63 12835 12567 --
NM_003716chr31360 1371 --1175
NM_003750chr10------2175 53
NM_003800chr682394 1666 842 454 334 214 198 115 2697 269 ----
NM_003873chr1032542 1884 1843 22004 1707 ----
NM_003887chr261921 1766 1581 869 534 159 --1485 --
NM_003895chr2142178 1879 1348 607 11744 12189 --
NM_003899chr133351 243 223 ----2705 450
NM_003913chr664156 3946 3515 3050 707 553 ------
NM_003916chrX61482 1221 1112 1007 460 298 11193 ----
NM_003948chr431822 77 52 --11050 2263 238
NM_003953chr152886 2123 1942 654 303 --21746 21 --
NM_003972chr1031313 1185 926 1336 ----
NM_003983chr1684091 2950 2892 1741 1142 1131 1008 888 --14023 24002 3332
NM_003994chr1253942 3046 1339 1306 792 13221 2635 119 --
NM_004006chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004007chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004009chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004010chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004011chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004012chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004013chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004014chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004015chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004016chrX52523 2228 2125 437 183 2973 454 1694 --
NM_004017chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004018chrX52523 2228 2125 437 183 2973 454 1694 --
NM_004020chrX52609 2314 2211 523 269 21059 540 1780 --
NM_004021chrX52523 2228 2125 437 183 2973 454 1694 --
NM_004022chrX52523 2228 2125 437 183 2973 454 1694 --
NM_004023chrX52523 2228 2125 437 183 2973 454 1694 --
NM_004028chr1821269 333 ----1452
NM_004035chr1733808 1147 333 --24730 4013 14881
NM_004064chr1261311 1015 888 120 96 44 ------
NM_004081chrY31673 1627 1616 ------
NM_004087chr361831 719 581 338 167 118 ------
NM_004093chr1353193 2037 1145 354 263 --33240 3233 557 --
NM_004100chr632265 803 358 22243 1809 12381 1920
NM_004105chr24783 739 669 99 1967 ----
NM_004124chr1432227 1106 853 --11099 --
NM_004136chr1563312 2536 2062 1149 1122 508 12119 --12127
NM_004162chr34921 500 494 395 ------
NM_004171chr11129491 9143 7592 7459 7193 5975 3735 3057 2247 1535 1208 642 28490 7295 38972 6412 3852 19339
NM_004229chrX61668 1462 703 665 578 217 ------
NM_004232chr1853846 3519 3251 578 342 13593 ----
NM_004253chr94812 269 119 55 ------
NM_004274chr1443124 2883 2564 661 22581 2308 ----
NM_004296chr1473706 3341 3145 986 509 481 311 22933 1380 32776 578 68 1432
NM_004331chr862462 2172 1731 1667 688 552 ----1123
NM_004337chr841698 1556 434 255 1765 11540 12220
NM_004338chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_004342chr741679 671 575 127 12269 1301 --
NM_004362chr43495 221 214 --192 --
NM_004384chr54940 554 499 158 --12316 --
NM_004389chr23899 239 200 1654 ----
NM_004392chr1352550 2390 639 375 56 1525 ----
NM_004393chr352385 1714 1482 954 789 ----12301
NM_004397chr1123318 51 12907 12805 --
NM_004432chr952431 1802 949 238 131 --22335 2057 --
NM_004438chr232955 2386 342 --12062 --
NM_004440chr631730 1616 569 21521 255 ----
NM_004449chr214926 558 458 224 1990 ----
NM_004458chrX22177 2135 ----12089
NM_004464chr454246 2892 2662 1710 126 43852 3579 2964 1406 ----
NM_004501chr143599 3225 3150 91 ------
NM_004504chr2102984 2864 2694 2663 2123 1991 704 344 321 46 1788 --1267
NM_004525chr231360 552 468 183 ----
NM_004527chr1711451 --3598 498 112 --
NM_004537chr1231129 257 76 ------
NM_004586chrX105235 5189 4918 4723 4360 3331 1404 914 677 665 1894 ----
NM_004598chr553013 2431 2350 1094 538 13056 ----
NM_004612chr984878 4755 4634 3330 1450 1233 916 412 13673 ----
NM_004637chr321306 160 ----1114
NM_004660chrY22181 554 ----22070 1528
NM_004686chr841681 1290 1205 475 1719 1359 --
NM_004713chr142530 239 1666 ----
NM_004719chr1252706 2660 2598 528 488 ------
NM_004734chr1363110 2724 2492 1986 847 729 21092 943 ----
NM_004736chr141702 860 115 26 ------
NM_004738chr2032645 106 48 12368 ----
NM_004745chr886950 6407 6060 5529 5080 2630 2203 409 35795 2825 2027 34720 1685 106 1703
NM_004760chr72599 258 31722 500 473 ----
NM_004768chr13423 318 158 ----1762
NM_004774chr1742994 2922 1058 426 11937 --1162
NM_004775chr1821513 476 --12104 --
NM_004788chr1122762 2690 12082 --1782
NM_004801chr2--21192 229 11179 1577
NM_004815chr1104546 4314 3862 3447 3383 1947 1373 1107 310 189 14914 --24250 3335
NM_004827chr461968 1743 1644 1504 667 530 ------
NM_004830chr63832 659 37 ------
NM_004840chrX11931 --32000 555 393 --
NM_004841chr1----1200 1866
NM_004850chr251500 1329 542 367 331 ------
NM_004859chr1732354 505 186 12125 1180 --
NM_004863chr1455115 3431 3225 1912 1818 --3813 783 738 25221 4032
NM_004866chr564964 4515 1877 1312 606 376 33388 1821 258 ----
NM_004887chr52391 343 --1847 --
NM_004898chr452518 2124 1084 1065 872 --12173 --
NM_004904chr796522 6461 5819 4886 4293 4093 2267 1414 428 12400 36024 5113 1762 --
NM_004912chr741396 1083 491 33 ------
NM_004926chr1431722 1643 1146 1665 156 --
NM_004929chr861195 1147 1089 956 392 350 11162 ----
NM_004932chr551736 1584 1108 686 433 2625 209 ----
NM_004956chr743540 3090 3071 1279 31659 988 410 ----
NM_004966chr102719 303 --2929 822 --
NM_004985chr1244398 4304 2908 673 11778 ----
NM_004992chrX77907 7774 2705 2045 2025 1887 758 15339 27739 6481 13409
NM_004992chrX77907 7774 2705 2045 2025 1887 758 15339 27739 6481 13409
NM_004999chr664314 3521 1153 1128 919 404 21426 298 --24324 3778
NM_005044chrX64150 3756 3070 1820 530 112 11138 --1774
NM_005056chr1275483 4937 844 430 416 289 133 24577 325 --14287
NM_005063chr1053592 3142 2945 2853 2503 21484 1032 ----
NM_005079chr852961 2726 2365 890 771 32053 586 262 23101 61 --
NM_005093chr2064177 3786 3308 1904 1726 643 --44054 1328 1295 936 --
NM_005116chr2064089 4050 3692 974 616 104 --33536 1567 1360 --
NM_005121chr1743509 3309 3204 2613 22723 2400 1817 --
NM_005135chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_005156chr955402 1879 1337 543 500 ----14604
NM_005188chr1167847 6644 5188 1355 919 132 ----15478
NM_005197chr1444689 2004 682 649 16074 1374 11213
NM_005235chr287292 2567 2193 1708 1521 1285 732 444 36915 1601 1468 ----
NM_005238chr1153505 3109 2353 955 371 --1862 --
NM_005254chr1511420 --11408 --
NM_005257chr18----1453 1400
NM_005259chr211545 31502 1197 623 ----
NM_005295chr7------133
NM_005339chr434284 2922 58 ----12821
NM_005359chr1865611 4897 4054 3961 1947 1185 12586 1237 --
NM_005385chr352612 2163 1982 584 203 ------
NM_005399chr123380 1135 --21104 573 --
NM_005436chr1054031 3947 3730 1203 1043 2601 238 ----
NM_005458chr972184 1984 1857 1538 730 431 256 ------
NM_005465chr13661 504 110 --11426 --
NM_005474chr17------181
NM_005497chr1754645 3795 2023 1329 1008 12422 ----
NM_005502chr952967 2747 2373 1173 627 --1414 1468
NM_005504chr12105794 4819 4480 2496 2428 2165 2007 966 623 343 16469 36570 4216 2436 15200
NM_005509chr541454 480 417 232 11868 1623 --
NM_005542chr7--11883 --11899
NM_005578chr373945 3389 1583 1186 233 184 177 24954 924 1508 --
NM_005587chr152117 57 1769 1884 --
NM_005596chr9105882 5794 5563 5116 4549 2477 1700 1687 1480 1398 26359 4716 ----
NM_005627chr6192 --2173 113 --
NM_005638chrX41573 1163 541 401 ------
NM_005665chr124760 465 14825 --14767
NM_005711chr531061 1042 229 --1918 --
NM_005715chr662031 1742 1000 839 278 119 22293 373 22626 772 --
NM_005717chr12154 131 1278 1996 --
NM_005737chr232166 1849 784 ----12179
NM_005746chr722658 1950 --11100 --
NM_005756chrX41435 1324 1298 113 ------
NM_005759chr284468 3205 1881 1848 1267 1230 866 608 ------
NM_005779chr532949 2726 194 ----1153
NM_005822chr652268 465 457 427 179 21822 541 11974 --
NM_005832chr331218 1158 513 11264 ----
NM_005840chrX87676 7562 5437 5050 4828 2604 1332 153 17596 25223 2916 17602
NM_005868chr752091 1012 725 151 82 ------
NM_005880chr164348 187 108 42 ------
NM_005885chr541219 1022 448 270 ------
NM_005901chr1898329 7514 7464 6887 6816 2986 2609 2262 2218 15499 --23321 1608
NM_005902chr1563236 1182 1033 781 490 206 14176 ----
NM_005909chr544250 4182 3390 1680 23011 1019 1677 --
NM_005935chr483303 2086 1854 1582 721 673 379 47 11634 14605 --
NM_005941chr843782 3007 1448 1141 1705 --13569
NM_005955chr135027 4927 4317 21303 161 1149 14083
NM_005962chr1032229 942 363 ------
NM_005962chr1032229 942 363 ------
NM_006007chr943245 3163 592 329 13451 13506 --
NM_006016chr631717 1627 555 ----11907
NM_006047chr2043385 2225 2174 1345 157 ----
NM_006060chr763760 3028 3015 1040 923 793 1223 12949 --
NM_006073chr621529 882 21390 687 --11463
NM_006080chr753017 2903 2684 1916 838 22065 1863 ----
NM_006095chr433525 3394 1311 23103 138 11601 --
NM_006113chr131966 292 121 --11491 --
NM_006134chr213285 75 21 ------
NM_006135chr11267 ----1484
NM_006141chr1642592 2359 2345 171 --1257 --
NM_006166chr1252513 2488 1748 1637 821 11794 ----
NM_006197chr842277 703 651 76 1557 ----
NM_006203chr5135340 5260 4532 4397 4195 2009 1941 1768 1682 1581 1215 1191 207 23547 1401 ----
NM_006206chr422749 2631 ----11883
NM_006209chr81306 ----1430
NM_006212chr135310 3798 203 1704 14017 --
NM_006226chr241415 1357 992 984 ----11066
NM_006237chr1321853 395 --1724 12028
NM_006246chr143849 498 465 --1515 --
NM_006251chr532909 1076 832 --2795 490 --
NM_006265chr811460 31355 1064 1029 ----
NM_006283chr854475 4096 1661 1042 704 --24747 3523 --
NM_006298chr633365 2296 736 11142 1685 11360
NM_006306chrX44434 4394 1762 750 13709 34628 2303 1266 --
NM_006313chr1241446 1312 1303 78 ----11160
NM_006315chr463397 2846 1237 1211 918 713 23354 2922 ----
NM_006359chrX22005 146 --12049 1709
NM_006364chr1441101 889 852 152 ------
NM_006371chr365306 5033 4817 3771 1148 706 23935 3249 24955 545 --
NM_006380chr1754283 3861 1569 508 227 ------
NM_006386chr2231634 920 499 --12342 --
NM_006393chr1031649 1230 959 --13392 --
NM_006408chr71680 ----1960
NM_006419chr42650 485 1768 1680 --
NM_006420chr2053475 3451 3113 2667 1271 12139 169 --
NM_006467chr532237 714 198 --1609 --
NM_006469chr151258 1107 319 298 269 11152 ----
NM_006482chr1263568 2919 823 612 514 364 1336 12444 --
NM_006544chr1446043 5992 4593 218 15520 ----
NM_006561chr1085667 4366 4316 4005 2042 1353 153 50 ----14725
NM_006599chr16107386 7236 6046 6027 3185 2080 1036 770 542 195 36059 2520 1298 ----
NM_006603chrX--2646 409 21980 1821 --
NM_006606chr202867 28 3595 135 87 11158 --
NM_006609chr272361 999 916 831 441 356 169 ------
NM_006621chr121837 1260 11287 11732 11804
NM_006624chr1032040 1855 731 ------
NM_006628chr1554154 4131 3214 1241 999 2960 951 34185 3953 3366 --
NM_006629chr1842208 1860 1108 844 --22137 890 --
NM_006636chr2----21030 309 --
NM_006646chr1342556 2471 1155 237 23058 2461 --1136
NM_006654chr1274528 3960 3675 3529 2916 1087 802 34653 2907 1659 ----
NM_006682chr722359 2207 --22640 686 12865
NM_006699chr122675 156 ----1889
NM_006750chr1678014 7079 6424 5522 5298 5209 1132 36094 3224 2291 13106 --
NM_006754chr721119 236 --11199 --
NM_006775chr62773 297 32821 2127 1895 ----
NM_006777chrX2341 107 ----12287
NM_006790chr5----1165 1321
NM_006814chr2052625 2471 1777 307 22 ----12362
NM_006873chr232473 2301 902 11403 13377 12429
NM_006888chr1453114 2866 2643 460 213 1831 ----
NM_006915chrX72038 1791 936 678 459 385 149 ----1477
NM_006918chr1195078 4952 4877 4097 3897 1822 1291 1229 510 21019 85 22272 1274 --
NM_006920chr231913 384 375 ----11678
NM_006924chr1774194 4082 3507 3259 420 371 135 1153 13902 --
NM_006930chr521654 266 31891 1510 649 --11926
NM_006940chr1231393 705 79 1271 ----
NM_006955chr1043096 2570 847 86 32696 2610 863 1932 --
NM_007006chr1653396 3293 3171 3066 2568 ------
NM_007007chr1264339 4144 3225 1609 1432 1088 14458 13953 --
NM_007011chr1566464 6289 6062 5734 1083 779 32032 1463 296 36558 6501 2445 --
NM_007038chr21116033 5339 4919 4763 4640 4597 1723 1145 422 397 230 24474 444 --25059 994
NM_007039chr1432358 735 273 --11426 --
NM_007106chr13------22409 901
NM_007114chr362591 2343 1255 903 448 431 12258 ----
NM_007139chr721115 429 1815 ----
NM_007172chr2252745 2503 2045 1111 93 --11322 --
NM_007175chr843617 2477 2357 1283 22704 1101 ----
NM_007187chr132362 193 --1713 --
NM_007195chr1843761 3502 2470 350 13252 ----
NM_007222chr81288 ----1656
NM_007231chrX42394 1580 436 133 ------
NM_007236chr151785 --12086 1282
NM_007249chr13118840 8682 8196 7876 6995 6105 5714 3453 2208 1837 1576 47991 6200 6148 3251 --36395 5914 466
NM_007287chr352509 2495 550 503 425 ----12403
NM_007288chr352509 2495 550 503 425 ----12403
NM_007289chr352509 2495 550 503 425 ----12403
NM_007292chr1733808 1147 333 --24730 4013 14881
NM_007345chr1872348 2166 1923 1834 849 770 717 ------
NM_007350chr1244444 2881 993 61 --13725 34544 1699 774
NM_007351chr421126 401 --174 1996
NM_007375chr152341 1852 1043 656 368 1992 1997 --
NM_012062chr124845 228 172 165 ------
NM_012081chr532866 2819 2371 11473 12380 --
NM_012092chr23689 324 112 --21828 286 --
NM_012096chr332764 1386 600 31045 366 218 22659 694 12409
NM_012097chr232117 1954 539 --11979 --
NM_012137chr141949 1179 834 603 --1718 --
NM_012141chr1364044 2564 1660 1097 579 555 --14147 --
NM_012158chr1341600 710 474 210 1311 ----
NM_012214chr276130 5627 5421 3949 1896 297 22 ------
NM_012234chr332993 2686 78 --1415 11235
NM_012249chr251127 878 678 342 279 1439 33434 2405 2341 --
NM_012262chr184860 4409 3796 3584 1530 1420 740 256 --14374 14836
NM_012290chr231540 1080 456 ----11400
NM_012293chr242307 765 680 654 2754 125 11556 --
NM_012294chr742913 1538 846 274 2571 125 13266 --
NM_012297chr46912 744 510 331 242 189 ------
NM_012301chr732014 500 174 22235 582 21855 534 --
NM_012309chr1184879 4576 4401 4143 3078 3012 1075 68 2976 623 24084 1497 --
NM_012316chr165349 4449 3932 1895 1473 579 --45222 4919 4608 1960 15588
NM_012323chr2221167 557 --21239 127 --
NM_012334chr534226 4040 3514 --23826 2879 --
NM_012345chr1331761 1381 1315 --11864 --
NM_012388chr1533173 3129 2177 --12012 --
NM_012425chr1062518 1888 991 867 653 541 ------
NM_012471chrX31979 1808 701 11225 1150 11728
NM_012482chr1--2435 218 --1656
NM_013231chr1463857 3457 3298 3233 1324 331 23480 1258 14324 1836
NM_013261chr463758 2770 1452 1406 1061 739 23306 226 12516 23162 1361
NM_013262chr611448 --1236 1175
NM_013269chr1263500 3163 3137 3128 1805 685 13591 ----
NM_013277chr122825 239 --156 1950
NM_013309chr1532654 2525 1754 ------
NM_013357chr84777 651 285 277 ------
NM_013372chr1553176 2431 2332 461 243 12116 12615 1293
NM_013436chr2------1196
NM_013989chr14104912 4777 3839 3310 3269 1881 1787 775 305 198 14386 ----
NM_014016chr3181 --2444 122 --
NM_014021chr153199 2703 2277 2117 654 ----23153 52
NM_014043chr341351 1065 565 507 --21268 631 --
NM_014048chr1685220 5144 4944 4223 4000 3636 3624 1050 14837 24191 1099 14428
NM_014089chr1351799 343 246 167 89 --1895 --
NM_014112chr885211 4786 4455 3699 1897 1868 1680 885 25492 4580 ----
NM_014141chr794416 4190 3915 3515 3232 1729 1680 1198 425 11378 21750 95 --
NM_014155chr1167080 5603 5531 2864 2819 1236 --12673 --
NM_014157chr1663903 3700 1338 960 897 620 23331 637 1148 --
NM_014243chr441980 1496 598 307 ------
NM_014253chrX1851 22312 311 --1122
NM_014294chr82570 315 --11222 --
NM_014325chr1242186 727 386 116 1566 1152 --
NM_014333chr1142396 2110 2033 349 ----12726
NM_014363chr1331218 253 108 ------
NM_014376chr582131 1943 1878 1738 1653 360 179 134 --12100 12095
NM_014379chr84841 795 193 160 11022 1684 --
NM_014388chr1124660 4472 4224 2223 1383 1208 1078 984 792 635 387 141 45997 5834 4792 685 --11409
NM_014410chr18--125 --1307
NM_014423chr555549 3990 3612 227 52 24082 3880 15420 --
NM_014447chr441632 1365 1058 421 1283 ----
NM_014554chr1222003 228 --21782 155 --
NM_014571chr162696 2542 2438 2086 972 832 12326 --12914
NM_014586chr2144511 4255 1599 103 --34707 1616 63 --
NM_014612chr931352 617 167 ------
NM_014615chr1642978 2937 2924 273 13638 ----
NM_014636chr954361 3244 3231 3101 1278 11529 11254 --
NM_014690chr742848 2129 2091 745 12882 12924 1549
NM_014701chr1543347 3271 3234 3046 12914 ----
NM_014702chr663373 3288 3087 2987 2930 2211 11144 --1567
NM_014705chr721959 604 --1404 11800
NM_014711chr1621468 571 21540 742 11933 --
NM_014720chr1031304 693 333 ------
NM_014721chr665688 5550 5115 4983 4557 770 11214 12543 --
NM_014729chr842304 1708 1660 697 1536 ----
NM_014733chr532246 1756 1575 1619 11416 --
NM_014735chrX31550 296 181 ------
NM_014739chr694026 3035 2598 1292 927 831 678 464 440 23850 3450 12563 13313
NM_014743chr443122 2861 2477 1141 22931 438 11061 --
NM_014746chr283087 2841 1476 1418 1243 1036 746 89 11688 2222 26 --
NM_014747chr185744 5565 5238 4515 4138 3882 520 270 14762 14104 --
NM_014751chr851410 1345 700 619 227 ------
NM_014755chr274175 3870 3112 2774 1421 1163 1145 22902 1250 ----
NM_014766chr763779 3572 3214 1221 600 295 ------
NM_014781chr84980 808 135 24 --1429 --
NM_014787chr131809 866 341 1815 12017 --
NM_014800chr731153 1136 948 1938 2455 123 --
NM_014810chr133425 3151 373 1828 1501 13557
NM_014812chr131845 1217 664 11787 ----
NM_014819chr542122 1744 1557 820 1211 ----
NM_014820chr342099 1820 622 135 ------
NM_014828chr1452421 2141 1851 610 447 1399 11704 --
NM_014829chr532206 2148 814 11668 --11967
NM_014830chr1273873 2913 2870 2472 1525 782 199 ------
NM_014839chr152223 2119 1642 956 168 --11767 --
NM_014848chr1522765 892 2570 60 --12076
NM_014850chr354328 1150 541 328 299 --1890 34340 4076 172
NM_014872chr95871 637 383 281 184 12344 1921 --
NM_014873chr174406 3551 1114 700 558 415 258 ------
NM_014877chr1762945 2640 2360 1917 1889 1302 14760 11997 --
NM_014888chr72564 221 ----11467
NM_014897chr1762360 1085 878 756 327 297 --22212 38 12752
NM_014900chr23797 755 729 --1311 --
NM_014903chr1242263 2171 1895 1664 ------
NM_014904chr1012866 13013 --11179
NM_014906chr1744024 3867 3461 3210 23296 2885 ----
NM_014920chr643527 2318 1082 858 13096 ----
NM_014923chr1342071 2022 1769 120 ------
NM_014932chr331688 1261 126 --11448 1240
NM_014935chr193741 3527 3305 3207 2813 2803 1257 806 356 --158 --
NM_014936chr652737 2347 1883 334 225 32524 2035 59 1861 --
NM_014947chr122898 776 ----1792
NM_014953chr1394337 3942 3768 3674 3600 3537 3244 1654 129 1228 23868 3852 --
NM_014962chr2052636 2624 2280 2086 1999 11806 143 --
NM_014978chr1041861 1741 1534 1400 ------
NM_014982chr1494661 4178 3612 3554 1684 1408 1104 866 270 ------
NM_014989chr631437 1304 364 --1494 --
NM_014991chr41532 22566 2547 1100 --
NM_014997chr752334 2238 965 170 128 1415 11879 --
NM_015000chr1261902 1227 997 501 363 259 13116 13085 --
NM_015025chr252733 1918 1735 266 195 --12703 --
NM_015026chr1283817 3108 2919 1046 723 447 266 172 ------
NM_015032chr1342929 2854 2158 959 ------
NM_015042chr1554065 3702 3201 2901 2793 13539 --11266
NM_015049chr253183 2588 2479 1061 341 13057 22309 1149 --
NM_015051chr953039 2787 1260 1073 434 ------
NM_015055chr1162845 2592 2520 2482 2051 23 ------
NM_015068chr783239 3233 2503 1260 1191 932 745 681 --33357 170 119 13147
NM_015071chr576136 5662 4935 4424 1952 1917 780 15834 35770 2173 763 11234
NM_015077chr1754709 4617 3425 1629 1443 23585 988 --22926 620
NM_015090chr146023 5410 4162 1258 15596 35866 5205 1485 35939 4754 3896
NM_015091chr141347 --1148 198
NM_015092chr1633712 3679 1269 274 46 ----
NM_015101chr171098 943 824 365 303 39 27 ------
NM_015115chr443219 2600 755 237 23105 2691 ----
NM_015124chr2242272 856 219 95 --32122 1791 816 --
NM_015137chr872160 2086 998 902 735 580 120 1374 ----
NM_015143chr451271 1251 1220 1172 1119 --122 --
NM_015154chr1572668 2638 2345 1254 1013 435 106 --11134 --
NM_015155chr1083012 2978 2569 901 836 715 422 410 --2881 581 --
NM_015156chr1452488 1161 816 572 556 --2258 93 13892
NM_015170chr841895 1572 876 395 172 ----
NM_015192chr2042945 2301 2168 104 --11890 11863
NM_015199chr332823 606 221 --12275 12369
NM_015200chr432045 1683 774 --12315 --
NM_015205chr1374600 3870 3717 3590 3333 970 378 23502 718 51271 1247 1189 1160 1139 13539
NM_015206chr1583798 3319 3184 3120 2940 946 603 161 32702 2384 1545 ----
NM_015215chr142514 2407 602 240 ------
NM_015225chr972864 2608 2110 1947 686 593 58 22570 2493 ----
NM_015247chr1645272 5253 4808 1829 25104 4772 15122 185
NM_015265chr252240 1007 766 342 31 ------
NM_015268chr34527 490 249 174 --152 --
NM_015271chr434030 3454 238 12820 22704 1262 --
NM_015272chr1652133 1965 1709 1509 548 21328 535 ----
NM_015275chr121456 1801 1104 11904
NM_015296chr1331223 813 129 --21235 51 --
NM_015299chr1443464 3397 1006 818 11428 23980 1357 --
NM_015310chr8107130 6524 6094 5338 5225 2828 2614 876 638 328 --26530 5283 11964
NM_015313chr1174766 4583 4200 4092 4072 3765 374 1211 31567 1259 67 --
NM_015315chr572510 2345 2135 1147 1117 228 192 ------
NM_015326chr142851 2617 2023 478 --12806 --
NM_015328chr742347 2064 1201 560 21931 1130 ----
NM_015365chrX54127 1562 1443 1288 512 ------
NM_015387chr241960 1855 413 72 ------
NM_015393chr443806 3223 2979 1378 21304 933 22814 2715 13542
NM_015455chr573989 3532 2956 1428 1104 999 836 1373 13565 --
NM_015460chr322101 437 ----1846
NM_015526chr192338 287 1451 --1103
NM_015535chr283609 3540 3244 3022 2949 2758 1644 428 13624 ----
NM_015542chr1021101 429 --21078 92 --
NM_015553chr62706 373 44439 1923 1627 840 14729 24388 195
NM_015560chr332837 205 36 32217 1065 702 ----
NM_015564chr563584 595 545 203 70 27 ------
NM_015565chr2131708 1642 36 1425 11898 --
NM_015569chr134068 3090 1047 21856 1001 2750 407 --
NM_015571chr622513 750 ----12053
NM_015576chr352306 1893 969 858 117 --1883 1785
NM_015635chr942044 776 550 259 ------
NM_015640chr174479 1490 1430 1374 825 779 655 25371 999 ----
NM_015646chr122273 96 1251 1165 --
NM_015678chr1361585 1386 435 372 112 93 --11092 --
NM_015691chrX2212 113 ----1546
NM_015852chr743226 3031 2846 2589 13245 ----
NM_015879chr1867763 6602 6355 6135 1833 448 --1869 --
NM_015888chr163085 2882 2143 1210 241 209 --22584 2504 12976
NM_015906chr174821 4127 3759 3364 1517 450 100 --1180 23372 1113
NM_015912chr842421 2267 1704 774 22169 969 ----
NM_016009chr154886 4846 4531 3992 1002 14200 11358 --
NM_016018chr842215 2099 2047 1912 12173 ----
NM_016021chr652927 2804 532 181 50 1158 1589 --
NM_016025chr1611893 --11390 11311
NM_016076chr153035 1976 862 660 77 22779 901 1618 22818 23
NM_016079chr242301 1542 1448 865 1849 ----
NM_016083chr683923 3387 3230 3015 2624 1529 847 765 11363 ----
NM_016089chr341359 796 376 208 21692 54 --2642 138
NM_016132chr1573470 1180 871 841 832 31 24 ------
NM_016205chr421034 496 11091 11222 --
NM_016206chr398835 8210 8182 7698 6511 2992 1878 1776 345 17099 --12153
NM_016217chr642474 902 75 57 1600 ----
NM_016248chr1353653 3576 2948 2627 1571 13322 1305 --
NM_016260chr2126654 5957 5607 4741 4698 2906 2825 1582 1418 654 502 281 ------
NM_016264chr19----1544 144
NM_016271chr1832038 1617 357 31899 1851 1803 ----
NM_016308chr141290 322 268 102 ----1705
NM_016315chr231720 1255 496 1759 ----
NM_016322chr973219 2335 2244 1226 1096 689 89 1568 ----
NM_016351chr73533 454 26 --1153 --
NM_016353chr872095 1953 797 718 423 266 194 ----12474
NM_016376chr1754267 3687 3633 1567 1317 --2864 30 --
NM_016395chr1571867 1705 1627 1534 571 563 144 1590 ----
NM_016396chr1542783 2716 625 262 ------
NM_016513chr643527 2318 1082 858 13096 ----
NM_016530chr1553417 3325 3263 3250 298 13437 --13073
NM_016531chr453098 2886 2866 406 80 ------
NM_016542chrX51668 1364 655 579 304 ------
NM_016544chr273608 3035 2733 1590 1553 1424 976 12517 11202 --
NM_016577chr374482 3556 3191 3148 1187 560 176 13345 13450 --
NM_016603chr561538 1435 690 566 273 25 11807 ----
NM_016604chr5----2295 233 1895
NM_016654chr1511420 --11408 --
NM_016824chr1021657 61 ----150
NM_016952chr1163841 2898 1582 1500 1117 717 13229 13949 1594
NM_017420chr142553 539 --1924 --
NM_017423chr462087 1620 722 536 449 230 --12044 --
NM_017447chr2144047 3859 372 138 13811 12828 --
NM_017544chrX------2782 266
NM_017594chr942948 2406 769 234 --33151 2656 414 1974
NM_017610chr1552040 1580 728 601 481 11400 ----
NM_017628chr474983 3735 3672 3604 2006 1226 1119 ------
NM_017633chr62815 667 13919 --11211
NM_017637chr9137988 7436 7157 7118 6450 2902 2753 2676 2055 1987 1719 1141 683 1612 --16211
NM_017643chr1742868 1901 1157 751 --1452 --
NM_017644chr364781 4123 1922 1741 1547 81 34401 3630 492 --14246
NM_017650chr785928 5859 4381 4205 3792 1933 944 277 14140 ----
NM_017658chr1474205 4157 4059 867 758 466 56 23922 1083 --11474
NM_017666chrX41614 558 291 201 32014 769 465 ----
NM_017680chr91826 ----1927
NM_017709chr133225 2962 2885 --33615 1000 250 --
NM_017737chr15747 696 629 564 446 ------
NM_017744chr121592 470 --1900 1453
NM_017745chrX2592 557 ----1522
NM_017752chrX41689 338 222 42 21606 127 ----
NM_017754chr634179 3557 1642 --1912 13116
NM_017778chr811030 11391 21491 328 --
NM_017779chr142341 943 119 57 ------
NM_017824chr1021747 660 1520 ----
NM_017849chr232763 1146 712 --23225 228 1245
NM_017915chr1241221 404 232 212 ------
NM_017919chr944727 4487 1999 1113 55578 4966 4950 4403 1258 21179 1081 --
NM_017943chr1431015 789 113 1319 ----
NM_017954chr741676 1100 336 232 184 ----
NM_017964chr24945 795 331 127 ------
NM_017982chr13403 380 132 --3981 333 313 --
NM_017994chr733022 1030 622 12360 ----
NM_018014chr241040 982 361 218 11104 ----
NM_018017chr1032917 2592 472 1396 ----
NM_018018chr1231704 1277 220 21328 654 ----
NM_018027chr1052858 2390 1196 753 275 1419 ----
NM_018061chr131609 511 27 ------
NM_018121chr1033159 2543 2443 2709 606 ----
NM_018155chr353068 2539 886 455 162 ------
NM_018157chr1252989 2443 904 513 112 11189 1789 --
NM_018172chr111315 --5582 530 478 426 374 --
NM_018181chr1851527 1450 547 156 37 ------
NM_018182chr173858 39 32 --1521 --
NM_018191chr1321632 1543 --1124 11784
NM_018243chr453954 3139 2491 714 701 --33647 3523 3413 11091
NM_018247chr642930 2066 460 212 1886 11053 --
NM_018254chr132463 2162 883 11488 1546 --
NM_018266chr3--1959 1286 1722
NM_018293chr362998 2256 2230 1933 232 143 11178 ----
NM_018313chr362592 1811 745 616 473 123 ------
NM_018315chr421140 632 --11059 --
NM_018351chr1284368 4207 4092 4021 3608 2893 1029 622 13554 14004 --
NM_018362chr1151404 977 771 747 324 ------
NM_018364chr171185 1132 798 791 148 129 22 --13495 --
NM_018374chr742008 1981 1961 1128 --33922 2051 658 --
NM_018375chr1451555 570 212 186 105 1603 1780 --
NM_018383chr232043 1992 1886 --2564 459 --
NM_018400chr1164116 3110 2788 1733 1484 53 2154 122 ----
NM_018409chr462657 2385 1053 620 252 90 1965 ----
NM_018423chr122349 134 124 1178 --
NM_018429chr552383 2238 1018 674 61 12769 ----
NM_018440chr885683 3357 3210 2777 2281 1792 644 594 58562 7967 7886 2937 927 25837 239 --
NM_018448chr1221307 958 1485 11216 --
NM_018482chr841902 702 251 156 21011 1002 2980 32 --
NM_018489chr142259 2160 1459 269 ------
NM_018553chr1761674 1428 447 166 149 42 ------
NM_018566chr1124651 4160 3996 3650 3486 3356 1563 1126 855 656 447 340 ----144
NM_018569chr451629 1505 1470 1312 988 ------
NM_018590chr1011350 --2515 377 --
NM_018638chr1254528 4328 1007 583 419 1561 ----
NM_018640chr1231059 765 42 1576 ----
NM_018704chr151981 1720 1656 1624 32 11997 2739 193 --
NM_018710chr84536 376 235 68 ------
NM_018717chr411168 22367 806 11152 1821
NM_018945chr633255 1386 978 12552 ----
NM_018947chr763932 3738 3246 1685 1505 1203 14718 24687 609 --
NM_018970chr762699 2630 1111 982 356 128 --22789 2536 11176
NM_018979chr1252429 2270 2231 1884 1638 ------
NM_018999chr1084489 4209 3720 1398 1006 891 608 61 1476 34599 3657 39 --
NM_019001chr354849 4552 577 341 63 22961 1663 11832 --
NM_019004chr742329 1787 1671 658 ----1533
NM_019022chr1812619 11994 11055 1972
NM_019042chr71322 1488 1353 --
NM_019045chrX3877 720 29 ------
NM_019067chrX43538 3248 1808 179 --24843 4812 --
NM_019080chr133468 289 22 21457 1254 11125 --
NM_019084chr1041662 945 907 144 ----21933 1927
NM_019596chr2141926 1896 975 304 --11051 --
NM_019600chr151269 ----1556
NM_019610chr141925 1899 1453 864 1354 ----
NM_019895chr3------1142
NM_019903chr1021657 61 ----150
NM_020116chr451768 1579 559 227 96 ------
NM_020122chr245485 4455 4319 1810 1128 21792 914 1272
NM_020144chr741914 1420 521 396 1758 11792 --
NM_020147chr1541044 673 369 192 ------
NM_020177chr51992 23366 227 22222 736 --
NM_020193chr1121347 233 ----1917
NM_020199chr531286 392 334 ----1356
NM_020228chr1132211 1668 1009 12509 --12082
NM_020310chr1732638 1973 1063 --32323 2219 83 --
NM_020336chr2043546 2784 604 142 11196 ----
NM_020337chr452943 2553 1949 565 435 ----12187
NM_020342chr252348 2221 2150 945 78 12307 ----
NM_020347chr311902 1592 190 --
NM_020357chr311071 --11226 --
NM_020390chr334450 4092 3540 34150 3860 3459 ----
NM_020403chr1341631 1401 1212 712 ----1353
NM_020420chrY31673 1627 1616 ------
NM_020440chr113005 ----13288
NM_020452chr142112 818 461 158 ------
NM_020463chr2----11048 1476
NM_020466chr654452 3264 1348 1029 138 11414 --1613
NM_020473chrX21883 558 21328 692 ----
NM_020640chr331583 158 146 11479 ----
NM_020654chr341511 525 417 152 21481 552 ----
NM_020689chr2031692 1159 627 2240 233 11525 --
NM_020699chr144898 4693 2134 1450 1484 --14239
NM_020714chr1964585 4339 2956 1850 1602 1590 43205 2797 1688 335 13037 --
NM_020717chrX2355 27 24163 3617 24133 3502 13795
NM_020718chr1656274 4935 4503 2010 1959 --15750 --
NM_020728chr742975 2044 2036 712 ------
NM_020734chr1253042 2318 1075 423 387 1368 ----
NM_020742chrX52456 1861 796 787 242 12269 ----
NM_020748chr171738 12172 31945 1574 190 --
NM_020760chr22739 150 1449 11538 --
NM_020766chrX44530 3721 1454 1129 23314 931 ----
NM_020772chr1778210 5318 3080 2978 2490 2052 1421 11446 12528 --
NM_020779chr212049 1701 22645 2018 --
NM_020796chr522937 1077 12668 32927 2673 2411 --
NM_020810chr1483251 3071 965 940 874 653 428 176 21317 555 12623 --
NM_020839chr341618 1508 1331 422 ------
NM_020871chrX72093 2050 1890 725 360 339 319 ------
NM_020925chr141245 1001 570 186 --1937 --
NM_020935chr284475 3850 3790 3210 1713 1609 1512 736 --1196 --
NM_020940chr1062886 2355 2333 373 228 157 ------
NM_020948chr133091 2237 648 11460 12949 13488
NM_020964chr1874750 4671 4019 1738 1702 1476 814 --14095 --
NM_020993chr1251958 1913 1873 471 45 12176 12581 12081
NM_021007chr272327 2181 1756 981 938 901 597 ------
NM_021072chr522045 1740 --12405 --
NM_021083chrX43370 2783 2435 2335 1637 11177 --
NM_021111chr92968 507 162 ----
NM_021120chrX32700 2168 588 12982 22805 2353 --
NM_021135chr663254 2623 2324 2051 472 39 --1387 12301
NM_021140chrX1263 ----11026
NM_021148chr731792 352 174 1714 ----
NM_021159chr421702 1687 --11461 --
NM_021183chrX42587 2226 589 566 31651 922 147 ----
NM_021222chr131316 275 215 1376 ----
NM_021252chr1041465 1385 810 48 1245 11409 --
NM_021255chr1443966 3772 1123 780 11450 ----
NM_021622chr1022003 1608 1888 22227 411 --
NM_021629chr374651 4479 3652 3613 3152 887 301 34809 3564 913 11867 14815
NM_021647chr483394 3144 2969 1680 1638 880 602 27 --21532 1370 13159
NM_021723chr73533 454 26 --1153 --
NM_021813chr6135861 5509 5451 4526 4029 3905 1489 1419 1196 1180 558 401 105 1476 21529 1308 14946
NM_021814chr631360 1240 32 11634 21447 1232 --
NM_021911chr575397 3707 3414 1788 1452 443 83 --15048 --
NM_021912chr1564129 3493 3324 3104 861 453 33247 1533 889 1520 11230
NM_021914chr1442190 1674 616 532 ------
NM_021961chr11127414 6611 6339 5895 5824 2421 2053 1795 1330 1245 1140 1118 25202 2663 16835 21729 1347
NM_021964chr385506 5445 4439 2506 2328 1772 830 325 --11556 --
NM_021988chr2021540 330 ----1307
NM_022041chr1632607 1929 730 12143 1738 1419
NM_022048chr1564208 2291 1821 1528 1216 895 1111 ----
NM_022154chr451148 940 447 345 54 ------
NM_022170chr721605 174 --11151 11710
NM_022374chr21356 ----1145
NM_022442chr2021540 330 ----1307
NM_022459chr1386296 5856 5608 5009 1727 1104 949 762 25074 1616 14155 15585
NM_022473chr1533926 753 51 23864 1701 ----
NM_022474chr1452746 1727 919 615 184 ------
NM_022495chr142382 185 1494 ----
NM_022650chr5----2396 110 --
NM_022716chr172398 2379 2090 2070 1280 1193 614 42730 2590 685 388 1907 --
NM_022719chr2263518 2833 2688 2453 628 329 --22467 463 13174
NM_022726chr631717 477 50 11293 --1283
NM_022739chr171411 ----1224
NM_022753chr162608 2493 2278 1969 1746 713 12028 ----
NM_022755chr942578 2473 2278 487 --22411 1995 --
NM_022756chr151293 1129 531 391 75 ------
NM_022758chr631190 534 93 --22365 2120 --
NM_022763chr373113 3018 1236 701 391 53 39 ------
NM_022802chr1041395 1209 1017 460 --1561 --
NM_022824chr521798 1508 --11270 21821 472
NM_022826chr2------1808
NM_022831chr12708 173 --1380 --
NM_022832chr442402 2186 1706 955 ------
NM_022893chr242670 750 505 492 --12560 --
NM_022898chr1493800 3511 3459 3160 3091 3085 1727 1703 401 11833 ----
NM_022900chr721198 136 ----1179
NM_022912chr242934 1131 800 671 --13074 --
NM_022977chrX22177 2135 ----12089
NM_023112chr1442982 2856 327 63 1538 ----
NM_023929chr822788 2096 1322 ----
NM_024007chr552973 2793 2175 707 549 ------
NM_024052chr174876 501 291 124 ----12271
NM_024294chr631190 534 93 --22365 2120 --
NM_024332chrX11578 21309 36 1345 1489
NM_024345chr965958 4786 4383 3922 2322 724 14498 --15707
NM_024511chr433062 1104 912 1164 ----
NM_024524chr352963 2865 2264 1957 364 33172 3158 1202 ----
NM_024545chr21689 1149 2748 519 --
NM_024551chr1252487 1589 958 417 308 --11011 --
NM_024551chr1252487 1589 958 417 308 --11011 --
NM_024557chr1151662 1503 1381 1309 589 --11369 --
NM_024561chr1321319 369 11290 ----
NM_024563chr531944 1581 1391 ----2605 599
NM_024569chr162963 2200 2019 731 380 66 --21823 98 --
NM_024646chr143738 3376 3042 813 --1241 --
NM_024665chr354637 4591 4184 3921 722 ------
NM_024713chr1551545 1252 662 178 43 1196 ----
NM_024725chr112828 295 ----1612
NM_024744chr252197 2183 1046 565 539 ------
NM_024761chr985196 4570 4372 4297 4087 1756 1240 147 13365 --14225
NM_024770chr2106638 5861 5653 5182 4821 4760 4478 2262 1070 539 1238 24578 2438 25270 4168
NM_024913chr76678 422 390 378 91 82 11328 ----
NM_024947chr3169489 9259 7989 7936 7799 7059 7040 3590 3292 2559 2263 1975 804 701 131 117 68378 7735 7018 6643 3491 2650 22720 1287 13741
NM_024949chr454953 4308 3768 157 141 ------
NM_024953chr1242096 643 294 74 11827 ----
NM_025027chr192115 43 ----1841
NM_025054chr823491 1584 ----1530
NM_025057chr1411173 31267 495 214 1250 --
NM_025073chr163715 3565 3147 1471 1139 837 --1298 --
NM_025134chr1652165 2091 1919 618 452 12329 1663 --
NM_025146chr342739 2184 765 325 12386 11096 --
NM_025160chr1103624 3601 3497 3403 3150 3077 1729 1396 1365 195 23424 263 ----
NM_025176chr201104 --2463 39 --
NM_025187chr162402 322 1472 31338 1263 50 --
NM_025191chr173266 2533 1314 1112 845 439 68 12359 ----
NM_025208chr1152410 2309 1976 995 527 ------
NM_025221chr461425 1211 1193 404 315 183 ------
NM_025222chr362138 1221 1104 867 147 112 --1362 --
NM_025235chr1041718 1472 528 146 11386 22237 718 --
NM_025236chr63779 709 130 --1179 193
NM_030621chr1441226 1022 729 615 ------
NM_030623chr261516 1380 1131 562 98 83 11546 ----
NM_030625chr104912 892 472 198 12074 --2808 418
NM_030647chr786346 5649 5309 4742 4593 4043 2521 701 1663 ----
NM_030648chr4105063 4776 4560 4159 2187 1669 1591 931 443 207 13856 34863 288 109 --
NM_030650chr273685 3252 3220 2863 1489 680 146 23109 326 ----
NM_030674chr1275106 4409 3832 730 657 57 25 24577 358 --31936 1882 638
NM_030755chr1442020 1924 915 846 22191 143 12293 --
NM_030806chr1119207 8945 8769 8737 6306 6259 2343 2306 2155 1388 945 23319 2354 16339 11596
NM_030816chr173202 3193 1471 897 240 125 112 --12563 --
NM_030820chr6--1706 --1326
NM_030881chr2231634 920 499 --12342 --
NM_030918chr155253 5032 4743 4544 36 1595 11681 --
NM_030934chr121767 538 --1349 --
NM_030953chr551560 1254 1124 487 102 --2595 296 --
NM_031362chr232749 1133 276 21753 197 ----
NM_031365chr232885 1846 412 21889 333 ----
NM_031366chr232885 1846 412 21889 333 ----
NM_031419chr351612 1524 1320 1232 232 ------
NM_031427chr1455055 2340 777 616 200 25850 5516 ----
NM_031442chrX32096 938 248 22611 173 22222 539 --
NM_031445chr242944 994 943 593 13222 12398 --
NM_031453chr1052291 1875 1030 704 684 --1873 --
NM_031461chr882310 2100 1937 1863 893 666 423 94 1581 ----
NM_031483chr2043249 2441 541 341 11167 174 --
NM_031844chr143599 3225 3150 91 ------
NM_031845chr253144 2957 2328 2289 327 1646 ----
NM_031847chr253144 2957 2328 2289 327 1646 ----
NM_031935chr14877 691 279 183 1267 ----
NM_031992chr721605 174 --11151 11710
NM_032012chr974846 4405 4263 3729 1809 1087 1050 --11439 --
NM_032042chr531895 1777 251 1136 ----
NM_032052chr2211192 ----1195
NM_032102chr1141945 863 201 80 ----1802
NM_032116chr1385594 5583 5081 3872 2204 1396 1254 1042 34743 1289 430 15236 15450
NM_032121chrX42835 2785 560 484 1978 12584 --
NM_032139chr191700 2379 246 2787 75 --
NM_032160chr18104116 4040 3919 3810 3597 3396 1523 1026 785 400 ------
NM_032228chr1163066 3035 780 686 593 514 129 ----
NM_032242chr323344 1005 ----1643
NM_032352chr1421250 360 ----11009
NM_032373chr10115563 5270 5241 4278 2296 1884 1490 1452 1042 736 605 --14297 --
NM_032410chr811164 ----21070 855
NM_032439chr1041661 1332 1274 1249 ------
NM_032445chr1561612 1597 920 782 522 444 ------
NM_032446chr543527 2945 807 541 ------
NM_032457chr433610 3130 1246 1705 ----
NM_032458chrX33330 2710 2644 1375 ----
NM_032521chr2032454 2369 2325 11989 2642 277 --
NM_032532chr61501 --1257 1611
NM_032560chr144938 803 453 233 ------
NM_032632chr1421788 288 1531 11627 --
NM_032682chr373453 3017 2853 2287 901 825 62 --11081 --
NM_032689chr193474 348 42 --11155 --
NM_032711chr1733665 3456 1437 --13360 --
NM_032778chr333147 2882 670 33274 2707 2458 ----
NM_032784chr64314 299 247 124 ------
NM_032810chr1031097 431 417 1411 ----
NM_032813chr13152 1770 3904 792 752 --
NM_032833chr152126 1912 910 846 711 2721 167 1151 --
NM_032839chr33392 146 60 ----180
NM_032859chr1321224 232 ----12536
NM_032873chr1132921 2820 615 33814 1509 1041 11204 --
NM_032961chr431190 1091 528 ------
NM_032968chrX63519 2724 1423 1182 796 229 1910 13070 --
NM_032969chrX63519 2724 1423 1182 796 229 1910 13070 --
NM_032973chrY63515 2719 1423 1182 796 229 1910 13065 --
NM_032978chr1851091 957 925 199 178 ------
NM_032979chr1851091 957 925 199 178 ------
NM_032981chr1851091 957 925 199 178 ------
NM_033020chr174821 4127 3759 3364 1517 450 100 --1180 23372 1113
NM_033058chr84892 885 276 76 1663 ----
NM_033081chr202557 343 11280 1161 --
NM_033135chr1152410 2309 1976 995 527 ------
NM_033138chr741679 671 575 127 12269 1301 --
NM_033139chr741679 671 575 127 12269 1301 --
NM_033140chr741679 671 575 127 12269 1301 --
NM_033143chr454577 3223 2993 457 157 44183 3910 3295 1737 ----
NM_033157chr741679 671 575 127 12269 1301 --
NM_033181chr683923 3387 3230 3015 2624 1529 847 765 11363 ----
NM_033224chr786480 5849 5670 5014 3195 2115 1379 1110 26269 6082 11750 1338
NM_033225chr872375 2284 2224 2105 770 289 276 --32711 2298 2011 --
NM_033285chr854246 4191 3569 834 238 --11642 --
NM_033290chrX63337 3019 933 690 412 294 --11184 11058
NM_033309chr1621100 752 ----11022
NM_033326chr1141626 928 372 103 31579 915 885 ----
NM_033360chr1244519 4425 3029 794 ------
NM_033425chr1131396 845 172 13173 11306 --
NM_033426chr1452101 1848 775 707 480 --11055 --
NM_033430chr453517 1674 1276 431 244 1231 --11173
NM_033437chr453517 1674 1276 431 244 1231 --11173
NM_033551chr572510 2345 2135 1147 1117 228 192 ------
NM_033632chr421140 632 --11059 --
NM_033656chr2165855 4884 4308 4244 2036 290 12021 ----
NM_052879chr1244055 1619 1035 355 23867 119 13136 --
NM_052885chr1244307 3869 1548 1344 23978 1583 --14510
NM_052886chr871807 1705 1461 761 386 209 97 --22008 1975 --
NM_052898chr841547 696 653 501 21285 32 ----
NM_052905chr241534 1192 1164 731 11657 21589 572 1423
NM_052907chr1244333 4300 4042 3887 --13528 --
NM_052910chr1321688 44 1364 --21997 370
NM_052917chr233377 3342 578 22224 1138 --32775 2552 1052
NM_052954chr2132117 217 135 ----1251
NM_052978chr1431521 312 153 --144 --
NM_053002chr331106 307 133 ------
NM_053016chr957642 7591 6454 5583 5280 37485 1570 1064 12419 --
NM_053043chr764685 4450 3974 3885 1297 884 --1219 --
NM_053053chr16998 852 388 313 191 75 ------
NM_053064chr1443055 2966 2034 1114 1796 1184 --
NM_058170chr121054 385 --1185 --
NM_058172chr451761 1619 1544 1279 42 ----11837
NM_058240chr1411606 --1279 1443
NM_078470chr1052169 2049 1652 804 491 22427 1043 ----
NM_078476chr6------21402 642
NM_080546chr962149 2059 773 763 302 35 11833 ----
NM_080599chr1021101 429 --21078 92 --
NM_080759chr1352550 2390 639 375 56 1525 ----
NM_080760chr1352550 2390 639 375 56 1525 ----
NM_080764chr2222114 192 11014 12717 1946
NM_080792chr202773 206 11813 --22008 547
NM_080867chr1451398 1271 675 343 314 24585 1924 ----
NM_080872chr873468 3116 2953 2679 1535 546 231 ------
NM_080927chr322522 2413 11033 --1526
NM_130391chr942298 1099 1032 717 2906 48 11299 11173
NM_130392chr942298 1099 1032 717 2906 48 11299 11173
NM_130393chr942298 1099 1032 717 2906 48 11299 11173
NM_130434chr15193 1117 --1836
NM_130438chr2162101 2092 495 476 289 256 22073 439 22913 837 --
NM_130439chr1032229 942 363 ------
NM_130439chr1032229 942 363 ------
NM_130442chr731153 1136 948 1938 2455 123 --
NM_130446chr343241 1012 944 111 --11485 --
NM_130768chr7196 --135 1260
NM_130831chr332837 205 36 32217 1065 702 ----
NM_130832chr332837 205 36 32217 1065 702 ----
NM_130833chr332837 205 36 32217 1065 702 ----
NM_130834chr332837 205 36 32217 1065 702 ----
NM_130835chr332837 205 36 32217 1065 702 ----
NM_130836chr332837 205 36 32217 1065 702 ----
NM_130837chr332837 205 36 32217 1065 702 ----
NM_133265chrX53210 2368 2362 2290 286 22529 674 12336 --
NM_133329chr22428 273 --11568 --
NM_133334chr456005 4500 4409 2460 2008 ----1204
NM_133367chr633019 2956 2847 2704 111 1628 --
NM_133370chr443427 3247 3206 3051 ------
NM_133445chr952520 1227 1063 888 471 ------
NM_133496chr143850 1261 1183 1024 24477 3609 --13257
NM_133638chr5--2545 143 --11153
NM_133647chr1572873 998 882 593 246 116 50 1620 23636 3328 11039
NM_138270chrX43131 2746 2259 2135 --1821 --
NM_138333chr942614 2429 2248 239 ------
NM_138426chr74911 905 651 61 12347 1658 --
NM_138459chr632567 1055 574 ------
NM_138468chr276068 5928 5480 4717 1229 182 157 --1174 14454
NM_138473chr1254499 3472 3363 1233 563 14721 ----
NM_138559chr241030 972 351 208 11094 ----
NM_138576chr1493800 3511 3459 3160 3091 3085 1727 1703 401 11833 ----
NM_138638chr1442190 1674 616 532 ------
NM_138713chr16107386 7236 6046 6027 3185 2080 1036 770 542 195 36059 2520 1298 ----
NM_138714chr16107386 7236 6046 6027 3185 2080 1036 770 542 195 36059 2520 1298 ----
NM_138727chr121592 470 --1900 1453
NM_138728chr121592 470 --1900 1453
NM_138731chr1463809 2783 2731 1530 700 341 21272 610 2129 38 --
NM_138735chr2--21192 229 11179 1577
NM_138771chr73347 117 47 ------
NM_138773chr54913 749 653 638 ----1762
NM_138782chr521671 228 --12336 --
NM_138959chr1146797 6567 6194 5942 5855 5189 4989 4261 4213 2519 2411 1679 463 207 26635 2207 45174 4518 4318 389 1425
NM_139136chr124939 812 419 363 ------
NM_139177chr17189 ----21478 1358
NM_139279chr262553 2466 2459 1299 1197 592 1187 12911 1948
NM_139281chr543619 3410 2929 385 12210 13220 --
NM_139321chr2063891 3429 2817 866 571 383 12595 12645 --
NM_144571chr465149 4547 4271 1771 1624 492 12026 16633 --
NM_144578chr1445498 5303 4167 170 23935 1663 1969 --
NM_144583chr251802 1270 1127 665 517 1707 ----
NM_144599chr1564959 4374 1544 1167 829 197 34438 1293 473 54322 4216 4002 3441 1298 --
NM_144633chr321338 597 1390 11474 --
NM_144664chr111557 2223 174 12544 --
NM_144709chr21156 154 1313 --
NM_144775chr1754895 3446 3322 1777 1613 --13776 --
NM_144963chr832309 635 86 22211 475 1176 --
NM_144964chr93923 453 418 1883 ----
NM_145055chr1833003 965 450 13695 ----
NM_145203chr132703 632 ----166
NM_145244chr4----11281 1143
NM_145259chr295825 5446 4721 2126 1909 1412 1383 897 670 15870 14412 15670
NM_145263chr432031 955 763 12339 11926 --
NM_145307chr1034042 1373 239 24442 719 ----
NM_145799chrX52536 2450 1025 256 249 --23005 307 --
NM_145808chr753093 2967 2617 2443 947 12079 ----
NM_145891chr16185 11304 --1301
NM_145892chr16185 11304 --1301
NM_145893chr161207 11426 --1423
NM_147156chr102387 224 11305 1341 --
NM_147175chrX32129 701 618 --21600 88 --
NM_147181chr461425 1211 1193 404 315 183 ------
NM_147182chr461425 1211 1193 404 315 183 ------
NM_147183chr461425 1211 1193 404 315 183 ------
NM_147223chr272483 2426 2185 1966 1688 1654 122 147 11511 --
NM_152253chr2253207 1733 1335 1033 646 21375 933 23898 3844 --
NM_152271chr821008 824 ----181
NM_152277chr521840 671 3823 642 331 2621 30 --
NM_152280chr123024 1045 11060 13111 11160
NM_152289chr1941623 1577 1322 333 ------
NM_152330chr1442587 2461 344 90 ----22511 706
NM_152352chr1872989 2205 1983 1927 1916 1165 1051 1351 ----
NM_152375chr142534 2009 948 655 1999 11023 11723
NM_152388chr273633 1250 1024 763 651 639 127 22829 929 ----
NM_152409chr523459 749 32843 2480 517 --12510
NM_152442chr1241220 301 158 137 ------
NM_152470chr1854126 1279 1217 931 121 --12745 13161
NM_152475chr1952759 990 690 441 37 ------
NM_152519chr251915 1476 602 594 280 1692 1827 --
NM_152529chr264374 3948 3890 1452 1002 859 --1697 --
NM_152556chr722571 2553 --12210 12387
NM_152563chr111315 --5582 530 478 426 374 --
NM_152594chr1531762 1445 730 --1609 --
NM_152622chr543162 2521 2336 959 12416 ----
NM_152626chr721115 429 1815 ----
NM_152641chr124673 407 318 46 1393 ----
NM_152692chrX1137 ----178
NM_152724chr1062518 1888 991 867 653 541 ------
NM_152734chr695068 4991 4894 4627 3840 3748 3391 2033 444 --34420 3681 1985 14488
NM_152754chr753387 1468 1343 805 67 22922 2827 1890 12336
NM_152756chr563774 3166 3058 2907 1398 459 --1942 --
NM_152758chr8102843 2785 2376 2094 1151 1127 985 271 165 110 12922 1669 --
NM_152774chr762562 2193 2171 2123 1984 198 1113 ----
NM_152787chrX33605 1381 635 11537 --23574 3188
NM_152793chr753216 1255 1211 312 107 2841 122 ----
NM_152838chr2043385 2225 2174 1345 157 ----
NM_152878chr2221167 557 --21239 127 --
NM_152903chr133397 298 84 12451 ----
NM_152924chr1566464 6289 6062 5734 1083 779 32032 1463 296 36558 6501 2445 --
NM_152989chr1231393 705 79 1271 ----
NM_152999chr754761 4362 1654 1615 1222 33888 3465 1246 ----
NM_153182chr333147 2882 670 33274 2707 2458 ----
NM_153188chr565004 3849 3570 761 743 213 --15447 --
NM_153207chr1273600 3328 1331 1323 995 165 86 1219 13357 --
NM_153235chr622143 945 21994 1923 --1149
NM_153262chr142266 2149 510 484 ------
NM_153332chr843025 534 392 332 ------
NM_153347chr1122423 242 ----22262 1029
NM_153354chr52323 116 ----127
NM_153456chr13105900 5682 4820 4373 4145 2103 232 125 98 48 24477 1520 23820 620 35474 3853 1929
NM_153605chr31375 11583 155 1297
NM_153619chr1542737 2718 2592 535 1718 1489 --
NM_153634chr1231450 1060 595 11444 ----
NM_153645chr2252745 2503 2045 1111 93 --11322 --
NM_153649chr141866 1828 332 283 ------
NM_153686chr451550 773 708 315 176 11675 ----
NM_153689chr232242 1565 844 --1130 --
NM_153702chr4133 ----144
NM_153748chr124939 812 419 363 ------
NM_153756chr151597 1392 1259 113 98 1359 ----
NM_153810chr1064963 4629 4480 1727 1634 1362 24052 1763 --23357 1159
NM_170665chr1244160 3241 808 635 11312 33123 2883 2784 13909
NM_170679chr51959 21196 815 --11231
NM_170692chr1----1200 1866
NM_170731chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_170732chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_170733chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_170734chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_170735chr1172817 2490 2053 969 959 395 225 11770 2853 759 12447
NM_170769chr63779 709 130 --1179 193
NM_172037chr841239 401 268 67 ------
NM_172058chr86699 651 469 264 169 74 ------
NM_172059chr86699 651 469 264 169 74 ------
NM_172060chr86699 651 469 264 169 74 ------
NM_172071chr176429 6411 6053 5519 1658 1004 180 15769 --24988 2351
NM_172103chr632265 803 358 22243 1809 12381 1920
NM_172105chr632265 803 358 22243 1809 12381 1920
NM_172127chr432018 717 680 ------
NM_172128chr431974 673 636 ------
NM_172159chr3----1169 1585
NM_172160chr3----1169 1585
NM_172344chr22428 273 --11568 --
NM_173060chr541915 557 439 146 11866 21333 350 --
NM_173061chr541915 557 439 146 11866 21333 350 --
NM_173063chr541915 557 439 146 11866 21333 350 --
NM_173075chr41219 11457 31700 1532 1521 --
NM_173156chr121916 460 ----11587
NM_173214chr16107386 7236 6046 6027 3185 2080 1036 770 542 195 36059 2520 1298 ----
NM_173359chr321336 198 11694 1502 --
NM_173468chr454875 4335 1982 1518 494 13991 --11554
NM_173469chr1531477 1447 1131 1149 11217 --
NM_173470chrX22708 280 --1251 --
NM_173473chr1032628 2401 119 1977 ----
NM_173478chr176914 803 761 685 401 189 --1830 --
NM_173536chr433690 3494 813 21805 1724 15212 --
NM_173552chr331945 1788 704 2147 103 ----
NM_173563chr6------137
NM_173570chr342200 2087 1956 240 11582 22120 514 --
NM_173582chr1196196 5790 5750 4496 4432 4110 4002 2227 1144 11076 11607 25572 5413
NM_173602chr1263747 2774 2636 1016 729 238 13354 12329 --
NM_173642chr1139237 9158 7923 7706 7467 7171 7003 6339 2286 1792 1670 1109 210 26990 6921 36970 2989 2658 19033
NM_173645chr24461 234 178 169 ------
NM_173694chrX32308 1961 454 22503 2299 ----
NM_173698chrX2670 308 11519 1553 --
NM_173808chr184305 4041 2967 1785 1226 508 425 208 23944 3637 ----
NM_173829chr556156 5446 4026 1239 250 14643 15210 --
NM_173834chrX2405 331 --144 --
NM_174890chr102640 162 ----1600
NM_174911chr843813 3614 3225 1513 ------
NM_175061chr772196 2098 1776 1491 733 402 263 ------
NM_175607chr331207 223 101 ------
NM_175610chr1551354 1317 561 439 404 ------
NM_175612chr331207 223 101 ------
NM_175733chr1131723 825 797 31583 428 91 1841 --
NM_175854chr1352169 2145 1742 341 92 12471 ----
NM_175861chr1295326 4424 3926 3880 573 247 143 132 77 35094 4579 3909 ----
NM_175907chr1832564 1115 471 32580 1854 236 ----
NM_175921chr553978 3888 3435 3024 918 1123 21069 727 --
NM_176814chr72505 82 21057 550 ----
NM_176815chr342969 2456 1066 173 1391 ----
NM_177414chr13714 613 362 11484 11347 --
NM_177438chr1441226 1022 729 615 ------
NM_177452chr1452126 833 820 755 161 11833 ----
NM_177966chr331765 1211 173 --1721 --
NM_177969chr23674 522 228 ------
NM_177985chr232117 1954 539 --11979 --
NM_178010chr1231393 705 79 1271 ----
NM_178011chr1073280 2998 2947 1269 1169 950 398 ----12320
NM_178140chr532220 2149 1703 1816 22738 2568 1482
NM_178151chrX86916 6170 5261 3013 2401 1232 947 140 15597 13134 --
NM_178152chrX86916 6170 5261 3013 2401 1232 947 140 15597 13134 --
NM_178153chrX86916 6170 5261 3013 2401 1232 947 140 15597 13134 --
NM_178313chr241524 1423 487 447 ----1333
NM_178423chr72901 403 1315 1797 --
NM_178425chr72901 403 1315 1797 --
NM_178426chr122196 2149 2851 435 22355 2239 1929
NM_178427chr122096 2049 2751 335 22255 2139 1829
NM_178539chr1251947 1686 1554 551 512 1590 ----
NM_178554chr393427 3383 2751 2723 2467 2212 1129 656 546 1279 ----
NM_178578chr2052625 2471 1777 307 22 ----12362
NM_178585chr41532 22566 2547 1100 --
NM_178586chr1452297 2164 1989 1865 881 ------
NM_178815chr1052602 2067 774 574 541 12436 ----
NM_178826chr124690 531 266 250 1144 ----
NM_181332chrX52456 1861 796 787 242 12269 ----
NM_181351chr1142867 2403 1158 682 --21174 126 --
NM_181361chr331218 1158 513 11264 ----
NM_181443chr2052636 2624 2280 2086 1999 11806 143 --
NM_181457chr251172 921 197 158 149 11003 ----
NM_181458chr251305 1054 330 291 282 11136 ----
NM_181459chr251071 820 96 57 48 1902 ----
NM_181460chr251118 867 143 104 95 1949 ----
NM_181481chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_181482chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_181483chr1886854 6548 6046 5905 5514 4784 2723 683 46219 2042 2019 707 15022 11216
NM_181504chr552997 2939 2863 1588 483 1695 --1543
NM_181523chr552997 2939 2863 1588 483 1695 --1543
NM_181524chr552997 2939 2863 1588 483 1695 --1543
NM_181552chr73923 847 808 ------
NM_181571chr1031027 988 127 1359 --11057
NM_181656chr171627 ----149
NM_181782chr631783 898 147 ----12210
NM_181784chr222423 782 21883 701 22643 2057 1214
NM_181846chr1942850 2749 2338 2009 --22411 640 12964
NM_181897chr372450 2283 2275 591 491 346 163 22229 789 12074 --
NM_182485chr442900 2566 1161 186 ------
NM_182503chr624367 1582 13994 34650 3446 2210 25035 4469
NM_182646chr442900 2566 1161 186 ------
NM_182664chr141486 798 383 220 --2853 580 --
NM_182691chr7--21303 277 --11041
NM_182692chr7--21303 277 --11041
NM_182715chr721119 236 --11199 --
NM_182717chr1031432 1393 532 ----11462
NM_182718chr1031027 988 127 1359 --11057
NM_182719chr1031027 988 127 1359 --11057
NM_182720chr1031432 1393 532 ----11462
NM_182721chr1031432 1393 532 ----11462
NM_182722chr1031432 1393 532 ----11462
NM_182723chr1031432 1393 532 ----11462
NM_182724chr1031027 988 127 1359 --11057
NM_182725chr1031027 988 127 1359 --11057
NM_182734chr2053192 2548 2415 351 218 --12137 12110
NM_182767chr1231633 1446 441 12071 ----
NM_182769chr1031027 988 127 1359 --11057
NM_182770chr1031027 988 127 1359 --11057
NM_182771chr1031027 988 127 1359 --11057
NM_182772chr1031027 988 127 1359 --11057
NM_182797chr2061808 1772 1755 1146 678 662 1508 11523 --
NM_182850chr1031027 988 127 1359 --11057
NM_182853chr1031432 1393 532 ----11462
NM_182896chr351682 1260 632 481 114 ------
NM_182898chr796522 6461 5819 4886 4293 4093 2267 1414 428 12400 36024 5113 1762 --
NM_182899chr796522 6461 5819 4886 4293 4093 2267 1414 428 12400 36024 5113 1762 --
NM_182918chr214926 558 458 224 1990 ----
NM_182936chr1411606 --1279 1443
NM_182970chr2041433 1249 1026 81 --13935 --
NM_182972chr132567 1117 230 186 ----
NM_183002chr1411606 --1279 1443
NM_183004chr1493716 3503 3079 1544 1197 587 265 254 188 1171 ----
NM_183011chr1031432 1393 532 ----11462
NM_183012chr1031432 1393 532 ----11462
NM_183013chr1031432 1393 532 ----11462
NM_183050chr632416 2308 526 --11554 --
NM_183060chr1031027 988 127 1359 --11057
NM_183393chr31360 1371 --1175
NM_183394chr31360 1371 --1175
NM_183416chr151431 689 604 562 498 2383 349 ----
NM_194071chr784984 4410 4346 3571 1641 1574 215 48 14373 24154 1213 1690
NM_194247chr273568 2944 2842 1759 829 316 261 11733 13288 --
NM_194278chr1473943 3718 3250 3149 2574 1667 1593 23289 1441 --13275
NM_194286chr12136098 6064 5923 5793 4321 4229 4102 3784 2378 1548 1392 913 580 ------
NM_194291chr832106 2065 170 12844 --1526
NM_194314chr1105338 4640 4624 4382 3813 2234 2105 1885 1601 207 --15142 --
NM_194317chr252605 2588 2292 588 563 ------
NM_194434chr1885688 5217 4155 3551 2216 1447 1175 241 --14140 --
NM_194454chr741396 1083 491 33 ------
NM_194455chr741396 1083 491 33 ------
NM_194456chr741396 1083 491 33 ------
NM_197939chr1741074 1058 799 465 ------
NM_198066chr1462821 2493 2421 1209 515 425 1728 22710 1074 --
NM_198128chr1832038 1617 357 31899 1851 1803 ----
NM_198273chr532624 2081 2068 21152 68 ----
NM_198279chrX31261 984 819 11244 1833 --
NM_198320chr1233822 1651 27 25256 4229 1859 23938 1083
NM_198336chr7--11795 --11811
NM_198381chr11170 --1136 1348
NM_198450chrX42040 1985 1418 775 1698 ----
NM_198503chr131929 1650 787 ----11834
NM_198581chr256946 2637 2436 1782 586 --22253 1454 --
NM_198793chr364033 3658 3548 2728 2535 1163 11092 1624 --
NM_198859chr364773 4646 4569 3672 1943 202 13215 --1515
NM_198904chr511791 1250 --1527
NM_198935chr2053185 2860 1188 576 118 12727 --11027
NM_198965chr123471 310 148 ------
NM_198966chr123471 310 148 ------
NM_198990chr732804 971 495 --1154 --
NM_198991chr183546 184 126 1134 ----
NM_199000chr741968 735 727 75 21811 146 11581 --
NM_199072chr733091 2459 73 ------
NM_199132chr194825 295 237 135 ------
NM_199144chr2021540 330 ----1307
NM_199167chr18--125 --1307
NM_199188chr1244055 1619 1035 355 23867 119 13136 --
NM_199190chr1244055 1619 1035 355 23867 119 13136 --
NM_199203chr2021540 330 ----1307
NM_199324chr453690 3609 3561 1149 1142 12996 ----
NM_199421chr1451398 1271 675 343 314 24585 1924 ----
NM_199437chr1132211 1668 1009 12509 --12082
NM_199438chr1132211 1668 1009 12509 --12082
NM_199439chr1132211 1668 1009 12509 --12082
NM_199461chr1023236 330 ----22665 231
NM_199482chr241960 1855 413 72 ------
NM_201568chr121916 460 ----11587
NM_201569chr121916 460 ----11587
NM_201570chr1021832 61 ----1709
NM_201571chr1021832 61 ----1709
NM_201572chr1021832 61 ----1709
NM_201590chr1021832 61 ----1709
NM_201593chr1021832 61 ----1709
NM_201596chr1021832 61 ----1709
NM_201597chr1021832 61 ----1709
NM_203282chr1941674 1571 1480 533 11693 1355 --
NM_203301chr1441565 1166 528 475 2419 383 --1696
NM_203327chr2064089 4050 3692 974 616 104 --33536 1567 1360 --
NM_203341chr131028 958 756 ------
NM_203406chr552595 2228 813 787 491 ------
NM_203446chr2132988 2689 2158 12554 12999 11915
NM_203459chr141707 1021 643 176 131 ----
NM_203487chr1341631 1401 1212 712 ----1353
NM_203504chr46912 744 510 331 242 189 ------
NM_203505chr46912 744 510 331 242 189 ------
NM_205842chr2------1196
NM_206594chr122772 225 --23472 2579 --
NM_206595chr122772 225 --23472 2579 --
NM_206853chr633264 3166 1443 --13454 --
NM_206854chr654525 4427 3406 1104 462 --34715 3702 1098 --
NM_206855chr695490 5392 4371 4185 4098 4017 2069 1427 548 --35680 4667 2063 --
NM_206866chr2152876 2400 2292 734 322 22948 352 ----
NM_206876chr263022 2882 2737 615 286 250 22456 490 12709 --
NM_206907chr532909 1076 832 --2795 490 --
NM_206909chr8107130 6524 6094 5338 5225 2828 2614 876 638 328 --26530 5283 11964
NM_206933chr162533 1853 1033 869 854 77 12733 12557 --
NM_207303chr1093537 2916 1240 1218 984 664 538 436 326 --11442 11097
NM_207321chr104962 764 430 361 21002 317 ----
NM_207361chr13116336 6055 5475 4833 4598 4412 4021 1557 1549 1230 396 --11610 --
NM_207387chr1731841 426 68 --11186 --
NM_207406chr4125641 5521 5108 4790 3993 1976 1881 1661 1278 561 414 225 46430 4102 1392 694 25935 115 12085
NM_207481chr241486 1165 274 160 ----1490
NM_207517chr1552029 1920 1409 356 304 --11684 --
NM_212471chr173850 753 501 ----12039
NM_212472chr173850 753 501 ----12039
NM_212558chr953090 2709 1194 947 175 23223 863 ----