TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4766-3p
miRNA Sequence: AUAGCAAUUGCUCUUUUGGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531313 1257 1225 1975 ----
NM_000024chr52542 192 --1338 --
NM_000037chr81403 --12428 --
NM_000038chr53728 293 120 --1341 --
NM_000067chr8194 --1601 --
NM_000074chrX3940 911 759 ------
NM_000081chr151628 1257 614 497 375 21702 1549 ----
NM_000084chrX126949 6504 5502 5390 5020 4950 1653 796 762 677 567 413 11857 1251 --
NM_000091chr251807 1128 1035 989 103 12916 22818 780 --
NM_000092chr243415 3128 1693 1417 13634 13819 --
NM_000093chr912151 --1602 --
NM_000098chr11570 ------
NM_000109chrX42493 1655 515 241 1248 12370 --
NM_000112chr575391 5111 4577 3876 3585 1542 1470 14519 45576 3904 1673 1446 --
NM_000129chr621454 590 ------
NM_000133chrX2118 86 11334 ----
NM_000138chr1512297 1700 12042 --
NM_000141chr1011236 2521 313 ----
NM_000151chr1721786 460 11916 ----
NM_000158chr32442 54 1609 ----
NM_000161chr1431931 622 449 --196 --
NM_000163chr522096 782 1813 ----
NM_000165chr6--11073 --1492
NM_000167chrX1124 --11248 11235
NM_000168chr731164 942 372 --2856 227 --
NM_000176chr523846 107 --13192 --
NM_000189chr241907 891 409 346 12229 ----
NM_000192chr12--11518 1415 --
NM_000194chrX2225 159 ----1386
NM_000202chrX83758 3626 3309 2999 1580 1333 939 746 --33143 3088 1318 12831
NM_000212chr171882 11952 ----
NM_000217chr1235171 2132 1648 --14254 14562
NM_000222chr442114 1800 1726 624 ------
NM_000227chr18--1317 ----
NM_000232chr42604 68 ----13178
NM_000237chr861673 1413 697 514 291 147 ------
NM_000240chrX21419 728 22282 1718 --1141
NM_000245chr732086 1546 1431 --1127 --
NM_000248chr31948 ------
NM_000251chr2165 ------
NM_000253chr42899 762 1303 ----
NM_000259chr1576332 5230 4399 2172 1545 853 383 22367 584 35678 1822 636 1491
NM_000264chr92403 352 43075 2734 2297 161 1134 --
NM_000267chr1733439 3154 948 43337 2601 1043 800 11256 13204
NM_000268chr2223771 1048 ------
NM_000276chrX22158 382 ------
NM_000280chr112959 814 ------
NM_000297chr411726 --2378 60 1125
NM_000303chr1621489 1175 ------
NM_000304chr172226 145 ------
NM_000313chr33856 721 203 ------
NM_000314chr1073227 2753 2199 2159 2151 2004 474 13240 22472 2101 --
NM_000321chr1371716 1708 1617 1548 1442 251 150 11810 31754 275 190 --
NM_000325chr41636 ------
NM_000328chrX1414 ------
NM_000332chr677177 7138 6184 5387 1853 1234 461 --15378 11283
NM_000337chr531834 1456 25 --26199 5191 --
NM_000345chr43349 338 320 1424 2979 940 --
NM_000346chr1722002 1679 11250 ----
NM_000353chr1631259 1153 133 --11130 --
NM_000368chr954878 4843 4805 893 37 24534 906 13927 --
NM_000369chr1431852 1229 711 --11895 --
NM_000378chr1121104 1009 ------
NM_000390chrX62917 2705 1156 981 923 797 ----23257 302
NM_000393chr221891 336 ------
NM_000397chrX42370 2102 1988 149 1726 ----
NM_000408chr273413 3245 3030 1279 1115 706 172 12580 ----
NM_000428chr1432480 2465 268 11737 11981 --
NM_000430chr1753719 3691 3220 1488 1230 13591 --13628
NM_000436chr531517 421 409 1217 ----
NM_000441chr712209 1268 ----
NM_000447chr12454 417 ------
NM_000459chr92653 322 ------
NM_000461chr344210 3467 3303 1848 1918 14467 --
NM_000462chr1531609 1459 1396 11320 ----
NM_000474chr72650 53 ------
NM_000484chr212811 46 ------
NM_000489chrX62224 1344 1146 935 863 242 ----31331 986 30
NM_000495chrX21064 782 ------
NM_000503chr841685 1649 317 125 ------
NM_000522chr72933 56 1923 --11302
NM_000523chr21128 ------
NM_000527chr1932257 2157 470 ------
NM_000533chrX--11513 ----
NM_000551chr341882 1678 547 133 ------
NM_000555chrX56876 6148 4758 1643 124 47561 6206 4834 864 ----
NM_000560chr11740 1684 ----
NM_000572chr12976 806 ------
NM_000586chr4291 74 ------
NM_000598chr721515 997 11119 ----
NM_000609chr1032977 2894 2541 --11068 --
NM_000610chr1152880 1895 439 193 96 --12916 13009
NM_000611chr1187076 6899 5530 4850 1933 1916 641 62 ------
NM_000615chr1122908 877 ------
NM_000618chr1274602 4356 1722 1377 923 477 411 31963 1534 1412 35555 4920 219 --
NM_000618chr1274602 4356 1722 1377 923 477 411 31963 1534 1412 35555 4920 219 --
NM_000619chr121494 1538 ----
NM_000627chr23955 945 317 ------
NM_000633chr1825016 2051 --13949 --
NM_000686chrX21000 174 ------
NM_000693chr151332 21474 298 1143 --
NM_000719chr1252261 1958 1933 1699 987 --16236 --
NM_000721chr152302 2227 1864 230 181 --12195 --
NM_000722chr71287 ------
NM_000724chr1021413 791 --1133 --
NM_000725chr121893 ------
NM_000756chr81319 ------
NM_000780chr82790 492 1795 --1903
NM_000793chr1453512 2028 1389 780 28 14138 ----
NM_000794chr54369 253 68 55 ------
NM_000806chr531866 1253 653 11370 11360 --
NM_000809chr498673 8582 8272 7499 6825 6046 3530 1016 403 58161 7760 6404 2179 25 16034 12383
NM_000811chr51289 ----1200
NM_000813chr5104637 4244 4115 3722 3710 1741 1048 876 161 122 1697 --11687
NM_000814chr1543712 3084 3071 1065 --24056 491 --
NM_000816chr52204 154 ------
NM_000817chr2--178 --1133
NM_000826chr441935 1637 936 853 --32251 758 453 --
NM_000827chr541975 608 351 171 1217 ----
NM_000833chr1621525 548 11022 ----
NM_000838chr642746 2626 1913 1829 --21009 908 --
NM_000845chr71371 ------
NM_000859chr541707 1664 1558 1408 --11512 --
NM_000864chr12136 25 ------
NM_000868chrX21753 225 12220 1100 --
NM_000872chr1011384 21485 38 --11548
NM_000875chr15126817 6435 6288 5550 5411 5297 2356 2249 2122 762 672 131 16763 12303 --
NM_000891chr1753608 2944 1189 597 566 --22817 2649 --
NM_000899chr1244399 3765 1197 135 --13269 --
NM_000901chr452413 2155 844 700 448 ------
NM_000908chr52793 613 ------
NM_000910chr441721 1208 638 578 --11275 1328
NM_000917chr103757 154 30 ------
NM_000921chr12------1173
NM_000922chr114879 860 791 298 ------
NM_000926chr11149458 9115 8874 8267 7952 7854 7825 7429 5890 3733 3697 2239 1630 876 37936 2380 1271 37709 3184 2883 1256
NM_000933chr2051348 1172 682 668 269 --1566 --
NM_000935chr31163 ------
NM_000944chr432037 1840 504 2821 597 172 --
NM_000945chr211830 1569 1715 1666
NM_000949chr52358 217 ------
NM_000950chrX53163 3035 1156 189 159 1492 11020 --
NM_000958chr541257 1237 968 444 ----1503
NM_000959chr173984 3960 2851 2730 2571 651 520 22694 2671 12705 --
NM_000961chr2063965 3167 3152 1442 913 561 --33955 3550 3139 --
NM_000965chr311230 ------
NM_001001132chr212455 395 ------
NM_001001323chr1243048 2814 1202 1151 21120 907 --1928
NM_001001330chr102166 145 ------
NM_001001389chr1152880 1895 439 193 96 --12916 13009
NM_001001390chr1152880 1895 439 193 96 --12916 13009
NM_001001391chr1152880 1895 439 193 96 --12916 13009
NM_001001392chr1152926 1941 485 239 142 --12962 13055
NM_001001394chr23638 536 494 ------
NM_001001395chr1252546 2108 621 376 242 ------
NM_001001396chr122755 753 24454 1005 --13807
NM_001001419chr595218 4286 3912 3676 3228 2057 1135 792 470 15224 24435 31 --
NM_001001420chr595218 4286 3912 3676 3228 2057 1135 792 470 15224 24435 31 --
NM_001001436chr162356 113 --1865 --
NM_001001481chr8113408 3378 3256 2883 2559 2498 1316 1206 996 845 609 11043 1822 --
NM_001001484chr1021994 654 ----12294
NM_001001521chr22303 233 ------
NM_001001549chr732167 738 179 22525 630 ----
NM_001001550chr732167 738 179 22525 630 ----
NM_001001555chr732167 738 179 22525 630 ----
NM_001001556chr151113 21505 1204 1344 --
NM_001001664chr234137 3203 136 14091 ----
NM_001001668chr19113815 3795 3517 3426 2810 2792 1666 1025 756 621 490 11371 --23877 283
NM_001001715chr13------2550 430
NM_001001890chr2133042 1473 958 13618 --13554
NM_001001933chr12416 129 ------
NM_001001936chr101295 165 1829 --
NM_001001937chr18146 ------
NM_001001971chr1051402 1231 953 563 324 174 ----
NM_001001974chr1032267 851 777 ------
NM_001001995chrX21744 1214 --1286 11306
NM_001002026chr352478 2432 2381 1619 849 12215 ----
NM_001002233chr862017 1956 1773 1623 1570 827 ------
NM_001002243chr24710 586 251 29 --1787 --
NM_001002257chr253366 3226 3107 2612 1154 22882 124 1163 12638
NM_001002259chr121243 ------
NM_001002838chrX31379 546 331 --11757 --
NM_001002843chr152832 797 1298 --1472
NM_001002860chr1484293 3738 3178 3074 1400 1224 654 533 ------
NM_001003652chr18178559 8474 7976 7661 6462 6374 6122 5819 5595 5561 5281 5273 3139 2238 1758 1435 1160 48077 7569 5448 1835 11259 --
NM_001003674chr18117013 6996 6636 6554 6541 5294 4594 4345 1067 879 776 45052 4669 2696 1312 25901 1566 --
NM_001003675chr18117013 6996 6636 6554 6541 5294 4594 4345 1067 879 776 45052 4669 2696 1312 25901 1566 --
NM_001003681chr2242043 1689 1605 836 --145 --
NM_001003712chr1253501 3474 1175 604 360 1754 1781 13011
NM_001003792chr311113 ------
NM_001003793chr311113 ------
NM_001003794chr343009 581 466 161 ----12955
NM_001003810chr41203 --1220 --
NM_001003845chr21468 1428 ----
NM_001003940chr154830 466 106 94 12725 13630 --
NM_001003942chr154830 466 106 94 12725 13630 --
NM_001003943chr154834 470 110 98 12729 13634 --
NM_001004065chr953791 2911 2770 1397 311 23256 1155 ----
NM_001004128chr1--1688 ----
NM_001004196chr331213 1078 1030 --1759 --
NM_001004317chr664162 3928 3313 1677 993 937 13849 ----
NM_001004342chr135026 1548 1027 --35892 5667 3882 --
NM_001004356chr4--11525 ----
NM_001004358chr4--11525 ----
NM_001004419chr1254408 3956 3271 1047 761 11455 ----
NM_001005242chr123434 407 235 11481 ----
NM_001005266chr151110 ------
NM_001005267chr151110 ------
NM_001005268chr151110 ------
NM_001005269chr151110 ------
NM_001005335chr192316 75 ------
NM_001005366chr124856 366 317 278 ------
NM_001005377chr194254 233 219 83 ------
NM_001005386chr2--41804 903 169 158 12227 --
NM_001005404chr1754477 4405 3125 1412 1155 ----11528
NM_001005463chr1022557 773 --1329 11758
NM_001005474chr321527 624 1567 1528 --
NM_001005502chr1274713 4664 4499 4478 3177 813 50 13300 ----
NM_001005612chrX1170 ------
NM_001005782chr21157 ------
NM_001005845chr821317 47 11841 ----
NM_001006117chrY1181 --181 --
NM_001006600chr552447 1693 746 483 219 ------
NM_001006612chrX3148 132 103 --1436 --
NM_001006613chrX3148 132 103 --1436 --
NM_001006614chrX3148 132 103 --1436 --
NM_001006618chr91254 ------
NM_001006623chr272386 2006 1952 944 915 690 157 --1559 --
NM_001007023chr1453512 2028 1389 780 28 14138 ----
NM_001007024chr1754276 3746 3196 2921 245 23801 1622 ----
NM_001007025chr1754276 3746 3196 2921 245 23801 1622 ----
NM_001007075chr421014 860 --11082 --
NM_001007094chr1074509 3183 2903 2730 1620 877 437 1779 11709 --
NM_001007097chr954901 4444 1706 1571 374 15082 --11174
NM_001007102chr641651 1596 1438 348 11060 --1482
NM_001007226chr175959 584 572 207 56 ------
NM_001007227chr175959 584 572 207 56 ------
NM_001007228chr175959 584 572 207 56 ------
NM_001007229chr175959 584 572 207 56 ------
NM_001007230chr175959 584 572 207 56 ------
NM_001007246chr2161861 1696 1312 778 619 384 --1517 1687
NM_001007257chr141251 1234 1141 1051 11202 11476 --
NM_001007278chr13115117 4957 4796 4440 4223 3873 3491 3257 2107 330 33 15255 143 13212
NM_001007466chr635203 4702 3661 11440 ----
NM_001007565chr32156 129 ------
NM_001007595chr151288 ------
NM_001007794chr12566 527 ------
NM_001008225chr74514 504 299 219 1618 ----
NM_001008226chr1531761 1361 193 ------
NM_001008239chr1843631 3587 3124 1369 --32892 2573 1361 --
NM_001008388chr4------1341
NM_001008392chr332557 996 866 12866 ----
NM_001008401chr1921343 530 ----11352
NM_001008405chr72350 63 21701 383 ----
NM_001008408chr755437 1551 520 296 211 ----12155
NM_001008495chr872257 1887 1753 1656 1507 482 261 1808 22022 575 --
NM_001008528chr1731466 231 185 21809 1642 ----
NM_001008539chr8135168 5144 4999 4606 4574 4528 4494 4401 4388 4213 2074 770 103 13521 25134 2157 11223
NM_001008540chr22383 103 1499 ----
NM_001008541chr1032210 2107 1890 --1680 21565 1548
NM_001008541chr1032210 2107 1890 --1680 21565 1548
NM_001008564chr1322278 2189 1406 ----
NM_001008660chr1131587 1541 1371 --1214 --
NM_001008701chr1923087 2004 12791 1897 --
NM_001008708chr21494 ------
NM_001008738chr582829 2545 2271 2248 1838 1126 1098 443 ------
NM_001008860chr151226 --135 --
NM_001008892chr151226 --135 --
NM_001008894chr151226 --135 --
NM_001008895chr131227 ----11407
NM_001009555chr411319 1694 11104 --
NM_001009567chr102151 80 ------
NM_001009571chr771679 1662 1434 1132 501 89 47 1439 ----
NM_001009881chr11417 ------
NM_001009882chr11417 ------
NM_001009894chr1221706 336 11176 --1480
NM_001009899chr363948 1820 1772 1115 375 344 11836 --16466
NM_001009909chr1133682 1548 36 13509 23974 501 --
NM_001009960chr732522 663 126 --1337 1688
NM_001010853chr673042 2627 2545 2206 2158 913 871 --1852 --
NM_001010854chr142260 231 ------
NM_001010861chr122154 475 12171 ----
NM_001010862chrX63024 2281 1234 979 553 67 1362 ----
NM_001010888chrX44529 4324 1753 1173 ----24622 1768
NM_001010891chr5105885 5462 4542 4363 4283 2703 1114 852 494 38 31095 668 311 14909 --
NM_001010908chr101498 1517 ----
NM_001010934chr731174 1064 935 --1857 --
NM_001010971chr131016 929 804 ------
NM_001010980chr11544 23235 491 13409 --
NM_001010986chrX42447 2200 1682 621 1340 11697 --
NM_001011537chr351837 1513 1489 409 51 ------
NM_001011546chr20154 2747 252 ----
NM_001011553chr71315 ------
NM_001011666chr766405 5444 4266 1175 1104 765 35551 594 342 16469 --
NM_001011708chr222813 748 1496 ----
NM_001011713chr1451545 1300 1027 192 76 ------
NM_001011724chr13------1291
NM_001011725chr13------1291
NM_001011885chr152729 528 ----11514
NM_001012267chr9177 ----1739
NM_001012423chr152425 331 ------
NM_001012751chr1031603 1322 417 11532 11489 1181
NM_001012755chrX94823 4771 3606 3468 1923 979 694 472 31 ----13598
NM_001012761chr542736 2571 2262 1020 --2656 418 --
NM_001012968chrX62741 2448 2341 921 869 181 12551 12164 12724
NM_001012989chrX4687 585 521 220 ------
NM_001013031chr1053278 3265 2474 1317 1021 23237 2629 1878 --
NM_001013398chr721515 997 11119 ----
NM_001013406chr711214 11124 ----
NM_001013415chr441254 1198 619 515 ------
NM_001013620chr12128237 7380 6973 6799 5309 3391 1926 1712 1615 619 609 231 --27843 1242 17001
NM_001013632chr1127 ------
NM_001013699chr122181 84 1201 ----
NM_001013703chr151446 ------
NM_001013843chr152915 138 1579 ----
NM_001014380chr1385385 5293 5046 4936 1095 991 673 185 25841 5724 --21833 437
NM_001014797chr10128052 7457 2663 2604 2240 2082 1949 1254 1230 944 934 296 12638 ----
NM_001014812chr152377 158 ------
NM_001014972chr2166 ------
NM_001015045chr452467 2314 2062 506 443 --11785 11568
NM_001015508chr81526 ------
NM_001015877chrX52890 2484 1933 1065 982 1779 ----
NM_001015882chr921096 189 1222 ----
NM_001017371chr231311 1175 61 --11219 --
NM_001017395chr383593 2928 2898 2641 2629 2231 998 22 11313 23415 844 --
NM_001017396chr2--1832 --22173 1457
NM_001017424chr141373 601 317 69 11772 11493 --
NM_001017425chr141373 601 317 69 11772 11493 --
NM_001017440chr757423 6179 3111 1085 268 16846 15258 15724
NM_001017923chr14--11648 ----
NM_001017926chr821775 1567 --1455 11588
NM_001017930chrX111452 1416 1359 1344 1304 1247 1232 1192 1127 945 120 ------
NM_001017962chr103757 154 30 ------
NM_001017963chr141332 189 ----
NM_001017969chr92659 43 ------
NM_001017999chr11789 1281 ----
NM_001017999chr11789 1281 ----
NM_001018000chr11789 1281 ----
NM_001018000chr11789 1281 ----
NM_001018001chr11789 1281 ----
NM_001018064chr931796 566 380 11821 ----
NM_001018065chr9105538 4547 3916 3681 1965 1883 1578 1431 1362 413 12420 21700 1638 15831
NM_001018066chr9105538 4547 3916 3681 1965 1883 1578 1431 1362 413 12420 21700 1638 15831
NM_001018067chr185053 4835 4716 4365 1787 1635 1421 813 13939 31955 1196 284 13664
NM_001018068chr185053 4835 4716 4365 1787 1635 1421 813 13939 31955 1196 284 13664
NM_001018069chr185053 4835 4716 4365 1787 1635 1421 813 13939 31955 1196 284 13664
NM_001018074chr523846 107 --13192 --
NM_001018075chr523846 107 --13192 --
NM_001018076chr523846 107 --13192 --
NM_001018077chr523846 107 --13192 --
NM_001018090chr1542016 1994 854 88 1920 11751 --
NM_001018091chr1542126 2104 964 198 11030 11861 --
NM_001018102chr1542016 1994 854 88 1920 11751 --
NM_001023567chr1512345 22247 410 ----
NM_001024094chr523846 107 --13192 --
NM_001024455chrX52639 1920 1894 1744 489 22220 88 166 --
NM_001024463chr15------1430
NM_001024647chr1287502 7475 6810 5940 4793 2920 2281 125 27722 5474 11282 12671
NM_001024649chr532951 2162 656 2959 799 ----
NM_001024688chr831487 785 174 ------
NM_001024808chr1222848 296 ------
NM_001024847chr322450 891 11791 ----
NM_001024934chr63513 505 266 ------
NM_001024935chr63513 505 266 ------
NM_001024936chr63513 505 266 ------
NM_001024937chr17--1750 ----
NM_001024948chr152621 2603 1257 959 115 ------
NM_001024956chr1155880 5748 5148 4291 431 35831 4548 3840 --45784 4597 1211 935
NM_001025068chr331849 1621 526 --1206 --
NM_001025069chr331849 1621 526 --1206 --
NM_001025076chr10106025 5909 5868 5468 4861 3977 3801 2157 1242 128 35677 1235 682 21271 258 --
NM_001025077chr10137383 7267 7226 6826 6219 5335 5159 4948 4704 2600 1486 991 649 37035 2593 2040 22629 1616 1920
NM_001025079chr364076 3711 3643 3573 3361 247 --34014 3054 154 --
NM_001025105chr521324 970 2422 333 ----
NM_001025108chr232702 2652 1658 11387 13834 --
NM_001025201chr21579 ------
NM_001025233chr1221881 405 1694 ----
NM_001025252chr893126 1288 1277 1257 905 704 525 420 322 12765 ----
NM_001025253chr893126 1288 1277 1257 905 704 525 420 322 12765 ----
NM_001025366chr621729 280 11468 11639 --
NM_001025366chr621729 280 11468 11639 --
NM_001025367chr621729 280 11468 11639 --
NM_001025367chr621729 280 11468 11639 --
NM_001025368chr621729 280 11468 11639 --
NM_001025368chr621729 280 11468 11639 --
NM_001025369chr621745 296 11484 11655 --
NM_001025369chr621745 296 11484 11655 --
NM_001025370chr621729 280 11468 11639 --
NM_001025370chr621729 280 11468 11639 --
NM_001025580chrX64135 3555 1083 954 566 288 1187 24293 3755 --
NM_001025595chr441686 1450 1234 37 11051 ----
NM_001025780chr921512 1238 2135 42 ----
NM_001029858chr633140 3075 2632 --2314 287 23233 3101
NM_001029860chr82266 242 ------
NM_001029863chr64983 145 73 61 12797 --11072
NM_001029875chr542939 1977 1150 522 1377 --1924
NM_001029999chr181378 21074 216 11024 --
NM_001030007chr1643553 2988 1424 630 --31562 597 71 1168
NM_001030055chr1454741 4672 4550 1238 400 11843 --11037
NM_001031679chr1232941 2754 570 --167 --
NM_001031684chr221476 1380 ----1311
NM_001031695chr2255376 4738 4487 2072 983 --11377 --
NM_001031712chr61299 ------
NM_001031716chr2--1131 --178
NM_001031732chr433409 648 25 --2741 584 --
NM_001031746chr1021154 1008 --11376 --
NM_001031801chr22----1187 --
NM_001031804chr1672790 1723 1609 902 539 304 73 --1741 --
NM_001031812chr542100 1734 1665 1655 ------
NM_001032282chr841196 1147 329 315 11079 ----
NM_001032283chr123908 804 695 ------
NM_001032284chr123908 804 695 ------
NM_001032288chr2041337 1065 442 347 --11320 --
NM_001032380chr1062033 1923 1303 251 155 89 ------
NM_001032393chrX--2765 560 ----
NM_001033044chr121825 1175 31640 1273 723 ----
NM_001033047chr4135 --11638 --
NM_001033056chr121825 1175 31640 1273 723 ----
NM_001033057chr321955 306 ------
NM_001033087chr2073278 3105 2442 2316 2041 1288 815 13179 1906 --
NM_001033112chr51126 2735 327 ----
NM_001033506chr111406 ------
NM_001033507chr121594 1367 ------
NM_001033551chr1763930 3886 3093 2848 1296 855 12853 12745 --
NM_001033557chr23340 131 96 11061 ----
NM_001033578chr83409 397 284 ------
NM_001033659chr17--122 ----
NM_001033756chr621663 214 11402 21573 726 --
NM_001033756chr621663 214 11402 21573 726 --
NM_001034954chr1023246 2492 --13045 1847
NM_001034955chr1023246 2492 --13045 1847
NM_001034956chr1023246 2492 --13045 1847
NM_001034957chr1023246 2492 --13045 1847
NM_001035chr1--21298 89 ----
NM_001035003chr42346 89 ------
NM_001035004chr42346 89 ------
NM_001035260chr10--1314 ----
NM_001035511chr131939 1720 323 ------
NM_001035512chr132046 1827 430 ------
NM_001035513chr132046 1827 430 ------
NM_001035521chr21512 ----1310
NM_001037132chr721712 476 1558 --1588
NM_001037133chr721712 476 1558 --1588
NM_001037165chr738897 7405 1405 ------
NM_001037172chr361216 1033 924 188 121 100 1398 1167 --
NM_001037174chr222050 1805 ------
NM_001037317chr122154 475 12171 ----
NM_001037339chr151769 1638 1218 715 232 ------
NM_001037340chr151769 1638 1218 715 232 ------
NM_001037341chr151769 1638 1218 715 232 ------
NM_001037341chr151769 1638 1218 715 232 ------
NM_001037553chr2145191 4935 4477 2073 13838 14703 13130
NM_001037558chr112450 208 ------
NM_001037954chr1133367 2862 567 12510 ----
NM_001038493chr231520 1325 1064 --21317 1302 --
NM_001039348chr2----152 --
NM_001039349chr2----152 --
NM_001039350chr741665 661 494 462 ------
NM_001039465chr142519 454 175 ----
NM_001039479chr141820 12006 ----
NM_001039538chr263705 3687 3673 1128 977 76 21251 342 1136 --
NM_001039547chr395674 3098 2247 1987 1809 1405 841 382 137 27717 6893 --17076
NM_001039570chr2244699 4612 4087 3547 14287 ----
NM_001039571chr2244699 4612 4087 3547 14287 ----
NM_001039573chr171414 --1506 --
NM_001039577chr151179 1161 1143 597 380 1169 1807 --
NM_001039585chr184241 4217 3108 2987 2828 908 777 212 22951 2928 12962 --
NM_001039590chrX94003 3783 3107 2589 1410 934 506 341 156 33475 3096 1438 ----
NM_001039591chrX94003 3783 3107 2589 1410 934 506 341 156 33475 3096 1438 ----
NM_001039618chr11115809 5683 5373 5045 4896 4688 4115 1616 1561 982 756 ----12139
NM_001039690chr1621880 1857 ------
NM_001039693chr223779 554 171 1152 --
NM_001039802chr11355 ------
NM_001039840chrX146031 5613 5391 5246 4826 4807 4250 2428 2277 2119 1980 1649 341 88 --25891 1306 --
NM_001039916chr1221139 294 ------
NM_001039917chr1221139 294 ------
NM_001039918chr1221139 294 ------
NM_001039919chr1221139 294 ------
NM_001039920chr1221139 294 ------
NM_001039937chr1344062 3808 500 100 1653 --21665 1638
NM_001040001chr641987 1268 451 135 --1750 --
NM_001040033chr11740 1684 ----
NM_001040057chr741304 1248 994 507 1978 ----
NM_001040092chr82359 56 ------
NM_001040100chr3146 11209 ----
NM_001040101chr431072 156 118 1130 ----
NM_001040110chr721685 1216 1115 ----
NM_001040134chr1921429 120 ------
NM_001040135chr72613 103 --1309 --
NM_001040142chr232234 1872 38 --11645 --
NM_001040143chr232234 1872 38 --11645 --
NM_001040144chr1621880 1857 ------
NM_001040146chr1621880 1857 ------
NM_001040152chr744579 2021 1514 173 25106 3825 45119 5070 4768 3711 14057
NM_001040153chr133956 779 130 ------
NM_001040158chr51155 1212 ----
NM_001040159chr42940 462 --21132 1084 --
NM_001040181chr32425 79 ------
NM_001040182chr32425 79 ------
NM_001040183chr32425 79 ------
NM_001040199chr32425 79 ------
NM_001040200chr32425 79 ------
NM_001040202chr422527 203 135 12118 12210
NM_001040214chr622264 528 12329 --1339
NM_001040260chr4----11133 --
NM_001040261chr4----11133 --
NM_001040284chr1665366 4841 4254 3624 2171 1217 1552 25429 1329 --
NM_001040402chr453006 891 175 163 138 --32170 263 69 --
NM_001040429chr1353613 3530 3211 2525 1062 ------
NM_001040441chr185462 5203 4919 4839 3879 3358 1991 193 ----1636
NM_001040450chr1532296 1880 139 --1923 --
NM_001040453chr1532296 1880 139 --1923 --
NM_001040624chr81237 --12475 --
NM_001040625chr81237 --12475 --
NM_001040626chr81237 --12475 --
NM_001040627chr81237 --12475 --
NM_001040628chr81237 --12475 --
NM_001040629chr81237 --12475 --
NM_001040630chr81237 --12475 --
NM_001040633chr72893 873 ------
NM_001040647chr742119 1815 774 76 ------
NM_001040648chr742119 1815 774 76 ------
NM_001040653chr342499 1740 1669 675 1898 ----
NM_001040665chr754471 3853 1673 884 262 1114 14910 11407
NM_001040668chr191135 ------
NM_001040708chr8--2455 220 ----
NM_001040712chr963593 1196 1182 881 683 323 23575 3448 ----
NM_001042353chr202538 159 1400 ----
NM_001042355chr1624176 156 45341 3356 1361 497 ----
NM_001042357chr1041416 487 203 93 ------
NM_001042358chr1041416 487 203 93 ------
NM_001042360chr1041416 487 203 93 ------
NM_001042363chr1041416 487 203 93 ------
NM_001042383chr332943 459 230 1284 33182 2904 2472 --
NM_001042388chr182906 347 1646 1621 --
NM_001042389chr1041416 487 203 93 ------
NM_001042390chr1041416 487 203 93 ------
NM_001042392chr1041416 487 203 93 ------
NM_001042395chr1041416 487 203 93 ------
NM_001042404chr151976 1950 1749 1475 643 1424 ----
NM_001042412chr1624176 156 45341 3356 1361 497 ----
NM_001042413chr973988 3864 3310 552 434 188 45 13456 ----
NM_001042414chr13------195
NM_001042424chr422946 554 1870 ----
NM_001042453chrX21688 1239 ------
NM_001042459chr31340 ------
NM_001042481chr1462398 2224 1847 488 472 43 12217 ----
NM_001042492chr1733439 3154 948 43337 2601 1043 800 11256 13204
NM_001042493chr621498 384 1268 ----
NM_001042494chr1543741 3132 2455 716 ------
NM_001042495chr1543741 3132 2455 716 ------
NM_001042496chr1543741 3132 2455 716 ------
NM_001042497chr1543741 3132 2455 716 ------
NM_001042510chr831366 763 228 ------
NM_001042511chr831366 763 228 ------
NM_001042517chr133980 279 78 ------
NM_001042537chrX21639 592 11739 2962 886 --
NM_001042550chr921731 1517 1777 11572 --
NM_001042555chr1251351 956 805 791 604 ----24784 376
NM_001042599chr297829 7636 7354 7269 7107 5416 4879 2204 1308 17228 ----
NM_001042601chr32256 125 --1374 --
NM_001042603chr1275149 3870 2038 2030 754 408 95 14539 --14606
NM_001042604chr373548 3526 3127 1559 1283 938 750 ------
NM_001042681chr132513 2234 1019 ------
NM_001042682chr132513 2234 1019 ------
NM_001042682chr132513 2234 1019 ------
NM_001042683chr63593 446 132 ----1743
NM_001042749chrX1471 --11614 --
NM_001042750chrX1471 --11614 --
NM_001042751chrX1471 --11614 --
NM_001044305chr631542 1320 512 151 ----
NM_001044722chr542100 1734 1665 1655 ------
NM_001044723chr542100 1734 1665 1655 ------
NM_001046chr552997 2779 2151 259 149 21155 506 ----
NM_001049chr1432456 2085 2028 ------
NM_001068chr3----1226 --
NM_001071775chr131424 --1245 --
NM_001076chr4--1128 ----
NM_001076chr4--1128 ----
NM_001083620chr441933 1636 935 852 --32249 757 452 --
NM_001099678chr376401 6016 5186 4123 4047 1714 1534 --35921 1288 652 16009
NM_001105518chr11912 1807 ----
NM_001106chr3119654 9351 7786 6533 5985 3686 3104 2441 2102 1502 212 ----18412
NM_001113490chrX63245 3065 2931 2306 723 241 12511 ----
NM_001116chr1632575 2096 370 --12592 13060
NM_001117chr183467 374 156 ----1532
NM_001121chr1031892 1619 428 11803 ----
NM_001122679chr531313 1257 1225 1975 ----
NM_001128chr1643553 2988 1424 630 --31562 597 71 1168
NM_001146chr832250 2143 276 --12189 11790
NM_001148chr432059 1720 438 11601 1818 2678 652
NM_001160chr1242857 2673 1966 101 ----12100
NM_001167chrX106701 6206 2617 2601 2440 2414 1209 470 442 105 35117 1252 916 11779 --
NM_001173chr1454741 4672 4550 1238 400 11843 --11037
NM_001177chr1222139 536 ------
NM_001186chr2153305 2786 2584 946 85 --12061 --
NM_001187chr211418 ------
NM_001199chr8130 ------
NM_001201chr433988 3194 1323 12696 12583 --
NM_001204chr297757 7517 7120 7053 6941 6651 5357 4710 1954 27403 7190 16373 21915 330
NM_001206chr953069 2361 482 467 161 12177 ----
NM_001219chr72546 70 --11664 --
NM_001220chr7--1152 ----
NM_001222chr1041967 1717 650 245 ------
NM_001227chr1021355 1189 1261 ----
NM_001231chr1--1458 ----
NM_001233chr751469 660 646 578 51 ------
NM_001237chr411189 2435 219 ----
NM_001237chr411189 2435 219 ----
NM_001239chr51122 ------
NM_001241chr272258 1907 1767 1632 476 450 200 --22345 151 --
NM_001241chr272258 1907 1767 1632 476 450 200 --22345 151 --
NM_001256chr173724 695 369 11943 ----
NM_001257chr1621327 122 ------
NM_001259chr7146165 5244 5208 2338 2240 2031 1997 1819 1333 1177 958 939 838 642 --65600 4836 1980 1387 1150 97 --
NM_001270chr51759 --1122 --
NM_001284chr52407 170 ------
NM_001304chr1733087 2777 1411 32815 2643 476 13135 1127
NM_001310chr1252725 1946 727 694 324 --11015 --
NM_001326chr113416 381 84 ------
NM_001329chr1021459 1286 21188 445 ----
NM_001331chr1132724 2625 2205 22309 2086 1703 12389
NM_001332chr531078 593 492 2483 100 ----
NM_001343chr52655 398 ------
NM_001356chrX42408 1777 1658 380 22364 302 1219 --
NM_001358chr41343 ------
NM_001364chr1163956 3849 3824 1842 1581 648 ------
NM_001378chr21413 ------
NM_001380chr102732 343 ------
NM_001387chr53724 179 45 ----12672
NM_001389chr21--1488 ----
NM_001402chr651903 1769 1731 1566 482 2587 521 ----
NM_001407chr341696 1112 1070 481 ------
NM_001412chrX53269 3079 2366 763 712 1110 23487 280 --
NM_001416chr172454 343 ------
NM_001419chr1944687 1585 751 67 ------
NM_001420chr1913152 12095 12127 --
NM_001423chr1251967 1608 1423 724 76 21864 737 ----
NM_001429chr221208 ----11100
NM_001431chr62961 188 1264 ----
NM_001432chr41798 33350 893 172 1332 --
NM_001438chr173177 2756 2704 2291 864 838 795 --12353 13576
NM_001453chr621298 684 11479 21759 1718 11749
NM_001455chr663982 3439 3293 1879 1135 657 11623 --13315
NM_001460chr142938 2426 2232 154 ------
NM_001465chr53523 438 120 21835 593 --1192
NM_001491chr642756 1810 634 228 --1264 --
NM_001511chr41489 ------
NM_001514chr11136 ----1446
NM_001521chr21512 ----1310
NM_001522chrX176 ------
NM_001527chr684353 3948 3833 3065 1466 1455 1287 470 --44736 4664 4359 735 --
NM_001530chr1421144 1138 ------
NM_001533chr192316 75 ------
NM_001546chr631201 1101 443 ------
NM_001557chr221207 221 11314 ----
NM_001560chrX42620 709 457 65 ------
NM_001584chr112402 117 11151 1255 --
NM_001587chrX22158 382 ------
NM_001604chr112959 814 ------
NM_001609chr1064439 4161 2936 1318 909 707 24403 4181 24350 3889 13786
NM_001616chr253410 3313 1382 443 151 22370 611 12841 13481
NM_001621chr732558 2527 795 ----12730
NM_001621chr732558 2527 795 ----12730
NM_001635chr721002 79 ------
NM_001650chr1843552 2856 1287 84 ------
NM_001652chr1211468 ------
NM_001656chr541585 1277 473 260 11672 ----
NM_001660chr36686 679 288 165 146 56 ------
NM_001663chr1452026 858 500 427 267 --12313 --
NM_001679chr31758 ------
NM_001681chr122260 177 ------
NM_001682chr1242762 2528 916 865 2834 621 --1642
NM_001684chr121531 470 24171 722 --13524
NM_001690chr321690 479 ----12594
NM_001693chr821116 305 --2483 255 --
NM_001695chr8104248 3797 3326 3178 2850 2775 931 628 606 318 ------
NM_001709chr1142649 2599 512 434 12539 12084 --
NM_001718chr621150 345 ------
NM_001723chr61843 ----1139
NM_001730chr1361496 1390 1379 1295 539 208 ------
NM_001730chr1361496 1390 1379 1295 539 208 ------
NM_001731chr123807 677 241 ------
NM_001742chr731592 1437 171 2740 637 --11666
NM_001743chr2143 --1498 --
NM_001745chr51736 1238 ----
NM_001746chr532951 2162 656 2959 799 ----
NM_001753chr741306 1144 635 289 182 --11797
NM_001754chr2133042 1473 958 13618 --13554
NM_001755chr1642253 1648 864 94 --11692 --
NM_001759chr1253266 1363 985 610 248 21518 1371 43960 1291 947 748 --
NM_001769chr121301 --1134 --
NM_001777chr364076 3711 3643 3573 3361 247 --34014 3054 154 --
NM_001786chr10------159
NM_001788chr71315 ------
NM_001791chr11355 ------
NM_001792chr183860 386 113 ------
NM_001797chr163765 535 308 ------
NM_001802chr163647 369 116 ------
NM_001822chr21579 ------
NM_001830chrX53875 1549 831 450 240 ------
NM_001839chr12693 499 1505 1721 --
NM_001845chr1321326 909 2176 57 ----
NM_001854chr1------11149
NM_001855chr94766 640 346 82 ------
NM_001859chr932603 1600 201 11224 23952 1238 11389
NM_001866chrX130 ------
NM_001873chr4--1505 ----
NM_001874chr1274713 4664 4499 4478 3177 813 50 13300 ----
NM_001892chr521324 970 2422 333 ----
NM_001894chr22--11248 ----
NM_001895chr2041176 1155 378 121 ------
NM_001903chr52612 273 2773 79 ----
NM_001923chr11--126 1644 --
NM_001931chr1121207 1171 --1928 --
NM_001935chr22279 232 ------
NM_001936chr741665 661 494 462 ------
NM_001938chr131650 1217 767 11577 11525 --
NM_001939chrX103685 3634 2815 2743 2650 2526 2407 1484 886 791 1870 21147 560 --
NM_001944chr1842404 2150 1945 875 1745 --12159
NM_001946chr122737 24 ------
NM_001949chr673180 2494 2262 2215 873 801 334 11053 ----
NM_001962chr5193 ------
NM_001966chr331313 1033 93 11453 ----
NM_001969chr1433616 2697 1034 13162 22844 415 --
NM_001970chr17--1609 ----
NM_001977chr451656 1410 662 157 41 ------
NM_001980chr1232288 1502 825 ------
NM_001987chr122721 300 --164 --
NM_001995chr42379 354 175 ----
NM_001999chr521397 360 1370 ----
NM_002006chr465788 5603 4428 2255 1517 1117 164 14296 --
NM_002009chr1541872 949 943 403 ----1671
NM_002013chr14187 ------
NM_002015chr1363244 2667 2539 836 762 695 1623 ----
NM_002017chr1111322 ------
NM_002024chrX42229 1827 216 72 1292 ----
NM_002025chrX118325 7479 6933 6710 5706 3085 2566 2325 632 291 132 35756 1839 663 16320 --
NM_002026chr24988 838 805 431 --1946 --
NM_002031chr61288 --1830 --
NM_002033chr1132902 240 222 11216 --12846
NM_002035chr1873953 3539 3500 1398 1164 98 53 13605 12742 --
NM_002039chr44888 619 304 220 2769 630 ----
NM_002040chr2162987 2733 2600 1013 840 418 --12657 --
NM_002041chr15145 ------
NM_002044chr151113 21505 1204 1344 --
NM_002054chr22191 109 ------
NM_002061chr15691 380 306 216 199 --1772 1424
NM_002063chrX21058 253 ------
NM_002065chr121825 1175 31640 1273 723 ----
NM_002106chr4122 ------
NM_002114chr62527 142 ------
NM_002126chr1723078 543 ------
NM_002128chr1342523 2444 470 356 22514 1845 --12469
NM_002136chr121584 ------
NM_002137chr731914 596 274 ------
NM_002138chr41203 --1220 --
NM_002140chr92300 177 ------
NM_002147chr171190 ----1200
NM_002157chr21145 ------
NM_002158chr233594 2960 2693 22329 412 1165 --
NM_002160chr92631 392 ------
NM_002165chr203393 360 318 ------
NM_002188chr51688 ------
NM_002196chr201339 --21069 772 --
NM_002196chr201339 --21069 772 --
NM_002199chr42907 842 --1138 --
NM_002210chr263427 3270 3170 908 836 758 13516 ----
NM_002211chr101452 1776 ----
NM_002214chr774761 2056 897 563 114 95 50 ----142
NM_002222chr31188 --1148 --
NM_002223chr1283098 2533 1451 1411 1126 958 942 97 22549 711 13962 12992
NM_002226chr144653 595 308 218 ------
NM_002227chr141138 530 415 379 --11167 --
NM_002233chr11----1145 --
NM_002239chr22843 820 ------
NM_002242chr231567 254 200 11789 ----
NM_002264chr384519 4452 3573 3115 1899 1541 1212 811 --24033 3229 --
NM_002265chr171432 --1957 --
NM_002266chr17296 59 ------
NM_002267chr1311712 --22350 2307 --
NM_002268chr331659 1387 448 ------
NM_002269chr61347 ------
NM_002270chr574735 4336 3804 3663 3514 2113 1978 34453 4349 1645 23501 1361 --
NM_002271chr1342208 1776 927 376 --1982 --
NM_002285chr232702 2652 1658 11387 13834 --
NM_002296chr121517 1302 ------
NM_002298chr1331508 1432 1009 ------
NM_002303chr11115 ------
NM_002310chr5135688 5575 5361 4934 4408 2346 2214 2064 2015 1900 1223 694 59 --26380 105 --
NM_002332chr12--1738 1772 --
NM_002336chr1294357 4324 3584 3375 1944 948 739 609 205 24529 773 --14371
NM_002349chr241542 1306 455 236 ------
NM_002355chr1251353 481 434 422 110 ------
NM_002356chr662863 2806 2235 2059 1879 741 --21152 749 12505
NM_002374chr263705 3687 3673 1128 977 76 21251 342 1136 --
NM_002384chr182886 682 ------
NM_002389chr141972 1933 1835 179 ------
NM_002397chr532085 1903 1602 1885 ----
NM_002399chr1521265 1207 ------
NM_002401chr1752238 2142 2130 76 38 11528 ----
NM_002408chr142627 243 --1823 --
NM_002411chr111121 ------
NM_002427chr111234 --2776 21 --
NM_002430chr2222067 415 --1391 1112
NM_002438chr102151 80 ------
NM_002442chr1211431 ------
NM_002444chrX21974 1634 11442 11796 --
NM_002448chr4--1768 ----
NM_002467chr81426 ------
NM_002480chr1221093 227 1953 ----
NM_002481chr157892 6357 1075 894 45 ------
NM_002482chr11663 --1709 --
NM_002485chr831487 785 174 ------
NM_002486chr952431 2304 1988 561 258 ------
NM_002500chr21416 11074 ----
NM_002501chr1932882 1317 1303 ------
NM_002509chr201575 ------
NM_002515chr14126 ------
NM_002520chr5--125 ----
NM_002524chr12231 96 --11075 --
NM_002527chr12178 1306 ----
NM_002556chr1131639 1505 592 ------
NM_002577chr341553 693 566 454 1302 14002 --
NM_002579chr1921429 120 ------
NM_002581chr995528 5476 5344 4857 3784 3639 1335 1274 837 22128 1848 15100 --
NM_002582chr161271 --1934 --
NM_002591chr203573 535 529 ------
NM_002594chr2012421 ------
NM_002595chr1241809 1344 423 158 11687 1319 --
NM_002600chr151769 1638 1218 715 232 ------
NM_002607chr7--1911 ----
NM_002613chr1645106 5097 1248 1203 1980 24867 1479 --
NM_002618chr22125 101 ------
NM_002623chr20148 ------
NM_002628chr331155 1077 990 11125 --1976
NM_002636chr61452 ------
NM_002641chrX11886 12003 ----
NM_002645chr112330 150 194 1219 1949
NM_002655chr895276 5222 3953 3821 3486 3371 1958 892 524 21596 1131 14982 14339
NM_002656chr61896 1756 ----
NM_002657chr2053592 2571 1249 1182 1072 23858 771 ----
NM_002670chr331482 514 262 ------
NM_002677chr883027 2995 2936 2922 2097 1059 836 57 ------
NM_002699chr131416 1013 87 11394 ----
NM_002703chr4----1628 1654
NM_002706chr2186 ------
NM_002709chr263074 3014 2595 2387 594 362 138 --13605
NM_002711chr73823 255 81 ------
NM_002715chr551281 1170 890 465 224 --11101 --
NM_002716chr1183077 2597 1480 1464 1278 898 649 178 23154 200 --1938
NM_002717chr8----1141 --
NM_002719chr1431827 825 710 --1454 --
NM_002721chr93424 158 99 ------
NM_002727chr101197 --1549 --
NM_002729chr102789 55 1319 ----
NM_002731chr143062 2682 412 387 --12879 --
NM_002734chr1782261 2209 1969 1672 1599 640 226 139 2861 550 ----
NM_002736chr721937 1873 ----11789
NM_002737chr17106650 6596 6387 6380 4627 4303 1883 1846 914 902 45394 1806 1201 736 ----
NM_002738chr1631004 987 429 --1868 --
NM_002747chr181536 --11888 --
NM_002753chr41351 1755 ----
NM_002787chr72648 581 1188 ----
NM_002808chr31118 ------
NM_002811chr162518 144 ----1377
NM_002814chrX1209 1700 ----
NM_002821chr61752 ----1129
NM_002822chr1221697 453 ----11676
NM_002828chr18--1236 ----
NM_002834chr1284034 3552 3372 3092 2771 2504 1385 405 1816 ----
NM_002835chr74615 602 495 132 --1114 --
NM_002836chr20--166 ----
NM_002838chr121225 759 1885 ----
NM_002839chr963593 1196 1182 881 683 323 23575 3448 ----
NM_002841chr31497 ------
NM_002843chr1123395 3365 12329 13386 --
NM_002845chr182545 156 ------
NM_002848chr1251077 832 398 309 61 --1452 --
NM_002851chr73763 588 39 ------
NM_002852chr31395 --1403 --
NM_002858chr1--1159 --1189
NM_002865chr8--1247 ----
NM_002869chr1132225 1589 534 --21554 132 11935
NM_002874chr962445 2365 2245 1764 496 118 --1766 --
NM_002886chr345016 3623 1496 657 23880 3463 14229 --
NM_002890chr51350 2826 698 ----
NM_002892chr1451556 1282 1198 487 34 ----1103
NM_002901chr112139 60 ------
NM_002902chr15148 ------
NM_002912chr64906 763 681 227 ------
NM_002923chr1------1533
NM_002924chr11616 --1124 --
NM_002938chr441950 1495 1385 156 ------
NM_002941chr32522 173 11074 ----
NM_002951chr202277 250 ------
NM_002956chr1211358 ------
NM_002959chr164463 3555 3480 1477 1368 1032 2991 642 13924 --
NM_002971chr371219 1122 907 748 453 227 100 ------
NM_002977chr263298 3024 2806 945 844 23 12232 ----
NM_002994chr421874 244 ----11823
NM_002998chr81776 2806 381 ----
NM_003001chr132046 1827 430 ------
NM_003016chr1771999 1695 1550 1276 594 452 250 ------
NM_003017chr621252 964 --1218 --
NM_003020chr15--1178 1400 --
NM_003022chrX2249 49 1870 ----
NM_003030chr3--1375 ----
NM_003034chr12118022 7799 6255 2836 1999 1520 1421 690 626 316 43 1374 25073 1048 12223
NM_003036chr12293 265 ------
NM_003046chr8135168 5144 4999 4606 4574 4528 4494 4401 4388 4213 2074 770 103 13521 25134 2157 11223
NM_003051chr121715 1230 21623 340 31580 1246 435 --
NM_003060chr54882 847 504 103 11209 ----
NM_003069chrX4732 638 574 491 ------
NM_003071chr341862 688 672 248 ------
NM_003074chr322211 420 ------
NM_003076chr1221566 661 ------
NM_003079chr172857 655 ------
NM_003081chr2051011 990 921 883 345 1286 --11042
NM_003094chr17986 479 214 163 140 89 27 --1758 --
NM_003099chr1536547 5855 4751 12402 11621 16479
NM_003101chr161334 1324 1286 493 265 78 ------
NM_003107chr632593 2243 286 ------
NM_003108chr254908 4737 2854 1003 797 1614 27084 6925 --
NM_003110chr1731043 945 686 11102 ----
NM_003111chr231311 1175 61 --11219 --
NM_003112chr742129 1266 896 372 22896 2388 ----
NM_003113chr21262 ------
NM_003114chr8--2283 235 ----
NM_003128chr242836 2794 884 499 1688 ----
NM_003129chr8----1239 --
NM_003133chr11274 ------
NM_003139chr11--2868 327 ----
NM_003140chrY197 ------
NM_003144chr662160 740 557 543 478 271 --11506 21459 155
NM_003149chr311318 ------
NM_003150chr1722237 339 21806 467 12377 --
NM_003155chr832482 2403 576 --11921 22670 1968
NM_003161chr1743457 2209 1054 314 13330 --2673 206
NM_003162chr21190 2942 426 ----
NM_003174chr10------1135
NM_003176chr11218 ------
NM_003176chr11218 ------
NM_003178chr331868 862 101 1606 11603 --
NM_003179chrX31402 997 121 ------
NM_003185chr20175 1934 11311 --
NM_003188chr64853 644 148 132 ------
NM_003189chr153190 3007 2848 2523 951 1970 12389 --
NM_003199chr18105440 4125 3941 3909 3828 1969 1322 889 819 24 25044 4935 --25061 4314
NM_003202chr5------11853
NM_003206chr62451 420 ------
NM_003211chr1251542 1505 1254 560 467 176 11777 --
NM_003221chr634212 3900 1447 --21365 535 --
NM_003222chr2041260 1222 805 108 ------
NM_003234chr341734 1670 883 720 1288 ----
NM_003236chr272950 2417 1322 1177 1145 1129 423 2710 236 13518 --
NM_003238chr1--1178 ----
NM_003242chr322450 891 11791 ----
NM_003244chr181297 ----1114
NM_003246chr1531888 1737 239 --1563 --
NM_003247chr641664 1258 465 283 ----1417
NM_003255chr1742472 1875 989 861 ------
NM_003257chr1521167 110 ------
NM_003262chr334967 1443 1139 --33435 1052 768 23199 2117
NM_003270chrX5836 450 401 237 76 ------
NM_003272chr12200 117 ------
NM_003274chr2122428 2177 --12949 --
NM_003286chr2011041 --11068 --
NM_003290chr192103 83 ------
NM_003295chr131155 ------
NM_003298chr376206 6125 5012 4226 2466 2177 1564 24176 1642 15061 --
NM_003304chr371579 1350 1086 596 515 455 241 ------
NM_003305chr41154 ------
NM_003319chr23969 192 166 1879 1957 --
NM_003330chr1221802 1177 ------
NM_003336chrX----2909 317 1380
NM_003337chr52678 36 --1203 --
NM_003338chr103730 654 401 1314 11644 --
NM_003339chr5----11233 11130
NM_003340chr421010 919 ------
NM_003341chr34671 624 279 168 ------
NM_003342chr1753154 2225 1328 932 406 --22265 93 --
NM_003348chr1261721 1452 1330 677 519 220 11191 1575 --
NM_003349chr2041337 1065 442 347 --11320 --
NM_003350chr81404 ------
NM_003352chr21157 ------
NM_003369chr1122428 1123 --22128 165 --
NM_003373chr1061925 1632 543 479 460 85 --1443 --
NM_003374chr5------1106
NM_003375chr101160 1393 ----
NM_003376chr621729 280 11468 11639 --
NM_003376chr621729 280 11468 11639 --
NM_003379chr61750 ------
NM_003385chr22837 116 2335 186 ----
NM_003387chr272877 2731 2272 973 332 208 48 ----12761
NM_003400chr23824 685 174 ------
NM_003403chr141567 ----1191
NM_003406chr82722 641 ------
NM_003410chrX22867 899 1572 ----
NM_003413chrX71985 1807 1607 1451 1373 744 398 1124 21747 649 --
NM_003418chr31777 1227 ----
NM_003421chr1074509 3183 2903 2730 1620 877 437 1779 11709 --
NM_003423chr1921050 445 --12582 --
NM_003432chr5----1462 --
NM_003439chr753460 2800 1360 816 397 ------
NM_003442chr11--1675 ----
NM_003454chr1641429 1388 530 453 11487 1161 --
NM_003463chr652664 2630 877 213 56 1292 ----
NM_003467chr22383 103 1499 ----
NM_003468chr243742 1544 1300 453 1984 ----
NM_003470chr1611183 ----1686
NM_003471chr33673 612 103 --1241 1462
NM_003478chr1183013 2992 1244 1098 747 564 553 330 22286 673 --12251
NM_003483chr1242959 2663 2429 972 --12831 --
NM_003489chr2142809 2730 820 337 22336 528 12268 --
NM_003498chr164865 261 232 108 2666 376 ----
NM_003505chr711679 ------
NM_003508chr71293 ------
NM_003557chr141596 1429 1394 1276 --21120 338 --
NM_003563chr175959 584 572 207 56 ------
NM_003566chr1273449 3034 2684 2461 2332 2220 410 --21061 536 --
NM_003569chr62616 123 1244 ----
NM_003574chr18105625 5508 4549 4421 4321 4196 2288 365 313 276 24695 489 45426 4595 3901 1659 1401
NM_003583chr1273906 3097 2612 1275 919 830 732 --12734 147
NM_003589chr131227 ----11407
NM_003590chr253485 3295 751 384 328 13504 13547 --
NM_003601chr4191 ------
NM_003603chr42536 411 32167 1885 627 ----
NM_003607chr174377 3864 3494 3247 815 477 253 11656 --13224
NM_003613chr151671 2627 511 ----
NM_003615chr363764 3666 3130 2870 1026 405 11367 13977 23592 1117
NM_003618chr211131 --1211 1265
NM_003622chr124734 354 210 100 ------
NM_003629chr173409 3369 3349 2960 2722 2321 1113 11143 13399 --
NM_003633chr562523 2323 787 679 658 335 --11661 --
NM_003659chr24910 440 353 308 1835 ----
NM_003663chr373455 3182 2881 2863 2252 1106 608 ----1177
NM_003670chr32250 90 ----21149 1034
NM_003671chr963074 2380 2363 779 339 105 --22845 2790 11235
NM_003672chr151906 1889 689 433 90 21409 700 ----
NM_003685chr19--1984 ----
NM_003688chrX163 ------
NM_003690chr22567 158 ----1446
NM_003692chr92875 202 ----1785
NM_003701chr131904 --1402 --
NM_003704chr4------1648
NM_003722chr352656 984 919 621 390 12137 ----
NM_003743chr212123 --12100 --
NM_003745chr16155 ------
NM_003758chr1551154 449 258 215 183 ------
NM_003758chr1551154 449 258 215 183 ------
NM_003774chr1222444 2056 1842 42601 2477 2153 422 --
NM_003778chr31110 ------
NM_003783chr1------145
NM_003787chr1841398 435 358 223 --11474 --
NM_003791chr161120 ------
NM_003794chr361073 969 913 878 844 260 ------
NM_003797chr112149 70 ------
NM_003799chr1853792 3186 2964 421 155 23625 2791 23659 663 2930 486
NM_003800chr642315 674 631 460 1527 ----
NM_003822chr152971 1085 970 898 861 22690 841 12856 --
NM_003825chr1531280 559 411 ------
NM_003850chr133559 283 76 ------
NM_003861chr142946 60 12733 ----
NM_003870chr1542078 849 288 172 ----21828 703
NM_003873chr1082420 2332 2232 2222 1010 937 808 597 --11847 --
NM_003876chr172310 120 ------
NM_003884chr331633 1427 681 ------
NM_003885chr1742167 927 585 285 ----12537
NM_003887chr231449 877 169 12309 1202 11600
NM_003895chr2152104 1700 1601 740 441 21925 369 22080 1797 1192
NM_003901chr1061972 1049 1016 383 254 231 ------
NM_003909chr852378 2187 1864 532 377 2974 845 12724 --
NM_003913chr641206 1093 1003 795 33130 1657 819 ----
NM_003916chrX21384 1080 1120 ----
NM_003922chr151353 ------
NM_003927chr182947 841 ------
NM_003930chr742592 2366 900 226 1479 32385 528 341 --
NM_003931chr63513 505 266 ------
NM_003932chr2221652 590 21785 30 11463 --
NM_003934chr91209 ----1183
NM_003941chr732137 683 106 11571 ----
NM_003943chr42126 115 ------
NM_003953chr122184 250 1816 1598 --
NM_003958chr633822 482 313 --23401 1466 --
NM_003983chr1624443 3343 13075 23489 847 --
NM_003994chr1244399 3765 1197 135 --13269 --
NM_003998chr43599 474 254 ----1565
NM_004006chrX42493 1655 515 241 1248 12370 --
NM_004007chrX42493 1655 515 241 1248 12370 --
NM_004009chrX42493 1655 515 241 1248 12370 --
NM_004010chrX42493 1655 515 241 1248 12370 --
NM_004011chrX42493 1655 515 241 1248 12370 --
NM_004012chrX42493 1655 515 241 1248 12370 --
NM_004013chrX42493 1655 515 241 1248 12370 --
NM_004014chrX42493 1655 515 241 1248 12370 --
NM_004015chrX42493 1655 515 241 1248 12370 --
NM_004016chrX42407 1569 429 155 1162 12284 --
NM_004017chrX42493 1655 515 241 1248 12370 --
NM_004018chrX42407 1569 429 155 1162 12284 --
NM_004020chrX42493 1655 515 241 1248 12370 --
NM_004021chrX42407 1569 429 155 1162 12284 --
NM_004022chrX42407 1569 429 155 1162 12284 --
NM_004023chrX42407 1569 429 155 1162 12284 --
NM_004028chr1843552 2856 1287 84 ------
NM_004035chr1745044 4990 4971 1518 1561 --2684 344
NM_004040chr231251 878 870 ------
NM_004046chr18146 ------
NM_004056chr82322 283 1183 11039 --
NM_004075chr121615 ------
NM_004080chr731384 530 132 --1430 --
NM_004087chr352056 1550 1290 630 492 11876 ----
NM_004093chr1321254 979 2842 660 13032 --
NM_004098chr1011234 ------
NM_004105chr2----152 --
NM_004114chrX31011 829 364 1889 --21137 973
NM_004117chr622176 99 21793 600 1883 --
NM_004124chr1463343 3299 3039 1166 807 290 23558 2665 1215 --
NM_004133chr852617 662 469 331 163 --22377 169 --
NM_004136chr1552721 2567 2015 1053 977 21109 868 --23044 208
NM_004161chr251137 1078 644 451 256 ------
NM_004171chr11159447 8314 7714 7263 7172 6909 6697 6366 3476 3100 2397 1973 1485 1105 434 --17596 18694
NM_004181chr41317 125 ----
NM_004187chrX1173 11123 ----
NM_004202chrY2694 47 ------
NM_004209chr1621035 934 ------
NM_004215chr81521 ------
NM_004227chr733161 2667 2207 12889 12553 --
NM_004229chrX42128 1796 480 317 ------
NM_004232chr1883561 3317 3039 2768 1039 750 306 94 11303 22374 400 --
NM_004241chr102323 136 1740 ----
NM_004261chr12892 33 ------
NM_004262chr421428 117 11305 ----
NM_004272chr511365 ----11485
NM_004274chr1452892 2618 1107 1050 750 22916 2660 ----
NM_004282chr6184 ------
NM_004290chr521263 34 ------
NM_004302chr1232277 1984 713 ------
NM_004319chr152217 1064 826 570 425 11048 ----
NM_004326chr111247 ------
NM_004329chr10--11195 ----
NM_004330chr1521140 853 ----1244
NM_004338chr18117013 6996 6636 6554 6541 5294 4594 4345 1067 879 776 45052 4669 2696 1312 25901 1566 --
NM_004346chr421533 1401 ----1251
NM_004352chr162579 517 ------
NM_004354chr42293 131 ------
NM_004360chr16160 12037 ----
NM_004370chr661729 1468 758 659 572 535 11590 12123 --
NM_004379chr231706 1362 671 1508 11385 --
NM_004380chr162964 634 1165 22167 303 1877
NM_004384chr542100 1734 1665 1655 ------
NM_004388chr14370 138 95 81 ------
NM_004392chr1342058 2027 778 264 --11788 --
NM_004397chr1163579 3543 3303 3121 1241 1071 14309 32781 1719 1692 12685
NM_004405chr221096 54 ------
NM_004412chr1055491 5098 4191 3754 1109 --1205 15738
NM_004438chr243114 2345 316 143 ----1161
NM_004440chr631771 794 638 21211 644 --1365
NM_004441chr321222 149 11296 ----
NM_004447chr1231147 303 30 ------
NM_004450chr141106 ------
NM_004454chr321477 760 ------
NM_004457chr251292 1217 505 486 27 ------
NM_004458chrX52599 2156 1005 557 153 11012 --12009
NM_004459chr1741578 1495 621 402 --21992 428 --
NM_004464chr464301 4270 4084 3466 1619 593 24148 403 23573 3506 --
NM_004481chr132679 2633 563 ------
NM_004482chr22861 391 ------
NM_004484chrX2369 101 ------
NM_004491chr1924291 3771 ------
NM_004496chr1411214 ----11250
NM_004500chr1441491 711 363 315 1210 11845 --
NM_004501chr131640 501 312 ----13904
NM_004504chr242164 652 637 590 11208 2443 348 --
NM_004516chr1911196 ------
NM_004525chr211147 31462 1366 297 ----
NM_004535chr2031625 1356 1164 ------
NM_004537chr1241413 1132 453 260 1591 ----
NM_004538chrX1644 ------
NM_004540chr212190 173 2210 201 1636 --
NM_004571chr2173409 2997 1300 1043 684 582 548 ------
NM_004575chr431447 1333 1212 --11455 --
NM_004586chrX85409 5309 4047 4035 3592 1807 597 361 --25253 177 --
NM_004593chr3145 ------
NM_004598chr523028 106 --12110 --
NM_004602chr2021281 1172 21367 940 ----
NM_004607chr51182 ------
NM_004612chr9114747 4639 4409 4005 3978 3850 1420 1238 589 108 74 --1286 2691 353
NM_004615chrX2719 632 --1764 --
NM_004620chr113574 461 124 ------
NM_004622chr221884 895 298 29 ----
NM_004627chr211632 ------
NM_004654chrY21143 1106 21399 467 ----
NM_004655chr171457 --11062 --
NM_004660chrY62278 2094 1709 1602 378 211 21447 300 --12232
NM_004663chr1521178 253 --31521 1432 638 --
NM_004671chr18--1316 ----
NM_004681chrY3249 205 134 ------
NM_004684chr42333 138 ------
NM_004685chr1332628 975 963 11115 ----
NM_004686chr82607 531 11643 --11377
NM_004703chr17--12526 ----
NM_004708chr191113 ------
NM_004709chrX51835 1758 1407 172 42 ----1126
NM_004713chr142626 123 ------
NM_004718chr21201 2621 283 --166
NM_004719chr1242818 2440 1839 759 --11158 --
NM_004726chrX84972 4790 4390 3612 1687 1589 965 563 15587 ----
NM_004727chr1531695 1449 868 --11924 --
NM_004733chr32444 247 1503 ----
NM_004734chr1342683 1147 540 313 1429 12328 --
NM_004736chr151963 835 608 578 282 11980 --1821
NM_004742chr311695 1425 1277 11667
NM_004745chr866941 6652 4674 1327 928 341 16119 35559 4783 2387 11133
NM_004748chr1584259 4189 3766 3674 3032 2849 2686 920 13786 ----
NM_004759chr112135 ------
NM_004760chr732469 2000 879 1402 21950 420 --
NM_004762chr1721968 143 ------
NM_004768chr121162 301 ------
NM_004772chr51501 ------
NM_004775chr1851723 1589 727 707 372 ------
NM_004781chr12609 574 1599 21402 584 --
NM_004781chr12609 574 1599 21402 584 --
NM_004788chr1162445 2326 2284 2236 640 55 22500 152 ----
NM_004789chr91436 ------
NM_004796chr1452241 2050 1892 1603 931 1781 12161 --
NM_004799chr1--198 ----
NM_004804chr242800 2541 1804 156 --1219 --
NM_004808chr1053291 2277 1294 658 362 144 1383 --
NM_004815chr144053 3756 1950 1898 11267 11522 --
NM_004834chr263150 2773 2647 2522 1243 973 13266 ----
NM_004836chr23383 225 191 1838 ----
NM_004840chrX31775 1492 197 11698 --12097
NM_004841chr141056 346 316 94 --1302 --
NM_004842chr651799 1599 1259 495 351 11264 --1160
NM_004845chrX53385 3000 2547 720 444 1259 13477 --
NM_004849chr641635 1334 1327 1103 ------
NM_004857chr1433245 3050 829 33797 3366 253 53974 3766 3059 971 496 11365
NM_004863chr1464853 4717 4327 3971 1946 1836 1196 34263 4051 3897 --
NM_004865chr62296 169 --1314 --
NM_004867chrX3448 192 114 ------
NM_004869chr1831615 1608 80 11130 --1395
NM_004871chr1754276 3746 3196 2921 245 23801 1622 ----
NM_004872chr13294 168 149 ------
NM_004874chr81495 ------
NM_004893chr51155 1212 ----
NM_004896chr10--1229 ----
NM_004897chr102884 742 ------
NM_004898chr442731 2268 1966 962 11855 11904 12648
NM_004904chr766405 5444 4266 1175 1104 765 35551 594 342 16469 --
NM_004905chr13889 653 116 1937 ----
NM_004906chr61640 1238 ----
NM_004912chr711214 11124 ----
NM_004921chr12525 113 1275 --11014
NM_004926chr1411753 11212 ----
NM_004927chr111928 ----11413
NM_004932chr521298 681 ------
NM_004949chr1832078 676 469 --12012 11762
NM_004956chr7104410 3963 3724 2793 1778 1464 1390 1229 740 566 11310 1511 169
NM_004965chr212514 192 ------
NM_004976chr1123641 1007 1250 ----
NM_004985chr1252858 2830 2776 2770 1183 --13089 --
NM_004992chrX88345 7209 6791 6370 5570 1944 1183 280 17149 ----
NM_004992chrX88345 7209 6791 6370 5570 1944 1183 280 17149 ----
NM_004993chr1421396 1275 ----11523
NM_004999chr694150 3058 2777 1711 1379 733 680 663 309 ----13704
NM_005006chr21743 ------
NM_005010chr721712 476 1558 --1588
NM_005011chr721685 1216 1115 ----
NM_005020chr71582 ------
NM_005027chr1911211 ------
NM_005028chr101851 ------
NM_005034chr82576 67 1629 ----
NM_005037chr31144 ----1206
NM_005045chr72858 47 ------
NM_005054chr221388 633 --1624 --
NM_005056chr1265393 4114 3460 998 652 339 14783 --14850
NM_005063chr1053385 3255 3115 1101 485 --1252 --
NM_005065chr1455409 1753 1658 1491 572 24252 663 ----
NM_005079chr893126 1288 1277 1257 905 704 525 420 322 12765 ----
NM_005095chr122086 1609 --21888 1868 --
NM_005096chrX41265 1168 1098 890 ------
NM_005109chr392142 2056 1682 729 645 626 515 443 58 1594 ----
NM_005112chr42847 712 ------
NM_005116chr2054469 3518 1827 1114 1093 159 24158 233 --
NM_005121chr1783685 3179 2807 2599 1173 986 596 136 --23734 858 --
NM_005134chr182906 347 1646 1621 --
NM_005135chr1543741 3132 2455 716 ------
NM_005139chr42319 131 1330 ----
NM_005149chr111288 21418 267 ----
NM_005156chr9115186 4669 3930 2057 1968 1753 1631 1614 1590 1563 864 35323 3308 1451 --14631
NM_005160chr2255661 4347 1725 1400 218 --16530 15462
NM_005168chr231346 1246 347 ----11189
NM_005171chr1211313 1369 ----
NM_005180chr1071487 1412 1188 550 379 281 195 21120 334 11534 --
NM_005188chr1197623 6690 5941 2879 2851 1898 773 671 315 11278 11300 --
NM_005197chr1486061 5289 5202 5044 4702 4051 2155 301 22465 737 ----
NM_005208chr17193 151 ----
NM_005222chr72919 835 --1673 --
NM_005226chr952224 2191 1979 1612 536 22633 2432 ----
NM_005230chr12--1104 ----
NM_005233chr372091 1776 877 703 665 656 217 --1580 --
NM_005235chr297829 7636 7354 7269 7107 5416 4879 2204 1308 17228 ----
NM_005238chr1143514 2400 2169 878 22564 1314 182 --
NM_005242chr551328 1295 1245 978 379 --1136 --
NM_005245chr42602 516 ------
NM_005249chr14------1808
NM_005252chr144767 756 582 233 ------
NM_005254chr1541254 1135 1011 254 ------
NM_005257chr1811147 2894 157 ----
NM_005259chr21972 11456 1408 --
NM_005277chr4--1624 ----
NM_005279chr23851 116 76 1285 ----
NM_005295chr7--1201 ----
NM_005302chr7------1289
NM_005311chr732167 738 179 22525 630 ----
NM_005324chr1731582 184 84 1204 ----
NM_005329chr1622273 1552 11855 ----
NM_005336chr21102 ------
NM_005339chr484060 3852 3468 3196 2932 1669 993 380 --11729 --
NM_005348chr141332 189 ----
NM_005349chr41465 ------
NM_005358chr1341706 1540 350 52 2725 600 ----
NM_005359chr1894647 4009 2381 2109 2080 1095 707 436 134 65788 4565 2626 2535 2451 800 14927 21964 374
NM_005369chrX1437 ------
NM_005375chr61867 1249 ----
NM_005378chr2------1552
NM_005385chr322517 2055 --21843 130 --
NM_005386chr201789 ------
NM_005388chr93263 58 34 --11585 --
NM_005389chr64739 572 155 93 ------
NM_005398chr1051269 1149 426 89 67 ------
NM_005399chr163813 3473 1676 1667 1226 263 ----11715
NM_005400chr253074 2577 2386 1939 1175 ------
NM_005402chr71110 ------
NM_005406chr1811286 --1128 --
NM_005412chr12--1554 ----
NM_005415chr2------1623
NM_005429chr41284 ------
NM_005433chr1862697 2637 2438 1106 896 336 --1358 --
NM_005436chr1043098 1228 1002 408 13055 --13344
NM_005455chr141859 1539 1299 229 ------
NM_005458chr922456 662 ------
NM_005460chr51490 1410 --151
NM_005475chr1243273 3225 233 213 --13290 --
NM_005476chr931399 1091 954 --11240 --
NM_005487chr2242043 1689 1605 836 --145 --
NM_005494chr73545 220 175 ------
NM_005497chr1725345 4674 1988 --16067
NM_005499chr192670 145 --2580 64 --
NM_005502chr942961 2940 2900 2013 --2721 474 12666
NM_005504chr1256555 6483 5229 2629 146 55415 4487 2634 2407 1691 16167 --
NM_005509chr511668 11488 ----
NM_005517chr141465 1396 151 129 1589 ----
NM_005520chr5--1556 1257 --
NM_005522chr71509 11179 --1891
NM_005536chr831109 1045 32 ----1945
NM_005537chr133951 707 432 --161 --
NM_005539chr1021061 910 ------
NM_005559chr18------136
NM_005561chr13--2211 190 ----
NM_005570chr1831078 1035 78 ------
NM_005578chr364853 3480 3331 541 347 164 --23923 3393 --
NM_005595chr11845 ----1964
NM_005596chr935997 1571 358 24753 4000 36347 4689 4389 15121
NM_005598chr12277 246 --11266 1224
NM_005600chr11229 ------
NM_005604chr631893 1001 98 ------
NM_005611chr1631241 1116 841 ----11217
NM_005613chr141665 1533 762 293 ------
NM_005614chr71758 --1324 --
NM_005618chr61239 1615 ----
NM_005626chr11550 ----1135
NM_005627chr61747 --1663 --
NM_005638chrX4572 471 421 301 1258 --1396
NM_005647chrX73478 3137 2811 1220 877 648 458 --12556 --
NM_005650chr2211244 ------
NM_005651chr42292 103 ------
NM_005655chr841196 1147 329 315 11079 ----
NM_005665chr154869 3149 3138 1625 496 44363 4280 3067 1653 ----
NM_005668chr594600 4573 3824 3325 2914 1712 1479 1397 1213 13408 24480 4464 --
NM_005669chr541994 1891 1689 263 ------
NM_005704chr11955 ------
NM_005711chr52821 257 ------
NM_005717chr121250 1053 --2402 44 --
NM_005722chr2--41804 903 169 158 12227 --
NM_005725chr151602 795 283 263 114 11532 ----
NM_005733chr51244 ------
NM_005734chr111734 1574 ----
NM_005737chr2----11843 --
NM_005742chr21201 1693 ----
NM_005744chr151132 1139 ----
NM_005746chr722606 342 --12538 --
NM_005748chr1263317 2651 883 582 151 141 --32165 520 444 --
NM_005752chr1631231 1047 461 1155 ----
NM_005754chr541178 940 836 461 1929 ----
NM_005756chrX41257 1231 1150 1103 --11111 --
NM_005759chr254772 3351 3135 1070 731 34407 1030 736 ----
NM_005765chrX--154 ----
NM_005789chr17165 ------
NM_005795chr232704 2469 1940 22094 628 1609 11852
NM_005798chr13115117 4957 4796 4440 4223 3873 3491 3257 2107 330 33 15255 143 13212
NM_005807chr11177 ------
NM_005808chr332557 996 866 12866 ----
NM_005813chr232144 641 56 12206 12339 --
NM_005819chr13795 592 337 2864 303 2848 475 --
NM_005822chr682083 1701 1603 1461 928 891 814 124 ------
NM_005826chr11110 --1521 --
NM_005828chr1784733 4497 3685 3650 1550 489 361 110 ------
NM_005829chr1531224 769 455 11919 1573 --
NM_005832chr331077 930 390 131 11162 --
NM_005836chr8------134
NM_005839chr1----1112 166
NM_005840chrX87218 5346 5269 2512 2310 2167 1597 739 17694 12231 --
NM_005842chr134714 606 177 124 ------
NM_005843chr211319 ------
NM_005859chr541532 1458 1150 532 ----1426
NM_005868chr741882 832 595 264 ----2908 125
NM_005871chr10186 1922 ----
NM_005875chr31259 ------
NM_005880chr1611132 ------
NM_005891chr6----1195 --
NM_005898chr1142412 2224 2018 873 --11024 13144
NM_005901chr18178559 8474 7976 7661 6462 6374 6122 5819 5595 5561 5281 5273 3139 2238 1758 1435 1160 48077 7569 5448 1835 11259 --
NM_005902chr1534290 1495 89 ----14565
NM_005903chr595218 4286 3912 3676 3228 2057 1135 792 470 15224 24435 31 --
NM_005906chr651681 1142 453 394 32 ------
NM_005909chr542953 2902 2748 651 23499 173 --1180
NM_005933chr1132569 2283 243 11089 ----
NM_005934chr1912570 12598 ----
NM_005935chr435259 4855 599 --15237 14590
NM_005941chr843698 1568 798 145 34145 4094 2853 ----
NM_005944chr331213 1078 1030 --1759 --
NM_005955chr165441 4933 4031 1760 1641 414 15148 13615 --
NM_005962chr1032210 2107 1890 --1680 21565 1548
NM_005962chr1032210 2107 1890 --1680 21565 1548
NM_005964chr172226 175 ------
NM_005966chr262241 2156 1764 1732 1574 772 ------
NM_005967chr121723 ------
NM_005968chr19--159 ----
NM_005977chr13158 2152 65 1223 --
NM_005986chr1352371 1087 493 443 387 1518 ----
NM_006007chr964032 3361 3277 3173 2842 163 ----1718
NM_006011chr1534313 4015 1516 23694 116 ----
NM_006015chr121050 482 ------
NM_006016chr631665 1592 607 11566 ----
NM_006036chr252151 2139 1601 629 344 ------
NM_006037chr261946 1749 1575 1525 1109 689 --1903 --
NM_006039chr1711082 ------
NM_006040chr1631417 1320 92 ------
NM_006047chr20113394 2262 2215 1024 811 571 543 525 436 100 64 --33306 185 42 --
NM_006060chr763568 3518 3158 3059 1730 757 11200 13702 --
NM_006070chr32156 129 ------
NM_006079chr6--1829 1170 --
NM_006080chr732674 1896 819 13008 --11939
NM_006089chrX11241 --11592 --
NM_006090chr12566 527 ------
NM_006095chr463568 1330 1256 784 751 682 22897 221 24509 3755 --
NM_006100chr32224 115 ------
NM_006106chr1163247 3212 2988 2974 2768 243 --23412 166 1184
NM_006108chr1152209 2059 1698 939 445 1956 11995 --
NM_006134chr2141569 1349 387 33 --11330 --
NM_006135chr121188 99 ------
NM_006141chr1612207 1202 22484 559 --
NM_006147chr13456 337 64 1487 ----
NM_006148chr1722633 2244 11868 ----
NM_006152chr121235 1241 ----
NM_006153chr33237 224 98 ------
NM_006154chr1511062 22314 659 ----
NM_006158chr861557 1419 1236 454 445 219 ------
NM_006159chr12--1115 ----
NM_006162chr1861791 1348 1314 1291 1159 454 ------
NM_006164chr21412 ------
NM_006166chr1242451 2383 503 250 --11825 --
NM_006178chr1711596 11543 ----
NM_006180chr931796 566 380 11821 ----
NM_006190chr24781 437 366 253 ------
NM_006192chr201823 1888 ----
NM_006194chr1441233 1217 1120 394 ------
NM_006195chr91241 ------
NM_006197chr861963 1919 1532 669 475 428 --11606 12056
NM_006203chr5105426 4757 4114 3501 1323 1235 1138 925 795 49 ----15320
NM_006209chr82359 56 ------
NM_006211chr82237 93 ------
NM_006212chr1105430 5131 5061 4751 3682 3553 3281 1669 1623 1064 ----24062 2022
NM_006218chr31277 ------
NM_006226chr261333 1257 1197 968 420 378 ------
NM_006241chr341589 924 64 28 ----12349
NM_006243chr11975 ------
NM_006246chr1431297 1180 235 --1292 --
NM_006251chr543273 2947 2098 971 11262 22625 1080 12399
NM_006252chr1167568 7387 7279 7018 6793 6070 5944 5741 5420 4617 2386 2353 2078 1383 1019 355 --36011 5193 2334 --
NM_006256chr122173 1720 --1770 --
NM_006258chr102353 270 21275 32 ----
NM_006259chr42928 310 2743 281 ----
NM_006264chr41537 ------
NM_006265chr841502 1483 1466 1454 --11338 --
NM_006267chr211794 1269 ----
NM_006275chr2042279 1852 1840 484 12038 12080 --
NM_006281chr82818 310 1811 ----
NM_006281chr82818 310 1811 ----
NM_006282chr20154707 4486 4304 4173 3365 2909 1789 1715 1600 1299 960 924 893 335 76 11316 ----
NM_006283chr843687 1958 1092 153 1909 24677 453 11946
NM_006287chr262379 2213 997 181 159 134 1175 --11043
NM_006300chr1982449 2304 1913 1681 396 245 170 136 11539 1643 --
NM_006306chrX31816 1646 1411 --22016 1732 11486
NM_006310chr1711300 ------
NM_006313chr1241331 1214 1067 271 ------
NM_006315chr494505 4393 4332 3918 1705 1623 1008 935 821 22879 874 12951 --
NM_006323chr42622 603 198 ----
NM_006325chr123821 296 189 ------
NM_006329chr142255 236 ------
NM_006343chr2--1140 ----
NM_006353chr631203 239 115 ------
NM_006359chrX21639 592 11739 2962 886 --
NM_006364chr1441259 1253 1218 98 ------
NM_006366chr641334 1241 1169 973 1888 2469 351 --
NM_006371chr355323 5000 4317 3855 1991 25191 1735 24905 1218 --
NM_006377chr921232 969 21239 446 11260 --
NM_006380chr1743300 2993 1455 1348 23620 698 --14385
NM_006386chr2242326 1971 1827 421 --1568 1692
NM_006389chr112392 361 ----11370
NM_006393chr1084545 4215 4033 3517 2975 2868 1403 1347 ----24558 4296
NM_006403chr61414 21654 386 ----
NM_006415chr911033 11087 21233 120 --
NM_006420chr2043048 2923 2865 2552 22131 564 ----
NM_006421chr81432 --1914 --
NM_006434chr1023246 2492 --13045 1847
NM_006451chr52947 287 ------
NM_006459chr1031714 1698 617 11373 ----
NM_006464chr284472 3458 3204 3052 1754 1719 1206 247 13887 ----
NM_006466chr202744 126 ------
NM_006467chr552318 2203 2050 1801 125 12337 22182 359 --
NM_006482chr1273906 3097 2612 1275 919 830 732 --12734 147
NM_006489chr14126 ------
NM_006504chr1042458 1888 756 119 22878 152 ----
NM_006520chrX41688 1640 1465 1075 ------
NM_006526chr2032106 1742 586 ----1602
NM_006534chr2063323 3155 1078 530 331 79 33414 2730 1307 --12836
NM_006544chr1485809 5582 5507 4656 3721 1874 427 301 ----1467
NM_006546chr1786660 6542 5769 4786 2432 2405 532 263 11736 1502 --
NM_006547chr73601 385 55 ----21788 403
NM_006557chr941560 1133 367 346 1538 --11714
NM_006558chr81195 ------
NM_006559chr13358 78 44 1390 ----
NM_006561chr10106025 5909 5868 5468 4861 3977 3801 2157 1242 128 35677 1235 682 21271 258 --
NM_006565chr1631115 866 180 ------
NM_006571chr81245 ------
NM_006572chr1772880 2811 1146 968 939 545 200 11038 ----
NM_006574chr31238 1101 ----
NM_006575chr1421154 490 1399 --11161
NM_006577chr21990 1409 ----
NM_006585chr21----1141 --
NM_006595chr1131367 624 505 ------
NM_006597chr11128 ------
NM_006599chr16117618 7170 6429 5195 2408 2285 2161 1997 1569 664 401 48204 7878 6068 5627 66660 5187 2919 2418 342 269 23144 2847
NM_006603chrX1471 --11614 --
NM_006609chr2--23003 616 ----
NM_006614chr3103484 3398 3053 2721 2239 1183 1100 782 343 210 --12248 --
NM_006622chr5--1490 ----
NM_006624chr1041964 1691 1610 80 1162 ----
NM_006625chr12962 739 ------
NM_006625chr12962 739 ------
NM_006625chr12962 739 ------
NM_006628chr1574090 3756 3064 3037 1445 989 941 24597 1297 --14297
NM_006629chr1812110 ----12499
NM_006633chr51786 1165 ----
NM_006640chr1721845 1807 ------
NM_006646chr1341977 422 334 124 11903 12174 --
NM_006653chr62392 99 ------
NM_006654chr1251351 956 805 791 604 ----24784 376
NM_006667chrX31009 953 113 ------
NM_006670chr62673 146 ------
NM_006682chr772895 2478 1071 322 303 289 189 ------
NM_006699chr142424 861 440 287 ------
NM_006713chr52835 736 ------
NM_006717chr952926 2408 2224 1049 73 --13005 11102
NM_006718chr61896 1756 ----
NM_006722chr31948 ------
NM_006726chr421212 891 --1137 --
NM_006729chrX75275 4620 4143 1965 1137 1028 916 15231 --1668
NM_006731chr965513 5494 4671 4564 3582 1781 15599 --14770
NM_006734chr641122 535 135 117 ------
NM_006750chr16148121 5561 5376 4920 2982 2718 2652 1098 844 775 458 356 319 300 --16656 --
NM_006751chr22400 87 1969 ----
NM_006754chr761204 1181 927 885 494 132 ------
NM_006756chr821156 1038 31543 1113 1012 ----
NM_006759chr22303 233 ------
NM_006761chr171840 1563 ----
NM_006763chr152138 1767 1333 753 643 ------
NM_006766chr821928 1066 --1105 1556
NM_006772chr631777 1611 471 ------
NM_006775chr663036 2901 2242 2132 864 169 12295 12766 --
NM_006777chrX32396 2112 1070 12528 11118 --
NM_006788chr1842121 1462 1360 854 1264 ----
NM_006791chr153628 510 480 --1205 --
NM_006811chr201735 ------
NM_006813chr62230 199 ------
NM_006815chr1211195 ------
NM_006826chr2--1927 1893 --
NM_006828chr61460 ------
NM_006832chr1421036 65 ------
NM_006838chr1231848 1813 385 ------
NM_006851chr1232954 2914 526 --12068 --
NM_006852chr1732852 719 515 32746 1071 1050 ----
NM_006868chr1832974 417 294 22355 266 ----
NM_006870chr20154 2747 252 ----
NM_006873chr231291 1193 378 ----12417
NM_006874chr41826 --1370 --
NM_006884chr3--1375 ----
NM_006885chr16144063 4051 3076 2970 2861 2789 2680 1686 1604 866 555 540 437 417 2608 468 ----
NM_006888chr1443359 3241 1064 635 1278 1805 12160
NM_006897chr121616 ------
NM_006908chr72342 131 11469 ----
NM_006914chr921183 359 ------
NM_006915chrX6974 681 491 425 391 137 12581 ----
NM_006918chr1155880 5748 5148 4291 431 35831 4548 3840 --45784 4597 1211 935
NM_006920chr221839 37 31624 1562 421 ----
NM_006922chr272398 2055 1582 853 816 206 35 --11944 11951
NM_006924chr1773949 3888 3531 1395 892 624 211 ----12763
NM_006925chr142519 454 175 ----
NM_006930chr521769 733 1209 --1771
NM_006936chr2121224 476 11200 31122 205 42 1889
NM_006940chr1241604 1331 1279 641 ------
NM_006947chr411121 11206 --11596
NM_006948chr2122426 828 --21572 814 --
NM_006965chr1811126 1921 ----
NM_006981chr942933 1073 372 51 --21957 1864 1279
NM_006988chr211276 ------
NM_006996chr111670 ------
NM_006999chr531290 426 337 11424 ----
NM_007005chr961554 1262 1161 521 512 160 ------
NM_007007chr1254623 1789 1734 949 196 31441 725 350 ----
NM_007008chr21120 --1841 --
NM_007011chr1596885 5965 5576 4437 4278 2723 1496 590 277 1620 1219 11021
NM_007013chr82399 183 1369 ----
NM_007017chr51924 1744 ----
NM_007023chr22947 885 1270 ----
NM_007033chr131702 632 588 ----155
NM_007034chr12982 643 ------
NM_007036chr5145 2231 204 ----
NM_007038chr2195490 5068 4656 4553 4304 1803 1784 1757 556 24071 3850 --21601 1167
NM_007039chr143896 513 468 1864 ----
NM_007042chr331932 1729 1067 1671 2692 532 --
NM_007045chr61561 ------
NM_007047chr622476 569 22541 71 ----
NM_007054chr531114 214 205 ------
NM_007068chr222858 23 ----11044
NM_007078chr1032500 1225 470 11944 ----
NM_007111chr134741 255 232 155 2314 305 ----
NM_007114chr332573 2562 138 ----12462
NM_007124chr621568 208 1685 11487 --
NM_007129chr132915 781 195 ----
NM_007137chrX65337 4412 4340 3962 3512 900 35318 3716 986 33542 1587 303 11849
NM_007146chr1782316 1922 1826 985 885 669 464 237 22032 761 ----
NM_007147chr193916 847 322 ------
NM_007159chr351665 1617 1446 502 139 11072 ----
NM_007166chr1131587 1541 1371 --1214 --
NM_007172chr2273234 3206 2587 2476 2463 2062 38 ------
NM_007173chr1141467 682 520 67 ------
NM_007175chr823480 830 13535 ----
NM_007178chr121465 ------
NM_007185chr111095 ------
NM_007191chr122456 439 152 ----
NM_007192chr141263 ------
NM_007195chr1833637 2566 1452 --1907 --
NM_007197chr1231049 665 346 ----1873
NM_007203chr953791 2911 2770 1397 311 23256 1155 ----
NM_007204chr14653 503 225 159 ------
NM_007207chr11862 --127 --
NM_007214chr641354 1277 257 52 ------
NM_007220chrX21763 665 13090 24001 3916 24941 66
NM_007222chr821775 1567 --1455 11588
NM_007235chr122212 101 ----1345
NM_007236chr1542445 2115 840 775 --12045 12160
NM_007249chr13119466 9270 9231 8170 8045 7211 1698 1684 662 323 249 ------
NM_007283chr343009 581 466 161 ----12955
NM_007292chr1745044 4990 4971 1518 1561 --2684 344
NM_007294chr1731129 1026 922 21204 1169 ----
NM_007295chr1731129 1026 922 21204 1169 ----
NM_007296chr1731129 1026 922 21204 1169 ----
NM_007297chr1731129 1026 922 21204 1169 ----
NM_007298chr1731129 1026 922 21204 1169 ----
NM_007299chr1731129 1026 922 21204 1169 ----
NM_007300chr1731129 1026 922 21204 1169 ----
NM_007302chr1731129 1026 922 21204 1169 ----
NM_007303chr1731129 1026 922 21204 1169 ----
NM_007304chr1731129 1026 922 21204 1169 ----
NM_007305chr1731129 1026 922 21204 1169 ----
NM_007324chr1--198 ----
NM_007345chr1831877 1526 197 ----11557
NM_007358chr151998 1479 753 540 399 ------
NM_007363chrX2866 200 ------
NM_007372chr171654 1779 --1678
NM_007373chr1031365 478 393 21236 204 21479 1132 --
NM_007375chr122344 196 ----12121
NM_012069chrX32265 788 260 --12543 --
NM_012073chr51496 21256 1010 187 --
NM_012081chr563703 3087 2975 651 307 68 1225 23066 910 --
NM_012082chr83995 956 707 ------
NM_012090chr151179 1084 834 506 386 1960 --195
NM_012096chr373726 3497 2674 2280 1248 594 402 --12328 --
NM_012097chr222050 1805 ------
NM_012102chr132513 2234 1019 ------
NM_012104chr1133762 2992 472 ------
NM_012104chr1133762 2992 472 ------
NM_012115chr61132 ------
NM_012120chr672701 2640 878 787 697 246 72 12944 --1749
NM_012124chr113956 916 70 --1759 --
NM_012129chr722470 2198 22313 1921 --22330 22
NM_012137chr11146 2802 206 12570 --
NM_012141chr1344062 3808 500 100 1653 --21665 1638
NM_012153chr1142194 1628 452 181 32516 457 330 ----
NM_012158chr132138 65 ----11152
NM_012164chr987357 6971 5323 5140 4700 1847 1414 434 27057 1800 ----
NM_012175chr114745 165 119 81 ------
NM_012180chr41569 ------
NM_012193chr1175423 4544 4291 1620 1261 1053 183 13496 --15314
NM_012199chr183542 3465 3276 2986 1613 1601 1467 596 ------
NM_012207chr1011089 ------
NM_012214chr296309 5701 5684 5413 4451 2255 1854 1047 997 142 24129 292 --
NM_012215chr1021926 1323 ------
NM_012218chr1933095 215 125 1350 ----
NM_012223chr231187 1130 843 ------
NM_012234chr332513 894 211 23414 3376 --13175
NM_012238chr1031359 140 30 ------
NM_012242chr101293 --1321 --
NM_012247chr1011036 --1236 --
NM_012249chr283064 2976 2728 2486 2464 2314 420 403 12880 13081 --
NM_012250chr1121048 858 1456 11173 --
NM_012252chr785055 4984 4415 3378 2015 1866 1251 83 14949 15244 15215
NM_012255chr202394 164 ------
NM_012262chr165127 4938 3818 3779 3335 1652 1515 35214 4701 3446 185
NM_012281chr712350 11825 ----
NM_012286chrX2498 191 ------
NM_012287chr3104348 4207 4191 3661 3540 3517 1558 1264 928 752 14124 11021 --
NM_012289chr19152 ------
NM_012290chr21353 21300 1040 ----
NM_012294chr762883 2756 753 706 277 72 42533 1369 872 97 ----
NM_012297chr462564 2311 1757 927 599 456 22401 63 22519 960 1194
NM_012300chr551587 807 560 367 287 12227 12524 12459
NM_012301chr721974 489 ------
NM_012302chr121155 220 ------
NM_012307chr181761 ------
NM_012309chr1133297 1919 37 13066 ----
NM_012316chr123981 599 24475 4077 11953 --
NM_012325chr2031520 1342 78 ------
NM_012328chr7----1496 11073
NM_012329chr1751706 1491 1238 1109 378 11230 ----
NM_012330chr1021572 470 1592 --1658
NM_012333chr131306 1178 608 ------
NM_012347chr632392 269 171 12934 ----
NM_012382chr563988 3638 1703 1613 1286 421 --1708 24449 1172
NM_012388chr1521176 592 1433 ----
NM_012394chr1--1103 ----
NM_012395chr753350 2904 2178 749 569 ------
NM_012399chr2211400 11498 --11771
NM_012416chr91275 --11253 --
NM_012428chr152677 236 1255 ----
NM_012431chr753256 2878 1163 952 212 12984 --13034
NM_012432chr1167 ------
NM_012449chr7--174 ----
NM_012464chr452836 2588 1847 937 923 12810 12855 22846 432
NM_012482chr13598 500 147 --1562 --
NM_012486chr12454 417 ------
NM_013229chr1242857 2673 1966 101 ----12100
NM_013230chrY31397 547 495 --1559 --
NM_013231chr1454236 3958 2817 1083 344 44356 3072 2784 253 ----
NM_013233chr251409 1245 988 406 261 ----21353 939
NM_013257chr83409 397 284 ------
NM_013261chr443699 2791 1499 1145 13269 22902 1056 --
NM_013269chr1254335 3883 3198 974 688 11382 ----
NM_013280chr111223 ------
NM_013282chr192817 351 21115 33 ----
NM_013283chr53864 853 317 ------
NM_013293chr72196 153 1590 ----
NM_013305chr181125 ------
NM_013309chr1511993 --2574 440 --
NM_013316chr72430 302 ------
NM_013320chr121129 1148 ----
NM_013322chr721197 1191 1411 ----
NM_013341chr222813 748 1496 ----
NM_013354chr821019 231 ------
NM_013357chr82808 105 ------
NM_013361chr194593 578 162 138 ------
NM_013372chr1533271 2863 2642 13389 ----
NM_013374chr352774 907 736 504 190 22717 2698 43069 2883 795 494 --
NM_013380chr192169 87 --1318 --
NM_013386chr121655 725 11607 ----
NM_013400chr71829 --2956 940 --
NM_013411chr121958 405 12256 ----
NM_013433chr1911977 11593 ----
NM_013437chr871276 1056 1017 1011 939 253 221 21303 434 ----
NM_013438chr921541 399 ----11662
NM_013446chr721393 1287 ------
NM_013448chr142177 43 ------
NM_013449chr1232869 1137 1078 1285 ----
NM_013450chr22935 494 ------
NM_013943chr161138 869 780 597 590 504 --23290 485 1364
NM_013989chr1453512 2028 1389 780 28 14138 ----
NM_013995chrX42614 1613 787 676 --1502 22116 1673
NM_014000chr1061925 1632 543 479 460 85 --1443 --
NM_014007chr92396 90 ------
NM_014011chr272364 2112 2086 979 911 780 298 2895 26 ----
NM_014021chr153428 3286 2663 2587 1287 ------
NM_014028chr662439 2406 1174 1049 701 417 11311 1457 --
NM_014043chr331665 1460 411 21637 338 11384 --
NM_014048chr1635116 4787 94 24543 1976 --1922
NM_014056chr33644 343 80 21682 749 12356 --
NM_014089chr1322278 2189 1406 ----
NM_014112chr894443 2052 2039 1962 1910 1746 1311 429 140 25294 4155 24320 1872 --
NM_014117chr1642673 2258 2175 1877 ------
NM_014153chr161628 2512 452 ----
NM_014154chr32392 349 11452 ----
NM_014155chr1177380 7369 6540 5878 2262 1561 458 15400 22540 1016 1558
NM_014157chr162855 236 13871 --13925
NM_014170chr3189 ------
NM_014181chr262898 937 908 818 790 512 22887 2706 ----
NM_014191chr122970 56 ------
NM_014211chr531721 430 161 ------
NM_014217chr141373 601 317 69 11772 11493 --
NM_014228chr511114 ----11429
NM_014243chr42535 159 1251 11840 --
NM_014248chr223122 37 31 ------
NM_014249chr151528 ------
NM_014250chr2242043 1689 1605 836 --145 --
NM_014251chr71793 --1594 --
NM_014253chrX31616 583 164 22416 565 --11961
NM_014263chr1031005 548 27 11216 ----
NM_014267chr11----145 --
NM_014268chr1821389 1000 ------
NM_014278chr41356 --2461 177 --
NM_014279chr91683 1824 ----
NM_014280chr13941 651 377 ------
NM_014283chr141325 1280 1195 444 ------
NM_014294chr831203 335 116 --1170 --
NM_014296chr32631 413 1314 11006 --
NM_014309chr2255366 4728 4477 2062 973 --11367 --
NM_014317chr101262 ------
NM_014319chr1231546 489 469 11246 ----
NM_014333chr1162507 2220 1854 702 626 144 --11794 --
NM_014342chr1121465 918 --1540 --
NM_014345chr63838 401 82 21001 249 ----
NM_014350chr541021 442 434 390 ------
NM_014361chr11--1352 ----
NM_014363chr1341226 295 141 118 --159 2949 101
NM_014372chr141818 1618 411 252 22101 796 11712 11905
NM_014374chr71829 --2956 940 --
NM_014379chr84976 789 428 136 2943 127 ----
NM_014382chr321557 662 --11476 --
NM_014392chr431072 156 118 1130 ----
NM_014393chr872273 2155 2096 1602 1582 942 206 --1450 11731
NM_014395chr451972 1953 1662 1389 170 1159 ----
NM_014399chr71741 1180 --1844
NM_014415chr341638 1475 1085 225 ----11251
NM_014421chr421864 435 ----41501 495 465 356
NM_014423chr5105076 4750 4343 4090 3415 1897 1593 1458 1340 1087 33812 2077 872 --23700 1724
NM_014445chr322363 622 1355 21780 1538 1238
NM_014447chr441685 1449 1233 37 11050 ----
NM_014456chr1041674 1626 1314 63 ------
NM_014458chr111371 --11094 --
NM_014469chr11------1201
NM_014478chr742119 1815 774 76 ------
NM_014487chr41457 --1253 --
NM_014488chr112591 264 ------
NM_014494chr1632384 1882 1719 ----12356
NM_014497chr2166 ------
NM_014500chrX--1243 ----
NM_014515chr122662 387 ------
NM_014517chr341988 1928 1535 311 ------
NM_014521chr21368 1228 ----
NM_014552chr221025 957 --11424 --
NM_014554chr1252118 1983 1967 1766 370 ----11565
NM_014570chr224935 657 108 102 1833 ----
NM_014572chr1311700 ------
NM_014575chr3--172 1213 --
NM_014577chr22165 ------
NM_014585chr241234 1161 1071 980 ------
NM_014606chr4------21451 1129
NM_014607chr22554 34 1772 ----
NM_014608chr152435 221 ------
NM_014612chr931202 1096 1086 11275 ----
NM_014613chr521100 749 12272 11234 12814
NM_014614chr221113 546 ------
NM_014615chr16----43619 1196 845 713 --
NM_014616chr3--2529 297 --12488
NM_014620chr121542 ------
NM_014629chr8--1498 ----
NM_014635chr231356 597 451 --1588 --
NM_014636chr974311 4293 4270 2687 1165 769 425 ----13913
NM_014644chr11701 1915 --1992
NM_014647chr1611883 1242 21999 1924 --
NM_014659chr15------1430
NM_014660chr73807 310 204 11077 ----
NM_014663chr111067 ------
NM_014666chr511190 ----11048
NM_014667chr332038 767 608 11869 12044 --
NM_014670chr271497 1222 1011 617 539 376 155 11519 ----
NM_014673chr8--1291 ----
NM_014682chr852037 1973 1887 688 446 11953 11679 --
NM_014683chr1731777 1535 823 1390 ----
NM_014701chr1552664 2155 1269 400 144 --13050 --
NM_014702chr622122 1110 --12495 --
NM_014705chr752121 1843 584 577 542 1168 11544 --
NM_014707chr742248 2073 1571 1531 ------
NM_014709chr21564 --1600 --
NM_014711chr1611496 ------
NM_014713chr22352 345 1185 ----
NM_014717chr191677 178 --1869
NM_014720chr1051830 1576 1322 1288 1185 --11840 --
NM_014721chr6147380 7059 7028 6658 6331 6085 5587 5570 5076 1758 1424 1338 1306 215 --34987 1083 370 --
NM_014729chr882019 1607 1524 876 722 261 204 62 1112 ----
NM_014730chr1275284 4231 3755 2124 1000 707 619 ------
NM_014730chr1275284 4231 3755 2124 1000 707 619 ------
NM_014733chr542071 2014 1805 705 143 ----
NM_014735chrX12012 22055 1480 --1332
NM_014741chr1121548 766 11724 11376 --
NM_014743chr452571 2319 2299 1262 27 21081 655 1831 --
NM_014751chr842168 2065 1595 1561 ------
NM_014752chr1111669 3372 263 41 ----
NM_014755chr273888 3745 2765 1447 1260 1069 586 11310 13709 --
NM_014757chr532397 2088 1916 ----12262
NM_014764chr121428 ------
NM_014765chr152679 1922 730 402 98 ------
NM_014772chr1852834 2728 2455 723 445 ------
NM_014774chr143086 2978 2885 2853 ----1540
NM_014779chr31876 ------
NM_014781chr821154 1140 --2969 948 --
NM_014783chr1521413 552 ----1101
NM_014790chr5150 ------
NM_014791chr91246 ------
NM_014795chr2----2417 50 1181
NM_014802chr1231105 873 388 1764 ----
NM_014803chr1052237 2120 1078 937 626 22767 2456 --11914
NM_014810chr132978 1282 969 23659 255 ----
NM_014812chr151976 1950 1749 1475 643 1424 ----
NM_014819chr552447 2371 2328 834 465 21854 1717 --12390
NM_014820chr32131 124 ------
NM_014826chr174377 3864 3494 3247 815 477 253 11656 --13224
NM_014827chr121205 214 ------
NM_014828chr1422008 183 ----11813
NM_014830chr1243896 3384 2797 2767 --13808 --
NM_014832chr1341740 1598 1468 211 1744 12112 --
NM_014835chr2022195 1980 1628 ----
NM_014836chr1062033 1923 1303 251 155 89 ------
NM_014839chr122324 850 32500 2301 535 --12124
NM_014840chr1242418 821 723 86 1716 ----
NM_014859chr1711407 ------
NM_014871chr122664 170 ------
NM_014872chr931751 882 728 ------
NM_014873chr173994 3888 3658 3586 1786 1506 1194 --12954 --
NM_014874chr151903 1819 1799 301 188 --11200 --
NM_014877chr17106814 6576 6557 6394 2924 1232 1034 801 138 132 15262 1253 --
NM_014881chr102113 52 ------
NM_014883chr452467 2314 2062 506 443 --11785 11568
NM_014887chr131772 1153 ----
NM_014890chr31340 ------
NM_014892chr61173 ------
NM_014893chrY42052 1957 1660 930 ------
NM_014899chr542434 1153 368 267 ------
NM_014903chr1222390 1868 ----12104
NM_014904chr1093150 3018 2934 2926 2541 2535 1620 657 74 ----11331
NM_014906chr1723422 1243 12490 --11629
NM_014912chr1052947 885 693 559 376 33471 3186 2764 23420 3163 --
NM_014913chr1841525 1492 1430 190 --11385 11128
NM_014918chr151430 1194 --1379
NM_014920chr683754 3258 2963 2701 2685 2660 2329 524 ------
NM_014921chr1923087 2004 12791 1897 --
NM_014923chr1342237 1740 214 70 --1151 --
NM_014924chr1443147 2757 999 481 12579 12224 --
NM_014932chr332011 212 199 --11801 --
NM_014934chr1323838 3678 13435 11211 --
NM_014937chr1021289 984 ------
NM_014939chr18286 46 ----11479
NM_014945chr511983 ------
NM_014946chr252385 2152 945 644 606 12561 ----
NM_014947chr183104 3006 2872 2284 758 626 449 327 22625 96 1838 --
NM_014950chr1431755 1222 352 ------
NM_014951chr1052546 2535 2362 1912 558 --11758 --
NM_014961chr452207 584 509 380 183 ------
NM_014962chr2052877 2471 2171 2098 534 11105 12263 --
NM_014965chr312357 ------
NM_014974chr1051830 1761 1255 412 48 31790 1230 331 1478 --
NM_014978chr1031836 1786 1456 ------
NM_014988chr452469 1840 1778 968 181 ------
NM_014989chr631599 817 86 11552 1150 --
NM_014990chr141360 ----11083
NM_014999chr1231688 1424 1164 --11086 --
NM_015000chr1253133 2734 1935 1211 991 23025 217 --13101
NM_015008chr383593 2928 2898 2641 2629 2231 998 22 11313 23415 844 --
NM_015015chr1941452 471 369 71 ------
NM_015017chr111071 11295 ----
NM_015018chr61186 ------
NM_015020chr1663899 3218 2615 2548 702 59 --13200 --
NM_015024chr821446 1255 ------
NM_015025chr262638 2613 2470 2175 519 57 --22285 1047 --
NM_015026chr1233159 1183 608 44503 2971 773 475 11869 --
NM_015027chr163429 209 38 11350 11412 11336
NM_015032chr1352752 2656 2606 2211 378 --22898 2482 12473
NM_015039chr144333 3594 2978 1489 21180 115 11612 --
NM_015042chr1564231 3790 3620 3406 3376 2695 ------
NM_015045chr1021498 1457 1172 12276 --
NM_015049chr253236 2991 2439 415 334 ----12842
NM_015052chr711185 11014 ----
NM_015061chr9191 --1675 --
NM_015068chr753431 1547 1495 873 366 33958 2677 1599 43971 3922 3620 2563 12909
NM_015071chr572144 1754 1603 1569 1370 434 117 26038 5259 --11779
NM_015074chr184903 4420 4325 4167 1940 1889 1866 169 23349 2003 21396 1048 13817
NM_015087chr1322271 593 2300 57 1670 12692
NM_015092chr16113354 3134 3087 3025 2940 1825 1508 1334 1096 801 485 14417 --11424
NM_015093chr61453 1729 ----
NM_015100chr111551 ----1456
NM_015115chr453006 891 175 163 138 --32170 263 69 --
NM_015132chr71642 ------
NM_015137chr862321 2309 2052 789 518 357 --22413 2255 12292
NM_015144chr1643589 1590 948 81 23955 3008 --12866
NM_015156chr1463950 3013 2812 1317 975 928 24017 3694 ----
NM_015158chr92235 52 ------
NM_015161chr161342 --11355 --
NM_015170chr811866 11454 11590 --
NM_015176chr11452 ------
NM_015185chrX62899 2674 932 704 433 351 1362 ----
NM_015186chr91337 ------
NM_015192chr2022813 438 2575 537 ----
NM_015198chr721284 1086 21249 246 ----
NM_015199chr322649 248 ------
NM_015200chr43753 634 284 --1964 --
NM_015203chr1168 ------
NM_015206chr1533549 2363 1371 13392 23149 462 --
NM_015208chr1843435 1429 1093 308 --1104 12988
NM_015209chr11789 1281 ----
NM_015215chr1138 --22874 2868 11077
NM_015231chr111177 ----1688
NM_015234chr611325 --21077 179 --
NM_015238chr51165 ------
NM_015239chr9--122 ----
NM_015245chr642734 2490 901 270 ----12604
NM_015247chr1624176 156 45341 3356 1361 497 ----
NM_015250chr91311 11530 11733 --
NM_015263chr1521191 436 1344 ----
NM_015265chr242620 2112 838 76 22687 2166 12661 --
NM_015268chr3--1745 ----
NM_015269chr11417 ------
NM_015271chr442952 2778 1715 1089 ------
NM_015272chr1622136 1950 ------
NM_015275chr1242112 1576 635 89 --11638 31334 569 48
NM_015277chr1821663 1302 ------
NM_015278chr683346 3320 2928 2773 2258 1228 1216 569 --13260 --
NM_015285chr184490 300 86 61 12211 1539 --
NM_015286chr1532415 2184 594 32467 2193 522 12353 --
NM_015288chr573044 2662 2368 1531 1182 1066 648 33515 3205 2388 1275 --
NM_015289chr1511822 ------
NM_015291chr163429 2860 2657 2234 1181 112 13203 ----
NM_015294chr1721075 53 21156 1103 ----
NM_015296chr13----1803 21256 821
NM_015305chr14----21940 1374 --
NM_015308chr112206 35 ------
NM_015310chr898265 8109 6186 5168 2511 2210 1778 523 145 35765 3103 751 1822 18061
NM_015313chr1174505 4295 3792 3696 1600 1560 871 11003 ----
NM_015314chr742471 1042 577 457 1660 1381 --
NM_015317chr232722 1755 710 11094 1237 --
NM_015323chr621639 1561 --1654 --
NM_015326chr132150 1903 1096 21993 1083 ----
NM_015335chr1222230 1839 1814 ----
NM_015336chr1232591 2083 438 ----131
NM_015344chr8--21506 172 3767 687 658 --
NM_015347chr1272992 2760 2705 2497 1955 815 584 --1345 --
NM_015349chr652985 2905 2668 973 515 --1576 13034
NM_015352chr2083932 3906 3430 2510 1427 1371 742 555 --13783 --
NM_015355chr1741740 1684 730 656 11613 ----
NM_015358chr2121215 196 --11083 --
NM_015359chr842982 2829 2400 1878 ------
NM_015361chr21833 ------
NM_015365chrX64135 3555 1083 954 566 288 1187 24293 3755 --
NM_015378chr112787 32504 377 293 ----
NM_015379chr71284 ------
NM_015385chr1023246 2492 --13045 1847
NM_015387chr231776 1389 812 11684 1273 --
NM_015394chr1261727 809 691 646 427 109 1358 --42441 2215 2063 1751
NM_015396chr331447 1206 475 ----1549
NM_015397chr941890 1618 380 254 1259 11854 --
NM_015419chrX2156 24 1205 ----
NM_015423chr1131540 1377 586 --31707 1332 1318 --
NM_015429chr321027 766 ----1157
NM_015435chr82547 268 ------
NM_015436chr442408 2271 2130 886 12156 ----
NM_015439chr62507 486 ------
NM_015443chr1721221 1012 11471 ----
NM_015446chr11164 11415 ----
NM_015455chr554059 2914 2861 2699 637 12528 ----
NM_015457chr111274 --1332 --
NM_015458chr885107 4865 4753 3223 1779 1624 1250 721 24976 1723 1738 --
NM_015460chr341733 1453 541 305 11548 ----
NM_015461chr182754 582 ----186
NM_015464chr731010 263 59 ------
NM_015475chr231019 775 25 1915 1941 --
NM_015483chr7--157 1275 --
NM_015497chr15----1734 1449
NM_015509chr1221276 176 ------
NM_015520chr322653 1004 --11757 --
NM_015525chr63918 381 247 ----1770
NM_015528chr171192 ------
NM_015532chr1542016 1994 854 88 1920 11751 --
NM_015534chr1------160
NM_015535chr254134 4079 4040 3655 465 --23132 1374 --
NM_015553chr675182 3861 3451 1579 1017 889 310 ------
NM_015554chr1562903 2684 2370 1970 1788 323 --12471 --
NM_015564chr51420 13483 ----
NM_015565chr2132101 1698 181 11837 12151 --
NM_015567chr1341278 1115 1013 272 ------
NM_015569chr134121 299 154 34489 3760 689 --13639
NM_015570chr751734 1714 1531 1479 408 --1580 --
NM_015571chr662356 2156 897 884 241 227 ------
NM_015577chr52677 82 ------
NM_015578chr1932056 1556 1356 ------
NM_015602chr131459 390 46 11133 ----
NM_015607chr1134 ------
NM_015622chr7------1275
NM_015626chr173986 352 322 ----11023
NM_015634chr102530 144 1207 ----
NM_015635chr9193 12213 12156 1581
NM_015640chr185053 4835 4716 4365 1787 1635 1421 813 13939 31955 1196 284 13664
NM_015652chr101617 ------
NM_015675chr194568 555 503 34 ------
NM_015678chr1331417 340 264 ------
NM_015693chr4----1244 3234 129 62
NM_015695chr632041 1374 820 ------
NM_015696chr12523 452 ------
NM_015702chr2123 --1262 --
NM_015716chr17--1750 ----
NM_015844chr182886 682 ------
NM_015846chr182886 682 ------
NM_015847chr182886 682 ------
NM_015850chr862414 1990 826 817 752 226 1531 22056 890 --
NM_015852chr743434 3089 2599 1024 --23324 2565 --
NM_015866chr141251 1234 1141 1051 11202 11476 --
NM_015869chr31144 ----1206
NM_015874chr41465 ------
NM_015878chr822082 1796 ------
NM_015879chr1886909 6853 2772 1565 1513 1018 550 398 18563 1840 28169 6524
NM_015886chr875748 4816 3935 3834 2200 2155 838 32149 1811 1350 14033 24074 1758
NM_015902chr82918 204 2285 147 123 --
NM_015906chr174824 4753 4680 4660 1552 91 26 11021 1287 --
NM_015912chr851699 768 704 658 307 ------
NM_015938chr31215 11028 ----
NM_015980chr541375 300 258 205 11384 ----
NM_015990chr421014 860 --11082 --
NM_015995chr1535536 5146 1999 24164 146 ----
NM_016009chr154825 4409 4383 4359 1048 --21036 1021 24602 4553
NM_016018chr862256 1898 1144 1128 448 303 11961 ----
NM_016021chr672971 2658 2651 2591 2054 499 77 11175 ----
NM_016025chr1631954 1630 356 --11464 --
NM_016037chr131125 986 180 ------
NM_016039chr142149 142 ------
NM_016045chr2031266 1245 68 11841 ----
NM_016048chr53953 916 340 2728 226 ----
NM_016060chr1721108 183 ----1154
NM_016072chr1222275 2171 ------
NM_016073chr1531200 1065 883 ------
NM_016075chr1342599 2439 997 735 --11038 12992
NM_016076chr133169 2644 1200 1494 12030 --
NM_016078chr173857 419 26 ----11040
NM_016083chr633099 1175 936 22692 151 23789 3693 --
NM_016084chr172643 427 148 ----
NM_016087chr7--11141 --11528
NM_016090chr1141014 340 310 22 ------
NM_016096chr831366 763 228 ------
NM_016097chr183985 301 242 ----1281
NM_016101chr1611388 --1310 --
NM_016106chr141203 1130 ----
NM_016107chr52431 361 ------
NM_016120chrX3479 291 124 ------
NM_016124chr131414 1358 1252 ------
NM_016127chr81741 ------
NM_016131chr281971 1952 1843 1806 1564 1532 885 54 32147 687 165 ----
NM_016132chr1553330 2843 2639 1129 998 32618 169 42 ----
NM_016133chr22346 183 --11665 --
NM_016138chr1621161 1126 1114 ----
NM_016147chr1131150 788 176 ------
NM_016152chr311230 ------
NM_016169chr102537 441 11096 ----
NM_016192chr21263 ------
NM_016201chr372328 2285 1753 1549 1471 594 452 --11777 --
NM_016203chr72893 873 ------
NM_016205chr42902 538 ------
NM_016206chr3148100 7174 6710 6084 3564 3435 2540 2004 1840 1660 774 655 480 252 28599 3414 12891 --
NM_016221chr532365 2202 181 1601 --1129
NM_016224chr611654 21738 1491 ----
NM_016227chr141325 1280 1195 444 ------
NM_016230chr62439 54 ------
NM_016231chr1721478 347 ------
NM_016235chr1651384 1221 1176 1098 1048 ------
NM_016247chr32429 58 ------
NM_016248chr1363977 3958 3678 3049 2472 1001 --23669 2562 --
NM_016252chr2--1357 ----
NM_016258chr11565 ------
NM_016260chr2137670 7078 6962 6197 6143 5944 5603 4999 2909 2530 1891 1653 215 27157 6824 24707 506 11185
NM_016269chr4--11060 1990 --
NM_016271chr1842343 2106 628 309 11461 --12315
NM_016272chr2242775 2264 845 597 ------
NM_016275chr342219 1780 810 775 11836 21731 1708 --
NM_016277chr621018 138 11613 1330 --
NM_016284chr161791 ------
NM_016287chr11160 ----11527
NM_016289chr221554 44 22264 684 11611 --
NM_016290chr5186 ------
NM_016297chr243129 2773 2717 111 43274 3087 1265 385 13328 --
NM_016303chrX3148 132 103 --1436 --
NM_016306chr32380 322 ------
NM_016308chr12531 44 11945 --11486
NM_016322chr942561 1996 1277 950 13075 1432 --
NM_016340chr52488 456 --2311 101 184
NM_016351chr71429 ------
NM_016356chr612916 22873 506 --184
NM_016374chr141073 444 203 118 1368 ----
NM_016374chr141073 444 203 118 1368 ----
NM_016376chr1743779 2847 2662 720 11070 ----
NM_016377chr651799 1599 1259 495 351 11264 --1160
NM_016395chr151378 --21919 1901 --
NM_016396chr1522929 2414 12443 12807 12131
NM_016404chr11128 ------
NM_016410chr92164 132 ------
NM_016422chr1151136 526 196 126 26 22310 277 ----
NM_016424chr173201 74 47 ------
NM_016436chr2072669 1911 1744 975 969 889 848 --12116 --
NM_016441chr261808 882 864 677 435 414 32017 1834 238 ----
NM_016451chr111283 ------
NM_016470chr202494 344 ----1501
NM_016475chr1431009 485 477 11178 ----
NM_016480chr51126 2735 327 ----
NM_016485chr622208 383 22070 860 --11968
NM_016486chr11349 --1370 --
NM_016488chr1231722 1395 26 --1703 --
NM_016505chr11649 ------
NM_016507chr1741125 965 505 151 22541 765 11059 --
NM_016513chr683754 3258 2963 2701 2685 2660 2329 524 ------
NM_016522chr1111054 ------
NM_016530chr1553431 2859 1585 1425 737 --11269 --
NM_016531chr4104081 3887 3335 3210 3116 2895 2795 2775 1691 794 23758 3079 13193 13256
NM_016542chrX21688 1239 ------
NM_016570chr12--1315 --1490
NM_016575chr12125439 4625 4522 4194 4118 3931 3892 3596 2175 2110 2009 83 24677 799 11514 11784
NM_016577chr363773 3307 3173 1137 1106 51 12887 13918 --
NM_016578chr111642 --1190 --
NM_016588chr62972 936 ------
NM_016603chr52341 255 --12211 --
NM_016607chrX41653 1626 245 210 ------
NM_016617chr1332216 2105 1423 21638 698 ----
NM_016626chr1841726 1604 1370 136 11583 --1259
NM_016630chr152535 387 ------
NM_016641chr1641572 1447 1354 206 ------
NM_016651chr1451153 979 844 199 143 ------
NM_016652chr2071370 1147 696 627 525 48 29 11138 ----
NM_016654chr1541254 1135 1011 254 ------
NM_016655chr15145 ------
NM_016824chr1031892 1619 428 11803 ----
NM_016931chr111358 ------
NM_016936chr1652213 1613 1482 246 184 ----22184 1704
NM_016950chr42940 462 --21132 1084 --
NM_016953chr2115955 5882 5690 5602 4887 4499 3816 1927 1850 1528 392 --25276 1856 --
NM_016954chrX2498 122 ------
NM_017412chr831140 915 145 ------
NM_017420chr1492990 2623 2326 1509 1331 1173 1093 763 394 ------
NM_017423chr432208 1669 671 --189 --
NM_017435chr121698 ----1734
NM_017437chr143885 513 373 ------
NM_017440chr122424 56 1538 --1151
NM_017447chr2164441 4371 3384 3084 1091 919 13820 ----
NM_017452chr2021281 1172 21367 940 ----
NM_017453chr2021281 1172 21367 940 ----
NM_017454chr2021281 1172 21367 940 ----
NM_017455chr152677 236 1255 ----
NM_017456chr1721968 143 ------
NM_017488chr211534 ------
NM_017491chr42847 712 ------
NM_017510chr51665 ------
NM_017540chr523048 2082 --12773 12651
NM_017548chr362041 1563 1344 867 578 347 --1199 --
NM_017569chr131243 --1145 --
NM_017577chr321598 343 ------
NM_017580chr1041549 939 626 305 11658 11850 --
NM_017582chr161547 1240 582 552 245 233 1449 1291 --
NM_017594chr963085 3041 2863 2724 1337 576 12200 13263 1265
NM_017599chr1231780 318 35 ------
NM_017610chr1522117 764 --12085 --
NM_017633chr653675 3336 3329 799 324 43604 3376 1527 556 ----
NM_017634chr811961 --1240 1438
NM_017637chr9129313 9075 8752 8336 3283 3114 2944 2937 2463 2153 2111 645 13460 ----
NM_017643chr1722318 468 1103 --1278
NM_017644chr3115079 4653 4622 4422 3404 3219 2039 1666 924 838 222 2479 204 23545 604 --
NM_017645chr943068 2550 2035 443 12776 --12044
NM_017649chr101335 1908 ----
NM_017650chr7106063 6027 5906 5868 5751 2037 1921 1375 805 611 2652 358 --15116
NM_017657chr24710 586 251 29 --1787 --
NM_017658chr1473371 3261 1694 1380 615 172 95 --24179 3253 24230 1655
NM_017661chr152832 797 1298 --1472
NM_017666chrX11663 22185 1731 1168 12227
NM_017672chr1531379 1070 82 1121 1886 --
NM_017673chr11912 1807 ----
NM_017676chr521891 27 ------
NM_017680chr92390 314 --1776 --
NM_017693chr1341609 1269 1071 377 ------
NM_017700chr42626 111 1466 ----
NM_017709chr121621 538 ----23242 678
NM_017719chr322479 976 ------
NM_017736chr1642794 2691 440 56 --11213 --
NM_017737chr11171 --1274 --
NM_017742chr1841404 1222 781 298 --11475 11725
NM_017745chrX3708 605 204 ------
NM_017747chr51315 ------
NM_017752chrX4372 227 173 95 32038 1776 1633 --21878 1712
NM_017754chr634482 4306 4184 24445 1544 ----
NM_017757chr1821099 815 ------
NM_017762chr1562353 2226 1954 1943 904 626 11841 1957 167
NM_017769chr1452516 2287 1052 868 454 1183 12940 --
NM_017778chr831108 1082 168 21332 555 ----
NM_017780chr82844 760 --1917 --
NM_017801chr352430 2214 727 399 261 187 ----
NM_017811chr942809 2796 2381 770 12153 13154 --
NM_017813chr8115769 5752 5704 5657 4635 2121 1053 1038 989 722 185 11394 1296 --
NM_017824chr1032673 2587 199 12665 --12339
NM_017831chr1854796 4247 3328 2922 1350 24002 1483 34766 246 138 --
NM_017845chr43677 246 40 1756 ----
NM_017847chr1----12288 --
NM_017848chrX64375 4158 1774 1610 1308 726 ------
NM_017866chr82450 308 1889 --194
NM_017890chr831891 1736 609 186 11550 --
NM_017913chr9138 ------
NM_017915chr1231060 438 145 ------
NM_017918chr42103 91 ------
NM_017919chr9115425 4372 4210 4129 3576 1676 1071 436 400 163 55 --24491 914 25813 5707
NM_017925chr931955 1262 324 ------
NM_017926chr143302 256 248 143 2833 262 --
NM_017933chr211570 11267 ----
NM_017938chrX72138 1993 1966 1387 781 677 608 --1863 --
NM_017943chr142960 130 ------
NM_017944chr1142986 2919 1949 1091 43130 1194 1108 923 1664 --
NM_017946chr71424 1517 ----
NM_017954chr771679 1662 1434 1132 501 89 47 1439 ----
NM_017958chr252958 2658 2420 2203 2023 11161 ----
NM_017972chr143302 256 248 143 2833 262 --
NM_017987chr1031833 301 177 1584 1736 --
NM_017988chr121936 ------
NM_017994chr752925 2706 2609 2562 1933 22206 1959 --11821
NM_017998chr951027 507 492 383 134 1400 --11064
NM_018004chr33387 338 52 ------
NM_018011chr132496 206 1647 --1470
NM_018015chrX31014 888 69 ------
NM_018028chr1921316 969 ------
NM_018030chr182281 203 1790 11060 --
NM_018046chr541461 594 570 491 ------
NM_018048chr121335 21959 230 --1690
NM_018056chr11130 ------
NM_018061chr141390 1098 236 219 21197 548 --1193
NM_018062chr21451 ------
NM_018084chr231057 881 514 ------
NM_018086chr221418 343 ------
NM_018092chr1631564 1336 228 ------
NM_018098chr341176 1125 954 268 ------
NM_018101chr151296 1266 1165 216 80 11013 ----
NM_018103chr12313 271 ------
NM_018120chr84969 489 201 57 ------
NM_018121chr1012510 23166 308 --1203
NM_018133chr321988 296 --12093 1130
NM_018149chr171168 ------
NM_018155chr343453 2261 1271 1033 ----1633
NM_018156chr112787 32504 377 293 ----
NM_018157chr1222034 31 ------
NM_018159chrX41463 1423 1081 689 ----11646
NM_018171chr122298 262 ------
NM_018181chr1841735 1402 235 61 --11712 --
NM_018182chr1741811 1605 1595 408 ------
NM_018184chr321848 1676 21801 1387 ----
NM_018195chr1131668 421 205 1183 1695 --
NM_018200chr152755 511 2838 608 31992 1744 693 --
NM_018211chr132196 2123 1587 ------
NM_018214chr621082 508 ------
NM_018221chr2----263 46 --
NM_018227chr442659 2269 2246 579 11286 22092 893 --
NM_018229chr141833 1199 --1326
NM_018237chr101253 ------
NM_018243chr453814 2767 1358 976 765 1150 --13871
NM_018247chr652542 2497 2406 1259 1077 22044 421 --12633
NM_018252chr11116 1531 ----
NM_018254chr142219 1543 915 567 ------
NM_018257chr2042435 983 401 230 11668 --143
NM_018263chr222087 792 11667 12416 --
NM_018287chr1031257 1220 177 11030 1878 11182
NM_018293chr342498 1187 910 80 32808 2081 669 ----
NM_018299chr8113408 3378 3256 2883 2559 2498 1316 1206 996 845 609 11043 1822 --
NM_018312chr113595 583 235 1881 1653 --
NM_018313chr322342 179 ----11716
NM_018315chr441254 1198 619 515 ------
NM_018323chr42400 248 196 11668 --
NM_018326chr73809 539 216 ------
NM_018327chr201650 11158 ----
NM_018330chr1041342 1227 685 276 1108 ----
NM_018339chr941723 1646 462 139 11711 11265 --
NM_018348chr1621261 67 1437 ----
NM_018351chr1263842 3252 1168 590 142 136 14308 ----
NM_018361chr853691 1474 1074 631 75 ------
NM_018362chr1173822 3807 3092 3005 1594 1117 276 11615 21520 516 1680
NM_018364chr153616 1499 1023 775 367 12581 23440 1136 14055
NM_018373chr14125980 5804 5286 5261 5128 4854 4265 4022 1897 784 184 134 14378 11585 --
NM_018374chr783882 3774 3440 3357 1234 1198 1048 941 --25127 461 11636
NM_018388chrX3519 371 278 11431 ----
NM_018403chr343477 1094 847 840 --11594 --
NM_018416chr1252617 2371 2246 1000 434 1314 22571 2346 --
NM_018424chr941548 766 351 303 1522 1387 --
NM_018429chr522731 591 --12242 --
NM_018434chr5------1131
NM_018439chr182605 322 ----12646
NM_018440chr897628 6956 6777 5830 5329 2440 2158 1821 1060 ------
NM_018448chr1221041 157 1500 ----
NM_018452chr6_random52821 2683 2431 962 33 --11232 33365 1241 114
NM_018466chrX1678 ------
NM_018469chr1741502 1385 1287 1102 ------
NM_018471chr21560 ------
NM_018477chr143261 210 87 1834 ----
NM_018482chr842595 1874 1728 1629 --12404 --
NM_018489chr122275 225 ------
NM_018490chr1121262 673 1415 21687 748 --
NM_018509chr1721063 294 11443 ----
NM_018553chr1741290 1202 604 133 ------
NM_018557chr241728 1429 1157 129 2265 161 ----
NM_018566chr132063 1482 1435 2982 154 ----
NM_018569chr421252 1090 21107 386 ----
NM_018584chr121247 107 ------
NM_018602chr15------21589 134
NM_018638chr1285307 4808 4515 4099 3618 1828 937 808 15341 --22056 883
NM_018640chr1252546 2108 621 376 242 ------
NM_018641chr71140 ------
NM_018650chr14842 581 484 282 ------
NM_018662chr144268 4246 3062 1299 1212 ----
NM_018683chr2021692 1150 11136 ----
NM_018685chr72719 441 1225 ----
NM_018691chr521158 143 ------
NM_018695chr552447 1693 746 483 219 ------
NM_018697chr742388 1704 1475 55 11663 ----
NM_018700chr531700 1376 1210 2610 305 --1631
NM_018710chr861400 1147 413 261 185 179 1325 ----
NM_018712chr1131350 1326 54 ------
NM_018715chr121447 1392 11658 ----
NM_018719chr721359 146 2239 138 ----
NM_018841chr163906 3749 3610 3232 2526 692 ------
NM_018844chr73592 305 51 21943 625 ----
NM_018890chr72342 131 11469 ----
NM_018898chr542117 1923 1892 1523 --12140 22387 1596
NM_018899chr542117 1923 1892 1523 --12140 22387 1596
NM_018900chr542117 1923 1892 1523 --12140 22387 1596
NM_018901chr542117 1923 1892 1523 --12140 22387 1596
NM_018902chr542117 1923 1892 1523 --12140 22387 1596
NM_018903chr542117 1923 1892 1523 --12140 22387 1596
NM_018904chr542117 1923 1892 1523 --12140 22387 1596
NM_018905chr542117 1923 1892 1523 --12140 22387 1596
NM_018906chr542117 1923 1892 1523 --12140 22387 1596
NM_018907chr542117 1923 1892 1523 --12140 22387 1596
NM_018908chr542117 1923 1892 1523 --12140 22387 1596
NM_018909chr542117 1923 1892 1523 --12140 22387 1596
NM_018910chr542117 1923 1892 1523 --12140 22387 1596
NM_018911chr542117 1923 1892 1523 --12140 22387 1596
NM_018945chr663171 1277 948 619 613 375 --22345 852 --
NM_018948chr151024 993 913 438 184 ------
NM_018951chr731017 397 297 --21237 846 --
NM_018958chr1553452 3353 2867 1163 635 --23873 977 --
NM_018964chr212990 965 ----1187
NM_018970chr722813 446 --2659 618 13158
NM_018975chr165795 724 309 291 129 1549 ----
NM_018976chr123996 494 316 11956 1737 --
NM_018979chr1252604 2242 1785 923 888 ------
NM_018981chr22905 272 --1368 --
NM_018999chr10114834 4617 4176 4078 4007 3509 1561 1468 1054 805 677 13646 ----
NM_019001chr373548 3526 3127 1559 1283 938 750 ------
NM_019004chr712296 1224 21603 1517 11696
NM_019008chr2263338 2695 2654 323 197 174 43137 2624 1138 113 ----
NM_019022chr1842932 2740 543 27 1118 12855 --
NM_019027chr412378 --12511 --
NM_019040chr11------158
NM_019045chrX1227 ------
NM_019050chr421509 516 1210 ----
NM_019058chr101292 1844 ----
NM_019063chr21335 1712 12266 --
NM_019072chr554286 3974 3703 1022 559 13481 ----
NM_019074chr15162 ------
NM_019084chr1032101 1798 819 --22228 518 --
NM_019091chr221027 865 --268 37 --
NM_019094chr1273814 3689 3310 2813 2796 853 369 --1993 --
NM_019098chr821744 406 11201 1232 21817 1409
NM_019106chr2243417 2557 1274 775 --33453 2856 2263 --
NM_019116chr1673757 3064 2914 2330 1335 1195 729 --1820 --
NM_019117chrX73172 2678 689 680 588 150 120 11080 ----
NM_019555chr31331 ------
NM_019556chrX1282 --1319 --
NM_019592chr9--2610 588 ----
NM_019593chr2043065 2740 940 76 ------
NM_019597chrX--2765 560 ----
NM_019600chr151563 ----1771
NM_019610chr161971 1806 1582 1530 1523 208 ------
NM_019859chr1011415 21516 69 --11579
NM_019860chr1011463 21564 117 --11627
NM_019884chr19----1385 --
NM_019885chr262860 2719 2705 2668 2068 1902 --1586 --
NM_019895chr32425 79 ------
NM_019903chr1031892 1619 428 11803 ----
NM_020066chr14847 764 705 153 ------
NM_020116chr441416 1262 142 62 1550 ----
NM_020122chr264890 4636 4473 1582 413 113 1961 --1818
NM_020123chr1021283 1246 11204 ----
NM_020132chr2145191 4935 4477 2073 13838 14703 13130
NM_020141chr132058 1893 891 --1782 --
NM_020147chr152357 71 ------
NM_020148chr183542 202 142 12919 23036 2911 --
NM_020151chr261729 1624 1500 1364 1260 168 ------
NM_020152chr214940 811 755 97 ------
NM_020156chr72526 414 1429 ----
NM_020159chr441665 1650 1072 278 21338 1297 31558 1187 500 --
NM_020168chr1521350 1013 ------
NM_020177chr562973 2474 625 420 278 199 ------
NM_020178chr17--1971 1781 --
NM_020184chr232262 2013 856 12304 ----
NM_020198chr1751394 1261 1141 469 372 ------
NM_020209chr19189 ------
NM_020242chr3--1436 ----
NM_020245chr635109 4608 3567 11346 ----
NM_020297chr1252965 2915 2219 391 172 --12836 --
NM_020311chr2----1495 --
NM_020337chr442801 2095 963 481 187 21149 1000 --
NM_020338chr1023085 972 --13688 --
NM_020341chr2031521 1434 1314 11562 ----
NM_020342chr252128 2089 1768 948 81 12490 ----
NM_020346chr113557 383 118 ------
NM_020347chr331996 1949 1780 --11713 1405
NM_020357chr311145 31556 1341 204 1550 --
NM_020378chr19--1594 ----
NM_020390chr394699 4525 3275 1830 1448 1427 573 445 119 11309 ----
NM_020401chr12164 1187 ----
NM_020403chr1361755 1674 1279 715 653 619 21570 1419 11264 --
NM_020416chr422656 2035 1728 ----
NM_020422chr162639 350 ------
NM_020425chr621498 384 1268 ----
NM_020429chr753119 2934 2078 1990 730 --22922 1149 --
NM_020432chr71326 --22169 732 --
NM_020438chr911395 11231 ----
NM_020440chr143314 3064 2709 1293 12289 11110 --
NM_020443chr155337 4892 2766 1689 945 --22199 2193 --
NM_020445chr72613 103 --1309 --
NM_020448chr133477 1363 1053 13696 13262 --
NM_020449chrX3645 201 144 ----2680 170
NM_020456chr1352355 2144 828 556 531 11984 ----
NM_020457chr165601 247 157 134 66 ------
NM_020463chr231361 335 186 ------
NM_020473chrX11886 12003 ----
NM_020474chr181567 ------
NM_020475chr81340 --12365 --
NM_020476chr81340 --12365 --
NM_020477chr81340 --12365 --
NM_020478chr81403 --12428 --
NM_020480chr81340 --12365 --
NM_020529chr142446 172 ------
NM_020532chr21120 --1841 --
NM_020548chr21218 ------
NM_020644chr113697 112 71 1164 ----
NM_020647chr852233 2147 2085 654 495 ------
NM_020651chr221512 314 ------
NM_020654chr331585 1470 164 1406 --1616
NM_020659chr191578 ------
NM_020673chr2087691 7563 7355 5460 2492 2015 911 868 57780 7149 2277 1301 249 ----
NM_020689chr2021716 493 ------
NM_020699chr164398 3471 2177 1422 1313 1041 ------
NM_020708chr2032449 2218 2088 ------
NM_020717chrX84877 4577 3677 1695 1288 1026 274 68 --2843 729 --
NM_020718chr1645341 2236 1693 172 --25688 1565 14074
NM_020727chr2133974 2498 1197 23723 2660 2757 117 --
NM_020728chr722805 139 1889 21193 771 --
NM_020734chr1252807 2655 789 746 358 1889 12684 22758 263
NM_020739chr1584259 4189 3766 3674 3032 2849 2686 920 13786 ----
NM_020742chrX32534 2162 2025 11085 ----
NM_020747chr52769 164 ------
NM_020751chr1331264 512 237 --1199 --
NM_020752chr1042496 864 805 494 11990 1632 --
NM_020754chr351264 417 395 303 166 --1315 --
NM_020755chr62151 40 --11320 --
NM_020760chr231776 1518 264 ------
NM_020765chr1----1105 --
NM_020766chrX174533 4369 4023 4007 3973 3831 3053 1389 1159 968 789 585 571 539 338 130 73 14348 1608 --
NM_020771chr611037 21180 342 ----
NM_020772chr17158678 8478 8031 7598 7260 7254 7050 6827 6785 5760 5633 5476 2997 2506 1150 38460 6927 6050 ----
NM_020773chr422617 2597 12575 12722 --
NM_020774chr18116209 5247 5068 4859 4174 3819 1601 1561 1088 645 25 25428 4870 24299 1354 15621
NM_020782chr122756 194 44712 4392 1916 1120 ----
NM_020783chr1832232 801 121 --12438 --
NM_020791chr1741315 1274 943 534 --21304 1129 --
NM_020794chr111421 --189 --
NM_020796chr542834 2466 2333 710 11957 ----
NM_020801chr552629 2170 2026 810 649 ------
NM_020803chr452375 1938 1909 919 722 --21702 637 --
NM_020808chr141080 1071 757 109 ----1930
NM_020809chr11--22034 1958 22042 589 1121
NM_020810chr1463617 3000 2978 1363 1250 1002 13438 ----
NM_020815chr41410 ------
NM_020819chr641200 769 295 247 1754 1356 1892
NM_020824chr101790 --189 --
NM_020839chr33523 483 340 1584 ----
NM_020841chr1253501 3474 1175 604 360 1754 1781 13011
NM_020854chr181456 --1388 --
NM_020856chr1931599 1247 185 ------
NM_020858chr1511881 1485 ----
NM_020859chr41363 13841 33856 3473 474 --
NM_020860chr421047 884 --11116 --
NM_020861chr611187 --11070 --
NM_020865chr3156 ------
NM_020866chr1341015 972 687 37 --1923 --
NM_020870chr442153 827 293 191 ------
NM_020871chrX22520 570 11642 ----
NM_020872chr341684 1676 1209 508 --11564 --
NM_020873chr32863 103 --2699 244 --
NM_020918chr1053625 2793 2292 1336 593 12273 ----
NM_020921chr1433122 2533 387 13100 ----
NM_020922chrX31379 546 331 --11757 --
NM_020924chr9178 --1433 --
NM_020927chr1652342 2211 2164 1947 418 11740 1815 --
NM_020940chr1052627 2156 858 845 231 1768 22643 115 --
NM_020948chr153143 2834 1338 1019 597 21419 824 1789 --
NM_020949chr3--1213 ----
NM_020951chr1962214 2116 518 290 185 151 ------
NM_020962chr1542089 1896 1864 129 ------
NM_020964chr1844743 1889 511 58 --133 --
NM_020977chr432059 1720 438 11601 1818 2678 652
NM_020993chr1222848 296 ------
NM_021003chr142787 573 ------
NM_021005chr152930 242 1115 1877 1313
NM_021007chr232234 1872 38 --11645 --
NM_021033chr1363421 3375 3264 3119 2195 1049 23443 684 12954 --
NM_021038chr3123363 3286 3015 3005 2914 2622 2572 2283 2246 2102 746 715 22539 650 13027 12081
NM_021069chr42536 411 32167 1885 627 ----
NM_021072chr561998 1871 1819 940 797 776 1598 12429 1457
NM_021088chr2--1832 --22173 1457
NM_021090chr2244612 4384 3157 477 11893 --12016
NM_021097chr252991 1220 956 390 347 --12853 12606
NM_021116chr769113 7860 7608 6438 5846 763 27051 679 12889 28947 7265
NM_021120chrX32790 923 295 13112 ----
NM_021140chrX31063 854 828 --11185 11145
NM_021141chr2----1222 --
NM_021144chr9--1520 ----
NM_021145chr72795 138 ------
NM_021148chr721962 1708 --11864 --
NM_021159chr421555 238 ------
NM_021165chr12832 673 1843 ----
NM_021180chr11644 ------
NM_021183chrX22280 1831 11026 11944 --
NM_021189chr12962 931 ------
NM_021190chr131202 328 38 1190 ----
NM_021191chr1222507 697 12169 ----
NM_021194chr1----1343 --
NM_021202chr2021891 1222 --13054 --
NM_021204chr42370 228 --1781 1287
NM_021219chr212160 39 ------
NM_021222chr131454 1001 98 ------
NM_021229chr1221228 936 21235 422 ----
NM_021238chr121112 1718 ----
NM_021244chr6--1117 ----
NM_021249chr1421463 377 ------
NM_021252chr1041652 640 327 108 21972 1349 ----
NM_021255chr1454022 3923 1652 993 708 31176 958 861 23398 1572 13495
NM_021572chr63451 442 221 ------
NM_021614chr51220 --1209 --
NM_021622chr1032267 851 777 ------
NM_021627chr321216 323 ------
NM_021629chr374750 4343 3854 2029 1428 558 252 14558 11374 --
NM_021637chrX41338 1235 1073 230 ------
NM_021638chr41310 23049 228 ----
NM_021639chr11165 ------
NM_021643chr21393 11707 11403 --
NM_021644chr1011089 ------
NM_021722chr71388 ------
NM_021723chr71429 ------
NM_021728chr142889 372 ------
NM_021738chr10------1135
NM_021785chrX--191 ----
NM_021807chr731026 944 271 --1487 --
NM_021809chr2041955 1640 627 518 1491 11716 11652
NM_021813chr695257 5218 4818 4176 3743 3699 2343 1981 1711 --25806 5725 --
NM_021814chr621395 394 --11580 11687
NM_021815chr242479 544 304 238 2529 380 23006 2004 --
NM_021818chr141140 2987 314 ----
NM_021911chr5104637 4244 4115 3722 3710 1741 1048 876 161 122 1697 --11687
NM_021912chr1543712 3084 3071 1065 --24056 491 --
NM_021914chr1442242 2140 2114 789 1561 ----
NM_021923chr4--11525 ----
NM_021935chr31331 --1990 --
NM_021940chr631542 1320 512 151 ----
NM_021942chr42591 29 1835 1241 --
NM_021943chr61613 12043 ----
NM_021946chrX21297 469 1222 21359 209 --
NM_021951chr93902 852 801 2828 70 2837 605 --
NM_021954chr1342509 662 379 175 ----1885
NM_021961chr1136163 2714 1280 27122 5795 ----
NM_021964chr395583 5423 5165 4675 4551 1905 1499 300 247 12237 --15687
NM_021967chr5--11171 ----
NM_021979chr142349 103 ------
NM_021988chr2041337 1065 442 347 --11320 --
NM_022037chr23799 766 166 --1271 --
NM_022048chr1541512 1171 716 280 ----25819 2321
NM_022051chr13594 514 208 156 1638 145
NM_022062chr11--11788 ----
NM_022073chr1421331 1141 2642 218 ----
NM_022091chr612610 2773 635 12021 12268
NM_022103chr1921039 942 ------
NM_022114chr144363 1723 559 535 11663 14197 --
NM_022118chr13------1209
NM_022130chr51581 11373 ----
NM_022138chr611521 ------
NM_022143chr721598 258 ----1300
NM_022154chr411347 2173 26 ----
NM_022166chr1675996 5868 5821 5638 5273 3928 2414 14238 ----
NM_022173chr23799 766 166 --1271 --
NM_022337chr11142 ------
NM_022351chr863438 2863 2781 2674 696 231 21096 89 ----
NM_022361chr62429 389 --2545 203 --
NM_022442chr2041337 1065 442 347 --11320 --
NM_022443chr3136 ------
NM_022456chr1287502 7475 6810 5940 4793 2920 2281 125 27722 5474 11282 12671
NM_022459chr1345824 5643 5397 1886 ----157
NM_022463chr1721539 1492 11481 ----
NM_022465chr1221946 1076 --12591 --
NM_022474chr1422355 563 22754 2321 ----
NM_022475chr41616 ------
NM_022477chr2011382 --21749 1535 11406
NM_022482chr2042526 2453 1725 562 11789 ----
NM_022484chr731231 921 104 11458 11395 --
NM_022494chr101442 ------
NM_022574chr742007 1714 1385 130 ----1263
NM_022650chr51350 2826 698 ----
NM_022652chr122737 24 ------
NM_022726chr621675 1301 21247 493 --11215
NM_022728chr71718 ------
NM_022735chr161754 1250 1237 540 343 139 ------
NM_022745chr152329 2296 1113 967 874 12694 ----
NM_022753chr152660 2547 898 382 75 1989 ----
NM_022763chr352798 2676 2500 1219 342 ------
NM_022771chr121822 21072 255 1408 --
NM_022776chr331571 1280 240 --11190 --
NM_022778chr121460 1083 11182 ----
NM_022780chr22695 638 11761 ----
NM_022781chr941168 854 619 290 23108 2908 1189 1637
NM_022783chr81280 ------
NM_022784chr1521048 299 11139 --139
NM_022787chr122349 1884 ------
NM_022802chr1021459 1286 21188 445 ----
NM_022824chr531419 651 598 --1330 11513
NM_022825chrX1304 ------
NM_022831chr12655 636 11677 1717 --
NM_022832chr421654 925 2346 248 1411 --
NM_022835chr191540 1203 ----
NM_022836chr141763 1623 1223 538 --1399 --
NM_022838chrX--1313 ----
NM_022840chr1841426 1248 84 37 ------
NM_022841chr1542765 2431 2398 120 1825 ----
NM_022843chr1321431 445 ------
NM_022845chr1642207 1602 818 48 --11646 --
NM_022893chr272967 2880 2627 2319 2057 771 428 23101 414 ----
NM_022894chr21295 --1196 --
NM_022898chr1444703 4597 3435 1099 ----11506
NM_022899chr331512 626 285 11380 ----
NM_022918chr1151855 1839 1778 1434 179 11832 ----
NM_022970chr1011236 2521 313 ----
NM_022977chrX52599 2156 1005 557 153 11012 --12009
NM_022978chr5--11171 ----
NM_023000chr1451556 1282 1198 487 34 ----1103
NM_023001chr1451556 1282 1198 487 34 ----1103
NM_023003chr15146 ------
NM_023037chr133924 746 117 ------
NM_023039chr54420 392 383 360 ------
NM_023073chr541298 1087 1060 1008 ----11044
NM_023074chr191169 11256 ----
NM_023075chr182867 785 ------
NM_023105chr862414 1990 826 817 752 226 1531 22056 890 --
NM_023106chr862414 1990 826 817 752 226 1531 22056 890 --
NM_023110chr862414 1990 826 817 752 226 1531 22056 890 --
NM_023111chr862414 1990 826 817 752 226 1531 22056 890 --
NM_023925chr121243 ------
NM_023927chr52995 222 2953 924 ----
NM_023929chr872313 2260 2210 1117 1009 118 66 12540 ----
NM_023934chrX41872 1450 1438 25 ------
NM_024007chr542761 2511 2250 642 --13076 23105 751
NM_024016chr171740 --1686 --
NM_024017chr1711687 ------
NM_024019chr41725 ------
NM_024036chr111268 ------
NM_024055chr52615 496 ------
NM_024095chr1221391 216 ------
NM_024165chr61228 ------
NM_024315chr71358 ------
NM_024345chr975162 4991 4287 4274 4065 1145 53 --25485 4044 24396 577
NM_024408chr163699 3553 3511 2360 1473 1279 13328 12662 --
NM_024424chr1121104 1009 ------
NM_024425chr1121104 1009 ------
NM_024426chr1121104 1009 ------
NM_024429chr72893 873 ------
NM_024430chr1831879 1785 121 ------
NM_024524chr332057 582 386 --23118 268 32404 2344 29
NM_024546chr1351137 986 841 334 165 157 ----
NM_024548chr331393 185 104 11082 ----
NM_024557chr11------11580
NM_024561chr1321058 903 11151 ----
NM_024563chr541687 1591 1435 1265 --11736 --
NM_024569chr122261 327 1893 1675 --
NM_024581chr61265 --165 --
NM_024582chr431062 720 360 168 ----
NM_024583chr22921 746 1170 ----
NM_024590chr411984 11198 ----
NM_024612chr173415 278 110 11142 ----
NM_024613chr821779 1277 --11223 --
NM_024615chr51249 --193 --
NM_024617chr9------2768 155
NM_024620chr1931308 1276 1124 ----1140
NM_024625chr73686 631 479 2158 25 ----
NM_024626chr121620 403 --139 --
NM_024636chr742017 920 302 145 22363 1139 ----
NM_024639chr642504 2054 1181 998 ------
NM_024641chr682996 2859 2460 1879 905 809 562 158 --12696 --
NM_024645chr831501 1329 62 ------
NM_024664chr1132 ------
NM_024665chr394682 4493 3512 1856 1792 1786 1647 1640 1202 13456 ----
NM_024670chr1031458 1300 426 --11418 --
NM_024674chr143146 2929 442 31 11257 ----
NM_024676chr121331 991 ------
NM_024692chr211156 --11478 --
NM_024721chr882684 2517 2324 2275 2045 1684 988 131 1448 ----
NM_024740chr1141291 704 277 262 139 --1872
NM_024744chr212064 22241 1067 --1470
NM_024745chr1631077 225 82 ------
NM_024755chr152915 138 1579 ----
NM_024769chr111747 ------
NM_024770chr295331 4790 4613 4318 2181 1750 638 348 69 11129 24974 4764 14707
NM_024779chr1231323 409 262 2444 103 ----
NM_024780chr1621012 240 1393 --2702 197
NM_024814chr72322 303 2367 329 ----
NM_024817chr1555547 5527 5304 5047 1991 2972 453 15405 --
NM_024824chr1451615 1414 1351 355 107 ------
NM_024828chr91243 --21512 1415 --
NM_024834chr1031917 1618 82 2570 286 --11285
NM_024852chr12253 163 ------
NM_024854chr1211100 1443 --11497
NM_024885chrX5927 709 668 276 133 ------
NM_024900chr431622 1481 872 ----1813
NM_024900chr431622 1481 872 ----1813
NM_024911chr1--1676 --1256
NM_024941chr521360 57 ------
NM_024944chr212347 279 1218 ----
NM_024945chr961000 389 367 312 216 153 1802 ----
NM_024947chr3199575 9518 9507 9479 8974 8894 8040 7199 3263 3118 2812 2711 2552 1456 1255 1233 912 760 242 28873 7968 --17850
NM_024953chr1242707 2604 2427 2042 12050 12304 --
NM_024969chr22654 80 ----1344
NM_024979chr1321248 554 ------
NM_024989chr2107536 7066 6397 5843 5726 3049 1632 1400 663 415 17892 16938 23171 866
NM_024991chr1023246 2492 --13045 1847
NM_024993chr231386 1235 1177 ------
NM_025027chr191472 ----1343
NM_025047chr32369 58 ------
NM_025054chr863105 3017 2635 855 656 126 1590 ----
NM_025073chr194727 4689 4230 4179 3174 1284 1026 672 286 ----14749
NM_025074chr442962 2887 2835 1060 12533 ----
NM_025106chr1--11948 ----
NM_025126chr122696 511 ------
NM_025134chr162938 465 1710 ----
NM_025137chr151386 188 ----
NM_025146chr341709 678 590 196 1660 32732 709 528 --
NM_025147chr21825 1101 2419 254 --
NM_025151chr862017 1956 1773 1623 1570 827 ------
NM_025160chr144307 3001 2788 339 13729 13739 --
NM_025164chr1142239 2083 1682 488 --11466 --
NM_025179chr154951 4869 3250 839 105 ------
NM_025180chr332943 459 230 1284 33181 2904 2472 --
NM_025182chr92439 331 1991 ----
NM_025184chrX1642 ------
NM_025191chr173414 2931 2872 2603 2196 724 545 22491 2206 ----
NM_025208chr1132494 1831 818 3712 153 132 ----
NM_025221chr42346 89 ------
NM_025222chr322447 454 --22029 1863 12083
NM_025235chr1072131 1970 1898 869 581 506 445 181 ----
NM_025237chr1741539 498 277 88 ----21585 1339
NM_030567chr51123 ------
NM_030579chr1633710 3522 306 12267 11478 --
NM_030621chr1453145 2977 1538 996 90 23251 3110 ----
NM_030625chr1071923 1916 724 683 570 463 32 2860 745 1486 --
NM_030627chr553822 3744 3509 1576 247 --12814 1359
NM_030629chr1631872 1535 777 --2704 500 --
NM_030640chr122891 154 ------
NM_030647chr735807 5486 4507 36025 4826 657 --24193 1663
NM_030648chr443886 1594 1571 1301 14841 15577 --
NM_030650chr264202 3952 2597 1139 512 60 1862 ----
NM_030660chr1421396 1275 ----11523
NM_030664chr1021994 654 ----12294
NM_030665chr1721464 1340 ------
NM_030667chr1251077 832 398 309 61 --1452 --
NM_030668chr1251077 832 398 309 61 --1452 --
NM_030669chr1251077 832 398 309 61 --1452 --
NM_030670chr1242109 1864 1430 874 --11484 --
NM_030671chr1242109 1864 1430 874 --11484 --
NM_030674chr1235775 5319 2139 1909 15420 --
NM_030751chr1021870 359 --21166 643 --
NM_030751chr1021870 359 --21166 643 --
NM_030762chr1241578 1382 1371 472 31560 1461 775 ----
NM_030771chr11161 ------
NM_030777chr2062502 2067 1858 1785 1530 140 --1853 --
NM_030780chr841713 1507 361 112 1310 ----
NM_030791chr142736 441 1742 ----
NM_030799chr522084 1687 21813 862 --11849
NM_030806chr1139162 8542 7943 6987 3616 3415 2964 2634 1369 996 981 517 223 28406 7132 19421 23652 182
NM_030809chr1242280 894 650 146 ------
NM_030816chr153709 3074 1046 787 723 13391 13257 --
NM_030817chr1253803 3403 2698 1480 980 ------
NM_030820chr631034 1023 912 ------
NM_030881chr2242326 1971 1827 421 --1568 1692
NM_030885chr341921 1737 773 724 ------
NM_030917chr4159 ------
NM_030918chr155411 5369 5051 3379 307 ------
NM_030920chr141411 660 507 376 ------
NM_030922chr151226 --135 --
NM_030938chr173828 383 276 ------
NM_030945chr5157 1882 21066 97 --
NM_030949chr631484 1075 1058 1201 ----
NM_030953chr511552 1511 ----
NM_030954chr8------1347
NM_030962chr1131003 566 146 ------
NM_030964chr522586 110 ----23762 444
NM_031157chr121584 ------
NM_031203chr19--159 ----
NM_031216chr1861605 654 472 316 36 28 ------
NM_031243chr731914 596 274 ------
NM_031244chr62943 357 ------
NM_031262chr92243 120 ------
NM_031263chr92300 177 ------
NM_031268chr1645106 5097 1248 1203 1980 24867 1479 --
NM_031291chr43634 481 252 2107 42 ----
NM_031296chr452014 1084 588 456 115 --11717 --
NM_031314chr1441491 711 363 315 1210 11845 --
NM_031362chr251733 1054 961 915 29 12842 22744 706 --
NM_031365chr251869 1190 1097 1051 165 12978 22880 842 --
NM_031366chr251869 1190 1097 1051 165 12978 22880 842 --
NM_031369chr41203 --1220 --
NM_031370chr41203 --1220 --
NM_031371chr141073 444 203 118 1368 ----
NM_031371chr141073 444 203 118 1368 ----
NM_031372chr441471 1460 283 189 --1620 1673
NM_031407chrX2337 42 ------
NM_031411chr542117 1923 1892 1523 --12140 22387 1596
NM_031412chr1231265 288 182 ------
NM_031419chr321527 624 1567 1528 --
NM_031424chr202538 159 1400 ----
NM_031431chr1341359 1301 647 523 31739 397 304 11847 --
NM_031435chr1233369 2534 2248 33067 2846 227 ----
NM_031439chr831792 1680 263 1673 ----
NM_031442chrX32536 2440 737 --12579 1943
NM_031445chr233138 1231 635 11236 11348 --
NM_031452chr153477 203 172 1501 ----
NM_031461chr842181 2079 1981 282 --1233 11920
NM_031468chr757423 6179 3111 1085 268 16846 15258 15724
NM_031469chr673838 3443 2903 1018 486 421 175 22867 1508 1674 --
NM_031471chr112391 350 ------
NM_031476chr1662774 2699 982 610 530 316 ------
NM_031479chr1211158 ------
NM_031483chr2063318 2731 1362 717 655 511 1423 --11035
NM_031844chr131640 501 312 ----13904
NM_031845chr263705 3687 3673 1128 977 76 21251 342 1136 --
NM_031847chr263705 3687 3673 1128 977 76 21251 342 1136 --
NM_031849chr542117 1923 1892 1523 --12140 22387 1596
NM_031857chr542117 1923 1892 1523 --12140 22387 1596
NM_031860chr542117 1923 1892 1523 --12140 22387 1596
NM_031866chr1031057 910 890 2869 790 1113 --
NM_031889chr411963 ------
NM_031890chr2232419 2362 2262 ------
NM_031911chr442648 2536 2324 1050 ------
NM_031953chr4----1398 --
NM_032012chr965098 4869 4495 1480 1260 168 2822 240 --1415
NM_032013chr2011382 --21749 1535 11406
NM_032041chr81237 --12475 --
NM_032042chr542825 2685 603 99 1945 ----
NM_032047chr352084 1627 855 744 333 21972 421 1392 32338 2290 779
NM_032052chr2221250 313 --21139 1106 --
NM_032102chr1173064 2974 1178 998 980 676 193 1924 ----
NM_032105chr158025 6490 1208 1027 178 ------
NM_032116chr1385385 5293 5046 4936 1095 991 673 185 25841 5724 --21833 437
NM_032119chr51280 ------
NM_032121chrX42751 1886 1005 636 12348 ----
NM_032124chr181502 1183 1771 --
NM_032128chr42889 69 1676 ----
NM_032144chr221446 383 --11411 11791
NM_032145chr671826 1811 1725 1485 772 651 214 41854 1651 1280 435 11832 1496
NM_032153chr322645 2355 12392 --22426 1919
NM_032156chr121243 ------
NM_032160chr1853479 3375 3306 2897 146 12957 1385 --
NM_032189chr131265 24177 3686 --14914
NM_032199chr1032738 786 664 13165 12807 --
NM_032208chr253652 3421 2912 2694 671 22321 1293 23576 363 --
NM_032213chr231237 1066 884 ------
NM_032217chr41394 ------
NM_032228chr1153471 2605 1330 810 618 23052 2836 --23532 2148
NM_032229chr132427 341 ------
NM_032231chr152253 34 ------
NM_032233chr141120 181 ----
NM_032236chr12976 762 ------
NM_032239chr42929 299 11275 ----
NM_032256chr122219 159 --1707 --
NM_032271chr161190 11481 ----
NM_032281chr1913152 12095 12127 --
NM_032288chr351837 1513 1489 409 51 ------
NM_032291chr131645 1593 351 11477 --1209
NM_032295chr731445 494 62 11406 ----
NM_032320chr112805 496 ------
NM_032328chr1148 160 ----
NM_032373chr1095924 5301 5011 1750 1743 1350 1274 856 318 25509 1224 14218 15651
NM_032379chr112827 740 ----1307
NM_032408chr731187 1021 407 ------
NM_032410chr831093 844 447 11146 ----
NM_032411chr2--1221 ----
NM_032420chr52794 360 ------
NM_032435chr132185 1812 181 --2904 163 --
NM_032438chr641651 1596 1438 348 11060 --1482
NM_032439chr1031579 1570 572 ------
NM_032440chr1062913 2361 2152 731 72 58 12111 22242 1841 --
NM_032445chr152428 167 ------
NM_032446chr532607 1461 330 --33065 2867 218 31179 1095 470
NM_032452chr143331 291 257 ------
NM_032457chr463904 3728 2685 1229 665 202 --12852 --
NM_032458chrX43220 2814 2263 1312 11109 ----
NM_032466chr821540 1080 11212 ----
NM_032468chr821540 1080 11212 ----
NM_032471chr611111 ------
NM_032491chr1211085 ------
NM_032494chr2----1552 --
NM_032505chr332795 2185 587 ----11868
NM_032510chr182910 407 22307 1976 12032 12229
NM_032521chr2022728 241 1220 --1162
NM_032523chr23546 384 199 ------
NM_032547chr41522 --134 11216
NM_032549chr74412 357 333 24 ------
NM_032550chr101295 165 1829 --
NM_032557chr42997 693 ------
NM_032560chr141321 11000 ----
NM_032569chr1611714 ------
NM_032582chr1711752 ------
NM_032594chr141814 ------
NM_032595chr1721536 48 ------
NM_032622chr43553 416 235 --11252 1405
NM_032632chr1431920 680 316 ------
NM_032663chr1242084 687 473 405 12032 11719 --
NM_032679chr19--11070 1959 --
NM_032682chr353087 2980 2601 597 84 21388 301 ----
NM_032784chr62136 107 11021 ----
NM_032804chr1062456 2229 1802 1790 460 202 11795 ----
NM_032818chr922150 577 11793 ----
NM_032828chr1951614 1143 1058 940 447 34908 3474 30 ----
NM_032829chr1211171 ------
NM_032833chr112150 12411 ----
NM_032834chr122503 231 --11254 --
NM_032838chr19--169 1370 1867
NM_032839chr31127 ------
NM_032857chr151203 ------
NM_032858chr11132 ------
NM_032859chr1363829 2886 1093 702 363 266 1286 ----
NM_032870chr6--1575 ----
NM_032873chr1173861 3565 3288 3272 2998 644 562 ------
NM_032900chr1043933 2420 822 102 31472 934 814 --11511
NM_032918chr121125 ------
NM_032943chr112827 740 ----1307
NM_032960chr121508 359 ------
NM_032961chr431272 1009 163 ------
NM_032967chrX1356 ------
NM_032968chrX64224 3966 3359 1093 612 513 1753 ----
NM_032969chrX64224 3966 3359 1093 612 513 1753 ----
NM_032971chrY1383 ------
NM_032972chrY1383 ------
NM_032973chrY64216 3958 3354 1093 612 513 1753 ----
NM_032982chr752503 1595 725 535 367 11882 ----
NM_032991chr421533 1401 ----1251
NM_033012chr131904 --1402 --
NM_033020chr174824 4753 4680 4660 1552 91 26 11021 1287 --
NM_033031chrX2207 138 ------
NM_033044chr151179 1084 834 506 386 1960 --195
NM_033083chr353388 3264 2464 1218 472 ----1271
NM_033089chr2071519 1444 1432 1073 567 522 458 1443 --11480
NM_033116chr141198 ------
NM_033119chr16----3119 103 85 --
NM_033121chr12------1616
NM_033132chr1332351 1904 773 ----11544
NM_033135chr1132494 1831 818 3712 153 132 ----
NM_033143chr454632 4601 4415 3797 924 24479 734 23904 3837 --
NM_033181chr633099 1175 936 22692 151 23789 3693 --
NM_033211chr521839 137 1341 --1463
NM_033222chr91963 ------
NM_033224chr775530 3152 2419 2211 1923 891 709 23084 828 12340 --
NM_033225chr821230 870 22587 329 12051 12990
NM_033228chr51155 1242 ----
NM_033254chr3136 ------
NM_033274chr593628 3604 3542 3497 2684 1453 1413 753 414 23070 2992 ----
NM_033281chr51200 ------
NM_033285chr854397 3181 3115 1799 792 11468 --13873
NM_033290chrX42797 2398 1506 1135 13001 13769 11441
NM_033326chr1152171 997 977 188 124 --1194 --
NM_033331chr963074 2380 2363 779 339 105 --22845 2790 11235
NM_033338chr1021355 1189 1261 ----
NM_033339chr1021355 1189 1261 ----
NM_033340chr1021471 1305 1377 ----
NM_033342chr51115 ------
NM_033360chr1252979 2951 2897 2891 1304 --13210 --
NM_033364chr311884 1264 ----
NM_033379chr10------159
NM_033380chrX21064 782 ------
NM_033381chrX21064 782 ------
NM_033394chr261589 1531 1387 355 307 274 ------
NM_033402chr82384 186 --1347 --
NM_033425chr1133367 2862 567 12510 ----
NM_033427chr71178 1550 ----
NM_033430chr433253 2856 259 21401 509 ----
NM_033437chr433253 2856 259 21401 509 ----
NM_033480chr632392 269 171 12934 ----
NM_033481chr632392 269 171 12934 ----
NM_033503chr154830 466 106 94 12725 13630 --
NM_033505chr2106787 6717 6551 6428 5887 5772 5070 4522 2066 701 21672 1241 26585 2141 11396
NM_033512chr852938 2515 2354 765 389 --12883 --
NM_033547chr111154 ------
NM_033631chr163409 3390 3377 2496 1395 824 ------
NM_033632chr441254 1198 619 515 ------
NM_033642chrX31011 829 364 1889 --21137 973
NM_033644chr551587 807 560 367 287 12227 12524 12459
NM_033645chr551587 807 560 367 287 12227 12524 12459
NM_033656chr2155653 5170 4207 1094 170 21866 987 --14161
NM_044472chr13602 506 27 1655 ----
NM_052811chr13115117 4957 4796 4440 4223 3873 3491 3257 2107 330 33 15255 143 13212
NM_052832chr852759 2302 980 677 186 ------
NM_052834chr184490 300 86 61 12211 1539 --
NM_052840chr1541043 550 361 163 11535 ----
NM_052874chr161667 ------
NM_052879chr1273971 3234 2879 985 953 876 296 ------
NM_052900chr851834 1531 620 503 105 1490 --11182
NM_052904chr6--11103 11409 --
NM_052905chr221420 1338 2387 173 ----
NM_052907chr1212719 13556 1298 --
NM_052911chr183858 275 172 160 ----
NM_052917chr252446 1224 1089 393 129 23221 83 ----
NM_052918chr1043477 3464 2673 1220 33436 2828 156 11077 --
NM_052927chr562185 2092 2083 2066 1997 656 ------
NM_052936chrX2910 256 ------
NM_052950chr1352219 1968 1729 334 262 ------
NM_052996chr1621711 1383 11751 ----
NM_053016chr9105906 2317 1683 1257 860 769 540 481 424 129 --21993 1503 --
NM_053024chr341477 1399 1312 38 11447 --11298
NM_053043chr755437 1551 520 296 211 ----12155
NM_053056chr1132639 2204 2032 12651 ----
NM_053064chr1411923 12734 12925 --
NM_053281chrX--2415 400 ----
NM_054012chr9168 ------
NM_054016chr132019 1525 111 1374 ----
NM_054016chr132019 1525 111 1374 ----
NM_054016chr132019 1525 111 1374 ----
NM_054026chr8133 1906 ----
NM_057168chr7--11141 --11528
NM_057175chr451920 1818 749 465 80 1765 --12465
NM_057749chr841366 1174 1070 412 --21225 1161 --
NM_058170chr131472 1234 498 1552 ----
NM_058191chr212850 704 ------
NM_058241chr272158 1807 1667 1532 376 350 100 --22245 51 --
NM_058241chr272158 1807 1667 1532 376 350 100 --22245 51 --
NM_078487chr943003 2817 2214 1211 23177 2181 ----
NM_079420chr2127 ------
NM_079422chr2127 ------
NM_080422chr18--1339 ----
NM_080476chr202315 283 ------
NM_080597chr182281 203 1790 11060 --
NM_080629chr1------11149
NM_080630chr1------11149
NM_080645chr661729 1468 758 659 572 535 11590 12123 --
NM_080647chr221311 ------
NM_080651chr82246 44 ------
NM_080669chr172841 534 14519 11518 --
NM_080676chr2073278 3105 2442 2316 2041 1288 815 13179 1906 --
NM_080683chr41537 ------
NM_080684chr41537 ------
NM_080685chr41537 ------
NM_080686chr6--1153 ----
NM_080717chr12--11518 1415 --
NM_080742chr6193 ------
NM_080743chr652561 2488 1845 989 831 ------
NM_080752chr201407 --1129 --
NM_080759chr1342058 2027 778 264 --11788 --
NM_080760chr1342058 2027 778 264 --11788 --
NM_080832chrX11501 11490 ----
NM_080840chr20--166 ----
NM_080841chr20--166 ----
NM_080867chr1444878 1527 899 167 1417 14511 --
NM_080872chr853806 3107 1454 1259 962 --12573 1816
NM_080874chr451890 623 406 223 167 ------
NM_080921chr121225 759 1885 ----
NM_080927chr343276 2044 587 507 ------
NM_130385chr1173079 3020 2573 1988 1280 1269 1250 13161 --11295
NM_130391chr963593 1196 1182 881 683 323 23575 3448 ----
NM_130392chr963593 1196 1182 881 683 323 23575 3448 ----
NM_130393chr963593 1196 1182 881 683 323 23575 3448 ----
NM_130434chr151478 1374 ----
NM_130435chr1042458 1888 756 119 22878 152 ----
NM_130439chr1032210 2107 1890 --1680 21565 1548
NM_130439chr1032210 2107 1890 --1680 21565 1548
NM_130797chr741665 661 494 462 ------
NM_130798chr1531280 559 411 ------
NM_130811chr2051011 990 921 883 345 1286 --11042
NM_130838chr1531609 1459 1396 11320 ----
NM_130839chr1531609 1459 1396 11320 ----
NM_130902chr4131 ------
NM_133177chr11955 ------
NM_133178chr11955 ------
NM_133265chrX63245 3065 2931 2306 723 241 12511 ----
NM_133329chr231197 162 76 --1757 --
NM_133330chr422946 554 1870 ----
NM_133331chr422946 554 1870 ----
NM_133334chr476051 5383 4932 4265 2299 689 337 16340 15135 --
NM_133335chr422946 554 1870 ----
NM_133370chr433409 648 25 --2741 584 --
NM_133372chr582829 2545 2271 2248 1838 1126 1098 443 ------
NM_133378chr23969 192 166 1879 1957 --
NM_133432chr23969 192 166 1879 1957 --
NM_133433chr53737 612 242 ------
NM_133437chr23969 192 166 1879 1957 --
NM_133443chr1631720 1618 265 ------
NM_133445chr953450 3181 2651 2608 388 --1361 --
NM_133468chr731638 222 206 ------
NM_133476chr1221139 294 ------
NM_133477chr472723 2705 2680 2632 2547 2155 1138 13197 11240 12483
NM_133486chrX2400 307 ------
NM_133493chr644225 1508 1062 58 ----14615
NM_133496chr174082 3588 2817 1474 1121 553 517 23277 547 ----
NM_133507chr12--1224 --2736 236
NM_133631chr32522 173 11074 ----
NM_133633chr22--11249 ----
NM_133638chr51301 ------
NM_133646chr2115332 5239 4913 4598 3898 3710 2096 1769 1747 589 404 11794 ----
NM_133647chr1543741 3132 2455 716 ------
NM_134265chr173986 352 322 ----11023
NM_134428chr91326 --1334 --
NM_134442chr231706 1362 671 1508 11385 --
NM_134470chr31169 --1182 1644
NM_138270chrX62224 1344 1146 935 863 242 ----31331 986 30
NM_138288chr1422141 386 32177 895 625 11969 --
NM_138290chr73296 119 92 ------
NM_138316chr1041256 940 495 440 --156 --
NM_138340chr18----1198 --
NM_138370chr21774 ------
NM_138391chr13400 310 300 ------
NM_138395chr231029 756 435 1258 ----
NM_138423chr1531778 1738 748 11701 --11574
NM_138444chr1354952 4451 3988 3492 369 11231 ----
NM_138448chr22412 396 ------
NM_138459chr663231 2283 717 697 626 516 11476 13024 --
NM_138468chr264786 4706 2380 1738 814 365 22546 697 ----
NM_138473chr1243909 3504 1651 767 ----13460
NM_138485chr3189 ------
NM_138494chr732522 663 126 --1337 1688
NM_138576chr1444703 4597 3435 1099 ----11506
NM_138609chr51155 1212 ----
NM_138610chr51155 1212 ----
NM_138633chr651799 1599 1259 495 351 11264 --1160
NM_138635chr722952 284 22697 44 22075 2008 11228
NM_138638chr1442242 2140 2114 789 1561 ----
NM_138639chr191135 ------
NM_138689chr11----1187 --
NM_138694chr623255 1165 3995 668 247 --22792 1279
NM_138711chr31144 ----1206
NM_138712chr31144 ----1206
NM_138713chr16117618 7170 6429 5195 2408 2285 2161 1997 1569 664 401 48204 7878 6068 5627 66660 5187 2919 2418 342 269 23144 2847
NM_138714chr16117618 7170 6429 5195 2408 2285 2161 1997 1569 664 401 48204 7878 6068 5627 66660 5187 2919 2418 342 269 23144 2847
NM_138731chr1453225 837 527 174 104 23792 3148 --12869
NM_138771chr751513 1405 1332 978 477 --174 --
NM_138773chr52828 54 ------
NM_138782chr521676 1616 11803 12298 --
NM_138819chrX1463 --1381 --
NM_138927chr211342 ------
NM_138959chr196291 5764 5686 4307 2643 1947 1511 795 350 11172 --1105
NM_138966chr183421 201 142 ------
NM_138970chr1452241 2050 1892 1603 931 1781 12161 --
NM_138971chr1133762 2992 472 ------
NM_138971chr1133762 2992 472 ------
NM_138972chr1133762 2992 472 ------
NM_138972chr1133762 2992 472 ------
NM_138973chr1133762 2992 472 ------
NM_138973chr1133762 2992 472 ------
NM_138980chr41220 1624 ----
NM_138981chr41351 1755 ----
NM_138982chr41220 1624 ----
NM_139035chrX4732 638 574 491 ------
NM_139048chr321025 256 1237 1130 --
NM_139071chr1221566 661 ------
NM_139072chr21299 2873 744 ----
NM_139076chr431462 968 66 ------
NM_139126chr63681 635 99 --1212 --
NM_139135chr121050 482 ------
NM_139168chr551426 608 395 155 131 ------
NM_139201chr123717 131 94 ------
NM_139207chr1242087 1806 461 423 --1232 --
NM_139239chr191247 ------
NM_139244chr63974 726 628 ------
NM_139276chr1722237 339 21806 467 12377 --
NM_139281chr572705 2523 2175 1350 1181 975 236 12644 1983 1485
NM_139283chr1272556 1999 1598 596 557 509 478 --22272 824 --
NM_139312chr1031005 548 27 11216 ----
NM_139316chr721002 79 ------
NM_139318chr142276 193 124 ----
NM_139321chr202436 256 23999 3481 ----
NM_144498chr2022195 1980 1628 ----
NM_144563chr24821 774 747 605 1617 1169 --
NM_144563chr24821 774 747 605 1617 1169 --
NM_144567chr142677 2380 498 44 ----12258
NM_144570chr1662369 1091 1045 603 535 503 12488 ----
NM_144571chr486534 5746 5272 4481 1393 1199 130 36 25642 2766 15440 15069
NM_144574chr141548 ------
NM_144578chr14105476 4792 4280 2184 1769 1434 1343 1325 848 772 22119 1741 2337 80 --
NM_144591chr103453 393 137 1185 ----
NM_144595chr133956 779 130 ------
NM_144599chr1575457 4623 4370 941 513 399 347 ------
NM_144600chr1641192 681 667 207 ------
NM_144604chr161537 ------
NM_144609chr173433 397 117 --11418 --
NM_144628chr2062797 2596 2467 1208 900 716 12167 ----
NM_144632chr241713 1683 759 114 --22161 844 --
NM_144633chr311005 --1373 --
NM_144642chr321284 236 1945 ----
NM_144643chr41125 --1404 --
NM_144644chr41184 ------
NM_144657chrX2196 112 --1581 --
NM_144660chr101394 ------
NM_144721chr451756 1066 724 576 138 12653 --1853
NM_144728chr11862 --127 --
NM_144729chr11862 --127 --
NM_144778chr1312041 11955 158 --
NM_144949chr272364 2112 2086 979 911 780 298 2895 26 ----
NM_144963chr842176 1840 378 22 ------
NM_144967chrX------11047
NM_144973chr1255174 3589 1463 929 778 24755 1488 25190 440 --
NM_144974chr132870 619 1169 ----
NM_144979chr43571 564 72 1597 --1654
NM_144982chr121793 ------
NM_145000chr5--1626 ----
NM_145005chr94699 197 134 104 ------
NM_145012chr102970 811 ------
NM_145018chr111258 1282 --1251
NM_145025chr621124 141 --1189 --
NM_145036chr171386 1299 ----
NM_145044chr361811 1602 1587 1472 386 362 ------
NM_145049chr521055 994 ------
NM_145055chr1843631 3587 3124 1369 --32892 2573 1361 --
NM_145115chr721705 801 12126 ----
NM_145117chr1142971 2329 254 241 ------
NM_145159chr144653 595 308 218 ------
NM_145175chr21891 11362 21437 990 --
NM_145203chr131947 2888 332 ----
NM_145206chr1052787 2722 2310 2041 1059 42449 637 392 261 ----
NM_145234chrX2914 358 ------
NM_145251chr1451361 1164 654 377 117 2423 413 --11647
NM_145259chr2107056 5950 5294 2829 2781 2270 2250 2109 1594 488 25094 945 --15265
NM_145274chr173720 620 312 ------
NM_145284chrX92241 1780 773 714 616 607 589 471 254 22284 204 12332 --
NM_145296chr19--1848 ----
NM_145305chrX11221 ----11322
NM_145307chr1054700 1828 1721 511 247 33419 2961 2951 33602 1757 1266 --
NM_145331chr64853 644 148 132 ------
NM_145332chr641001 792 296 280 ------
NM_145333chr641001 792 296 280 ------
NM_145341chr1041674 1626 1314 63 ------
NM_145350chr1711565 21613 1078 ----
NM_145351chr1712705 22753 2218 ----
NM_145649chr642756 1810 634 228 --1264 --
NM_145655chr642756 1810 634 228 --1264 --
NM_145686chr263150 2773 2647 2522 1243 973 13266 ----
NM_145687chr263150 2773 2647 2522 1243 973 13266 ----
NM_145690chr82722 641 ------
NM_145693chr211007 1600 ----
NM_145728chr1532415 2184 594 32467 2193 522 12353 --
NM_145735chr1352860 2776 2370 2060 71 ------
NM_145739chr23546 384 199 ------
NM_145803chr113574 461 124 ------
NM_145805chr15----3571 469 116 --
NM_145808chr752207 2127 1144 900 169 --1605 --
NM_145858chr212418 75 1352 ----
NM_147150chr953791 2911 2770 1397 311 23256 1155 ----
NM_147175chrX31970 1929 1484 --21997 268 --
NM_147181chr42346 89 ------
NM_147182chr42346 89 ------
NM_147183chr42346 89 ------
NM_147189chr82895 105 11622 11430 --
NM_147190chr121719 ------
NM_147233chr212123 --12100 --
NM_148174chr822082 1796 ------
NM_148894chr42170 141 ------
NM_148955chr1536547 5855 4751 12402 11621 16479
NM_148957chr1352577 2127 807 158 61 --12515 --
NM_148977chr1041256 940 495 440 --156 --
NM_148978chr1041256 940 495 440 --156 --
NM_152221chr22--11248 ----
NM_152233chr1421463 377 ------
NM_152237chr2221676 1132 ------
NM_152261chr1242145 2072 1933 562 22572 766 11945 159
NM_152265chr141342 1327 1302 404 ------
NM_152281chr11629 1907 1771 1879
NM_152282chr361216 1033 924 188 121 100 1398 1167 --
NM_152287chr1622307 709 --11816 --
NM_152289chr1921115 1066 21718 390 ----
NM_152291chr41678 11092 ----
NM_152298chr11663 --1709 --
NM_152309chr1022157 376 ----22259 124
NM_152323chr121153 ------
NM_152330chr1462398 2224 1847 488 472 43 12217 ----
NM_152352chr1832520 2382 2212 12909 --22395 807
NM_152363chr191209 ------
NM_152390chr22638 532 ------
NM_152400chr441973 1608 1365 22 ------
NM_152408chr5----188 --
NM_152409chr553037 2942 2440 1235 1091 12927 --13058
NM_152412chr8173 --21494 320 --
NM_152414chr841327 1231 1157 1042 ------
NM_152421chr91224 ------
NM_152422chr931737 478 120 --1496 --
NM_152424chrX74275 4166 3520 3480 3358 1491 565 14720 24386 3591 --
NM_152429chr1031520 1453 395 --11379 --
NM_152433chr1121741 1163 148 1397 21696 620
NM_152437chr1222363 116 --12429 --
NM_152446chr14121 ------
NM_152447chr14197 ------
NM_152450chr1541476 800 407 95 1179 --1606
NM_152455chr15146 ------
NM_152487chr11974 --1102 --
NM_152512chr22--1392 ----
NM_152520chr21786 1834 ----
NM_152522chr23167 46 23 1377 1874 --
NM_152523chr21493 1749 ----
NM_152525chr21153 ------
NM_152545chr4--1428 ----
NM_152556chr762154 2027 1649 303 133 48 ------
NM_152557chr711481 1123 ----
NM_152564chr831891 1736 609 186 11550 --
NM_152574chr91338 ------
NM_152608chr131820 1768 825 ------
NM_152613chr222932 356 ------
NM_152621chr4--1259 ----
NM_152622chr553410 3139 2834 2538 1391 22283 1068 --13271
NM_152624chr597432 7135 7015 6670 6217 4824 2944 2669 234 12738 --11774
NM_152629chr973988 3864 3310 552 434 188 45 13456 ----
NM_152638chr1231243 926 293 ------
NM_152641chr1242601 2526 1781 917 12617 12632 --
NM_152660chr12957 742 ----1770
NM_152665chr13326 234 227 11094 1511 --
NM_152667chr2051357 1250 346 269 157 146 ----
NM_152676chr18122 ------
NM_152678chr332588 594 573 ------
NM_152688chr61282 4888 608 396 346 ----
NM_152695chrX21490 559 --11807 --
NM_152699chr363555 2557 2466 749 179 53 --1124 --
NM_152707chr101873 --21047 339 --
NM_152721chr181689 --2727 617 --
NM_152727chr16----1281 --
NM_152734chr611141 11700 ----
NM_152737chr621530 387 --12131 --
NM_152739chr731111 848 435 ------
NM_152744chr762823 2323 1216 955 928 832 163 --1859
NM_152745chr731087 979 400 ------
NM_152754chr731482 1396 836 1108 --23827 1368
NM_152756chr543853 3413 1624 996 1415 23929 2687 14360
NM_152758chr833074 2851 742 1331 1866 --
NM_152765chr842137 1919 1897 350 11811 --1209
NM_152772chr121363 ------
NM_152773chr3------166
NM_152787chrX33159 1404 460 23033 2818 23377 544 1308
NM_152789chr741304 1248 994 507 1978 ----
NM_152793chr755194 3513 3454 3177 887 1825 --14199
NM_152826chr1536547 5855 4751 12402 11621 16479
NM_152835chr152921 2430 2361 917 521 --12748 --
NM_152838chr20113394 2262 2215 1024 811 571 543 525 436 100 64 --33306 185 42 --
NM_152889chr31705 ------
NM_152890chr131171 810 516 --2968 48 --
NM_152896chr92798 617 ------
NM_152902chr111371 --11393 21984 1848
NM_152905chr12177 ------
NM_152924chr1596885 5965 5576 4437 4278 2723 1496 590 277 1620 1219 11021
NM_152989chr1241604 1331 1279 641 ------
NM_152991chr112679 600 ------
NM_152995chr42877 132 153 ----
NM_152999chr754471 3853 1673 884 262 1114 14910 11407
NM_153013chr532056 237 95 ------
NM_153020chr621695 29 --11359 --
NM_153035chr142733 1221 1185 257 22897 1988 ----
NM_153050chr2244612 4384 3157 477 11893 --12016
NM_153051chr2244612 4384 3157 477 11893 --12016
NM_153181chr183421 201 142 ------
NM_153184chr331872 606 232 11224 11548 --
NM_153186chr92235 52 ------
NM_153188chr574735 4336 3804 3663 3514 2113 1978 34453 4349 1645 23501 1361 --
NM_153201chr11128 ------
NM_153207chr1252537 2477 1084 1039 310 13304 14056 11236
NM_153235chr642407 1787 916 163 1301 ----
NM_153260chr1531396 1112 88 ------
NM_153261chr1621072 636 1584 11291 --
NM_153262chr122587 520 23218 2214 23037 2206 22076 233
NM_153321chr172226 145 ------
NM_153322chr172226 145 ------
NM_153332chr842238 1119 888 39 33230 3128 2091 ----
NM_153353chr3143 ------
NM_153354chr52619 348 ----1200
NM_153365chr422483 2136 12615 12576 --
NM_153367chr1033327 3067 2734 --1187 --
NM_153426chr41636 ------
NM_153427chr41636 ------
NM_153456chr1365271 4257 4187 2497 2204 1217 25993 767 56265 2346 1808 799 607 --
NM_153464chr191789 ------
NM_153499chr1241172 516 372 27 --12445 --
NM_153500chr1241172 516 372 27 --12445 --
NM_153605chr331505 634 596 ------
NM_153607chr5103171 2792 2699 2030 1940 1122 898 407 392 123 12661 ----
NM_153610chr51461 1584 ----
NM_153613chr15193 ------
NM_153616chr1511881 1485 ----
NM_153617chr1511881 1485 ----
NM_153618chr1511881 1485 ----
NM_153619chr1553119 2687 983 503 27 ------
NM_153620chr7--11570 --11282
NM_153633chr121542 ------
NM_153634chr1251488 1366 629 295 206 ------
NM_153645chr2273234 3206 2587 2476 2463 2062 38 ------
NM_153689chr262338 1719 893 800 673 291 --22072 317 --
NM_153690chr32864 798 ------
NM_153715chr731017 397 297 --21237 846 --
NM_153809chr91578 ------
NM_153810chr1074521 3922 3838 3804 1712 557 190 24700 530 ----
NM_153812chr121640 306 2779 628 12345 1316
NM_153827chr17--1750 ----
NM_153828chr21120 --1841 --
NM_170606chr71321 ------
NM_170663chr17--1750 ----
NM_170665chr1284095 4012 777 684 520 509 492 56 --11693 11649
NM_170674chr1521265 1207 ------
NM_170675chr152941 883 ------
NM_170676chr152941 883 ------
NM_170677chr1521265 1207 ------
NM_170679chr521074 38 ----176
NM_170692chr141056 346 316 94 --1302 --
NM_170695chr181297 ----1114
NM_170706chr144333 3594 2978 1489 21180 115 11612 --
NM_170709chr83409 397 284 ------
NM_170721chr1751343 1188 1179 177 34 ------
NM_170724chr631009 354 120 1102 11000 --
NM_170731chr1142649 2599 512 434 12539 12084 --
NM_170732chr1142649 2599 512 434 12539 12084 --
NM_170733chr1142649 2599 512 434 12539 12084 --
NM_170734chr1142649 2599 512 434 12539 12084 --
NM_170735chr1142649 2599 512 434 12539 12084 --
NM_170750chrX1355 1846 ----
NM_170775chr51220 --1209 --
NM_172037chr841408 1043 1009 377 ----178
NM_172058chr841685 1649 317 125 ------
NM_172059chr841685 1649 317 125 ------
NM_172060chr841685 1649 317 125 ------
NM_172071chr197344 6358 5895 5643 5035 4550 2079 1397 1080 37295 4978 916 --16853
NM_172078chr7--1152 ----
NM_172079chr7--1152 ----
NM_172080chr7--1152 ----
NM_172081chr7--1152 ----
NM_172082chr7--1152 ----
NM_172083chr7--1152 ----
NM_172084chr7--1152 ----
NM_172127chr46747 720 624 429 378 217 3736 550 30 21661 1514 --
NM_172128chr46703 676 580 385 334 173 2692 506 21617 1470 --
NM_172159chr33673 612 103 --1241 1462
NM_172160chr33673 612 103 --1241 1462
NM_172164chr11663 --1709 --
NM_172169chr1041967 1717 650 245 ------
NM_172170chr1041967 1717 650 245 ------
NM_172171chr1041967 1717 650 245 ------
NM_172173chr1041967 1717 650 245 ------
NM_172218chr8--2283 235 ----
NM_172226chr1241172 516 372 27 --12445 --
NM_172315chr1521265 1207 ------
NM_172316chr1521265 1207 ------
NM_172337chr142889 372 ------
NM_172344chr231197 162 76 --1757 --
NM_172354chr141972 1933 1835 179 ------
NM_172373chr1351056 260 176 140 30 3939 446 36 --1114
NM_172375chr1421210 1127 1958 ----
NM_172387chr1861744 1301 1267 1244 1112 407 ------
NM_172388chr1861791 1348 1314 1291 1159 454 ------
NM_172389chr1861791 1348 1314 1291 1159 454 ------
NM_173054chr72858 47 ------
NM_173074chr2188 ------
NM_173082chr62330 183 ----1480
NM_173083chr12219 38 ----1169
NM_173084chr35960 779 573 270 134 12303 --148
NM_173156chr141709 1656 1407 419 1426 11416 --
NM_173164chr16293 57 ------
NM_173198chr942933 1073 372 51 --21957 1864 1279
NM_173199chr91169 ------
NM_173200chr942933 1073 372 51 --21957 1864 1279
NM_173207chr181297 ----1114
NM_173208chr181297 ----1114
NM_173209chr181297 ----1114
NM_173210chr181297 ----1114
NM_173211chr181297 ----1114
NM_173214chr16117618 7170 6429 5195 2408 2285 2161 1997 1569 664 401 48204 7878 6068 5627 66660 5187 2919 2418 342 269 23144 2847
NM_173354chr211368 --11947 --
NM_173359chr32528 324 135 ----
NM_173468chr475917 5897 5414 5246 91 67 26 12414 25082 172 --
NM_173469chr1551431 1352 561 380 36 ----1527
NM_173470chrX32753 2358 1012 11070 12068 --
NM_173471chr311039 ------
NM_173473chr10------1111
NM_173475chr1621177 444 11228 ----
NM_173478chr17------1871
NM_173494chrX2636 74 ------
NM_173495chrX3426 359 203 12275 ----
NM_173496chr1042914 2203 1957 965 11029 --11066
NM_173508chr1----21086 901 --
NM_173510chr2232356 1934 655 1501 12121 --
NM_173511chr233940 3847 565 23387 1208 33899 2954 892 --
NM_173515chr63988 690 337 21013 873 ----
NM_173518chr81164 --1101 165
NM_173519chr831712 1316 532 ------
NM_173548chr191529 ------
NM_173550chr9152 ------
NM_173552chr322277 1677 --12115 1283
NM_173557chr182651 196 1502 ----
NM_173560chr63512 408 120 ------
NM_173563chr62293 122 ------
NM_173576chr1032139 500 144 --11613 1933
NM_173582chr11115489 4769 4556 4370 4116 3914 3811 2078 1870 1648 1430 34235 1150 840 1463 25615 2050
NM_173595chr1215331 ----1261
NM_173602chr123732 723 709 1433 ----
NM_173609chr151110 ------
NM_173631chr192858 368 21306 1192 1943 --
NM_173642chr1129188 8962 7571 7565 7332 6750 6329 3443 2879 725 656 292 38563 7099 5881 18235 --
NM_173644chr2052003 1954 1886 1843 1816 --1658 11755
NM_173645chr21454 ----1141
NM_173653chr331473 1276 591 11263 ----
NM_173654chr312307 11791 2189 140 --
NM_173665chr5------1201
NM_173667chr532328 1664 275 12205 ----
NM_173683chr811736 ------
NM_173694chrX42513 2266 1748 687 1406 11763 --
NM_173797chr521375 89 ------
NM_173802chr12--1106 ----
NM_173803chr1651645 1526 603 551 386 11589 ----
NM_173808chr133903 3457 140 33910 669 78 14424 13387
NM_173814chr152471 456 1407 1531 --
NM_173822chr221961 1613 ------
NM_173829chr5106094 5880 5866 5806 4710 4229 3963 1763 201 75 --1369 --
NM_173830chr62246 188 1684 ----
NM_173848chr81144 1237 ----
NM_173851chr863594 3163 2527 2495 2444 1562 --12450 --
NM_174886chr181297 ----1114
NM_174890chr101235 ------
NM_174900chr4169 ------
NM_174911chr851277 1213 863 657 379 11309 11571 --
NM_174916chr1531645 657 160 ------
NM_174921chr431116 394 127 1809 ----
NM_175056chr352214 1371 630 419 309 --1174 --
NM_175061chr742008 1563 1445 306 147 ----
NM_175566chr11--1352 ----
NM_175607chr371390 1260 1169 1077 1055 88 25 ----11717
NM_175610chr1521167 110 -----