TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4766-5p
miRNA Sequence: UCUGAAAGAGCAGUUGGUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11123518 3417 3091 2724 1273 1052 834 794 693 199 52 26 1860 --1822
NM_000052chrX122547 2435 1181 1172 923 821 654 627 457 222 162 75 53060 2136 1385 592 488 32620 2167 1376 --
NM_000055chr31339 --1324 --
NM_000084chrX86962 5884 5451 4945 4415 4281 661 452 12366 ----
NM_000089chr72698 225 ------
NM_000091chr232276 163 33 1498 12633 --
NM_000092chr283911 3825 3450 3268 1554 1471 597 461 43514 3370 1512 717 24501 108 --
NM_000093chr932510 2081 628 1830 ----
NM_000097chr32402 360 2775 440 ----
NM_000104chr283111 2838 2721 854 621 548 540 480 32224 444 28 12950 --
NM_000108chr771795 1295 532 526 420 268 197 ------
NM_000109chrX62600 2497 2059 1721 668 218 ----12308
NM_000110chr141006 938 59 33 ----11165
NM_000114chr202330 199 ------
NM_000115chr1392574 1903 1637 897 872 727 617 466 410 41942 1863 1835 542 12360 --
NM_000125chr653836 3712 3640 542 515 ------
NM_000138chr1592391 2379 2361 1805 913 731 434 329 103 ------
NM_000141chr1021240 554 --1588 --
NM_000142chr441385 1171 1097 571 ------
NM_000151chr1731694 671 394 31931 1559 1551 --1210
NM_000161chr1441853 527 311 89 ------
NM_000165chr641186 1105 686 436 ------
NM_000168chr7163100 2501 2411 2343 2310 2080 1231 1178 862 689 433 289 208 149 101 84 33111 2665 2448 --33307 2388 335
NM_000176chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_000189chr252006 1805 1590 781 734 ------
NM_000192chr1241344 1280 447 111 ------
NM_000194chrX4560 491 480 430 ------
NM_000202chrX93857 3170 3136 3072 2747 1242 993 520 363 33231 1377 717 ----
NM_000208chr1974665 4321 3775 3600 3484 894 587 --24230 3148 --
NM_000214chr2021667 1158 ------
NM_000216chrX94071 3592 3536 3130 2899 1406 1037 730 265 ------
NM_000217chr12115301 4776 4463 4013 3713 3330 2123 1164 975 220 187 ----1802
NM_000227chr182363 292 ------
NM_000237chr831921 157 73 21215 497 --1392
NM_000240chrX51768 1506 674 179 36 1352 ----
NM_000242chr1072625 2508 2123 2086 829 447 290 ------
NM_000245chr741621 511 467 52 11580 ----
NM_000248chr3103084 2507 2029 1219 1070 955 738 688 589 116 1154 ----
NM_000252chrX51243 1070 570 517 55 ------
NM_000259chr15136249 5996 5965 5709 5697 5590 5277 2278 1690 1596 992 186 156 15652 --12111
NM_000264chr973123 2757 2509 2225 792 501 341 --13212 --
NM_000267chr17102887 2878 2573 2464 1297 1114 966 783 433 281 13428 1489 --
NM_000276chrX32134 1863 615 32044 1901 60 --1185
NM_000280chr112771 239 --183 --
NM_000282chr132177 59 ------
NM_000284chrX11846 --11537 --
NM_000289chr124346 109 94 82 ------
NM_000291chrX5768 752 641 629 219 ------
NM_000297chr461853 1365 779 483 462 315 ------
NM_000313chr321091 823 1339 ----
NM_000314chr10103070 3041 2806 2714 2639 2438 2168 2082 1101 1004 ------
NM_000321chr1341652 1584 1108 620 --11387 --
NM_000325chr42646 201 1549 ----
NM_000332chr6187181 6861 5990 5743 5545 4972 4447 2771 2703 2487 2111 1964 1515 1394 1266 1246 639 109 34501 1874 1058 16401 --
NM_000333chr37981 916 908 871 727 407 236 ------
NM_000335chr351448 1366 745 319 46 --12093 --
NM_000337chr5116421 5062 4828 4793 4605 4470 2523 1106 660 508 225 --1416 --
NM_000340chr341060 600 547 265 ------
NM_000345chr461004 963 381 371 187 174 1702 ----
NM_000368chr953036 2971 1543 1420 1100 34486 1828 654 34647 4314 1119 --
NM_000378chr1131249 810 59 --1199 --
NM_000390chrX63439 3350 2765 2639 1375 595 43422 2787 928 370 12484 --
NM_000393chr251895 1821 1455 318 217 ------
NM_000401chr1121126 307 --2453 427 --
NM_000408chr283008 2993 2777 2634 2442 2144 237 208 ------
NM_000421chr172265 61 ------
NM_000430chr1773252 2613 1432 1080 984 888 102 1483 ----
NM_000444chrX4298 116 106 99 ------
NM_000445chr8171 ------
NM_000446chr711041 ------
NM_000448chr1163205 2376 1184 820 708 379 13132 21055 192 --
NM_000449chr11177 --11380 --
NM_000452chr1351546 1393 752 473 143 ------
NM_000461chr384486 4373 3543 2822 1470 815 692 480 --32971 457 449 --
NM_000462chr1571646 1585 1528 1329 1225 279 207 --11561 --
NM_000474chr72519 191 ------
NM_000477chr41216 ------
NM_000484chr2131092 1056 718 ------
NM_000489chrX163411 3356 3219 2661 2567 2428 2353 1168 1115 1016 907 759 722 246 59 50 33401 2175 1151 1318 --
NM_000493chr641113 1103 1054 970 ------
NM_000495chrX21007 386 ------
NM_000503chr861758 1247 1205 645 326 239 ------
NM_000523chr221066 430 ------
NM_000533chrX51681 1626 1493 584 299 --1195 11956
NM_000553chr82647 625 ------
NM_000555chrX167623 7233 6753 5936 5827 5098 2616 2536 2417 1872 1390 1327 977 901 279 99 17251 21509 918 --
NM_000598chr71200 ------
NM_000599chr274329 1416 1315 1052 1031 868 408 2790 728 ----
NM_000609chr1052256 1908 723 186 145 ------
NM_000610chr1182863 2415 2224 2148 1855 972 264 116 22931 511 ----
NM_000614chr1151099 1022 813 475 168 ------
NM_000615chr1152818 2781 2549 788 677 22852 410 2476 423 --
NM_000617chr1231868 1506 463 --12275 --
NM_000618chr12156164 6113 5962 5819 5813 5675 5193 4878 4712 1595 1568 1165 895 715 230 1634 ----
NM_000618chr12156164 6113 5962 5819 5813 5675 5193 4878 4712 1595 1568 1165 895 715 230 1634 ----
NM_000621chr136576 562 320 271 205 49 ----11024
NM_000627chr24922 884 609 368 ------
NM_000633chr1895070 5036 5028 4920 3701 3580 1184 896 753 24087 3721 23968 962 --
NM_000637chr85534 424 231 198 137 ------
NM_000663chr1662850 2829 2780 2486 2141 80 ------
NM_000668chr441030 428 362 167 ------
NM_000676chr172218 70 ------
NM_000686chrX41552 1503 1497 383 11296 1159 --
NM_000693chr1531739 1506 1250 ------
NM_000719chr1285648 5247 5096 1605 1596 853 754 353 21676 64 ----
NM_000735chr62245 194 ------
NM_000788chr481475 1446 1436 1362 1311 1210 1042 1036 21340 995 ----
NM_000793chr1483892 3885 3427 3265 1942 1629 1004 160 23833 2059 ----
NM_000801chr203729 289 264 --1757 --
NM_000806chr561452 1290 726 714 633 124 11590 ----
NM_000809chr4339039 8819 8341 8251 8244 8115 8077 7714 7474 7465 7448 7149 6873 6846 6605 6573 6443 6422 5889 5745 3678 3395 3112 3081 2834 2752 1586 1414 1170 987 906 669 301 33727 1691 191 ----
NM_000811chr52678 552 ------
NM_000813chr5115576 5451 5298 4644 4500 3945 3732 1985 1381 1290 628 11779 ----
NM_000814chr1543516 580 431 21 22678 1170 ----
NM_000817chr21389 11212 ----
NM_000824chr44824 758 92 58 ------
NM_000826chr4112554 2527 2108 1849 1689 985 964 688 589 571 562 --1267 --
NM_000827chr572567 2468 2435 2278 1979 1655 199 1475 ----
NM_000828chrX81822 1724 1707 1606 858 756 592 136 11876 ----
NM_000855chr11190 ----1279
NM_000859chr541731 1641 1601 1576 ----21178 150
NM_000868chrX32379 774 711 ------
NM_000875chr15106546 6538 6184 5791 5577 2453 2212 1215 511 186 12812 ----
NM_000876chr631410 362 113 ------
NM_000880chr82872 815 179 ----
NM_000885chr241771 567 226 106 22141 464 11640 --
NM_000891chr17113426 2998 2672 2613 2559 2492 2428 2368 1459 921 904 ------
NM_000899chr12133850 3826 3428 2955 2936 2782 1588 1548 1498 1392 1273 435 30 13578 12969 --
NM_000901chr452045 1961 1796 967 298 11555 12192 --
NM_000902chr373254 2987 1077 997 984 818 450 1718 ----
NM_000908chr53772 584 189 ------
NM_000917chr102317 173 --2878 77 --
NM_000922chr115435 395 363 320 180 ------
NM_000926chr11199262 9153 9017 8598 8581 8347 7652 7343 7039 5916 3724 3692 3198 1987 1420 1011 908 503 169 59314 8296 7203 6752 3493 28186 7903 --
NM_000933chr2041587 1552 1526 1325 11116 ----
NM_000944chr472380 2019 1917 1854 724 362 234 ------
NM_000945chr251969 1842 676 454 292 ------
NM_000950chrX113011 2542 2531 2460 2370 2272 1427 1377 1178 931 890 32851 2761 2656 12315 --
NM_000958chr53873 844 150 ------
NM_000959chr1103695 3226 3067 3003 2431 1321 691 669 185 65 43868 3085 1372 749 11432 11414
NM_000963chr172438 2060 1529 764 740 718 159 11940 ----
NM_000964chr171559 ------
NM_000965chr341202 851 482 137 ------
NM_000975chr1139 ------
NM_000990chr1193785 3775 3765 3669 2951 2712 1131 815 605 ------
NM_001001132chr2181398 1341 1158 970 933 494 356 321 ------
NM_001001323chr12123151 3136 3113 2970 2793 2553 2537 2442 2370 1208 838 351 ------
NM_001001330chr1051249 898 891 253 130 ------
NM_001001331chr341736 1689 346 195 ------
NM_001001389chr1182863 2415 2224 2148 1855 972 264 116 22931 511 ----
NM_001001390chr1182863 2415 2224 2148 1855 972 264 116 22931 511 ----
NM_001001391chr1182863 2415 2224 2148 1855 972 264 116 22931 511 ----
NM_001001392chr1192909 2461 2270 2194 1901 1871 1018 310 162 22977 557 ----
NM_001001395chr12132798 2765 2447 2307 2292 2166 1961 814 759 695 637 567 47 1728 ----
NM_001001396chr194055 3850 3743 3240 1346 1078 823 758 367 --14098 --
NM_001001419chr5103354 3216 2088 2063 1022 873 856 843 420 278 23963 53 14775 12098
NM_001001420chr5103354 3216 2088 2063 1022 873 856 843 420 278 23963 53 14775 12098
NM_001001433chr2032375 1993 360 1284 13004 --
NM_001001436chr163871 802 599 ------
NM_001001481chr8112988 2887 2729 2706 2672 2303 1027 649 384 201 128 13385 ----
NM_001001556chr1551455 1343 506 238 135 ------
NM_001001557chr852021 1651 1640 1545 214 --1711 --
NM_001001664chr2194029 3992 3707 3577 3179 3127 2776 2590 1655 1344 1312 1234 937 847 598 562 556 146 39 1951 ----
NM_001001668chr1944268 1391 1272 169 1377 1558 --
NM_001001701chr481564 1495 1446 650 505 331 241 131 1833 --12203
NM_001001870chr171797 ------
NM_001001890chr2183842 3573 3429 3299 2749 1517 1477 977 33664 2919 1033 ----
NM_001001924chr881651 1403 1293 718 549 391 299 232 ------
NM_001001925chr881651 1403 1293 718 549 391 299 232 ------
NM_001001928chr22148324 7420 6621 6290 6109 5851 5160 3190 3175 2615 2424 1515 1493 1250 35150 2588 1656 12655 --
NM_001001931chr881651 1403 1293 718 549 391 299 232 ------
NM_001001938chr993371 3353 3270 1281 1068 933 626 489 87 ------
NM_001001971chr1041265 1057 425 28 21220 1203 ----
NM_001001974chr1072161 1919 1874 1629 906 95 51 ----12304
NM_001001995chrX41261 733 602 21 ------
NM_001002233chr872089 1941 1757 367 349 183 46 ----1607
NM_001002257chr293530 3427 2851 2584 2576 1249 1119 1106 1100 13434 23139 273 --
NM_001002294chr12314 80 ------
NM_001002814chr84367 349 183 46 13282 --1607
NM_001002838chrX61504 1393 1373 524 221 49 21421 39 ----
NM_001002843chr1571168 1081 824 390 338 275 22 ------
NM_001002860chr14144631 3837 3733 3693 3599 3292 3078 1404 1327 1316 537 524 401 377 --33752 3621 1488 --
NM_001002906chrY3459 425 120 1128 ----
NM_001002926chr762336 2030 1821 848 454 67 1773 ----
NM_001003407chr1084832 3664 3580 3242 1122 1067 1031 250 ------
NM_001003408chr1084832 3664 3580 3242 1122 1067 1031 250 ------
NM_001003652chr18258625 8515 8461 8377 7954 7122 6985 6833 6710 6250 5941 5337 3266 2840 2595 2313 1642 1633 1562 1552 1330 979 556 504 363 16075 27420 7209 15903
NM_001003674chr18216981 6928 6868 6795 6658 6644 6051 5927 5636 5436 5379 4951 4838 4514 4499 2647 2434 1655 1014 650 466 --26309 151 --
NM_001003675chr18216981 6928 6868 6795 6658 6644 6051 5927 5636 5436 5379 4951 4838 4514 4499 2647 2434 1655 1014 650 466 --26309 151 --
NM_001003679chr1112147 2102 1877 1556 1470 1445 892 648 608 602 232 1499 --11710
NM_001003688chr451207 1169 997 452 442 1781 1256 --
NM_001003712chr1283766 3758 3688 2936 2510 908 889 154 --11404 --
NM_001003800chr9103677 3168 2685 2671 2533 2378 1350 760 753 434 ------
NM_001004051chrX3322 243 229 ------
NM_001004065chr963727 3127 2880 2568 1173 773 23940 908 ----
NM_001004196chr321189 1084 ------
NM_001004313chr1762053 1993 1849 1382 87 39 ------
NM_001004316chr33320 303 101 ----2282 49
NM_001004342chr1105274 4678 4511 4457 4324 4132 1485 822 631 329 --25847 506 25198 2441
NM_001004346chr43940 223 115 ------
NM_001004360chr272010 1861 1772 1762 576 454 397 ------
NM_001004419chr1264616 4525 4170 3313 640 247 13109 ----
NM_001004441chr551475 1282 1155 365 87 1332 ----
NM_001004720chr21880 ------
NM_001004722chr211049 ------
NM_001005375chrY91789 1610 1602 1483 1384 1193 703 510 408 --11205 --
NM_001005386chr262512 2392 973 475 389 293 12309 ----
NM_001005404chr17104531 4409 4372 4239 3583 3543 3295 3223 3096 1133 23890 1689 ----
NM_001005463chr1062460 1994 1936 1909 763 237 22578 960 ----
NM_001005473chr5246503 6291 6222 5789 5427 5324 5216 4960 4796 4776 4653 4238 4226 4082 4045 2537 2374 2335 2115 1728 1633 1166 1124 264 25271 701 --15814
NM_001005502chr1244760 3530 3501 3199 14170 1575 --
NM_001005505chr321860 1812 --1519 --
NM_001005732chr212670 633 ------
NM_001005743chr143975 378 102 ------
NM_001005744chr143975 378 102 ------
NM_001005745chr143975 378 102 ------
NM_001005781chr21170 ------
NM_001005782chr23274 258 165 1405 1383 --
NM_001005845chr861880 1564 1554 1390 1307 1260 21806 1757 ----
NM_001005849chr172435 128 ------
NM_001005861chr34854 660 638 199 ------
NM_001005910chr33689 642 272 --1651 --
NM_001005911chr33689 642 272 --1651 --
NM_001006117chrY2253 185 ------
NM_001006118chrY2253 185 ------
NM_001006120chrY2253 185 ------
NM_001006600chr5142139 2099 2080 2063 1854 1844 1753 1719 1621 1508 859 773 390 349 12074 ----
NM_001006605chr16994 962 951 828 809 44 ----1204
NM_001006605chr16994 962 951 828 809 44 ----1204
NM_001006623chr262090 1650 1037 516 249 161 ------
NM_001006636chr21923 ------
NM_001006665chr11757 ------
NM_001006684chrX4195 181 113 88 ------
NM_001006933chrX2182 169 ------
NM_001007023chr1483892 3885 3427 3265 1942 1629 1004 160 23833 2059 ----
NM_001007024chr1784308 3950 3928 3144 2899 1478 239 39 --23689 393 --
NM_001007025chr1784308 3950 3928 3144 2899 1478 239 39 --23689 393 --
NM_001007067chr861112 815 763 277 222 154 ------
NM_001007068chr861112 815 763 277 222 154 ------
NM_001007069chr861112 815 763 277 222 154 ------
NM_001007070chr861112 815 763 277 222 154 ------
NM_001007097chr985039 4552 3258 3187 1722 1084 530 477 2912 826 ----
NM_001007099chr12766 705 1267 --1694
NM_001007100chr12766 705 1267 --1694
NM_001007102chr661442 1024 656 381 361 183 ----1392
NM_001007189chr52161 51 ------
NM_001007226chr1751378 1187 490 144 99 ------
NM_001007227chr1751378 1187 490 144 99 ------
NM_001007228chr1751378 1187 490 144 99 ------
NM_001007229chr1751378 1187 490 144 99 ------
NM_001007230chr1751378 1187 490 144 99 ------
NM_001007237chr162721 2710 2684 2271 2251 248 12111 22126 842 --
NM_001007246chr2131682 1583 1511 ------
NM_001007277chr112888 803 ------
NM_001007278chr13135160 5081 5050 4961 4013 3647 3261 2113 2004 948 913 897 541 35206 4488 4314 24592 3331 14852
NM_001007464chr62131 105 ------
NM_001007466chr6163921 3497 3275 3263 3239 2036 2003 1949 1768 1737 1316 1066 515 320 314 288 --1365 1446
NM_001007526chrY2253 185 ------
NM_001007527chr54734 728 551 190 ------
NM_001007553chr13830 363 250 ------
NM_001007559chr1841933 1529 1373 631 --11795 --
NM_001007794chr11120 ------
NM_001008239chr18163648 3360 3337 3020 2914 2665 2603 2567 1451 1444 1319 1230 917 545 341 277 1720 23186 3085 1306
NM_001008388chr42357 302 ------
NM_001008392chr343230 474 306 189 --1467 --
NM_001008393chr472872 2420 2347 2216 2147 1893 229 12090 ----
NM_001008405chr71129 ------
NM_001008408chr7196292 5950 5727 5393 5354 5279 5191 5084 5072 4792 4715 4407 4395 4234 4028 1274 1264 379 267 --15057 14114
NM_001008495chr871904 1775 1723 849 764 656 542 ------
NM_001008539chr875255 4345 4337 3426 1573 1352 562 25331 3383 ----
NM_001008564chr1341729 1717 883 876 11629 ----
NM_001008567chr93146 48 36 ------
NM_001008660chr1161513 1399 1339 1083 986 266 ------
NM_001008707chr1451775 1288 658 629 332 11849 ----
NM_001008723chr101489 ------
NM_001008738chr562671 2598 1977 1085 1075 648 ----196
NM_001008744chr1451380 532 306 208 159 1593 --11054
NM_001008777chr173686 241 67 1142 ----
NM_001008801chr1952015 1638 801 550 196 --1634 --
NM_001008860chr154771 760 314 248 ------
NM_001008892chr154771 760 314 248 ------
NM_001008894chr154771 760 314 248 ------
NM_001008895chr1331316 394 147 --1213 --
NM_001008925chr4103277 3248 3050 2548 2411 2402 2301 907 556 483 ----12808
NM_001009552chr81606 ------
NM_001009554chr4164657 4559 4285 4174 4091 3873 3804 3367 3140 1782 1435 1410 1383 1035 651 372 34337 3937 254 13892 --
NM_001009554chr4164657 4559 4285 4174 4091 3873 3804 3367 3140 1782 1435 1410 1383 1035 651 372 34337 3937 254 13892 --
NM_001009555chr441369 1314 1308 173 ------
NM_001009567chr104456 215 179 65 1227 ----
NM_001009894chr122590 301 ------
NM_001009899chr3126192 6184 6065 5875 4678 4195 2152 1967 1024 198 192 121 15713 26024 1506 --
NM_001009909chr1163697 3518 2821 1494 145 105 43634 3558 1426 58 12848 --
NM_001009959chr282532 2028 1006 979 666 445 223 128 ------
NM_001009960chr762463 710 625 531 287 270 ------
NM_001009993chr284567 3021 1813 1059 806 554 548 232 13916 11571 --
NM_001010000chr1883499 3319 3108 2949 2633 2310 2201 672 --23099 2906 --
NM_001010852chr6152 ------
NM_001010853chr683201 2603 2534 2037 1196 685 63 53 ------
NM_001010854chr141279 ------
NM_001010861chr172794 2618 2544 1955 1709 510 22 32405 1873 535 ----
NM_001010862chrX83304 3145 2928 2350 710 595 544 188 43031 2413 1004 566 ----
NM_001010867chr176663 4691 4351 2300 2157 1530 840 15026 ----
NM_001010888chrX114392 4305 3613 3519 3369 2945 2901 2838 1027 589 171 --1816 --
NM_001010891chr5186472 6286 5962 5705 5258 4475 4327 4318 2677 2231 2056 1154 1066 1010 959 940 647 471 22207 731 1702 14989
NM_001010895chr951888 1550 631 546 21 188 --1139
NM_001010908chr101609 ------
NM_001010922chr194122 3387 3105 1158 811 662 460 254 103 33490 875 501 ----
NM_001010971chr13693 655 328 ------
NM_001010984chr142408 2329 731 218 22231 2008 11046 --
NM_001010986chrX62477 2415 2380 2182 835 260 ------
NM_001011513chr463764 3737 3135 2653 1516 986 2307 74 13029 --
NM_001011515chr43305 61 43 1729 ----
NM_001011516chr43305 61 43 1729 ----
NM_001011537chr362181 2009 1880 1772 1695 595 1355 --1548
NM_001011553chr72725 356 ------
NM_001011666chr7145416 4654 4352 4181 4174 2114 2046 1926 1654 1507 814 157 124 61 22257 75 21256 356 --
NM_001011708chr272765 2053 936 786 579 253 214 1951 ----
NM_001011713chr1471530 1415 1304 1122 1031 459 445 ------
NM_001011885chr1561711 1440 1396 499 452 133 1679 ----
NM_001012267chr931953 1642 1509 ------
NM_001012393chr11115034 5024 4265 4114 3826 3299 1970 1643 1596 1071 158 13650 ----
NM_001012410chr32330 37 ------
NM_001012418chr694204 3927 3672 3338 3172 1559 908 693 635 11403 ----
NM_001012420chr1552374 2035 228 213 187 22592 1930 ----
NM_001012423chr1552374 2035 228 213 187 22592 1930 ----
NM_001012456chr72117 25 ------
NM_001012732chr431197 1029 67 ------
NM_001012755chrX124402 4374 4099 3916 3834 3729 1878 1800 1359 922 462 224 14733 1525 14314
NM_001012756chr1973024 2836 2646 2512 2135 2124 2052 ------
NM_001012761chr572512 2432 2139 1877 1068 445 169 1609 --12317
NM_001012968chrX122601 2494 2392 2199 2031 1979 1123 1072 997 714 679 656 1763 ----
NM_001012977chrX51429 1303 528 448 314 ------
NM_001012979chrX1182 1246 1169 --
NM_001013031chr1053282 1086 404 361 140 13040 ----
NM_001013398chr71200 ------
NM_001013415chr441618 1499 1034 376 ------
NM_001013437chr18276 52 ----188
NM_001013615chr131002 328 38 --21127 1111 --
NM_001013620chr12238428 8335 7365 7342 7141 6920 6811 6437 6209 6079 5443 5220 3332 3289 3002 2279 1961 1220 1190 1042 1032 648 514 47891 7101 1620 237 196 --
NM_001013699chr123551 415 122 ------
NM_001013703chr152503 454 ------
NM_001013746chr772343 2078 582 498 418 268 166 12245 ----
NM_001013843chr153623 379 186 --1750 --
NM_001014380chr13255738 5227 5171 5069 4665 4636 4622 4241 3756 2228 2037 1888 1797 1711 1701 1373 1192 1037 1016 940 929 761 399 295 93 11553 13667 --
NM_001014434chr12766 693 --1252 --
NM_001014445chr172924 691 ------
NM_001014797chr10168038 7389 7377 7273 7200 6831 6769 5447 3284 3040 2555 1499 770 734 617 420 13069 11076 --
NM_001015877chrX123130 3080 3048 2668 2615 2424 2412 1106 973 545 442 65 42738 2730 1095 945 ----
NM_001015882chr94971 410 393 50 168 ----
NM_001015892chr52156 136 ------
NM_001017368chr1732748 2584 2314 1567 11066 --
NM_001017369chr43959 944 224 2735 375 --1355
NM_001017371chr211185 ------
NM_001017395chr373651 3174 2670 2619 2430 889 717 1176 13283 --
NM_001017405chr43830 344 246 ------
NM_001017424chr181783 1606 1511 1414 1386 566 453 361 11816 --11834
NM_001017425chr181783 1606 1511 1414 1386 566 453 361 11816 --11834
NM_001017440chr766040 5063 1314 1201 1156 399 11644 17584 --
NM_001017523chr1251379 1306 574 476 305 ------
NM_001017923chr1451701 1130 612 128 64 2575 116 11558 --
NM_001017926chr881782 1741 1575 1517 1444 1334 1286 1137 ------
NM_001017962chr102317 173 --2878 77 --
NM_001017967chr163801 89 59 --1929 --
NM_001017969chr93593 157 65 ------
NM_001017977chr11309 ------
NM_001017979chr42555 297 ------
NM_001017995chr574499 3737 3364 3075 3039 1458 747 1160 --14351
NM_001017999chr152162 2156 1817 1788 717 12041 ----
NM_001017999chr152162 2156 1817 1788 717 12041 ----
NM_001018000chr152162 2156 1817 1788 717 12041 ----
NM_001018000chr152162 2156 1817 1788 717 12041 ----
NM_001018001chr152162 2156 1817 1788 717 12041 ----
NM_001018038chr94505 124 82 47 ------
NM_001018056chr92582 429 ------
NM_001018064chr941971 1928 1869 69 ------
NM_001018065chr9114590 3939 3741 2176 1932 1733 1585 1561 1407 1143 799 34574 4148 2335 15045 --
NM_001018066chr9114590 3939 3741 2176 1932 1733 1585 1561 1407 1143 799 34574 4148 2335 15045 --
NM_001018067chr1165217 3923 3850 3517 3247 2148 2000 1838 1619 1553 1362 721 574 550 351 237 34392 1439 248 13564 14976
NM_001018068chr1165217 3923 3850 3517 3247 2148 2000 1838 1619 1553 1362 721 574 550 351 237 34392 1439 248 13564 14976
NM_001018069chr1165217 3923 3850 3517 3247 2148 2000 1838 1619 1553 1362 721 574 550 351 237 34392 1439 248 13564 14976
NM_001018072chr1251379 1306 574 476 305 ------
NM_001018074chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_001018075chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_001018076chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_001018077chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_001018088chr151135 ------
NM_001018090chr1582793 2596 2251 2134 2097 1953 255 165 11017 1362 1153
NM_001018091chr1582903 2706 2361 2244 2207 2063 365 275 11127 1472 1263
NM_001018102chr1582793 2596 2251 2134 2097 1953 255 165 11017 1362 1153
NM_001020818chr1941913 1602 1499 245 ------
NM_001020819chr1941913 1602 1499 245 ------
NM_001020820chr1941913 1602 1499 245 ------
NM_001020821chr1941913 1602 1499 245 ------
NM_001020825chr581430 1308 1300 1116 913 874 346 122 --1153 --
NM_001023567chr1552466 1789 1763 805 229 11951 ----
NM_001023587chr331160 1154 1144 ------
NM_001024094chr5193955 3833 3825 3641 3438 3399 3319 3148 3138 2871 2647 2531 1162 1078 500 359 201 111 51 11545 22678 998 --
NM_001024218chr142615 157 --1283 --
NM_001024226chr131141 1134 1093 ------
NM_001024227chr131141 1134 1093 ------
NM_001024228chr131141 1134 1093 ------
NM_001024372chr862271 2216 1701 596 542 517 --11825 --
NM_001024380chr842224 1618 679 548 --12483 --
NM_001024381chr842224 1618 679 548 --12483 --
NM_001024647chr12166713 6469 6128 5757 5458 4955 3050 2644 2539 1827 1368 1213 1151 1139 352 150 --1963 1971
NM_001024649chr572428 2231 2036 1120 1027 706 642 12729 12106 --
NM_001024688chr85862 838 666 213 187 11900 ----
NM_001024808chr1232801 2754 2728 12858 12449 --
NM_001024809chr171559 ------
NM_001024847chr372459 2346 2312 1858 1003 901 700 ------
NM_001024855chr361921 1896 1792 1629 1439 338 ------
NM_001024924chr43542 513 408 ------
NM_001024948chr173525 3237 2555 1167 1013 689 510 12823 ----
NM_001024956chr11135777 5124 4405 3920 3551 2349 2217 2193 2013 1454 1315 840 442 11223 15164 --
NM_001025068chr331748 508 267 11422 1490 --
NM_001025069chr331748 508 267 11422 1490 --
NM_001025076chr10136204 6176 6141 5881 5376 1833 1650 1556 1433 1059 566 532 34 14933 15209 --
NM_001025077chr10197562 7534 7499 7239 6734 4911 3008 2914 2791 2417 1924 1890 1012 663 590 296 274 109 34 26291 671 16567 --
NM_001025079chr394156 3372 3013 2701 1598 1442 865 702 679 --31365 1237 306 11230
NM_001025100chr1843346 1400 1205 1161 --23083 1293 --
NM_001025105chr551283 1081 259 142 77 1377 ----
NM_001025108chr253928 2686 1562 1303 1144 --1498 --
NM_001025201chr21653 1572 --1712
NM_001025233chr1292258 2122 1898 1772 1731 1025 910 409 327 ------
NM_001025252chr883155 3084 3028 3010 1060 735 695 104 ------
NM_001025253chr883155 3084 3028 3010 1060 735 695 104 ------
NM_001025266chr3124949 4618 4567 4377 4369 4086 3891 1774 1758 1018 910 862 13376 ----
NM_001025356chr12132999 2957 2890 2611 2571 2165 941 572 525 468 335 148 141 ------
NM_001025580chrX113915 3779 3634 3294 2968 2704 1543 1127 802 431 87 53762 3006 1229 1194 209 ----
NM_001025595chr451309 1229 646 439 145 --21472 1326 --
NM_001025603chr11177 --11380 --
NM_001025616chr481747 1551 1528 1500 1258 611 338 236 ------
NM_001029858chr6103392 2816 2772 2564 2286 2260 2132 950 871 653 --1339 --
NM_001029863chr65889 838 387 308 246 ------
NM_001029875chr582843 2381 1943 1909 937 720 149 127 21061 963 12462 12678
NM_001029882chr11578 1280 --151
NM_001029882chr11578 1280 --151
NM_001029883chr222072 178 ----1230
NM_001029884chr682649 2395 1092 558 534 398 275 135 32534 2134 269 ----
NM_001029955chr4103131 2587 2494 2399 2353 1138 571 352 212 178 13314 --1670
NM_001030006chr1752650 1057 711 577 172 ----1912
NM_001030007chr1683784 3462 3134 3048 2891 1309 817 475 11385 ----
NM_001030055chr14124446 4187 3767 3327 3250 2985 907 885 629 488 375 64 31419 1283 816 ----
NM_001030059chr102311 95 ------
NM_001030288chr1644583 4451 4301 1962 ------
NM_001031623chr661218 1181 686 670 386 129 --11350 --
NM_001031679chr1233519 2969 89 ------
NM_001031692chr71276 ----1311
NM_001031695chr2285384 5322 4881 2144 2111 1643 1214 864 --14349 15238
NM_001031709chr102131 46 ------
NM_001031710chr761044 997 977 354 184 150 ------
NM_001031711chr541863 1815 1689 1296 1188 1458 --
NM_001031712chr63307 148 70 ------
NM_001031723chr41194 --2389 27 --
NM_001031732chr493387 2866 2801 2595 1131 1071 869 224 89 23155 2822 13633 --
NM_001031743chr61173 ------
NM_001031804chr1654215 3746 3717 2738 733 24004 3022 --1531
NM_001032280chr621547 1251 ------
NM_001032282chr831095 353 235 1265 ----
NM_001032283chr122230 42 2821 687 1667 --
NM_001032284chr122230 42 2821 687 1667 --
NM_001032293chr171228 1249 ----
NM_001032296chr1332051 831 758 --1467 12202
NM_001032380chr1071803 1706 1283 1245 319 115 61 11492 ----
NM_001032394chr672846 2447 2234 2198 1942 1841 627 --11026 --
NM_001032395chr672713 2314 2101 2065 1809 1708 494 --1893 --
NM_001033002chr172111 81 ------
NM_001033045chr274224 4078 4045 3763 3015 1663 61 44235 3778 3748 2931 ----
NM_001033047chr472159 2082 2049 2013 956 516 82 12107 1262 --
NM_001033059chr682008 1689 1644 1581 1405 804 374 269 --11423 --
NM_001033087chr2053228 2734 2286 1292 432 --2723 239 --
NM_001033112chr52884 765 ------
NM_001033117chr374068 3556 3483 3019 1958 1157 1062 11894 ----
NM_001033506chr113390 109 72 1117 ----
NM_001033507chr15574 558 493 422 261 21417 659 --1671
NM_001033518chr771095 1014 894 364 217 196 181 --1685 --
NM_001033519chr771095 1014 894 364 217 196 181 --1685 --
NM_001033520chr771095 1014 894 364 217 196 181 --1685 --
NM_001033561chr171671 1881 ----
NM_001033564chr621782 394 --1130 --
NM_001033566chr174961 737 696 42 ------
NM_001033568chr174961 737 696 42 ------
NM_001033578chr832241 1514 357 ------
NM_001033602chr135571 433 312 286 272 ------
NM_001033659chr1751680 1560 1541 416 40 21405 358 ----
NM_001033723chr852498 1727 1106 579 381 21912 979 2863 124 --
NM_001033756chr611233 ------
NM_001033756chr611233 ------
NM_001033910chr182239 2045 1771 740 631 556 509 282 ------
NM_001033925chr1051618 1462 1450 1325 764 ------
NM_001034852chr141135 --11918 1277
NM_001034954chr1032876 2257 69 ----1795
NM_001034955chr1032876 2257 69 ----1795
NM_001034956chr1032876 2257 69 ----1795
NM_001034957chr1032876 2257 69 ----1795
NM_001035chr131279 1198 827 21305 145 11042 --
NM_001035003chr43437 309 189 --2167 78 --
NM_001035004chr43437 309 189 --2167 78 --
NM_001035260chr1051561 1266 462 392 30 11537 ----
NM_001037132chr761902 1881 743 711 418 203 1809 ----
NM_001037133chr761902 1881 743 711 418 203 1809 ----
NM_001037164chr742017 1680 1459 788 1696 1351 --
NM_001037165chr7158883 8862 8719 8479 8175 8116 7336 6923 6674 5997 5851 2912 1661 1025 978 11940 ----
NM_001037174chr242268 1516 1474 1431 --1837 --
NM_001037304chr111163 ------
NM_001037317chr172794 2618 2544 1955 1709 510 22 32405 1873 535 ----
NM_001037332chr521904 1012 12360 22177 733 --
NM_001037333chr521904 1012 12360 22177 733 --
NM_001037334chr1842130 1658 328 287 22188 722 ----
NM_001037339chr191867 1794 1773 1663 1300 704 486 422 311 --21690 119 --
NM_001037340chr191867 1794 1773 1663 1300 704 486 422 311 --21690 119 --
NM_001037341chr191867 1794 1773 1663 1300 704 486 422 311 --21690 119 --
NM_001037341chr191867 1794 1773 1663 1300 704 486 422 311 --21690 119 --
NM_001037494chr12187 ------
NM_001037495chr12187 ------
NM_001037535chrX51554 1476 1198 590 251 21371 1030 ----
NM_001037536chrX51554 1476 1198 590 251 21371 1030 ----
NM_001037540chrX51554 1476 1198 590 251 21371 1030 ----
NM_001037631chr24879 864 457 436 --1262 --
NM_001037872chr23696 141 113 ------
NM_001037954chr1173417 3371 3230 3115 2141 1353 923 --22243 1029 --
NM_001038702chr5102766 2541 2189 2167 1899 984 856 571 279 179 1602 ----
NM_001038707chr152340 2326 1981 1952 1683 --11693 --
NM_001038707chr152340 2326 1981 1952 1683 --11693 --
NM_001039091chrX4463 316 259 69 21302 554 1294 --
NM_001039199chr20105017 4860 4669 3959 3910 3398 3390 1731 1701 467 13133 --13841
NM_001039538chr2103646 3430 3377 3224 1070 1012 965 666 415 300 1891 ----
NM_001039547chr3187777 7122 6767 6450 5313 3127 3102 2937 2790 2751 2491 1643 1352 1331 1227 762 682 141 47795 6880 3028 2362 --17165
NM_001039570chr2244643 4602 4173 1112 14030 13117 --
NM_001039571chr2244643 4602 4173 1112 14030 13117 --
NM_001039577chr153630 1647 1550 1057 988 13437 ----
NM_001039580chr4135011 4695 4622 4239 4084 3820 3476 3203 1315 1155 697 513 293 14753 --11400
NM_001039585chr1103952 3483 3324 3260 2688 1578 948 926 442 322 44125 3342 1629 1006 11689 11671
NM_001039590chrX113974 3548 3285 3193 3141 3081 3028 1608 812 751 590 11253 13238 --
NM_001039591chrX113974 3548 3285 3193 3141 3081 3028 1608 812 751 590 11253 13238 --
NM_001039618chr11165783 5769 5690 5673 4919 4809 4240 4072 3773 1804 1016 902 803 690 221 40 44797 2333 704 100 35717 2061 797 --
NM_001039693chr244093 3741 2809 366 ------
NM_001039711chr121104 969 ------
NM_001039712chr121104 969 ------
NM_001039762chr1041584 516 481 369 ------
NM_001039840chrX186011 5874 5546 5206 4766 4664 4373 2362 1984 1964 1938 1229 988 749 464 449 330 179 25351 1010 21487 1475 1428
NM_001039888chr12553 539 ------
NM_001039937chr13114139 3930 3561 3031 2786 2717 2606 1600 1555 1336 614 --11237 14183
NM_001040001chr671938 1451 1407 1361 1309 410 45 21877 397 ----
NM_001040020chr761137 506 431 393 370 37 ------
NM_001040057chr721342 463 --1487 --
NM_001040142chr272358 2349 1804 1667 1580 628 220 1640 ----
NM_001040143chr272358 2349 1804 1667 1580 628 220 1640 ----
NM_001040147chr183641 623 570 1467 ----
NM_001040152chr7105000 4960 4639 4583 4483 4008 3800 3354 1616 1233 24536 3341 14038 --
NM_001040153chr1341006 899 800 696 ------
NM_001040157chr482635 2626 2620 1862 1816 666 219 163 ------
NM_001040159chr431274 1006 276 ------
NM_001040181chr33467 330 207 ------
NM_001040182chr33467 330 207 ------
NM_001040183chr33467 330 207 ------
NM_001040199chr33467 330 207 ------
NM_001040200chr33467 330 207 ------
NM_001040202chr482495 2062 1795 1711 837 580 424 377 ------
NM_001040214chr662066 1938 1828 1558 958 38 ------
NM_001040260chr421147 276 ------
NM_001040261chr421147 276 ------
NM_001040280chr651416 1260 593 278 234 ------
NM_001040284chr16145969 5565 5505 5203 5082 4691 4603 4545 4312 3830 1761 1636 1589 1318 22078 1883 45146 3712 1624 1513 --
NM_001040402chr4123251 3188 3013 2924 1976 1295 1223 1140 949 937 657 115 2516 415 ----
NM_001040429chr1393358 3266 3183 3060 2923 2871 2843 1386 777 33590 2193 180 23126 124 --
NM_001040437chr6164 ------
NM_001040438chr6164 ------
NM_001040441chr194388 4203 1995 1581 1430 1397 333 300 257 13335 11271 --
NM_001040446chr542193 1002 956 162 ------
NM_001040450chr1552225 1837 578 163 124 12616 ----
NM_001040453chr1552225 1837 578 163 124 12616 ----
NM_001040458chr541785 1693 162 64 ------
NM_001040633chr72281 271 21044 208 ----
NM_001040665chr7164817 4738 4455 4003 3929 3411 3369 3150 3065 1804 1597 1426 1053 703 357 164 14036 ----
NM_001040666chr72519 157 ------
NM_001040708chr841074 943 180 159 1404 11089 1116
NM_001040712chr973211 3191 2922 2795 2777 509 457 --22414 2352 --
NM_001040876chr481690 1431 1311 1298 605 490 290 269 ------
NM_001042355chr1685035 4965 4931 4075 3961 1419 1331 754 45351 5075 4537 914 1336 --
NM_001042403chr125858 404 336 240 186 ------
NM_001042404chr181896 1759 1364 784 757 522 257 175 ------
NM_001042406chr66952 905 878 829 131 43 2965 820 ----
NM_001042412chr1685035 4965 4931 4075 3961 1419 1331 754 45351 5075 4537 914 1336 --
NM_001042413chr994136 3627 3231 2726 2686 2604 1271 1061 241 ----1138
NM_001042424chr44817 718 691 305 --13096 --
NM_001042425chr621547 1251 ------
NM_001042453chrX111750 1508 1345 1189 1135 1090 504 350 300 259 205 --1663 --
NM_001042473chr1051862 1765 1691 1391 346 ------
NM_001042481chr1462281 1856 1625 980 455 320 ------
NM_001042486chr202445 124 ------
NM_001042492chr17102887 2878 2573 2464 1297 1114 966 783 433 281 13428 1489 --
NM_001042493chr682044 1993 1885 1563 736 565 553 161 ----11667
NM_001042494chr15103597 3168 3018 2991 2681 1262 1026 755 502 237 22953 1346 1745 --
NM_001042495chr15103597 3168 3018 2991 2681 1262 1026 755 502 237 22953 1346 1745 --
NM_001042496chr15103597 3168 3018 2991 2681 1262 1026 755 502 237 22953 1346 1745 --
NM_001042497chr15103597 3168 3018 2991 2681 1262 1026 755 502 237 22953 1346 1745 --
NM_001042506chrX81442 1391 1338 1314 582 528 448 314 ------
NM_001042533chr383302 3291 3046 2971 2054 2026 1219 806 ------
NM_001042537chrX102514 2437 2301 2222 1923 1905 1605 1579 236 223 1820 12364 --
NM_001042543chr461542 1391 1325 1203 254 190 ------
NM_001042550chr961745 1578 1427 807 255 52 ------
NM_001042555chr12194760 4367 4221 3951 3869 3738 3118 1775 1763 1644 1297 1159 1070 900 337 313 229 95 72 14031 ----
NM_001042599chr2167601 7562 6607 6419 6396 6168 5649 5147 3000 2763 2471 879 838 651 631 584 15181 25121 994 --
NM_001042601chr373213 2910 2882 2524 1271 574 92 22943 1287 ----
NM_001042603chr1285191 3874 3709 1810 1740 1107 884 773 ------
NM_001042604chr3174650 4596 4451 4235 4180 3965 3406 3155 3043 1894 1525 1385 1296 1036 708 152 127 43162 1840 1403 1131 ----
NM_001042646chr341395 1338 622 537 11658 ----
NM_001042669chr481747 1551 1528 1500 1258 611 338 236 ------
NM_001042683chr671872 1697 1631 1458 1399 172 48 11747 ----
NM_001042749chrX61984 1770 1472 582 571 476 1638 11465 --
NM_001042750chrX61984 1770 1472 582 571 476 1638 11465 --
NM_001042751chrX61984 1770 1472 582 571 476 1638 11465 --
NM_001043318chr1454156 3886 3607 2790 615 11625 --1160
NM_001043351chr151809 647 598 398 125 12331 ----
NM_001044385chr253481 2862 2744 2515 1268 ----13796
NM_001046chr5162812 2801 2630 2521 2489 2465 2228 2006 1969 1043 955 936 869 374 183 112 ------
NM_001048183chr163546 3526 3423 1112 1106 220 13800 ----
NM_001068chr3127 ------
NM_001079874chr131851 1526 550 21585 40 ----
NM_001083620chr4112552 2525 2106 1847 1688 984 963 687 588 570 561 --1266 --
NM_001099678chr3186233 5992 5683 5195 5091 5057 4569 4500 4392 4345 4334 4278 2211 1987 1570 889 623 248 26160 1590 ----
NM_001100108chr1128214 7263 7240 7021 5991 2972 2381 2329 2276 2262 1979 1340 37312 3134 83 11810 17101
NM_001106chr3219223 9129 8834 8640 8573 8537 7590 7417 6807 6792 6103 6062 2656 2549 2518 2320 1340 857 566 535 524 19606 12064 16716
NM_001113490chrX133659 3344 3303 2955 2910 2656 2275 2262 621 500 296 62 44 12588 --1729
NM_001117chr1852238 2148 2079 1726 656 12325 ----
NM_001119chr431405 1398 1069 --11536 --
NM_001121chr1041370 1304 662 432 --11614 1161
NM_001123chr101279 ------
NM_001125chr341563 279 154 67 11663 --11869
NM_001126chr141001 839 313 257 1141 ----
NM_001128chr1683784 3462 3134 3048 2891 1309 817 475 11385 ----
NM_001149chr102957 222 --11209 --
NM_001159chr24712 514 502 205 ------
NM_001167chrX156663 6545 5782 4909 4879 4727 4624 2214 2031 843 827 517 496 177 142 3902 476 343 ----
NM_001173chr14124446 4187 3767 3327 3250 2985 907 885 629 488 375 64 31419 1283 816 ----
NM_001174chrX82283 2211 2146 2089 1887 1691 1444 310 11733 --11674
NM_001179chr41186 ------
NM_001186chr2163105 2933 2551 2305 980 420 --11275 --
NM_001198chr621783 348 ------
NM_001201chr4113766 3724 3381 3361 3280 1354 1084 878 866 784 216 23824 280 43944 3791 2486 1307 --
NM_001204chr2267479 7200 6457 6341 6218 5858 5755 5706 5425 5245 3105 2532 2442 2157 2144 2132 2102 2048 2023 1472 1364 1338 1306 1134 771 147 26294 6275 25870 1420 --
NM_001206chr972973 2373 2261 798 749 495 311 22766 1984 22140 1052 --
NM_001227chr1041248 480 459 108 21154 174 11196 --
NM_001233chr752291 2249 2134 1770 159 11695 ----
NM_001235chr112680 597 ------
NM_001241chr232406 2182 1965 ------
NM_001241chr232406 2182 1965 ------
NM_001253chr63249 114 47 --1222 --
NM_001254chr1731067 911 67 1826 --1968
NM_001256chr17112554 2391 2123 1818 1130 1067 885 375 205 136 21 42915 2535 2285 1810 ----
NM_001259chr7165907 5499 5474 4751 4499 2444 2402 2355 2084 1803 1471 1432 1227 1215 976 468 25843 4594 --15052
NM_001260chr131286 ------
NM_001269chr12949 225 ------
NM_001270chr531102 863 391 41083 985 943 329 139 --
NM_001271chr1533118 2407 163 23290 706 22784 1069 12736
NM_001278chr1051203 1185 785 748 358 11107 ----
NM_001282chr1752650 1057 711 577 172 ----1912
NM_001290chr43907 763 667 ------
NM_001304chr1763587 3326 3221 2796 1185 443 33361 2608 906 ----
NM_001310chr1283028 2773 2620 2552 1988 802 403 182 --1793 --
NM_001315chr662306 1899 1654 1636 1588 55 11502 1310 --
NM_001316chr201403 ------
NM_001326chr111309 1174 ----
NM_001329chr1031163 1097 247 ----11470
NM_001331chr1142094 1755 465 41 ----1477
NM_001343chr531243 385 169 1426 ----
NM_001349chr22396 96 ------
NM_001351chr351771 1485 1457 1146 306 --21359 608 --
NM_001356chrX82320 2198 1956 1939 1575 854 759 723 12525 ----
NM_001358chr4------1358
NM_001364chr1164445 3811 3659 1613 898 81 11044 ----
NM_001386chr852470 1875 893 745 355 --12301 --
NM_001391chr1841010 485 283 113 1243 --1205
NM_001400chr151357 1255 1166 1036 495 1947 ----
NM_001401chr951345 1216 1069 475 304 ------
NM_001406chr1721185 469 --2546 154 11363
NM_001407chr32262 215 ------
NM_001408chr121664 1329 1263 ----
NM_001412chrX103780 3654 3333 1345 1318 1203 957 725 540 209 32630 839 605 ----
NM_001415chrX51422 775 683 482 77 ------
NM_001418chr112201 102 ------
NM_001418chr112201 102 ------
NM_001419chr19174548 4539 4459 4339 4257 4224 4210 3749 3493 2962 1759 1577 1381 962 689 387 96 24614 4361 23885 381 --
NM_001420chr1943171 3140 2434 299 ------
NM_001422chr112380 44 ------
NM_001423chr1231911 1582 635 11832 ----
NM_001431chr63496 461 319 ----1985
NM_001432chr4103311 2869 2792 2666 2543 2504 2402 1168 1009 720 1865 ----
NM_001438chr1113066 2864 2858 2760 2266 1076 889 844 543 288 262 --23648 3101 1154
NM_001451chr162931 428 21068 385 ----
NM_001452chr63721 683 549 ------
NM_001461chr16638 585 439 429 120 29 --1255 --
NM_001465chr541693 823 541 494 22001 1336 --31844 1651 287
NM_001482chr152930 672 ------
NM_001511chr42671 194 ------
NM_001527chr694539 4459 3076 1735 1039 939 774 386 123 33212 1209 25 ----
NM_001530chr1461093 1032 989 410 366 171 21019 88 ----
NM_001542chr162721 2710 2684 2271 2251 248 12111 22126 842 --
NM_001543chr554599 4434 4279 4033 3716 ------
NM_001546chr661454 1399 991 294 179 134 ------
NM_001584chr112421 288 ------
NM_001587chrX32134 1863 615 32044 1901 60 --1185
NM_001604chr112771 239 --183 --
NM_001609chr10154410 4191 4169 4135 3202 2973 2741 1693 1386 1071 989 953 443 206 171 24221 584 --13243
NM_001612chr112236 169 ------
NM_001616chr2123168 3142 2871 2763 2206 1386 1087 1049 997 900 754 399 42745 2226 1258 406 ----
NM_001621chr7102956 2943 2896 2497 2352 2292 2282 674 462 314 21095 907 --1161
NM_001621chr7102956 2943 2896 2497 2352 2292 2282 674 462 314 21095 907 --1161
NM_001634chr682008 1689 1644 1581 1405 804 374 269 --11423 --
NM_001635chr721063 748 --1437 --
NM_001642chr113432 350 174 --1478 --
NM_001649chrX42099 1989 830 181 11965 ----
NM_001650chr1873910 1556 1236 871 823 479 264 --12806 --
NM_001655chr1151647 1607 1422 529 167 137 11748 --
NM_001656chr571659 1465 1345 793 432 419 244 21381 275 1345 --
NM_001658chr131141 1134 1093 ------
NM_001663chr14112446 2350 2067 1934 1791 1093 992 590 525 374 80 ------
NM_001668chr132065 1900 657 --1212 --
NM_001677chr13887 816 370 ------
NM_001682chr12132865 2850 2827 2684 2507 2267 2251 2156 2084 1171 922 552 65 ------
NM_001683chr341736 1689 346 195 ------
NM_001684chr193772 3567 3460 2957 1063 795 540 475 84 --13815 --
NM_001688chr12555 348 ------
NM_001690chr352377 1811 1583 796 502 12316 ----
NM_001701chr961571 1270 474 439 427 66 ------
NM_001703chr1153 ------
NM_001704chr62488 139 ------
NM_001706chr36854 842 797 393 104 23 ------
NM_001709chr1172916 2762 2474 2200 2182 595 460 21012 410 --1343
NM_001713chr541144 907 817 91 1178 ----
NM_001714chr121495 ------
NM_001717chr1571439 1372 1258 959 436 224 40 ------
NM_001718chr631178 1015 314 1992 ----
NM_001726chr11141 ------
NM_001730chr1331349 595 426 11337 ----
NM_001730chr1331349 595 426 11337 ----
NM_001731chr124818 309 268 188 1719 ----
NM_001742chr721866 453 11677 --11398
NM_001746chr572428 2231 2036 1120 1027 706 642 12729 12106 --
NM_001748chr11286 ------
NM_001753chr771601 1472 686 672 452 148 45 ------
NM_001754chr2183842 3573 3429 3299 2749 1517 1477 977 33664 2919 1033 ----
NM_001755chr1672302 2166 1590 1401 868 663 310 1483 11965 --
NM_001759chr1275206 5144 4602 4566 2046 357 85 ----1144
NM_001766chr171559 574 460 435 202 169 156 ------
NM_001777chr394156 3372 3013 2701 1598 1442 865 702 679 --31365 1237 306 11230
NM_001788chr72725 356 ------
NM_001806chr1962958 2907 2716 2261 966 799 ------
NM_001822chr21653 1572 --1712
NM_001827chr9297 31 ------
NM_001839chr13785 285 118 1588 1185 --
NM_001845chr1361313 1237 1072 933 353 204 ------
NM_001854chr141502 1470 1110 934 ------
NM_001855chr93607 336 31 ------
NM_001858chr6134905 4099 3977 3717 3224 3153 3144 2034 2019 1926 1668 1602 588 23760 395 ----
NM_001859chr933498 2925 1184 23923 2818 23423 3083 --
NM_001872chr131396 ------
NM_001874chr1244760 3530 3501 3199 14170 1575 --
NM_001875chr231099 1057 112 ------
NM_001881chr101359 ------
NM_001884chr51134 ------
NM_001890chr41355 179 ----
NM_001892chr551283 1081 259 142 77 1377 ----
NM_001895chr201208 ------
NM_001903chr51619 ----1184
NM_001904chr331093 1010 53 ------
NM_001918chr1119326 9027 9018 8834 7510 7337 7078 6500 6116 3461 1087 48370 3557 2131 948 15834 --
NM_001921chr431197 1029 67 ------
NM_001935chr231035 739 53 ------
NM_001938chr161886 1506 1380 748 487 370 1251 ----
NM_001942chr1831880 1707 24 ------
NM_001949chr673153 2821 2687 2238 822 812 638 --12881 --
NM_001957chr492247 2107 2088 1911 857 837 476 343 324 --11408 11850
NM_001969chr1483814 2992 2932 2488 1540 1405 993 880 11023 ----
NM_001977chr431277 346 114 11545 ----
NM_001980chr1281969 1945 1827 1818 1537 742 544 302 11396 --1676
NM_001981chr151877 1829 963 463 138 2690 525 ----
NM_001982chr121147 ----11274
NM_001987chr1284072 3636 3498 1546 1381 1340 1189 573 33036 2889 1457 --13117
NM_002006chr4205793 5396 5323 5281 4757 4189 3653 3619 3510 1826 1333 1310 1264 957 900 612 448 287 256 203 24968 54 24160 3636 23600 877
NM_002009chr1592771 2692 1998 1948 1013 856 806 97 89 12324 ----
NM_002010chr131386 --1498 --
NM_002015chr1372980 1347 1030 897 324 152 84 22090 308 199 --
NM_002017chr113991 508 448 11288 ----
NM_002024chrX122171 2112 1942 1831 1502 1414 862 519 478 392 251 220 1178 ----
NM_002025chrX268972 8343 8068 7750 7707 7676 7434 7415 7295 7049 6435 6309 6148 5946 5795 5769 5664 3332 3192 2982 2315 1283 1202 736 710 504 26616 450 22546 219 16761
NM_002031chr61614 ------
NM_002035chr1863993 3673 2907 1366 894 426 --23726 1093 --
NM_002037chr62439 64 ------
NM_002039chr42907 290 ------
NM_002040chr2172586 2439 2160 1994 1953 958 93 1186 --12065
NM_002044chr1551455 1343 506 238 135 ------
NM_002048chr931199 551 479 ------
NM_002054chr22476 443 --1139 --
NM_002056chr23830 786 106 ------
NM_002063chrX21110 521 --1260 --
NM_002069chr771704 1687 1408 1226 350 321 31 1752 11476 --
NM_002072chr93983 821 239 ----1678
NM_002076chr1253266 2776 2377 2332 2278 1437 --11105
NM_002086chr1751589 1555 396 269 231 --11914 --
NM_002089chr42684 269 1181 ----
NM_002092chr4154922 4765 4327 4111 4105 3882 3838 3425 3358 3291 3108 1625 1542 1350 296 33450 920 483 14121 --
NM_002094chr161324 ------
NM_002107chr11185 ------
NM_002126chr1753088 2952 2944 815 648 33466 2685 1467 2559 253 12970
NM_002128chr1392328 2035 1599 651 571 480 315 197 74 12218 --11748
NM_002129chr43419 325 160 ------
NM_002137chr71347 21575 710 --1719
NM_002140chr92783 199 ------
NM_002146chr1741223 1166 1055 172 ------
NM_002148chr22542 267 ------
NM_002154chr54205 158 124 113 ------
NM_002158chr2143262 2901 2367 2351 1413 1262 876 767 730 423 358 117 82 30 --11495 --
NM_002166chr25612 229 90 70 26 1666 ----
NM_002182chr382801 2754 2747 2012 909 721 573 463 --1850 --
NM_002196chr2041141 1027 937 208 1892 ----
NM_002196chr2041141 1027 937 208 1892 ----
NM_002202chr52927 327 ------
NM_002203chr5104173 4110 3905 3291 3016 2598 2559 1167 506 331 --1833 1601
NM_002210chr283334 1266 956 840 686 600 572 214 22446 470 13039 --
NM_002214chr7185533 5239 4816 4490 4471 4377 4060 3974 3953 3788 3757 3735 2218 1750 1650 1475 1339 521 1188 14338 --
NM_002222chr351298 1116 510 469 34 ------
NM_002223chr1273017 1089 903 698 401 171 32 23688 2459 --12820
NM_002227chr141174 1038 812 468 ------
NM_002235chr1221731 617 ----11430
NM_002241chr112480 32943 2842 2512 22363 1945 1466
NM_002242chr23466 362 87 ------
NM_002247chr1081943 1799 1478 927 918 836 625 562 ------
NM_002253chr471216 1164 1041 969 232 107 61 --11419 --
NM_002264chr3154846 4101 3588 3581 3480 3356 3061 1988 1762 1705 1569 1102 957 474 233 21581 1556 14524 13560
NM_002265chr171841 ------
NM_002267chr1382393 2323 2315 2096 1808 1571 516 465 21774 218 2965 958 --
NM_002270chr5124918 4838 4645 4626 3648 3469 2200 2168 1920 1860 1116 693 13532 ----
NM_002285chr253928 2686 1562 1303 1144 --1498 --
NM_002293chr152657 2383 2214 2147 850 2711 90 1579 --
NM_002296chr161315 718 437 338 251 159 --21501 1173 --
NM_002310chr5226124 5954 5883 5824 5570 5392 5299 4770 4653 4574 4547 4498 4437 4249 2192 1394 1064 756 735 729 718 159 16426 15220 14298
NM_002313chr1084832 3664 3580 3242 1122 1067 1031 250 ------
NM_002314chr71945 ------
NM_002317chr52274 141 ------
NM_002334chr1122074 641 ------
NM_002336chr1294810 4558 4337 4305 3701 1812 1728 1369 1257 34015 3986 1929 11058 14797
NM_002345chr123534 275 56 1484 ----
NM_002349chr251676 1581 1238 474 115 ------
NM_002351chrX41732 1543 346 225 ------
NM_002355chr1251285 1237 939 426 346 ------
NM_002356chr662643 2518 2277 907 674 274 ------
NM_002359chr1754329 3425 3078 2732 743 23213 3105 --1821
NM_002372chr54658 146 85 40 ------
NM_002374chr2103646 3430 3377 3224 1070 1012 965 666 415 300 1891 ----
NM_002383chr161799 ------
NM_002387chr595067 3887 3805 2068 1990 1983 1841 1251 1210 55020 4807 3154 1975 1450 1280 --
NM_002389chr161774 1630 1307 758 511 31 31674 804 724 ----
NM_002395chr641314 387 76 50 ------
NM_002397chr562071 1918 1408 703 261 147 21859 1434 ----
NM_002398chr211180 ------
NM_002399chr151456 ------
NM_002401chr171385 ------
NM_002408chr143631 523 326 --1676 --
NM_002430chr2261687 868 671 458 365 315 1339 --11710
NM_002438chr104456 215 179 65 1227 ----
NM_002442chr1221763 256 ------
NM_002470chr17194 ------
NM_002480chr12101368 1360 1341 1276 1048 1041 1035 548 537 472 1110 1390 --
NM_002481chr1177853 7717 7639 6674 6371 5672 2953 2882 2747 2448 2431 1882 1418 1313 702 575 171 12409 26869 4894 --
NM_002482chr1158 ------
NM_002485chr85862 838 666 213 187 11900 ----
NM_002486chr972308 2198 1871 634 378 157 101 ------
NM_002487chr155318 231 135 121 113 ------
NM_002500chr23924 917 394 ------
NM_002501chr1964008 3604 2655 2573 1258 1176 12688 11142 --
NM_002505chr621302 1263 21492 222 1205 11456
NM_002514chr831128 1095 158 ------
NM_002515chr1431803 331 52 ------
NM_002518chr22980 462 1125 ----
NM_002519chr1141540 1155 966 106 ------
NM_002522chr1743915 3796 3765 1014 --23062 554 --
NM_002523chr721113 394 ------
NM_002524chr151102 919 688 300 41 ------
NM_002526chr631484 653 45 --170 --
NM_002537chr1511009 ------
NM_002545chr11115034 5024 4265 4114 3826 3299 1970 1643 1596 1071 158 13650 ----
NM_002546chr81805 1501 186 --
NM_002547chrX113819 3566 3270 3264 3199 3163 1437 1368 1172 941 331 23756 3308 --1133
NM_002553chr71391 ------
NM_002556chr1142110 1892 1763 1362 --12063 --
NM_002568chr81279 ------
NM_002577chr3113966 3369 2809 2664 1435 1358 1042 975 948 581 181 43285 2931 662 380 54057 3230 2976 246 55 --
NM_002578chrX2418 115 ------
NM_002581chr954370 3908 1566 1315 970 ----14449
NM_002583chr126568 531 420 192 161 145 --1218 --
NM_002585chr11330 ------
NM_002594chr2052143 2076 886 154 69 ------
NM_002595chr1231945 1758 1526 1145 ----
NM_002597chr13335 274 261 ------
NM_002600chr191867 1794 1773 1663 1300 704 486 422 311 --21690 119 --
NM_002605chr152472 414 --187 --
NM_002610chr2113137 2878 2857 2164 1156 934 421 333 253 203 104 22499 2205 ----
NM_002613chr1664610 4406 4035 3997 3690 1637 --24937 1921 --
NM_002623chr205697 308 267 142 113 2686 631 ----
NM_002628chr331033 948 349 ------
NM_002629chr104798 563 153 147 ------
NM_002645chr1142801 2030 696 378 1582 12185 --
NM_002647chr182332 226 ------
NM_002649chr741221 1156 533 360 1112 ----
NM_002655chr8204852 4597 3996 3851 3684 3635 3527 3343 3237 1609 1344 887 845 763 329 302 287 156 124 70 41654 1091 543 505 --1315
NM_002656chr631114 951 404 11071 ----
NM_002657chr2053895 3871 3078 552 246 ----196
NM_002667chr62427 208 ------
NM_002670chr371555 1515 1466 1192 1104 1093 425 ------
NM_002687chr1451326 883 524 451 444 ------
NM_002697chr12237 35 ------
NM_002709chr292846 2756 2407 1430 1185 842 555 408 355 31355 967 583 ----
NM_002713chr141017 776 752 230 1862 --1112
NM_002715chr531035 478 119 ------
NM_002716chr1173304 3283 2621 1382 998 946 918 --12523 --
NM_002718chr392434 2287 1887 1082 811 754 747 740 506 11692 12699 --
NM_002719chr1452354 2328 513 485 339 12062 ----
NM_002731chr182716 2630 2534 2354 2094 1161 853 668 21247 337 1392 --
NM_002734chr1771647 1572 1423 1417 701 157 143 --11592 --
NM_002736chr761942 1913 1865 1755 1383 103 31661 1580 684 ----
NM_002737chr1796606 6353 5738 4855 2342 1640 1403 697 348 56051 5481 4261 1976 760 --16343
NM_002740chr332036 391 233 --12361 --
NM_002742chr142734 717 ------
NM_002745chr22103221 3147 3077 2762 1530 1523 1078 964 168 160 14235 --1662
NM_002748chr154409 400 384 175 ------
NM_002749chr171219 ------
NM_002750chr101236 ------
NM_002760chrY96039 5631 5443 5430 4431 3715 1455 1309 615 ------
NM_002765chrX4463 316 259 69 21302 554 1294 --
NM_002788chr14190 ------
NM_002806chr141233 ------
NM_002812chr192429 365 ------
NM_002815chr171168 ------
NM_002816chr172295 279 ------
NM_002821chr63747 656 600 ------
NM_002822chr1251731 1498 542 239 130 --152 21233 512
NM_002826chr12742 294 ------
NM_002827chr2021467 187 ------
NM_002828chr184985 949 868 693 ------
NM_002834chr12103801 3648 3581 3532 3484 3459 3326 3014 1647 45 13133 11021 --
NM_002837chr12144407 3747 3386 3350 3220 2984 2817 1462 1370 1101 1019 903 823 217 14349 23016 1114 --
NM_002839chr973211 3191 2922 2795 2777 509 457 --22414 2352 --
NM_002843chr1153105 1315 1135 993 787 13222 ----
NM_002844chr661059 923 876 516 311 119 1556 11113 --
NM_002869chr1182130 1915 1526 1426 807 746 225 61 ------
NM_002874chr962528 2440 1921 942 548 303 1371 ----
NM_002886chr3185159 5036 4894 4702 4513 4479 4193 3756 3440 3266 1925 1851 1453 1304 1284 1208 979 331 --11144 --
NM_002890chr54802 323 310 266 ------
NM_002892chr143692 451 396 --1313 --
NM_002902chr153648 424 38 --1152 --
NM_002906chr1182324 2022 1696 1493 1477 832 324 241 11463 ----
NM_002912chr63218 83 39 ------
NM_002920chr121352 ------
NM_002922chr12650 436 ------
NM_002940chr481690 1431 1311 1298 605 490 290 269 ------
NM_002941chr341594 1562 1271 507 ------
NM_002942chr35573 420 405 321 165 ------
NM_002953chr11757 ------
NM_002956chr125888 869 455 352 208 11045 ----
NM_002958chr34854 660 638 199 ------
NM_002959chr164284 3471 3123 2926 805 329 21068 583 --11648
NM_002973chr124531 511 426 405 1233 ----
NM_002977chr282955 2355 1095 959 722 647 317 295 13139 --12930
NM_002979chr12766 705 1267 --1694
NM_002984chr171277 ------
NM_002993chr441044 974 715 299 1954 ----
NM_002994chr481853 1520 1302 1222 714 686 464 323 31833 792 668 1200 11663
NM_002995chr15824 761 534 131 84 ------
NM_002998chr861816 600 522 271 94 45 ------
NM_003010chr1742080 783 723 64 ------
NM_003015chr102650 96 ------
NM_003017chr631213 1103 119 --1266 --
NM_003022chrX61061 956 805 410 126 53 ----11313
NM_003026chr931099 964 412 ----11245
NM_003028chr922785 1194 ----12718
NM_003035chr13768 299 23 1944 ----
NM_003043chr374072 1721 1566 759 406 363 261 24287 4241 ----
NM_003046chr875255 4345 4337 3426 1573 1352 562 25331 3383 ----
NM_003051chr171685 1594 1296 711 461 293 253 1453 ----
NM_003069chrX2561 75 ------
NM_003071chr361482 648 474 338 284 260 274 49 ----
NM_003077chr171551 ------
NM_003081chr2031073 330 259 ------
NM_003095chr124354 331 312 63 1273 ----
NM_003096chr2188 ------
NM_003099chr15106602 6395 5254 2218 2140 1830 1577 1530 760 299 35050 4238 1780 ----
NM_003106chr331056 228 37 1736 ----
NM_003107chr652247 2191 1988 1684 1647 11003 ----
NM_003108chr2187284 6754 6568 6205 5822 5712 5598 5503 5242 5228 5109 5088 4744 4501 1377 1070 1013 964 36895 6744 787 11026 --
NM_003111chr211185 ------
NM_003112chr773024 2661 1227 1201 1019 700 107 --11997 --
NM_003113chr22307 71 ------
NM_003123chr1644583 4451 4301 1962 ------
NM_003127chr91294 ------
NM_003128chr252479 1100 941 145 40 ------
NM_003131chr642290 1799 1483 64 11538 ----
NM_003136chr142292 251 ------
NM_003137chr651811 620 534 351 80 1898 ----
NM_003150chr172205 166 ------
NM_003157chr32949 209 145 ----
NM_003161chr17103554 3255 2859 2650 2264 1104 725 535 364 270 23590 97 ----
NM_003162chr22912 755 ------
NM_003174chr102105 91 1120 ----
NM_003178chr351907 671 541 112 23 --11989 --
NM_003182chr72373 141 ------
NM_003182chr72373 141 ------
NM_003184chr83698 265 28 --11111 --
NM_003185chr2031241 1202 1081 21044 450 11215 11291
NM_003187chr52156 136 ------
NM_003188chr62757 143 ------
NM_003189chr153095 3000 2979 2804 1311 ------
NM_003199chr18135629 5003 4916 4407 4378 4239 4039 3819 3549 3476 2129 1341 157 21055 704 ----
NM_003200chr1912265 --22349 37 --
NM_003201chr1041004 421 364 110 ------
NM_003202chr531918 1877 1278 1345 11166 --
NM_003204chr1741721 1194 534 364 ------
NM_003206chr61406 ------
NM_003211chr1271752 1700 1471 1311 475 370 288 ------
NM_003215chr451106 641 628 523 66 ------
NM_003216chr2242945 2648 1219 1192 13340 ----
NM_003217chr1241925 1856 1582 791 ------
NM_003220chr621547 1251 ------
NM_003221chr6103493 3213 3048 3002 2867 1552 589 447 263 70 ----1805
NM_003222chr203965 412 316 1308 ----
NM_003223chr162137 123 ------
NM_003234chr352150 1569 763 155 77 --11563 1511
NM_003236chr253502 3279 2956 1422 1080 13317 ----
NM_003242chr372459 2346 2312 1858 1003 901 700 ------
NM_003244chr182443 404 1307 ----
NM_003246chr1551466 1332 541 366 176 ------
NM_003253chr2161895 1861 1243 417 244 169 --11546 --
NM_003262chr3125010 5004 4586 4340 4232 4193 3302 3282 1958 1539 489 459 21701 837 ----
NM_003269chr631179 364 23 ------
NM_003272chr14247 206 178 75 --1658 --
NM_003274chr2152929 2902 2753 2703 171 --21016 359 --
NM_003286chr2061144 964 956 858 452 257 21058 207 ----
NM_003288chr201602 ------
NM_003290chr192217 198 ------
NM_003291chr134623 314 97 80 ------
NM_003292chr1102274 2254 1908 1873 1475 594 463 318 136 51 ------
NM_003298chr375851 5778 4439 4164 2050 1195 239 14855 12132 12264
NM_003304chr371510 1185 655 616 570 425 33 ------
NM_003319chr22934 158 ------
NM_003320chr1164456 4331 4068 3821 3672 3062 24432 1104 --13258
NM_003336chrX41135 1068 304 269 1832 1934 1993
NM_003337chr551742 1218 309 269 28 ------
NM_003338chr1041919 782 721 55 ------
NM_003340chr411400 ----1204
NM_003342chr17153317 3172 3163 2828 2417 2195 2172 1231 1144 1119 1053 569 517 381 36 ------
NM_003344chr731622 1436 357 41487 1264 1160 24 11746 --
NM_003348chr1261664 1312 1148 1065 660 258 ------
NM_003350chr83841 825 170 1894 11015 --
NM_003352chr23274 258 165 1405 1383 --
NM_003360chr4------1236
NM_003369chr1172665 2523 2225 2070 925 210 195 --32498 2402 277 --
NM_003373chr1041604 1571 696 172 1529 ----
NM_003379chr62915 757 ----1954
NM_003380chr102101 79 ------
NM_003383chr92582 429 ------
NM_003385chr22933 736 ------
NM_003387chr242843 2737 2028 180 22464 2277 ----
NM_003390chr113977 179 126 ------
NM_003392chr3114107 3894 3587 3514 3305 3187 3088 2880 2861 1191 550 22809 83 12780 --
NM_003394chr12157 ------
NM_003403chr143807 696 332 ------
NM_003404chr2042002 767 119 111 ------
NM_003406chr851490 793 672 629 206 ----11875
NM_003409chr18101454 1436 1423 1390 1310 1251 1040 568 320 159 ------
NM_003410chrX72812 2116 2069 1163 1106 608 235 1519 --1672
NM_003411chrY51636 1541 1495 592 258 1475 --1635
NM_003412chr3103007 2719 2459 2301 2227 1223 984 197 191 177 ------
NM_003413chrX41962 1715 1318 521 ------
NM_003418chr32716 626 ------
NM_003423chr1972307 1825 1660 1009 930 901 135 11638 --1304
NM_003430chr1951614 1202 1120 411 232 ------
NM_003439chr743442 3088 803 284 21367 55 12654 --
NM_003442chr113257 244 41 ------
NM_003457chr171228 1249 ----
NM_003462chr121789 1187 1560 1389 11614
NM_003468chr273683 3342 2921 1354 821 485 448 --12808 --
NM_003471chr372165 1882 1727 913 657 579 348 12124 ----
NM_003472chr671391 1231 1105 343 307 237 198 ----11155
NM_003474chr1021479 302 22063 1948 4520 294 85 53 --
NM_003477chr111616 ------
NM_003478chr1173170 2861 1278 663 625 618 260 --11213 --
NM_003482chr1232465 1913 1821 ------
NM_003483chr12102554 2488 1978 1069 780 761 663 624 275 106 --12156 12391
NM_003489chr21133193 3164 2951 2833 2522 2113 1295 860 752 613 518 275 115 22536 370 13432 --
NM_003503chr181320 843 497 311 280 261 233 120 ----1386
NM_003505chr771606 1448 1364 1264 337 257 122 1400 ----
NM_003506chr851331 976 536 496 479 ------
NM_003507chr241883 750 508 215 --1613 --
NM_003538chr6150 ------
NM_003542chr6168 ------
NM_003545chr6155 ------
NM_003547chr6160 ------
NM_003557chr121440 264 2586 305 ----
NM_003558chr92543 145 ------
NM_003563chr1751378 1187 490 144 99 ------
NM_003566chr1252792 2278 994 235 198 ------
NM_003567chr12310 34 1370 1118 --
NM_003574chr18174787 4769 4393 3665 3639 3502 2251 1743 1560 1492 1426 1179 1143 1013 868 820 545 11397 13886 --
NM_003576chr1332051 831 758 --1467 12202
NM_003580chr82449 65 ------
NM_003581chr21880 ------
NM_003583chr12113427 3283 3211 1441 1374 1359 1022 899 811 454 123 23927 2637 1637 1208
NM_003589chr1331316 394 147 --1213 --
NM_003590chr2113980 3896 3392 3114 2972 2916 1550 1272 1175 719 65 23845 1289 --11532
NM_003597chr252200 1623 627 447 285 2379 201 1488 1542
NM_003603chr451493 1469 644 473 441 1684 11611 --
NM_003607chr194073 3389 2983 1574 1567 1226 1079 350 62 --1258 --
NM_003615chr3163957 3901 3829 3476 3058 1598 1331 1321 1142 996 972 790 590 467 384 365 13374 21342 281 --
NM_003618chr241166 1006 511 304 ------
NM_003620chr172876 726 21019 337 ----
NM_003622chr1272421 1995 1909 976 664 583 542 1403 ----
NM_003626chr1191376 1242 1225 1125 551 318 311 285 256 21074 191 ----
NM_003629chr172858 2739 2304 2276 2127 1401 770 ----1992
NM_003633chr542570 1702 1640 960 11670 ----
NM_003644chr1776612 6303 4415 2286 1636 1616 573 22352 1842 31560 1316 1166 --
NM_003645chr151192 ------
NM_003657chr201828 ------
NM_003658chr113871 845 761 ------
NM_003659chr241024 246 135 50 ------
NM_003663chr392799 2377 2256 1370 740 701 653 567 183 13446 --13433
NM_003670chr351125 928 905 424 345 11266 ----
NM_003671chr943316 3057 2500 1366 22825 914 ----
NM_003672chr141671 1601 468 228 1537 ----
NM_003677chr1241612 610 296 71 ------
NM_003687chr531180 1067 891 ------
NM_003692chr931031 206 107 183 ----
NM_003702chr81808 ------
NM_003714chr542436 1898 1172 776 ------
NM_003722chr352613 2472 2459 1861 298 --1562 --
NM_003744chr143975 378 102 ------
NM_003746chr12187 ------
NM_003749chr1351750 880 328 295 77 11535 ----
NM_003759chr4134293 4278 4243 3974 3965 3521 3329 2658 2612 1636 1398 479 224 24009 3693 --34028 3903 366
NM_003760chr12791 329 ------
NM_003762chr151236 464 192 107 93 ------
NM_003763chr2032375 1993 360 1284 13004 --
NM_003766chr172498 39 ------
NM_003769chr122227 34 ------
NM_003772chr114921 462 177 153 1248 ----
NM_003774chr12102996 2895 2864 2733 2725 2553 2514 1313 1049 456 2548 476 32624 2061 1088 --
NM_003783chr141212 472 378 91 1366 ----
NM_003784chr183641 623 570 1467 ----
NM_003787chr1881633 1412 1053 685 550 514 234 104 ------
NM_003795chr61605 --173 --
NM_003799chr18164521 4468 4290 4201 4026 3750 3223 2828 2815 1437 1243 1215 546 435 393 229 31031 655 514 11561 --
NM_003800chr672057 2021 1981 1948 1749 659 425 22254 391 ----
NM_003816chr851494 1178 1168 1004 469 21420 1371 ----
NM_003822chr153169 1983 918 785 28 ------
NM_003825chr155541 295 258 236 85 171 ----
NM_003831chr1841590 1337 1315 163 31706 1603 537 1695 --
NM_003861chr1432311 2221 1805 --1372 12525
NM_003864chr4156 ------
NM_003872chr242967 2899 667 470 12387 11226 --
NM_003873chr1052571 2311 1016 445 78 22227 1827 ----
NM_003877chr122959 189 1651 --1243
NM_003878chr81197 ------
NM_003883chr52489 40 ------
NM_003884chr32629 411 2358 161 1152 --
NM_003885chr1752488 2418 2174 599 141 11954 --12119
NM_003887chr272345 2248 1589 1514 751 393 189 ------
NM_003888chr1541716 643 549 481 ------
NM_003895chr2171659 1354 747 660 645 597 293 --1335 --
NM_003899chr1332339 2115 1673 --12333 --
NM_003901chr1092728 2670 2626 2450 2376 666 653 461 289 ------
NM_003902chr17850 765 672 319 313 300 218 2792 692 1558 --
NM_003908chr202534 298 ------
NM_003909chr8113083 3021 2897 2478 2343 2334 1907 1889 1040 750 297 11876 1771 --
NM_003913chr6104308 3654 3263 3232 1106 1032 1007 990 859 497 --11500 23214 156
NM_003916chrX51510 1490 1339 1141 416 ------
NM_003934chr92907 823 ------
NM_003941chr7102443 2402 2245 909 814 793 733 543 350 256 12460 ----
NM_003947chr321033 858 ------
NM_003953chr182893 2798 2190 957 513 385 309 269 22233 296 ----
NM_003968chr33567 192 81 ----1256
NM_003971chr174574 529 523 70 ------
NM_003972chr102372 88 ------
NM_003980chr671378 1238 1103 1050 1043 389 183 11142 ----
NM_003994chr12133850 3826 3428 2955 2936 2782 1588 1548 1498 1392 1273 435 30 13578 12969 --
NM_003998chr43679 181 144 1619 ----
NM_004006chrX62600 2497 2059 1721 668 218 ----12308
NM_004007chrX62600 2497 2059 1721 668 218 ----12308
NM_004009chrX62600 2497 2059 1721 668 218 ----12308
NM_004010chrX62600 2497 2059 1721 668 218 ----12308
NM_004011chrX62600 2497 2059 1721 668 218 ----12308
NM_004012chrX62600 2497 2059 1721 668 218 ----12308
NM_004013chrX62600 2497 2059 1721 668 218 ----12308
NM_004014chrX62600 2497 2059 1721 668 218 ----12308
NM_004015chrX62600 2497 2059 1721 668 218 ----12308
NM_004016chrX62514 2411 1973 1635 582 132 ----12222
NM_004017chrX62600 2497 2059 1721 668 218 ----12308
NM_004018chrX62514 2411 1973 1635 582 132 ----12222
NM_004020chrX62600 2497 2059 1721 668 218 ----12308
NM_004021chrX62514 2411 1973 1635 582 132 ----12222
NM_004022chrX62514 2411 1973 1635 582 132 ----12222
NM_004023chrX62514 2411 1973 1635 582 132 ----12222
NM_004028chr1873910 1556 1236 871 823 479 264 --12806 --
NM_004050chr1432722 2433 1758 11062 ----
NM_004061chr51265 ----1647
NM_004067chr731156 1000 460 ------
NM_004078chr1144 ------
NM_004080chr761430 1060 1030 968 488 301 --11325 1447
NM_004081chrY91789 1610 1602 1483 1384 1193 703 510 408 --11205 --
NM_004086chr141568 ------
NM_004087chr381413 1352 1251 765 552 352 344 140 1213 1595 --
NM_004096chr1051654 1403 1362 704 553 21937 1393 ----
NM_004109chr1142106 1996 290 25 ------
NM_004111chr113677 198 129 ------
NM_004117chr672115 1733 1611 1560 1365 363 275 --22127 841 --
NM_004124chr1473510 2958 2902 2747 2283 833 691 ------
NM_004133chr882541 2520 2490 2479 2319 666 493 185 ------
NM_004136chr15103012 2837 2549 2171 1286 832 718 710 469 26 ------
NM_004156chr81606 ------
NM_004162chr331188 1179 386 ------
NM_004169chr172721 145 ------
NM_004170chr941883 1503 692 603 1241 ----
NM_004171chr11149227 8101 7978 5835 3428 3285 3140 3122 2119 1838 1825 1711 1042 959 27645 1953 ----
NM_004172chr542038 1527 404 187 11808 11407 1387
NM_004202chrY2632 67 ------
NM_004209chr1621143 950 ------
NM_004215chr81559 ------
NM_004229chrX112221 2209 1843 1828 1738 1646 1606 1498 748 155 139 12260 ----
NM_004232chr18133477 3322 3300 2821 2622 1447 1361 961 669 583 425 109 72 1216 --13223
NM_004233chr651416 1260 593 278 234 ------
NM_004237chr55940 920 828 583 219 1912 ----
NM_004241chr103648 592 25 ------
NM_004242chr63310 95 52 ------
NM_004253chr94705 368 326 207 ----1959
NM_004261chr18959 941 930 841 823 809 787 105 ------
NM_004264chr12101245 1176 1082 906 799 487 401 337 155 129 11028 ----
NM_004272chr541742 1665 1528 1282 1173 11246 --
NM_004274chr1492727 2297 2044 1291 1162 906 785 689 549 13078 12704 --
NM_004279chr761866 770 356 262 210 118 21632 1482 22352 746 --
NM_004288chr23930 831 175 ------
NM_004290chr531297 1287 144 ------
NM_004293chr983590 3147 2600 2480 1538 1151 664 315 33347 596 565 ----
NM_004311chr1073009 2986 2979 2129 1981 284 199 21047 984 ----
NM_004329chr1031241 971 405 11151 2419 150 --
NM_004331chr872625 2557 2390 963 855 700 626 21016 215 12091 --
NM_004337chr862277 1524 1496 672 279 239 1790 ----
NM_004338chr18216981 6928 6868 6795 6658 6644 6051 5927 5636 5436 5379 4951 4838 4514 4499 2647 2434 1655 1014 650 466 --26309 151 --
NM_004342chr782222 2056 2027 880 620 558 121 114 2676 485 ----
NM_004346chr43304 264 29 2498 462 ----
NM_004349chr841238 1034 300 123 ------
NM_004354chr43653 300 157 ------
NM_004370chr662200 2129 1741 763 620 225 22055 1966 ----
NM_004379chr241378 1366 248 214 11175 ----
NM_004380chr1672366 2336 2027 981 479 371 30 21895 665 ----
NM_004382chr1711057 ------
NM_004385chr53462 37 28 ------
NM_004392chr13102658 2264 2142 1745 1033 732 675 573 181 93 1886 11636 --
NM_004393chr341628 1612 1472 641 ----1474
NM_004395chr52718 169 ------
NM_004396chr173221 184 34 ------
NM_004397chr1183552 3077 2800 1642 584 557 96 89 34137 3202 1490 --1496
NM_004398chr111417 ------
NM_004414chr2121521 54 ------
NM_004415chr6--1508 --1688
NM_004419chr101296 ------
NM_004432chr992418 2001 1944 1742 1578 766 287 276 193 ------
NM_004434chr1451775 1288 658 629 332 11849 ----
NM_004437chr1113258 3209 3144 2233 1240 988 869 755 235 136 102 --22347 1100 --
NM_004438chr273254 2941 2724 2220 1018 1006 416 --1472 --
NM_004440chr651703 1382 784 739 486 2457 403 ----
NM_004442chr111138 1608 --1408
NM_004447chr1221106 1092 ------
NM_004456chr71234 ------
NM_004457chr241638 1585 1373 192 ------
NM_004458chrX62102 1749 1642 1071 1054 51 32342 1044 388 ----
NM_004459chr1741792 1517 1500 84 --11341 --
NM_004463chrX4644 180 163 121 ------
NM_004464chr4123607 3392 3238 3215 3019 2986 2847 1191 661 560 468 318 1279 13095 --
NM_004482chr23914 710 620 ------
NM_004491chr1924097 3914 ------
NM_004496chr142952 137 ------
NM_004499chr52364 357 ------
NM_004500chr1471526 1324 1262 338 236 179 73 --11753 --
NM_004501chr173707 3325 2954 1634 1276 331 244 1126 --11421
NM_004502chr172559 207 ------
NM_004504chr282998 2718 2535 2524 2017 540 388 34 23005 2051 --11929
NM_004505chr1731612 1271 517 11520 1207 --
NM_004514chr1762702 2641 2351 956 684 566 ----21168 498
NM_004516chr193789 422 120 21185 240 ----
NM_004519chr81196 ------
NM_004521chr101120 ------
NM_004523chr1031308 547 529 ----11099
NM_004535chr2031501 1368 484 ------
NM_004537chr1251356 1219 367 165 96 11070 ----
NM_004560chr92829 313 ------
NM_004561chr1121287 691 ------
NM_004566chr1012518 --11950 12538
NM_004571chr2163332 3238 2781 2752 1304 158 11314 ----
NM_004575chr461630 1581 1206 1192 1134 73 21173 415 ----
NM_004578chr12909 244 1357 1251 --
NM_004586chrX85340 4800 4774 4022 3691 2105 1267 1114 ------
NM_004593chr35888 617 162 124 115 1212 --1783
NM_004596chr191219 ------
NM_004598chr552772 2445 1170 995 534 12343 ----
NM_004600chr171555 1174 1146 970 957 473 379 --11427 1545
NM_004612chr9104104 3778 3612 3177 1614 1594 1341 957 595 480 11849 ----
NM_004619chr182239 2045 1771 740 631 556 509 282 ------
NM_004622chr272166 1780 1716 1667 1499 241 211 22197 1554 ----
NM_004637chr31857 --11118 --
NM_004642chr123726 597 90 ------
NM_004643chr143809 745 692 ------
NM_004650chrX41916 1690 1429 509 276 37 11493 --
NM_004654chrY31120 1087 561 11209 ----
NM_004660chrY22119 1885 22296 1697 1726 --
NM_004661chr561271 1218 945 887 834 301 ------
NM_004663chr1561563 1478 1018 262 192 145 --11090 --
NM_004673chr151475 1363 518 394 47 --11160 --
NM_004677chrY3459 425 120 1128 ----
NM_004681chrY4747 711 538 129 ------
NM_004685chr1382753 2719 2461 2210 868 811 393 103 --2999 440 --
NM_004686chr831677 525 496 --2541 381 11538
NM_004687chr1771852 1827 1658 1558 1471 594 29 ----12006
NM_004689chr142464 453 ------
NM_004694chr173737 356 105 --1787 --
NM_004703chr1772509 2212 2038 2026 866 807 531 1311 --12262
NM_004709chrX51697 1328 1256 46 26 1346 ----
NM_004717chr731192 1165 148 11392 11178 --
NM_004718chr22655 59 ------
NM_004726chrX165683 5525 5458 5379 4945 4333 4006 3766 3756 3727 3616 3559 2006 1770 819 736 --35156 4795 399 11472
NM_004730chr541440 1425 578 272 ------
NM_004731chr1271887 1841 1532 1433 91 57 24 --1295 --
NM_004734chr13123204 3053 3017 2991 2960 1214 690 480 385 242 120 106 --12693 --
NM_004736chr132032 1633 210 --1752 --
NM_004738chr20--12333 --1190
NM_004741chr1041540 591 349 253 --11259 --
NM_004744chr4103731 3662 3531 2800 1499 1315 1265 992 711 512 11441 ----
NM_004745chr8176687 6505 6167 6067 5890 5803 5757 5516 5252 5189 4817 4324 2735 2394 1530 946 506 44365 2101 2075 1409 ----
NM_004748chr15104181 4101 2986 1332 1305 1094 551 412 311 255 11128 23575 3089 --
NM_004755chr1471141 837 440 212 130 78 70 11055 ----
NM_004760chr742399 661 457 428 --11980 --
NM_004768chr12930 860 ----1172
NM_004774chr1793087 3035 2593 2555 900 812 579 379 356 1953 12746 --
NM_004775chr18102309 2236 2205 2116 1942 1900 1610 921 431 315 ------
NM_004788chr1152266 1755 418 392 258 ------
NM_004789chr92293 111 ------
NM_004796chr1452217 2208 1521 347 32 22099 853 12253 --
NM_004798chr2052909 2872 2716 1256 204 11442 ----
NM_004801chr261421 1201 1096 973 633 240 ------
NM_004808chr10103312 2885 2854 2493 2389 2251 2088 1332 291 256 12680 ----
NM_004815chr1103975 3378 1485 1297 1094 795 776 739 533 488 23454 831 ----
NM_004834chr243028 2874 2251 1077 --12848 --
NM_004836chr23959 855 612 ------
NM_004840chrX52448 2433 2149 1907 235 --32361 867 774 --
NM_004841chr111138 --1154 1749
NM_004842chr671776 1727 1716 1449 1421 1312 136 ------
NM_004845chrX73739 3640 3394 3324 3277 2932 2819 11565 ----
NM_004849chr641537 1363 646 415 11256 ----
NM_004850chr231447 1223 1108 ------
NM_004856chr153531 490 33 ------
NM_004857chr14134010 3745 3564 3490 3396 3374 3265 2951 1789 1657 1460 551 53 ------
NM_004859chr1722958 2143 32640 804 194 12158 --
NM_004860chr171559 ------
NM_004865chr64417 362 110 43 ------
NM_004866chr5204890 4766 4723 4506 4401 3816 3072 1652 1534 1472 1095 1062 1019 832 711 481 472 347 272 191 21753 558 23535 1012 --
NM_004867chrX3558 466 176 ------
NM_004869chr1851378 1258 382 98 44 ------
NM_004871chr1784308 3950 3928 3144 2899 1478 239 39 --23689 393 --
NM_004872chr12441 64 ------
NM_004874chr83429 184 168 1193 ----
NM_004879chr112766 681 ------
NM_004883chr52155 149 ------
NM_004896chr1041476 1181 377 307 11452 ----
NM_004897chr106757 731 629 181 122 95 ------
NM_004898chr482282 1033 1000 930 891 854 824 236 1484 21162 349 1512
NM_004902chr204818 538 226 69 1332 ----
NM_004904chr7145416 4654 4352 4181 4174 2114 2046 1926 1654 1507 814 157 124 61 22257 75 21256 356 --
NM_004921chr172521 1598 904 396 188 108 59 --2689 428 --
NM_004922chr1011022 ------
NM_004924chr19------1761
NM_004926chr1441866 1507 1261 525 11451 ----
NM_004932chr571705 1674 1314 1293 1273 201 168 ------
NM_004936chr952922 2293 941 846 286 ----11189
NM_004938chr93463 340 228 ------
NM_004947chr332222 2214 984 12550 --1939
NM_004949chr1872101 2001 1582 775 706 392 254 ----1866
NM_004950chr121406 ------
NM_004952chr12950 928 ------
NM_004956chr7114472 4380 3440 3049 1271 1197 1139 1055 881 789 767 34373 3912 1021 14240 --
NM_004958chr11736 ------
NM_004964chr12541 379 1410 ----
NM_004966chr104694 294 205 38 ------
NM_004972chr941200 826 293 150 21083 1040 ----
NM_004973chr641727 1381 1217 147 2418 129 ----
NM_004985chr12154441 4424 4176 3999 3726 3556 1790 1377 1227 1028 871 669 403 130 85 23819 3742 22889 1545 --
NM_004992chrX108454 7497 5709 5437 5408 2216 1969 1560 1258 400 --56418 5420 3336 3127 129 --
NM_004992chrX108454 7497 5709 5437 5408 2216 1969 1560 1258 400 --56418 5420 3336 3127 129 --
NM_004993chr1451423 1338 1332 583 412 --31062 440 112 --
NM_004996chr1631682 1500 1115 11198 11636 --
NM_004999chr6104240 3746 3406 3100 2985 2820 1124 836 793 334 43443 1255 1200 486 14189 11759
NM_005010chr761902 1881 743 711 418 203 1809 ----
NM_005016chr123330 301 114 ------
NM_005020chr71124 ----1570
NM_005023chr531039 947 343 ------
NM_005028chr1042356 2081 1864 788 11600 --12062
NM_005032chrX1115 ------
NM_005036chr22148324 7420 6621 6290 6109 5851 5160 3190 3175 2615 2424 1515 1493 1250 35150 2588 1656 12655 --
NM_005037chr31173 ------
NM_005056chr1285435 4118 3953 2054 1984 1351 1128 1017 ------
NM_005057chr141651 1235 1182 196 21779 563 ----
NM_005058chrY2253 185 ------
NM_005063chr1052822 2672 241 135 28 13505 ----
NM_005065chr14135276 5163 4268 4184 3471 3456 3342 1966 1578 469 336 211 166 --1236 --
NM_005066chr14828 696 78 62 ------
NM_005069chr2131683 1286 1247 --1369 1455
NM_005079chr883155 3084 3028 3010 1060 735 695 104 ------
NM_005080chr224775 630 616 203 ------
NM_005095chr192186 1921 1473 1455 884 878 643 543 25 --12204 --
NM_005112chr41869 1702 ----
NM_005113chr142405 121 ------
NM_005119chr12888 456 ------
NM_005121chr17113519 3270 2998 1485 1153 1094 1040 1009 937 496 175 ----1602
NM_005135chr15103597 3168 3018 2991 2681 1262 1026 755 502 237 22953 1346 1745 --
NM_005141chr44355 295 273 75 ------
NM_005151chr1842130 1658 328 287 22188 722 ----
NM_005156chr9275384 5140 4963 4869 4824 4779 4585 4465 4140 3913 3581 3477 3408 2137 1730 1691 1533 1462 1379 1202 1180 605 371 319 265 96 43 33961 1702 870 --1963
NM_005160chr22176449 6235 5854 5814 5764 5563 5450 5340 4977 2131 2012 1365 1285 1025 758 740 733 22706 956 --12066
NM_005164chr12112565 2340 2055 2041 1987 1780 1709 1673 677 643 129 1161 ----
NM_005168chr2----11147 21316 1304
NM_005180chr1031522 1326 1192 ------
NM_005188chr11158312 8275 8196 7860 7690 7227 7153 5951 5945 5026 2685 2535 1557 1210 1159 1593 11071 --
NM_005197chr14125893 5471 5162 4477 3847 2337 1534 1377 725 259 143 46 15517 14730 --
NM_005203chr102417 68 ------
NM_005207chr2263677 2886 2688 2323 1235 749 1214 12420 --
NM_005214chr24842 827 420 399 --1225 --
NM_005215chr182240 175 ------
NM_005221chr73267 255 241 ------
NM_005229chrX41302 1038 982 853 --1316 --
NM_005230chr124547 501 429 122 --1244 --
NM_005233chr352511 2025 950 514 435 --12323 1777
NM_005235chr2167601 7562 6607 6419 6396 6168 5649 5147 3000 2763 2471 879 838 651 631 584 15181 25121 994 --
NM_005238chr1163486 3305 2596 1168 419 229 11322 ----
NM_005239chr2131912 596 218 2443 351 ----
NM_005241chr331069 432 55 --11353 --
NM_005243chr221138 ------
NM_005245chr43628 527 190 ------
NM_005250chr1671926 1648 1561 1480 651 561 411 ------
NM_005254chr1541371 1241 541 310 1510 ----
NM_005256chr112623 228 ----1615
NM_005259chr221541 1386 11097 ----
NM_005261chr83998 704 327 ------
NM_005273chr71334 ------
NM_005276chr121120 --1580 --
NM_005276chr121120 --1580 --
NM_005277chr4111824 1797 1763 1717 1362 1290 1270 761 553 405 393 ------
NM_005284chr62398 364 ------
NM_005295chr71122 ------
NM_005302chr72306 43 ------
NM_005312chr952686 1805 574 527 284 --11028 --
NM_005313chr1511046 ------
NM_005316chr111912 ----1354
NM_005324chr1741374 835 415 125 --11649 --
NM_005328chr83757 713 148 ----1790
NM_005329chr1642334 2152 645 103 1233 ----
NM_005339chr4133985 3429 3120 2900 2656 2623 1336 965 907 883 720 91 69 12909 13992 --
NM_005342chrX32494 960 383 ------
NM_005349chr45637 615 422 249 106 ------
NM_005359chr18176006 5912 5759 5679 5598 5437 5078 4936 4572 4265 4099 2409 2256 1735 545 321 109 12011 34354 1876 1649 11619
NM_005369chrX7677 581 537 480 175 159 111 ------
NM_005370chr1931038 182 162 ------
NM_005376chr12983 316 --1971 --
NM_005384chr9182 ------
NM_005388chr951727 1616 1443 112 89 --21606 694 --
NM_005389chr62193 169 ------
NM_005398chr1041141 290 252 76 ------
NM_005399chr1154295 4048 3549 3275 2999 2772 2686 1046 1013 956 947 818 772 709 281 1121 --13645
NM_005400chr282922 2586 2459 2195 713 610 603 328 13079 ----
NM_005406chr1871075 1027 998 639 607 362 356 ------
NM_005433chr1852692 1953 677 555 209 ------
NM_005436chr1094064 3458 3329 2747 1628 1219 869 583 281 --2491 333 13139
NM_005450chr171103 ------
NM_005455chr151568 659 358 234 224 ------
NM_005458chr922288 1993 --11834 --
NM_005465chr132048 1785 148 --1348 --
NM_005467chr113564 136 102 ------
NM_005475chr1242777 1068 632 345 23314 2836 1814 --
NM_005494chr71425 --1101 --
NM_005497chr17176099 5943 3781 3773 1990 1956 1646 1287 1275 1262 773 678 610 562 380 328 30 35770 2068 525 11939 --
NM_005502chr943184 2953 2398 2157 32522 2018 515 --11245
NM_005504chr12166371 5916 5402 5049 4985 4715 4633 4422 2283 2250 2023 1953 1914 1836 473 279 11714 21904 1821 --
NM_005509chr561697 1468 1168 731 666 546 ------
NM_005517chr131446 937 545 ------
NM_005520chr53773 707 488 --1729 --
NM_005522chr761393 1238 1134 878 492 355 --1257 1289
NM_005530chr1541370 1244 979 182 1118 ----
NM_005537chr1341133 883 169 132 1216 ----
NM_005539chr1041375 1003 876 315 ------
NM_005542chr741948 1912 1338 723 ------
NM_005544chr23848 360 151 ------
NM_005562chr12682 560 ------
NM_005563chr12720 159 1102 --1677
NM_005572chr1179 ------
NM_005575chr53715 708 155 ------
NM_005578chr3215135 5053 4987 4969 4898 4628 4474 4334 4179 3899 3666 1909 1624 1474 1297 1215 1182 1086 871 310 285 --1395 --
NM_005593chr122528 110 ------
NM_005595chr12878 689 ------
NM_005596chr952238 1794 1785 1753 658 24323 1664 25877 1882 11334
NM_005602chr341110 1075 928 892 ------
NM_005604chr672326 1877 1851 933 828 494 104 ------
NM_005607chr83673 277 202 ------
NM_005611chr1621329 1129 ----1277
NM_005613chr172053 1705 1624 1452 1367 659 284 ----11949
NM_005618chr61448 ------
NM_005625chr861112 815 763 277 222 154 ------
NM_005627chr63742 199 54 1686 ----
NM_005637chr1841933 1529 1373 631 --11795 --
NM_005638chrX51696 1419 550 435 77 --1624 --
NM_005639chr1241930 1377 216 85 ------
NM_005642chr55500 153 130 102 23 ------
NM_005647chrX33350 700 566 12712 ----
NM_005648chr83201 73 36 ------
NM_005655chr831095 353 235 1265 ----
NM_005657chr151132 ------
NM_005662chr81342 ------
NM_005665chr184635 4470 3662 1301 1270 971 844 673 13992 11124 13962
NM_005668chr5144644 4373 3754 3364 2813 2805 1483 1287 1271 1252 1172 851 835 90 14328 ----
NM_005708chr132414 35 ------
NM_005715chr682637 2576 2354 2326 1754 803 720 389 --12619 12081
NM_005717chr151006 299 237 225 127 ------
NM_005721chr261034 996 963 945 814 247 ------
NM_005722chr262512 2392 973 475 389 293 12309 ----
NM_005725chr162392 2340 862 807 741 38 1577 11781 1339
NM_005737chr252917 2156 1813 766 560 12795 ----
NM_005738chr742017 1680 1459 788 1696 1351 --
NM_005746chr7102381 2091 918 460 435 408 289 263 216 128 21809 814 11857 --
NM_005748chr1262399 2275 2156 642 274 81 21046 849 22592 281 13009
NM_005749chr173552 151 61 ------
NM_005751chr71509 ------
NM_005752chr1661226 1217 882 822 451 301 11096 ----
NM_005754chr561191 904 822 239 223 195 ------
NM_005756chrX41366 307 217 63 1189 21354 297 --
NM_005759chr274464 4028 3617 3552 3386 1824 992 23324 519 24608 3577 11791
NM_005761chr12------1159
NM_005765chrX2734 671 --168 --
NM_005766chr133499 382 373 1482 ----
NM_005768chr12158 ------
NM_005776chr142807 178 ------
NM_005777chr31110 ------
NM_005778chr31456 ------
NM_005779chr563618 3208 3112 2719 2344 443 1640 ----
NM_005780chr132726 369 ------
NM_005786chr1841101 994 426 218 ------
NM_005788chr111740 ------
NM_005789chr1782112 1615 1457 622 405 296 179 124 --1734 11929
NM_005795chr252898 2736 2505 2240 2219 12358 1446 --
NM_005797chr1171452 1323 1306 1268 577 373 239 1224 1387 --
NM_005798chr13135160 5081 5050 4961 4013 3647 3261 2113 2004 948 913 897 541 35206 4488 4314 24592 3331 14852
NM_005808chr343230 474 306 189 --1467 --
NM_005813chr271965 1702 1694 927 593 503 228 11984 ----
NM_005822chr682125 1830 1721 1647 858 847 499 340 1769 ----
NM_005828chr17135030 5019 5011 4847 4835 3909 3374 1936 1818 1798 1770 981 105 11686 --1926
NM_005832chr371422 1319 1227 555 378 218 54 ------
NM_005839chr12390 194 ----1826
NM_005840chrX137065 6460 5232 5072 5025 2998 2784 2556 1660 1402 556 505 411 1607 27077 4893 12316
NM_005842chr132695 596 1485 ----
NM_005843chr231592 209 180 1505 1236 1258
NM_005857chr151469 1391 976 958 436 191 ----
NM_005859chr541510 1476 515 447 1493 ----
NM_005863chr1041245 922 559 116 ------
NM_005868chr771962 1875 1631 1591 1007 211 199 ------
NM_005871chr1051083 1063 1046 441 426 1345 ----
NM_005875chr31100 ------
NM_005882chr43830 344 246 ------
NM_005885chr551438 1189 1083 625 384 ------
NM_005898chr11133037 2896 2766 2684 2459 2353 2293 2214 1097 1073 1017 346 127 22101 1055 199 --
NM_005899chr175373 310 254 229 190 ------
NM_005900chr451207 1169 997 452 442 1781 1256 --
NM_005901chr18258625 8515 8461 8377 7954 7122 6985 6833 6710 6250 5941 5337 3266 2840 2595 2313 1642 1633 1562 1552 1330 979 556 504 363 16075 27420 7209 15903
NM_005902chr1594626 4517 4460 3885 3736 3315 2881 986 713 14502 13710 --
NM_005903chr5103354 3216 2088 2063 1022 873 856 843 420 278 23963 53 14775 12098
NM_005904chr1821046 91 ------
NM_005907chr671669 1598 1589 1426 1251 1115 137 ------
NM_005909chr5134229 3974 3730 3723 3545 3520 3228 1709 1661 1421 1393 1176 672 ------
NM_005911chr231161 972 150 --21418 105 --
NM_005920chr163861 3757 3449 2890 1006 249 --13167 12397
NM_005922chr62506 488 ------
NM_005927chr53890 479 189 ----1841
NM_005930chr142587 48 1193 1269 --
NM_005933chr1132870 2303 922 12093 1771 --
NM_005935chr465283 3742 3558 3225 1389 939 25160 3363 13632 21471 1125
NM_005937chr1764163 4013 3560 3026 1415 423 --11179 --
NM_005938chrX1575 ------
NM_005941chr8114186 3686 3500 3202 1689 1606 1326 792 778 285 129 13824 12807 11040
NM_005944chr321189 1084 ------
NM_005955chr1105250 4881 4578 4435 4065 3955 3439 2019 1585 397 14404 --1127
NM_005966chr272253 2233 2109 2071 1942 1632 605 1839 ----
NM_005969chr1171194 1079 957 481 211 205 190 1273 ----
NM_005977chr132407 33 ------
NM_005986chr1352476 1758 953 939 672 1223 12065 --
NM_005994chr172893 724 ------
NM_005996chr1241205 1130 411 24 1605 ----
NM_005999chr141233 405 347 98 --11084 --
NM_006002chr13188 ------
NM_006007chr993824 3535 3070 1356 1329 1253 861 792 144 ------
NM_006015chr111185 ------
NM_006016chr662260 2156 1788 1650 1482 72 32149 815 776 ----
NM_006020chr14------1559
NM_006022chr1331080 906 761 ------
NM_006030chr321860 1812 --1519 --
NM_006036chr292549 2326 1919 1820 928 559 541 219 100 ----1359
NM_006037chr294803 4099 4007 3386 1881 1684 1549 1430 1119 31803 1771 1380 14232 --
NM_006042chr174467 456 113 102 ------
NM_006043chr162711 190 ------
NM_006047chr20103209 3143 3053 2655 2462 2143 1202 890 852 474 ------
NM_006080chr762325 2037 2031 1870 790 89 12926 22990 612 12200
NM_006088chr91146 ------
NM_006089chrX61900 1822 760 641 578 291 11717 ----
NM_006090chr11120 ------
NM_006091chr1551822 1505 1402 1379 477 --11183 --
NM_006094chr832272 1970 1659 1744 12401 --
NM_006095chr4114264 4173 1607 1596 1528 1466 1402 1294 817 800 426 21571 1429 ----
NM_006106chr1182831 2772 2459 988 923 603 193 88 33369 2889 2143 1544 --
NM_006108chr1192272 2231 1596 1529 1487 920 574 484 103 ------
NM_006110chr16199 ------
NM_006113chr131851 1526 550 21585 40 ----
NM_006135chr131030 564 108 ------
NM_006136chr761258 1041 1003 541 171 30 11243 ----
NM_006139chr282729 2674 2223 2202 2132 736 590 374 22739 1784 ----
NM_006141chr1622221 2063 ------
NM_006147chr12197 83 ------
NM_006154chr1572620 1109 1007 799 791 639 176 ------
NM_006166chr1281754 1613 812 790 679 391 324 177 ------
NM_006167chr862055 1985 1689 954 897 619 ------
NM_006178chr1721417 593 ------
NM_006180chr941971 1928 1869 69 ------
NM_006183chr123436 385 168 ------
NM_006190chr25941 785 773 345 224 ------
NM_006195chr951446 1214 1056 1023 441 ------
NM_006197chr832257 1975 808 ----1504
NM_006203chr5164975 4612 4321 4235 4109 3555 2196 2005 1839 1438 981 697 598 285 237 176 44442 1866 1100 369 14485 --
NM_006206chr442404 2100 638 557 12789 ----
NM_006216chr23435 113 74 ------
NM_006226chr231261 149 132 ------
NM_006239chr45767 482 308 249 141 ------
NM_006241chr382288 2228 2068 1681 1507 862 648 345 22027 2007 22427 2361 --
NM_006242chr2071968 1605 1565 1526 1520 871 734 ----12058
NM_006243chr12381 367 ------
NM_006246chr1441268 1107 356 249 1831 ----
NM_006251chr5113343 2951 2689 2597 2445 2388 1103 922 864 803 671 22998 2990 ----
NM_006252chr1247583 7434 7375 7156 7022 6758 6374 6046 5289 5254 4621 2800 2746 2408 2295 2233 2201 2040 1633 1323 1207 745 610 394 22286 519 ----
NM_006253chr1211236 ------
NM_006254chr31353 ------
NM_006256chr152589 2268 2126 1099 746 12231 --22387 825
NM_006257chr102148 82 ------
NM_006258chr1031061 984 245 --11363 --
NM_006264chr41505 ------
NM_006267chr271845 1768 1517 612 407 332 210 11552 11196 --
NM_006273chr171416 ------
NM_006275chr2092455 2385 1916 769 750 711 427 321 313 11651 ----
NM_006277chr22628 270 ------
NM_006281chr81275 ------
NM_006281chr81275 ------
NM_006282chr20134433 3666 3212 2883 1467 1401 1006 744 734 603 353 329 234 ------
NM_006283chr8154668 4640 3579 3560 3531 3516 3261 1977 1888 1644 1372 700 495 411 402 14513 14431 --
NM_006284chr11157 ------
NM_006287chr252141 1889 1032 252 91 ------
NM_006290chr631956 1764 683 ------
NM_006291chr1421520 1461 12007 1549 --
NM_006292chr112162 58 ------
NM_006312chr121613 ------
NM_006313chr1241147 690 513 262 1109 ----
NM_006315chr4114542 2945 2766 1600 1152 1135 795 620 445 407 371 11061 ----
NM_006321chr372156 1504 318 228 219 170 87 ------
NM_006322chr133841 768 133 1625 --2591 342
NM_006323chr43731 509 179 ------
NM_006328chr111112 ------
NM_006329chr145709 566 547 296 267 1514 ----
NM_006330chr861651 1141 1112 609 590 175 ------
NM_006333chr22486 477 ------
NM_006345chr42896 335 ------
NM_006348chr72326 196 ----1242
NM_006352chr12285 255 ----1464
NM_006353chr641432 999 921 502 ------
NM_006357chr23472 437 122 ------
NM_006359chrX102514 2437 2301 2222 1923 1905 1605 1579 236 223 1820 12364 --
NM_006361chr1732000 1671 356 ------
NM_006364chr1461315 1025 795 459 381 359 1831 ----
NM_006366chr641293 1048 332 215 --1402 --
NM_006372chr62473 198 ------
NM_006375chrX51788 748 537 292 86 1646 ----
NM_006379chr762222 2068 2008 1999 1973 419 21875 766 ----
NM_006380chr17144279 4108 4025 4013 3976 3831 3689 3024 1519 1509 1422 904 797 231 33455 2887 780 ----
NM_006386chr2271762 1514 963 666 515 326 153 ------
NM_006390chr1261581 1418 1366 620 580 143 21572 288 21145 95 --
NM_006393chr1084583 3349 3319 2795 1308 1253 185 77 --13900 --
NM_006401chr91396 ------
NM_006403chr621550 542 21850 608 --1149
NM_006411chr62894 845 ------
NM_006413chr103295 96 44 ------
NM_006420chr2032224 916 697 12497 ----
NM_006424chr441561 214 183 82 1323 ----
NM_006434chr1032876 2257 69 ----1795
NM_006439chr42452 97 ------
NM_006449chr262163 2116 1727 812 491 233 12107 ----
NM_006451chr56850 801 731 414 408 387 ------
NM_006457chr463764 3737 3135 2653 1516 986 2307 74 13029 --
NM_006459chr1041749 1585 546 189 --21932 1443 --
NM_006460chr174520 392 351 183 1228 ----
NM_006464chr274613 3626 1791 1425 948 837 65 13115 14537 --
NM_006469chr151627 645 517 409 211 ------
NM_006482chr12113427 3283 3211 1441 1374 1359 1022 899 811 454 123 23927 2637 1637 1208
NM_006489chr1431803 331 52 ------
NM_006496chr141948 1622 372 164 ------
NM_006504chr1072708 2677 2465 2057 1105 505 255 ------
NM_006526chr2042162 1657 1641 511 ----11881
NM_006529chr461533 1382 1316 1194 245 181 ------
NM_006532chr1952062 1882 1777 1659 731 --3703 349 122 --
NM_006534chr20113159 2672 2633 2572 2514 2261 2091 1209 1086 692 576 12203 --12684
NM_006537chr15199 ------
NM_006538chr2114207 4179 3894 2776 1567 1546 1288 1174 898 795 335 53909 1417 710 484 136 ----
NM_006544chr14275704 5373 5359 5345 5086 4915 4878 4817 4252 4196 3961 2379 2281 2148 2118 1898 1533 1336 1244 1062 1032 968 512 481 453 351 337 45479 2053 1640 255 --11524
NM_006546chr1786637 6161 5877 5365 2419 2389 1557 250 ------
NM_006547chr772140 1985 1820 1766 854 752 362 --11960 --
NM_006549chr1282941 2866 2735 2260 2142 1125 1052 863 1320 ----
NM_006555chr721941 290 ------
NM_006559chr13882 838 289 --1856 --
NM_006561chr10136204 6176 6141 5881 5376 1833 1650 1556 1433 1059 566 532 34 14933 15209 --
NM_006565chr1631202 1193 1119 11066 1817 --
NM_006572chr17103338 3220 3171 2943 2719 2224 1226 884 613 287 ----1575
NM_006575chr1451458 999 582 425 419 21358 314 1517 --
NM_006599chr16248183 8141 8103 7918 7852 7634 6759 6472 6315 5781 5355 5314 5114 5098 5064 2452 2294 1903 1819 881 870 511 465 405 78119 6999 6051 6035 2705 1860 655 14982 --
NM_006601chr1241025 897 244 132 1383 ----
NM_006602chr202686 624 ------
NM_006603chrX61984 1770 1472 582 571 476 1638 11465 --
NM_006609chr272500 2293 2020 1951 1846 419 293 ------
NM_006614chr393651 1370 1165 1156 1108 839 624 214 77 23151 1395 ----
NM_006618chr151598 1097 577 474 307 ------
NM_006621chr161619 1547 1486 408 131 72 ------
NM_006624chr10111968 1943 1696 1375 679 618 604 591 275 253 182 2395 44 ----
NM_006626chr962475 2035 1711 1063 603 515 12105 ----
NM_006628chr15134433 4107 3996 3948 3280 1535 1319 1252 1023 934 531 317 82 --13611 --
NM_006629chr1832263 1827 1798 ------
NM_006644chr131651 ----1201
NM_006646chr13113076 2763 2564 2423 2411 2211 1951 1063 995 634 155 32781 2311 486 1532 --
NM_006654chr12194760 4367 4221 3951 3869 3738 3118 1775 1763 1644 1297 1159 1070 900 337 313 229 95 72 14031 ----
NM_006682chr782800 2324 2244 2233 1058 707 262 91 11985 11768 --
NM_006698chr2041437 958 551 181 --11296 --
NM_006699chr192608 2514 2084 1867 1782 1765 1750 1028 569 1293 ----
NM_006706chr52259 58 ------
NM_006708chr65404 236 183 155 142 131 1438 --
NM_006717chr9123241 2921 2781 2772 2738 2379 1128 1078 1017 938 674 203 ------
NM_006718chr631114 951 404 11071 ----
NM_006720chr1084832 3664 3580 3242 1122 1067 1031 250 ------
NM_006721chr101279 ------
NM_006722chr3103084 2507 2029 1219 1070 955 738 688 589 116 1154 ----
NM_006724chr62506 488 ------
NM_006726chr43359 254 231 ------
NM_006729chrX115348 5139 4601 4374 3824 3528 2157 2121 638 312 227 12244 23554 2148 --
NM_006731chr9155793 4628 4507 4202 4108 2028 1843 1689 1190 734 664 539 458 245 176 12017 24145 588 --
NM_006734chr661356 1297 452 284 222 23 1307 ----
NM_006738chr15114652 4546 4236 3873 3473 3056 2980 1307 728 641 368 --11560 --
NM_006745chr43959 944 224 2735 375 --1355
NM_006746chrX51554 1476 1198 590 251 21371 1030 ----
NM_006750chr16277779 7737 7435 7373 7168 7069 7008 6889 6466 6444 6156 5637 5401 5014 2961 2950 2797 2575 2257 2140 2124 1895 1649 728 323 314 168 57828 7512 5508 2264 331 ----
NM_006751chr24912 769 720 160 1307 ----
NM_006754chr721227 261 ------
NM_006756chr831493 444 315 21473 170 ----
NM_006761chr173266 169 103 --1225 --
NM_006766chr8102672 2328 2311 2241 2213 1709 609 462 280 55 1148 ----
NM_006775chr662990 2612 2375 1001 934 291 12355 12949 --
NM_006777chrX42899 861 628 224 3459 150 55 11058 11980
NM_006791chr152217 191 1635 1620 --
NM_006801chr192531 142 ----1212
NM_006811chr204848 815 298 70 ------
NM_006813chr62639 358 ------
NM_006814chr2082640 2576 2558 2391 2180 630 248 227 --11851 --
NM_006815chr1251276 1205 530 309 160 ------
NM_006823chr851191 1138 1126 450 253 ------
NM_006826chr231109 475 132 --1436 --
NM_006827chr14123024 2877 2797 2660 1216 1149 979 908 760 516 437 387 1610 ----
NM_006828chr62200 183 ------
NM_006838chr1251658 1399 1218 199 117 21622 434 11347 --
NM_006851chr12122726 2490 2268 2212 1954 967 961 858 660 496 292 247 2447 103 1223 --
NM_006852chr1792856 2695 2519 2492 1923 876 833 428 120 ------
NM_006854chr732022 1645 608 ------
NM_006857chr22782 363 --2809 203 --
NM_006868chr1853220 2439 1274 610 469 32053 1154 178 12719 --
NM_006873chr293186 1198 973 731 712 683 620 180 110 1963 22630 1134 --
NM_006874chr451186 977 882 336 164 1483 ----
NM_006885chr1684135 2913 2836 1568 734 561 347 209 1531 ----
NM_006888chr1483544 2837 2699 1399 1142 1104 313 56 12764 12851 --
NM_006892chr2051392 1304 1191 1125 557 11159 ----
NM_006892chr2051392 1304 1191 1125 557 11159 ----
NM_006894chr12314 80 ------
NM_006902chr1103348 2367 2117 2086 1345 1290 1069 996 642 410 --22391 2218 --
NM_006908chr71273 11168 ----
NM_006910chr162404 284 ------
NM_006913chr61374 ------
NM_006914chr951370 965 415 184 135 11423 --11381
NM_006915chrX92529 2241 2068 1887 916 799 407 324 113 --1851 --
NM_006916chr241108 501 191 45 ------
NM_006918chr11135777 5124 4405 3920 3551 2349 2217 2193 2013 1454 1315 840 442 11223 15164 --
NM_006920chr231808 1545 1457 11631 ----
NM_006922chr292481 2339 2290 2211 1801 1680 704 610 566 1733 12250 --
NM_006924chr1774190 3858 3793 975 433 349 70 11081 12872 --
NM_006930chr561985 1532 1474 1366 467 189 --1659 --
NM_006937chr172435 128 ------
NM_006939chr1451152 1036 337 140 86 1962 ----
NM_006940chr1241835 1445 1335 490 21485 1362 ----
NM_006943chr2043315 2172 1183 483 ------
NM_006947chr451807 600 354 292 115 1702 ----
NM_006948chr2172348 2266 2202 2099 1537 900 659 21769 1672 ----
NM_006963chr1031211 389 290 178 --1870
NM_006981chr962881 2582 2538 2200 1944 505 12888 1781 --
NM_006990chr121997 195 ----11632
NM_006997chr10194 ------
NM_006999chr52538 343 1459 ----
NM_007005chr951572 1226 1145 964 557 1103 ----
NM_007007chr1294529 3997 3916 3784 3482 3050 1552 1217 182 23777 1753 --11695
NM_007008chr23702 370 135 1617 ----
NM_007010chr1731479 331 66 11272 ----
NM_007011chr15186553 6116 5995 5888 5860 4758 4694 4441 2417 2151 1925 1623 1221 947 701 281 265 69 16538 11936 --
NM_007013chr81816 ------
NM_007018chr91399 ------
NM_007023chr261030 896 876 761 442 50 1732 ----
NM_007033chr11200 ------
NM_007034chr121007 238 2793 663 ----
NM_007036chr52913 67 ------
NM_007038chr21166017 5249 5186 4923 4236 2317 1836 1788 1763 1730 923 895 882 739 608 352 31448 1343 771 --15171
NM_007042chr372618 2447 2366 2019 1780 1669 493 22393 1687 1213 --
NM_007043chr1262162 1693 1606 1533 1330 356 ------
NM_007050chr20127911 7593 7017 6304 6003 5919 3000 2747 2351 1662 1003 221 11652 ----
NM_007054chr563998 3903 2822 1516 1133 935 --23584 158 --
NM_007068chr2231065 364 357 ------
NM_007073chr6104146 4035 3237 1315 745 319 253 191 164 73 23703 893 183 --
NM_007078chr1053061 2907 2446 1137 139 32978 2224 449 ----
NM_007080chr42118 26 ------
NM_007084chr1321183 1043 41302 1258 1065 224 ----
NM_007106chr13132551 2128 2037 1736 1721 1071 797 780 598 319 285 182 43 ------
NM_007111chr132791 248 ------
NM_007114chr3103172 3166 2828 2698 2322 1051 897 639 427 84 ------
NM_007118chr53320 63 32 ------
NM_007124chr642010 1676 462 52 11497 ----
NM_007125chrY1421 --11063 11258
NM_007126chr91205 ------
NM_007137chrX95325 4809 4517 4315 3877 3807 1608 720 507 12219 33974 1485 445 --
NM_007145chr1931154 241 37 ------
NM_007146chr1731865 1810 547 1509 2223 61 --
NM_007150chrX62129 778 665 577 554 252 11989 11364 --
NM_007158chr13830 363 250 ------
NM_007159chr321277 229 ------
NM_007166chr1161513 1399 1339 1083 986 266 ------
NM_007170chr13874 666 623 1929 ----
NM_007173chr1132067 135 51 1814 1647 --
NM_007174chr1262148 1652 675 665 499 256 --11940 --
NM_007175chr883417 3360 3036 2961 1200 704 694 196 1542 ----
NM_007176chr1441132 336 330 108 21408 599 1119 --
NM_007187chr135969 962 862 754 150 --131 --
NM_007191chr125286 262 211 161 59 ------
NM_007192chr1441138 970 93 87 ------
NM_007195chr18103641 3531 2808 2758 2325 1342 494 273 235 206 151 ----
NM_007197chr1211003 ------
NM_007200chr15114652 4546 4236 3873 3473 3056 2980 1307 728 641 368 --11560 --
NM_007203chr963727 3127 2880 2568 1173 773 23940 908 ----
NM_007207chr12970 289 ------
NM_007212chr172245 2045 1604 528 372 306 80 ------
NM_007214chr641009 515 380 204 --11328 --
NM_007216chr1121124 382 ------
NM_007218chr82705 242 ------
NM_007222chr881782 1741 1575 1517 1444 1334 1286 1137 ------
NM_007231chrX52471 2215 1965 1795 129 2205 48 ----
NM_007235chr122494 94 ------
NM_007236chr1541651 960 485 342 ------
NM_007245chr162910 792 ------
NM_007246chr42278 222 ------
NM_007249chr13199109 7860 7755 7028 6934 6733 3589 3477 3419 3203 2919 2162 2005 1873 1108 1067 642 434 377 37141 6467 2471 13175 11597
NM_007259chr11384 ------
NM_007269chr13457 245 117 ------
NM_007282chr32666 107 ------
NM_007285chr16165 ------
NM_007287chr373254 2987 1077 997 984 818 450 1718 ----
NM_007288chr373254 2987 1077 997 984 818 450 1718 ----
NM_007289chr373254 2987 1077 997 984 818 450 1718 ----
NM_007294chr1731225 963 236 ------
NM_007295chr1731225 963 236 ------
NM_007296chr1731225 963 236 ------
NM_007297chr1731225 963 236 ------
NM_007298chr1731225 963 236 ------
NM_007299chr1731225 963 236 ------
NM_007300chr1731225 963 236 ------
NM_007302chr1731225 963 236 ------
NM_007303chr1731225 963 236 ------
NM_007304chr1731225 963 236 ------
NM_007305chr1731225 963 236 ------
NM_007315chr251490 1246 1086 596 540 ------
NM_007325chrX81822 1724 1707 1606 858 756 592 136 11876 ----
NM_007332chr841520 1348 155 62 ------
NM_007345chr1852031 1898 1761 926 532 22327 1803 --1153
NM_007347chr1573120 2976 2405 1237 964 800 782 1619 ----
NM_007349chr72413 277 ------
NM_007350chr12184628 4620 4556 4106 3765 3400 2996 1657 1494 1318 1239 1144 1098 796 512 396 221 181 11019 --1496
NM_007353chr742174 1958 582 287 --11063 1965
NM_007358chr171326 1272 738 691 501 192 80 21862 1348 --1437
NM_007363chrX3990 771 765 ------
NM_007373chr1041799 1347 1205 367 ------
NM_007375chr162654 2636 2613 2455 1012 101 --1434 --
NM_012064chr1241122 1099 1052 172 ------
NM_012081chr5103748 3696 3394 3284 3014 1366 1225 1145 243 111 43499 3232 2305 326 --12665
NM_012089chr151031 630 430 377 232 11428 ----
NM_012090chr151219 1054 979 526 163 1809 1344 --
NM_012095chr1073331 2864 2353 1070 826 508 217 12638 2792 190 12799
NM_012096chr3123676 3317 3095 1510 1399 1313 1286 1000 968 506 385 303 2977 795 ----
NM_012097chr242268 1516 1474 1431 --1837 --
NM_012104chr1143028 2533 805 727 2678 353 ----
NM_012104chr1143028 2533 805 727 2678 353 ----
NM_012105chr212179 171 ------
NM_012108chr4268 48 ------
NM_012110chr41254 ------
NM_012115chr62585 392 ------
NM_012120chr662747 2353 2042 1907 961 522 22967 1000 1405 1682
NM_012129chr772340 2049 1927 1817 429 354 223 ----1841
NM_012137chr182900 2861 2616 2127 1029 490 449 388 ------
NM_012141chr13114139 3930 3561 3031 2786 2717 2606 1600 1555 1336 614 --11237 14183
NM_012153chr112288 265 ------
NM_012154chr81829 ------
NM_012156chr2033288 3209 308 ------
NM_012157chr32887 167 ----1984
NM_012158chr1351855 1447 1383 1210 385 --1676 11400
NM_012161chr451184 417 252 219 53 1838 1991 --
NM_012164chr9127489 7474 6459 5965 5931 5441 4714 2690 2683 2383 1418 1221 27109 4603 1929 12580
NM_012177chr62460 88 ------
NM_012183chr12510 423 ------
NM_012193chr1185342 4921 4788 4102 1737 1467 1207 230 13554 23670 592 25254 431
NM_012199chr164423 1133 1121 1006 529 458 ------
NM_012200chr11133 ------
NM_012207chr103955 820 118 1336 ----
NM_012210chr931068 993 146 --1479 11152
NM_012214chr2156261 5983 5977 5503 2302 1970 1864 1238 947 798 682 652 596 387 218 26302 4832 12377 11661
NM_012215chr1061848 1753 1541 1414 1277 260 21723 450 11786 --
NM_012219chr352372 978 828 449 428 1896 ----
NM_012223chr271336 1245 1025 847 229 175 23 ----1109
NM_012224chr44439 392 332 164 ------
NM_012234chr3113758 3439 2914 2664 2452 2343 1256 1003 420 377 197 --23029 408 --
NM_012238chr1091653 1624 1263 652 623 423 355 269 145 11311 ----
NM_012242chr105819 248 108 59 32 ------
NM_012243chr13838 661 28 ------
NM_012249chr283439 3389 3070 2917 2330 1235 682 81 12598 --11010
NM_012250chr1151199 1041 990 934 868 --11147 --
NM_012252chr7185251 4806 4486 4190 3730 3394 3383 3306 2152 2131 1819 1758 1220 1081 958 940 899 408 --11861 --
NM_012255chr203481 120 30 ------
NM_012262chr1154914 4439 4212 3676 2024 2012 1803 1709 1214 1125 882 734 722 350 187 54717 4185 4112 3945 309 --13761
NM_012281chr772228 2087 1890 1538 1521 907 864 ----1636
NM_012287chr384268 4108 3037 1411 1074 913 507 203 ----11588
NM_012288chr6135662 5606 5435 4877 4784 4342 4247 4178 3986 1857 1807 893 363 11170 --25119 1317
NM_012290chr261648 1523 1350 634 595 386 ------
NM_012297chr472568 2354 2046 1910 1797 1617 666 ------
NM_012300chr591947 1796 1785 670 609 564 462 456 25 ------
NM_012301chr752177 1590 707 459 84 ------
NM_012302chr151274 1180 1159 791 503 ------
NM_012307chr186901 875 356 282 263 121 ------
NM_012309chr1134793 4309 3315 33670 3326 1553 ----
NM_012316chr175441 5265 4065 2236 1234 630 394 25516 1623 ----
NM_012319chr185975 336 301 275 47 ------
NM_012325chr2031085 188 107 ----11561
NM_012327chr1881574 1505 1469 1198 639 563 247 46 --1447 --
NM_012330chr1051500 1248 1165 415 230 ------
NM_012333chr141543 665 305 102 ------
NM_012338chr73488 432 255 179 ----
NM_012341chr101472 ------
NM_012343chr551038 972 463 436 161 1282 ----
NM_012345chr1341833 1367 1294 344 11569 ----
NM_012347chr662227 1969 1203 537 325 183 22570 1086 --11173
NM_012382chr563679 3094 2877 1812 1412 774 33863 1507 120 12795 --
NM_012383chr92364 316 ------
NM_012388chr1562643 2519 421 407 320 202 ----12507
NM_012399chr2271806 1567 735 533 505 486 356 ------
NM_012420chr1041723 907 798 442 22151 1663 --11715
NM_012421chr11470 ------
NM_012425chr1082158 1893 1692 1017 608 545 368 121 ----1156
NM_012428chr153886 787 94 ------
NM_012430chr32767 529 ------
NM_012434chr631667 1406 278 ----11517
NM_012443chr102803 628 ------
NM_012446chr52567 397 ------
NM_012463chr1281755 1554 1531 1507 1499 1343 265 62 11519 --21292 30
NM_012464chr462380 1119 1046 1017 768 560 --21975 1788 --
NM_012465chr1052647 2589 2189 1181 777 --1848 13194
NM_012471chrX61933 1575 1363 742 183 139 ------
NM_012482chr14626 159 128 115 ------
NM_013230chrY61472 1318 625 499 376 127 11415 ----
NM_013231chr1472761 1752 1707 1297 1165 1119 745 1867 ----
NM_013232chr52378 326 ------
NM_013233chr251213 1133 553 459 401 ------
NM_013236chr223836 464 53 --2871 127 --
NM_013243chr154520 365 137 28 139 ----
NM_013248chr201213 ------
NM_013255chr7188711 8688 8568 7434 7370 5462 2898 2709 2674 2638 1993 1434 1129 978 939 876 858 275 58747 8406 5660 5501 323 --12887
NM_013257chr832241 1514 357 ------
NM_013261chr443547 3378 3094 1178 13117 ----
NM_013262chr661467 1403 1267 948 571 413 --1334 --
NM_013269chr1264543 4452 4097 3240 567 174 13036 ----
NM_013272chr151277 ------
NM_013281chr20101450 1418 1368 1349 1268 1110 410 241 231 177 ------
NM_013282chr1941343 1227 175 159 11321 ----
NM_013283chr54747 674 369 342 1307 1120 --
NM_013286chr353402 3259 3001 2764 2572 ----13352
NM_013309chr15102516 2442 1769 1746 1032 840 813 716 643 478 2535 198 1991 --
NM_013322chr741254 1248 694 173 31657 1170 1076 ----
NM_013330chr12249 81 ------
NM_013341chr272765 2053 936 786 579 253 214 1951 ----
NM_013357chr83835 768 756 ------
NM_013372chr1593358 3086 2873 2481 2415 1187 583 445 415 1188 12219 1366
NM_013374chr352751 2709 2661 2008 663 33043 2680 702 ----
NM_013377chr126495 204 165 154 53 33 ------
NM_013381chr12122373 2349 2295 2151 2142 2096 1728 1512 871 575 136 104 --11801 --
NM_013396chr2141049 544 294 42 ------
NM_013400chr721065 374 11093 ----
NM_013423chrX71245 1173 1108 1051 849 406 101 ------
NM_013427chrX71245 1173 1108 1051 849 406 101 ------
NM_013437chr871233 1074 473 257 237 189 85 ------
NM_013438chr921817 256 ------
NM_013444chrX41087 1053 107 93 ------
NM_013446chr731368 312 286 --11107 --
NM_013448chr143772 622 298 --1702 --
NM_013449chr1272544 2483 2441 1855 1826 1117 69 1581 ----
NM_013450chr271278 1244 1229 1033 406 378 256 ------
NM_013937chr671072 1059 907 797 779 366 165 --1841 --
NM_013943chr1113325 3259 3087 2968 2743 2677 2416 2127 1284 910 265 ------
NM_013952chr222365 1815 ------
NM_013953chr222365 1815 ------
NM_013958chr81293 ------
NM_013959chr81293 ------
NM_013961chr81293 ------
NM_013962chr81293 ------
NM_013981chr52155 149 ------
NM_013982chr52155 149 ------
NM_013983chr52155 149 ------
NM_013986chr221138 ------
NM_013989chr1483892 3885 3427 3265 1942 1629 1004 160 23833 2059 ----
NM_013992chr222365 1815 ------
NM_013995chrX82494 2486 2102 2072 767 716 287 279 1294 ----
NM_013996chr72373 141 ------
NM_013996chr72373 141 ------
NM_013997chr72373 141 ------
NM_013997chr72373 141 ------
NM_013998chr72373 141 ------
NM_013998chr72373 141 ------
NM_014000chr1041604 1571 696 172 1529 ----
NM_014005chr573109 2770 2512 2038 925 640 236 12816 11048 --
NM_014011chr272424 2344 2326 1955 1003 97 41 22227 631 --1487
NM_014016chr351329 1316 1300 1213 350 11664 --11360
NM_014021chr183463 2972 2409 1216 586 455 201 24 11093 1309 --
NM_014023chr1052868 2576 2077 649 132 1765 ----
NM_014034chr641269 1246 1176 951 ------
NM_014043chr341621 645 316 73 ------
NM_014048chr16104934 4791 4759 4254 4036 4025 3954 3822 3628 661 23733 71 23242 933 13472
NM_014055chr124356 194 175 132 1107 1381 --
NM_014057chr961576 1390 1344 534 457 350 11187 ----
NM_014089chr1341729 1717 883 876 11629 ----
NM_014096chr113744 647 21 ------
NM_014106chr1581185 1173 1051 888 871 746 605 568 52987 1079 356 195 174 1394 --
NM_014110chr141017 776 752 230 1862 --1112
NM_014112chr8105402 5270 4681 4390 3587 3550 2193 2077 1178 798 21940 548 ----
NM_014117chr1672441 2353 2200 1774 923 539 533 12662 --22541 2157
NM_014141chr795312 5122 4780 4762 3611 1826 1645 915 714 12064 --25025 249
NM_014154chr341232 1118 1076 1043 1118 ----
NM_014155chr11217243 7207 6221 5898 5823 5805 5489 5362 5320 5179 4718 3026 2958 2804 2666 2220 2169 1852 1696 1188 834 55108 4885 2091 1613 1004 15906 16295
NM_014171chr22266 58 1637 ----
NM_014175chr82141 117 ------
NM_014181chr262843 2360 1893 974 404 282 ----12690
NM_014189chr431405 1398 1069 --11536 --
NM_014190chr441757 1750 1421 1183 --11888 --
NM_014191chr121352 ------
NM_014217chr181783 1606 1511 1414 1386 566 453 361 11816 --11834
NM_014240chr394102 4005 3627 3090 1364 1220 1131 896 487 12569 32908 2618 1151 --
NM_014243chr431507 614 163 1331 ----
NM_014248chr221114 ------
NM_014253chrX112338 2294 2133 1853 1760 1593 790 427 278 200 133 1264 ----
NM_014263chr1041368 1161 1146 72 11446 --11127
NM_014267chr114243 163 141 114 ------
NM_014280chr13590 128 113 --1842 --
NM_014283chr131499 433 243 11351 11231 --
NM_014289chrX41370 1130 335 44 ------
NM_014290chr92181 42 ------
NM_014294chr861487 1402 1270 1210 454 191 --2403 61 --
NM_014302chr72117 25 ------
NM_014309chr2285374 5312 4871 2134 2101 1633 1204 854 --14339 15228
NM_014313chr141228 483 426 221 ------
NM_014323chr222732 187 ------
NM_014324chr511175 ------
NM_014331chr4217639 7434 7130 6924 6831 6733 6696 6365 6339 5430 5240 2655 2597 2474 2211 2118 737 714 693 420 140 26785 4980 16245 --
NM_014333chr1162446 2155 2041 1750 898 274 32544 2170 377 ----
NM_014335chr153941 522 306 1127 ----
NM_014338chr2221017 61 ------
NM_014344chr114795 177 156 135 ------
NM_014345chr61778 ----1708
NM_014372chr152089 2037 1979 1965 1349 1168 ----
NM_014374chr721065 374 11093 ----
NM_014376chr521904 1012 12360 22177 733 --
NM_014382chr361714 1398 1364 1128 1097 472 ------
NM_014386chr5166 ------
NM_014388chr1165919 5754 5270 4973 4623 4013 2408 2092 1403 1052 767 727 588 564 297 150 43916 1723 1003 960 11242 1210
NM_014394chr1041116 911 217 89 ------
NM_014397chr91445 ------
NM_014411chr721246 791 ------
NM_014415chr341618 1500 561 277 --21568 1266 --
NM_014423chr5155250 5220 5043 4722 4655 4648 4389 4164 4021 3737 3589 1839 1536 1396 212 35309 1903 994 24505 2188 34187 2181 1581
NM_014429chr34260 135 58 23 ----1226
NM_014431chr1021693 1413 1154 11546 --
NM_014445chr332000 936 916 --11666 --
NM_014447chr451308 1228 646 439 145 --21471 1325 --
NM_014452chr61322 --1823 --
NM_014458chr151451 1341 1207 1050 174 ------
NM_014469chr115779 563 212 115 35 ------
NM_014491chr721085 966 1223 ----
NM_014494chr1632113 1549 600 ------
NM_014504chr731759 507 315 --11804 --
NM_014515chr123897 801 243 ------
NM_014516chr191237 ------
NM_014517chr391964 1640 1558 1204 786 762 749 741 393 11812 ----
NM_014554chr1281935 1925 788 764 601 488 284 256 ----11791
NM_014572chr1341725 1476 207 195 --11188 --
NM_014573chr1731856 1346 1152 11185 ----
NM_014574chr1461002 548 487 437 299 265 11278 ----
NM_014575chr31458 1498 ----
NM_014583chr32448 125 ------
NM_014584chr1431395 1104 426 21204 493 --1643
NM_014586chr2184673 4429 4044 3591 3375 1195 788 473 --11806 --
NM_014602chr3197 ------
NM_014606chr451466 1197 1069 977 118 ------
NM_014608chr153407 85 72 1461 ----
NM_014612chr931325 374 172 --11566 --
NM_014613chr583068 2944 2476 1215 1180 523 513 367 12844 ----
NM_014614chr261467 1348 1178 1146 993 34 ------
NM_014615chr1673292 2928 2587 1267 1081 734 79 --21279 967 12547
NM_014616chr383216 1194 1116 1098 470 361 286 233 11084 12311 --
NM_014630chr1563502 2942 2811 1559 1404 1232 14012 ----
NM_014636chr954303 4247 4041 1293 678 43886 3043 1519 1461 ----
NM_014637chr851214 1018 1005 446 120 ------
NM_014647chr1651633 1456 538 274 212 ------
NM_014666chr541217 422 95 39 1170 --1954
NM_014670chr271596 1546 1209 1203 633 242 120 ------
NM_014671chr771418 1290 1263 1085 604 202 120 ------
NM_014672chr141165 ------
NM_014674chr393957 3718 3372 2783 1576 1533 1243 1169 696 13010 21067 898 --
NM_014677chr851396 1323 1042 1000 313 ------
NM_014679chr1151408 1369 938 354 150 2549 518 ----
NM_014682chr872165 823 795 548 344 243 228 ------
NM_014683chr1742000 1455 728 588 --11842 --
NM_014686chr1972555 1981 1829 994 490 477 340 ------
NM_014701chr1593010 2713 2590 962 507 220 165 137 59 11104 12147 --
NM_014702chr683393 2980 2812 2598 2356 1357 901 471 11274 1930 12152
NM_014705chr741715 1601 1310 681 1428 ----
NM_014707chr762177 1924 1893 658 493 410 ------
NM_014709chr22639 26 ------
NM_014711chr1662125 2085 2079 1473 1375 307 ------
NM_014713chr23428 193 132 --1368 --
NM_014718chr123837 686 131 ------
NM_014720chr1061781 1387 1335 643 551 531 --139 --
NM_014721chr6137245 7147 6446 4931 4694 2895 2650 2520 2025 1985 1054 730 652 ----16140
NM_014723chr2022012 129 --12303 --
NM_014729chr892075 1868 1697 1656 854 775 585 340 50 12039 ----
NM_014730chr1285272 4681 4634 1322 732 672 349 80 --14164 --
NM_014730chr1285272 4681 4634 1322 732 672 349 80 --14164 --
NM_014733chr551914 1698 440 251 150 1357 ----
NM_014735chrX82142 2113 2064 1820 823 543 460 79 ------
NM_014738chr171947 --1706 --
NM_014741chr1131900 1808 859 ----1809
NM_014743chr453147 2464 2166 2106 565 21929 157 12138 --
NM_014746chr2104262 3558 3288 1446 1323 1178 1032 596 377 148 1487 ----
NM_014750chr141192 1148 ----
NM_014751chr831882 1684 192 1357 ----
NM_014752chr1181577 775 768 671 642 588 559 134 11371 ----
NM_014755chr263892 3355 1675 1063 692 187 32734 479 102 ----
NM_014758chr1132460 978 564 ------
NM_014761chr1641153 1130 901 38 ------
NM_014764chr1231146 1078 152 1919 2311 142 --
NM_014774chr1143153 3030 2959 2532 2524 2391 2013 1248 793 782 649 352 311 126 ------
NM_014776chr1283029 2728 2596 1200 1101 993 358 167 ------
NM_014779chr361069 849 824 462 423 122 ------
NM_014787chr152648 2562 2334 2104 106 ------
NM_014795chr281380 1291 1164 1065 958 540 516 486 ------
NM_014803chr1092846 2822 2749 2632 2591 2045 1935 1186 416 12336 ----
NM_014810chr183540 3160 2961 2904 2629 734 214 182 ----12689
NM_014812chr181896 1759 1364 784 757 522 257 175 ------
NM_014819chr552410 2055 2047 1668 444 2541 506 ----
NM_014820chr351913 1663 1412 820 198 21638 561 1454 --
NM_014822chr43534 483 456 1110 ----
NM_014826chr194073 3389 2983 1574 1567 1226 1079 350 62 --1258 --
NM_014828chr1432473 477 209 ------
NM_014829chr582317 2300 2213 1768 825 705 562 364 22047 210 ----
NM_014832chr1362009 1886 1424 1299 752 298 21522 1327 --1260
NM_014836chr1071803 1706 1283 1245 319 115 61 11492 ----
NM_014838chr2262722 2336 999 832 631 394 1886 22314 2144 11145
NM_014840chr1273299 3137 2946 2841 2545 692 469 --12689 --
NM_014841chr651346 1218 1048 914 496 ------
NM_014850chr374068 3556 3483 3019 1958 1157 1062 11894 ----
NM_014858chr131214 1075 983 ------
NM_014859chr1721125 1049 --3565 270 203 --
NM_014860chr251996 900 722 705 434 ------
NM_014862chr1564197 3241 3042 2774 2761 1404 ------
NM_014873chr164622 4569 4540 3350 1378 51 34814 1555 1219 ----
NM_014877chr17277735 7675 7031 6824 6629 6275 6207 6081 5651 5448 5072 5042 4908 4771 3110 3014 1969 1609 1481 1422 1389 1350 1146 1137 794 563 216 36312 1359 573 26928 2164 --
NM_014888chr761137 506 431 393 370 37 ------
NM_014893chrY92348 2096 1677 1608 821 717 683 671 457 21925 935 1701 --
NM_014897chr1792895 2348 2029 2004 1129 650 442 322 252 1577 1844 --
NM_014899chr593141 2971 2265 2204 1236 1182 558 461 212 ------
NM_014900chr241158 1115 256 139 ------
NM_014902chr202445 124 ------
NM_014903chr126898 784 759 636 67 37 11909 11820 --
NM_014904chr1073294 2618 1561 1349 1054 800 343 33316 1136 543 ----
NM_014905chr261962 1539 1533 412 307 114 11974 ----
NM_014906chr17103564 3242 2737 1193 995 925 752 342 327 167 1974 ----
NM_014912chr10133384 3378 3289 3218 3157 3121 3037 2703 2447 2313 997 787 603 23171 405 1658 --
NM_014913chr1881028 965 952 575 360 345 227 53 21498 371 ----
NM_014916chr72747 690 ------
NM_014918chr1561616 1457 1112 1104 1069 50 ------
NM_014923chr1361879 1520 1440 731 136 74 1744 ----
NM_014924chr1463222 3197 2774 2056 2038 958 1396 ----
NM_014926chr341085 1021 374 38 ------
NM_014929chr23673 270 138 ------
NM_014932chr371627 1613 1273 608 396 230 72 11528 ----
NM_014937chr105484 438 364 54 33 ------
NM_014938chr1222436 2412 --2947 723 --
NM_014942chr672674 2513 2302 1938 1649 710 566 --12400 --
NM_014943chr861074 1057 971 921 376 230 11037 ----
NM_014945chr531883 1300 231 ------
NM_014946chr2103040 2541 2235 2156 2128 1978 1242 1193 1001 625 1110 --22603 2293
NM_014947chr152219 1089 474 171 150 2545 310 ----
NM_014951chr1042001 1889 1054 329 12621 21692 612 1204
NM_014953chr1374185 4088 3399 3031 752 365 102 31287 398 124 13380 --
NM_014961chr42500 140 ------
NM_014962chr2082453 2385 2003 1945 523 185 149 141 2729 237 1674 1715
NM_014964chr1742150 1617 762 113 ------
NM_014969chr121138 1019 --1180 --
NM_014974chr1041725 1217 650 381 --1494 --
NM_014978chr1051466 1421 1358 1252 306 --11369 --
NM_014982chr1485441 4186 3740 3686 3559 2166 1066 999 ------
NM_014988chr472821 2740 2559 2363 765 270 147 2474 358 ----
NM_014989chr6102087 2035 1620 1364 1265 835 675 486 130 42 ------
NM_014991chr493291 3099 2926 2284 1026 820 641 607 240 12908 --1377
NM_014996chr36963 942 855 94 60 31 ----1788
NM_014997chr772816 2507 2357 2319 2146 514 156 12765 ----
NM_014999chr1251630 1262 1060 639 411 ----11391
NM_015008chr373651 3174 2670 2619 2430 889 717 1176 13283 --
NM_015009chr35621 313 298 265 230 1287 ----
NM_015017chr141019 398 107 40 --1221 --
NM_015020chr1642515 2461 884 781 21506 288 ----
NM_015023chr131328 270 109 ----1176
NM_015025chr282426 2012 1659 1013 865 764 604 355 1450 12245 --
NM_015026chr12144570 4558 4485 4273 4022 3566 3075 3065 1478 1434 1356 925 873 399 34100 3689 1009 34592 3013 1706 --
NM_015027chr1641551 708 367 42 ------
NM_015032chr1372679 2496 1970 1182 704 458 312 12923 1809 --
NM_015039chr163538 3422 1698 1290 1224 812 --13757 --
NM_015040chr263264 2246 2095 949 784 119 ----1685
NM_015045chr1062282 2021 1625 1540 520 464 ------
NM_015046chr972399 2178 1851 708 455 397 338 1650 --1191
NM_015049chr293010 2682 2627 2592 1285 762 619 577 25 22856 809 ----
NM_015051chr9122992 2836 2270 1273 930 841 776 469 398 372 77 30 --12608 13031
NM_015052chr741078 399 208 123 --11301 --
NM_015054chr123432 96 90 ------
NM_015061chr94783 737 566 217 ------
NM_015068chr7103852 3812 3491 3435 3335 2860 2652 1000 468 85 13388 12890 --
NM_015069chr163607 584 495 ----1237
NM_015071chr5116397 6260 4339 4161 2319 2209 2006 1660 1279 1184 917 15385 ----
NM_015074chr184807 4801 4549 3801 3468 1474 725 428 23480 528 53791 3779 1805 1505 1430 --
NM_015076chr6114295 3960 2913 1218 1056 929 567 473 457 362 351 23303 383 ----
NM_015082chr542251 2045 1880 1032 --1878 --
NM_015092chr16164315 4015 3879 3633 3017 2972 1397 1273 1227 1179 1166 1049 1018 728 722 710 44685 3211 1851 555 --14260
NM_015093chr611724 --31613 752 393 --
NM_015094chr2234701 1814 1023 ------
NM_015097chr341768 399 186 118 ------
NM_015100chr151601 1493 562 542 368 ------
NM_015107chrX52080 1837 766 638 184 22436 2298 1737 --
NM_015110chr962094 1828 1530 837 742 122 1955 12077 1373
NM_015115chr4123251 3188 3013 2924 1976 1295 1223 1140 949 937 657 115 2516 415 ----
NM_015120chr2--1118 --1284
NM_015129chrX41583 1484 248 42 1221 ----
NM_015130chr441296 1254 133 89 ------
NM_015132chr741872 1689 1524 1314 --2512 105 --
NM_015137chr852340 2140 964 299 186 --167 12488
NM_015141chr3112714 2595 2166 1991 1982 1885 757 600 467 341 272 12313 ----
NM_015143chr441330 1321 286 260 --11133 --
NM_015149chr121761 763 --12133 11422
NM_015153chr63614 608 293 ------
NM_015155chr1062954 2733 2071 1014 211 182 ------
NM_015156chr14124036 3884 3724 3309 2871 2788 1477 1157 1082 916 897 733 23706 419 12686 --
NM_015158chr93846 609 148 ------
NM_015163chr1451541 1490 750 286 172 ------
NM_015170chr872310 2083 1845 1645 1639 638 486 12025 ----
NM_015176chr131717 1402 628 ----1112
NM_015180chr142767 680 ----1170
NM_015184chr31641 ------
NM_015185chrX72935 918 719 708 624 522 503 172 12834 1328
NM_015186chr93482 134 111 ------
NM_015187chr42645 43 ------
NM_015192chr2063011 2848 2627 2172 497 293 ------
NM_015199chr343005 2294 673 53 --11964 --
NM_015200chr492272 2260 974 956 934 719 587 530 159 21047 419 ----
NM_015206chr1563814 2981 1252 994 968 516 33804 221 149 ----
NM_015208chr1883388 2752 1402 1127 918 735 721 698 13230 1354 --
NM_015209chr152162 2156 1817 1788 717 12041 ----
NM_015215chr192130 2018 871 821 787 220 207 67 54 145 --12401
NM_015216chr54553 430 357 351 ------
NM_015221chr1041551 1353 1183 614 --143 --
NM_015225chr9103020 2380 2097 1201 927 768 736 648 606 222 ------
NM_015231chr113953 869 387 2930 256 ----
NM_015233chr135571 433 312 286 272 ------
NM_015234chr64899 311 132 53 ------
NM_015245chr642740 1928 533 309 --1591 --
NM_015247chr1685035 4965 4931 4075 3961 1419 1331 754 45351 5075 4537 914 1336 --
NM_015250chr951979 1470 835 680 144 ------
NM_015251chr1652331 606 366 254 239 12001 ----
NM_015252chr22959 91 137 ----
NM_015265chr272368 2310 2290 2257 1974 1714 54 ------
NM_015267chr1211454 11829 11864 2333 300
NM_015271chr494253 4128 3963 3676 3420 1382 846 655 460 14018 11356 --
NM_015272chr164689 391 294 164 ------
NM_015275chr1231501 562 182 11973 ----
NM_015278chr6123046 2851 2506 2377 2371 1244 1152 1097 610 588 561 43 33113 1042 252 ----
NM_015282chr262970 2925 824 558 456 359 --1619 --
NM_015288chr553639 2477 2460 1196 932 ------
NM_015291chr1113145 3007 2922 2536 2472 2383 1319 1312 1185 833 67 22739 107 ----
NM_015294chr174889 810 789 716 ------
NM_015296chr1321133 342 ------
NM_015305chr1431662 1368 516 --2611 349 --
NM_015308chr111149 ------
NM_015310chr8137885 7804 7696 7678 5412 2979 2947 2678 1831 1256 668 404 52 21880 253 --15203
NM_015313chr11144565 4559 4472 4457 4343 3831 3700 3102 1814 1760 1680 1647 1571 1127 53406 3061 1862 1419 425 14640 --
NM_015314chr771902 1789 679 652 549 499 145 12069 ----
NM_015317chr272300 2257 2042 890 791 474 365 22657 2418 22611 2529 --
NM_015321chr1973091 1821 1587 1574 1239 968 579 23332 1005 1924 --
NM_015323chr681588 1472 1436 1338 288 261 250 225 ------
NM_015326chr173004 2170 2029 2013 1967 826 267 --31852 940 386 --
NM_015328chr762881 2762 2645 2479 1206 390 22178 1245 --1974
NM_015329chr1952849 2836 2819 2789 1897 ------
NM_015335chr1272652 2475 2027 2013 1823 351 301 22666 2379 1233 --
NM_015336chr1272460 2115 918 853 291 153 144 32062 1918 474 12401 --
NM_015339chr202789 287 1768 --1846
NM_015344chr861458 866 454 158 138 118 ----11713
NM_015345chr612765 ------
NM_015347chr1292540 2501 2369 2362 2171 2124 1839 1096 1079 12786 ----
NM_015349chr652756 1902 1073 1044 127 12592 1705 --
NM_015353chr173844 525 229 1217 1300 11732
NM_015355chr1781657 1503 721 706 649 591 195 47 1412 ----
NM_015358chr214864 317 303 57 ------
NM_015361chr25948 894 828 708 263 ------
NM_015365chrX113915 3779 3634 3294 2968 2704 1543 1127 802 431 87 53762 3006 1229 1194 209 ----
NM_015367chr2211650 11559 --11239
NM_015375chr163112 1396 1153 1119 314 22 13380 ----
NM_015379chr72260 214 ------
NM_015385chr1032876 2257 69 ----1795
NM_015387chr241582 1395 761 138 32098 1429 66 ----
NM_015393chr453087 3015 2669 1327 1091 --1350 --
NM_015394chr1282016 1909 1640 951 717 411 203 172 --1101 --
NM_015397chr961721 1566 669 241 224 103 ------
NM_015409chr1252268 1771 795 730 583 11930 22240 262 --
NM_015429chr341116 1075 370 317 ------
NM_015436chr4113096 3067 2869 2367 2230 2221 2120 1275 726 375 302 ----12627
NM_015439chr61136 --1150 --
NM_015443chr1751171 1162 959 109 99 --11313 --
NM_015455chr5164144 3638 3280 3123 3051 2928 2688 2639 2620 2575 1401 1344 1006 284 235 118 63779 3160 2716 2548 719 412 ----
NM_015457chr1141092 921 218 211 ------
NM_015458chr8124691 3805 3422 3259 1478 1350 1142 994 756 437 409 81 ------
NM_015463chr21618 139 1553 153
NM_015464chr76979 822 738 687 190 181 ------
NM_015466chr31211 ------
NM_015472chr31205 ------
NM_015472chr31205 ------
NM_015474chr203438 272 145 ------
NM_015475chr22340 332 2383 55 ----
NM_015481chr121689 ------
NM_015483chr72422 368 ------
NM_015508chr341498 1456 1283 254 1117 11228 --
NM_015509chr1241402 412 337 125 ------
NM_015532chr1582793 2596 2251 2134 2097 1953 255 165 11017 1362 1153
NM_015534chr14994 403 243 229 ------
NM_015535chr2103832 3487 2720 850 667 562 519 232 177 26 --1644 --
NM_015541chr331344 948 250 1230 ----
NM_015550chr753282 2924 995 546 534 23411 1030 13138 --
NM_015553chr6124399 4195 4100 3866 3275 1417 1319 1301 1231 640 382 181 14051 14933 --
NM_015554chr1532667 940 374 1812 12528 --
NM_015555chr661218 1181 686 670 386 129 --11350 --
NM_015559chr1821085 718 ------
NM_015565chr2152046 1949 898 208 105 1378 ----
NM_015567chr133937 855 421 ------
NM_015568chr2074352 3728 3710 2845 1634 1104 503 1120 12985 --
NM_015569chr183829 3814 3566 3001 1910 1679 1545 1114 1721 14727 1206
NM_015570chr741558 1320 660 627 1190 21696 198 1363
NM_015571chr662102 2037 892 525 220 49 22272 2261 12456 133
NM_015575chr273577 3499 3455 3279 2326 2302 267 ------
NM_015576chr352578 2314 2170 1090 168 ------
NM_015577chr551788 1715 1198 1114 429 --11287 --
NM_015578chr1951973 1946 1458 303 66 ----11597
NM_015601chr1031032 801 396 1292 ----
NM_015602chr141800 1111 432 190 11465 11749 --
NM_015604chr141217 ------
NM_015608chr103601 494 441 ------
NM_015610chr771095 1014 894 364 217 196 181 --1685 --
NM_015635chr951680 1379 378 349 264 ------
NM_015640chr1165217 3923 3850 3517 3247 2148 2000 1838 1619 1553 1362 721 574 550 351 237 34392 1439 248 13564 14976
NM_015652chr104596 97 77 51 ------
NM_015657chr23895 850 307 ----1823
NM_015660chr71228 ------
NM_015670chr172356 119 ------
NM_015678chr1351442 1117 659 391 175 --11059 --
NM_015690chr22595 191 --1664 --
NM_015691chrX42785 1923 430 48 12699 ----
NM_015695chr631881 1864 1386 ----11920
NM_015713chr863488 3342 3334 2395 1379 1264 ----12624
NM_015852chr7153597 3486 3345 2825 2774 2768 2524 2425 1087 1003 583 415 331 247 163 22860 2323 43295 752 668 500 --
NM_015869chr31173 ------
NM_015874chr45637 615 422 249 106 ------
NM_015878chr851970 702 575 387 160 ------
NM_015879chr18178007 7304 5992 5935 5812 5764 5715 5650 2983 2818 2587 2127 1360 780 270 161 151 11740 22845 2728 --
NM_015885chr114730 268 187 154 ------
NM_015886chr865758 5065 4063 3734 2174 1427 15572 15363 24700 1533
NM_015888chr1102252 2128 2079 1107 863 851 342 314 301 74 32890 1215 1050 ----
NM_015906chr1194865 4711 4274 4204 4020 3987 3776 3590 3359 3142 3117 3065 1883 1872 1494 696 422 142 82 23951 1568 ----
NM_015938chr34765 398 287 136 1184 ----
NM_015952chr62131 105 ------
NM_015975chrX31496 1487 174 1306 --11793
NM_015982chr171131 ------
NM_015984chr12544 47 ------
NM_015986chr1771277 1124 921 512 207 148 28 ------
NM_015995chr1534601 1088 119 14529 15120 --
NM_015999chr13524 149 46 ------
NM_016003chr771095 1014 894 364 217 196 181 --1685 --
NM_016009chr1154926 4912 4798 4465 4446 3787 3747 3262 1585 1463 617 487 326 303 192 24083 577 1423 --
NM_016018chr842760 2419 2382 511 22498 2080 22517 1078 --
NM_016021chr672577 2557 2532 2122 1216 1015 557 ------
NM_016023chr891996 1921 1819 1417 808 756 357 313 265 1145 ----
NM_016025chr1631700 1247 432 ------
NM_016026chr1441474 1308 594 85 ------
NM_016027chr8------140
NM_016028chr118994 965 464 444 280 83 38 26 ----1986
NM_016040chr162698 2521 2377 649 582 408 ------
NM_016045chr2051857 1693 1530 316 307 ------
NM_016048chr561006 975 939 642 382 236 ------
NM_016057chr122181 64 ------
NM_016072chr1242030 1938 938 914 21831 384 1646 --
NM_016073chr1561000 802 788 298 182 164 1382 ----
NM_016076chr1103237 3022 3007 2931 2713 2069 931 911 648 128 ----1475
NM_016081chr431736 1423 849 ----1111
NM_016083chr672620 2456 1495 1165 751 511 346 13475 ----
NM_016087chr761537 1235 1207 1062 696 553 ------
NM_016090chr117996 843 704 418 394 186 40 1255 ----
NM_016100chr202104 59 ------
NM_016104chr62131 105 ------
NM_016107chr54927 899 296 60 ------
NM_016120chrX2328 66 ------
NM_016121chr14973 809 787 66 ------
NM_016125chr173460 427 82 1117 ----
NM_016127chr84698 684 655 49 ------
NM_016131chr251502 1456 632 261 147 11765 ----
NM_016132chr1583249 2800 1134 1103 384 269 131 112 22412 452 ----
NM_016133chr231442 1434 1023 11592 ----
NM_016138chr1661549 1402 1279 1233 289 270 11463 ----
NM_016141chr31778 1162 --1271
NM_016144chr52742 24 ------
NM_016147chr113815 458 153 ------
NM_016152chr341202 851 482 137 ------
NM_016166chr151176 ------
NM_016203chr72281 271 21044 208 ----
NM_016206chr3178862 8660 7563 5868 5840 5617 5495 2988 2090 1863 1735 1585 1564 835 309 263 144 37008 1686 1257 1364 26077 5532
NM_016217chr673345 3107 1467 1037 751 582 62 33643 2331 1435 1856 1386
NM_016218chr52839 364 ------
NM_016220chr772343 2078 582 498 418 268 166 12245 ----
NM_016221chr541996 1444 757 691 1957 ----
NM_016224chr662227 1826 1693 1360 525 266 --1481 --
NM_016226chr124480 377 96 37 ------
NM_016227chr131499 433 243 11351 11231 --
NM_016231chr1741395 1273 1231 172 ----1199
NM_016248chr13133964 3903 3841 3582 3453 2748 1475 762 635 592 513 283 27 53925 2714 2603 1068 783 ----
NM_016252chr24931 201 194 156 ------
NM_016255chr652929 801 762 575 311 22878 212 1417 --
NM_016260chr2227045 6853 6704 6610 5870 5864 5025 4986 2369 2258 1623 1364 1247 1161 1067 1054 880 853 750 619 512 102 36993 6907 788 --26598 6164
NM_016261chr174624 317 81 55 ------
NM_016271chr18112353 2074 2048 1787 1775 1556 754 686 666 296 121 --21694 806 --
NM_016272chr2242725 2376 2336 681 --1576 --
NM_016277chr671491 1463 1415 1265 652 432 87 21649 155 ----
NM_016281chr1251165 1127 1034 836 278 --1204 --
NM_016287chr151736 1299 641 176 88 ------
NM_016289chr271617 1452 801 696 609 144 124 1226 11978 --
NM_016297chr23984 837 220 ----21054 664
NM_016299chr10189 ------
NM_016304chr153752 727 24 ------
NM_016306chr32389 94 ------
NM_016308chr191861 1773 1452 1279 503 345 307 274 92 ------
NM_016315chr241468 1370 1152 212 ------
NM_016316chr23696 141 113 ------
NM_016322chr973171 2854 2508 2317 2303 1107 36 12975 13064 --
NM_016323chr42261 90 --198 --
NM_016333chr161461 ------
NM_016338chr521080 306 11217 --134
NM_016351chr72587 50 ------
NM_016356chr692785 2702 2249 2220 2033 873 862 766 194 --1647 1458
NM_016358chr5163 ------
NM_016359chr15------1680
NM_016374chr151397 1077 632 425 273 ------
NM_016374chr151397 1077 632 425 273 ------
NM_016376chr17104347 4199 4092 4023 3813 3133 784 561 545 480 13955 12728 21425 951
NM_016377chr671776 1727 1716 1449 1421 1312 136 ------
NM_016396chr1582788 2775 2282 2261 997 736 572 356 --32112 658 531 --
NM_016410chr93648 243 138 ------
NM_016418chr2243718 3154 3005 2790 --13698 --
NM_016422chr1162989 2976 2431 873 150 117 3910 789 206 --12297
NM_016441chr292253 2142 1799 1716 1679 1659 1553 1470 683 ------
NM_016442chr5152291 2281 2157 2108 1996 1868 1832 1732 1481 1469 932 744 626 570 523 11818 ----
NM_016448chr181900 1808 1194 729 714 493 147 126 1134 ----
NM_016451chr114313 246 120 81 ------
NM_016472chr1431136 317 180 11417 11297 --
NM_016475chr144965 499 406 395 ------
NM_016480chr52884 765 ------
NM_016485chr642155 1535 406 179 ----1618
NM_016506chr112672 641 1167 ----
NM_016507chr1752548 2432 1168 579 345 12090 13175 12163
NM_016530chr15123859 3826 3269 2749 2652 1214 1208 1181 1006 867 322 192 53679 3575 3552 2871 1129 ----
NM_016531chr473547 2614 1382 1102 1016 696 646 12848 1989 14166
NM_016542chrX111750 1508 1345 1189 1135 1090 504 350 300 259 205 --1663 --
NM_016544chr253056 2675 469 355 108 --11567 --
NM_016559chr331157 1020 526 ------
NM_016569chr1241205 1130 411 24 1605 ----
NM_016575chr1245306 4056 3523 1556 11167 15269 --
NM_016578chr11------1116
NM_016584chr122283 111 ------
NM_016592chr20133 --11333 --
NM_016603chr522240 306 21979 1764 1280 --
NM_016604chr551249 1058 954 819 42 ------
NM_016605chr532381 2277 2205 --12130 --
NM_016607chrX31674 1371 308 --187 --
NM_016613chr452288 2194 1794 842 275 32611 2052 640 ----
NM_016623chr85663 411 212 107 71 ------
NM_016626chr1821320 613 ------
NM_016628chr103680 564 322 ------
NM_016631chr214958 779 392 350 ------
NM_016644chr51456 ------
NM_016652chr2071812 1451 724 543 418 348 294 1634 ----
NM_016654chr1541371 1241 541 310 1510 ----
NM_016824chr1041370 1304 662 432 --11614 1161
NM_016831chr172367 2163 1494 857 700 428 77 1287 ----
NM_016929chr684625 4519 4491 4207 4036 3142 966 158 1824 1231 --
NM_016931chr111278 ------
NM_016936chr1621869 672 ----1602
NM_016946chr163283 2827 2671 2414 2269 1347 1644 ----
NM_016950chr431274 1006 276 ------
NM_016953chr295984 5900 5780 4633 4082 1574 1308 139 54 24655 3862 21725 85 --
NM_016954chrX4653 551 430 405 ------
NM_017413chrX42552 2517 987 558 --12507 --
NM_017415chr564297 4232 3168 3038 2956 407 --22995 944 --
NM_017416chrX1128 ------
NM_017420chr14103104 2445 2369 2332 1184 919 503 408 220 49 --12640 13526
NM_017423chr462218 1699 635 550 398 204 ------
NM_017424chr2261647 1517 1311 719 525 509 1245 ----
NM_017437chr1462167 1675 869 826 517 467 1741 --1199
NM_017440chr124445 274 248 178 ------
NM_017447chr21164065 4013 3845 3713 3695 3498 3473 3184 2991 2902 2839 1612 803 564 528 436 12930 --24041 3121
NM_017449chr111138 1608 --1408
NM_017455chr153886 787 94 ------
NM_017491chr41869 1702 ----
NM_017510chr51647 --1444 --
NM_017516chr1111083 ------
NM_017519chr661196 1045 936 868 857 844 ------
NM_017540chr562256 2020 738 498 279 62 1793 23136 442 --
NM_017545chr205562 213 172 150 39 ----1197
NM_017548chr331846 236 193 11622 ----
NM_017551chr1062653 2601 2129 769 758 123 12487 1466 --
NM_017553chr1521290 162 ------
NM_017569chr13------1314
NM_017577chr351112 1023 464 194 108 --1142 --
NM_017580chr1092221 2110 1774 1678 1583 694 522 443 420 1603 1568 1409
NM_017582chr151768 1703 1537 1486 273 ------
NM_017583chr1121689 590 ------
NM_017588chr921965 326 ------
NM_017593chr42499 431 ------
NM_017599chr1271896 1876 1705 1630 1614 663 42 22036 651 21752 187 --
NM_017611chr113744 647 21 ------
NM_017617chr951582 370 234 166 146 1640 ----
NM_017623chr262599 2057 1903 1701 542 413 32269 1010 115 ----
NM_017628chr4105150 4651 4602 4435 3507 2035 1655 1397 1161 1073 35075 1797 194 --13801
NM_017631chr4150 ------
NM_017633chr663568 3360 1280 1157 378 164 139 13555 --
NM_017634chr861671 1615 1214 591 562 310 11787 ----
NM_017635chr1121357 621 ------
NM_017637chr9199010 8628 7941 7884 7161 6709 3558 3440 3396 2763 2263 2022 2004 1963 1238 1107 827 249 204 12210 13687 18852
NM_017641chr123834 287 245 ------
NM_017643chr17163051 3027 2922 2763 2601 2426 2313 1188 979 665 651 593 186 156 133 119 22209 433 ----
NM_017644chr3185184 5026 4852 4519 4147 4038 3841 3594 3341 2045 1792 1775 1543 1312 1273 1216 627 154 53957 1912 1698 1679 1383 1305 --
NM_017645chr9103183 3047 2247 1215 804 772 438 414 158 109 --1139 --
NM_017649chr104962 351 285 272 ------
NM_017650chr7145804 5715 5597 5057 3876 2403 1987 1929 1708 1474 1050 920 828 378 35948 1425 1099 15375 --
NM_017658chr14234529 4194 4025 3799 3752 3428 3214 2885 1879 1445 1435 1367 1117 903 879 769 648 619 580 518 471 350 149 ------
NM_017661chr1571168 1081 824 390 338 275 22 ------
NM_017672chr1511102 ------
NM_017680chr931058 758 383 ------
NM_017693chr1371628 1457 1337 459 349 216 80 21232 180 ----
NM_017703chr19137 ------
NM_017709chr1104212 3753 3169 3147 2764 1713 1134 881 470 95 --12798 --
NM_017712chr1963945 3920 1170 1068 649 403 1374 14987 --
NM_017719chr331905 982 945 ------
NM_017730chr32742 56 1551 1122 --
NM_017737chr132234 1946 482 11532 --1376
NM_017740chr1671849 1837 1824 1728 1167 717 383 1703 ----
NM_017742chr183772 421 130 --11576 --
NM_017745chrX5586 552 224 181 173 ------
NM_017752chrX61563 1510 1474 1454 789 509 --1346 --
NM_017753chr92885 361 ------
NM_017754chr663722 3314 1604 1046 993 658 14250 14719 14282
NM_017758chr1721122 302 --1376 --
NM_017760chr71305 ------
NM_017762chr1581934 1732 1612 748 570 417 385 161 1515 ----
NM_017769chr1493225 3110 2911 2830 2632 2555 393 76 59 32195 935 544 ----
NM_017772chr621726 1247 ------
NM_017779chr172072 1861 1671 929 730 637 483 ------
NM_017780chr82941 868 ------
NM_017789chr22591 266 ------
NM_017799chr1481807 1786 1702 1243 623 313 264 224 ------
NM_017809chrX2179 59 ------
NM_017811chr9103005 2960 2720 2139 1255 1171 1074 1068 1026 362 32599 2407 336 32699 2609 2295 --
NM_017813chr8215260 5179 5150 4998 4205 3929 3763 1761 1633 1571 1253 1057 1014 969 945 817 728 569 347 312 226 25428 3770 --14598
NM_017816chr42150 50 ------
NM_017824chr10142549 2515 2463 2152 2004 1935 1780 1716 1013 785 747 627 216 194 12428 ----
NM_017831chr18154686 4580 4375 4269 4140 3895 3703 3464 3433 3339 2932 1838 1775 1054 952 11682 11181 13409
NM_017848chrX114076 4024 3998 3724 3261 3023 1649 1505 1183 62 47 44580 4272 4105 580 34689 4323 1455 --
NM_017851chr1541151 272 219 129 21283 856 1948 --
NM_017857chr112703 655 ------
NM_017860chr13299 83 56 1822 --1846
NM_017864chr8124 ------
NM_017866chr83899 867 122 1205 ----
NM_017890chr821813 1696 1735 11603 --
NM_017902chr1065503 4019 1843 1771 1092 1078 12189 24339 766 14141
NM_017905chr133547 535 151 1176 ----
NM_017915chr1261197 910 325 251 219 183 11169 1808 11044
NM_017919chr9125429 5109 5087 4868 4422 2337 2272 1590 1560 1543 1035 905 --22102 1534 24712 3754
NM_017922chr144634 585 446 415 ------
NM_017923chr41727 1658 1286 --
NM_017925chr971799 1710 1701 1494 1386 1247 216 ------
NM_017933chr251505 1432 1343 593 306 ------
NM_017935chr42702 597 1136 150 --
NM_017938chrX21585 319 --11532 --
NM_017944chr1162969 2588 2463 2202 806 308 11038 ----
NM_017945chr371073 973 939 925 75 51 43 ------
NM_017952chr2114469 4234 4026 3938 3895 3568 2806 1504 1473 687 468 34143 3437 248 13394 --
NM_017958chr262769 2665 2598 2126 416 332 1297 ----
NM_017974chr251317 1246 1030 992 927 ------
NM_017987chr10122097 2050 1971 1961 1904 1776 655 593 439 406 195 182 --199 --
NM_017994chr772866 2749 1015 1009 659 386 324 22711 2068 11872 --
NM_018010chr341379 492 266 219 ----11442
NM_018011chr131233 ------
NM_018015chrX41091 312 91 79 1179 ----
NM_018017chr10111813 968 675 617 520 513 485 362 296 146 95 52306 2246 2174 1856 632 ----
NM_018018chr1261934 1638 1535 1498 1265 768 ------
NM_018026chr1121436 493 ------
NM_018027chr1083321 3237 2942 2830 2500 2203 2197 776 --11061 --
NM_018036chr14194254 4217 3700 3648 3604 3216 3176 2931 2770 2764 1735 1438 1431 930 885 811 447 394 125 34281 1298 627 12959 12722
NM_018045chr11864 ------
NM_018046chr531469 565 149 ------
NM_018048chr1282048 1940 1443 1279 813 785 673 535 --1823 --
NM_018053chr13852 702 187 ------
NM_018061chr161447 1207 627 181 134 122 21753 1522 1655 --
NM_018063chr102373 24 1428 ----
NM_018078chr451042 977 368 294 249 ------
NM_018080chr151135 ------
NM_018084chr2143265 3061 2843 2614 2549 2390 2229 1296 1126 772 757 362 243 142 ------
NM_018085chr167110 5205 3269 3000 2937 2637 25461 701 ----
NM_018092chr1651616 1364 618 403 317 11152 11226 --
NM_018094chrX1305 --1316 --
NM_018095chr112672 641 1167 ----
NM_018096chr172924 691 ------
NM_018098chr32976 179 ------
NM_018100chr643027 2977 2901 126 23268 293 12796 11349
NM_018105chr861213 961 792 352 282 181 11176 ----
NM_018120chr841415 1335 352 236 1110 ----
NM_018121chr1062672 1078 736 529 219 55 2465 334 42697 2164 1196 1147 --
NM_018122chr12563 292 1796 134 --
NM_018133chr322130 123 ------
NM_018137chr131414 1053 1019 ------
NM_018139chr14123 ------
NM_018155chr3173442 2855 2846 2604 2560 2495 2304 2206 1354 1224 1193 882 854 772 703 560 451 --1176 --
NM_018157chr1243154 2188 1232 840 11994 12211 22876 1059
NM_018159chrX21366 1321 1484 --11522
NM_018169chr123537 398 123 1473 ----
NM_018177chr42144 54 1770 ----
NM_018181chr1851763 1694 495 423 124 1440 ----
NM_018184chr352189 1923 1588 1458 358 1118 ----
NM_018191chr1362014 1909 1748 1420 291 232 21374 520 ----
NM_018200chr1542368 2143 383 358 22491 1717 --12570
NM_018201chr912478 ------
NM_018202chr12339 283 1197 ----
NM_018221chr24481 454 353 303 ------
NM_018223chr1241098 401 353 89 --128 --
NM_018227chr482944 2789 2675 2376 2289 1167 1101 106 12476 ----
NM_018241chr42907 765 ------
NM_018243chr493963 3864 3503 2504 1549 1344 928 839 554 --11116 --
NM_018246chr862793 2643 2308 2213 374 138 2861 495 12225 --
NM_018247chr673018 2218 2150 864 485 291 66 13080 21914 429 --
NM_018254chr172382 2372 2359 864 555 163 34 11608 ----
NM_018257chr20102601 2480 2108 1656 1635 1609 1029 718 622 286 --12534 --
NM_018261chr43542 513 408 ------
NM_018264chr76947 936 918 882 826 107 1202 ----
NM_018266chr351019 996 333 178 45 --1426 --
NM_018279chr1283012 2838 2429 2317 2311 717 621 64 ------
NM_018287chr102471 259 --1394 1959
NM_018293chr372676 2643 2268 2239 1998 1989 1810 22771 105 ----
NM_018298chr11942 --1919 --
NM_018299chr8112988 2887 2729 2706 2672 2303 1027 649 384 201 128 13385 ----
NM_018302chr441517 905 671 572 12171 ----
NM_018307chr174961 737 696 42 ------
NM_018312chr1162111 2007 1507 853 420 409 11411 ----
NM_018313chr392549 2312 2264 2254 1936 724 154 62 22 32121 882 594 ----
NM_018314chr112521 258 ------
NM_018315chr441618 1499 1034 376 ------
NM_018317chr4138 ------
NM_018319chr1451380 532 306 208 159 1593 --11054
NM_018321chr5270 27 ------
NM_018323chr471840 1801 1613 1597 1279 324 184 1489 ----
NM_018327chr2031384 545 294 --31264 749 318 --
NM_018330chr1061615 1377 1215 1151 517 252 163 --1480
NM_018339chr971843 1786 1776 1700 1166 659 319 11534 ----
NM_018340chr1623545 29 13775 11416 --
NM_018351chr1294569 4392 3960 3339 998 747 733 562 178 --1511 --
NM_018361chr873753 3331 3186 2627 1608 1340 366 14038 11378 11114
NM_018362chr11134005 3960 3889 3347 1495 1484 871 822 599 593 319 249 37 1340 12834 --
NM_018364chr1134011 3854 3784 3732 3677 3508 3465 3358 3041 3030 1113 1070 541 11165 ----
NM_018373chr14116086 5610 5593 5297 4998 4960 4424 2000 1886 1791 1624 15251 16391 12357
NM_018374chr7265258 4829 4565 4474 4184 4170 4087 4029 3913 3710 1957 1724 1536 1284 1260 1247 1202 946 753 651 567 521 493 477 420 202 34684 4002 1017 1500 --
NM_018375chr1421457 229 ----1173
NM_018383chr242004 1931 1675 556 ------
NM_018387chr91497 ------
NM_018394chr331614 990 223 1456 ----
NM_018403chr3174143 4082 3903 3680 2706 2582 1648 1579 1510 1492 1187 1134 763 491 334 328 275 11461 ----
NM_018409chr463086 2734 1992 1173 477 455 --12684 12584
NM_018423chr121908 1270 ----
NM_018425chr1012497 --12574 --
NM_018429chr561948 1070 445 414 184 150 11966 22115 1807 --
NM_018434chr51119 ------
NM_018438chr12497 171 ------
NM_018439chr1891889 1011 779 505 483 410 300 251 199 22303 1966 ----
NM_018440chr8258317 7861 6832 6474 6133 5883 5841 5491 5391 5320 3178 2989 2838 2761 2575 2564 2517 2465 2169 1683 1677 1356 800 527 488 36816 1496 730 ----
NM_018442chr11309 ------
NM_018444chr892130 1798 1760 1474 927 675 496 480 269 ------
NM_018445chr152508 79 ------
NM_018448chr1261007 936 465 444 365 228 3794 510 180 11065 --
NM_018452chr6_random53327 2527 1363 1149 993 --12670 --
NM_018454chr15------1680
NM_018462chr32231 130 1557 1791 1727
NM_018465chr9------1200
NM_018477chr1421054 1041 ------
NM_018482chr872599 2549 1980 1951 831 755 707 --1449 --
NM_018489chr122075 1744 11999 11803 --
NM_018490chr1151788 657 529 160 75 11422 ----
NM_018553chr1761608 1144 673 317 189 170 ----11171
NM_018557chr221657 1613 --11377 --
NM_018566chr1114430 3990 3683 3470 1673 1609 1601 1556 1163 1010 118 11751 ----
NM_018569chr441284 1126 302 208 ------
NM_018602chr151251 ------
NM_018638chr12195547 5526 5389 4568 3977 3913 3875 3820 3658 3499 1865 1024 1011 984 830 778 749 524 410 25094 1044 15568 24713 1302
NM_018640chr12132798 2765 2447 2307 2292 2166 1961 814 759 695 637 567 47 1728 ----
NM_018650chr152149 2115 2073 1872 1701 ------
NM_018657chr33682 257 112 1294 ----
NM_018683chr2031706 1440 648 ------
NM_018689chr1542596 2233 2109 124 1868 52289 2076 1780 630 573 --
NM_018695chr5142139 2099 2080 2063 1854 1844 1753 1719 1621 1508 859 773 390 349 12074 ----
NM_018698chrX51907 1524 543 450 410 ------
NM_018700chr581717 1278 1214 1155 465 370 257 183 --11346 --
NM_018703chr162404 284 ------
NM_018704chr162044 1790 1766 1644 518 507 ------
NM_018710chr86991 291 231 221 196 139 ------
NM_018712chr1141478 1100 379 131 1274 ----
NM_018713chr161116 863 805 737 231 150 ----1780
NM_018718chr742246 1822 409 298 21500 46 --11478
NM_018834chr54799 650 399 118 ------
NM_018840chr201473 ------
NM_018846chr75997 977 354 184 150 ------
NM_018847chr931699 1383 312 --1134 --
NM_018890chr71273 11168 ----
NM_018940chr56866 766 461 426 397 284 11134 ----
NM_018945chr683568 3294 3166 2387 1220 982 751 530 ------
NM_018947chr764110 637 562 542 277 237 34949 3726 1529 ----
NM_018948chr131453 1331 1172 1951 1498 --
NM_018951chr7128 ------
NM_018958chr1583856 3440 3178 3130 2731 1597 1342 839 --1571 23608 2948
NM_018970chr742818 2641 2469 1203 21247 408 ----
NM_018975chr161790 ------
NM_018976chr12102687 2627 2354 2294 1856 1067 484 478 286 86 1642 ----
NM_018979chr1242275 1876 1642 903 11737 ----
NM_018981chr261377 1035 1019 909 397 282 21161 205 ----
NM_018983chr41259 ------
NM_018999chr1084594 3885 3380 1263 1111 545 349 106 1961 --13285
NM_019001chr3174650 4596 4451 4235 4180 3965 3406 3155 3043 1894 1525 1385 1296 1036 708 152 127 43162 1840 1403 1131 ----
NM_019004chr752308 963 917 583 560 11962 11546 --
NM_019006chr154464 258 238 220 ----1645
NM_019008chr2253034 2513 1495 877 159 --1457 13441
NM_019027chr4102555 2501 2447 1918 965 864 317 249 180 157 12489 ----
NM_019035chr481997 1950 1899 1888 1836 1612 574 444 1457 11967 --
NM_019036chr66952 905 878 829 131 43 2965 820 ----
NM_019044chr2144695 4572 3991 3975 3887 3499 3000 1718 1483 1395 564 501 268 41 ------
NM_019049chr14745 662 564 197 ------
NM_019050chr4102248 2198 2159 1984 1932 1817 1765 1695 692 118 1283 ----
NM_019053chr1051020 853 443 437 218 --2431 225 --
NM_019063chr24877 722 180 148 12207 ----
NM_019072chr574264 3890 3858 3648 2726 1669 276 14042 --12920
NM_019074chr15192 ------
NM_019080chr1341539 1368 1156 987 11034 21314 1011 --
NM_019084chr1082623 2120 2073 1962 1921 1688 832 409 2697 555 ----
NM_019087chr541695 672 651 439 1125 ----
NM_019094chr12143423 3269 2989 2601 2362 1411 1102 1062 701 598 290 151 121 58 1143 13033 --
NM_019098chr851804 1739 1379 485 212 11678 ----
NM_019106chr2242283 1116 902 222 ----1823
NM_019114chr972130 2103 2009 1941 441 330 155 1273 ----
NM_019116chr1683654 1386 1227 1199 1015 548 395 164 184 12518 --
NM_019117chrX113303 3166 1316 1244 1201 877 542 464 377 218 154 ------
NM_019555chr321342 93 --1266 11701
NM_019590chr107509 452 446 364 338 151 72 ------
NM_019591chr12--1889 1821 1156
NM_019592chr91279 1207 --1272
NM_019593chr2092366 2042 1998 1019 621 531 345 137 61 11102 ----
NM_019595chr22628 270 ------
NM_019605chr11688 ----1649
NM_019610chr162168 1573 757 727 445 213 ------
NM_019842chr63390 351 142 ------
NM_019843chr222451 89 ------
NM_019862chr1631682 1500 1115 11198 11636 --
NM_019885chr222611 2521 --22351 361 1352
NM_019891chr151096 948 249 202 55 2983 276 --1834
NM_019895chr33467 330 207 ------
NM_019898chr1631682 1500 1115 11198 11636 --
NM_019899chr1631682 1500 1115 11198 11636 --
NM_019900chr1631682 1500 1115 11198 11636 --
NM_019903chr1041370 1304 662 432 --11614 1161
NM_020069chr112236 169 ------
NM_020122chr2246000 5759 5322 4464 4282 3987 2244 2114 2063 1827 1783 1768 1733 1723 1401 1312 1237 1217 1096 1056 1047 810 402 96 --14079 --
NM_020141chr162267 2076 525 427 414 348 ------
NM_020143chr24925 337 184 92 ------
NM_020144chr762029 1744 1722 1644 1336 646 1639 21442 494 --
NM_020147chr154225 208 85 40 ------
NM_020148chr1882998 2842 1948 1909 1032 916 903 774 ------
NM_020159chr461679 1621 1574 1319 489 360 ------
NM_020177chr543295 3113 1110 888 33158 2720 671 22463 1028 --
NM_020193chr1131163 1035 948 ------
NM_020198chr1741310 1132 580 547 21484 98 1317 --
NM_020199chr531282 875 298 31104 497 256 --1179
NM_020204chr12766 693 --1252 --
NM_020205chr153314 2740 1291 909 131 --12966 --
NM_020216chr12415 385 ----149
NM_020226chr42712 653 ------
NM_020228chr1172390 1740 1734 986 472 466 280 1604 1224 12062
NM_020239chr152340 2326 1981 1952 1683 --11693 --
NM_020240chr5102766 2541 2189 2167 1899 984 856 571 279 179 1602 ----
NM_020245chr6173827 3403 3181 3169 3145 2042 1942 1909 1855 1674 1643 1222 972 421 226 220 194 --1271 1352
NM_020317chr11334 1279 ----
NM_020336chr2083637 2631 905 387 302 268 252 235 12814 ----
NM_020337chr452722 2247 2181 2163 428 ------
NM_020341chr2031635 1624 245 ------
NM_020342chr252576 2108 1728 267 187 11948 12228 --
NM_020347chr382056 2001 1906 1888 906 895 669 151 1277 ----
NM_020357chr31111 21076 295 11351 --
NM_020361chr82259 76 ----1224
NM_020362chr12810 801 ------
NM_020374chr1251832 730 520 403 341 1537 11411 --
NM_020379chr12603 53 ------
NM_020381chr661491 707 201 120 93 73 1547 ----
NM_020382chr1231218 221 146 1311 ----
NM_020390chr3164703 4659 4422 4209 3992 3835 3486 3058 1849 1825 1508 1097 792 608 312 236 33493 1572 125 1455 --
NM_020420chrY91789 1610 1602 1483 1384 1193 703 510 408 --11205 --
NM_020424chr162715 539 ------
NM_020425chr682044 1993 1885 1563 736 565 553 161 ----11667
NM_020432chr762146 1786 1761 1651 738 186 32125 1986 1925 ----
NM_020439chr1136 ------
NM_020440chr153086 2255 1182 541 515 --12076 13072
NM_020443chr1116752 6737 6561 6509 5911 2576 2453 1519 1346 1283 845 ----185
NM_020444chr531258 570 57 ------
NM_020449chrX2687 224 --1261 --
NM_020452chr142047 1964 550 539 ------
NM_020453chr491925 1799 1595 1420 744 493 300 274 32 11808 ----
NM_020455chr672846 2447 2234 2198 1942 1841 627 --11026 --
NM_020457chr162650 432 ------
NM_020466chr6114281 3767 3739 3346 3268 3116 3078 3050 1894 1012 27 --14913 --
NM_020474chr1891860 1845 1543 1488 1406 675 650 332 160 ----11982
NM_020482chr64795 734 523 331 193 ----
NM_020529chr141468 ------
NM_020532chr23702 370 135 1617 ----
NM_020630chr101576 ------
NM_020638chr1242029 1593 550 335 12014 ----
NM_020640chr362224 2072 1981 739 614 321 21911 655 11769 --
NM_020644chr115625 345 333 308 239 ------
NM_020647chr862308 1792 1574 1514 792 441 ------
NM_020651chr241836 1668 1360 1264 --1277 11340
NM_020654chr341547 1455 644 587 ------
NM_020661chr1251999 1968 1958 775 456 --1307 --
NM_020673chr20177721 7695 7679 7624 7217 6143 5455 5213 4960 4778 3060 2543 2410 1012 553 176 86 55055 4899 4797 2841 1552 11257 --
NM_020686chr1662850 2829 2780 2486 2141 80 ------
NM_020697chr851314 1108 517 506 148 2171 159 ----
NM_020698chr12102934 2747 2642 2606 2357 2030 1978 749 662 31 22834 206 ----
NM_020699chr175335 5286 1716 1676 1161 965 56 15317 ----
NM_020708chr2032481 2352 2170 22499 2229 11803 --
NM_020711chr282532 2028 1006 979 666 445 223 128 ------
NM_020718chr16226501 6344 6338 6113 5909 5621 5605 4891 4672 4353 4154 4048 2446 2271 2061 1668 1556 1476 1370 1334 703 518 26426 1765 11153 --
NM_020727chr21123741 3715 3472 3449 2542 1476 1425 1370 1287 1252 367 189 33774 1522 378 23519 1326 13647
NM_020732chr661196 1045 936 868 857 844 ------
NM_020734chr12112647 2161 1293 1228 1071 929 755 531 313 254 178 ------
NM_020739chr15104181 4101 2986 1332 1305 1094 551 412 311 255 11128 23575 3089 --
NM_020742chrX82736 2607 2450 2421 1684 733 698 686 11992 1716 --
NM_020748chr1752011 1786 1555 1356 568 ------
NM_020749chr881651 1403 1293 718 549 391 299 232 ------
NM_020752chr1092477 2090 2076 1861 1160 1004 522 480 245 --21014 739 --
NM_020754chr321145 463 ----1479
NM_020755chr631542 1474 338 11371 ----
NM_020760chr271966 1750 1568 1394 530 317 225 ------
NM_020766chrX114607 4541 4403 2934 2885 1805 1626 1367 946 938 636 1109 1823 --
NM_020768chr531986 481 224 62748 2200 1298 1093 959 647 ----
NM_020772chr17197991 7703 7587 6778 5602 5573 3248 2152 1917 1702 1639 1124 1079 1070 1012 966 901 575 72 28186 7111 26795 5310 16059
NM_020774chr18146283 5953 5912 5544 5456 5353 5074 4666 3911 2411 2283 2211 2127 1289 --15782 --
NM_020776chr1862216 1868 357 231 172 99 1433 12190 --
NM_020777chr432537 1018 25 ------
NM_020782chr12124870 4649 4630 4300 3998 3962 3934 3434 3171 1346 1154 543 23215 1893 ----
NM_020783chr1852005 1999 900 529 212 22154 2066 ----
NM_020794chr161475 1397 1316 1201 560 490 1306 ----
NM_020796chr542145 2010 1969 664 ----11067
NM_020801chr532440 764 220 21651 91 ----
NM_020803chr482028 1922 1746 699 625 531 521 80 2768 592 ----
NM_020805chr1841430 1271 761 387 21852 231 ----
NM_020806chr142615 157 --1283 --
NM_020808chr1186 ----1272
NM_020809chr1182253 2236 1900 1563 1515 765 755 679 1256 --11637
NM_020810chr1443394 758 462 77 1605 13219 --
NM_020815chr44152 140 122 40 --1381 --
NM_020819chr671192 862 806 796 426 261 235 ------
NM_020830chr261998 1196 1017 972 568 296 12202 1650 --
NM_020834chr1451607 1405 1281 1221 651 11395 ----
NM_020839chr361624 1045 1020 487 251 136 ------
NM_020841chr1283766 3758 3688 2936 2510 908 889 154 --11404 --
NM_020844chr8217641 7339 7166 6734 6107 5572 5504 5013 4919 4908 4800 2839 2725 2674 2309 2182 1238 632 363 316 152 35561 5421 528 ----
NM_020850chr1632421 897 418 ------
NM_020853chr1241105 622 381 206 ------
NM_020854chr1831536 1266 151 1629 --1254
NM_020856chr1931221 569 375 1607 ----
NM_020858chr1531656 543 525 ------
NM_020861chr621379 889 1261 1201 --
NM_020865chr31101 ------
NM_020868chr272010 1861 1772 1762 576 454 397 ------
NM_020870chr432200 1865 1590 ------
NM_020871chrX102240 1947 1937 1818 1650 855 746 675 552 382 1268 22157 523 --
NM_020872chr3101761 1665 1659 1270 1199 1185 1115 351 91 60 --1164 --
NM_020873chr35885 732 352 266 151 1827 ----
NM_020879chr71254 ------
NM_020898chr121149 ------
NM_020909chr294031 3966 3578 2839 2630 948 695 234 56 --1920 --
NM_020918chr1073406 3185 1144 1119 521 474 315 13377 ----
NM_020920chr14145 ------
NM_020921chr14103689 3677 2903 2554 2430 2418 1403 1077 1037 58 22726 1281 ----
NM_020922chrX61504 1393 1373 524 221 49 21421 39 ----
NM_020935chr274570 4558 1799 1458 1444 1230 473 23638 1523 1467 --
NM_020940chr1092704 2398 2319 2101 2082 1896 1839 651 187 --1351 --
NM_020948chr1153653 3343 2921 2798 2562 2524 2378 1468 1402 1257 1028 810 774 194 56 33638 2422 1288 13000 --
NM_020951chr1961806 1502 971 508 231 38 21965 115 ----
NM_020962chr1542262 1996 505 395 ------
NM_020975chr1031901 1614 639 21652 1592 ----
NM_020980chr1531352 449 336 1699 --11154
NM_020987chr102957 222 --11209 --
NM_020993chr1232801 2754 2728 12858 12449 --
NM_021003chr142713 73 --1608 --
NM_021005chr152739 188 ------
NM_021007chr272358 2349 1804 1667 1580 628 220 1640 ----
NM_021012chr1743157 3146 402 124 ----1772
NM_021033chr13123045 2813 2780 2719 2323 1294 1160 1032 719 557 443 192 ------
NM_021038chr393215 3093 2949 2902 2810 2690 2665 1317 435 1721 13046 --
NM_021061chr8124501 4421 4121 4020 3716 1613 1311 999 960 815 501 442 ------
NM_021063chr6165 ------
NM_021069chr451493 1469 644 473 441 1684 11611 --
NM_021072chr56725 686 525 517 427 300 1118 12252 1638
NM_021076chr222545 83 ------
NM_021083chrX133655 3582 3440 3338 2731 1418 1030 921 915 688 533 406 265 2866 832 22539 484 --
NM_021090chr2264936 4699 4478 3610 1975 751 --1758 --
NM_021097chr2103077 2813 2735 2696 2502 2285 2213 1208 983 304 ------
NM_021101chr362544 2264 1865 697 574 551 ------
NM_021111chr911208 2374 330 --11293
NM_021116chr788937 7864 7732 7620 7614 6622 2062 661 21492 1037 17877 --
NM_021120chrX51044 1023 655 299 187 1120 ----
NM_021132chr1041188 922 841 347 ------
NM_021133chr131659 1320 79 --11091 --
NM_021140chrX3817 332 296 ------
NM_021145chr721078 403 ------
NM_021155chr1982703 2572 2504 2430 2285 2172 2000 747 ----11122
NM_021163chr742595 849 762 144 11042 ----
NM_021167chr752844 2785 2720 2267 2036 ----1336
NM_021180chr13753 694 637 ------
NM_021183chrX42255 736 389 255 ------
NM_021188chr143432 373 350 ------
NM_021205chr162844 2714 1074 754 233 79 134 1797 --
NM_021215chr2052366 2113 1835 338 254 ------
NM_021220chr203464 298 65 ------
NM_021224chr93428 138 118 ------
NM_021238chr12102088 1660 1546 1455 1316 1291 593 545 253 247 --11395 --
NM_021239chr1431289 1120 52 130 ----
NM_021252chr1081870 1477 817 798 753 700 494 81 11983 1437 --
NM_021255chr14123905 3778 3759 3296 3063 2714 1637 1506 1228 1009 900 694 --12870 --
NM_021572chr6------1981
NM_021619chr911147 ------
NM_021622chr1072161 1919 1874 1629 906 95 51 ----12304
NM_021627chr33854 408 42 ------
NM_021629chr365119 4759 4725 3846 1337 801 54319 3789 3695 3101 1451 2607 136 1846
NM_021637chrX31382 1209 78 ------
NM_021638chr4124913 4838 4683 4632 4517 4494 4410 3116 1471 671 598 314 1718 --11538
NM_021643chr241331 1174 437 296 ------
NM_021644chr103955 820 118 1336 ----
NM_021645chr1342390 2356 1963 1695 1169 12119 1781
NM_021647chr4164657 4559 4285 4174 4091 3873 3804 3367 3140 1782 1435 1410 1383 1035 651 372 34337 3937 254 13892 --
NM_021648chr652774 2532 2345 1830 384 ------
NM_021705chr621302 1263 21492 222 1205 11456
NM_021722chr72546 50 ------
NM_021723chr72587 50 ------
NM_021738chr102105 91 1120 ----
NM_021785chrX1289 ------
NM_021813chr6145790 5443 4931 4849 4775 3915 3705 2209 2065 1273 966 639 377 262 1702 1944 --
NM_021815chr252861 2745 1098 552 504 11042 ----
NM_021818chr1451264 1007 212 157 49 --11414 --
NM_021908chr73904 677 335 ------
NM_021911chr5115576 5451 5298 4644 4500 3945 3732 1985 1381 1290 628 11779 ----
NM_021912chr1543516 580 431 21 22678 1170 ----
NM_021914chr1482010 1986 1848 1712 468 383 237 200 22100 1753 11650 --
NM_021947chr1741272 463 369 160 ------
NM_021949chrX32237 1098 1041 ------
NM_021956chr641572 1344 1129 1008 ------
NM_021959chr64915 718 364 348 ------
NM_021960chr192811 2333 1796 1037 1015 763 544 224 30 11857 --1270
NM_021961chr11177392 7071 6656 6538 6112 5917 5680 5626 4945 4856 4622 2256 2040 1429 1086 662 174 ------
NM_021963chrX5764 635 504 176 160 ------
NM_021964chr3276334 6314 6002 5793 5502 5455 4670 4632 4590 4573 4316 4028 2321 2190 1917 1706 1510 1397 1259 981 804 774 671 551 517 378 290 66203 4303 4191 2383 2221 233 12301 1664
NM_021980chr1041213 1119 974 85 ------
NM_021994chr76741 374 360 152 133 46 ------
NM_021998chrX51218 1210 985 461 390 1402 ----
NM_021999chr135314 194 177 130 96 1556 ----
NM_022041chr1652674 2555 2340 1766 958 12030 ----
NM_022048chr15145206 5034 5020 4924 4708 4605 4146 3964 3945 1747 1713 1656 997 831 25851 5264 25187 756 --
NM_022049chr131700 378 353 2466 245 11296 --
NM_022062chr1111974 ------
NM_022063chr1041595 1211 547 147 21637 1474 11794 --
NM_022073chr1431255 1243 36 ------
NM_022079chr1031032 801 396 1292 ----
NM_022091chr632799 1813 835 22673 2436 ----
NM_022103chr192994 223 1920 ----
NM_022114chr124292 1676 13562 14060 14245
NM_022118chr132402 72 ------
NM_022133chr881908 1858 1746 1526 1486 1203 432 186 ----1755
NM_022137chr141135 --11918 1277
NM_022138chr621491 600 ------
NM_022154chr481306 1261 1085 870 433 249 194 109 1396 ----
NM_022160chr91145 ------
NM_022164chr11676 ------
NM_022166chr1675825 5678 4017 2402 2288 1601 331 46331 5784 1136 320 ----
NM_022170chr751764 1673 562 411 167 ----11590
NM_022336chr252109 1980 1834 934 600 --1875 1206
NM_022351chr8103853 2836 2729 1542 1381 1320 610 187 176 136 13370 1258 1360
NM_022373chr72967 291 ------
NM_022454chr84896 637 558 346 ------
NM_022456chr12166713 6469 6128 5757 5458 4955 3050 2644 2539 1827 1368 1213 1151 1139 352 150 --1963 1971
NM_022458chr783057 2907 2432 981 628 458 311 138 22568 849 13150 --
NM_022459chr13195771 5495 4901 4829 4724 4606 4417 3882 2370 2328 2224 2115 1818 1399 1006 935 536 324 251 24702 1239 25224 5199 1225
NM_022461chr311163 --21096 48 --
NM_022473chr1574473 2908 1040 410 354 176 47 --1629 13228
NM_022474chr1462513 1962 1870 1825 291 249 --12154 --
NM_022475chr43685 620 112 1472 ----
NM_022484chr731337 1165 1030 --1254 --
NM_022491chr1273347 3280 2731 858 776 410 274 1768 1241 --
NM_022495chr145589 565 531 468 49 ------
NM_022496chr123194 141 56 ------
NM_022576chr13335 274 261 ------
NM_022650chr54802 323 310 266 ------
NM_022716chr193192 2211 1961 1189 1134 913 840 486 254 --22235 2062 --
NM_022735chr131659 1565 1311 11179 ----
NM_022739chr1751116 833 768 181 140 --162 --
NM_022750chr74252 165 88 27 ------
NM_022753chr162481 2471 1943 663 463 110 ------
NM_022755chr982528 2489 2043 699 502 471 414 108 ------
NM_022756chr141489 1346 546 209 1396 ----
NM_022763chr343029 2430 443 301 23078 280 ----
NM_022770chr1641334 1278 1230 871 ------
NM_022771chr122746 51 1348 ----
NM_022776chr351496 1224 623 265 194 1392 ----
NM_022780chr241350 736 591 350 157 ----
NM_022781chr953003 2980 2142 1279 331 13066 1319 --
NM_022787chr162791 2759 2723 2323 2296 991 125 --12136
NM_022802chr1031163 1097 247 ----11470
NM_022817chr241673 1493 602 256 2754 127 --12301
NM_022818chr1621429 233 ----1364
NM_022824chr551815 1379 778 746 235 ------
NM_022826chr251120 953 843 830 440 --1252 --
NM_022828chr551600 1263 700 514 67 1392 --1117
NM_022832chr4102099 1984 1615 840 776 748 421 335 254 187 --22394 481 --
NM_022840chr1841205 964 945 127 ------
NM_022841chr1542780 2731 928 356 ----1392
NM_022843chr1381466 1382 1213 1161 1017 1005 607 266 --11403 --
NM_022845chr1662256 2120 1544 822 617 264 1437 11919 --
NM_022893chr253010 2940 2756 2021 49 ------
NM_022894chr231287 1127 285 11251 ----
NM_022897chr52223 104 1865 ----
NM_022898chr14174568 4360 4296 3925 3775 3750 3581 3389 3357 1235 743 737 650 521 503 406 209 1672 11025 --
NM_022912chr241041 531 434 211 21113 362 12629 --
NM_022918chr11121890 1782 1577 834 802 762 624 521 397 167 122 104 11584 ----
NM_022965chr441385 1171 1097 571 ------
NM_022970chr1021240 554 --1588 --
NM_022977chrX62102 1749 1642 1071 1054 51 32342 1044 388 ----
NM_023000chr143692 451 396 --1313 --
NM_023001chr143692 451 396 --1313 --
NM_023012chr123777 253 233 ------
NM_023016chr292806 2749 2546 2515 2481 2438 792 632 395 22032 182 --1816
NM_023034chr83565 407 400 ------
NM_023076chr1632049 1844 377 ----1927
NM_023923chr163546 3526 3423 1112 1106 220 13800 ----
NM_023927chr561173 844 532 436 389 340 --1892 --
NM_023929chr8142846 2688 2616 2601 2423 2386 2280 2159 2110 1931 1765 1053 499 483 12839 ----
NM_024007chr5113158 3151 3024 2909 2438 2347 2070 789 581 319 88 1512 ----
NM_024052chr1752813 2698 2679 872 748 ----12831
NM_024063chr15------179
NM_024071chr141568 1210 ----
NM_024076chr19121 ------
NM_024077chr94762 704 641 81 --1628 --
NM_024312chr1231293 421 226 11527 ----
NM_024315chr72330 117 ------
NM_024345chr9175963 5899 5826 5372 5244 4790 4727 4511 4449 4215 4208 4163 1890 1448 636 604 515 45950 2175 1931 83 ----
NM_024408chr172825 2613 2477 2450 1310 1149 652 ------
NM_024416chr961576 1390 1344 534 457 350 11187 ----
NM_024424chr1131249 810 59 --1199 --
NM_024425chr1131249 810 59 --1199 --
NM_024426chr1131249 810 59 --1199 --
NM_024429chr72281 271 21044 208 ----
NM_024430chr1851611 1476 1196 681 269 1133 21886 1160 --
NM_024511chr4103097 3089 2989 2947 2411 2266 1258 926 493 41 2837 297 ----
NM_024520chr21112 ------
NM_024524chr3122915 2615 2061 1293 1236 1043 903 827 776 487 328 58 --2803 275 --
NM_024529chr14870 408 351 94 ------
NM_024539chrX3316 279 203 21106 244 ----
NM_024545chr22483 306 ------
NM_024546chr1331040 1018 192 --1428 --
NM_024548chr33303 285 171 1146 153 21718 524
NM_024556chr112462 403 ------
NM_024557chr11--1412 --11446
NM_024569chr182970 2875 2267 1034 590 462 386 346 22310 373 ----
NM_024582chr41797 --11028 --
NM_024585chr1731209 419 104 --1130 --
NM_024586chr12568 454 1502 ----
NM_024594chr531792 1735 603 1471 ----
NM_024612chr1751093 1078 804 750 318 2460 75 ----
NM_024613chr851656 663 474 318 250 ------
NM_024617chr93758 690 317 ------
NM_024624chr241643 1462 1405 600 21078 280 ----
NM_024630chr61546 ------
NM_024631chr113546 537 496 ------
NM_024636chr782934 2888 2791 2470 2279 2021 1869 932 21934 821 ----
NM_024639chr652854 2680 2577 1007 976 22864 893 --12279
NM_024646chr163876 3754 1344 1325 1263 1160 13430 2246 225 --
NM_024659chr21923 ------
NM_024665chr3164620 4582 4502 3730 3612 3349 3206 3190 3096 2984 1775 1424 1398 1358 554 547 --11703 13109
NM_024670chr1041437 1206 1151 583 --11270 --
NM_024674chr152885 2261 2225 451 326 ------
NM_024680chr112219 144 ------
NM_024692chr241836 1285 205 193 ----1528
NM_024702chr172254 90 ------
NM_024704chr2031101 412 395 ------
NM_024713chr1551633 1585 1299 126 35 11533 11154 --
NM_024721chr862209 2150 2058 1911 837 751 11830 ----
NM_024725chr115636 599 582 570 182 ------
NM_024744chr272513 2485 2095 1691 621 592 125 ------
NM_024749chr172244 1851 1422 722 658 400 297 12165 ----
NM_024751chr472090 2046 1862 1842 1807 1633 549 ------
NM_024755chr153623 379 186 --1750 --
NM_024761chr985071 5020 4132 3576 1980 1366 1182 949 15168 1490 14161
NM_024763chr141025 449 203 149 2156 97 ----
NM_024770chr2106078 5585 5571 5024 4845 4282 1742 1601 611 555 15437 ----
NM_024772chr12409 55 ------
NM_024780chr161204 ------
NM_024785chr211118 1607 --1372
NM_024806chr111218 ------
NM_024812chr862165 2110 1595 490 436 411 --11719 --
NM_024814chr72298 61 ------
NM_024817chr1575413 4863 4314 3971 2128 2076 500 --11655 21758 1608
NM_024824chr144415 158 111 46 --11638 --
NM_024828chr941042 174 126 26 11202 ----
NM_024830chr562188 1778 1677 1622 845 483 11916 --1605
NM_024837chr1551858 1714 758 458 36 --11933 1490
NM_024841chr1172418 2332 1992 1723 963 696 554 2791 561 ----
NM_024847chr1671270 992 962 936 889 444 274 11083 ----
NM_024852chr12586 262 1552 ----
NM_024884chr14104419 3861 3623 3606 1415 1342 1100 920 333 105 33774 1739 938 ----
NM_024909chr621637 130 ------
NM_024913chr761558 1269 1094 669 449 361 31749 1480 1180 ----
NM_024920chr45985 506 295 218 194 --2389 27 --
NM_024930chr5102512 2424 1845 713 588 575 503 242 233 93 11972 ----
NM_024941chr541327 1193 357 27 1238 ----
NM_024944chr2161302 1102 469 337 330 321 ------
NM_024945chr92888 121 ----1769
NM_024947chr3419493 9352 9318 9160 8991 8879 8831 8512 8417 8228 8044 7742 7477 6421 6348 6232 5921 3828 3794 3347 2746 2725 2715 2682 2578 2518 2329 2194 2031 1659 1647 1638 1564 1529 1412 1125 934 916 332 264 180 26219 2101 --26011 506
NM_024948chr103645 235 134 ------
NM_024949chr4134933 4817 4793 3838 3728 3363 1846 1298 1059 588 150 132 28 ------
NM_024953chr12112829 2669 2657 2590 2092 1721 1013 778 467 299 145 ------
NM_024979chr133430 420 410 11145 21181 312 --
NM_024989chr2207502 6173 6000 5859 5603 5413 5191 4948 2973 2845 2530 2354 2243 1949 1928 1793 1661 1328 670 388 26962 1159 25779 1176 --
NM_024991chr1032876 2257 69 ----1795
NM_024993chr251312 1284 642 481 315 21453 1298 ----
NM_024997chr16136 --1342 --
NM_025027chr1941121 953 737 85 --2303 180 --
NM_025040chr1952028 983 745 537 220 ------
NM_025047chr32328 174 ------
NM_025054chr894083 3932 3718 3567 3289 2850 1661 1077 168 33259 2758 942 ----
NM_025065chr12116 84 ------
NM_025073chr1194707 4653 4296 4210 4038 3267 3116 1665 1453 1312 907 812 747 563 376 293 275 239 232 --11840 --
NM_025074chr4102843 2780 2722 2671 2654 2474 1948 1107 838 593 ------
NM_025076chr23512 467 252 ------
NM_025126chr122720 643 ------
NM_025134chr1672397 2133 1969 907 803 643 112 ----1144
NM_025138chr1351494 1084 1063 571 244 ------
NM_025146chr352524 2398 321 162 91 ----1730
NM_025147chr22310 66 181 31108 987 54 --
NM_025151chr872089 1941 1757 367 349 183 46 ----1607
NM_025154chr751477 1279 1148 966 501 21175 458 1430 --
NM_025160chr1124087 4044 3719 3439 3332 2973 1466 1405 1346 1309 990 628 23615 1240 ----
NM_025181chr26802 618 340 227 168 88 ------
NM_025187chr1611045 ------
NM_025191chr183055 2702 2651 2480 2468 2458 2443 2173 23185 2936 ----
NM_025195chr831560 1342 391 1741 ----
NM_025208chr1152378 2345 2082 2044 857 ------
NM_025211chr91243 ------
NM_025212chr42112 23 ------
NM_025221chr43437 309 189 --2167 78 --
NM_025222chr331073 534 117 12872 --12007
NM_025234chr151144 ------
NM_025235chr1071903 1409 894 790 495 281 203 42037 1776 852 468 ----
NM_025237chr171315 ------
NM_025238chr1551508 1237 1193 296 249 1476 ----
NM_025248chr1743214 1126 324 216 --1869 --
NM_030579chr16113199 3029 2528 1378 994 938 805 719 670 589 410 13648 ----
NM_030621chr1493854 3671 3226 3168 2813 1133 735 619 201 ------
NM_030623chr251291 1238 1135 521 500 ------
NM_030625chr1062138 2001 1820 789 250 50 31995 1040 332 --12612
NM_030627chr594166 3975 3730 2732 1475 625 484 385 25 --13769 11124
NM_030629chr1621695 1313 --21934 198 --
NM_030636chr782097 2007 906 675 486 439 243 95 ------
NM_030637chr145721 572 166 101 83 ------
NM_030647chr7236248 5645 5561 5278 5257 5088 5056 4835 4566 4423 4074 2365 2356 2152 1719 1693 1408 1084 878 775 369 304 150 15729 25943 2400 14979
NM_030648chr4155015 4101 4050 3895 2234 1756 1651 1645 1264 1201 1037 894 477 345 334 23765 1869 25290 4371 11372
NM_030650chr2103730 3633 2812 1590 1539 1251 985 654 442 67 13897 --1249
NM_030652chr61277 ------
NM_030660chr1451423 1338 1332 583 412 --31062 440 112 --
NM_030674chr12145561 5555 5406 4847 4295 3872 1957 1857 1047 953 928 808 258 224 35815 5735 415 14728 --
NM_030751chr1061458 1367 564 245 234 69 11358 21351 1265 --
NM_030751chr1061458 1367 564 245 234 69 11358 21351 1265 --
NM_030755chr1482959 2925 1940 1219 738 697 517 462 3837 486 350 12298 --
NM_030762chr1241719 1248 605 510 --1318 1545
NM_030766chr121133 ------
NM_030771chr11126 ------
NM_030773chr2021736 1407 11842 ----
NM_030780chr841609 1443 1303 1130 11206 ----
NM_030791chr1491731 1702 1454 1395 1283 1266 1187 572 177 21250 626 ----
NM_030799chr551990 1797 1779 1671 1553 21542 1497 ----
NM_030803chr251317 1246 1030 992 927 ------
NM_030806chr1126511 6430 5799 3685 2268 1868 1816 1808 1130 988 958 251 --37698 6816 1376 11648
NM_030809chr1272416 2160 1903 1779 1700 1655 934 --1812 --
NM_030816chr193407 1381 1372 1001 923 738 479 421 168 33271 1346 630 23287 89 --
NM_030817chr12103671 3445 3193 2955 2795 2534 2310 1149 313 209 32729 2689 2670 ----
NM_030820chr64919 830 377 302 1683 ----
NM_030881chr2271762 1514 963 666 515 326 153 ------
NM_030885chr3132158 1888 1842 1686 1671 923 762 444 390 366 298 266 104 --1524 --
NM_030915chr272265 2210 1906 808 763 575 569 ------
NM_030917chr41158 ------
NM_030918chr1105454 5376 5288 5210 1309 1286 1096 868 694 443 25267 882 1547 1769
NM_030920chr192006 1961 1929 1748 1299 745 313 286 204 1428 ----
NM_030922chr154771 760 314 248 ------
NM_030925chr1331948 460 190 168 --1855
NM_030934chr1111898 1717 1520 1480 1354 565 548 331 283 124 86 --11803 --
NM_030938chr173790 363 282 --1723 --
NM_030939chr621110 1072 ----183
NM_030964chr553124 2447 1254 212 88 23663 287 ----
NM_030966chr172167 21 --142 --
NM_030979chr131308 ------
NM_031216chr1851881 1857 1609 1382 426 ----11893
NM_031217chr114456 213 68 47 --1133 --
NM_031243chr71347 21575 710 --1719
NM_031244chr631103 925 277 ------
NM_031262chr92726 142 ------
NM_031263chr92783 199 ------
NM_031266chr52364 357 ------
NM_031268chr1664610 4406 4035 3997 3690 1637 --24937 1921 --
NM_031283chr21891 --1571 --
NM_031292chr1281367 1196 1170 641 277 240 118 111 ------
NM_031296chr452416 2137 960 437 192 21776 606 ----
NM_031305chr481747 1551 1528 1500 1258 611 338 236 ------
NM_031314chr1471526 1324 1262 338 236 179 73 --11753 --
NM_031365chr232338 225 95 1560 12695 --
NM_031366chr232338 225 95 1560 12695 --
NM_031371chr151397 1077 632 425 273 ------
NM_031371chr151397 1077 632 425 273 ------
NM_031412chr1221081 157 --11049 --
NM_031418chr1172818 2623 2555 2535 2417 1053 702 12403 --12703
NM_031427chr14125875 5299 4489 3752 3685 3676 2233 1945 1875 1426 355 336 21417 216 11852 15044
NM_031431chr1351805 1673 1330 1170 422 ------
NM_031435chr1222201 1035 22168 46 12333 --
NM_031438chr561740 1695 458 420 338 135 11445 --1696
NM_031442chrX52562 2496 2242 2083 167 1180 ----
NM_031445chr273094 2832 1204 1196 984 657 447 ------
NM_031453chr1062505 878 636 516 380 95 ----1790
NM_031461chr821913 105 1211 ----
NM_031463chr1641893 763 682 236 1342 ----
NM_031468chr766040 5063 1314 1201 1156 399 11644 17584 --
NM_031469chr6104091 3749 3056 3038 2849 2649 1412 1025 817 568 42909 1363 1138 1085 ----
NM_031476chr1682823 2778 2574 2228 1043 988 447 58 ------
NM_031483chr20113517 3471 3389 3151 3098 3062 2875 1302 1115 659 493 --13358 22603 336
NM_031844chr173707 3325 2954 1634 1276 331 244 1126 --11421
NM_031845chr2103646 3430 3377 3224 1070 1012 965 666 415 300 1891 ----
NM_031847chr2103646 3430 3377 3224 1070 1012 965 666 415 300 1891 ----
NM_031858chr175373 310 254 229 190 ------
NM_031862chr175373 310 254 229 190 ------
NM_031866chr101963 ------
NM_031889chr461944 1929 1795 1677 347 203 ------
NM_031890chr2232550 794 113 --1368 --
NM_031911chr4102754 2702 2674 2661 2284 2267 2240 732 448 345 12155 ----
NM_031922chr64542 470 367 158 ------
NM_031935chr161068 1055 999 760 737 162 1402 ----
NM_031940chr842224 1618 679 548 --12483 --
NM_031942chr241202 932 289 68 1406 1971 --
NM_031966chr55568 528 483 109 87 ------
NM_031989chr123330 301 114 ------
NM_031992chr751764 1673 562 411 167 ----11590
NM_032027chr12263 85 ------
NM_032028chr53621 597 113 --1676 --
NM_032042chr592732 2541 1971 1943 807 780 624 618 461 21822 739 11093 --
NM_032047chr362157 2000 1554 810 628 26 11718 --21699 650
NM_032050chr222732 187 ------
NM_032052chr2241117 1037 988 572 1308 ----
NM_032102chr1141257 539 517 349 --11161 12905
NM_032116chr13255738 5227 5171 5069 4665 4636 4622 4241 3756 2228 2037 1888 1797 1711 1701 1373 1192 1037 1016 940 929 761 399 295 93 11553 13667 --
NM_032121chrX82847 2687 2318 2025 1895 818 303 112 ------
NM_032124chr183950 254 192 2923 356 ----
NM_032128chr42877 80 11050 1927 1264
NM_032131chr65591 245 124 110 83 ------
NM_032138chr131464 ------
NM_032144chr261771 1383 1135 659 598 75 11292 11160 --
NM_032145chr661799 1639 1549 410 265 236 --1474 --
NM_032146chr3133 ------
NM_032147chr125858 404 336 240 186 ------
NM_032153chr342203 692 292 204 --1816 --
NM_032160chr1894209 3787 3523 3231 3005 2901 743 495 411 24022 713 ----
NM_032189chr1394973 4936 1979 1926 1905 1778 1493 1287 560 11870 11329 --
NM_032195chr212531 513 ------
NM_032199chr1092663 2471 2431 1521 1393 1309 1123 480 422 23039 1133 ----
NM_032205chr8----2143 78 --
NM_032208chr253272 3069 2916 2698 2405 ------
NM_032213chr211222 --1863 --
NM_032217chr451105 1070 1035 299 36 1370 ----
NM_032221chr2041917 1840 1522 1512 1631 ----
NM_032226chr95782 696 286 128 31 ------
NM_032228chr11112887 2823 2649 2231 1273 1190 920 622 510 478 458 ------
NM_032233chr142882 862 --1200 --
NM_032239chr441345 1246 479 179 --1946 --
NM_032256chr122828 224 ------
NM_032281chr1943171 3140 2434 299 ------
NM_032283chr121822 114 ------
NM_032287chr2264135 4094 3943 3826 3696 2587 ------
NM_032288chr362181 2009 1880 1772 1695 595 1355 --1548
NM_032291chr13653 285 137 21536 582 ----
NM_032303chr951256 1238 525 379 331 ------
NM_032312chr21692 ------
NM_032320chr112784 273 1293 1326 --
NM_032321chr2113208 2982 2465 2417 2082 1257 1099 1006 797 733 206 13023 22754 1077 --
NM_032329chr274298 4100 3467 2941 602 221 77 12712 11024 --
NM_032343chr31197 ------
NM_032358chr123702 254 205 ------
NM_032368chr1169 ------
NM_032373chr10144914 4880 4694 2182 1897 1798 1328 1312 1242 1038 781 390 374 108 35328 5054 962 --14949
NM_032410chr84871 441 167 71 --1199 --
NM_032429chr102604 589 ------
NM_032433chr193203 178 95 ------
NM_032434chr241496 1404 1320 1025 --31525 187 91 --
NM_032435chr152415 2083 894 875 95 ------
NM_032438chr661442 1024 656 381 361 183 ----1392
NM_032439chr1051484 1089 1056 199 164 ------
NM_032440chr1082729 2489 2283 2076 912 877 471 182 12573 --1394
NM_032446chr563828 3147 2476 1118 1043 84 2656 229 13788 --
NM_032449chr162849 2303 2283 1799 252 46 12921 ----
NM_032457chr482673 2556 1465 1093 996 671 395 322 43267 1210 793 465 13030 13654
NM_032458chrX133460 3410 3378 2998 2945 2754 2742 2172 1303 875 772 395 325 33068 3060 1275 ----
NM_032466chr841487 639 376 164 1186 31248 609 290 --
NM_032468chr841487 639 376 164 1186 31248 609 290 --
NM_032482chr1922780 909 2917 196 ----
NM_032499chr1561514 1313 1221 1091 674 352 1705 ----
NM_032505chr372346 1065 788 657 502 370 180 21839 86 22093 577 --
NM_032509chr862409 2200 2193 1688 1031 439 12342 ----
NM_032510chr1892448 2374 2344 2214 1918 1757 1560 1526 830 ------
NM_032517chr101138 ------
NM_032523chr2------1148
NM_032539chrX1338 --1582 --
NM_032552chr931874 287 46 ----1572
NM_032557chr44718 214 95 88 ------
NM_032558chr961464 1357 998 558 412 362 ------
NM_032569chr1641792 1574 806 117 ----21933 1500
NM_032581chr741651 1426 778 82 --11709 --
NM_032582chr1731635 1275 528 11543 1219 --
NM_032603chr21151 ------
NM_032622chr471587 1343 1318 634 534 420 200 1446 1465 11541
NM_032623chr44281 155 68 23 --1370 --
NM_032632chr1491995 1924 1896 1579 1467 431 415 385 374 1409 ----
NM_032663chr1291951 1876 691 648 589 467 461 375 305 ------
NM_032682chr343325 2351 842 116 43080 2215 1375 1014 1317 --
NM_032711chr1754329 3425 3078 2732 743 23213 3105 --1821
NM_032737chr1942618 952 565 212 22625 823 ----
NM_032741chr62894 845 ------
NM_032778chr383302 3291 3046 2971 2054 2026 1219 806 ------
NM_032780chr1111190 ------
NM_032784chr61338 ----1201
NM_032793chr11372 ------
NM_032796chrX1130 1291 ----
NM_032801chr1152052 1768 1668 990 981 --11974 --
NM_032804chr1062570 2347 2209 2168 566 465 ------
NM_032810chr1051419 1286 1159 1041 243 ------
NM_032811chr1161712 1586 771 510 214 179 11655 ----
NM_032833chr1102130 2030 1774 1045 992 451 364 313 251 59 1103 ----
NM_032837chr1762090 1995 1756 1617 360 116 11645 --1648
NM_032842chr761534 1480 557 382 322 233 2400 225 ----
NM_032859chr13133950 3498 3372 3112 2860 1532 1452 1130 908 816 424 199 189 --1212 168
NM_032864chr151598 1523 1501 616 103 ------
NM_032866chr1553203 3035 2746 2605 1147 11954 ----
NM_032870chr62457 227 --1504 --
NM_032871chr1111480 ------
NM_032873chr1153882 3110 1758 473 126 11624 14530 --
NM_032880chr1155 ------
NM_032892chr151301 ------
NM_032895chr171797 ------
NM_032900chr1073901 3839 3230 2725 2539 2495 530 ------
NM_032905chr102398 188 ------
NM_032918chr1261178 1158 284 175 155 61 ------
NM_032926chrX2182 169 ------
NM_032932chr1795637 5519 5375 4629 2267 2165 726 498 395 52555 2510 2493 1944 998 ----
NM_032933chr1841364 1311 1301 450 2654 491 1403 --
NM_032961chr461380 1374 1276 974 471 71 1127 ----
NM_032968chrX134233 3819 3608 3547 3480 3406 3207 3133 2717 1494 1157 637 495 129 13856 --
NM_032969chrX134233 3819 3608 3547 3480 3406 3207 3133 2717 1494 1157 637 495 129 13856 --
NM_032973chrY144225 3811 3600 3543 3476 3402 3202 3128 2712 1494 1387 1157 637 495 129 13848 --
NM_032978chr1841010 485 283 113 1243 --1205
NM_032979chr1841010 485 283 113 1243 --1205
NM_032981chr1841010 485 283 113 1243 --1205
NM_032982chr782375 2358 2118 859 700 414 371 245 ------
NM_032983chr783189 3172 2932 2183 1228 1185 1059 348 ------
NM_032991chr43304 264 29 2498 462 ----
NM_032993chr41259 ------
NM_032998chr121104 969 ------
NM_033014chr961576 1390 1344 534 457 350 11187 ----
NM_033020chr1194865 4711 4274 4204 4020 3987 3776 3590 3359 3142 3117 3065 1883 1872 1494 696 422 142 82 23951 1568 ----
NM_033030chr2101601 1556 1461 1180 1162 446 437 398 322 184 21499 593 ----
NM_033044chr151219 1054 979 526 163 1809 1344 --
NM_033055chr141039 899 717 50 --1846 --
NM_033056chr104680 615 599 271 ------
NM_033081chr2051154 1080 1070 536 374 1260 ----
NM_033089chr204528 357 241 161 --11412 --
NM_033121chr1231816 1491 385 1606 ----
NM_033132chr1362137 2030 2019 2004 1885 648 11597 ----
NM_033135chr1152378 2345 2082 2044 857 ------
NM_033138chr782222 2056 2027 880 620 558 121 114 2676 485 ----
NM_033139chr782222 2056 2027 880 620 558 121 114 2676 485 ----
NM_033140chr782222 2056 2027 880 620 558 121 114 2676 485 ----
NM_033143chr4153938 3723 3569 3546 3350 3317 3178 2833 1522 992 891 799 649 212 24 1610 13426 --
NM_033157chr782222 2056 2027 880 620 558 121 114 2676 485 ----
NM_033181chr672620 2456 1495 1165 751 511 346 13475 ----
NM_033211chr551513 1383 846 766 254 1543 ----
NM_033221chr952288 1857 1046 628 282 ----12810
NM_033222chr961433 1287 1261 422 272 52 ------
NM_033224chr7197025 6997 6771 6118 5477 5452 3143 2357 2351 2239 2159 2040 1836 1625 1506 1471 1449 1231 794 36418 4876 1974 ----
NM_033225chr883065 2723 2562 1155 1092 340 312 202 23226 1067 --11260
NM_033272chr22319 43 ------
NM_033274chr542575 2196 1007 748 --42983 2271 480 473 --
NM_033285chr8164474 4199 3976 3909 3854 3751 3381 2981 2750 1666 1622 1110 1005 374 347 341 1219 11712 --
NM_033290chrX73458 3431 2679 1511 862 809 161 --1272 --
NM_033326chr112991 165 2436 357 ----
NM_033331chr943316 3057 2500 1366 22825 914 ----
NM_033338chr1041248 480 459 108 21154 174 11196 --
NM_033339chr1041248 480 459 108 21154 174 11196 --
NM_033340chr1031364 575 224 21270 290 11312 --
NM_033343chr12117 77 ------
NM_033360chr12154562 4545 4297 4120 3847 3677 2845 1498 1348 1149 992 790 524 251 206 23940 3863 23010 1666 --
NM_033364chr321954 163 ------
NM_033380chrX21007 386 ------
NM_033381chrX21007 386 ------
NM_033389chr1794658 3972 3963 3587 3501 3170 1773 292 148 1257 --13182
NM_033393chr452911 2792 2251 1949 342 11978 ----
NM_033419chr1721631 94 --1606 --
NM_033425chr1173417 3371 3230 3115 2141 1353 923 --22243 1029 --
NM_033426chr1472845 2618 2544 2251 1952 880 627 11910 141 --
NM_033427chr72236 97 ------
NM_033429chr1583071 2667 2654 2572 1319 236 164 76 23128 3083 ----
NM_033430chr4124048 3967 3886 3447 3284 3104 3042 1509 861 687 399 372 24037 166 ----
NM_033437chr4124048 3967 3886 3447 3284 3104 3042 1509 861 687 399 372 24037 166 ----
NM_033480chr662227 1969 1203 537 325 183 22570 1086 --11173
NM_033481chr662227 1969 1203 537 325 183 22570 1086 --11173
NM_033505chr2136781 6646 4326 2628 2601 2201 2009 1431 1258 1251 1173 946 381 1344 25342 2394 24465 2517
NM_033512chr852786 2640 2504 2305 708 12395 ----
NM_033515chr621301 256 --11206 --
NM_033516chr981417 1333 1305 1265 1163 641 361 322 ------
NM_033535chr451184 417 252 219 53 1838 1991 --
NM_033540chr341051 843 389 351 ------
NM_033550chr2091952 1914 1813 891 730 611 501 300 43 --2635 562 --
NM_033632chr441618 1499 1034 376 ------
NM_033644chr591947 1796 1785 670 609 564 462 456 25 ------
NM_033645chr591947 1796 1785 670 609 564 462 456 25 ------
NM_033656chr21155838 5236 4952 4824 4414 4385 4127 3751 1933 1857 1055 746 642 568 321 44444 1750 1508 1393 12152 --
NM_052811chr13135160 5081 5050 4961 4013 3647 3261 2113 2004 948 913 897 541 35206 4488 4314 24592 3331 14852
NM_052821chr921965 326 ------
NM_052832chr8122957 2907 2889 2594 2542 2000 1213 1100 1080 617 443 241 2898 815 ----
NM_052840chr1531079 596 316 ------
NM_052860chr53991 774 214 ------
NM_052877chr12401 51 ------
NM_052879chr12114077 3834 3677 3629 3484 3015 2985 2900 1503 1303 1046 2997 800 ----
NM_052885chr12144646 4566 4425 3888 3702 3655 3276 3187 3155 1668 987 755 679 514 24318 3420 ----
NM_052896chr132362 694 466 12432 ----
NM_052898chr851819 1206 736 683 657 ----11186
NM_052900chr871799 1385 1319 1215 459 148 95 ----1634
NM_052904chr631173 578 212 11199 ----
NM_052905chr231884 414 162 ------
NM_052907chr1264264 4183 4027 3854 550 372 34242 3613 1437 --13564
NM_052911chr186984 947 746 729 206 137 ------
NM_052913chr651161 869 294 238 52 ------
NM_052917chr232062 966 943 1907 2993 109 --
NM_052918chr1053481 1285 603 560 339 13239 ----
NM_052923chr61173 ------
NM_052927chr572078 2012 1381 834 735 714 391 --11785 11760
NM_052937chr872101 2061 1961 731 222 179 93 ------
NM_052940chr12205 186 ------
NM_052954chr2182154 1726 1684 1532 664 540 441 322 ------
NM_052965chr14914 498 135 74 --1830 --
NM_053001chr81395 1276 ----
NM_053002chr32963 98 ------
NM_053016chr9158042 7802 7754 7253 6428 6345 5095 5082 5066 2542 1756 1267 1165 1106 902 26996 6937 15775 --
NM_053023chr1193254 3170 2637 2279 2172 1103 1034 369 362 1590 12427 --
NM_053025chr331518 1497 1162 1274 ----
NM_053026chr331518 1497 1162 1274 ----
NM_053027chr331518 1497 1162 1274 ----
NM_053028chr331518 1497 1162 1274 ----
NM_053031chr331518 1497 1162 1274 ----
NM_053032chr331518 1497 1162 1274 ----
NM_053042chr4142714 2457 2380 2360 2093 1203 931 670 638 611 586 524 326 265 12467 136 --
NM_053043chr7196292 5950 5727 5393 5354 5279 5191 5084 5072 4792 4715 4407 4395 4234 4028 1274 1264 379 267