TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4777-3p
miRNA Sequence: AUACCUCAUCUAGAAUGCUGUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_002130chr54345 53 46 35 ----21701 489
NM_014155chr1145589 2559 1439 150 ----26414 4582
NM_015020chr164753 550 438 167 11431 148 33588 2691 1074
NM_198859chr3--13922 14254 33927 3175 1680