TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4777-5p
miRNA Sequence: UUCUAGAUGAGAGAUAUAUAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51916 ------
NM_000037chr811920 12395 ----
NM_000038chr521446 359 21490 139 ----
NM_000052chrX43335 2136 592 481 43061 2236 884 489 12123 --
NM_000084chrX86387 5722 4759 2366 2347 986 551 501 31872 954 164 25048 647 --
NM_000097chr31830 1441 ----
NM_000104chr212224 129 12268 11923
NM_000110chr1--11166 ----
NM_000112chr594648 4485 4313 3418 1950 1557 1340 462 28 55486 3982 2231 1652 1639 45542 4674 4190 3537 11002
NM_000115chr1332471 1942 1863 ------
NM_000125chr693889 3307 2956 2795 2755 1395 1002 565 127 --13552 --
NM_000151chr1721931 480 21560 1552 ----
NM_000153chr1421119 31 ----11077
NM_000161chr1431547 1502 437 1149 31581 738 699 --
NM_000163chr512128 --1558 21456 820
NM_000168chr743111 2665 2388 186 1336 ----
NM_000176chr552788 1575 1532 542 385 13463 --11240
NM_000183chr21466 ------
NM_000202chrX53152 2800 2581 1377 380 --13947 --
NM_000210chr241970 1882 1838 46 ------
NM_000217chr1244781 4484 3846 291 24629 3612 ----
NM_000222chr431815 1426 495 --21618 1348 11640
NM_000245chr712120 11581 --1415
NM_000248chr3--21192 155 ----
NM_000252chrX1586 1150 1266 --
NM_000259chr1546152 4895 1955 824 36160 6022 2112 11347 --
NM_000267chr1752989 2506 2386 1017 226 --11377 11392
NM_000332chr687077 6190 4365 2380 2206 2189 2163 1664 12278 ----
NM_000337chr534148 2291 55 14366 1385 16597
NM_000345chr4--1703 ----
NM_000346chr172787 504 11741 ----
NM_000390chrX22874 562 33101 929 899 1480 --
NM_000393chr231915 1881 705 ----11342
NM_000397chrX42330 1692 980 346 1280 --1746
NM_000411chr2132398 443 213 12374 163 151
NM_000430chr1773019 2830 2627 1354 483 118 40 21251 209 13289 --
NM_000439chr532024 552 256 --1582 1589
NM_000447chr1--1434 ----
NM_000448chr1142686 2271 1276 1112 --3993 851 836 1723
NM_000462chr1511662 11733 ----
NM_000484chr211260 ------
NM_000489chrX42749 2175 1174 353 ------
NM_000522chr711002 1965 1519 1366
NM_000531chrX----1243 --
NM_000544chr6_cox_hap122757 536 23012 1068 1318 --
NM_000555chrX77712 5670 5534 5071 4777 2193 449 45268 2026 1094 788 --17423
NM_000598chr7--1144 ----
NM_000609chr101191 ------
NM_000618chr1264814 2421 1833 1761 843 634 15242 --15083
NM_000618chr1264814 2421 1833 1761 843 634 15242 --15083
NM_000633chr1865238 4200 3721 3574 3352 1853 31678 1089 874 14583 --
NM_000681chr1021281 1034 ------
NM_000745chr153253 96 31 ------
NM_000756chr8135 ------
NM_000761chr15--11347 ----
NM_000788chr421106 583 31341 996 91 ----
NM_000806chr551664 1590 1234 672 166 ------
NM_000809chr477494 7442 5722 3727 3498 1798 1521 39243 1555 761 46661 3588 1196 877 --
NM_000813chr551865 1779 848 828 660 --1642 --
NM_000814chr1523524 878 --11461 21128 945
NM_000816chr51593 ------
NM_000817chr211212 ------
NM_000831chr186191 5673 5091 4306 4243 1701 1593 1439 36317 5270 718 24169 2006 25064 4350
NM_000834chr122460 424 1912 11149 --
NM_000838chr61722 ------
NM_000840chr74398 182 172 34 1114 ----
NM_000868chrX31906 982 173 ------
NM_000875chr1576955 6104 5629 4719 4588 888 521 15383 15054 16517
NM_000885chr232017 660 464 --12151 31686 1654 874
NM_000895chr12125 ------
NM_000899chr1243229 1117 984 103 13579 14152 2478 278
NM_000912chr873223 3052 1273 1029 944 220 121 12879 159 11397
NM_000919chr51579 ------
NM_000921chr12----176 --
NM_000922chr112985 832 ------
NM_000935chr31311 31276 836 826 ----
NM_000950chrX73196 3045 2851 2761 2656 2254 1126 13317 ----
NM_000959chr163868 3783 3298 2801 749 443 33086 2649 1382 23537 3264 23759 584
NM_000962chr92465 24 2475 315 12877 2157 131
NM_000963chr11952 32486 2295 1941 ----
NM_001001323chr1222062 1142 11948 --12501
NM_001001395chr1232589 2396 384 21133 729 11788 --
NM_001001419chr531702 584 53 24859 3964 13643 --
NM_001001420chr531702 584 53 24859 3964 13643 --
NM_001001433chr2042724 984 560 421 1285 1641 --
NM_001001481chr843240 2870 2410 1180 ------
NM_001001664chr222741 951 13022 ----
NM_001001668chr1963643 3634 3556 1450 377 256 --23855 91 --
NM_001001890chr21104101 3808 3752 3664 3188 1704 1315 1135 1033 342 ------
NM_001001938chr934117 4048 2706 32630 1244 478 33005 1042 572 13423
NM_001001971chr101340 ------
NM_001002257chr222444 2172 23435 2393 --1346
NM_001002838chrX21421 121 11451 1429 --
NM_001002860chr1464541 4214 3761 3547 2850 966 24178 4025 ----
NM_001002909chr1741563 421 304 153 ------
NM_001002919chr21454 ------
NM_001003652chr1867733 7193 5903 3206 1318 916 68310 7085 6076 3221 2944 196 1407 1516
NM_001003679chr142086 593 499 464 ----1160
NM_001003688chr42781 419 126 ----
NM_001003694chr31664 ------
NM_001003712chr1232545 915 844 ----23631 3574
NM_001003810chr41791 1661 1671 --
NM_001004065chr9103940 3887 3281 2792 2717 2525 1549 908 807 190 13310 ----
NM_001004304chr1233239 2159 1006 ----12238
NM_001004316chr31282 ------
NM_001004317chr694244 3832 3804 3578 3440 2861 1456 1173 607 --24404 4275 13406
NM_001004419chr1273109 3037 1498 1377 1270 524 73 1106 --11002
NM_001005353chr11923 11261 ----
NM_001005353chr11923 11261 ----
NM_001005375chrY1106 21520 60 --3710 542 274
NM_001005386chr222320 892 12310 1267 22422 2060
NM_001005404chr1734150 3477 102 24008 3891 24097 3335 --
NM_001005473chr546510 6414 5544 5065 34678 2652 1642 15225 --
NM_001005476chr21199 ------
NM_001005861chr32318 188 2794 142 ----
NM_001006118chrY1228 ------
NM_001006120chrY1228 ------
NM_001006612chrX1118 ------
NM_001006613chrX1118 ------
NM_001006614chrX1118 ------
NM_001006618chr91171 ------
NM_001007067chr8------1426
NM_001007068chr8------1426
NM_001007069chr8------1426
NM_001007070chr8------1426
NM_001007097chr984246 4188 4138 3851 3233 1624 1519 116 24069 913 ----
NM_001007246chr2131663 364 128 ------
NM_001007267chr2--2775 593 ----
NM_001007466chr644096 446 172 21 15073 --11081
NM_001007526chrY1228 ------
NM_001008391chr111286 ----1648
NM_001008408chr745449 4479 4114 1842 15033 ----
NM_001008541chr1021641 1597 11869 ----
NM_001008541chr1021641 1597 11869 ----
NM_001008707chr1431849 1264 369 ------
NM_001008708chr2--1245 ----
NM_001008738chr522936 96 12209 ----
NM_001009552chr83213 197 174 ------
NM_001009881chr11167 ------
NM_001009882chr11167 ------
NM_001009899chr375513 5259 5193 4049 862 703 566 15714 15134 1448
NM_001009958chr7--1250 ----
NM_001010846chr144463 3182 830 535 33505 1091 630 11707 14354
NM_001010853chr622372 862 ------
NM_001010861chr142526 2442 1881 766 1536 --11909
NM_001010862chrX42860 2356 2024 1004 23032 567 ----
NM_001010891chr545605 1387 906 731 56449 4602 2208 1685 453 ----
NM_001010895chr91139 ------
NM_001010908chr101575 --1782 1740
NM_001010971chr1153 ------
NM_001010984chr152477 2231 2008 1861 1679 --12209 12575
NM_001010986chrX32308 1798 85 --11874 --
NM_001011513chr473923 3808 3638 3611 3167 3037 74 1308 13425 --
NM_001011515chr42989 747 1730 ----
NM_001011516chr42989 747 1730 ----
NM_001011537chr33849 648 355 21846 1758 12335 21784 883
NM_001011546chr202121 78 ------
NM_001011553chr74936 822 619 181 1348 1678 --
NM_001011657chrX1358 11191 --163
NM_001011666chr766285 6098 5770 5655 4357 2257 36169 5872 76 25637 1803 35679 4637 4051
NM_001011708chr212493 ------
NM_001011713chr14192 ------
NM_001011885chr1541240 1164 249 208 ------
NM_001012393chr1175007 4850 4440 3894 1151 790 115 ------
NM_001012418chr644209 3123 2608 1403 --1411 --
NM_001012420chr151996 12593 21156 535 12182
NM_001012421chr92822 634 --150 --
NM_001012423chr151996 12593 21156 535 12182
NM_001012614chr4--2499 274 --1509
NM_001012761chr562630 2208 2102 2095 859 728 12379 ----
NM_001012989chrX--2646 460 1494 --
NM_001013398chr7--1144 ----
NM_001013620chr12148260 8200 5660 3367 2737 2699 2649 2615 1902 1620 1097 864 816 596 37892 7102 5469 11082 --
NM_001014380chr1364864 4186 3979 3730 1178 743 1496 --1314
NM_001014797chr10127158 6789 6469 6178 6157 6110 5745 4966 2609 1652 1544 1225 47541 7397 5876 3070 16882 25380 2371
NM_001014972chr2--1214 ----
NM_001015877chrX72951 2879 2582 2536 1122 327 303 32731 1096 946 --12281
NM_001015882chr9--169 ----
NM_001017395chr31176 --1287 1129
NM_001017424chr1--21835 1817 ----
NM_001017425chr1--21835 1817 ----
NM_001017923chr1421404 474 --11439 11196
NM_001018004chr15----1639 --
NM_001018006chr15----1639 --
NM_001018007chr15----1639 --
NM_001018020chr15----1639 --
NM_001018065chr955025 3983 2077 328 297 12211 --14980
NM_001018066chr955025 3983 2077 328 297 12211 --14980
NM_001018067chr195211 4669 4482 4392 4258 1983 1831 1761 1514 34977 1440 1352 14988 2384 211
NM_001018068chr195211 4669 4482 4392 4258 1983 1831 1761 1514 34977 1440 1352 14988 2384 211
NM_001018069chr195211 4669 4482 4392 4258 1983 1831 1761 1514 34977 1440 1352 14988 2384 211
NM_001018074chr552788 1575 1532 542 385 13463 --11240
NM_001018075chr552788 1575 1532 542 385 13463 --11240
NM_001018076chr552788 1575 1532 542 385 13463 --11240
NM_001018077chr552788 1575 1532 542 385 13463 --11240
NM_001023567chr1511004 ------
NM_001024094chr552788 1575 1532 542 385 13463 --11240
NM_001024660chr32636 432 11433 ----
NM_001024934chr61453 ------
NM_001024935chr61453 ------
NM_001024936chr61453 ------
NM_001024948chr193131 3083 3000 2523 917 791 784 621 488 22824 433 ----
NM_001024956chr1175737 5359 4326 2086 1445 704 617 11224 25303 780 15670
NM_001025076chr1053807 1987 505 220 185 21825 855 11019 11460
NM_001025077chr1085165 5007 1863 1578 1543 1100 982 955 44619 2213 997 672 22377 698 25096 2818
NM_001025079chr3104087 3136 3033 1453 1230 957 797 669 330 187 --12780 --
NM_001025252chr8102829 2692 2047 1148 926 853 668 632 219 109 --12539 42161 2143 860 334
NM_001025253chr8102829 2692 2047 1148 926 853 668 632 219 109 --12539 42161 2143 860 334
NM_001025580chrX83898 1470 1229 1160 1091 866 209 75 13083 --23396 928
NM_001025595chr4----1596 --
NM_001029858chr623175 3092 1629 --12608
NM_001029859chr1132329 2195 598 1680 ----
NM_001029875chr552707 2072 1889 963 546 11062 ----
NM_001029882chr1--1281 ----
NM_001029882chr1--1281 ----
NM_001029883chr242917 2514 1945 230 1672 --11169
NM_001029884chr632534 2134 269 ----12687
NM_001029989chr152222 98 130 1111 --
NM_001030055chr14114768 4663 4457 3657 3609 3484 2959 1836 1497 852 816 --150 1965
NM_001031716chr21226 ------
NM_001031732chr433093 2389 1050 12685 ----
NM_001031748chr12--1238 ----
NM_001031804chr1674159 3780 3536 3456 2937 531 81 34005 3918 1117 ----
NM_001032282chr81477 1820 ----
NM_001032283chr122821 687 2846 238 ----
NM_001032284chr122821 687 2846 238 ----
NM_001032293chr17--1250 2487 241 --
NM_001032296chr1312202 ------
NM_001032393chrX--1663 1738 1303
NM_001032730chr12678 229 1692 ----
NM_001033030chr3189 ------
NM_001033031chr3189 ------
NM_001033032chr3189 ------
NM_001033045chr234235 723 553 23779 2795 22867 2812 --
NM_001033057chr321619 74 ------
NM_001033503chr52389 119 1370 ----
NM_001033506chr11--1118 ----
NM_001033557chr21512 21419 1260 ----
NM_001033578chr822173 2007 ------
NM_001033602chr131500 --1364 --
NM_001034841chr1655150 5007 527 364 303 25176 893 ----
NM_001034954chr1032513 2215 751 2888 796 ----
NM_001034955chr1032513 2215 751 2888 796 ----
NM_001034956chr1032513 2215 751 2888 796 ----
NM_001034957chr1032513 2215 751 2888 796 ----
NM_001035505chr2----179 --
NM_001035512chr132156 180 108 --1779 1627
NM_001035513chr132156 180 108 --1779 1627
NM_001037131chr2----11086 --
NM_001037164chr731720 749 583 2697 550 ----
NM_001037172chr32998 954 ------
NM_001037317chr142526 2442 1881 766 1536 --11909
NM_001037334chr1822001 77 22189 723 11943 --
NM_001037535chrX41390 1030 447 40 11372 2564 23 --
NM_001037536chrX41390 1030 447 40 11372 2564 23 --
NM_001037540chrX41390 1030 447 40 11372 2564 23 --
NM_001037954chr1153208 1016 739 626 175 12437 1218 1337
NM_001039538chr263586 2917 2899 2695 891 36 ----12667
NM_001039569chr222803 316 1575 ----
NM_001039577chr131789 791 97 23438 366 11526 21736 745
NM_001039580chr494940 4753 4024 3511 1909 1817 1400 990 823 --43401 1234 403 354 --
NM_001039585chr164125 4040 3555 3058 1006 700 33343 2906 1639 23794 3521 24016 841
NM_001039590chrX64022 3827 3516 2872 653 581 --13916 13261
NM_001039591chrX64022 3827 3516 2872 653 581 --13916 13261
NM_001039618chr1184558 4520 4166 4110 3990 3848 3611 1327 22334 2170 ----
NM_001039762chr1022089 634 138 ----
NM_001039840chrX65770 5714 5375 1434 1215 366 25352 429 24632 1031 12163
NM_001039937chr1344117 3156 1473 945 ------
NM_001040020chr751292 1250 1191 640 244 ------
NM_001040092chr82309 172 ------
NM_001040100chr341085 268 203 64 1311 ----
NM_001040101chr441358 1229 244 92 --1394 --
NM_001040142chr21640 ------
NM_001040143chr21640 ------
NM_001040152chr765147 4536 4186 3572 3341 1305 14312 14825 24687 875
NM_001040284chr1675681 5467 5210 4750 3851 3805 1883 11988 13864 15536
NM_001040424chr213483 405 59 22717 183 12195 --
NM_001040429chr1372959 2880 2785 2508 2467 2193 769 13591 13523 13030
NM_001040441chr154816 4175 3534 463 83 --11422 --
NM_001040450chr152563 367 22351 884 22657 615 --
NM_001040453chr152563 367 22351 884 22657 615 --
NM_001040665chr784622 3659 3170 1809 1560 1228 1143 220 --21189 478 --
NM_001040712chr942992 997 501 21 ----12264
NM_001042355chr16105351 5326 4998 4537 4312 3509 3280 1094 914 694 45076 4104 929 202 34085 2084 1932 --
NM_001042406chr62439 281 21243 966 11151 --
NM_001042412chr16105351 5326 4998 4537 4312 3509 3280 1094 914 694 45076 4104 929 202 34085 2084 1932 --
NM_001042440chr521835 24 31943 420 119 --11646
NM_001042441chr521835 24 31943 420 119 --11646
NM_001042442chr521835 24 31943 420 119 --11646
NM_001042443chr521835 24 31943 420 119 --11646
NM_001042444chr521835 24 31943 420 119 --11646
NM_001042445chr521835 24 31943 420 119 --11646
NM_001042446chr521835 24 31943 420 119 --11646
NM_001042459chr31224 ------
NM_001042492chr1752989 2506 2386 1017 226 --11377 11392
NM_001042555chr1264506 2924 1628 1408 812 295 --11599 --
NM_001042599chr276478 6390 5454 3055 2791 1879 439 35370 2551 2261 22296 1771 12051
NM_001042604chr354456 3663 3162 1840 555 21132 635 13475 --
NM_001042616chr4182 ------
NM_001044385chr283819 3001 2789 1296 642 501 370 191 24064 313 ----
NM_001046chr552720 1208 923 894 479 --1905 1843
NM_001099678chr3106387 6160 5399 5132 4549 4460 2380 671 509 188 35271 3964 1591 --12540
NM_001100108chr155910 3186 3000 2741 2476 57102 6980 2838 2441 1799 12935 --
NM_001106chr3149366 8531 7537 7392 7320 7112 7097 6962 6449 5941 3808 3005 1735 1604 39607 9080 3058 --19758
NM_001115chr8--186 ----
NM_001117chr1832379 2257 2109 12326 ----
NM_001121chr1031563 1214 700 1646 ----
NM_001122679chr51916 ------
NM_001123chr101307 --1132 --
NM_001135chr151250 ------
NM_001144chr16--11263 ----
NM_001149chr1021070 186 ------
NM_001160chr1242051 2039 1078 556 ------
NM_001167chrX86719 6466 4570 4393 2510 2408 2304 476 22606 903 25235 325 --
NM_001173chr14114768 4663 4457 3657 3609 3484 2959 1836 1497 852 816 --150 1965
NM_001174chrX31674 381 318 31745 1734 1517 ----
NM_001200chr202834 245 149 ----
NM_001201chr423824 2558 22624 281 ----
NM_001204chr296574 6565 6294 6268 6107 3081 2839 1928 165 ------
NM_001206chr922933 2766 12749 --11150
NM_001237chr411015 ------
NM_001237chr411015 ------
NM_001241chr241719 738 602 177 1388 12047 --
NM_001241chr241719 738 602 177 1388 12047 --
NM_001254chr171826 --146 --
NM_001256chr1752707 2134 1810 436 181 12536 11867 --
NM_001259chr7115880 5843 5353 5052 4846 4104 4000 2476 2038 728 128 12415 1103 --
NM_001269chr1----1969 --
NM_001270chr541083 952 329 27 2929 764 ----
NM_001271chr1533077 2902 2308 13291 183 --
NM_001326chr11--1175 ----
NM_001328chr4--2499 274 --1509
NM_001329chr1031470 1145 109 ------
NM_001331chr1132848 477 24 1874 12395 --
NM_001332chr541537 1170 427 92 1160 ----
NM_001351chr3--11494 --1179
NM_001356chrX32425 1765 325 11677 --1646
NM_001358chr4--2359 280 ----
NM_001364chr1131557 1175 324 --14269 143
NM_001390chr1843149 1323 856 786 22512 1458 ----
NM_001391chr182243 146 1206 ----
NM_001401chr921199 271 2620 543 1284 --
NM_001412chrX42460 2391 1457 1196 13584 23695 3289 --
NM_001415chrX--11900 11744 --
NM_001417chr123479 307 237 ------
NM_001418chr111221 ------
NM_001418chr111221 ------
NM_001451chr1621068 509 1386 ----
NM_001482chr151735 --1860 --
NM_001527chr664430 4230 3284 3212 1543 429 ----14721
NM_001530chr14--21020 89 ----
NM_001546chr6--1351 11373 --
NM_001609chr1021367 493 --23479 3165 23962 792
NM_001616chr242796 2745 2394 1410 12227 11329 --
NM_001621chr772823 2784 2464 1879 1095 781 770 2580 162 12452 --
NM_001621chr772823 2784 2464 1879 1095 781 770 2580 162 12452 --
NM_001656chr52453 97 11382 ----
NM_001681chr122694 217 ------
NM_001682chr1231776 1053 856 ----12215
NM_001695chr883993 3895 3773 3244 1246 968 808 390 11101 13567 --
NM_001699chr1981576 1514 1320 1272 1250 306 290 268 21463 1132 ----
NM_001709chr1121764 410 11013 12188 --
NM_001718chr6--21316 993 --11200
NM_001721chrX194 ----1136
NM_001723chr61211 ------
NM_001742chr741677 1452 1408 390 1189 1624 --
NM_001750chr521835 24 31943 420 119 --11646
NM_001754chr21104101 3808 3752 3664 3188 1704 1315 1135 1033 342 ------
NM_001755chr1642046 1951 483 455 ------
NM_001777chr3104087 3136 3033 1453 1230 957 797 669 330 187 --12780 --
NM_001788chr74936 822 619 181 1348 1678 --
NM_001798chr1211123 ------
NM_001806chr1952068 659 265 188 24 --12323 --
NM_001839chr12636 28 ------
NM_001854chr11129 ------
NM_001858chr654977 3799 3760 3341 582 33912 1491 1310 11342 --
NM_001873chr4172 ------
NM_001880chr2129 ------
NM_001895chr203877 347 290 ------
NM_001903chr5--1185 1787 --
NM_001918chr177618 6160 3557 3381 3096 2781 948 13638 19225 12883
NM_001941chr1821111 41 11487 23134 1080 12883
NM_001942chr1821468 42 ----1113
NM_001950chr16----1658 1679
NM_001963chr4------1547
NM_001967chr31197 1436 ----
NM_001981chr11690 1321 2680 674 --
NM_001982chr12154 21275 787 ----
NM_001999chr52499 471 11087 1167 --
NM_002006chr423853 1475 3878 305 55 23834 1914 14407
NM_002009chr1542483 2215 1087 218 52417 2366 2358 2325 2265 ----
NM_002015chr1352698 2503 2434 1182 1088 22445 2091 ----
NM_002017chr1121288 410 --11164 --
NM_002025chrX109043 8318 7655 7243 6761 3068 2741 2441 2198 850 26617 881 27603 1070 16113
NM_002033chr1154012 3189 3056 1165 418 13847 ----
NM_002039chr43861 596 89 --1152 --
NM_002040chr2152065 633 411 101 47 2352 187 ----
NM_002089chr4--1182 ----
NM_002092chr423405 858 84871 4738 4368 3451 1729 921 624 171 11897 --
NM_002094chr161346 ------
NM_002128chr131172 12219 22178 1874 --
NM_002136chr121133 ------
NM_002137chr742063 786 719 710 ------
NM_002138chr41791 1661 1671 --
NM_002154chr5------1223
NM_002163chr16----1513 --
NM_002165chr20----1411 --
NM_002190chr6------1449
NM_002203chr543665 3048 1172 601 21561 858 ----
NM_002239chr23765 256 39 21063 305 --1890
NM_002264chr331846 1581 444 23561 1598 --24056 164
NM_002267chr1332065 1489 673 31775 300 219 ----
NM_002310chr596432 5513 5282 4298 1612 1300 928 561 460 24595 4238 12112 --
NM_002312chr13136 ----2326 292
NM_002336chr1254784 4086 1268 723 355 44016 3987 687 551 23774 68 14431
NM_002345chr121232 2524 485 ----
NM_002374chr263586 2917 2899 2695 891 36 ----12667
NM_002376chr14180 ------
NM_002387chr565020 4807 4399 3680 3154 946 31976 1609 403 ----
NM_002392chr12----157 --
NM_002444chrX42028 519 510 435 ------
NM_002467chr81126 1433 ----
NM_002469chr12299 73 ------
NM_002500chr2------11284
NM_002501chr1952688 2620 1284 1252 535 ------
NM_002515chr1441441 1433 808 345 --21862 1834 --
NM_002545chr1175007 4850 4440 3894 1151 790 115 ------
NM_002546chr81672 1502 1211 --
NM_002556chr11--12055 --1426
NM_002577chr343393 3285 3159 2931 43730 2838 828 663 ----
NM_002581chr965029 1748 1697 1488 608 390 45160 4450 3491 794 1316 --
NM_002583chr12----1493 --
NM_002588chr51616 ------
NM_002594chr2021724 514 ------
NM_002595chr122604 484 21477 728 ----
NM_002603chr8--145 ----
NM_002610chr222850 2499 22635 2206 ----
NM_002618chr2139 ------
NM_002623chr202686 224 1632 --1287
NM_002655chr864311 3542 3332 386 369 315 21655 1092 1918 --
NM_002670chr311596 11388 --11028
NM_002706chr2--2702 543 ----
NM_002709chr233045 967 583 11356 12672 --
NM_002710chr121138 ------
NM_002715chr521295 344 1189 ----
NM_002720chr161261 ------
NM_002731chr132365 2088 970 13089 11963 --
NM_002734chr1721903 1622 12175 2867 393 --
NM_002745chr2273993 3637 2884 2767 1697 1502 992 1663 ----
NM_002748chr151107 ------
NM_002822chr12--2513 301 11304 11541
NM_002836chr20--1107 ----
NM_002837chr1224349 3740 11744 1126 24022 1596
NM_002839chr942992 997 501 21 ----12264
NM_002886chr364947 4830 4076 4012 1810 1293 --25094 4265 15046
NM_002890chr51941 --1679 --
NM_002892chr1411477 11110 11084 1494
NM_002902chr15--1466 ----
NM_002906chr1121775 758 21464 929 --1847
NM_002912chr6------1853
NM_002956chr1241316 1084 1045 194 11183 1395 1127
NM_002958chr32318 188 2794 142 ----
NM_002970chrX--141 ----
NM_002973chr121192 ------
NM_002994chr451833 1814 792 668 60 1561 ----
NM_002998chr821984 505 1166 ----
NM_003001chr132156 180 108 --1779 1627
NM_003010chr1741965 1841 470 317 126 --22463 908
NM_003022chrX--11314 ----
NM_003036chr1------1968
NM_003042chr322130 1737 11673 12250 --
NM_003043chr334287 4241 3962 11461 13161 --
NM_003051chr13626 581 309 1302 ----
NM_003071chr3--31997 75 50 187 --
NM_003079chr172278 137 --1248 --
NM_003095chr122248 39 ------
NM_003099chr1566499 5050 4730 1094 953 169 36200 536 454 24126 3990 --
NM_003106chr31736 --2422 328 --
NM_003108chr297042 6895 6744 6305 5988 4732 1714 522 317 1477 --15518
NM_003112chr712173 12645 12521 22969 63
NM_003113chr21192 ------
NM_003114chr8----1533 1227
NM_003133chr12343 153 ------
NM_003139chr11174 ------
NM_003144chr632014 782 771 1297 ----
NM_003155chr842647 2606 2552 828 1359 ----
NM_003157chr32760 45 --1601 2902 289
NM_003161chr1723566 1292 ------
NM_003183chr21201 1624 --1571
NM_003185chr201450 ------
NM_003199chr1854826 3928 3695 3572 670 ------
NM_003201chr1021034 117 1854 ----
NM_003217chr1211607 11789 ----
NM_003234chr342168 1655 710 51 1241 ----
NM_003236chr233195 2861 1337 43318 2406 2260 1046 --12685
NM_003257chr1521336 90 ------
NM_003262chr335229 1799 837 --1781 --
NM_003286chr2011058 ------
NM_003298chr375374 5183 4957 4363 4029 3939 1702 1783 --1258
NM_003300chr14125 ------
NM_003317chr141126 ------
NM_003320chr1174432 4423 3980 2763 1743 1529 1145 33300 1105 1002 13380 --
NM_003337chr53667 631 342 1136 ----
NM_003338chr1011848 --146 11243
NM_003340chr4--1205 ----
NM_003341chr31438 --1261 --
NM_003344chr731487 1160 157 11629 ----
NM_003360chr4164 1237 ----
NM_003374chr52768 63 ----1263
NM_003375chr10--1325 1147 --
NM_003387chr232581 2001 1829 32278 792 511 ----
NM_003392chr353365 2809 1528 1291 803 23289 84 23110 1493 --
NM_003400chr21204 ------
NM_003406chr83571 544 189 11876 ----
NM_003407chr191637 ------
NM_003409chr181217 2511 299 --1889
NM_003410chrX42174 1969 1910 1150 1673 --11990
NM_003413chrX21919 1298 11971 11232 11872
NM_003418chr3--1613 ----
NM_003457chr17--1250 2487 241 --
NM_003473chr101172 ------
NM_003474chr1092299 1969 1948 1469 820 795 583 462 337 --11662 --
NM_003478chr1123148 2224 12339 --22573 28
NM_003483chr122817 111 22392 507 ----
NM_003489chr2173077 2927 2536 2427 2236 1302 1077 --22544 967 --
NM_003506chr821214 1184 ----1919
NM_003517chr1139 ------
NM_003558chr92672 633 ------
NM_003566chr1243246 1312 700 217 1249 --1785
NM_003567chr1--124 ----
NM_003574chr1854887 4376 2024 1873 1309 21906 1398 24944 394 --
NM_003576chr1312202 ------
NM_003583chr12113636 3476 2935 2454 1300 1157 1102 995 839 467 252 ----22644 751
NM_003590chr263236 1532 1138 829 702 122 33846 3558 2818 --1301
NM_003618chr231052 482 176 132 ----
NM_003620chr17--1338 ----
NM_003626chr1111074 1192 ----
NM_003628chr21199 ------
NM_003629chr162897 2829 2537 1295 992 601 1187 12563 11318
NM_003630chr62648 178 ------
NM_003633chr542160 1774 667 253 11671 ----
NM_003645chr15----1177 --
NM_003663chr363295 1071 959 946 437 217 23434 1039 ----
NM_003668chr121127 ------
NM_003671chr942825 1013 914 245 32341 680 39 ----
NM_003672chr121479 667 1538 2415 57 --
NM_003692chr91935 ----2400 134
NM_003701chr1321009 356 1836 --1819
NM_003714chr543052 2718 2008 1241 ------
NM_003735chr51616 ------
NM_003736chr51616 ------
NM_003749chr1372395 2241 2069 1801 1535 537 418 11617 ----
NM_003759chr433903 1044 113 --23784 1208 11678
NM_003760chr11712 ------
NM_003763chr2042724 984 560 421 1285 1641 --
NM_003769chr12186 1325 ----
NM_003783chr12496 366 11186 ----
NM_003787chr1811225 11501 11648 --
NM_003800chr622254 2104 1392 12170 22150 360
NM_003816chr811371 1503 --1946
NM_003822chr123061 365 ------
NM_003825chr1531302 515 471 ------
NM_003829chr911113 1777 --1152
NM_003851chr121230 21 185 ----
NM_003860chr111352 ------
NM_003873chr1032227 2009 1827 11656 ----
NM_003877chr122243 86 1839 ----
NM_003902chr11225 ------
NM_003913chr6104219 3932 3847 3414 3362 3214 3177 3044 1718 156 --13054 13388
NM_003922chr151135 ------
NM_003924chr431474 1277 1221 1440 ----
NM_003930chr72430 395 --11990 155
NM_003931chr61453 ------
NM_003934chr91958 --1132 --
NM_003941chr761962 1757 1663 976 801 395 ------
NM_003953chr14941 718 664 174 ----1322
NM_003966chr577860 7313 7039 5822 2377 1922 1108 26307 335 25959 506 15722
NM_003968chr31256 ------
NM_003980chr621142 104 ------
NM_003983chr1663895 3517 3250 512 243 175 ------
NM_003994chr1243229 1117 984 103 13579 14152 2478 278
NM_004050chr1452573 2317 2195 518 371 12639 --1998
NM_004075chr122536 452 ------
NM_004080chr7--1448 ----
NM_004081chrY1106 21520 60 --3710 542 274
NM_004094chr1432866 814 571 11219 ----
NM_004096chr1011393 11938 ----
NM_004100chr6----1471 --
NM_004113chr331664 1462 797 11970 11793 1473
NM_004114chrX----21051 186 --
NM_004124chr1473176 3131 2601 2418 1269 704 476 23156 553 23384 720 --
NM_004156chr83213 197 174 ------
NM_004161chr21330 ----11149
NM_004162chr3--1406 ----
NM_004171chr11109234 8577 7055 6976 6640 6195 3753 3393 1953 489 48478 7646 2379 466 58090 7159 6542 3601 3363 12671
NM_004202chrY1621 --2678 259 --
NM_004229chrX42077 889 730 571 ------
NM_004232chr1863889 2600 2590 2361 1274 216 ----32952 744 528
NM_004234chr191150 ------
NM_004236chr151527 ------
NM_004274chr1462482 2361 2309 2258 1058 922 23194 398 22157 443 --
NM_004282chr62237 208 --1197 --
NM_004287chr1732472 2087 1649 ----12602
NM_004290chr5184 ------
NM_004293chr963708 3528 3127 2962 547 128 2982 566 --11224
NM_004311chr1043153 2794 1047 314 2985 141 13121 1752
NM_004331chr81443 2246 216 ----
NM_004342chr73763 676 174 11986 --1359
NM_004349chr821187 234 ------
NM_004362chr41108 ----1199
NM_004370chr622038 1966 1786 ----
NM_004397chr1193562 3484 2980 2920 2609 1532 1259 1225 496 11151 --13422
NM_004411chr71660 ------
NM_004415chr62745 688 ------
NM_004429chrX1108 ------
NM_004432chr921725 1473 --12072 1806
NM_004434chr1431849 1264 369 ------
NM_004437chr153534 3170 3104 1081 173 ----12216
NM_004438chr233150 3080 2649 22929 2142 --1767
NM_004440chr631733 1255 189 1458 ----
NM_004449chr211325 ------
NM_004456chr7------178
NM_004458chrX32603 2313 652 21946 61 --11826
NM_004501chr154027 3646 1614 1184 1151 43077 2920 1422 127 11031 --
NM_004505chr1731460 754 396 11862 11340 --
NM_004521chr101298 ------
NM_004543chr2165 ------
NM_004575chr411173 ------
NM_004593chr31783 ------
NM_004598chr542873 2088 625 549 22192 792 --13261
NM_004612chr954790 1877 1044 979 745 44452 3578 1850 1178 ----
NM_004627chr211109 1714 ----
NM_004634chr31664 ------
NM_004654chrY1552 11210 ----
NM_004660chrY42296 1697 1476 323 ------
NM_004661chr5--11130 1900 --
NM_004687chr1751631 1420 648 504 169 21486 238 --11528
NM_004713chr141711 ------
NM_004730chr511912 ------
NM_004734chr1352400 2388 2338 1093 204 22162 611 --1576
NM_004736chr142078 1619 1497 846 ------
NM_004738chr2072648 2452 2333 1610 1007 971 841 1191 12352 12371
NM_004744chr443345 1580 1441 116 --13900 --
NM_004745chr877066 6531 5201 4795 2075 1310 315 45021 4874 4765 2120 ----
NM_004757chr42628 115 ------
NM_004768chr1--1173 ----
NM_004772chr51132 --1400 --
NM_004776chr2032749 899 479 22641 1214 --12156
NM_004788chr1132189 1707 763 22166 241 1482 --
NM_004796chr1442099 1818 553 285 1747 --11878
NM_004799chr11291 ------
NM_004808chr1012830 263 22 --11317
NM_004827chr461619 1512 1284 779 564 246 41483 662 287 149 ----
NM_004831chr192929 814 ----1797
NM_004834chr243209 3011 2839 998 11162 ----
NM_004841chr12808 749 ------
NM_004856chr15--1467 1580 --
NM_004857chr1421293 194 23984 108 14129 --
NM_004859chr172804 365 42847 2641 2363 195 --13018
NM_004863chr1475140 3940 3387 2113 1177 1170 1083 15209 ----
NM_004866chr544895 3596 3560 359 24749 559 13701 13914
NM_004869chr18--11325 ----
NM_004872chr12408 353 ------
NM_004904chr766285 6098 5770 5655 4357 2257 36169 5872 76 25637 1803 35679 4637 4051
NM_004929chr841237 1126 540 402 ------
NM_004936chr932005 251 194 21190 604 --13055
NM_004956chr7103551 3181 3057 3020 2953 2883 1021 746 727 551 ----23414 846
NM_004958chr12890 759 1293 ----
NM_004969chr10------1402
NM_004985chr12104055 3855 3742 3507 3216 3009 1531 1324 482 373 23820 3343 14046 13545
NM_004992chrX87230 2835 2283 2016 1714 1575 1057 509 38305 2792 2373 16943 18037
NM_004992chrX87230 2835 2283 2016 1714 1575 1057 509 38305 2792 2373 16943 18037
NM_004993chr1411166 1488 122 21512 1095
NM_004999chr6104412 4275 4127 3825 3024 1759 1698 1255 1019 896 53444 1201 586 578 317 ----
NM_005006chr2----1923 --
NM_005025chr3169 ------
NM_005044chrX21555 1473 ----122
NM_005054chr241607 1370 1093 401 1319 ----
NM_005058chrY1228 ------
NM_005065chr1435262 1610 73 21907 261 24432 3536 --
NM_005066chr1149 ------
NM_005079chr8102829 2692 2047 1148 926 853 668 632 219 109 --12539 42161 2143 860 334
NM_005121chr1762724 1132 1120 1062 602 412 ------
NM_005151chr1822001 77 22189 723 11943 --
NM_005153chr16190 1231 --1794
NM_005156chr9--1964 13875 --
NM_005159chr1521684 1494 1439 11769 --
NM_005160chr2265913 5509 5498 4545 1857 381 22707 2067 36570 5184 2186 --
NM_005168chr261304 1176 1111 476 467 37 ------
NM_005180chr1031713 511 77 ------
NM_005188chr1187641 7509 7355 6268 5910 2263 1714 28 48238 7296 6310 594 15600 --
NM_005197chr1496047 5527 5517 4863 4749 4342 4042 3750 1355 11865 --12116
NM_005235chr276478 6390 5454 3055 2791 1879 439 35370 2551 2261 22296 1771 12051
NM_005238chr1152878 2778 2641 2337 1306 11323 --13341
NM_005245chr41141 1672 --1612
NM_005254chr1511287 2511 174 ----
NM_005256chr113699 603 323 2691 616 --1269
NM_005261chr83689 658 238 ------
NM_005302chr71183 ------
NM_005316chr1111113 2923 64 ----
NM_005339chr434071 3283 1114 12910 1124 --
NM_005358chr1341559 1316 304 136 11244 ----
NM_005359chr1874734 2587 2561 2424 1327 782 294 36300 2012 1956 --14027
NM_005375chr61147 ------
NM_005378chr21844 ------
NM_005384chr9------132
NM_005388chr961674 1652 1591 1482 1372 453 1579 --11395
NM_005402chr721525 624 ----2608 467
NM_005410chr5132 1330 ----
NM_005436chr1084047 3810 3417 3250 3139 2833 1131 484 23539 2846 23716 120 --
NM_005465chr131437 444 391 1413 ----
NM_005493chr61740 --183 --
NM_005502chr933001 1253 238 12019 --1994
NM_005504chr1296499 5664 5534 5246 4353 2574 2098 1777 1325 24556 2069 25948 1175 --
NM_005537chr131330 1217 1920 --
NM_005574chr112619 279 ------
NM_005587chr151937 ------
NM_005596chr986178 5963 5954 4779 4290 4113 1664 423 15247 ----
NM_005599chr141515 1398 1254 582 ----1425
NM_005610chr1128 ------
NM_005611chr1611022 1278 164 --
NM_005625chr8------1426
NM_005626chr11394 ------
NM_005655chr81477 1820 ----
NM_005665chr134446 3962 3116 33993 3421 285 11500 --
NM_005668chr534252 2970 1586 44147 1721 1337 538 ----
NM_005688chr33441 209 34 ------
NM_005711chr51970 --1902 --
NM_005717chr1--1854 ----
NM_005722chr222320 892 12310 1267 22422 2060
NM_005725chr11920 41635 675 578 231 --1365
NM_005738chr731720 749 583 2697 550 ----
NM_005739chr1521515 606 1346 --22148 948
NM_005746chr73814 667 249 ----22626 2119
NM_005748chr1233009 2301 705 33267 3068 850 --11200
NM_005759chr284592 3463 3324 3279 1791 1043 317 219 ----23817 951
NM_005765chrX1159 ----1306
NM_005780chr132747 708 ------
NM_005786chr1831068 289 115 ------
NM_005819chr123102 2511 13382 11391 12265
NM_005822chr652397 2058 883 435 219 --31922 869 558 1210
NM_005824chr71649 1749 --168
NM_005835chr61198 ------
NM_005839chr1185 ------
NM_005840chrX67679 7525 5960 5791 1951 1180 36475 5530 2162 27261 3046 16303
NM_005842chr131485 ------
NM_005853chr16--1579 ----
NM_005859chr5--1494 ----
NM_005871chr101902 ------
NM_005885chr521024 305 11296 --11384
NM_005896chr2--1116 ----
NM_005900chr42781 419 126 ----
NM_005901chr1867733 7193 5903 3206 1318 916 68310 7085 6076 3221 2944 196 1407 1516
NM_005903chr531702 584 53 24859 3964 13643 --
NM_005911chr21224 ------
NM_005930chr141193 ------
NM_005935chr435097 1141 261 65161 3829 3364 3243 1472 289 ----
NM_005962chr1021641 1597 11869 ----
NM_005962chr1021641 1597 11869 ----
NM_005977chr131875 --1382 --
NM_005994chr17----1694 --
NM_005999chr151221 1193 1098 418 69 --11506 11396
NM_006016chr671744 1440 1419 776 460 369 355 --22246 1546 --
NM_006022chr133861 724 703 ------
NM_006024chr71349 1614 ----
NM_006047chr2032870 789 295 33429 3338 2378 2991 209 13110
NM_006054chr1111488 ------
NM_006080chr712639 1825 ----
NM_006095chr42866 390 --21626 849 --
NM_006106chr1173369 2452 2362 2143 1339 1087 390 11131 --11044
NM_006107chr17------1443
NM_006136chr72555 428 11244 ----
NM_006139chr251971 1784 950 610 65 1569 ----
NM_006147chr1168 1388 ----
NM_006154chr1552398 1907 496 266 220 22649 2528 ----
NM_006186chr2------1245
NM_006197chr831987 504 175 2687 621 --1643
NM_006203chr564993 3843 2211 1866 1293 1100 24262 4120 15263 --
NM_006206chr43840 387 46 22790 2201 --1619
NM_006209chr82309 172 ------
NM_006212chr1154925 4466 3994 3774 3536 2064 1988 1975 1739 1732 1553 1304 802 718 510 21022 551 54213 3490 847 624 269 --
NM_006226chr24938 875 460 344 --11147 --
NM_006237chr13--1505 ----
NM_006241chr322180 446 22008 306 --11704
NM_006246chr142474 379 1832 11330 11221
NM_006251chr532998 473 281 12065 11247 13359
NM_006256chr122761 794 22388 2232 ----
NM_006267chr221220 595 21553 525 ----
NM_006275chr203825 409 269 1842 11594 --
NM_006298chr611073 32191 496 244 ----
NM_006300chr1922376 224 2295 198 ----
NM_006306chrX105839 5088 4797 1565 1226 732 171 122 61 30 24940 409 --11098
NM_006315chr431727 1511 1310 ----1494
NM_006329chr141514 1754 ----
NM_006335chr11132 ------
NM_006352chr141975 464 187 163 1138 11843 --
NM_006369chr11337 ------
NM_006379chr72785 766 22180 364 ----
NM_006390chr1241572 439 288 125 11412 ----
NM_006393chr1084304 3724 3480 3195 1200 1153 1000 219 43643 2923 1717 1189 --23635 546
NM_006407chr331197 1028 953 11385 ----
NM_006413chr1011301 --1211 --
NM_006420chr2032853 2673 2535 ----23118 2753
NM_006434chr1032513 2215 751 2888 796 ----
NM_006449chr222107 289 ----1172
NM_006451chr52426 53 1350 ----
NM_006457chr473923 3808 3638 3611 3167 3037 74 1308 13425 --
NM_006460chr172405 147 1229 ----
NM_006482chr12113636 3476 2935 2454 1300 1157 1102 995 839 467 252 ----22644 751
NM_006489chr1441441 1433 808 345 --21862 1834 --
NM_006502chr62239 134 ------
NM_006520chrX2628 481 ----1241
NM_006527chr4--1592 --1632
NM_006537chr151119 ------
NM_006544chr1455533 4291 4169 4110 2053 55480 4539 1641 1554 1275 25606 4341 21170 368
NM_006546chr1775223 4714 4337 2570 2517 2020 1160 15396 14580 --
NM_006558chr81349 ------
NM_006559chr11212 ------
NM_006561chr1053807 1987 505 220 185 21825 855 11019 11460
NM_006571chr81231 ------
NM_006572chr1732436 1372 575 --63534 3359 3106 2707 2508 2233 12864
NM_006575chr1431321 348 314 ------
NM_006584chr17142 130 ----
NM_006599chr1656568 1975 1622 1411 893 46291 6052 6036 2987 25014 954 15893
NM_006601chr122698 383 ------
NM_006609chr252461 2450 2009 1891 531 22248 1914 ----
NM_006614chr313151 11396 1256 --
NM_006620chr663588 1022 715 673 109 29 1852 24596 1467 --
NM_006624chr101521 185 11310 1359
NM_006625chr111100 ------
NM_006625chr111100 ------
NM_006625chr111100 ------
NM_006628chr1564369 4123 4072 1684 1663 1620 13767 ----
NM_006646chr1342311 983 486 284 32782 2010 1123 12300 --
NM_006654chr1264506 2924 1628 1408 812 295 --11599 --
NM_006682chr732686 2318 2004 168 ----
NM_006699chr13780 308 293 ----22096 1082
NM_006704chr13--1134 ----
NM_006717chr952704 2175 1178 767 755 11001 2932 681 13315
NM_006721chr101307 --1132 --
NM_006722chr3--21192 155 ----
NM_006729chrX74790 4533 4519 2244 1346 1229 626 1962 34398 2101 859 1559
NM_006746chrX41390 1030 447 40 11372 2564 23 --
NM_006750chr1677893 7338 7057 5211 1696 1494 331 47829 5509 2307 638 46478 6348 2860 1878 --
NM_006751chr2----1738 --
NM_006761chr171123 ------
NM_006766chr8--1149 1115 --
NM_006774chr771234 1210 1110 1075 1056 368 295 2188 157 ----
NM_006777chrX52498 2181 1044 602 459 31796 471 151 ----
NM_006828chr6----162 1252
NM_006851chr1231012 447 374 ------
NM_006870chr202121 78 ------
NM_006874chr4--1484 ----
NM_006888chr1441287 1211 1093 640 22272 36 ----
NM_006897chr121206 ------
NM_006908chr721168 235 ------
NM_006918chr1175737 5359 4326 2086 1445 704 617 11224 25303 780 15670
NM_006920chr221834 1631 11406 ----
NM_006922chr22751 584 2822 795 ----
NM_006924chr1752921 1081 1074 960 220 ----12784
NM_006931chr1221424 719 ------
NM_006948chr2152237 2134 982 287 280 21770 1673 1124 --
NM_006950chrX--2259 218 ----
NM_006951chr101623 --2744 531 2302 119
NM_006988chr21--1296 ----
NM_006996chr11714 21323 668 11287 --
NM_007006chr1623247 2427 --1661 13366
NM_007007chr1264744 4075 3747 3638 1753 775 23778 1461 13573 --
NM_007011chr1576538 5142 4477 1418 923 297 272 142 14326 22026 1504
NM_007026chr173526 487 376 ------
NM_007034chr12793 337 2664 417 ----
NM_007039chr1451639 1537 1418 411 294 12037 21611 689 --
NM_007050chr2097659 6723 4934 2649 2593 2283 1861 1605 516 25782 5423 11256 --
NM_007054chr553439 3337 2997 336 289 ------
NM_007064chr32636 432 11433 ----
NM_007084chr1341394 1258 1129 1004 11303 ----
NM_007106chr1332586 1952 722 --22316 2176 1423
NM_007112chr1137 ------
NM_007114chr313203 --1715 13069
NM_007125chrY11258 ------
NM_007137chrX65177 4474 3851 1991 1435 1355 ----1516
NM_007157chrX52766 2070 993 926 67 12861 ----
NM_007172chr2232738 2650 1003 23004 1082 12487 11333
NM_007187chr13----1104 --
NM_007195chr1863588 3565 3441 3003 1144 480 --13632 13493
NM_007203chr9103940 3887 3281 2792 2717 2525 1549 908 807 190 13310 ----
NM_007231chrX21710 205 149 --1681
NM_007236chr1562349 2076 2021 1906 770 29 ------
NM_007246chr43940 263 78 ------
NM_007249chr13108709 8469 7819 7629 6467 6157 2740 2529 2386 1832 37643 7000 2472 ----
NM_007308chr4--1703 ----
NM_007324chr11291 ------
NM_007350chr1223582 3199 54498 1079 1020 606 268 13337 23087 1628
NM_007358chr131916 1348 437 21863 250 11751 --
NM_007373chr1021508 1417 --1550 2661 156
NM_007375chr112324 22011 160 ----
NM_012064chr12----11011 1826
NM_012069chrX32501 2327 389 22630 1082 --12128
NM_012081chr563232 3000 2736 2665 326 73 --12486 3743 591 479
NM_012090chr1--11150 ----
NM_012092chr221667 591 11376 --1140
NM_012096chr332645 795 421 23603 954 12710 12825
NM_012104chr1173485 3280 2964 1038 786 678 483 ------
NM_012104chr1173485 3280 2964 1038 786 678 483 ------
NM_012120chr622527 1118 1683 ----
NM_012137chr162540 2506 2176 1901 317 286 ------
NM_012141chr1344117 3156 1473 945 ------
NM_012158chr1311400 --11566 --
NM_012180chr41681 ------
NM_012183chr1----1409 --
NM_012214chr244939 4832 1736 990 26124 4751 34777 2486 2217 26018 5565
NM_012223chr21109 1493 ----
NM_012234chr343632 3501 586 152 22706 2519 23233 3041 1987
NM_012247chr101269 ------
NM_012249chr263208 2999 2846 2683 821 730 ------
NM_012287chr3104304 3825 3161 1825 1738 666 272 254 168 33 23383 1589 ----
NM_012294chr762703 2560 1023 541 476 408 23039 2617 --13103
NM_012297chr432554 1762 732 --1208 --
NM_012302chr121109 271 ----1949
NM_012304chr532041 2025 131 ----12565
NM_012309chr1154947 3326 3169 1659 370 44640 1641 1630 1190 ----
NM_012316chr195244 4610 4026 4010 3957 3513 1623 1332 174 11364 24204 3748 --
NM_012330chr1031832 1818 1354 ------
NM_012334chr564705 4587 3274 1491 1233 1024 2932 117 ----
NM_012343chr51282 ------
NM_012382chr584514 4305 3997 3863 3627 2915 924 78 --11582 --
NM_012416chr931202 1003 906 ------
NM_012420chr1022151 476 --1753 --
NM_012433chr2------1265
NM_012471chrX31426 1396 1321 127 11527 1792
NM_012486chr1--1434 ----
NM_013227chr151250 ------
NM_013229chr1242051 2039 1078 556 ------
NM_013231chr1411588 33660 868 855 33271 1037 967 --
NM_013233chr211364 1902 --1473
NM_013249chr11--1169 ----
NM_013255chr7177986 6520 6477 6052 5894 5660 3200 3160 2997 2887 2545 2447 2377 2132 1545 1248 828 38540 5775 530 17124 --
NM_013257chr822173 2007 ------
NM_013261chr433388 2689 803 13118 --22947 1260
NM_013269chr1263036 2964 1425 1304 1197 451 133 --1929
NM_013277chr121229 --1952 1363
NM_013293chr72494 125 ------
NM_013313chr2271123 1095 890 861 438 242 79 --12735 23035 1164
NM_013323chr1711191 ------
NM_013330chr1----141 --
NM_013341chr212493 ------
NM_013354chr81435 ------
NM_013374chr313043 1703 ----
NM_013390chr931689 1396 357 ------
NM_013396chr2121460 330 11522 ----
NM_013410chr11923 11261 ----
NM_013436chr22629 184 ------
NM_013448chr141541 ------
NM_013450chr21223 ------
NM_013937chr621145 374 --1819 --
NM_013943chr14686 513 461 272 32830 2195 735 --12920
NM_013995chrX52584 2470 777 294 88 31622 323 109 2999 655 --
NM_014005chr542816 2206 324 166 1407 2860 754 --
NM_014011chr212227 22642 488 ----
NM_014016chr3--11361 ----
NM_014021chr1103373 2938 2902 2738 2303 2280 2234 701 657 217 11070 1901 --
NM_014023chr101765 1557 ----
NM_014028chr642671 2050 1201 304 11150 ----
NM_014043chr311215 ----1154
NM_014048chr1654568 3733 880 289 71 13254 13992 --
NM_014055chr122213 159 1370 ----
NM_014106chr1552466 1148 356 302 195 1175 1635 --
NM_014112chr864704 3952 1127 726 687 522 34486 961 347 ----
NM_014117chr1632662 2541 153 32158 1849 1088 11841 --
NM_014141chr765080 1995 1094 594 307 249 12065 ----
NM_014155chr11137513 7098 5789 5524 4885 4871 2867 2798 2091 1857 1835 1716 1613 26296 5764 15535 26370 1379
NM_014157chr1663579 3480 3249 3071 650 248 11069 21131 639 --
NM_014213chr21140 ------
NM_014214chr18--1346 ----
NM_014217chr1--21835 1817 ----
NM_014223chr11772 ------
NM_014232chr1731594 1275 370 ------
NM_014232chr1731594 1275 370 ------
NM_014267chr111686 ----1702
NM_014283chr1--11352 ----
NM_014319chr121156 ------
NM_014326chr15--11247 ----
NM_014331chr487152 6972 4980 4850 1424 613 170 81 26786 1179 35701 1201 520 17091
NM_014333chr1142544 2130 556 268 12171 146 --
NM_014372chr131898 1331 1298 1169 1244 --
NM_014382chr3--1444 --158
NM_014392chr441358 1229 244 92 --1394 --
NM_014393chr842228 711 192 124 32135 829 491 --11493
NM_014394chr103341 314 172 1102 --11192
NM_014423chr5105471 5234 4966 4224 4216 3693 3470 2057 1903 390 34694 2007 784 ----
NM_014429chr32690 533 2673 160 1245 --
NM_014447chr4----1596 --
NM_014455chr1191 ------
NM_014456chr1031763 1200 378 1617 ----
NM_014469chr11----1532 --
NM_014470chr12185 ------
NM_014491chr71971 1224 ----
NM_014497chr2--1214 ----
NM_014547chr153829 521 219 ------
NM_014547chr153829 521 219 ------
NM_014548chr1541442 500 341 245 ------
NM_014554chr1231994 869 834 11792 --12286
NM_014572chr133584 380 247 1259 11546 --
NM_014574chr1431278 610 120 ------
NM_014575chr31498 ------
NM_014584chr1451204 602 451 436 32 21066 644 ----
NM_014586chr2154513 3895 3727 3453 1707 64590 4314 3771 1718 922 33 13530 11504
NM_014608chr153374 161 60 ------
NM_014612chr931234 1031 48 --159 --
NM_014616chr31845 11085 13325 23351 1401
NM_014635chr221585 365 1283 ----
NM_014636chr9--53887 3500 3286 1615 1419 --1744
NM_014660chr71767 ----11062
NM_014666chr521166 954 ------
NM_014671chr7----1186 --
NM_014686chr1911036 ------
NM_014701chr1512270 21217 1105 11154 --
NM_014702chr633206 2274 748 22526 1275 22933 350 --
NM_014705chr7174 1429 ----
NM_014711chr1642102 1872 841 790 --1112 --
NM_014720chr102269 116 1699 11535 11457
NM_014721chr697000 6748 6564 6361 6140 4972 4564 2248 510 25543 4769 17460 12333
NM_014730chr1284344 3683 3280 1788 1153 792 571 435 34138 3360 1642 --1560
NM_014730chr1284344 3683 3280 1788 1153 792 571 435 34138 3360 1642 --1560
NM_014736chr152247 123 155 1136 --
NM_014740chr17----167 --
NM_014743chr442528 2514 409 157 ------
NM_014746chr231755 471 348 24285 488 --21661 608
NM_014755chr233371 1442 479 1527 33115 2753 412 --
NM_014774chr153272 2714 2435 2372 545 2990 22 ----
NM_014781chr811082 1247 1819 --
NM_014783chr1531429 1349 1167 21195 718 --11241
NM_014793chr15----1615 --
NM_014802chr121190 ----1360
NM_014810chr173396 2709 2261 924 505 310 100 22690 2384 --11431
NM_014819chr541833 1784 694 158 1128 22356 1753 --
NM_014832chr1352087 1513 1440 828 812 21923 1686 1285 --
NM_014838chr2222023 954 31146 887 542 ----
NM_014839chr131712 832 503 11682 ----
NM_014841chr61931 ------
NM_014860chr242547 2479 1712 643 12106 1365 --
NM_014873chr184765 4157 3396 3355 3316 3304 1219 340 41556 1542 547 405 14822 --
NM_014877chr17107585 6312 5509 5490 5310 2261 1892 1112 847 573 15698 16588 --
NM_014888chr751292 1250 1191 640 244 ------
NM_014890chr31224 ------
NM_014893chrY22376 116 41926 1905 1759 936 ----
NM_014897chr1732811 2804 577 11181 --13063
NM_014904chr1033854 3041 401 21137 544 --23840 553
NM_014905chr241712 699 433 82 21271 393 ----
NM_014906chr17103888 3128 3017 2945 2683 1420 1206 974 744 385 1145 ----
NM_014914chr2----11086 --
NM_014918chr15----11463 --
NM_014923chr132454 94 21748 745 --1302
NM_014936chr621152 361 12425 ----
NM_014946chr242603 2293 658 110 ------
NM_014951chr1042621 2214 1067 301 2205 81 ----
NM_014962chr2062773 2554 1143 729 237 45 2716 681 --22339 481
NM_014965chr321692 739 --22339 1712 --
NM_014982chr1444459 4086 4055 1424 35216 5161 4413 11325 --
NM_014991chr463168 2778 2758 2506 2098 1227 22909 378 ----
NM_014997chr782765 2557 2433 2023 1860 1170 440 416 1362 --1120
NM_014999chr1211391 11202 ----
NM_015000chr1243053 2456 1983 437 32325 2190 983 ----
NM_015008chr31176 --1287 1129
NM_015009chr31559 ------
NM_015017chr12892 192 ------
NM_015018chr6123 ------
NM_015025chr21450 ------
NM_015026chr1274331 4258 3595 3229 3209 3048 909 14004 --11166
NM_015040chr283075 2793 2496 2219 967 765 685 137 ------
NM_015049chr223213 510 32857 2408 810 --13060
NM_015051chr963031 2541 2186 965 724 438 --22798 2219 --
NM_015068chr783999 3388 3038 2424 1320 1151 1082 157 13164 13677 13539
NM_015071chr546176 5515 4684 1509 35386 2188 1593 ----
NM_015076chr654088 1133 986 561 431 1384 14159 --
NM_015091chr14--1617 ----
NM_015092chr1653491 3211 1851 1384 692 14261 --14202
NM_015093chr621826 1276 --1560 --
NM_015094chr2231874 1832 893 ------
NM_015107chrX32436 1951 1597 22299 2137 ----
NM_015110chr962436 1852 1015 485 392 373 1956 ----
NM_015113chr172713 51 ------
NM_015120chr21300 2285 119 ----
NM_015129chrX2221 35 ------
NM_015137chr832228 822 494 22489 1007 ----
NM_015138chr1542226 1106 259 76 ------
NM_015156chr1443706 3369 1200 100 32693 1626 448 ----
NM_015170chr812025 12342 1135 1475
NM_015173chr42250 199 ------
NM_015191chr1112005 ------
NM_015192chr2022255 1864 --1963 --
NM_015200chr442380 2097 1686 419 11796 21892 316 --
NM_015206chr1533804 1539 607 32447 387 222 12386 --
NM_015208chr1823419 1591 13231 1884 --
NM_015213chr111163 ------
NM_015216chr52467 390 11230 --1152
NM_015225chr932580 2416 1949 --12999 --
NM_015231chr112597 256 ----1785
NM_015233chr131500 --1364 --
NM_015235chr1041815 1609 1383 855 1528 1872 --
NM_015236chr411259 21137 567 1413 11533
NM_015238chr51262 ------
NM_015239chr91354 1427 ----
NM_015245chr631975 351 331 ------
NM_015247chr16105351 5326 4998 4537 4312 3509 3280 1094 914 694 45076 4104 929 202 34085 2084 1932 --
NM_015251chr1642140 1615 306 50 22002 846 ----
NM_015263chr151248 ------
NM_015267chr1221370 333 1301 1531 11845
NM_015269chr11167 ------
NM_015271chr454018 3601 3504 1508 577 13785 ----
NM_015277chr1821176 695 --1382 --
NM_015278chr683383 2520 2410 813 542 497 85 26 12869 11141 --
NM_015285chr1861724 1646 1617 753 716 408 ------
NM_015286chr1531658 790 269 --1453 12437
NM_015291chr152739 2502 1115 362 107 1121 --1495
NM_015293chr62583 223 2546 453 ----
NM_015296chr1311147 ------
NM_015310chr897471 6196 6073 5389 2649 2320 1766 843 518 38413 7999 7983 12230 13328
NM_015313chr1134769 1783 425 43864 3062 1863 1375 --13714
NM_015338chr2041903 1383 1333 34 --11630 11759
NM_015339chr202909 846 --1688 --
NM_015349chr662771 2731 2425 2335 1892 459 12593 ----
NM_015361chr21590 ------
NM_015365chrX83898 1470 1229 1160 1091 866 209 75 13083 --23396 928
NM_015378chr152902 2853 428 274 198 11960 --1637
NM_015385chr1032513 2215 751 2888 796 ----
NM_015387chr241834 1748 408 66 ----11349
NM_015396chr31995 11163 --11007
NM_015409chr1262345 2324 2213 2181 2170 1752 31931 1090 1021 --21814 320
NM_015446chr1171 ----11111
NM_015455chr574042 4016 3451 3160 3010 2548 443 23780 2717 11461 --
NM_015457chr111700 ------
NM_015460chr31715 --11991 --
NM_015465chr51187 1634 ----
NM_015475chr22694 383 ------
NM_015477chr151895 ------
NM_015496chr82323 241 --298 81 1231
NM_015509chr121403 ------
NM_015525chr611080 11036 1905 1355
NM_015534chr13957 426 171 ------
NM_015541chr311120 ----11247
NM_015553chr644051 2039 462 276 --25118 1273 11441
NM_015554chr1552504 2295 1160 340 286 1793 --41947 1798 204 185
NM_015560chr342618 2591 974 724 ----1845
NM_015564chr5--12959 1778 33002 868 337
NM_015569chr164094 3586 1008 476 317 206 1756 14018 --
NM_015576chr342891 2445 2218 1887 --11843 --
NM_015578chr1921597 1546 ------
NM_015601chr103828 714 302 ------
NM_015607chr11148 ------
NM_015626chr17--1939 1252 --
NM_015640chr195211 4669 4482 4392 4258 1983 1831 1761 1514 34977 1440 1352 14988 2384 211
NM_015676chr14--1258 ----
NM_015697chr4--1287 1116 --
NM_015711chr191194 ----1822
NM_015713chr863359 2624 859 786 664 526 31319 803 794 13071 22748 541
NM_015878chr8123 --1194 1452
NM_015879chr1886706 5589 2780 2430 2096 895 203 170 36692 5692 5267 47729 7441 1776 1560 26360 1011
NM_015886chr8135572 4950 4873 4723 4635 4198 4080 1966 1168 1092 1010 951 152 --11792 22049 563
NM_015888chr163322 2994 2864 2506 882 686 12891 ----
NM_015891chr61328 11649 21990 1656 --
NM_015901chr101847 ------
NM_015905chr7134 1422 ----
NM_015967chr11822 2946 266 ----
NM_016018chr832051 495 430 --12348 --
NM_016025chr16--1441 ----
NM_016045chr201678 ------
NM_016048chr52778 177 ------
NM_016073chr152948 382 1290 ----
NM_016076chr162982 2385 2303 2173 475 83 12234 22921 233 --
NM_016083chr643972 3073 1047 775 1592 13593 161
NM_016089chr341570 1398 266 182 12130 ----
NM_016103chr52389 119 1370 ----
NM_016107chr5----1388 --
NM_016120chrX2985 388 ------
NM_016125chr17--1118 ----
NM_016127chr8--166 --1597
NM_016132chr1552933 2272 1254 673 452 ------
NM_016133chr2--11593 --11570
NM_016141chr31271 1163 --1597
NM_016206chr3148038 8015 7189 6544 5585 3086 2926 2657 2045 1686 1268 1230 1072 582 58347 7009 5533 2880 1258 35949 2336 2063 16982
NM_016217chr6103643 3283 3065 2529 2516 2477 2331 1444 386 294 ----12285
NM_016227chr1--11352 ----
NM_016231chr1731382 243 71 21318 200 --2459 155
NM_016255chr692878 2646 2587 2516 2443 1148 647 454 212 12526 --192
NM_016260chr287539 6976 6907 6164 5448 2683 2419 1201 46994 6599 6024 1383 ----
NM_016275chr342133 1846 1736 862 12475 12654 12206
NM_016303chrX1118 ------
NM_016308chr132055 1568 352 ------
NM_016315chr231844 1664 298 11580 1600 --
NM_016337chr141189 ------
NM_016396chr1562727 2569 2148 1945 934 556 1221 --1680
NM_016410chr9191 ------
NM_016413chr13--1448 ----
NM_016422chr1133159 2297 206 32777 720 344 22907 2610 --
NM_016424chr17------11948
NM_016436chr201124 22488 735 --22129 702
NM_016448chr131514 170 134 ------
NM_016451chr11140 ------
NM_016467chr2--11342 ----
NM_016470chr202522 57 ------
NM_016507chr1733074 1116 435 12091 ----
NM_016512chr81269 ------
NM_016519chr43525 511 219 ------
NM_016530chr15123786 3667 3575 3552 3301 3120 2922 2519 1381 1000 859 371 21164 1130 12990 --
NM_016531chr454245 4166 2848 2596 727 --1653 --
NM_016571chr6127 ------
NM_016578chr111540 1117 ----
NM_016607chrX21043 409 --11451 123
NM_016620chr11416 21054 946 1535 --
NM_016654chr1511287 2511 174 ----
NM_016824chr1031563 1214 700 1646 ----
NM_017420chr1463569 2971 2954 939 276 133 ------
NM_017437chr1421790 567 3742 385 279 --1408
NM_017447chr2153812 3121 1066 750 178 11305 --24093 4052
NM_017450chr17--11026 ----
NM_017528chr7--177 ----
NM_017563chr366235 5189 4514 4506 2339 2031 22441 820 16073 21647 461
NM_017599chr1252036 1494 737 591 365 1652 --22112 1526
NM_017610chr151205 1453 22049 692 1736
NM_017612chr121232 ------
NM_017628chr4105047 4790 4640 4121 3855 3801 3374 752 211 194 25076 4912 --13945
NM_017633chr652989 2559 1582 1568 1447 ----11107
NM_017637chr958801 8134 7866 7252 534 48853 6893 3004 2249 ----
NM_017643chr1732069 951 643 22210 434 ----
NM_017644chr394310 3518 3280 1956 1912 1502 1490 1343 411 21680 446 14967 --
NM_017650chr7115901 5521 4332 2357 2302 2019 1363 1099 732 522 117 1467 11541 --
NM_017654chr721435 1295 --1366 21645 1478
NM_017667chr71530 ------
NM_017672chr1531215 535 454 ------
NM_017686chr11243 --1794 11057
NM_017709chr164039 3743 1414 1027 618 76 31727 1357 1167 11443 --
NM_017712chr1945132 2232 2166 227 46317 6124 5559 1658 11754 24924 116
NM_017737chr171840 1792 1709 776 496 460 376 11533 ----
NM_017742chr1811690 11939 --21636 1268
NM_017754chr665010 4615 4260 3745 3513 1649 ----11786
NM_017761chr12231 24 ------
NM_017769chr1472195 2107 935 806 544 378 287 2756 510 ----
NM_017784chr321075 860 1801 ----
NM_017786chr81134 ------
NM_017798chr2021275 831 21243 939 21173 401 --
NM_017811chr942599 2407 956 336 ------
NM_017813chr844571 3770 2342 1077 15395 12246 11290
NM_017831chr1843520 3409 3384 530 --13493 21392 974
NM_017890chr821381 39 1736 --11625
NM_017922chr14--1253 --1603
NM_017944chr1143027 2067 1038 973 21009 611 12833 12931
NM_017964chr22952 57 1221 ----
NM_017988chr12------1718
NM_017994chr762525 2068 1964 865 303 284 22035 900 ----
NM_018010chr331442 1164 1085 1590 ----
NM_018014chr211006 ------
NM_018017chr1032858 2174 1976 32307 2247 1857 22533 2467 22516 715
NM_018028chr1911291 ------
NM_018030chr182724 400 11122 --1423
NM_018036chr1474281 4243 2743 2722 1184 627 492 11402 ----
NM_018046chr5--21921 439 1653 --
NM_018048chr1261829 1394 1364 1348 478 318 --21622 699 --
NM_018061chr11585 21754 1523 ----
NM_018063chr102428 45 ------
NM_018084chr242429 1097 441 427 --13160 12754
NM_018085chr1108042 7627 7232 5588 5169 2788 2412 1555 1518 913 4965 883 702 236 26016 3261 --
NM_018086chr261834 1526 1378 1179 338 141 --1574 --
NM_018092chr1621346 1152 ------
NM_018098chr31757 ------
NM_018100chr683268 3213 3198 2892 1349 833 293 187 ------
NM_018105chr831176 990 394 ----11183
NM_018121chr103727 334 134 12011 1850 --
NM_018126chr441581 1113 362 233 11566 ----
NM_018133chr33802 657 356 --1750 --
NM_018137chr141083 535 245 136 --1415 --
NM_018147chr3189 ------
NM_018155chr353432 2699 2545 2160 2098 1228 13000 --
NM_018156chr152902 2853 428 274 198 11960 --1637
NM_018157chr1242309 1994 335 298 22013 1060 ----
NM_018159chrX41522 1103 420 118 11213 1446 11092
NM_018167chr142911 662 2373 219 --2830 283
NM_018181chr182256 100 1441 ----
NM_018184chr321965 1581 --1827 1461
NM_018191chr132637 126 ----22141 689
NM_018202chr1--1198 ----
NM_018211chr122018 281 11634 --11470
NM_018222chr11----31823 1265 1194 --
NM_018227chr442774 2476 2426 286 1858 ----
NM_018254chr162297 1721 1608 886 220 97 ------
NM_018263chr242466 2350 468 168 ------
NM_018287chr1031350 1303 959 ------
NM_018293chr32937 105 1151 --1526
NM_018299chr843240 2870 2410 1180 ------
NM_018313chr362168 1899 1841 1806 594 586 12122 1815 --
NM_018318chr121766 1732 --1149
NM_018323chr421510 1230 3490 298 35 ----
NM_018325chr921426 571 21259 508 ----
NM_018328chr2----1100 --
NM_018330chr10163 1481 ----
NM_018340chr1634163 3775 3207 14683 --24446 3123
NM_018362chr1123794 363 1341 ----
NM_018364chr132563 500 476 43265 1166 711 294 ----
NM_018373chr1476101 5996 5251 4826 4316 1265 590 24494 2358 14067 --
NM_018374chr773653 3224 2011 1964 1300 1017 888 24886 4685 --23926 1108
NM_018375chr1471883 1399 621 536 396 296 173 11922 ----
NM_018387chr91160 ------
NM_018429chr551972 1966 615 605 382 141 179 --
NM_018440chr8128102 7115 6878 6816 6678 5981 5483 2796 1638 832 730 44 37953 7159 3081 27761 612 --
NM_018444chr842140 1519 909 442 22106 1956 ----
NM_018448chr121866 ------
NM_018452chr6_random53753 3256 1207 716 53 --11473 11268
NM_018465chr91200 ------
NM_018482chr831610 631 241 --12488 1808
NM_018566chr144141 4068 3545 1751 14882 11920 --
NM_018638chr1264961 4221 3887 1044 838 516 ------
NM_018640chr1232589 2396 384 21133 729 11788 --
NM_018649chr10--1236 ----
NM_018650chr142108 1841 808 305 --12159 --
NM_018657chr31630 1295 --2616 586
NM_018682chr71297 ------
NM_018704chr121735 126 11774 ----
NM_018712chr1131389 274 177 ------
NM_018834chr51319 ------
NM_018845chr11205 ------
NM_018890chr721168 235 ------
NM_018898chr511967 2603 150 --11940
NM_018899chr511967 2603 150 --11940
NM_018900chr511967 2603 150 --11940
NM_018901chr511967 2603 150 --11940
NM_018902chr511967 2603 150 --11940
NM_018903chr511967 2603 150 --11940
NM_018904chr511967 2603 150 --11940
NM_018905chr511967 2603 150 --11940
NM_018906chr511967 2603 150 --11940
NM_018907chr511967 2603 150 --11940
NM_018908chr511967 2603 150 --11940
NM_018909chr511967 2603 150 --11940
NM_018910chr511967 2603 150 --11940
NM_018911chr511967 2603 150 --11940
NM_018912chr51616 ------
NM_018913chr51616 ------
NM_018914chr51616 ------
NM_018915chr51616 ------
NM_018916chr51616 ------
NM_018917chr51616 ------
NM_018918chr51616 ------
NM_018919chr51616 ------
NM_018920chr51616 ------
NM_018921chr51616 ------
NM_018922chr51616 ------
NM_018923chr51616 ------
NM_018924chr51616 ------
NM_018925chr51616 ------
NM_018926chr51616 ------
NM_018927chr51616 ------
NM_018928chr51616 ------
NM_018929chr51616 ------
NM_018945chr633694 3517 3327 ------
NM_018947chr744605 3726 1626 705 44994 3257 3065 1025 21207 331 23617 3313
NM_018948chr13951 442 140 ------
NM_018970chr742867 2077 854 835 21248 409 ----
NM_018976chr1232739 2714 642 ----11813
NM_018994chr11449 ------
NM_018999chr1044862 4336 3017 477 13286 13814 23343 3006
NM_019001chr354456 3663 3162 1840 555 21132 635 13475 --
NM_019004chr741962 1499 645 310 1417 ----
NM_019022chr1852786 2627 2523 2373 448 21262 925 167 12760
NM_019027chr422489 2357 --12561 --
NM_019036chr62439 281 21243 966 11151 --
NM_019044chr264643 3897 3753 3606 3229 520 --13842 --
NM_019072chr544071 4042 2920 170 --23510 490 1775
NM_019083chr111052 1204 --1466
NM_019084chr103598 555 339 1698 11696 --
NM_019087chr51700 ------
NM_019094chr1252416 1024 877 769 219 13385 ----
NM_019095chr20------1228
NM_019106chr225955 892 855 823 334 11137 ----
NM_019117chrX43060 3010 2968 253 11222 11284 1413
NM_019590chr102572 462 ------
NM_019593chr2022455 2283 12635 --11064
NM_019594chr941481 1410 1035 469 ------
NM_019597chrX--1663 1738 1303
NM_019610chr131363 355 302 --11920 11457
NM_019842chr6------1300
NM_019885chr232724 2689 807 12971 --12087
NM_019891chr121206 1189 4984 835 517 277 11298 1524
NM_019903chr1031563 1214 700 1646 ----
NM_020066chr12953 137 1978 1404 --
NM_020122chr221304 585 15933 12102 --
NM_020123chr101512 11252 21434 1186 --
NM_020141chr171956 1789 1593 962 929 637 446 21633 513 ----
NM_020144chr741891 1765 759 639 --21570 524 --
NM_020159chr411364 1305 11403 11112
NM_020177chr563158 2720 2157 825 671 93 --11084 11093
NM_020180chr1821165 507 ------
NM_020199chr54516 497 256 179 21105 277 ----
NM_020207chr921262 246 1535 --1859
NM_020336chr2093860 2978 2834 2677 2656 2384 2364 1088 177 13015 ----
NM_020342chr221814 549 21949 843 31855 1839 581 --
NM_020347chr321446 277 1726 2736 117 1133
NM_020357chr321076 295 11422 1478 --
NM_020381chr651926 1753 1671 547 525 --21425 1371 --
NM_020382chr121311 ------
NM_020390chr354413 4012 3620 1572 1126 13494 ----
NM_020420chrY1106 21520 60 --3710 542 274
NM_020443chr1126965 6948 6434 5090 2794 2748 2673 1897 1793 670 499 414 16129 22399 1695 16787
NM_020463chr221254 1108 ----2930 356
NM_020466chr664275 4255 3670 1572 1385 55 --11303 14473
NM_020474chr1821313 317 11983 ----
NM_020475chr811857 12332 ----
NM_020476chr811857 12332 ----
NM_020477chr811857 12332 ----
NM_020478chr811920 12395 ----
NM_020480chr811857 12332 ----
NM_020630chr101134 ------
NM_020640chr331498 908 655 ----2746 500
NM_020647chr821799 844 ------
NM_020653chr17----1158 --
NM_020654chr31490 ------
NM_020673chr2075606 5055 4899 4797 3051 2951 1309 --12205 11138
NM_020696chr3121 ------
NM_020697chr821126 171 21148 160 1887 --
NM_020718chr16115796 4782 4526 2487 2329 1797 1765 1730 1240 909 304 46427 5966 5578 594 11790 32393 2307 51
NM_020727chr2163647 3597 3590 1522 378 207 1177 11446 13205
NM_020734chr1222631 2273 12596 --11170
NM_020747chr51886 1834 ----
NM_020748chr172772 303 1148 ----
NM_020754chr32479 204 ----148
NM_020766chrX44546 1599 1373 389 --34303 3109 3043 --
NM_020768chr541229 1093 393 196 12749 ----
NM_020772chr1798315 8186 6350 6144 5298 3062 2972 1954 1708 57112 6060 2496 1231 705 --1834
NM_020773chr422645 1830 11001 --12509
NM_020774chr18106050 5039 4926 4204 1461 926 868 627 69 39 25849 1192 --25693 1665
NM_020782chr1254745 4637 1893 493 366 14833 --1780
NM_020801chr512345 21652 159 ----
NM_020808chr11272 ------
NM_020809chr111256 21875 1638 --1819
NM_020841chr1232545 915 844 ----23631 3574
NM_020844chr897036 5561 5363 5168 4678 1538 1469 1380 1327 12648 --17178
NM_020856chr191250 ------
NM_020861chr61261 ----1441
NM_020866chr13--1845 ----
NM_020870chr431496 800 198 ----1790
NM_020872chr311631 --11435 --
NM_020899chr1711652 11870 12485 12442
NM_020918chr1053467 3303 1403 716 419 33378 2610 362 --33246 805 605
NM_020921chr1472961 2885 2528 2463 2386 1281 414 12727 33325 2254 351 1623
NM_020922chrX21421 121 11451 1429 --
NM_020925chr151469 1237 1174 979 35 156 ----
NM_020927chr1622332 2003 1277 11701 1510
NM_020948chr132479 2411 631 ------
NM_020975chr101667 ------
NM_020987chr1021070 186 ------
NM_020988chr16------1213
NM_020989chr2150 ------
NM_021007chr21640 ------
NM_021025chr5--1364 ----
NM_021032chr331664 1462 797 11970 11793 1473
NM_021072chr52787 118 ------
NM_021090chr2255014 4896 3877 1716 1020 12009 ----
NM_021115chr221119 ------
NM_021127chr1841466 1416 1361 1161 ----11018
NM_021141chr2--2723 300 1191 --
NM_021144chr9--1466 --1355
NM_021159chr431265 578 384 ------
NM_021180chr11796 ------
NM_021183chrX62345 2010 923 823 808 700 ------
NM_021190chr121119 924 11331 ----
NM_021215chr2062392 1933 1818 1789 613 200 1331 1638 12404
NM_021218chr91673 ------
NM_021229chr123283 155 57 ------
NM_021237chr31357 ------
NM_021252chr10------2379 299
NM_021619chr911322 ------
NM_021629chr354500 3695 3101 3086 1173 13770 2915 39 --
NM_021631chr8--186 ----
NM_021639chr1--1842 ----
NM_021645chr1331734 781 650 21918 170 32290 2278 749 11631
NM_021814chr621302 630 21187 505 ----
NM_021825chr11--1146 ----
NM_021911chr551865 1779 848 828 660 --1642 --
NM_021912chr1523524 878 --11461 21128 945
NM_021913chr1981576 1514 1320 1272 1250 306 290 268 21463 1132 ----
NM_021947chr173986 913 40 ------
NM_021956chr6155 ------
NM_021961chr1156918 5435 1248 500 401 37461 2972 1940 16500 --
NM_021964chr386203 4303 4191 2561 2383 2245 1098 233 34451 2222 39 ----
NM_021998chrX21057 31 1403 ----
NM_022037chr2----1641 --
NM_022070chr172283 22 ----1118
NM_022075chr11823 ------
NM_022079chr103828 714 302 ------
NM_022095chr20188 ------
NM_022114chr123562 1525 14246 ----
NM_022123chr14167 1510 ----
NM_022133chr861752 1698 1617 736 477 390 1551 129 147
NM_022138chr61267 ------
NM_022143chr7--1396 ----
NM_022154chr43891 832 86 ----11116
NM_022173chr2----1641 --
NM_022351chr853370 3027 2410 649 360 22647 2565 ----
NM_022462chr19143681 3215 2711 2679 2649 2558 2528 2472 1490 1426 1392 823 792 178 73048 2744 2619 2499 2438 2356 1367 13054 --
NM_022474chr1452718 2620 1791 488 39 --12580 --
NM_022496chr121199 ------
NM_022650chr51941 --1679 --
NM_022658chr121392 ------
NM_022726chr61348 ------
NM_022733chr1--1110 ----
NM_022763chr323078 121 13038 ----
NM_022781chr962369 1234 1013 1001 562 24 --12876 12856
NM_022802chr1031470 1145 109 ------
NM_022817chr22653 460 22302 128 ----
NM_022818chr1651481 1348 1274 1232 654 128 ----
NM_022828chr521689 117 31429 393 131 ----
NM_022841chr1532646 476 392 ------
NM_022845chr1642000 1905 437 409 ------
NM_022893chr212269 12242 23044 2789 --
NM_022894chr241531 1442 1425 41 ------
NM_022913chr5--123 ----
NM_022977chrX32603 2313 652 21946 61 --11826
NM_023000chr1411477 11110 11084 1494
NM_023001chr1411477 11110 11084 1494
NM_023037chr1321151 346 1335 ----
NM_023076chr1641873 586 404 203 22819 928 --12100
NM_023929chr832839 2186 1810 --12594 1773
NM_024057chr12--1115 ----
NM_024061chr7--1250 ----
NM_024089chr13--1182 ----
NM_024295chr821916 1661 11930 --11831
NM_024345chr965950 5796 5199 4523 1931 853 75543 4370 2353 2176 1251 669 84 25854 63 14413
NM_024430chr183298 160 133 ------
NM_024511chr432795 2683 837 1298 13076 --
NM_024539chrX21134 244 11107 --1435
NM_024561chr131292 --21344 1311 --
NM_024567chr8138 ------
NM_024569chr141018 795 741 251 ----1399
NM_024586chr1--1503 ----
NM_024626chr121638 128 --11388 1121
NM_024631chr11----1531 --
NM_024639chr622259 893 32280 1912 1140 11931 12330
NM_024646chr173947 3448 3430 3141 2648 1549 1542 --13313 11406
NM_024665chr354631 4200 3176 1046 493 13110 --24012 254
NM_024686chr11393 1230 --1487
NM_024692chr2181 --21769 1300 --
NM_024713chr1511517 11177 --11030
NM_024744chr241832 1768 1053 1020 ------
NM_024757chr9--1869 ----
NM_024761chr945316 5042 1372 452 14162 23835 2014 --
NM_024770chr276649 5766 5466 5271 5146 4947 1805 12626 14700 --
NM_024780chr16--1382 ----
NM_024798chr1532918 2261 2083 32230 1136 959 11036 12048
NM_024808chr131337 ------
NM_024817chr1554430 1806 1608 572 318 ----15156
NM_024824chr1431716 1091 529 ----11628
NM_024828chr931202 426 256 ----11060
NM_024831chr81184 1590 1578 1624
NM_024835chr17180 ------
NM_024854chr1241428 1296 300 283 11523 ----
NM_024945chr91834 ----153
NM_024947chr3159533 8466 7111 6804 6569 6402 6262 6185 6011 2460 1804 772 703 506 447 37773 6220 82 39346 7859 655 26283 565
NM_024989chr288191 6317 5544 3101 3000 1284 899 324 37048 3285 2032 11455 15620
NM_024991chr1032513 2215 751 2888 796 ----
NM_024993chr221298 534 ------
NM_025047chr31133 ----1160
NM_025054chr82982 623 14006 11529 24191 2614
NM_025073chr123834 1734 34671 3020 368 21407 1181 1136
NM_025133chr21912 1846 11071 --
NM_025134chr1621802 683 1126 ----
NM_025135chr181453 ------
NM_025138chr1311304 ----11072
NM_025146chr312460 1731 ----
NM_025154chr7----11038 --
NM_025191chr163201 3185 2535 563 340 315 --1157 22638 2527
NM_025205chr41246 ------
NM_025208chr111413 2678 406 ----
NM_025222chr321030 1007 22873 2008 ----
NM_025235chr1021622 852 1469 --11893
NM_030621chr1442600 1236 988 284 --11250 23802 3195
NM_030625chr1041995 1668 964 332 12613 ----
NM_030627chr563784 3266 1314 1156 1124 819 --11017 --
NM_030647chr7126177 5729 4380 2125 1965 1834 1346 1120 898 517 409 45 --1430 --
NM_030650chr284071 3534 3017 2677 870 842 481 249 13499 11031 --
NM_030660chr1411166 1488 122 21512 1095
NM_030663chr1198 --1244 1191
NM_030674chr12135663 5646 4616 4578 4412 3665 2099 2036 1810 1162 884 742 202 25036 416 45270 5168 2276 1088 22181 1014
NM_030751chr101352 21359 580 1603 --
NM_030751chr101352 21359 580 1603 --
NM_030755chr1473062 2253 2097 600 486 350 113 12746 13040 --
NM_030758chr22171 1378 ----
NM_030769chr12434 81 2525 188 --1411
NM_030789chr201272 ------
NM_030791chr1451784 1558 1250 1172 699 1627 --1227
NM_030799chr542128 1630 1414 734 21543 1394 ----
NM_030806chr1169019 8482 8451 8148 8022 7391 7283 7236 6563 5959 5804 5714 3057 1860 1648 457 16112 16487 --
NM_030816chr133132 1402 1346 13272 --12354
NM_030817chr1253142 2934 2689 2670 1172 23169 2730 13293 11521
NM_030820chr61683 ------
NM_030918chr185390 4563 3887 631 483 269 105 59 21499 989 25090 3457 --
NM_030920chr131941 620 428 --1243 --
NM_030939chr611181 --1389 --
NM_030953chr54649 642 479 53 11393 11053 --
NM_030958chr82398 23 ------
NM_031157chr121133 ------
NM_031243chr742063 786 719 710 ------
NM_031262chr91433 ------
NM_031275chr112254 141 1391 ----
NM_031296chr461971 1812 695 606 580 552 --1248 --
NM_031369chr41791 1661 1671 --
NM_031370chr41791 1661 1671 --
NM_031411chr511967 2603 150 --11940
NM_031422chr181512 ------
NM_031427chr1455597 5375 5257 5227 632 45817 5045 3882 217 --15937
NM_031435chr1233151 2168 667 --23426 3141 --
NM_031438chr531445 696 681 1321 21842 1591 --
NM_031442chrX43107 2706 2009 1280 1181 1672 1370
NM_031461chr841783 1497 515 374 1212 ----
NM_031469chr652838 2673 2574 1405 558 13614 ----
NM_031483chr2063311 3292 3184 1357 336 101 32604 2318 1402 1141 --
NM_031844chr154027 3646 1614 1184 1151 43077 2920 1422 127 11031 --
NM_031845chr263586 2917 2899 2695 891 36 ----12667
NM_031847chr263586 2917 2899 2695 891 36 ----12667
NM_031849chr511967 2603 150 --11940
NM_031857chr511967 2603 150 --11940
NM_031860chr511967 2603 150 --11940
NM_032012chr985031 4848 4800 4733 4501 3942 3472 2080 131 13351 11883
NM_032047chr341718 1682 763 488 2651 151 --21641 214
NM_032088chr51616 ------
NM_032092chr51616 ------
NM_032116chr1364864 4186 3979 3730 1178 743 1496 --1314
NM_032128chr441050 800 264 23 ------
NM_032138chr131145 1112 ----
NM_032144chr221292 1208 --11314 --
NM_032145chr6----11737 11188
NM_032146chr31355 ------
NM_032153chr312532 22095 743 ----
NM_032160chr1864283 4170 3536 3126 713 685 1937 1350 12730
NM_032186chr11416 21054 946 1535 --
NM_032189chr1345023 4198 3711 494 21871 1241 12018 --
NM_032217chr421079 336 1371 1509 --
NM_032229chr131196 ------
NM_032271chr161311 ------
NM_032288chr33849 648 355 21846 1758 12335 21784 883
NM_032291chr121282 195 11537 --11305
NM_032293chr91249 ------
NM_032315chr1148 277 25 ----
NM_032320chr111607 ------
NM_032352chr1421456 1093 ----2977 508
NM_032373chr10125602 5167 5121 4717 4643 4548 4229 3888 3706 1838 1455 962 15329 15878 25086 468
NM_032403chr51616 ------
NM_032424chr114353 310 42 21 1536 ----
NM_032434chr251214 1132 577 378 359 31178 593 458 11089 --
NM_032440chr1032327 1965 1142 1395 ----
NM_032441chrX1358 11191 --163
NM_032446chr543683 3621 3463 2832 3657 625 230 11060 --
NM_032458chrX73281 3209 2912 2866 2081 657 633 23061 1276 --12611
NM_032471chr63895 312 82 11017 ----
NM_032499chr1541173 705 487 145 ------
NM_032505chr31324 11840 12327 21977 692
NM_032509chr822026 270 11867 31904 939 166 1353
NM_032557chr41349 ------
NM_032560chr143824 304 188 ----11008
NM_032574chr2127 ------
NM_032582chr1721483 407 11874 11359 --
NM_032601chr2----1181 --
NM_032622chr421541 1198 ------
NM_032626chr161236 128 ----
NM_032632chr1451765 1600 585 532 409 --21383 291 --
NM_032663chr12------21286 445
NM_032682chr353243 3080 2637 2215 107 1953 ----
NM_032765chr5----1264 --
NM_032772chr101372 ------
NM_032796chrX2291 59 ------
NM_032832chr641307 1290 1078 70 51506 1468 1406 1167 338 1189 --
NM_032842chr72400 126 21582 1331 21090 30 --
NM_032859chr1363363 1462 1227 1194 715 534 169 22706 1263 32520 1599 744
NM_032873chr1183819 3245 2773 1624 878 624 204 112 --23046 1240 --
NM_032876chr1461947 1904 1399 746 634 318 --1725 --
NM_032884chr11266 1332 ----
NM_032932chr1795936 5702 4838 4738 4482 2555 2149 1452 1206 66273 5945 5111 2511 1676 1057 1541 --
NM_032961chr431408 304 216 --11247 1958
NM_032973chrY13537 --23159 670 --
NM_032975chr1843149 1323 856 786 22512 1458 ----
NM_032978chr182243 146 1206 ----
NM_032979chr182243 146 1206 ----
NM_032980chr1843149 1323 856 786 22512 1458 ----
NM_032981chr182243 146 1206 ----
NM_033012chr1321009 356 1836 --1819
NM_033023chr7--1505 ----
NM_033030chr22405 206 ------
NM_033044chr1--11150 ----
NM_033067chr11264 ------
NM_033071chr62583 223 2546 453 ----
NM_033119chr161135 ------
NM_033121chr122606 298 1516 ----
NM_033135chr111413 2678 406 ----
NM_033138chr73763 676 174 11986 --1359
NM_033139chr73763 676 174 11986 --1359
NM_033140chr73763 676 174 11986 --1359
NM_033157chr73763 676 174 11986 --1359
NM_033181chr643972 3073 1047 775 1592 13593 161
NM_033211chr52199 30 --11456 1448
NM_033222chr91976 ----1229
NM_033224chr776585 6274 4876 2744 429 410 390 26937 6045 37363 7074 488 16368
NM_033281chr5----1136 --
NM_033285chr823924 1292 1231 1134 13621
NM_033290chrX53305 3132 1215 876 58 1725 32778 1499 218 --
NM_033326chr1142447 2092 357 223 1437 21581 709 --
NM_033331chr942825 1013 914 245 32341 680 39 ----
NM_033360chr12104176 3976 3863 3628 3337 3130 1652 1445 603 494 23941 3464 14167 13666
NM_033389chr1731713 1618 515 24284 30 23518 195 --
NM_033425chr1153208 1016 739 626 175 12437 1218 1337
NM_033426chr1412878 --11811 1712
NM_033495chrX2997 848 1203 ----
NM_033502chr6--1137 ----
NM_033505chr266358 6016 5423 5018 4868 568 36632 4493 4466 36207 4343 4315 --
NM_033642chrX----21051 186 --
NM_033656chr2185959 5289 5145 4816 4444 4215 1323 559 25810 717 14776 1888
NM_052827chr1211123 ------
NM_052832chr862730 2308 2215 1139 815 90 ------
NM_052834chr1861724 1646 1617 753 716 408 ------
NM_052879chr1263380 2654 2512 966 636 327 ----21409 1040
NM_052885chr12104859 4318 4291 4087 3989 3463 1773 358 89 23 34018 3421 131 --14598
NM_052886chr852118 2012 1946 1839 738 21580 453 ----
NM_052898chr811186 ------
NM_052900chr82634 62 ------
NM_052904chr641199 1015 980 267 ------
NM_052905chr21125 ------
NM_052907chr1232691 413 365 44232 3614 3565 517 1678 --
NM_052911chr18----1248 --
NM_052917chr243367 2603 1353 907 1147 23283 631 --
NM_052927chr51865 11865 ----
NM_052932chr112712 346 22513 551 21762 197 21000 924
NM_052958chr81252 --198 --
NM_052978chr1451724 664 454 282 109 --1275 --
NM_053016chr966996 6937 5875 5326 1275 873 17637 35051 2084 524 11311
NM_053025chr351574 436 305 274 235 ------
NM_053026chr351574 436 305 274 235 ------
NM_053027chr351574 436 305 274 235 ------
NM_053028chr351574 436 305 274 235 ------
NM_053031chr351574 436 305 274 235 ------
NM_053032chr351574 436 305 274 235 ------
NM_053043chr745449 4479 4114 1842 15033 ----
NM_053064chr1452249 1949 1118 150 128 2393 120 12212 12585
NM_054016chr161793 1572 1279 790 479 441 11683 11609 --
NM_054016chr161793 1572 1279 790 479 441 11683 11609 --
NM_054016chr161793 1572 1279 790 479 441 11683 11609 --
NM_054022chr172619 234 ----1749
NM_057159chr921199 271 2620 543 1284 --
NM_057749chr82874 406 ------
NM_058170chr111096 --21542 1102 --
NM_058191chr21------1157
NM_058241chr241619 638 502 77 1288 11947 --
NM_058241chr241619 638 502 77 1288 11947 --
NM_080391chr11598 --142 177
NM_080392chr11647 --191 1126
NM_080546chr931841 1773 1717 22033 550 --12016
NM_080552chr20----1688 --
NM_080591chr92465 24 2475 315 12877 2157 131
NM_080597chr182724 400 11122 --1423
NM_080626chr121264 ------
NM_080629chr11129 ------
NM_080630chr11129 ------
NM_080645chr622038 1966 1786 ----
NM_080667chr2159 ------
NM_080678chr21631 ------
NM_080764chr2262601 2195 2056 310 216 194 12178 ----
NM_080840chr20--1107 ----
NM_080841chr20--1107 ----
NM_080862chr31351 ------
NM_080872chr853526 3436 2783 947 465 1930 --2534 527
NM_080927chr352685 2198 1326 612 474 --13286 --
NM_130391chr942992 997 501 21 ----12264
NM_130392chr942992 997 501 21 ----12264
NM_130393chr942992 997 501 21 ----12264
NM_130434chr151859 21195 905 ----
NM_130439chr1021641 1597 11869 ----
NM_130439chr1021641 1597 11869 ----
NM_130446chr384174 3551 3176 3075 2909 1658 1546 234 24151 3465 ----
NM_130798chr1531302 515 471 ------
NM_130831chr342618 2591 974 724 ----1845
NM_130832chr342618 2591 974 724 ----1845
NM_130833chr342618 2591 974 724 ----1845
NM_130834chr342618 2591 974 724 ----1845
NM_130835chr342618 2591 974 724 ----1845
NM_130836chr342618 2591 974 724 ----1845
NM_130837chr342618 2591 974 724 ----1845
NM_130838chr1511662 11733 ----
NM_130839chr1511662 11733 ----
NM_133170chr2097659 6723 4934 2649 2593 2283 1861 1605 516 25782 5423 11256 --
NM_133264chr1762817 2654 2628 1379 415 176 1695 ----
NM_133370chr433093 2389 1050 12685 ----
NM_133372chr522936 96 12209 ----
NM_133433chr53869 848 570 ------
NM_133445chr983457 3379 3274 1368 1296 602 185 111 21460 1446 2456 423 --
NM_133446chr10----1264 --
NM_133496chr144220 3311 2799 1598 23629 401 --23362 1572
NM_133499chrX--2329 288 ----
NM_133650chr62583 223 2546 453 ----
NM_134265chr17--1939 1252 --
NM_138270chrX42749 2175 1174 353 ------
NM_138285chr2--1121 1421 --
NM_138288chr1441621 1583 827 93 --1560 --
NM_138316chr103957 468 380 1394 --11023
NM_138385chr411448 ------
NM_138444chr1354642 4514 3919 3006 647 1542 14542 --
NM_138459chr623670 2906 ----11388
NM_138468chr266302 5895 5649 4347 1979 137 24963 1151 2271 76 11728
NM_138555chr15--1467 1580 --
NM_138559chr21996 ------
NM_138713chr1656568 1975 1622 1411 893 46291 6052 6036 2987 25014 954 15893
NM_138714chr1656568 1975 1622 1411 893 46291 6052 6036 2987 25014 954 15893
NM_138731chr1444187 1663 1086 40 24171 3734 12994 23263 936
NM_138766chr51579 ------
NM_138771chr711298 --21320 1304 --
NM_138782chr52382 363 ------
NM_138821chr51579 ------
NM_138822chr51579 ------
NM_138970chr1442099 1818 553 285 1747 --11878
NM_138971chr1173485 3280 2964 1038 786 678 483 ------
NM_138971chr1173485 3280 2964 1038 786 678 483 ------
NM_138972chr1173485 3280 2964 1038 786 678 483 ------
NM_138972chr1173485 3280 2964 1038 786 678 483 ------
NM_138973chr1173485 3280 2964 1038 786 678 483 ------
NM_138973chr1173485 3280 2964 1038 786 678 483 ------
NM_139048chr31310 21160 141 153 --
NM_139078chr121127 ------
NM_139168chr542014 1637 1551 90 1716 ----
NM_139244chr61646 ------
NM_139245chr331357 301 66 --11435 --
NM_139286chr9----172 --
NM_139321chr2094265 4096 4013 3736 2675 966 814 677 495 23938 3538 ----
NM_144571chr465936 5589 5460 2172 2140 2027 15123 15294 15741
NM_144578chr1465562 5290 4052 2016 1548 716 21714 954 --15075
NM_144600chr1631095 520 172 ------
NM_144618chr11180 ------
NM_144643chr4132 1356 ----
NM_144664chr1162574 2456 2175 2125 1797 489 ----2846 406
NM_144684chr1942002 866 479 36 ----11185
NM_144721chr442720 2533 1098 116 22635 1026 1995 --
NM_144949chr212227 22642 488 ----
NM_144963chr822025 1077 32316 977 652 1947 --
NM_144973chr1224415 184 ----15088
NM_144988chr11242 125 ----
NM_145000chr51492 ----1259
NM_145011chr1031967 1715 1653 ----1407
NM_145037chr341249 1200 1157 387 --1124 1609
NM_145117chr1152982 2611 2141 2082 1322 11177 ----
NM_145175chr211014 ------
NM_145176chr643258 2781 1336 396 --22199 502 1754
NM_145203chr133769 694 117 1623 --169
NM_145235chr101109 ------
NM_145246chr101376 ------
NM_145259chr246298 4660 2730 1745 36872 2092 837 --26855 2131
NM_145261chr32247 103 2892 180 ----
NM_145274chr174669 381 357 195 2167 134 --181
NM_145307chr1063948 3634 765 688 342 231 2565 474 ----
NM_145332chr6154 --1623 --
NM_145333chr6154 --1623 --
NM_145341chr1031763 1200 378 1617 ----
NM_145647chr8167 1205 ----
NM_145686chr243209 3011 2839 998 11162 ----
NM_145687chr243209 3011 2839 998 11162 ----
NM_145690chr83571 544 189 11876 ----
NM_145725chr14125 ------
NM_145726chr14125 ------
NM_145728chr1531658 790 269 --1453 12437
NM_145808chr731041 752 662 ------
NM_147150chr9103940 3887 3281 2792 2717 2525 1549 908 807 190 13310 ----
NM_147166chr72176 137 --1753 --
NM_147175chrX31813 274 127 ------
NM_148174chr8123 --1194 1452
NM_148898chr71971 1224 ----
NM_148899chr71971 1224 ----
NM_148904chr1--1503 ----
NM_148905chr1--1503 ----
NM_148906chr1--1503 ----
NM_148907chr1--1503 ----
NM_148908chr1--1503 ----
NM_148909chr1--1503 ----
NM_148955chr1566499 5050 4730 1094 953 169 36200 536 454 24126 3990 --
NM_148957chr1342496 1868 1778 85 22193 925 12602 --
NM_148977chr103957 468 380 1394 --11023
NM_148978chr103957 468 380 1394 --11023
NM_152244chr1711191 ------
NM_152261chr122314 214 1705 ----
NM_152263chr1116097 4619 4580 3889 3870 3859 1877 695 389 77 27 22353 942 ----
NM_152275chr282403 1568 1504 548 542 526 226 69 1567 11471 11528
NM_152277chr531769 560 121 3693 378 267 ----
NM_152282chr32998 954 ------
NM_152284chr81788 ------
NM_152291chr41878 ------
NM_152329chr14----1138 --
NM_152388chr283819 3001 2789 1296 642 501 370 191 24064 313 ----
NM_152400chr411891 1842 ----
NM_152407chr542917 2792 612 116 11295 1439 12483
NM_152409chr573382 3363 3298 3274 2249 822 253 131 --12711
NM_152417chr82879 30 --11023 --
NM_152420chr9------1137
NM_152437chr1242258 1879 586 483 11542 11935 --
NM_152440chr1221166 879 21054 424 --1196
NM_152442chr1231277 1106 561 11327 1349 1163
NM_152446chr141399 ------
NM_152450chr15----1646 1561
NM_152455chr1542679 1894 1815 419 151 1156 11826
NM_152520chr231183 349 179 ------
NM_152522chr21976 1173 ----
NM_152529chr234235 723 553 23779 2795 22867 2812 --
NM_152536chr33926 802 288 161 --1329
NM_152545chr41480 ------
NM_152564chr821381 39 1736 --11625
NM_152597chr151627 ------
NM_152609chr121187 482 --11063 --
NM_152622chr553517 2344 1016 874 706 --11004 12796
NM_152624chr587058 6736 6083 5958 5518 4927 4846 533 21837 569 --15795
NM_152641chr1231936 719 503 32307 961 529 ----
NM_152666chr1--1296 ----
NM_152678chr342556 2191 1873 717 ------
NM_152705chr1311330 1294 --1413
NM_152737chr652019 1916 1775 1733 1727 21907 1794 11302 --
NM_152740chr73706 671 120 ------
NM_152754chr732989 699 582 23378 2524 22532 1002 23443 2859
NM_152756chr554068 3867 2771 2635 864 13620 13020 --
NM_152774chr722366 561 12330 ----
NM_152787chrX73838 3176 2997 2732 2483 1153 1044 22796 428 11243 --
NM_152793chr774886 4325 3913 1995 1321 487 109 --24495 259 --
NM_152826chr1566499 5050 4730 1094 953 169 36200 536 454 24126 3990 --
NM_152835chr162291 1907 1824 669 316 115 22138 294 ----
NM_152836chr861752 1698 1617 736 477 390 1551 129 147
NM_152837chr861752 1698 1617 736 477 390 1551 129 147
NM_152838chr2032870 789 295 33429 3338 2378 2991 209 13110
NM_152890chr121062 841 ----21229 907
NM_152903chr132276 247 1137 --1987
NM_152924chr1576538 5142 4477 1418 923 297 272 142 14326 22026 1504
NM_152991chr11----1624 --
NM_152995chr4----142 --
NM_152998chr7------178
NM_152999chr784622 3659 3170 1809 1560 1228 1143 220 --21189 478 --
NM_153013chr521562 313 --1280 --
NM_153018chr1733191 2855 631 1685 --1584
NM_153020chr661334 1213 1204 1156 374 169 ----1564
NM_153035chr131254 1237 428 ----22459 2178
NM_153042chr661512 1438 640 556 318 241 --1497 --
NM_153050chr2255014 4896 3877 1716 1020 12009 ----
NM_153051chr2255014 4896 3877 1716 1020 12009 ----
NM_153207chr1233059 1151 136 --1476 --
NM_153223chr521268 452 ------
NM_153235chr632282 2042 712 22390 2370 1618 --
NM_153256chr1051514 714 599 224 139 ------
NM_153261chr1621211 1077 ------
NM_153262chr183189 2533 2283 2049 962 731 293 188 22691 2344 ----
NM_153365chr422286 1112 22374 1710 12444 --
NM_153371chr13143 ----11559
NM_153456chr1375710 4929 3854 1885 1706 1389 100 35051 1140 251 36111 4895 1673 --
NM_153605chr311520 11202 ----
NM_153607chr522709 1272 32881 838 399 11168 12002
NM_153634chr1221635 517 11190 ----
NM_153645chr2232738 2650 1003 23004 1082 12487 11333
NM_153690chr3--1659 ----
NM_153707chr9------123
NM_153713chr1166 ------
NM_153812chr11119 31984 1927 1743 ----
NM_170606chr7------11870
NM_170665chr1284529 4052 3636 3211 3090 3040 814 129 ------
NM_170692chr12808 749 ------
NM_170707chr11740 1315 1664 --
NM_170708chr11740 1315 1664 --
NM_170709chr822173 2007 ------
NM_170719chr1311304 ----11072
NM_170731chr1121764 410 11013 12188 --
NM_170732chr1121764 410 11013 12188 --
NM_170733chr1121764 410 11013 12188 --
NM_170734chr1121764 410 11013 12188 --
NM_170735chr1121764 410 11013 12188 --
NM_171998chrX22542 2510 42349 2294 2232 2016 --1791
NM_172037chr81959 21421 308 --11078
NM_172071chr176981 6030 5470 5126 2836 2826 600 12437 --15618
NM_172103chr6----1471 --
NM_172105chr6----1471 --
NM_172127chr4--1419 ----
NM_172128chr4--1375 ----
NM_172193chr1431223 831 25 ------
NM_172218chr8----1533 1227
NM_172242chr104721 559 128 102 ------
NM_172373chr1331268 1154 1025 ------
NM_173060chr521835 24 31943 420 119 --11646
NM_173061chr521835 24 31943 420 119 --11646
NM_173063chr521835 24 31943 420 119 --11646
NM_173075chr4--11573 11351 --
NM_173083chr131260 1106 445 ------
NM_173163chr16199 1543 ----
NM_173171chr2------1245
NM_173173chr2------1245
NM_173199chr9167 ------
NM_173214chr1656568 1975 1622 1411 893 46291 6052 6036 2987 25014 954 15893
NM_173468chr476036 5610 5130 4482 3820 2244 1989 54062 1460 1444 1407 963 186 24350 1557
NM_173469chr151186 ------
NM_173473chr1021073 511 1783 --12567
NM_173475chr162496 304 --1585 --
NM_173491chr51329 130 ----
NM_173500chr1541309 1103 1089 1067 1875 --11008
NM_173508chr111003 1768 ----
NM_173531chr1933468 2754 2694 ------
NM_173557chr181495 ------
NM_173576chr1042349 2156 1539 139 1720 1730 --
NM_173582chr1156058 2267 532 190 104 34376 3921 550 ----
NM_173589chr112711 186 ------
NM_173591chr123910 409 137 1204 ----
NM_173595chr122547 75 ----24163 58
NM_173602chr1243749 2487 1198 992 22862 316 21503 972 --
NM_173642chr1108932 8852 8506 6290 6188 3230 3124 2169 1490 116 69227 8750 3514 2328 2130 1628 26465 73 16576
NM_173647chr211065 ------
NM_173648chr2------1729
NM_173654chr331560 903 536 21826 792 21768 1638 11502
NM_173667chr5--11532 ----
NM_173694chrX32374 1864 151 --11940 --
NM_173797chr521207 963 ------
NM_173808chr143860 1710 250 65 23967 1177 1512 23992 3228
NM_173829chr5105777 5701 5693 5121 3755 2382 1654 1578 844 511 35313 2325 764 --14251
NM_173848chr8--1155 ----
NM_173854chr192439 2127 1945 1870 1621 1540 567 510 377 42097 1837 303 104 --11517
NM_174890chr102227 68 ------
NM_174900chr411276 176 --2232 207
NM_174902chr11--21258 650 ----
NM_175056chr332063 1560 25 --1387 11550
NM_175061chr731826 806 249 12130 ----
NM_175571chr711576 11328 --21119 234
NM_175607chr351686 1190 289 175 48 ------
NM_175610chr1521336 90 ------
NM_175612chr351686 1190 289 175 48 ------
NM_175613chr3148 ------
NM_175634chr821187 234 ------
NM_175635chr821187 234 ------
NM_175636chr821187 234 ------
NM_175736chr1297023 6621 6448 5881 5341 2962 935 567 400 11517 22129 411 --
NM_175854chr1322334 229 11914 11693 --
NM_175856chr5--2733 523 ----
NM_175861chr1224746 332 11985 35488 4558 1117 --
NM_175866chr12962 216 11417 ----
NM_176814chr72966 517 ----1997
NM_177438chr1442600 1236 988 284 --11250 23802 3195
NM_177553chr113699 603 323 2691 616 --1269
NM_177559chr203877 347 290 ------
NM_177560chr203877 347 290 ------
NM_177947chrX21043 409 --11451 123
NM_177948chrX21043 409 --11451 123
NM_177967chr13----11057 --
NM_177969chr2--2702 543 ----
NM_177972chr1174432 4423 3980 2763 1743 1529 1145 33300 1105 1002 13380 --
NM_177976chr31355 ------
NM_178123chr231003 714 379 11076 2792 389 --
NM_178151chrX77712 5670 5534 5071 4777 2193 449 45268 2026 1094 788 --17423
NM_178152chrX77712 5670 5534 5071 4777 2193 449 45268 2026 1094 788 --17423
NM_178153chrX77712 5670 5534 5071 4777 2193 449 45268 2026 1094 788 --17423
NM_178313chr222051 1539 2804 547 11813 11724
NM_178423chr721045 217 1990 ----
NM_178425chr721045 217 1990 ----
NM_178566chr911291 ------
NM_178581chr201272 ------
NM_178585chr463168 2778 2758 2506 2098 1227 22909 378 ----
NM_181054chr14--21166 235 --1830
NM_181353chr20----1668 --
NM_181354chr831433 1415 1392 ------
NM_181358chr133254 3192 2856 24019 1220 ----
NM_181442chr202909 846 --1688 --
NM_181443chr2062773 2554 1143 729 237 45 2716 681 --22339 481
NM_181453chr221585 365 1283 ----
NM_181457chr231234 1180 506 11061 ----
NM_181458chr221367 1313 11194 ----
NM_181459chr231133 1079 405 1960 ----
NM_181460chr231180 1126 452 11007 ----
NM_181504chr543134 2718 2552 384 33546 1553 55 11267 --
NM_181523chr543134 2718 2552 384 33546 1553 55 11267 --
NM_181524chr543134 2718 2552 384 33546 1553 55 11267 --
NM_181702chr83689 658 238 ------
NM_181705chr5105748 5286 4562 4542 4517 4199 3783 1917 539 409 14836 1720 11057
NM_181706chr111601 11642 11894 --
NM_181713chr21146 1281 ----
NM_181746chr11823 ------
NM_181782chr621840 835 1164 --1429
NM_181787chr833752 3701 2996 ----1570
NM_181789chr1522336 966 12294 --1102
NM_181794chr63895 312 82 11017 ----
NM_181795chr63895 312 82 11017 ----
NM_181836chr522013 358 ----11056
NM_181844chr1741933 707 646 622 51397 1318 734 629 538 ----
NM_181861chr1242051 2039 1078 556 ------
NM_181868chr1242051 2039 1078 556 ------
NM_181869chr1242136 2124 1163 641 182 ----
NM_181886chr4--1205 ----
NM_181887chr4--1205 ----
NM_181888chr4--1205 ----
NM_181889chr4--1205 ----
NM_181890chr4--1205 ----
NM_181891chr4--1205 ----
NM_181892chr4--1252 ----
NM_181893chr4--1205 ----
NM_182485chr452849 2794 1368 975 946 21254 722 1834 --
NM_182493chr1655307 4070 3296 1289 475 24354 689 55173 4536 3883 3672 2033 --
NM_182503chr675341 5300 5128 4635 3937 3498 1636 35605 257 170 34997 3996 3449 21753 559
NM_182515chr1986246 6105 5901 5042 2407 2266 2210 434 ----15441
NM_182551chr222444 2172 23435 2393 --1346
NM_182569chr171273 1215 ----
NM_182607chrX31454 1354 347 1701 ----
NM_182620chr1752153 1439 640 89 59 12254 --11852
NM_182646chr452849 2794 1368 975 946 21254 722 1834 --
NM_182648chr141541 ------
NM_182666chr31438 --1261 --
NM_182691chr711249 41261 1225 961 230 ----
NM_182692chr711249 41261 1225 961 230 ----
NM_182697chr731487 1160 157 11629 ----
NM_182700chr761931 1921 1517 1301 657 352 --11574 --
NM_182765chr1032341 1929 641 ------
NM_182789chr52426 53 1350 ----
NM_182896chr321478 211 1262 --1381
NM_182898chr766285 6098 5770 5655 4357 2257 36169 5872 76 25637 1803 35679 4637 4051
NM_182899chr766285 6098 5770 5655 4357 2257 36169 5872 76 25637 1803 35679 4637 4051
NM_182918chr211325 ------
NM_182931chr71297 ------
NM_182943chr31311 31276 836 826 ----
NM_182948chr132365 2088 970 13089 11963 --
NM_182961chr62583 223 2546 453 ----
NM_182964chr1152982 2611 2141 2082 1322 11177 ----
NM_182975chr111033 ------
NM_182977chr51282 ------
NM_183043chr131875 --1382 --
NM_183044chr131875 --1382 --
NM_183238chr1283119 2984 2447 1370 1141 1124 883 662 1309 12913 1154
NM_183323chr52426 53 1350 ----
NM_183353chrX2985 388 ------
NM_183387chr141307 ------
NM_183398chr5184 ------
NM_183399chr5184 ------
NM_183400chr5184 ------
NM_183401chr5184 ------
NM_183416chr111754 ------
NM_183422chr133861 724 703 ------
NM_194247chr223658 654 24460 824 ----
NM_194250chr21367 ------
NM_194282chr412690 2522 72 1898 2473 403
NM_194283chr534224 3031 36 --22681 1623 13944
NM_194285chr1143339 619 90 30 ------
NM_194291chr872796 2331 2033 1070 780 117 73 32977 2891 1985 ----
NM_194314chr165326 4945 2004 1804 1471 232 14600 15016 --
NM_194317chr232681 1968 286 1444 1870 --
NM_194328chr962369 1234 1013 1001 562 24 --12876 12856
NM_194329chr962369 1234 1013 1001 562 24 --12876 12856
NM_194330chr962369 1234 1013 1001 562 24 --12876 12856
NM_194332chr962369 1234 1013 1001 562 24 --12876 12856
NM_194356chr1221519 799 12366 12179 --
NM_194434chr1854887 4376 2024 1873 1309 21906 1398 24944 394 --
NM_194463chrX21134 244 11107 --1435
NM_197970chr22405 206 ------
NM_197972chr1----141 --
NM_198066chr1412670 --32833 1216 187 1149
NM_198086chr1461947 1904 1399 746 634 318 --1725 --
NM_198123chr82634 62 ------
NM_198124chr82634 62 ------
NM_198158chr3--21192 155 ----
NM_198159chr3--21192 155 ----
NM_198173chr11796 ------
NM_198174chr11796 ------
NM_198177chr3--21192 155 ----
NM_198178chr3--21192 155 ----
NM_198195chr31256 ------
NM_198215chr101340 ------
NM_198217chr131330 1217 1920 --
NM_198218chr131330 1217 1920 --
NM_198219chr131330 1217 1920 --
NM_198240chr1241316 1084 1045 194 11183 1395 1127
NM_198243chr152315 41 ----1278
NM_198267chr7----2661 598 1775
NM_198268chr133254 3192 2856 24019 1220 ----
NM_198269chr133254 3192 2856 24019 1220 ----
NM_198270chrX53382 2842 915 384 171 11061 --22797 431
NM_198273chr552848 1113 813 493 197 12826 21159 95 146
NM_198353chr41408 1171 ----
NM_198400chr1552398 1907 496 266 220 22649 2528 ----
NM_198465chrX42807 2508 871 197 ----22243 2173
NM_198468chr663464 3392 3100 1078 643 579 44551 4111 771 115 ----
NM_198484chr366212 5691 5438 4773 4559 4367 35673 5035 234 11416 14858
NM_198506chr421083 225 31287 1094 591 ----
NM_198513chr821454 815 11928 ----
NM_198549chr112105 22740 2628 ----
NM_198581chr277066 7043 5903 2111 1641 917 319 26116 2366 12440 --
NM_198793chr3104083 3132 3029 1449 1226 953 793 665 326 183 --12776 --
NM_198794chr1431321 348 314 ------
NM_198829chr721168 235 ------
NM_198844chr171897 ------
NM_198889chr421079 336 1371 1509 --
NM_198900chr1297023 6621 6448 5881 5341 2962 935 567 400 11517 22129 411 --
NM_198903chr51593 ------
NM_198904chr521794 593 --11773 --
NM_198956chr761931 1921 1517 1301 657 352 --11574 --
NM_198965chr121300 ------
NM_198966chr121300 ------
NM_198990chr752943 2732 2199 1150 256 12782 --1867
NM_199003chr821460 1274 ----11467
NM_199040chr1252416 1024 877 769 219 13385 ----
NM_199168chr101142 11250 1172 --
NM_199188chr1263380 2654 2512 966 636 327 ----21409 1040
NM_199189chr51319 ------
NM_199190chr1263380 2654 2512 966 636 327 ----21409 1040
NM_199320chr462907 2173 2064 960 855 643 1438 ----
NM_199320chr462907 2173 2064 960 855 643 1438 ----
NM_199321chr171897 ------
NM_199324chr443056 1076 939 310 33338 2988 2276 ----
NM_199436chr242603 2293 658 110 ------
NM_199454chr123562 1525 14246 ----
NM_199461chr1022631 322 1396 12724 --
NM_199482chr241834 1748 408 66 ----11349
NM_201269chr11416 21054 946 1535 --
NM_201413chr211260 ------
NM_201414chr211260 ------
NM_201428chr1111488 ------
NM_201429chr1111488 ------
NM_201430chr1111414 ------
NM_201624chr12892 192 ------
NM_201995chr11----1152 --
NM_201998chr11----1217 --
NM_201999chr4--1484 ----
NM_203281chrX194 ----1136
NM_203301chr14--1177 ----
NM_203342chr153534 3170 3104 1081 173 ----12216
NM_203343chr153534 3170 3104 1081 173 ----12216
NM_203350chr111613 --11528 --
NM_203354chr141193 ------
NM_203355chr141193 ------
NM_203356chr141193 ------
NM_203364chr11----1440 1453
NM_203394chr1252613 2293 871 505 325 2742 270 11898 --
NM_203406chr521785 1114 21169 246 --12715
NM_203446chr2111938 11076 1342 --
NM_203459chr132526 2383 1771 1493 1790 1969
NM_203464chr11923 11261 ----
NM_203504chr432554 1762 732 --1208 --
NM_203505chr432554 1762 732 --1208 --
NM_205768chr141975 464 187 163 1138 11843 --
NM_205842chr22629 184 ------
NM_205860chr123061 365 ------
NM_206853chr642956 2797 2771 1275 ------
NM_206855chr645182 5023 4997 63 ------
NM_206876chr233045 967 583 11356 12672 --
NM_206907chr532998 473 281 12065 11247 13359
NM_206909chr897471 6196 6073 5389 2649 2320 1766 843 518 38413 7999 7983 12230 13328
NM_206937chr13136 ----2326 292
NM_207015chr321700 312 22021 1798 ----
NM_207032chr2021342 576 ------
NM_207033chr2021250 484 ------
NM_207034chr2021250 484 ------
NM_207123chr43861 596 89 --1152 --
NM_207303chr1063967 3754 3374 2985 1661 974 54137 2593 1457 1126 258 13762 --
NM_207311chr12--11270 ----
NM_207391chr192918 524 ------
NM_207396chr1----11364 11863
NM_207406chr476071 5805 4681 1829 1462 1450 648 76525 6396 6101 4337 4144 2053 1002 14117 --
NM_207422chrX--2257 82 --1335
NM_207645chr1131166 860 460 11140 ----
NM_207647chr962492 1672 1604 787 616 411 ------
NM_207660chr1431716 1091 529 ----11628
NM_207661chr1431716 1091 529 ----11628
NM_207662chr1431716 1091 529 ----11628
NM_212460chr731720 749 583 2697 550 ----
NM_212471chr1721903 1622 12175 2867 393 --
NM_212472chr1721903 1622 12175 2867 393 --
NM_212554chr101276 --11525 159
NM_212558chr922762 673 --1334 --
NM_213589chr274304 3886 3868 3761 1156 815 753 24898 1695 14597 1376