TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4778-3p
miRNA Sequence: UCUUCUUCCUUUGCAGAGUUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX106459 6060 5302 4718 4595 4522 2313 478 186 33 56634 6227 5736 4963 223 12697 14452
NM_000216chrX113994 3345 1633 1359 1202 1170 1000 700 659 234 225 42935 1532 352 137 ----
NM_000217chr1264540 3936 3495 1711 1621 909 54859 4751 4346 4150 1802 --34862 3417 3414
NM_000254chr182778 2670 2458 2100 688 406 378 220 32169 2071 2051 22829 2825 --
NM_000259chr1596109 5411 1404 423 388 284 266 255 123 34533 4349 1520 1276 14794
NM_000332chr6176969 6875 6797 6786 6561 6350 5775 5334 5252 5088 5080 2047 1287 1078 919 340 258 24713 2505 24515 213 11468
NM_000337chr5116142 5581 5543 5304 4173 4005 2358 1961 1389 1157 961 45958 5936 5718 1433 24392 1435 --
NM_000368chr9174660 4521 4440 4176 4141 3605 3549 3180 3098 1863 1454 1438 1383 1200 864 847 570 14466 63749 3534 2939 1386 1087 819 --
NM_000376chr12112988 2965 2787 2752 2741 2723 2183 2080 641 609 349 --32882 2479 909 42880 2487 2477 957
NM_000448chr1172835 2800 2649 2635 2605 1141 113 12643 --12726
NM_000480chr1131614 1295 116 --1471 21378 103
NM_000555chrX157717 7537 6762 6555 6415 5990 2997 2805 1923 1132 1079 1046 675 569 479 --12222 12255
NM_000599chr2154466 3754 2882 1719 1710 1580 1537 1334 520 372 320 302 272 265 134 43703 3691 1827 353 13417 63706 3344 3230 2980 291 279
NM_000618chr12136476 4763 4667 4500 4113 4040 4001 2410 1195 1127 1039 559 25 35012 1672 1072 ----
NM_000618chr12136476 4763 4667 4500 4113 4040 4001 2410 1195 1127 1039 559 25 35012 1672 1072 ----
NM_000633chr18165254 5075 4149 4113 3499 3339 1941 1627 1615 1425 1273 1241 915 675 619 406 --2884 475 24032 574
NM_000719chr12135791 5734 5725 5699 5691 5664 5525 5476 5437 4936 4805 1565 1502 26612 4127 52435 2122 437 236 173 35133 811 808
NM_000721chr161963 772 577 374 113 45 32434 135 105 41880 274 140 94 2138 92
NM_000793chr14124690 4215 4148 3795 3410 3381 1298 1161 900 331 292 128 54951 3670 3625 823 713 44820 1349 828 825 31347 1344 254
NM_000809chr4168946 8533 8483 8432 8046 6708 6698 3024 2666 2392 2162 1659 1348 1228 865 569 17874 ----
NM_000813chr574950 4787 2217 1312 1130 916 609 23819 1609 --13822
NM_000831chr1155481 4906 3828 2452 1668 1484 1369 1267 1133 1079 854 251 154 66 46 62315 1035 647 625 513 57 55346 4775 2317 2157 1252 24773 1250
NM_000891chr1763407 3121 2353 2270 2249 1399 1945 --41403 954 951 948
NM_001001396chr133162 2747 1569 --22954 434 74408 4405 4402 3939 2958 123 120
NM_001001419chr5104412 3527 2012 1990 1836 1485 1113 989 375 358 23753 3167 13748 14946
NM_001001420chr5104412 3527 2012 1990 1836 1485 1113 989 375 358 23753 3167 13748 14946
NM_001001557chr871796 1576 848 626 509 252 155 11890 31457 1423 92 21427 459
NM_001002814chr8103896 3808 3703 3073 3044 2837 1354 1201 755 311 --53546 3373 3139 2990 998 23485 3450
NM_001003407chr10134905 4686 4399 4311 4245 3917 3847 3098 1375 693 440 190 89 23309 445 11399 11644
NM_001003408chr10134905 4686 4399 4311 4245 3917 3847 3098 1375 693 440 190 89 23309 445 11399 11644
NM_001003652chr18148138 8060 8000 7223 7076 5844 3480 3260 3150 3103 1991 1908 860 582 37853 225 217 27855 7602 21884 220
NM_001003674chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_001003675chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_001003800chr953655 3030 2779 558 507 32425 1085 589 11260 23659 3272
NM_001003940chr1583445 3236 3083 2643 2444 367 297 54 23196 1441 22788 1076 53758 3755 2448 1552 231
NM_001003942chr1583445 3236 3083 2643 2444 367 297 54 23196 1441 22788 1076 53758 3755 2448 1552 231
NM_001003943chr1583449 3240 3087 2647 2448 371 301 58 23200 1445 22792 1080 53762 3759 2452 1556 235
NM_001004330chr12121897 1444 1371 1360 1293 328 276 263 198 166 118 99 21470 639 11165 --
NM_001004419chr1293936 3773 3676 2977 1392 1366 1126 1109 943 14014 44086 1421 1101 40 2973 970
NM_001005473chr5156334 6132 5942 5567 4666 1913 1890 1446 1194 988 980 945 886 665 37 51205 1159 1083 1031 938 61207 1078 1018 1002 969 957 31086 1071 1051
NM_001005502chr12134587 4488 4041 3774 3541 3246 1890 1475 789 593 295 280 103 1320 21548 783 1127
NM_001007023chr14124690 4215 4148 3795 3410 3381 1298 1161 900 331 292 128 54951 3670 3625 823 713 44820 1349 828 825 31347 1344 254
NM_001007094chr10164231 4187 4042 3800 3729 3578 3066 2800 1115 954 598 514 379 317 119 107 34148 1724 366 14150 --
NM_001007097chr984523 3752 1981 1781 1313 1123 1041 930 1746 --2752 749
NM_001009880chr22103771 3727 3609 3476 3211 1832 835 724 547 433 33441 1234 275 32991 1932 314 22995 1237
NM_001009993chr273303 1832 1414 1076 1045 990 895 24265 3454 --13954
NM_001010846chr174207 4117 3731 970 791 769 591 63292 3151 2821 1790 1484 975 13401 1725
NM_001010888chrX123902 3789 3665 3605 3441 3393 3239 1871 1672 1476 1366 179 13536 13538 --
NM_001010891chr5156382 6093 5905 5532 5028 4915 2481 2432 2197 2154 1034 537 506 238 160 56633 2084 692 104 80 34886 1704 787 --
NM_001011666chr796070 4572 4361 2390 2169 1994 1949 1296 1210 46539 4923 2487 31 16252 26372 4926
NM_001012393chr11174625 4253 3869 3697 3514 3487 3404 3180 3144 1828 1741 1682 1600 1452 1322 1233 748 34379 4360 3604 --14382
NM_001013438chr33664 306 128 1114 1164 190
NM_001013659chr19145310 4991 4978 4574 4426 4174 3949 3712 3433 1965 1877 1627 882 364 44025 3341 1828 1743 15355 11501
NM_001013746chr781929 1646 1590 482 402 384 297 65 1317 22193 1532 --
NM_001014380chr13105011 4346 4130 1481 1263 709 604 466 142 52 1444 1785 --
NM_001014797chr10198012 6916 6842 6775 6686 6562 6551 6534 6068 5925 5911 5532 5302 4972 3135 2867 2072 527 113 57340 6664 5075 3297 635 26845 1548 28108 6274
NM_001017395chr3113032 3003 2509 2423 1450 931 911 783 507 324 190 11143 --11125
NM_001017440chr7287678 7180 6962 6951 6818 6721 6583 6493 6456 6139 6123 5555 5301 5101 3224 3187 3166 2689 2606 2566 2439 2433 2377 2359 1898 1289 775 453 57634 7310 7151 6984 2611 37636 5457 480 15455
NM_001017535chr12112988 2965 2787 2752 2741 2723 2183 2080 641 609 349 --32882 2479 909 42880 2487 2477 957
NM_001017995chr5134375 4312 4019 3581 3259 1491 1232 1078 951 828 515 499 352 13660 1997 21005 995
NM_001018065chr984674 4008 2424 2016 1756 1001 160 50 35151 1746 1007 --25501 79
NM_001018066chr984674 4008 2424 2016 1756 1001 160 50 35151 1746 1007 --25501 79
NM_001024455chrX62666 2611 2544 2273 903 208 22507 448 32264 883 880 5894 891 888 586 131
NM_001024647chr12227579 7220 7146 6222 5958 5643 5324 5236 2915 2613 2533 2143 1818 1642 1338 854 839 497 395 202 133 89 11977 --15549
NM_001024948chr173120 2774 2408 1393 1308 851 257 4899 550 465 40 31329 1296 1112 1929
NM_001025077chr10116858 5949 5941 5789 5770 2497 2116 1254 986 430 320 16800 36466 524 514 15462
NM_001025389chr1131614 1295 116 --1471 21378 103
NM_001025390chr1131614 1295 116 --1471 21378 103
NM_001025580chrX84229 4150 3766 3437 1552 904 730 415 2880 847 23240 785 11476
NM_001030007chr16143937 3571 3526 3272 3198 2828 2810 2610 2497 1516 719 561 308 115 22772 1019 158 1962
NM_001030288chr1695470 5164 4857 4615 4597 4115 3846 2173 1863 54962 4658 1969 1954 1789 41971 1812 1177 735 --
NM_001031695chr22115163 3660 3536 3488 3454 1944 1000 579 454 344 79 14821 55403 1397 1009 348 333 31987 352 101
NM_001034841chr16124941 4760 3853 3659 3354 2099 1902 963 657 531 307 290 --1321 24885 1107
NM_001037165chr7158754 6714 6700 6655 6414 6244 5581 5443 2817 2612 1652 1332 724 327 95 27519 2680 48676 6798 1646 1231 21644 1336
NM_001037954chr1183294 3062 2981 2539 2215 2163 791 92 43184 2763 2716 906 11140 --
NM_001039538chr283039 3017 2775 2233 507 456 449 434 2386 204 23008 627 --
NM_001039547chr3127948 7856 7769 7304 7246 6123 6095 5669 5090 2242 1139 130 23056 97 1910 --
NM_001039937chr1373651 2746 1462 1440 1267 476 364 33459 2833 1531 11184 13227
NM_001040001chr641746 1590 495 375 186 188 2316 78
NM_001040152chr784861 4285 4070 3934 3391 1772 1662 1533 44226 4075 3969 1013 23576 782 14078
NM_001040429chr1372929 2859 2349 2231 325 285 97 4990 737 272 263 --2740 298
NM_001040712chr983548 3137 1315 1269 1091 240 212 85 22312 340 --22584 285
NM_001042355chr16104743 4623 4385 4252 4089 3375 1716 1663 230 185 65282 4421 4035 3746 2134 2127 44903 4607 4435 3748 34605 4433 427
NM_001042412chr16104743 4623 4385 4252 4089 3375 1716 1663 230 185 65282 4421 4035 3746 2134 2127 44903 4607 4435 3748 34605 4433 427
NM_001042599chr2197654 7513 6352 6201 5884 5458 5060 4827 3013 2542 2389 2264 1659 1347 1031 936 261 244 201 16837 22733 2426 --
NM_001042601chr352397 2316 2101 2094 43 52566 1276 1014 1009 946 11016 12623
NM_001042603chr1294883 4828 4717 4474 1354 780 725 612 595 35379 3698 824 --33987 827 705
NM_001042604chr384616 3597 3101 3094 1222 926 498 402 13941 11852 24079 3237
NM_001044385chr264056 3842 2981 2782 695 22 33966 3944 729 --21085 982
NM_001049chr1461807 782 166 73 66 59 12429 1785 --
NM_001100108chr1167530 7223 7158 6564 6453 5863 5601 2709 2456 2252 2167 2027 1055 629 280 173 67747 6427 6327 2043 1637 1580 11328 --
NM_001106chr3229748 9121 8942 8908 8404 7490 3921 3724 3493 3475 3442 2706 2561 2469 2015 1939 1560 800 755 426 294 44 23022 1073 79722 6749 6681 3519 3515 3024 1828 1471
NM_001113490chrX83310 2945 2737 2634 1300 1250 462 351 23540 2415 22417 976 12544
NM_001117chr185886 779 695 525 286 11771 1908 31783 1780 770
NM_001128chr16143937 3571 3526 3272 3198 2828 2810 2610 2497 1516 719 561 308 115 22772 1019 158 1962
NM_001204chr2177307 6984 6898 6119 5956 5012 4760 4720 3051 3034 2934 2924 2268 1247 1210 733 699 11690 27716 656 17720
NM_001206chr921241 114 23107 45 4970 967 221 93 22802 965
NM_001256chr1742734 1916 808 322 1301 --32244 1161 862
NM_001259chr7115890 5680 5082 4952 4784 4052 4003 2492 2018 1944 37 44857 4372 2056 683 24202 4148 1262
NM_001271chr15112906 2628 2448 2429 2280 2170 2159 1987 1288 1127 922 12057 72539 2111 2059 945 625 571 137 --
NM_001331chr1161779 832 805 788 534 371 1817 22248 835 2865 862
NM_001343chr541147 1141 677 34 11134 11407 11405
NM_001412chrX53433 3027 1497 464 323 21289 76 1986 1984
NM_001609chr10124495 4011 3748 3337 3181 2912 2811 1534 1429 1240 1205 871 33147 2891 1421 12846 --
NM_001650chr1883957 3793 2904 2636 1484 1418 176 165 53504 3078 2706 2623 787 ----
NM_001759chr12175211 5148 5068 4650 4237 4100 3683 3671 3603 3301 2098 1704 1572 1450 1235 473 457 34493 4483 4203 44246 3747 538 492 24150 3925
NM_001829chr45997 774 665 213 205 2199 25 139 137
NM_001858chr694522 3813 3431 1544 1421 1279 1113 1056 964 11082 --14254
NM_001874chr12134587 4488 4041 3774 3541 3246 1890 1475 789 593 295 280 103 1320 21548 783 1127
NM_001918chr1189173 9009 8228 7866 7588 7413 3595 3514 3497 3301 2886 2546 1968 1830 1812 1073 1018 485 67739 6516 2789 1982 1184 1175 56021 3412 3216 3013 1179 --
NM_001945chr551278 1214 430 411 388 3368 216 50 31187 1022 376 3380 374 371
NM_002025chrX128745 8597 7494 6124 6100 5915 5893 5629 3642 3582 2815 803 68776 8540 6868 2358 1996 680 ----
NM_002035chr1873579 3324 2712 2435 1248 1157 816 ----21519 23
NM_002214chr7125520 5431 5099 4577 3767 3457 1684 1558 1126 526 413 290 ------
NM_002223chr1273779 3407 3249 3198 1518 432 313 73934 3271 3006 2969 753 692 244 --53274 2491 2486 2483 297
NM_002268chr311453 11169 11317 21175 1172
NM_002270chr594816 4319 4220 4126 3536 1795 723 528 446 25229 386 1272 --
NM_002313chr10134905 4686 4399 4311 4245 3917 3847 3098 1375 693 440 190 89 23309 445 11399 11644
NM_002336chr12104779 3875 3396 3291 1837 1737 1481 573 165 93 24745 386 13497 2392 389
NM_002374chr283039 3017 2775 2233 507 456 449 434 2386 204 23008 627 --
NM_002383chr164127 121 109 32 1670 1824 2644 132
NM_002409chr2272920 2793 2743 2018 705 509 330 33207 2597 537 1486 23210 855
NM_002451chr9133926 3647 3627 3621 3592 3543 3014 2995 2679 1505 536 199 23 21038 30 33681 3280 2737 21041 351
NM_002545chr11174625 4253 3869 3697 3514 3487 3404 3180 3144 1828 1741 1682 1600 1452 1322 1233 748 34379 4360 3604 --14382
NM_002581chr9124832 4545 2245 1635 1608 1357 1344 1304 1055 1015 465 149 45260 4768 1962 627 34686 1686 629 --
NM_002612chr792004 1542 1302 1294 647 500 263 173 145 31415 1323 539 --11418
NM_002737chr17136409 6216 5976 5239 4654 4606 2584 1868 1683 1209 928 711 439 15381 14181 36473 2571 2286
NM_002760chrY154786 4454 4393 4383 4237 4047 3726 2351 2191 2072 1572 1139 397 208 160 35337 804 217 34118 1888 1779 1817
NM_002839chr983548 3137 1315 1269 1091 240 212 85 22312 340 --22584 285
NM_002886chr3115132 4058 3710 3234 3165 1659 810 499 487 380 371 14402 31679 1161 512 1528
NM_003010chr1772127 2070 1728 760 658 487 380 41933 1864 851 435 2986 44 --
NM_003034chr12188121 8079 7843 7785 7234 7111 6270 5853 5839 4957 2309 2038 1988 1596 1239 327 123 67 37449 7260 5862 47177 6957 6156 5864 36955 5422 5054
NM_003043chr3134114 3793 3224 3126 3107 2686 1551 1440 930 877 837 580 534 1670 22618 933 1629
NM_003099chr15136461 5326 4896 4873 4779 4498 4430 4041 2240 2048 997 687 471 56139 4837 4160 1988 651 24972 622 25515 1991
NM_003108chr266940 6523 6317 2414 2183 661 45854 5158 2240 145 22302 61 32711 2233 148
NM_003123chr1695470 5164 4857 4615 4597 4115 3846 2173 1863 54962 4658 1969 1954 1789 41971 1812 1177 735 --
NM_003236chr283555 3548 2847 2176 1311 893 505 450 32799 1162 204 43067 1314 1164 460 1948
NM_003326chr182462 2366 2202 1034 867 601 427 126 1570 2435 91 1419
NM_003370chr196730 714 698 604 301 292 1720 2722 306 --
NM_003421chr10164231 4187 4042 3800 3729 3578 3066 2800 1115 954 598 514 379 317 119 107 34148 1724 366 14150 --
NM_003441chr491149 1069 985 924 904 522 239 192 107 ----11373
NM_003466chr242415 2244 1648 328 21548 307 1314 1273
NM_003574chr1895457 5298 4977 4234 3774 3646 1458 762 429 35248 5160 948 25250 5162 --
NM_003671chr9112240 1380 1354 1213 831 759 695 353 199 136 121 131 --12562
NM_003743chr282229 2111 1900 715 708 651 333 154 41589 626 405 357 31591 1433 407 21564 360
NM_003759chr483250 3198 3027 2956 1444 804 495 339 1672 --34265 1153 1140
NM_003800chr642196 642 305 45 237 30 11717 --
NM_003822chr152475 2317 890 359 308 32084 1187 77 --168
NM_003947chr341293 1201 960 505 1540 2518 377 2516 513
NM_004028chr1883957 3793 2904 2636 1484 1418 176 165 53504 3078 2706 2623 787 ----
NM_004171chr11169103 8531 8281 8047 7141 6726 6396 3761 3728 3569 3145 2631 2569 1548 734 254 39051 3270 2276 ----
NM_004290chr541278 894 365 127 31349 1210 320 3531 325 163 1323
NM_004316chr123919 284 107 31008 150 131 --4153 140 137 134
NM_004338chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_004380chr1652460 2260 2002 1989 758 52608 2572 820 716 405 1718 12577
NM_004397chr11114110 3997 1375 1334 1296 510 433 307 282 174 156 2324 296 ----
NM_004441chr3101169 1121 1108 1071 912 899 361 280 131 110 21051 337 21053 348 126
NM_004586chrX94158 4089 3394 3299 1766 1673 979 860 209 34662 4199 968 ----
NM_004612chr9114310 4272 4162 3365 3126 3083 1642 1180 550 341 101 34175 3829 1741 11331 --
NM_004703chr174381 122 97 90 22554 114 12450 1146
NM_004744chr483853 3405 3339 3010 2510 1097 683 443 43571 3503 2835 2633 12674 12636
NM_004745chr8116974 6367 5648 5471 5416 5321 4492 1495 1259 1182 733 22524 1076 --14775
NM_004748chr15164165 3857 3833 3759 3529 3016 2793 1342 1088 1077 993 955 904 768 491 375 ------
NM_004763chr21115 ----6824 772 716 436 380 324
NM_004798chr20103463 3169 2887 1335 1177 1016 906 618 585 509 42523 2454 1208 53 42832 2829 955 115 --
NM_004834chr2103125 2354 2323 2134 1018 922 551 433 418 410 22302 533 22385 2304 1536
NM_004863chr14135146 4866 4603 4246 4150 3995 3827 3696 3280 2136 1706 798 26 12093 22139 1465 11401
NM_004884chr1511379 21306 327 1342 21499 1309
NM_004904chr796070 4572 4361 2390 2169 1994 1949 1296 1210 46539 4923 2487 31 16252 26372 4926
NM_004956chr784507 4114 4007 2972 1665 1523 1292 227 24321 1474 23944 1385 24048 3350
NM_005044chrX113305 3123 2973 1756 1130 1094 737 676 594 214 25 53859 2894 1222 666 34 12896 11680
NM_005056chr12105127 5072 4961 4718 1598 1024 969 856 839 154 35623 3942 1068 --34231 1071 949
NM_005065chr14125081 4558 4238 3871 3567 1910 1673 1272 834 667 121 39 24457 4397 23838 106 13836
NM_005156chr975174 4993 4045 3419 2114 2013 1496 25219 4752 --1304
NM_005188chr11147999 7589 7396 6556 5370 5329 5282 1538 1241 1192 1075 1022 760 469 18028 16163 11993
NM_005197chr14116234 5957 5806 5671 5129 4464 3972 3919 2035 1268 503 25969 207 54296 4106 1968 1964 1904 2865 707
NM_005235chr2197654 7513 6352 6201 5884 5458 5060 4827 3013 2542 2389 2264 1659 1347 1031 936 261 244 201 16837 22733 2426 --
NM_005238chr1193248 3117 1405 1380 1300 1240 921 785 441 12691 32763 1018 242 11023
NM_005338chr7133906 3802 3633 3440 3349 3174 2956 2711 1403 1246 961 952 535 33764 1451 1179 23057 274 2939 870
NM_005359chr18126374 6145 4909 4592 4079 2455 1994 1642 804 391 269 229 36401 5406 816 26304 6096 --
NM_005399chr1104311 3678 3612 3199 3052 2896 1776 1484 1236 1040 44201 3040 326 222 2224 36 13249
NM_005400chr262850 2739 2081 1165 649 39 32200 368 53 --1465
NM_005497chr1775453 3979 2440 2258 2000 1188 962 46145 5413 2388 537 22366 592 42309 2059 547 256
NM_005504chr12126508 6086 5903 5671 5357 5249 4955 4735 4202 4077 1718 1434 55300 4963 2343 1016 587 36106 1941 1018 15280
NM_005596chr9106105 5891 5544 5510 4253 1636 1202 783 225 82 33932 231 178 14897 1181
NM_005665chr184841 4177 4029 3803 3599 1765 1677 1095 14804 23295 1313 24323 3299
NM_005668chr574193 4155 3804 3507 1790 1509 601 34280 2983 1796 --1354
NM_005715chr6102649 2095 2025 1995 1887 643 477 448 437 296 22780 914 12652 --
NM_005828chr17105046 4286 3431 3398 3145 1624 1584 1248 1237 773 44346 4001 3318 74 54796 4040 3996 3699 2036 --
NM_005840chrX137504 7473 7186 6651 6355 6337 5648 5550 4776 2724 1553 1231 1161 37236 6030 5415 67370 6034 5417 2021 1994 1984 --
NM_005901chr18148138 8060 8000 7223 7076 5844 3480 3260 3150 3103 1991 1908 860 582 37853 225 217 27855 7602 21884 220
NM_005902chr15104334 4114 3751 2871 1603 1377 1260 1118 732 62 53804 3096 1779 418 100 33386 1826 1790 23491 103
NM_005903chr5104412 3527 2012 1990 1836 1485 1113 989 375 358 23753 3167 13748 14946
NM_005909chr5124073 4050 3884 3684 3105 2664 1639 1362 948 628 488 418 --23947 1261 1422
NM_005935chr4145164 4866 4826 4361 4336 4273 3460 1606 1265 541 488 414 347 108 35291 4500 3373 24032 896 --
NM_005941chr863066 2906 2869 1117 934 384 73236 2611 2562 2548 546 315 301 13073 1304
NM_005955chr1115412 5047 4429 4019 3910 1775 1738 1558 1505 97 90 15363 1943 --
NM_006007chr954280 4078 3479 3218 1682 3766 504 487 --11807
NM_006011chr1592989 2785 2621 655 522 430 306 289 241 1229 1231 2887 746
NM_006139chr2102757 2378 2244 2216 2062 1158 994 767 385 270 32647 2347 481 11771 --
NM_006203chr595275 5266 5169 5159 2182 2126 1647 680 373 35196 2082 1727 25201 5053 15199
NM_006252chr1117423 6121 5973 5842 5577 4783 2879 2206 2023 1511 577 57547 7027 6193 5999 443 11711 12481
NM_006282chr2044159 3678 1706 1273 34053 3824 808 34055 3471 696 23682 3469
NM_006283chr8134037 3879 3849 3767 3127 1769 1550 1062 990 591 475 207 176 43693 1256 1242 435 11258 21245 713
NM_006306chrX125786 5754 5709 5435 4747 3578 2155 1474 1237 1175 714 217 22314 652 65585 5216 4856 3593 1083 413 1148
NM_006371chr3135090 4703 4221 3696 2120 2052 2010 1842 1762 1641 1358 1225 1159 55080 4830 1767 1622 1008 24015 1624 11457
NM_006393chr10104471 4308 4089 3912 3364 3266 1058 951 500 310 1148 1150 13184
NM_006464chr2154604 4209 4148 3740 3721 3598 3578 3453 3260 3194 3125 1536 1356 1150 136 23100 3089 23849 908 --
NM_006544chr14135915 5420 5238 5110 5016 4997 4624 4298 4043 2330 1816 1215 46 1979 15727 --
NM_006546chr17166368 5290 5199 4858 4517 2589 1946 1886 1774 1210 686 647 318 293 271 160 14509 66332 5406 4323 4072 1509 632 45404 5401 4067 630
NM_006572chr17113443 3263 3059 2975 2667 2633 2421 2366 2133 1072 652 13148 ----
NM_006609chr272194 2125 1014 937 823 117 104 1389 --1392
NM_006720chr10134905 4686 4399 4311 4245 3917 3847 3098 1375 693 440 190 89 23309 445 11399 11644
NM_006729chrX73648 3472 1914 975 733 506 298 44295 1479 380 62 15537 11080
NM_006750chr16127411 7318 5925 5806 5394 5367 2268 1601 1539 1486 951 529 36031 1608 156 --15514
NM_006851chr1242178 1846 1813 819 42380 2125 802 144 --22165 2128
NM_006902chr193363 2682 2614 2525 2468 986 666 160 134 22628 188 13218 11011
NM_007006chr1672980 1261 1040 765 440 163 29 2850 649 --12452
NM_007050chr20256993 6968 6532 6518 6397 6298 6169 6099 5702 5549 5333 5287 4967 3043 2960 2837 2663 2634 2557 2267 1898 1838 1435 950 853 67843 6912 5445 3199 1066 121 35447 2143 2030 1124
NM_007114chr343079 951 735 393 1302 1793 1305
NM_007137chrX145378 4642 4548 2144 1870 1563 1300 1081 920 862 853 490 322 163 11444 --34145 326 190
NM_007153chr19194417 4240 3712 3433 3303 3186 1350 1335 1055 942 920 904 659 596 428 259 154 90 72 23789 1308 24424 4420 --
NM_007172chr2273135 2930 2812 2670 2644 969 404 12709 23313 654 1132
NM_007249chr13128369 7779 7240 6825 3293 2881 2700 1001 922 622 237 141 57117 6231 3510 2833 782 21499 507 --
NM_007350chr1294274 3811 3652 3576 3546 3166 1633 896 432 44417 1308 827 215 2832 46 1830
NM_012095chr1093290 3187 2589 2519 1369 960 796 441 166 22885 227 --22891 2888
NM_012104chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_012104chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_012141chr1373651 2746 1462 1440 1267 476 364 33459 2833 1531 11184 13227
NM_012153chr1192537 2520 2405 2204 1829 1623 1596 837 545 31950 812 623 11832 1147
NM_012164chr9107342 7225 6877 6597 5190 4993 3006 1721 1120 1066 --25135 1382 15133
NM_012192chr11102262 1777 874 744 725 644 291 189 52 22 --31805 940 432 1923
NM_012193chr11155269 4856 4226 3893 3790 2077 1705 964 845 807 796 573 378 310 61 --13530 --
NM_012199chr184242 4182 2849 927 870 450 86 34 53446 3409 3185 574 497 44029 3574 1739 79 --
NM_012214chr2126404 6152 6140 5520 4489 4211 4158 4111 2225 2194 1448 470 36287 4498 4017 25523 4755 --
NM_012219chr372637 1987 1973 1290 1282 208 121 33256 2216 710 32040 1990 128 12038
NM_012252chr795298 4972 4174 3587 1996 1344 1094 261 148 24934 160 --1877
NM_012288chr6105464 5011 4606 3613 1976 1942 1545 1275 664 57 1508 15293 25170 4074
NM_012316chr1165599 5534 5304 5124 4801 4535 3833 3601 3457 3451 2212 990 492 305 220 54 34220 1214 1141 24342 1816 21257 1217
NM_012382chr574016 3414 3179 1586 1423 372 92 11255 13243 13241
NM_012395chr7103025 2721 2486 2165 1221 1176 868 856 492 56 33321 2914 2566 22134 78 --
NM_013231chr1474019 3927 3843 3344 3188 1652 888 43640 3013 783 417 33015 872 571 --
NM_013255chr7158855 8427 8293 7917 7671 7000 6349 6224 5626 2787 2021 1326 1037 886 863 77777 7529 6641 6175 5604 1850 1416 13306 37298 6178 5741
NM_013269chr1293863 3700 3603 2904 1319 1293 1053 1036 870 13941 34013 1348 1028 2900 897
NM_013382chr1482083 1943 1828 1640 1537 765 109 100 12092 72215 1996 1990 1954 1716 593 88 42307 2304 1994 1701
NM_013951chr242415 2244 1648 328 21548 307 1314 1273
NM_013952chr242492 2321 1725 405 21625 384 1391 1350
NM_013953chr242492 2321 1725 405 21625 384 1391 1350
NM_013989chr14124690 4215 4148 3795 3410 3381 1298 1161 900 331 292 128 54951 3670 3625 823 713 44820 1349 828 825 31347 1344 254
NM_013992chr242492 2321 1725 405 21625 384 1391 1350
NM_014112chr8124639 4527 4290 4185 3997 3825 3798 3649 1768 1460 1451 474 14279 --14282
NM_014155chr11176825 6722 6476 6441 6387 4620 4590 2598 2557 2292 2133 1721 1676 951 628 594 59 75751 2617 2607 2580 513 178 31 35943 5617 183 1181
NM_014190chr421368 118 2338 296 4301 212 128 121 3341 329 299
NM_014240chr373863 3032 2549 1209 1088 925 547 32713 1621 966 21518 1447 2747 100
NM_014309chr22115153 3650 3526 3478 3444 1934 990 569 444 334 69 14811 55393 1387 999 338 323 31977 342 91
NM_014331chr497013 6097 5887 5457 1534 1446 708 267 113 76012 2614 2301 1266 919 604 461 ----
NM_014360chr143843 549 284 1556 2704 564 --
NM_014423chr5105624 4494 4204 4113 1962 1751 1300 765 104 60 24150 2026 34152 4047 788 --
NM_014613chr5133042 2957 2918 2858 2421 2125 2100 1879 794 479 460 451 162 12190 12861 12411
NM_014630chr15103914 3895 2755 1564 1315 1033 1008 711 621 441 --21527 444 32520 1284 1281
NM_014721chr6126380 6206 5496 5269 4649 4607 2911 1174 556 438 196 122 75480 2941 2843 2820 932 806 283 12778 --
NM_014730chr12115005 4643 4467 4209 4116 4050 3854 3616 1554 847 144 1134 43968 3394 2089 1533 23972 856
NM_014730chr12115005 4643 4467 4209 4116 4050 3854 3616 1554 847 144 1134 43968 3394 2089 1533 23972 856
NM_014732chr16175833 5457 5450 5071 3941 2355 2271 2161 972 861 846 798 577 555 301 287 148 --24580 4098 --
NM_014737chr20203657 3150 3143 3127 3081 2967 2789 2622 1646 1569 1536 1326 1284 949 860 743 552 420 235 64 32930 2841 796 1485 --
NM_014739chr6114216 3376 3323 1598 1581 1331 1222 1064 849 780 557 12609 --13360
NM_014741chr1151922 1766 1654 833 237 21456 445 51957 869 477 470 447 3468 451 207
NM_014774chr163203 2787 2107 993 757 639 42696 2684 493 170 1141 22480 173
NM_014827chr141109 621 552 534 21338 1144 11175 21173 1170
NM_014873chr194840 4482 4077 4045 3680 3278 1759 1120 465 33878 3507 3204 11516 33510 270 267
NM_014877chr1797507 5771 5536 5098 2338 1052 779 285 27 41938 1930 1264 1067 27016 5637 --
NM_014974chr1041604 1470 580 213 1626 11607 4144 141 132 129
NM_014982chr1485426 5128 4810 1709 1642 935 248 67 34416 3486 955 15138 24223 958
NM_015008chr3113032 3003 2509 2423 1450 931 911 783 507 324 190 11143 --11125
NM_015035chr20156357 6295 4701 4684 4387 2497 2255 1903 1596 1424 1011 575 559 61 24 --35908 5451 4998 15455
NM_015049chr2122916 2731 2675 2112 1323 767 402 394 385 225 137 46 12527 22825 173 --
NM_015051chr993272 3159 2922 2898 2742 2714 2456 2445 1079 33387 3351 817 12249 12162
NM_015064chr12133584 3189 2751 2266 1338 1159 880 865 644 616 429 356 199 22780 1068 33239 2782 496 13201
NM_015068chr793713 3137 2922 2786 1142 1049 624 514 385 33078 2927 2821 12428 32930 1204 1201
NM_015071chr5145414 5389 5366 5301 4873 4592 3947 1982 1858 1823 1797 1381 401 208 84606 2587 2348 1867 1620 1318 336 245 44608 1784 531 338 44081 2354 2351 248
NM_015076chr6113865 3250 1514 1376 1252 918 879 847 663 298 123 33765 3090 183 11782 --
NM_015090chr1114949 4891 4760 4455 3940 2449 2300 1609 883 821 471 44778 4541 1638 932 54211 4035 2375 688 52 25590 1613
NM_015192chr2072034 320 301 215 156 145 99 22854 1147 --22103 946
NM_015206chr1573683 1263 918 889 635 424 390 2417 303 23364 638 --
NM_015215chr193203 3098 2622 2599 2038 702 469 301 291 1320 1322 --
NM_015234chr65445 427 419 399 302 41475 459 412 141 1143 --
NM_015247chr16104743 4623 4385 4252 4089 3375 1716 1663 230 185 65282 4421 4035 3746 2134 2127 44903 4607 4435 3748 34605 4433 427
NM_015264chr22103771 3727 3609 3476 3211 1832 835 724 547 433 33441 1234 275 32991 1932 314 22995 1237
NM_015288chr521190 468 32914 2555 1497 33008 2767 2557 42917 2765 1521 1500
NM_015299chr14173823 3576 3537 3224 3115 2842 2769 2692 2599 2455 1504 657 642 625 356 346 199 33459 2680 2544 33257 2546 509 1443
NM_015310chr8218369 7690 7617 7486 7030 6710 6702 6399 5948 5305 5207 3366 2658 2561 1749 1382 1143 1047 720 599 21 47146 6273 5483 687 35957 2535 689 11374
NM_015352chr20153940 3651 3043 2989 2964 2856 2770 2724 2450 2442 1526 1404 1284 707 154 13751 53216 3015 2784 1529 991 1132
NM_015365chrX84229 4150 3766 3437 1552 904 730 415 2880 847 23240 785 11476
NM_015375chr1224923 4487 4423 4306 4093 4040 3812 3704 3693 3418 3118 1924 1608 1457 1297 881 689 657 290 258 169 68 1671 33843 1736 1635 13235
NM_015569chr194776 4267 4031 3884 3776 3573 3540 833 518 44279 3927 3525 733 24638 735 --
NM_015713chr892589 2380 1393 1358 1322 1307 1139 657 576 23189 2601 43580 2244 1438 1114 --
NM_015852chr7172738 2634 2410 1401 1236 1155 1071 903 819 651 567 483 399 315 231 129 63 ------
NM_015879chr18238519 8440 8418 8131 8095 7461 7434 7358 7333 7317 7279 7196 6889 6482 6319 6308 5240 3385 2505 2458 2397 1638 1327 57413 3279 2175 2164 998 38313 8041 7415 21940 1001
NM_015886chr8135375 3688 3637 3565 1944 1679 1541 1418 981 973 857 793 311 45479 5030 4500 2187 15601 --
NM_015905chr76577 487 238 227 211 195 191 --1199
NM_016173chr3124485 4197 4127 4101 3737 1814 1506 1491 1257 1141 785 548 14234 44046 3023 1778 407 14181
NM_016206chr3178449 8330 8026 7829 6823 6553 6532 6097 3557 2674 2393 1577 1556 1061 848 513 185 12911 --42245 1442 114 111
NM_016220chr781929 1646 1590 482 402 384 297 65 1317 22193 1532 --
NM_016260chr2137452 6723 6667 6076 4840 3033 2675 2577 2567 1594 1014 194 53 3531 441 184 ----
NM_016357chr123858 848 386 ----2866 863
NM_016531chr484210 3989 3186 2907 2826 2817 1682 1542 11618 1745 11611
NM_016953chr2135438 5385 5353 4727 3731 2409 1674 1443 1021 761 722 192 180 12427 11969 --
NM_017447chr2184083 3611 3525 3403 3174 1102 355 76 2736 652 167 --
NM_017551chr10112397 2284 2040 1912 1737 997 781 678 390 355 303 --41674 871 812 377 22071 955
NM_017563chr396161 5882 4695 4601 2484 2140 1982 1810 297 35566 1615 320 11909 24605 1714
NM_017633chr693837 3275 3251 2625 1343 937 784 762 412 43020 1259 907 296 23022 1230 --
NM_017637chr9188998 8883 8299 8030 7898 7675 7643 7619 7330 6860 5899 3738 3374 3061 2406 2323 745 231 77608 7234 7128 6928 5868 1871 1639 11526 28599 6154
NM_017650chr7145843 5701 5480 5133 4425 4355 3848 2131 1948 1211 1078 312 129 41 --24640 1293 11297
NM_017709chr1113961 3770 3380 1360 1289 661 607 569 353 333 232 23987 3099 13989 --
NM_017919chr9145419 5396 4162 4153 4004 3996 3878 1719 1386 803 571 543 408 250 1941 12173 --
NM_018085chr1247004 6972 6622 6290 5816 5724 5563 5538 5148 3294 3119 3068 3052 3030 2517 2501 2045 1782 1473 1361 828 498 365 319 57968 6608 2743 1858 1576 57970 7289 5123 5101 2013 17287
NM_018200chr15102591 2454 2443 1874 867 842 597 161 60 53 31012 705 351 --1531
NM_018313chr341036 938 93 84 ----22479 2336
NM_018373chr14205895 5149 4912 3917 3907 2475 2431 2245 2178 2008 1653 1647 1467 1214 1058 893 624 557 202 191 45359 2326 687 472 --1370
NM_018440chr8168504 8331 7956 6945 6330 6120 6103 6080 5496 3278 2653 2105 1767 1689 1213 306 36616 1411 69 37441 7166 71 17164
NM_018452chr6_random123780 3705 3680 3189 2840 2662 2392 1417 941 706 501 396 31390 999 208 --13583
NM_018490chr1131626 402 303 --1122 21156 126
NM_018638chr1295655 5637 5475 5098 4635 3780 1288 1263 547 34936 3932 1985 ----
NM_018660chr8102963 2891 2851 2481 2165 1105 795 682 338 56 11073 41242 1239 1063 845 11120
NM_018945chr642963 2949 2335 1102 23179 2376 --32522 287 275
NM_019001chr384616 3597 3101 3094 1222 926 498 402 13941 11852 24079 3237
NM_019008chr22113741 3211 3076 2568 2472 2292 1358 923 562 475 261 33377 2555 1240 --33786 2719 2403
NM_019027chr442075 1607 110 47 22163 1731 170 42175 2172 2169 2166
NM_019044chr2104538 4502 4140 4038 4019 3601 3314 1080 981 231 21000 331 14677 53300 2981 1686 909 390
NM_019063chr272105 1406 918 826 772 646 87 21762 1647 --21944 225
NM_019072chr593988 3725 3255 2871 1315 1163 476 396 130 24082 439 1441 13299
NM_019089chr183433 3294 2423 1325 784 670 247 200 13463 43465 2298 743 266 2264 235
NM_019106chr2283283 2981 1152 1084 1039 561 552 541 12848 12152 12830
NM_020122chr285069 4434 3680 2136 1749 1553 436 422 35537 4523 137 13953 25676 284
NM_020133chr6156098 6069 4695 4113 4018 2445 2309 1765 1608 1497 1475 1355 1280 977 783 11167 25682 1779 21170 169
NM_020180chr1841057 1045 905 276 ----2269 266
NM_020182chr2093565 3343 3014 2940 2855 1276 1208 993 692 --2466 82 3863 506 71
NM_020205chr1123163 3112 3000 1120 769 633 624 531 441 379 367 27 21213 703 23104 3072 --
NM_020336chr2073356 2355 939 566 471 293 135 23880 1311 43830 3783 2528 463 12526
NM_020416chr492376 2262 2166 1949 1829 232 144 89 81 32231 2074 1004 11006 --
NM_020440chr183375 3194 2365 1276 977 809 796 760 32139 2099 57 33113 900 351 23111 60
NM_020443chr1226828 5561 5214 5082 4768 4403 4288 2564 1819 1751 1736 1419 1232 1201 1176 992 712 628 519 427 185 114 42556 2373 2368 141 56911 6246 5756 5753 2270 21099 1096
NM_020466chr6124440 4426 3502 1656 1489 1333 1324 882 832 506 488 21 33099 1370 219 11372 11547
NM_020673chr20147761 7183 6983 6809 6765 6685 5583 5494 2844 2797 2034 1850 1490 718 1781 22694 799 22692 784
NM_020699chr1145373 4616 4563 4535 4213 3961 1922 1777 1707 1093 1017 773 618 302 11616 34459 1662 1627 --
NM_020717chrX164872 4366 4078 3716 3197 1961 1910 1759 1493 1270 1208 1054 957 579 523 292 1922 43043 1057 924 639 --
NM_020718chr1676506 6394 4385 4099 2469 1040 771 21276 626 65181 4825 628 390 387 383 15449
NM_020727chr2163603 3484 3215 3119 1048 823 2681 431 32705 2698 433 13573
NM_020739chr15164165 3857 3833 3759 3529 3016 2793 1342 1088 1077 993 955 904 768 491 375 ------
NM_020742chrX102489 2253 1715 824 576 507 457 234 74 64 --158 --
NM_020752chr1072409 1814 1785 1149 83 27 21 32031 1047 416 21049 185 1148
NM_020772chr17138294 7337 6808 6319 6013 5874 3155 2552 1662 1544 1042 770 102 46234 6002 1253 1091 28511 8005 --
NM_020774chr18125917 5830 5749 5533 5085 4917 4670 4146 728 539 433 412 36091 4376 258 14445 15047
NM_020778chr15104737 4696 4349 4154 1708 1579 1567 961 802 49 --198 33163 1555 112
NM_020830chr232319 2096 1027 42810 2483 2117 1176 22100 1280 11171
NM_020844chr8116823 6008 5769 5696 5337 5281 2885 1124 986 725 559 26026 1214 36461 1550 238 --
NM_020956chr1984681 4423 4180 4159 3423 1319 797 451 14494 54496 4289 3533 2951 809 44287 623 620 617
NM_020960chr964931 4790 1777 1065 912 661 53723 3579 1278 449 268 64890 4630 3798 1600 451 386 21692 257
NM_021033chr1372562 1180 843 818 796 352 342 32520 882 412 ----
NM_021090chr22115023 4595 3337 3259 3206 1995 1898 1784 1544 1206 408 23666 1949 --11322
NM_021120chrX102976 2746 2665 2386 2163 2134 2004 323 88 37 32999 2064 332 33077 1110 793 13160
NM_021813chr6115017 4745 3953 3891 3809 3755 1896 1816 1794 1365 91 25183 3942 14210 24064 3945
NM_021905chr662270 2184 344 209 197 82 5832 507 408 358 202 3791 773 212 2795 222
NM_021911chr574950 4787 2217 1312 1130 916 609 23819 1609 --13822
NM_021949chrX61910 615 586 538 532 24 --41940 599 590 568 5597 594 546 543 513
NM_021960chr1122718 2564 2451 2103 1983 1934 1861 735 398 208 191 170 1137 11767 --
NM_021964chr3136233 5868 5770 5319 4871 4544 4106 2575 2262 2151 1749 1430 584 ----14074
NM_021977chr6113830 3381 3370 3297 3278 3125 2469 498 319 234 25 11252 128 11235
NM_022048chr15146140 6030 5322 4140 1831 1804 1678 1500 1139 1021 932 458 448 428 55150 4659 1542 1286 125 26013 4661 31143 483 420
NM_022091chr672664 2365 1775 669 274 182 129 41086 501 348 29 32468 2465 369 --
NM_022114chr1124530 4320 3862 1731 1532 1502 1264 870 716 648 79 54 11760 44696 4323 3122 757 14570
NM_022121chr641065 902 144 22 1403 --4412 409 406 56
NM_022334chr21115 ----6824 772 716 436 380 324
NM_022456chr12227579 7220 7146 6222 5958 5643 5324 5236 2915 2613 2533 2143 1818 1642 1338 854 839 497 395 202 133 89 11977 --15549
NM_022497chr393620 3156 3146 2927 2392 1345 1281 706 396 11321 1267 23426 265
NM_022648chr294080 3789 3205 3167 3161 1699 501 430 333 3941 312 121 33219 3081 91 22973 218
NM_022716chr173207 2526 2458 2369 2312 830 510 22472 32 13062 1855
NM_022719chr22103267 3080 3011 2983 1560 1238 1054 1000 896 135 13639 32628 2373 374 31175 1172 502
NM_022898chr1464308 3734 3361 3292 3112 1805 24121 1005 1482 24312 3365
NM_024345chr964636 4195 3914 1985 974 412 35385 2221 784 --1958
NM_024408chr192410 1450 1437 781 725 281 155 89 56 3839 369 127 1841 1734
NM_024565chr571687 1398 1334 1033 407 297 107 11179 125 365 53 50
NM_024665chr364717 3967 3426 1593 975 279 54522 3980 3973 3496 898 33982 3868 599 --
NM_024761chr9124925 4861 4830 4780 3931 3386 2117 1908 826 706 229 25 25109 3794 23484 275 --
NM_024770chr2106572 5550 5382 5237 5100 4403 2629 2104 1267 1094 36107 5528 98 26109 1152 --
NM_024798chr15102897 2860 2792 2635 2291 2041 1805 767 444 353 42649 880 243 226 41980 1888 882 245 11886
NM_024817chr15135035 4919 4494 4269 4194 4053 3816 2112 1461 1386 823 727 414 55982 4243 4114 2365 1507 35475 4224 2065 13635
NM_024949chr484550 4283 3966 1998 1444 1109 665 126 21001 953 24286 955 23343 724
NM_024989chr2117848 6273 6084 3083 1804 1765 1754 1216 723 305 57 35201 1193 590 27052 1195 1104
NM_025160chr1133474 3450 2724 1688 1542 1113 1026 926 902 837 688 429 249 43655 3480 3166 1632 23657 1634 11715
NM_025179chr1104504 4430 3826 3509 3020 1564 1400 1190 938 72 43603 3126 1740 601 2249 30 33129 609 606
NM_030623chr231256 463 165 11119 --3684 681 678
NM_030647chr7126011 5602 4719 4629 4485 4215 3934 3882 3820 2293 412 123 34326 4028 1668 2210 207 21574 205
NM_030648chr463665 2017 1562 1524 1397 814 51837 1246 846 841 777 35266 4663 1816 24667 1541
NM_030674chr12135844 5496 4857 4335 4224 4140 3955 3551 1818 1416 1213 917 419 24914 1430 --25394 1260
NM_030762chr1281506 1333 746 611 372 81 62 43 --2365 114 1735
NM_030806chr1159030 8376 8089 7788 6851 6756 6199 6031 3068 2654 1676 1236 962 932 557 69085 7515 6925 3675 1310 114 43287 2668 2664 549 --
NM_030918chr195335 5136 4333 3941 1548 1532 1507 1410 638 53597 3423 909 728 572 24202 3953 14951
NM_030964chr5123701 3281 3041 2945 2653 2535 2528 1297 1287 1264 1008 437 41094 1076 472 64 2843 192 --
NM_031427chr14125836 4323 4038 2392 2116 1713 1520 1374 1368 1261 973 474 75111 5096 4773 4517 4451 1889 1828 35280 5182 4674 --
NM_031453chr1092178 1976 1751 1709 980 697 607 543 87 32119 892 293 --1296
NM_031468chr7287678 7180 6962 6951 6818 6721 6583 6493 6456 6139 6123 5555 5301 5101 3224 3187 3166 2689 2606 2566 2439 2433 2377 2359 1898 1289 775 453 57634 7310 7151 6984 2611 37636 5457 480 15455
NM_031845chr283039 3017 2775 2233 507 456 449 434 2386 204 23008 627 --
NM_031847chr283039 3017 2775 2233 507 456 449 434 2386 204 23008 627 --
NM_032105chr1157595 7438 7411 6374 6360 6085 5391 2697 2588 2370 1226 1180 390 242 157 57037 5955 5144 2759 1301 37928 7634 5892 15734
NM_032116chr13105011 4346 4130 1481 1263 709 604 466 142 52 1444 1785 --
NM_032153chr362316 2021 1725 867 490 475 2505 374 --22039 2025
NM_032199chr1063744 3536 2355 509 373 355 31340 385 297 12547 21242 1217
NM_032440chr1072789 2515 2137 2091 1090 991 495 2521 372 --1375
NM_032784chr67994 826 687 640 623 356 188 1863 --1307
NM_032873chr11113448 3097 1186 948 730 501 465 270 234 184 21 33734 1553 359 33736 364 361 11556
NM_033224chr7127517 6456 6353 5282 5264 3227 2775 2255 2247 2218 1948 609 47698 2949 511 227 ----
NM_033331chr9112240 1380 1354 1213 831 759 695 353 199 136 121 131 --12562
NM_033360chr1274088 3572 3456 2858 1719 1104 94 21633 86 11635 --
NM_033389chr17114337 4170 4115 3445 1848 1521 1254 704 555 359 33 24245 719 31755 1257 528 1725
NM_033425chr1183294 3062 2981 2539 2215 2163 791 92 43184 2763 2716 906 11140 --
NM_033449chr531763 513 388 ----6844 841 838 827 652 649
NM_033503chr1583445 3236 3083 2643 2444 367 297 54 23196 1441 22788 1076 53758 3755 2448 1552 231
NM_033505chr2116436 5745 5202 4356 2590 2488 1287 1035 995 816 25 15823 14973 15915
NM_052840chr1521066 39 254 47 195 1502
NM_052851chr1392023 1678 1620 1582 1482 711 307 138 103 32240 601 94 139 137
NM_052885chr1284372 4124 4091 3835 3411 3298 746 736 24468 1020 21721 1022 2150 50
NM_052896chr172246 1930 1758 768 403 365 72 4851 846 435 227 2445 229 1248
NM_053016chr9137612 6441 5960 5846 4959 3180 3086 2132 1881 1288 924 728 623 26981 1867 --16374
NM_080669chr17104244 3770 3756 3451 3200 1697 1614 1138 587 495 44651 4067 3264 33 64069 3043 1702 1171 1028 479 23775 519
NM_080867chr1474999 4850 4681 4478 3181 1885 1074 33464 3168 3155 --13171
NM_080872chr8113202 3155 2473 1187 1142 724 516 203 178 138 66 13295 23756 2477 --
NM_130391chr983548 3137 1315 1269 1091 240 212 85 22312 340 --22584 285
NM_130392chr983548 3137 1315 1269 1091 240 212 85 22312 340 --22584 285
NM_130393chr983548 3137 1315 1269 1091 240 212 85 22312 340 --22584 285
NM_133170chr20256993 6968 6532 6518 6397 6298 6169 6099 5702 5549 5333 5287 4967 3043 2960 2837 2663 2634 2557 2267 1898 1838 1435 950 853 67843 6912 5445 3199 1066 121 35447 2143 2030 1124
NM_133264chr17103929 3008 1387 1258 1026 520 490 478 347 263 32981 1520 899 33557 1210 1054 --
NM_133265chrX83310 2945 2737 2634 1300 1250 462 351 23540 2415 22417 976 12544
NM_133468chr792388 2070 2038 1762 806 652 351 70 59 11662 22064 442 12310
NM_138444chr13104239 3618 3155 1782 1341 1028 1017 815 642 236 24700 4288 11044 11642
NM_138473chr1264182 3809 1524 1487 1265 87 44274 4094 4023 125 11674 33876 1096 483
NM_138576chr1464308 3734 3361 3292 3112 1805 24121 1005 1482 24312 3365
NM_138971chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_138971chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_138972chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_138972chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_138973chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_138973chr11123863 3740 3250 3144 2928 2821 2810 2765 2608 1356 1177 834 53656 2956 591 415 207 2595 148 22886 599
NM_139279chr273167 3112 2163 968 839 303 296 33293 172 149 33295 2272 405 22270 403
NM_144571chr4116605 5900 4755 4675 4381 2800 2698 2458 1270 1176 664 34768 2812 923 25855 2814 --
NM_144578chr1455419 4800 2106 1657 782 35017 2052 136 2958 792 12055
NM_144599chr1564792 1918 1625 1332 495 31 1593 23691 81 25307 5304
NM_144628chr20112962 2913 2773 2101 2047 2029 1115 834 630 475 58 12196 42747 449 430 275 12139
NM_144973chr12155048 5036 4876 4235 3530 3257 1809 1592 1278 1214 1164 1129 994 982 336 34784 1599 354 34748 3708 356 21508 1071
NM_145037chr361368 1297 1232 615 148 25 21407 1095 11066 11257
NM_145165chr14112926 2416 2156 2030 1820 913 885 713 605 465 138 32257 1014 1003 12259 --
NM_145259chr2136747 6638 5896 5777 5037 4708 2502 2026 1938 1818 1710 1502 1236 67142 5937 1634 1124 1087 257 11092 26308 1090
NM_145686chr2103125 2354 2323 2134 1018 922 551 433 418 410 22302 533 22385 2304 1536
NM_145687chr2103125 2354 2323 2134 1018 922 551 433 418 410 22302 533 22385 2304 1536
NM_147223chr292412 2294 2083 898 891 834 516 337 155 41772 809 588 540 31774 1616 590 21747 543
NM_147233chr282229 2111 1900 715 708 651 333 154 41589 626 405 357 31591 1433 407 21564 360
NM_148955chr15136461 5326 4896 4873 4779 4498 4430 4041 2240 2048 997 687 471 56139 4837 4160 1988 651 24972 622 25515 1991
NM_152253chr22124206 3965 3552 3323 2912 1539 1164 980 938 883 861 754 11277 54003 2806 2780 948 470 11298
NM_152261chr12112079 1927 1903 1750 1640 965 904 889 515 468 376 1154 ----
NM_152263chr1185967 5057 5044 5033 4822 4803 4502 4432 4309 4198 4006 3981 1567 1547 1150 537 274 245 54552 4437 4360 4326 3842 22081 248 14511
NM_152280chr1143198 3063 2925 2866 2510 2187 1299 1110 936 785 755 636 108 75 21201 942 ----
NM_152388chr264056 3842 2981 2782 695 22 33966 3944 729 --21085 982
NM_152424chrX124748 4501 4133 4077 4016 3981 3946 3238 3106 3039 1484 1034 34319 1685 1500 34494 4491 1687 --
NM_152455chr15102683 2628 2137 2099 2031 1952 1940 1922 1122 28 52486 2384 1984 386 194 1388 11126
NM_152542chr472178 2084 2027 1673 1381 786 238 1792 --11922
NM_152594chr1552166 2101 1469 434 224 11772 21809 127 11807
NM_152624chr5156881 6689 6164 5405 5023 2742 2413 2396 1779 1553 1436 1243 1162 998 713 46519 4560 2477 1503 ----
NM_152734chr6175452 4840 4692 4536 4294 4186 4107 3990 3556 3477 2193 1719 1291 971 559 481 205 23971 924 15216 13428
NM_152793chr794971 4902 4310 3956 3716 3670 554 303 22 23889 404 44812 4219 4055 1865 24807 26
NM_152826chr15136461 5326 4896 4873 4779 4498 4430 4041 2240 2048 997 687 471 56139 4837 4160 1988 651 24972 622 25515 1991
NM_153050chr22115023 4595 3337 3259 3206 1995 1898 1784 1544 1206 408 23666 1949 --11322
NM_153051chr22115023 4595 3337 3259 3206 1995 1898 1784 1544 1206 408 23666 1949 --11322
NM_153188chr594816 4319 4220 4126 3536 1795 723 528 446 25229 386 1272 --
NM_153235chr672329 2066 1562 1545 1526 690 105 21538 1510 21555 1548 --
NM_153442chr10296437 6408 6364 6330 6100 6041 6021 5699 5639 5531 5259 4995 4674 4646 4505 4372 4034 2343 2240 2061 1701 1564 1515 1506 1483 878 391 244 23 86442 6424 6413 6388 6369 2522 1290 49 66447 6444 5052 4049 826 51 15764
NM_153450chr112815 320 4309 297 274 255 --5312 300 277 258 43
NM_153645chr2273135 2930 2812 2670 2644 969 404 12709 23313 654 1132
NM_153810chr10124849 4687 4422 4163 3775 3317 2041 1891 1536 963 344 259 43448 3172 1741 38 21093 658 1127
NM_170774chr20203657 3150 3143 3127 3081 2967 2789 2622 1646 1569 1536 1326 1284 949 860 743 552 420 235 64 32930 2841 796 1485 --
NM_173065chr142399 914 451 364 --23332 94 42701 588 585 117
NM_173468chr465714 5687 2000 1068 878 554 56059 5751 4193 2198 1560 --15621
NM_173595chr1294906 3951 3854 3757 1927 1241 892 458 124 191 53760 3462 3382 1322 1177 23380 1175
NM_173632chr19103039 2731 2150 1236 883 400 363 277 232 85 ----32722 2719 1318
NM_173642chr1179059 8543 8087 8031 7857 7736 6579 3567 3491 2874 2468 2336 2258 2193 1619 1398 1199 27142 3459 48101 6422 6351 3570 17721
NM_173808chr1113758 3488 3242 3143 2879 2871 2861 2848 2767 1480 1459 43763 2935 2910 2772 32901 2893 744 --
NM_173851chr853587 3275 2764 817 553 61338 1303 915 428 162 97 23147 164 11312
NM_173872chr45929 706 597 145 137 1131 ----
NM_175623chr12227579 7220 7146 6222 5958 5643 5324 5236 2915 2613 2533 2143 1818 1642 1338 854 839 497 395 202 133 89 11977 --15549
NM_175624chr12227674 7315 7241 6317 6053 5738 5419 5331 3010 2708 2628 2238 1913 1737 1433 949 934 592 490 297 228 184 22072 88 --15644
NM_175625chr12227674 7315 7241 6317 6053 5738 5419 5331 3010 2708 2628 2238 1913 1737 1433 949 934 592 490 297 228 184 22072 88 --15644
NM_175736chr12147482 7382 7361 7030 6304 6221 5700 3060 2940 2342 2164 726 646 600 55754 2431 1546 1025 519 85756 2907 2501 2441 2288 2237 1548 1223 47304 2905 2499 1221
NM_176801chr421368 118 2338 296 4301 212 128 121 3341 329 299
NM_177538chr2167223 6699 6467 5556 3373 3314 3160 2878 2790 2315 2255 2141 2039 1811 989 41 27611 2326 ----
NM_178006chr1392023 1678 1620 1582 1482 711 307 138 103 32240 601 94 139 137
NM_178007chr1392023 1678 1620 1582 1482 711 307 138 103 32240 601 94 139 137
NM_178011chr1052394 2360 1239 765 632 22235 159 --21188 65
NM_178037chr12133584 3189 2751 2266 1338 1159 880 865 644 616 429 356 199 22780 1068 33239 2782 496 13201
NM_178038chr12133584 3189 2751 2266 1338 1159 880 865 644 616 429 356 199 22780 1068 33239 2782 496 13201
NM_178151chrX157717 7537 6762 6555 6415 5990 2997 2805 1923 1132 1079 1046 675 569 479 --12222 12255
NM_178152chrX157717 7537 6762 6555 6415 5990 2997 2805 1923 1132 1079 1046 675 569 479 --12222 12255
NM_178153chrX157717 7537 6762 6555 6415 5990 2997 2805 1923 1132 1079 1046 675 569 479 --12222 12255
NM_181332chrX102489 2253 1715 824 576 507 457 234 74 64 --158 --
NM_181458chr261406 1237 1230 574 515 65 1142 --3221 218 215
NM_181460chr251219 1050 1043 387 328 1508 1510 334 31 28
NM_181481chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_181482chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_181483chr18206493 5799 5770 5544 5228 4638 4321 4298 2829 2656 2530 2250 2076 1502 1298 546 426 394 43 30 35723 2070 338 21701 528 --
NM_181521chr16147280 7154 6784 6247 5201 2910 2671 2532 2064 1895 1398 578 357 341 26017 1378 15425 --
NM_181876chr492376 2262 2166 1949 1829 232 144 89 81 32231 2074 1004 11006 --
NM_182503chr6125116 4719 4483 4302 3634 2164 2058 1903 1852 1825 1396 990 35572 3627 1743 --13578
NM_182515chr19135480 4734 4189 1254 1199 1104 982 968 576 513 262 181 32 24872 1513 15521 --
NM_182762chr7106119 5543 4169 3783 2384 2168 1830 801 584 473 46019 4627 1749 1596 46021 4175 1751 1702 --
NM_182763chr1122707 2553 2440 2092 1972 1923 1850 724 387 197 180 159 1126 11756 --
NM_182898chr796070 4572 4361 2390 2169 1994 1949 1296 1210 46539 4923 2487 31 16252 26372 4926
NM_182899chr796070 4572 4361 2390 2169 1994 1949 1296 1210 46539 4923 2487 31 16252 26372 4926
NM_183238chr12153485 3169 2503 1456 1305 1217 1188 963 899 806 561 484 422 273 161 31511 1434 325 --21517 1514
NM_183398chr541278 894 365 127 31349 1210 320 3531 325 163 1323
NM_183399chr541278 894 365 127 31349 1210 320 3531 325 163 1323
NM_183400chr541278 894 365 127 31349 1210 320 3531 325 163 1323
NM_183401chr541278 894 365 127 31349 1210 320 3531 325 163 1323
NM_194282chr45902 862 715 160 75 ----2144 141
NM_194283chr5113957 3794 3443 3266 3101 2995 2762 1251 954 860 297 44182 4150 2867 775 33493 3478 3311 33491 3309 2600
NM_194286chr12106077 5715 5407 5037 4908 4811 4158 1361 817 296 3806 473 264 42371 736 572 144 2142 137
NM_194314chr1105605 5598 4997 4838 4436 4340 4202 3551 1216 405 12088 --15131
NM_194434chr1895457 5298 4977 4234 3774 3646 1458 762 429 35248 5160 948 25250 5162 --
NM_198320chr12134587 4488 4041 3774 3541 3246 1890 1475 789 593 295 280 103 1320 21548 783 1127
NM_198484chr3146091 5574 5335 5246 4699 4641 4542 4185 2462 2445 2267 1793 649 237 46160 2321 1512 601 35725 4649 4096 24873 4846
NM_198581chr252954 1734 1545 1371 1300 36001 5982 4559 --22887 1571
NM_198859chr3135039 4538 4277 4048 3723 1978 1789 1783 1343 1273 1097 705 109 54053 3998 3222 1230 1202 44000 3821 3224 1149 129
NM_198900chr12147482 7382 7361 7030 6304 6221 5700 3060 2940 2342 2164 726 646 600 55754 2431 1546 1025 519 85756 2907 2501 2441 2288 2237 1548 1223 47304 2905 2499 1221
NM_199000chr762160 1680 1528 721 460 87 21432 299 1487 1302
NM_199169chr2093565 3343 3014 2940 2855 1276 1208 993 692 --2466 82 3863 506 71
NM_199170chr2093565 3343 3014 2940 2855 1276 1208 993 692 --2466 82 3863 506 71
NM_199171chr2093565 3343 3014 2940 2855 1276 1208 993 692 --2466 82 3863 506 71
NM_199320chr482768 2095 895 573 287 209 200 172 --31952 602 77 --
NM_199320chr482768 2095 895 573 287 209 200 172 --31952 602 77 --
NM_199421chr1474999 4850 4681 4478 3181 1885 1074 33464 3168 3155 --13171
NM_199454chr1124530 4320 3862 1731 1532 1502 1264 870 716 648 79 54 11760 44696 4323 3122 757 14570
NM_199462chr1224923 4487 4423 4306 4093 4040 3812 3704 3693 3418 3118 1924 1608 1457 1297 881 689 657 290 258 169 68 1671 33843 1736 1635 13235
NM_203446chr2131119 357 150 2699 389 12023 3554 551 548
NM_203463chr2164653 4333 4318 4241 4005 3965 3214 3193 1967 1430 1290 1277 1098 939 602 293 34384 1395 588 34386 1741 781 2339 171
NM_205860chr152475 2317 890 359 308 32084 1187 77 --168
NM_206855chr6125838 5244 4912 4118 4066 3902 2427 1986 1748 1712 1211 981 14635 ----
NM_206909chr8218369 7690 7617 7486 7030 6710 6702 6399 5948 5305 5207 3366 2658 2561 1749 1382 1143 1047 720 599 21 47146 6273 5483 687 35957 2535 689 11374
NM_207012chr1093290 3187 2589 2519 1369 960 796 441 166 22885 227 --22891 2888
NM_207406chr4116357 6173 5833 5344 4694 2248 1893 1840 1681 629 405 25322 1802 1371 15325
NM_207578chr14531 108 71 62 189 --1152
NM_213589chr294762 4601 4502 3875 3514 3488 3469 2162 1676 1893 1295 15185